Preparation of libraries of protein variants expressed in eukaryotic cells

JP2024531431A5Pending Publication Date: 2025-08-26IONTAS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024510636
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-25
Filing Date
2022-08-24
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

Existing methods for generating libraries of eukaryotic cell clones with diverse binders lack a comprehensive list of recognition sequences and loci for efficient integration, leading to limitations in diversity and uniformity.

Method used

A method involving the use of a landing pad array, random integration by transposon-mediated integration, and site-specific nucleases like meganucleases, zinc finger nucleases, or CRISPR/Cas9 to identify and integrate donor DNA at specific loci in eukaryotic genomes, such as the NLN, TNIK, PARP11, RAB40B, ABI2, RNF19B, PKIA, or FTCD genes, enhancing integration efficiency and diversity.

Benefits of technology

This approach allows for the creation of libraries with increased integration efficiency and stable expression of binders, enabling the generation of large libraries with diverse and uniformly integrated binders, suitable for screening and identification of binders targeting specific interests.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000083_0000
    Figure 00000083_0000
  • Figure 00000083_0001
    Figure 00000083_0001
  • Figure 00000083_0002
    Figure 00000083_0002
Patent Text Reader

Abstract

Described herein are methods for identifying loci in the genome of a eukaryotic cell, which loci are candidates for the insertion of binder sequences. Also described herein are methods for generating a library of eukaryotic cell clones that contain DNA encoding a diverse repertoire of binders.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the generation of libraries of eukaryotic cell clones, and in particular to libraries of eukaryotic cell clones containing DNA encoding a diverse repertoire of binders. Additionally, the present invention relates to methods for identifying loci in the genome of eukaryotic cells. [Background technology]

[0002] WO 2015 / 166272 describes a method for generating a library of eukaryotic cell clones containing DNA encoding a diverse repertoire of binders, in which site-specific nucleases are used to cleave recognition sequences in cellular DNA to create integration sites into which donor DNA encoding the binders can be integrated.

[0003] However, the method of WO 2015 / 166272 relies on the selection of appropriate recognition sequences at specific loci in the genome of eukaryotic cells to enable the generation of libraries characterized by a high diversity of binders and / or uniform integration of binders and / or uniform transcription of binders, and WO 2015 / 166272 does not provide an extensive list of such recognition sequences or loci.

[0004] Thus, there is a continuing need in the art for methods to identify loci in the genome of eukaryotic cells that are candidates for insertion of binder sequences and for specific loci in the genome of eukaryotic cells that contain appropriate recognition sequences that can be used in methods to generate libraries. Summary of the Invention [Means for solving the problem]

[0005] In one aspect, there is provided a method for identifying a locus in the genome of a eukaryotic cell, said locus being a candidate for insertion of a binder sequence, said method comprising: a. providing a landing pad array; b. introducing the landing pad sequence into a eukaryotic cell; c. randomly integrating the landing pad sequence into the genome of a eukaryotic cell by transposon-mediated integration; d. Selecting clones that have the landing pad sequence integrated into their genome Includes.

[0006] The method according to this aspect may be referred to in the context of this application as a "method of identifying a genetic locus according to the invention" or a "method of identifying a genetic locus", etc.

[0007] In some embodiments, the method of identifying a genetic locus according to the present invention comprises the further step of: e. screening for single copy integration; f. Identifying the locus.

[0008] In some embodiments, the method of identifying a genetic locus according to the present invention comprises the additional step of: g. incorporating a donor DNA sequence containing one or more transgenes encoding binders into the landing pad sequence; h. Screening for integration of donor DNA.

[0009] In some embodiments, the method of identifying a genetic locus according to the present invention is such that the landing pad sequence comprises a recognition sequence for a site-specific nuclease. Preferably, the nuclease recognition sequence is a meganuclease recognition sequence, a zinc finger nuclease recognition sequence, a TALE nuclease recognition sequence or a nucleic acid-guided nuclease recognition sequence, more preferably a meganuclease recognition sequence, most preferably an I-SceI meganuclease recognition sequence.

[0010] In some embodiments, in methods of identifying loci provided herein, step g of integrating donor DNA into a cell comprises providing a site-specific nuclease into the cell, wherein the nuclease cleaves a recognition sequence contained in the landing pad. In some embodiments, in methods of identifying loci provided herein, step h of screening for integration of donor DNA comprises screening for display of one or more binders encoded by the donor DNA.

[0011] In some embodiments, the donor DNA further comprises homology arms to increase integration efficiency. In some embodiments, the landing pad sequence and / or the donor DNA sequence comprises a selectable marker.

[0012] In one aspect, there is provided a use of a locus identified in a method for identifying a locus according to the invention for constructing a library of eukaryotic cell clones comprising DNA encoding a diverse repertoire of binders. The use according to this aspect may, in the context of this application, be referred to as "use of a locus according to the invention" or the like.

[0013] In one aspect, a method is provided for generating a library of eukaryotic clones comprising DNA encoding a diverse repertoire of binders, the method comprising: - providing a donor DNA molecule encoding the binder and a eukaryotic cell; - introducing donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in the cellular DNA, the recognition sequence being within the NLN gene, the TNIK gene, the PARP11 gene, the RAB40B gene, the ABI2 gene, the RNF19B gene, the PKIA gene, or the FTCD gene, to create an integration site at which the donor DNA will integrate into the cellular DNA, wherein integration occurs through the cell's endogenous DNA repair mechanisms, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA; and - culturing and cloning the recombinant cells, thereby providing a library of eukaryotic cell clones containing donor DNA encoding a repertoire of binders. Includes.

[0014] A method according to this aspect may be referred to in the context of this application as a "method of generating a library according to the invention," or a "method of generating a library," or a "method of making a library," etc. A "method according to the invention" refers to both a method of identifying loci according to the invention and a method of generating a library according to the invention.

[0015] In some embodiments, in the method of generating a library according to the invention, the recognition sequence is in the NLN gene, the TNIK gene, or the RAB40B gene. Preferably, the recognition sequence is in the NLN gene.

[0016] In some embodiments, in the methods of generating a library according to the present invention, the recognition sequence is within an intron of a gene. In some embodiments, the recognition sequence is within an open chromatin region of an intron. In some embodiments, the recognition sequence is within an enhancer region of an intron.

[0017] For multimeric binders comprising at least a first and a second subunit (i.e., separate polypeptide chains such as antibody VH and VL domains presented in Fab or IgG format), the subunits may be encoded on the same molecule of donor DNA. However, it may be desirable to integrate different subunits at separate loci, in which case the subunits may be provided on separate donor DNA molecules. They may be incorporated within the same cycle of nuclease-mediated incorporation, or may be incorporated sequentially using nuclease-mediated incorporation at one or both incorporation steps.

[0018] A method for generating a library of eukaryotic clones encoding multimeric binders comprises: providing a eukaryotic cell containing DNA encoding a first subunit, and providing a donor DNA molecule encoding a second binder subunit; introducing donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in the cellular DNA, the recognition sequence being within the NLN gene, TNIK gene, PARP11 gene, RAB40B gene, ABI2 gene, RNF19B gene, PKIA gene, or FTCD gene, to create an integration site at which the donor DNA will integrate into the cellular DNA, wherein integration occurs through DNA repair mechanisms endogenous to the cell, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA. These recombinant cells may contain DNA encoding the first and second subunits of the multimeric binder, and the recombinant cells may be cultured to express both subunits. The multimeric binder is obtained by expression and assembly of the separately encoded subunits.

[0019] In the above example, nuclease-mediated integration is used to integrate DNA encoding the second subunit into cells already containing DNA encoding the first subunit. The first subunit can be previously introduced using the technology of the present invention or any other suitable DNA integration method. In an alternative approach, nuclease-mediated integration is used in the first cycle of introducing donor DNA to integrate the first subunit, followed by introduction of the second subunit by either the same approach or any other suitable method. When the nuclease-mediated approach is used for multiple integration cycles, different site-specific nucleases can optionally be used to facilitate nuclease-mediated donor DNA integration at different recognition sites. A method for generating a library of eukaryotic cell clones encoding multimeric binders comprises: providing a first donor DNA molecule encoding a first subunit and providing a eukaryotic cell; introducing a first donor DNA into the cells and providing a site-specific nuclease within the cells, wherein the nuclease cleaves a recognition sequence in the cellular DNA, the recognition sequence being within the NLN gene, the TNIK gene, the PARP11 gene, the RAB40B gene, the ABI2 gene, the RNF19B gene, the PKIA gene, or the FTCD gene, to create an integration site at which the donor DNA will integrate into the cellular DNA, wherein integration occurs through DNA repair mechanisms endogenous to the cell, thereby creating a first set of recombinant cells comprising the first donor DNA integrated into the cellular DNA; culturing the first set of recombinant cells to produce a first set of clones comprising DNA encoding the first subunit; introducing a second donor DNA molecule encoding a second subunit into cells of the first set of clones, wherein the second donor DNA is integrated into the cellular DNA of the first set of clones, thereby creating a second set of recombinant cells comprising the first and second donor DNA integrated into the cellular DNA; and Culturing the second set of recombinant cells to produce a second set of clones, the clones comprising DNA encoding the first and second subunits of the multimeric binder, thereby providing a library of eukaryotic cell clones comprising donor DNA encoding a repertoire of multimeric binders. may include:

[0020] As used herein, "method of generating a library according to the invention" and "method according to the invention" also refer to the above-described method of generating a library of eukaryotic clones encoding multimeric binders.

[0021] Site-specific integration of donor DNA into cellular DNA creates recombinant cells, which can be cultured to produce clones. Individual recombinant cells into which donor DNA has been integrated are then replicated to generate a clonal population of cells ("clones"), each clone derived from a single original recombinant cell. This method therefore generates a number of clones corresponding to the number of cells into which donor DNA has been successfully integrated. The collection of clones constitutes a library encoding a repertoire of binders (or clones may encode sets of binder subunits at intermediate stages where binder subunits are integrated at separate times). Thus, the method of the invention can provide a library of eukaryotic cell clones containing donor DNA encoding a repertoire of binders.

[0022] Thus, in one aspect, there is provided a library of eukaryotic clones comprising DNA encoding a diverse repertoire of binders, which library is obtainable by use of loci according to the invention and / or by a method for generating a library according to the invention. Such libraries according to this aspect may be referred to in the context of this application as "libraries of the invention" or the like.

[0023] The methods of the present invention can generate a library of clones containing donor DNA integrated at a fixed locus or multiple fixed loci in cellular DNA. "Fixed" means that the locus is the same between cells. Thus, the cells used to generate the library can contain nuclease recognition sequences at fixed loci that represent universal landing sites within the cellular DNA into which the donor DNA can be integrated. The recognition sequences for the site-specific nucleases can be present at one or multiple locations in the cellular DNA. Thus, in one embodiment, at least 10 3 pieces, 10 4 pieces, 10 5 pieces, 10 6 pieces, 10 7 pieces, 10 8 Pieces or 10 9In vitro libraries of eukaryotic cell clones are provided that express a diverse repertoire of different binders, each cell comprising recombinant DNA, wherein donor DNA encoding a binder or a subunit of a binder is integrated into an anchored locus in the cellular DNA, the locus being identified by a method according to the invention. In vitro libraries of eukaryotic cell clones are also provided according to the invention, wherein donor DNA encoding a binder or a subunit of a binder is integrated into at least a first and / or second anchored locus in the cellular DNA, the one or more anchored loci being identified by a method according to the invention. As used herein, "libraries of the invention" and the like also refer to such in vitro libraries of eukaryotic cell clones.

[0024] Libraries generated in accordance with the present invention can be utilized in a variety of ways. The libraries can be cultured to express the binders, thereby generating a diverse repertoire of binders. The libraries can be screened for cells of a desired phenotype, the phenotype resulting from the expression of the binder by the cells. Thus, in one aspect, a method is provided for screening for cells of a desired phenotype, the phenotype resulting from the expression of the binder by the cells, the method comprising: Providing a library by the method for making a library of the invention, or by using a locus according to the invention, or by providing a library according to the invention; Culturing the library cells to express the binders; and Detecting whether the desired phenotype is exhibited Includes.

[0025] The method according to this aspect may be referred to as a "method of screening for cells of a desired phenotype according to the present invention" or the like. As used herein, "method of the present invention" also refers to the above-described method of screening for cells of a desired phenotype.

[0026] The library cells can be cultured to express the binders, followed by phenotypic screening to detect whether the desired phenotype is exhibited by the clones in the library. Cell readout can be based on changes in cellular behavior, such as changes in expression of endogenous or exogenous reporter genes, differentiation state, proliferation, survival, cell size, metabolism, or interactions with other cells. Once the desired phenotype is detected, clones of cells exhibiting the desired phenotype can be recovered. Optionally, DNA encoding the binders is then isolated from the recovered clones, providing DNA encoding binders that, when expressed in cells, result in the desired phenotype.

[0027] A primary purpose for which eukaryotic cell libraries have been used is in methods of screening for binders that recognize a target of interest. Accordingly, in one aspect, there is provided a screening method for identifying binders to a target of interest, said method comprising: Providing a library by the method for making a library of the invention, or by using a locus according to the invention, or by providing a library according to the invention; culturing cells of the library to express the binders; exposing the binder to the target to allow recognition of the target by one or more cognate binders, if present; Detecting whether the target is recognized by a cognate binder Includes.

[0028] The method according to this aspect may be referred to as a "screening method for identifying binders to a target of interest according to the present invention" or a "screening method for identifying binders", etc. As used herein, "method according to the present invention" also refers to the above-described screening method for identifying binders to a target of interest.

[0029] In such methods, the library is cultured to express the binders, which are then exposed to the target to allow recognition of the target by one or more cognate binders, if present, and to detect whether the target is recognized by the cognate binder. In such methods, binders can be displayed on the cell surface, and clones of the library that display binders with desired properties can be isolated. Cells within the library containing genes encoding binders with desired functional or binding properties can thus be identified. The genes can be recovered and used to generate binders or further engineered to create derivative libraries of binders with improved properties.

[0030] In one aspect, the invention also encompasses binders identified from the libraries of the invention, e.g., binders identified using the screening methods for identifying binders to a target of interest according to the invention. Preferred binders are described elsewhere herein.

[0031] Various features of the present invention are further described below, and it should be noted that the headings used throughout this specification are for navigational purposes only and should not be construed as being definitive, and that features described in different sections may be relevant to all aspects of the present invention and may be combined as appropriate.

[0032] As shown in the experimental part, aspects of the present invention such as the new locus of the present invention are associated with advantages such as improved integration efficiency and stable antibody expression.

[0033] eukaryotic cell Preferred eukaryotic cells and eukaryotic cell clones for aspects of the invention, including the methods, uses and libraries of the invention, are defined below, it being understood that all preferences relating to eukaryotic cells may also apply to eukaryotic cell clones.

[0034] The eukaryotic cells are preferably higher eukaryotic cells, and are 12×10 6 Higher eukaryotic cells are defined as cells with genomes larger than Saccharomyces cerevisiae, which has a genome size of 2×10 base pairs (bp). 7 The eukaryotic cell may have a genome size of more than 100 base pairs. This includes, for example, mammalian cells, avian cells, insect cells, or plant cells. The eukaryotic cell is not limited to a mammalian cell. Preferably, the eukaryotic cell is a mammalian cell, such as a mouse or human cell. More preferably, the eukaryotic cell is a human cell. The eukaryotic cell may be a primary cell or a cell line. Chinese hamster ovary (CHO) cells are commonly used for antibody and protein expression, although any alternative stable cell line, such as HEK293 cells, can also be used in the present invention. Efficient methods for introducing foreign DNA into primary cells that enable their use are available (e.g., by electroporation, which achieves up to 95% efficiency and viability; http: / / www.maxcyte.com / technology / primary-cells-stem-cells.php).

[0035] A particular advantage of nuclease-mediated integration in methods for identifying gene loci or generating libraries relates to the integration of binder genes into higher eukaryotic cells with larger genomes, where homologous recombination is less effective in the absence of nuclease cleavage. Yeast (e.g., Saccharomyces cerevisiae) have smaller genomes than mammalian cells, and homologous recombination induced by homology arms (in the absence of nuclease cleavage) is an effective method for introducing foreign DNA compared to higher eukaryotic cells. Nuclease-mediated integration has been used in yeast cells to solve the problem of efficiently integrating multiple genes into individual yeast cells, for example, for metabolic pathway engineering (U.S. Patent Application Publication No. 2012 / 0277120), but this work did not incorporate the introduction of a library of binders, nor did it address the problem of constructing libraries in higher eukaryotic cells.

[0036] Preferred eukaryotic cells are T lymphoid cells (e.g., primary T cells or T cell lines) or B lymphoid cells. Particularly preferred are primary T cells or T cell-derived cell lines for use in TCR libraries, including cell lines lacking TCR expression [23, 24, 25]. Preferred B lymphoid cells are B cells, pre-B cells, or pro-B cells, and cell lines derived from any of these.

[0037] Construction of libraries in primary B cells or B cell lines will be particularly useful for constructing antibody libraries. These eukaryotic cells are preferred for methods of identifying loci and generating libraries. Breous-Nystrom et al.

[15] generated libraries in a mouse pre-B cell line (1624-5). The chicken B cell-derived cell line DT40 (ATCC CRL-2111) is particularly promising for constructing binder libraries. DT40 is a small cell line with a relatively fast cell division rate. Binder repertoires can be targeted to specific loci using ZFNs, TALE nucleases, or CRISPR / Cas9 to target endogenous sequences, or by targeting pre-integrated heterologous sites that may contain meganuclease recognition sites. Because DT40 cells express antibodies, it is advantageous to target antibody genes within the antibody locus, with or without disruption of endogenous chicken antibody variable domains. DT40 cells have also been used as the basis for an in vitro system for the generation of chicken IgM, called the Autonomous Diversification Library System (ADLib system), which takes advantage of the endogenous diversification occurring in the chicken antibody locus. As a result of this endogenous diversification, new specificities can be generated. The nuclease-based approach described here can be used in conjunction with ADLib to combine diverse libraries of binders from heterologous sources (e.g., human antibody variable region repertoires or synthetically derived alternative scaffolds) with the chicken IgG locus, potentially allowing for further diversification. Similar advantages can also be applied to human B cell lines such as Nalm6

[26] .

[0038] Other preferred B-lineage cell lines that are preferred in the methods of identifying loci and generating libraries include lines such as the murine pre-B cell line 1624-5 and the pro-B cell line Ba / F3. Ba / F3 is dependent on IL-3

[27] , the use of which is discussed elsewhere herein. Finally, several human cell lines are preferred, including those listed in the "Cancer Cell Line Encyclopaedia"

[28] or the "COSMIC catalogue of somatic mutations in cancer"

[29] .

[0039] In the methods and libraries for generating libraries according to the present invention, the eukaryotic cells are preferably cells of a single type generated by the introduction of donor DNA into a population of clonal eukaryotic cells, e.g., by the introduction of donor DNA into cells of a particular cell line. The primary significant difference between different library clones is due to the integration of donor DNA.

[0040] Eukaryotic cell virus system The advantages of aspects of the present invention, such as the method for generating a library of eukaryotic cell clones and the resulting library, can be applied to viral display systems based on eukaryotic cell expression systems, such as baculovirus display or retrovirus display [1, 2, 3, 4]. In this approach, each cell encodes a binder that can be incorporated into viral particles. In the case of retrovirus systems, the encoding mRNA is packaged, and the encoded binder is displayed on the cell surface. In the case of baculovirus systems, the binder-encoding gene would need to be packaged within the baculovirus particle to maintain the association between the gene and the encoded protein. This can be achieved using host cells with an episomal copy of the baculovirus genome. Alternatively, the integrated copy can be released after the action of specific nucleases (different from those used to promote site-specific integration). In the case of multimeric binder molecules, some partners may be encoded within the cellular DNA, and one or more partner genes may be packaged within the virus.

[0041] Nucleic acid introduction The methods described herein involve the introduction of nucleic acids into eukaryotic cells. In methods for identifying loci, a landing pad sequence (i.e., nucleic acid) is introduced, preferably a donor DNA sequence. In methods for generating libraries, a donor DNA molecule is introduced. Unless otherwise specified, introduction of a nucleic acid refers to the introduction of a DNA molecule into a eukaryotic cell.

[0042] Many methods have been described for introducing nucleic acids into eukaryotic cells, including transfection, infection, or electroporation. Transfection of large numbers of cells is possible by standard methods, including polyethylenimine-mediated transfection, as described herein. In addition, transfection of 10 cells in 5 minutes is possible. 10 Highly efficient methods for electroporating individual cells are also available (e.g., http: / / www.maxcyte.com).

[0043] In methods for generating libraries, combinatorial libraries can be created in which members of a multimeric binding pair (e.g., the VH and VL genes of an antibody gene) or even different portions of the same binder molecule are introduced into different plasmids. Introduction of separate donor DNA molecules encoding separate binders or binder subunits can be simultaneous or sequential. For example, an antibody light chain can be introduced by transfection or infection, and the cells can be grown and selected as needed. The other components can then be introduced in a subsequent infection or transfection step. One or both steps can include nuclease-mediated integration into specific genomic loci.

[0044] Nucleic acid incorporation The method for identifying a locus or generating a library involves the integration of a nucleic acid into the genome of a eukaryotic cell. In this context, the terms genome and cellular DNA can be used interchangeably. Unless otherwise specified, integration refers to the integration of a DNA molecule into the genome of a eukaryotic cell. The nucleic acid is integrated into the genome (i.e., cellular DNA) to form recombinant DNA having a contiguous DNA sequence in which the nucleic acid is inserted at the integration site. In the present invention, integration is mediated by the cell's endogenous natural DNA repair mechanism.

[0045] The integration of a nucleic acid can be random or specific. Random integration of a nucleic acid preferably refers to random integration of a nucleic acid into the genome of a eukaryotic cell by transposon-mediated integration. As used herein, an integration site is not defined by a specific sequence. The method for identifying a locus includes random integration of a landing pad sequence into a eukaryotic cell.

[0046] The terms "transposon," "transposon vector," or "transposable element" are used herein in accordance with their conventional and commonly understood meaning by those skilled in the art. A transposon is a genetic element that can integrate into cellular DNA in a non-site-specific manner, and when engineered to carry or be adjacent to a landing pad sequence, this sequence is inserted into the cellular DNA at a random location. Those skilled in the art will recognize suitable transposons, many of which are commercially available, such as the PiggyBac system, an example of which is provided in the experimental section of this specification. The PiggyBac system is further described, for example, in Wilson et al., Molecular Therapy vol. 15 no. 1, 139-145 Jan. 2007; Kim et al., Mol Cell Biochem (2011) 354: 301-309; Galvan et al., Immunother. 2009 October; 32(8): 837-844. Generally, the PiggyBac system utilizes two vectors. One vector, called the helper PBase vector, encodes a transposase. The other vector, called the transposon vector, contains two terminal repeats (TRs) surrounding the region to be replaced. The landing pad delivered to the host cell can be cloned into this region using standard molecular techniques in the art. When the PBase vector and the PiggyBac transposon vector are co-transfected into a target cell, the transposase produced by the helper recognizes the two TRs on the transposon and inserts the flanking region containing the two TRs into the host cell DNA. Integration typically occurs at a host chromosomal site containing a TTAA sequence, which is replicated on two sides of the integrated fragment. The transposon can integrate into a single locus (single-copy integration) or multiple loci (multiple-copy integration) in the host cell genome.

[0047] In specific integration of a nucleic acid, the integration site is defined by a specific sequence. In the context of specific integration, the nucleic acid may be referred to as donor DNA, a donor DNA molecule, or a donor DNA sequence.

[0048] Specific integration can occur by introducing nucleic acid into cells, allowing a site-specific nuclease to create an integration site, allowing the donor DNA to integrate. In this context, specific integration can be referred to as nuclease-mediated integration. The cells can be continued in culture for a time sufficient for the DNA to integrate. This typically results in a mixed population of cells containing (i) recombinant cells in which the donor DNA has integrated at the integration site created by the site-specific nuclease, and optionally (ii) cells in which the donor DNA has integrated at a site other than the desired integration site, and / or optionally (iii) cells in which the donor DNA has not integrated. Thus, the desired recombinant cells and resulting clones can be provided in a mixed population that further includes other eukaryotic cells. Selection methods described elsewhere herein can be used to select for desired cells and clones or to enrich the mixed population for the desired cells and clones.

[0049] As explained above, integration is mediated by the cell's natural DNA repair mechanisms. Endogenous DNA repair mechanisms in eukaryotic cells include homologous recombination, non-homologous end joining (NHEJ), and microhomology-induced end joining. The efficiency of integration by such processes can be improved by introducing double-strand breaks (DSBs) into cellular DNA; a 40,000-fold increase in efficiency has been reported using rare-cutting endonucleases (meganucleases) such as I-Sce1 [48, 49, 50].

[0050] Unlike site-specific recombination involved in systems such as the Flp-In system

[16] , integration in the present invention does not require exogenous recombinases or engineered recombinase recognition sites. Therefore, the methods for identifying loci and generating libraries preferably do not include a step of recombinase-mediated integration of DNA molecules. Furthermore, the eukaryotic cells in the methods for identifying loci and generating libraries preferably lack recombination sites for site-specific recombinases. The mechanisms and utility of specific integration of donor DNA into cellular DNA by recombinases and nucleases are quite clear, as discussed by Jasin 1996

[50] .

[0051] In contrast, specific integration, involving the use of site-specific nucleases, involves nuclease action, creating breaks or nicks in cellular DNA that are then exposed to endogenous cellular repair mechanisms, such as homologous recombination or NHEJ, for repair. Because recombinase-based approaches absolutely require preintegration of a recognition site, these methods require the prior engineering of "hotspot" integration sites into cellular DNA. For nuclease-mediated integration, nucleases can be engineered, or in the case of CRISPR:Cas9, guided by guide RNA, to recognize endogenous recognition sequences, i.e., nucleic acid sequences that occur naturally in cellular DNA. Finally, at a practical level, nuclease-mediated approaches are more efficient at specific integration of transgenes at the levels required to generate large libraries of binders.

[0052] The DNA repair mechanisms into which donor DNA is incorporated in methods to identify loci or generate libraries can be predetermined or biased to some extent by the design of the donor DNA and / or the site-specific nuclease selection.

[0053] Homologous recombination is a natural mechanism used by cells to repair double-strand breaks using homologous sequences (e.g., from another allele) as a repair template. Homologous recombination has been utilized in cell engineering to introduce insertions (including transgenes), deletions, and point mutations into genomes. Homologous recombination is facilitated by providing homology arms on the donor DNA. Therefore, the donor DNA preferably contains homology arms. Initial approaches to engineering higher eukaryotic cells typically used 5-10 kb of homology arms in the donor plasmid to increase the efficiency of targeted integration at the desired site. Homologous recombination is possible with genome sizes as small as 12.5 × 10 6 It is particularly suitable for eukaryotic organisms such as yeast with genomes up to 3000 x 10 bp, and for higher eukaryotic cells with genomes larger than 3000 x 10 bp, e.g. 6 bp is more effective compared to mammalian cells.

[0054] Homologous recombination can also be induced by nicks in cellular DNA

[52] , which can also serve as a pathway for nuclease-mediated integration into cellular DNA. Therefore, integration of donor DNA included in methods for identifying loci or generating libraries preferably involves the introduction of nicks into cellular DNA. Two different pathways have been shown to promote homologous recombination at nicked DNA. One pathway is essentially similar to repair at double-strand breaks that utilizes Rad51 / Brca2, while the other pathway is inhibited by Rad51 / Brca2 and preferentially uses single-stranded DNA or nicked double-stranded donor DNA

[51] .

[0055] Non-homologous end joining (NHEJ) is an alternative mechanism for repairing genomic double-strand breaks in which DNA ends are directly religated without the need for a homologous template. Nuclease-mediated cleavage of genomic DNA can also promote transgene integration via a non-homologous mechanism. NHEJ provides a simple means for integrating in-frame exons into introns or allows for the integration of promoter:gene cassettes into the genome. The use of non-homologous methods allows for the use of donor vectors lacking homology arms, thereby simplifying the construction of donor DNA.

[0056] Focusing on the use of short regions of terminal homology to rejoin DNA ends, it was hypothesized that 4 bp of microhomology could be utilized to guide repair at double-strand breaks, a process known as microhomology-mediated end joining

[50] .

[0057] site-specific nucleases The present invention includes the use of site-specific nucleases and their recognition sequences. On the one hand, a method for identifying a genetic locus includes providing a landing pad sequence, which preferably includes a recognition sequence for the site-specific nuclease. More preferably, this method includes providing a site-specific nuclease in a cell, which cleaves the recognition sequence included in the landing pad. On the other hand, a method for generating a library includes providing a site-specific nuclease that cleaves the recognition sequence in cellular DNA. Preferred site-specific nucleases are defined below. It should be understood that all preferences regarding the site-specific nuclease also apply mutatis mutandis to the corresponding recognition site.

[0058] Following specific binding to the recognition sequence, the site-specific nuclease cleaves the cellular DNA, thereby creating an integration site for the donor DNA. In this context, the terms site, target site, recognition site, and recognition sequence can be used interchangeably. The nuclease can cause a double-strand break or a single-strand break (nick). Nuclease-mediated DNA cleavage promotes site-specific integration of the binder gene via endogenous cellular DNA repair mechanisms.

[0059] In methods for identifying loci or generating libraries, the eukaryotic cells used may contain endogenous sequences recognized by the site-specific nuclease, or the recognition sequence may be engineered into the cellular DNA. Additionally, the site-specific nuclease may be exogenous to the cell, i.e., not naturally occurring in the cell type selected.

[0060] In methods for identifying loci or generating libraries, the site-specific nuclease can be introduced before, after, or simultaneously with the introduction of donor DNA. It may be convenient for the donor DNA to encode the nuclease in addition to the binder, or on a separate nucleic acid that is co-transfected or otherwise introduced simultaneously with the donor DNA. The clones of the library may optionally carry a nucleic acid encoding the site-specific nuclease, or such a nucleic acid may simply be transiently transfected into the cells.

[0061] In embodiments, a method of identifying a genetic locus according to the invention comprises integrating donor DNA, as defined elsewhere herein, into a cell, said step comprising providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence contained in the landing pad.

[0062] Any suitable site-specific nuclease can be used with the present invention. The site-specific nuclease can be a naturally occurring enzyme or an engineered variant. There are several known nucleases that are particularly suitable, such as nucleases that recognize or can be engineered to recognize sequences that occur only rarely in cellular DNA.

[0063] Preferably, the site-specific nucleases recognize only one or two distinct recognition sequences, which is advantageous as it should allow for only one or two donor DNA molecules to be integrated per cell.

[0064] The rarity of sequences recognized by site-specific nucleases is higher when the recognition sequence is relatively long. Preferably, the recognition sequence has a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. Preferably, the recognition sequence has a length of 10 to 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 nucleotides, or 12 to 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 nucleotides.

[0065] Preferred site-specific nucleases are nucleic acid-guided (e.g., RNA-guided) nucleases, such as meganucleases, zinc finger nucleases (ZFNs), TALE nucleases, and CRISPR / Cas systems. Each of these generates a double-strand break, although engineered forms that generate a single-strand break are known. In embodiments, the landing pad sequence comprises a corresponding nuclease recognition sequence.

[0066] Meganucleases (also known as homing endonucleases) are nucleases found in all biological kingdoms that recognize relatively long sequences (12-40 bp). Given the long recognition sequences, they are absent or relatively rare in eukaryotic genomes. Meganucleases are classified into five families based on their sequence / structure: the LAGLIDADG (SEQ ID NO: 76), GIY-YIG (SEQ ID NO: 77), HNH, His-Cys box, and PD-(D / E)XK families. The most well-studied family is the LAGLIDADG family, which includes the well-characterized I-SceI meganuclease from Saccharomyces cerevisiae. I-SceI recognizes and cleaves an 18-bp recognition sequence (5'TAGGGATAACAGGGTAAT, SEQ ID NO: 70), leaving a 4-bp 3' overhang. Another commonly used example is I-CreI, derived from the chloroplasts of the unicellular green alga Chlamydomonas reinhardtii, which recognizes a 22-bp sequence

[30] . Several engineered mutants with altered recognition sequences have been generated

[31] . Meganucleases represent the first examples of the use of site-specific nucleases in genome engineering [49, 50]. Similar to recombinase-based approaches, the use of I-SceI and other meganucleases requires prior insertion of the appropriate target recognition sequence into the genome or engineering of the meganuclease to recognize an endogenous recognition sequence

[30] . With this approach, targeted efficiency in HEK293 cells (as judged by homology-mediated "repair" of an integrated defective GFP gene) was achieved in 10–20% of cells using I-SceI

[32] .

[0067] A preferred class of meganucleases are the LAGLIDADG endonucleases. These include I-SceI, I-ChuI, I-Cre I, CsmI, PI-SceI, PI-TIiI, PI-MtuI, I-CeuI, I-SceII, I-SceIll, HO, Pi-CivI, PI-CtrI, PI- AaeI, PI-BsuI, PI-DhaI, PI-DraI, PI-MavI, PI-MchI, PI-Mfu, PI-MflI, PI-MgaI, PI-MgoI, PI -MinI, PI-MkaI, PI-MleI, PI-MrnaI, PI-MshI, PI-MsmI, PI-MthI, PI-Mtu, PI-MxeI, PI-NpuI, PI-PfuI, PI-RmaI, PI-SpbI, PI-SspI, PI-FacI, PI-MjaI, PI-PhoI, Pi-TagI, PI-ThyI, PI-Tko I, I-Msol, and PI-TspI; preferably I-SceI, I-CreI, I-ChuI, I-DmoI, I-CsmI, PI-SceI, PI-PfuI, PI-TliI, PI-MtuI, and I-Ceul. In embodiments, the landing pad sequence comprises the corresponding nuclease recognition sequence.

[0068] In recent years, several methods have been developed that allow the design of novel sequence-specific nucleases by fusing sequence-specific DNA-binding domains to nonspecific nucleases to form engineered sequence-specific nucleases induced through custom DNA-binding domains. Binding specificity can be induced by engineered binding domains, such as zinc finger domains. These are small modular domains stabilized by zinc ions that are involved in molecular recognition and are used in nature to recognize DNA sequences. Arrays of zinc finger domains are engineered for sequence-specific binding and linked to the nonspecific DNA cleavage domain of the type II restriction enzyme Fok1 to form zinc finger nucleases (ZFNs). Such ZFNs are preferred site-specific nucleases herein. ZFNs can be used to create double-strand breaks at specific sites in the genome. Fok1 is an obligate dimer, requiring the binding of two ZFNs in close proximity to generate cleavage. The specificity of engineered nucleases was enhanced by forming two distinct Fok1 mutants engineered to only heterodimerize with each other, reducing their toxicity

[33] . Such obligate heterodimeric ZFNs have been shown to achieve homologous integration in 5–18% of target cells without the need for drug selection [21, 34, 35]. Integration of inserts up to 8 kb at frequencies greater than 5% has been demonstrated without selection.

[0069] The ability to engineer DNA-binding domains of defined specificity was further simplified by the discovery of transcription activator-like effector (TALE) molecules in Xanthomonas bacteria. These TALE molecules consist of an array of 33–35 amino acid monomers, each recognizing a single base within a target sequence

[37] . This modular 1:1 relationship made it relatively easy to design engineered TALE molecules to bind to any DNA target of interest. Binding these engineered TALEs to Fok1 enabled the formation of novel sequence-specific TALE nucleases. TALE nucleases, also known as TALENs, are the preferred site-specific nucleases in this application; they have been engineered against numerous sites (i.e., recognition sequences) and exhibit a high success rate of efficient gene modification activity

[38] . Other variations and enhancements of TALE nuclease technology have been developed and can be used as site-specific nucleases in methods for identifying genetic loci or generating libraries. These include “megaTALENs”

[39] , in which a TALE nuclease binding domain is fused to a meganuclease, and “compact TALENs”

[40] , in which a single TALE nuclease recognition domain is used to effect cleavage.

[0070] Recently, another system has been described that induces double- or single-strand breaks at specific sequences in the genome. This system, called the "clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas)" system, is based on a bacterial defense mechanism

[41] . CRISPR / Cas systems are the preferred site-specific nucleases for methods of identifying gene loci or generating libraries. CRISPR / Cas systems target DNA cleavage via short, complementary single-stranded RNAs (CRISPR RNAs or crRNAs) flanking short palindromic repeats. In commonly used "type II" systems, targeted processing of the RNA depends on the presence of a transactivating crRNA (tracrRNA) with a sequence complementary to the palindromic repeat. Hybridization of the tracrRNA to the palindromic repeat sequence triggers processing. The processed RNA activates the Cas9 domain, directing its activity to complementary sequences within DNA. This system has been simplified to direct Cas9 cleavage from a single RNA transcript and directed to many different sequences within the genome [42, 43]. This approach to genome cleavage has the advantage that engineering cleavage specificity is relatively simple, due to the short RNA sequence-mediated guidance. Thus, several different methods exist for achieving site-specific cleavage of genomic DNA. As noted above, this improves the rate of integration of the donor plasmid by endogenous cellular DNA repair mechanisms.

[0071] Methods for generating libraries allow for the targeting of endogenous loci within the genome by the use of nucleic acid guided systems such as meganucleases, ZFNs, TALE nucleases or CRISPR / Cas9 systems as site-specific nucleases.

[0072] Alternatively, methods for identifying loci and generating libraries can pre-introduce heterologous recognition sites (i.e., recognition sequences) for site-specific nucleases, including meganucleases, ZFNs, and TALE nucleases. Nuclease targeting can be used to promote insertion of the recognition sequence by homologous recombination or NHEJ using vector DNA or even double-stranded oligonucleotides

[45] . Alternatively, non-specific targeting methods can be used to introduce the recognition sequence for the site-specific nuclease by using transposon-mediated integration

[46] . Virus-based systems, such as lentiviruses, applied at low titers, can also be used to introduce the recognition sequence.

[0073] The site-specific nuclease can be encoded by a single gene introduced into one plasmid, while the donor DNA resides on a second plasmid. Naturally, combinations of two or more of these elements can be used in the same plasmid, thereby increasing the efficiency of targeting by reducing the number of plasmids introduced in methods for identifying loci or generating libraries. Additionally, nucleases may be pre-integrated or can be induced to allow for temporal control of nuclease activity, as has been demonstrated for transposases

[46] . Finally, nucleases can be introduced as recombinant proteins or protein:RNA complexes (e.g., in the case of RNA-guided nucleases such as CRISPR:Cas9).

[0074] Recognition sequence As previously mentioned, the method for generating the library involves providing a site-specific nuclease that cleaves a recognition sequence in cellular DNA.

[0075] In some embodiments, the recognition sequence is located within the neurolysin (NLN) gene. The eukaryotic cells used may contain an endogenous sequence recognized by the site-specific nuclease, or the recognition sequence may be engineered into the cellular DNA as described previously herein. The neurolysin gene (human sequence: Uniprot Q9BYT8, ENSEMBL gene id ENSG00000123213) encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, resulting in the formation of neurotensin(1-10) and neurotensin(11-13). An exemplary sequence of the neurolysin gene is set forth in SEQ ID NO: 1. In some embodiments, the recognition sequence is within a nucleic acid molecule represented by a nucleotide sequence comprising, consisting essentially of, or consisting of SEQ ID NO:1, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:1.

[0076] In some embodiments, the recognition sequence is within the TRAF2 and NCK interacting kinase (TNIK) gene (Uniprot Q9UKE5, ENSEMBL gene id ENSG00000154310). An exemplary sequence of the TNIK gene is represented by SEQ ID NO: 2. In some embodiments, the recognition sequence is within the protein mono-ADP-ribosyltransferase 11 (PARP11) gene (Uniprot Q9NR21, ENSEMBL gene id ENSG00000111224). An exemplary sequence of the PARP11 gene is represented by SEQ ID NO: 3. In some embodiments, the recognition sequence is within the RAB40B gene (member of the RAS oncogene family, Uniprot Q12829, ENSEMBL gene id ENSG00000141542). An exemplary sequence of the RAB40B gene is represented by SEQ ID NO: 4. In some embodiments, the recognition sequence is within the abl interactor 2 (ABI2) gene (Uniprot Q9NYB9, ENSEMBL gene id ENSG00000138443). An exemplary sequence of the ABI2 gene is represented by SEQ ID NO:5. In some embodiments, the recognition sequence is within the ring finger protein 19B (RNF19B) gene (Uniprot Q6ZMZ0, ENSEMBL gene id ENSG00000116514). An exemplary sequence of the RNF19B gene is represented by SEQ ID NO:6. In some embodiments, the recognition sequence is within the cAMP-dependent protein kinase inhibitor alpha (PKIA) gene (Uniprot P61925, ENSEMBL gene id ENSG00000171033). An exemplary sequence of the PKIA gene is represented by SEQ ID NO:7. In some embodiments, the recognition sequence is within the formimidoyltransferase cyclodeaminase (FTCD) gene (Uniprot O95954, ENSEMBL gene id ENSG00000160282). An exemplary sequence of the FTCD gene is set forth in SEQ ID NO:8.

[0077] In some embodiments, the recognition sequence is within the NLN gene, the TNIK gene, or the RAB40B gene.

[0078] In some embodiments, the recognition sequence is within a nucleic acid molecule represented by a nucleotide sequence comprising, consisting essentially of, or consisting of SEQ ID NO:1-8, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:1-8.

[0079] In some embodiments, the recognition sequence is within an intron of a gene selected from the NLN, TNIK, PARP11, RAB40B, ABI2, RNF19B, PKIA, or FTCD genes, preferably the NLN, TNIK, or RAB40B gene. Intron is used herein as conventionally and commonly understood by those of skill in the art.

[0080] The recognition sequence in the NLN intron is preferably located within intron 2 (introns 2-3) or intron 6 (introns 6-7) of intron 1 (introns 1-2) of NLN-207. The recognition sequence in the TNIK intron is preferably located within intron 2 (introns 2-3) of TNIK-04 (Ensembl ID ENST00000436636.7). The recognition sequence in the PARP11 intron is preferably located within intron 1 (introns 1-2) of PARP11-205 (Ensembl ID ENST00000450737.2). The recognition sequence in the RAB40B intron is preferably located within intron 1 (introns 1-2) of RAB40B-206 (Ensembl ID ENST00000571995.6). The recognition sequence in the ABI2 intron is preferably located within intron 1 (introns 1-2) of ABI2-203 (Ensembl ID ENST00000261018.12). The recognition sequence in the RNF19B intron is preferably located within intron 1 (introns 1-2) of RNF19B-201 (Ensembl ID ENST00000235150.5). The recognition sequence in the PKIA intron is preferably located within intron 1 (introns 1-2) of PKIA-202 (Ensembl ID ENST00000396418.7). The recognition sequence in the FTCD intron is preferably located within intron 3 (introns 3-4) of FTCDNL1-201 (Ensembl ID ENST00000416668.5).

[0081] In preferred embodiments, the recognition sequence is within an intron of the neurolysin gene. The canonical transcript of the human neurolysin (NLN) gene is NLN-201 (Ensembl transcript ID: ENST00000380985.10), which contains 13 exons. An alternative transcript is NLN-207 (Ensembl transcript ID: ENST00000509935.2), which contains 7 exons. In some embodiments, the recognition sequence is within intron 1 of NLN-201 of the neurolysin gene (introns 1-2 of NLN-201; exemplary sequence: SEQ ID NO: 9). In some embodiments, the recognition sequence is within intron 2 of NLN-201 of the neurolysin gene (introns 2-3 of NLN-201; exemplary sequence: SEQ ID NO: 10). In some embodiments, the recognition sequence is within intron 3 of NLN-201 of the neurolysin gene (introns 3-4 of NLN-201; exemplary sequence: SEQ ID NO: 11). In some embodiments, the recognition sequence is within intron 4 of NLN-201 of the neurolysin gene (introns 4-5 of NLN-201; exemplary sequence: SEQ ID NO: 12). In some embodiments, the recognition sequence is within intron 5 of NLN-201 of the neurolysin gene (introns 5-6 of NLN-201; exemplary sequence: SEQ ID NO: 13). In some embodiments, the recognition sequence is within intron 6 of NLN-201 of the neurolysin gene (introns 6-7 of NLN-201; exemplary sequence: SEQ ID NO: 14). In some embodiments, the recognition sequence is within intron 7 of NLN-201 of the neurolysin gene (introns 7-8 of NLN-201; exemplary sequence: SEQ ID NO: 15). In some embodiments, the recognition sequence is within intron 8 of NLN-201 or intron 1 of NLN-207 of the neurolysin gene (introns 8-9 of NLN-201 or introns 1-2 of NLN-207; exemplary sequence: SEQ ID NO: 16). In some embodiments, the recognition sequence is within intron 9 of NLN-201 or intron 2 of NLN-207 of the neurolysin gene (introns 9-10 of NLN-201 or introns 2-3 of NLN-207; exemplary sequence: SEQ ID NO: 17).In some embodiments, the recognition sequence is within intron 10 of NLN-201 or intron 3 of NLN-207 of the neurolysin gene (introns 10-11 of NLN-201 or introns 3-4 of NLN-207; exemplary sequence: SEQ ID NO: 18). In some embodiments, the recognition sequence is within intron 11 of NLN-201 or intron 4 of NLN-207 of the neurolysin gene (introns 11-12 of NLN-201 or introns 4-5 of NLN-207; exemplary sequence: SEQ ID NO: 19). In some embodiments, the recognition sequence is within intron 12 of the NLN-201 neurolysin gene (introns 12-13 of NLN-201; exemplary sequence: SEQ ID NO: 20). In some embodiments, the recognition sequence is within intron 5 of the NLN-207 neurolysin gene (introns 5-6 of NLN-207; exemplary sequence: SEQ ID NO: 21). In some embodiments, the recognition sequence is within intron 6 of the NLN-207 neurolysin gene (introns 6-7 of NLN-207; exemplary sequence: SEQ ID NO: 22).

[0082] Preferred introns are introns 1, 2, and 6 of NLN-207 of the NLN gene. In some embodiments, the recognition sequence is within a nucleic acid molecule represented by a nucleotide sequence comprising, consisting essentially of, or consisting of SEQ ID NO: 16, 17, 22, or a nucleotide sequence having at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 16, 17, 22.

[0083] Preferably, the recognition sequence comprises, consists essentially of, or consists of a base sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:15 or SEQ ID NO:23.

[0084] In some embodiments, particularly when the recognition sequence is within an intron of a gene selected from the NLN, TNIK, PARP11, RAB40B, ABI2, RNF19B, PKIA, or FTCD genes as described above, the recognition sequence is within an open chromatin region of the intron.

[0085] In some embodiments, particularly when the recognition sequence is within an intron of a gene selected from the NLN, TNIK, PARP11, RAB40B, ABI2, RNF19B, PKIA, or FTCD genes as described above, the recognition sequence is within an enhancer region of the intron.

[0086] As used herein, "open chromatin," or "euchromatin," or "loose chromatin" refers to a structure that is permissive for transcription, whereas "heterochromatin," or "tight" or "closed" chromatin, is more compact and less responsive to factors that need to gain access to the DNA template.

[0087] Distribution of recognition sequences The recognition sequence of the site-specific nuclease in the method of the present invention can be present in genomic DNA or episomal DNA that is stably inherited in the cell. Thus, the donor DNA can be integrated into a genomic or episomal locus of the cellular DNA. Preferably, the genomic locus is identified by a method for identifying a locus.

[0088] In its simplest form, a single gene encoding a binder (binder gene) targets a single site within the eukaryotic cell genome. Identification of cells demonstrating a particular binding activity or cellular phenotype allows for the direct isolation of the gene encoding the desired trait (e.g., by PCR from mRNA or genomic DNA). This is facilitated by the use of a unique recognition sequence for a site-specific nuclease that occurs once in the cellular DNA. Thus, cells used to form a library can contain a nuclease recognition sequence at a single fixed locus, i.e., one and the same locus in all cells. Libraries made from such cells contain donor DNA integrated at a fixed locus, i.e., occurring at the same locus within the cellular DNA of all clones in the library.

[0089] Optionally, the recognition sequence may occur multiple times in the cellular DNA, so that the cell has two or more potential integration sites for the donor DNA. This is typical of diploid or polyploid cells, where the recognition sequences are present at corresponding positions on a pair of chromosomes, i.e., duplicated loci. Libraries generated from such cells may contain donor DNA integrated at duplicated fixed loci. For example, a library generated from diploid cells may have donor DNA integrated at doubled fixed loci, and a library generated from triploid cells may have donor DNA integrated at tripled fixed loci. Many suitable mammalian cells are diploid, and clones in mammalian cell libraries according to the present invention may have donor DNA integrated at doubled fixed loci.

[0090] The sequence recognized by the site-specific nuclease can occur at two or more independent loci in the cellular DNA. Thus, the donor DNA can be integrated at multiple independent loci. A library of diploid or polyploid cells can contain donor DNA integrated at multiple independent fixation loci and / or duplicate fixation loci.

[0091] In cells containing recognition sequences at multiple loci (either duplicated loci or independent loci), each locus represents a potential integration site for a molecule of donor DNA. Introduction of donor DNA into a cell can result in integration at all of the nuclease recognition sequences present in the cell, or the donor DNA can integrate into some, but not all, of these potential sites. For example, when a library is generated from diploid cells containing recognition sequences at a first and a second fixation locus (e.g., a double fixation locus), the resulting library can include clones in which the donor DNA has integrated into the first fixation locus, clones in which the donor DNA has integrated into the second fixation locus, and clones in which the donor DNA has integrated into both the first and second fixation loci.

[0092] Therefore, a method for creating a library can involve site-specific nuclease cleavage of multiple fixed loci in cells and integration of donor DNA at the multiple fixed loci. As mentioned above, when multiple copies of the same recognition sequence exist (for example, when targeting endogenous loci in diploid or polyploid cells), particularly when an efficient targeting mechanism is used, two binder genes can be integrated, with only one gene being specific to the target. This can be resolved by subsequent screening once the binder genes are isolated.

[0093] In some cases, it may be desirable to introduce more than one binder per cell. For example, a bispecific binder can be generated by combining two different antibodies, which may have properties not present in the individual binders

[47] . This can be achieved by introducing different antibody genes into both alleles of a double anchoring locus, or by targeting different antibody populations to independent anchoring loci using the methods described herein. Furthermore, the binder itself can be composed of multiple chains (e.g., antibody VH and VL domains displayed in Fab or IgG formats). In this case, it may be desirable to incorporate different subunits into different loci. These can be incorporated within the same cycle of nuclease-mediated incorporation, or they can be incorporated sequentially using nuclease-mediated incorporation in one or both incorporation steps.

[0094] Landing Pad Layout In step (a) of the method for identifying a locus, a landing pad sequence is provided. As used herein, "landing pad sequence" can be interpreted to refer to a nucleotide sequence that directs integration or "landing" of a donor DNA molecule at a particular genomic locus. The landing pad sequence generally comprises a nucleotide sequence ("recognition sequence") recognized by a site-specific recombinase or site-specific nuclease, allowing site-specific recombinase-mediated or nuclease-mediated integration of a donor DNA molecule containing one or more transgenes of interest, e.g., transgenes encoding binders or selectable markers as described below herein. In embodiments, the landing pad sequence comprises a recognition sequence for a site-specific nuclease. Preferred recognition sequences are defined elsewhere herein.

[0095] Optionally, landing pad sequences may contain additional nucleotide sequences, such as a selectable marker, such as a gene that confers resistance to an antibiotic, to facilitate screening and / or selection of clones in which the landing pad sequence has been integrated into their genome. Landing pad sequences may optionally further contain nucleotide sequences, such as a promoter or other regulatory region, to facilitate screening and / or selection of clones in which the donor DNA sequence has been integrated into the landing pad sequence. As a non-limiting example, a promoter flanked by site-specific nuclease recognition sites in the landing pad sequence can be operably linked to a promoterless transgene of interest following genomic integration of the transgene after cleavage of the cellular DNA with the site-specific nuclease. Expression of the resulting transgene can then be used for screening and / or selection purposes.

[0096] Selection of clones incorporating the landing pad sequence Step (d) of the method for identifying a locus involves selecting clones that have the landing pad sequence integrated into their genome. If the landing pad sequence includes a selectable marker, such as a gene that confers resistance to an antibiotic (such as blasticidin or puromycin), clones can be selected by culturing cells in the presence of the antibiotic. Alternatively, clones can be screened and / or selected using standard molecular toolbox methods in the art, such as Southern blotting or PCR. Clonal selection can include screening of clones. For example, inverse PCR (iPCR), as described in Schuldiner et al. (2018) Dev Cell 14:227-238 (incorporated herein by reference in its entirety), can be used to map the insertion site of a transposable element. Alternatively, sprinklelet PCR (spPCR), as described in Potter and Luo (2010) PLoS ONE 5(4):e1016 (incorporated herein by reference in its entirety), can be used. Sprinklelet PCR involves digestion of genomic DNA, resulting in overhanging sticky ends. Restriction enzymes are not required for cleavage within the landing pad sequence. A double-stranded oligonucleotide (sprinklelet) that is non-phosphorylated and contains a stable hairpin loop and a compatible sticky end is ligated to the sticky end. Two nested PCRs are then performed to amplify the genomic sequence between the transposon insertion site and the annealed sprinklelet. This is followed by sequencing of the PCR product using, for example, Sanger sequencing with separate nested primers or any other nucleic acid sequencing method known to those skilled in the art. Examples include Sanger sequencing, single-molecule real-time sequencing, Ion Torrent sequencing, Pyrosequencing, Illumina sequencing, combinatorial probe-anchor synthesis, sequencing by ligation (SOLiD sequencing), Nanopore sequencing, and GenapSys sequencing.Sequencing sample preparation, equipment and protocols are discussed in standard handbooks such as Head, Ordoukhanian and Salomon (Eds), Next Generation Sequencing: Methods and Protocols, Humana Press, NJ, USA (2018), which is incorporated herein by reference in its entirety, many of which are commercially available, for example, from Illumina (CA, USA) and Pacific Biosciences (CA, USA).

[0097] Using the screening and / or selection methods described above, clones that have only a single copy of the transposon element and thus the landing pad sequence integrated into their genome can be selected.

[0098] Alternatively, screening for single-copy integration can be performed using whole genome sequencing (WGS), followed by genome assembly using standard bioinformatics tools available in the art. Alternatively, screening for single-copy integration can be performed by quantifying the expression of the transgene of interest after its integration into the landing pad sequence. Expression can be assessed at the mRNA or protein level by standard assays known to those skilled in the art (e.g., qPCR, Western blotting, ELISA). Expression can also be assessed using spectroscopic methods, such as fluorescence-activated cell sorting (FACS) using commercially available devices. As a non-limiting example, a transgene encoding a cell membrane-associated binder can be integrated into the landing pad after integration of the landing pad into the cellular DNA. Fluorescently labeled antibodies against the binder can then be used in conjunction with FACS to quantify expression levels and select clones with single-copy integration of the binder. Examples of FACS-based single-copy integration screening and selection are further provided in the experimental section of this specification.

[0099] These clones are particularly useful because they can be used to construct libraries characterized by homogeneous integration and / or homogeneous transcription of binders, as described elsewhere herein.

[0100] In embodiments, the method of identifying a locus further comprises (e) screening for single copy integration (of the landing pad sequence), and (f) identifying the locus (in which the landing pad sequence has been integrated). Step (f) can be performed by any of the sequencing methods described above.

[0101] Locus and Use In the context of methods for identifying loci in the genome of eukaryotic cells, "locus" refers to a genomic locus that is a candidate for insertion of a binder sequence. Loci identified by such methods can therefore be used to construct libraries according to the invention by integrating donor DNA sequences containing one or more transgenes encoding binders at the locus. Preferably, in such uses, the donor DNA is integrated into a landing pad sequence at the locus.

[0102] In a preferred embodiment, the use of the locus according to the present invention comprises: - identifying a locus by the method for identifying a locus according to the invention; - providing a donor DNA molecule encoding the binder and a eukaryotic cell; - introducing donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in the cellular DNA, the recognition sequence creating an integration site at the locus where the donor DNA will integrate into the cellular DNA, the integration occurring through the cell's endogenous DNA repair mechanisms, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA; and - culturing and cloning the recombinant cells, thereby providing a library of eukaryotic cell clones containing donor DNA encoding a repertoire of binders. Includes.

[0103] All preferred embodiments relating to the method for generating a library according to the present invention apply mutatis mutandis to the method according to this preferred embodiment.

[0104] Donor DNA Methods for generating libraries and preferably for identifying loci also involve incorporating donor DNA. Preferred donor DNAs are described in this section.

[0105] The donor DNA is usually circular DNA and can be provided as a plasmid or vector. Another possibility is linear DNA. The donor DNA molecule may contain one or more donor DNA sequences that are integrated into the cellular DNA, as well as regions that are not integrated into the cellular DNA. The DNA is typically double-stranded, although single-stranded DNA can also be used in some cases. The donor DNA may contain one or more transgenes encoding the binders, for example, a promoter:gene cassette.

[0106] In the simplest format, double-stranded circular plasmid DNA can be used to promote homologous recombination. This requires a DNA region flanking the transgene that is homologous to the DNA sequence flanking the cleavage site in the genomic DNA. Linearized double-stranded plasmid DNA, PCR products, or synthetic genes can be used to promote both homologous recombination and the NHEJ repair pathway. As an alternative to double-stranded DNA, single-stranded DNA can be used to promote homologous recombination

[52] . A common approach to generating single-stranded DNA is to include a single-stranded origin of replication from a filamentous bacteriophage into the plasmid.

[0107] The use of single-stranded DNA viruses such as adeno-associated viruses (AAVs) to promote efficient homologous recombination has been shown to improve efficiency by several orders of magnitude [53, 54]. Systems such as AAVs can be used in conjunction with nuclease cleavage in methods for identifying gene loci and generating libraries. The advantages of both systems can be applied to methods for identifying gene loci and generating libraries. While the packaging limit for AAV vectors is 4.7 kb, the use of nuclease digestion of target genomic DNA can reduce this limit, allowing for the integration of larger transgene constructs.

[0108] A molecule of donor DNA can encode a single binder or multiple binders. Optionally, multiple subunits of a binder can be encoded per molecule of donor DNA. In some embodiments, the donor DNA encodes subunits of a multimeric binder.

[0109] In embodiments, methods of identifying genetic loci according to the present invention further comprise (g) integrating a donor DNA sequence comprising one or more transgenes encoding binders into the landing pad sequence, and (h) screening for integration of the donor DNA. In additional embodiments, step (g) comprises providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence contained in the landing pad. In more preferred embodiments, step (h) comprises screening for display of one or more binders encoded by the donor DNA.

[0110] Selection of clones into which the donor DNA promoter and donor DNA have been integrated In the methods for identifying loci and generating libraries, the donor DNA contains one or more transgenes encoding binders. Transcription of the binder by the encoding donor DNA is typically achieved by placing the binder-encoding sequence under the control of a promoter and, optionally, one or more enhancer elements for transcription. The promoter (and optionally other genetic control elements) can be contained in the donor DNA molecule itself. Alternatively, the binder-encoding sequence can lack a promoter on the donor DNA and instead be placed in operably linked relationship with a promoter on cellular DNA, such as an endogenous promoter or a previously integrated exogenous promoter, as a result of its insertion into an integration site generated by a site-specific nuclease.

[0111] The donor DNA may further comprise one or more additional coding sequences, such as genetic elements that allow for the selection of cells containing or expressing the donor DNA. Such elements may be referred to as selectable markers. Similar to the binder-encoding sequences described above, such elements may be associated with a promoter on the donor DNA or placed under the control of a promoter as a result of integration of the donor DNA at a fixed locus. The latter arrangement provides a convenient means of specifically selecting cells that have integrated the donor DNA at the desired site, since these cells will express the selectable genetic element. This may be, for example, a gene that confers resistance to a negative selection agent, such as blasticidin or puromycin. One or more selection steps may be applied to remove unwanted cells, such as cells lacking donor DNA or cells in which the donor DNA has not been integrated at the correct location.

[0112] Expression of the membrane-anchored binder itself can be used as a form of selectable marker. For example, if a library of antibody genes formatted as IgG or scFv-Fc fusions is introduced, antibody-expressing cells can be selected using a secondary reagent that recognizes surface-expressed Fc using the methods described herein. Initial transfection with donor DNA encoding the transgene under the control of an exogenous promoter results in transient expression (and cell surface expression) of the binder; it is then necessary to wait for this to subside (e.g., to achieve targeted integration of 1-2 antibody genes / cell).

[0113] Alternatively, a construct encoding a membrane-tethering element (e.g., the Fc domain in this example fused to a PDGF receptor transmembrane domain) can be pre-integrated before the binder sequence is introduced. If this membrane-tethering element lacks a promoter or is encoded in an exon out of frame with the preceding exon, surface expression will be impaired. Targeted integration of a new donor molecule can then correct this defect (e.g., by targeting a promoter or "in-frame" exon to an intron upstream of the defective anchoring element). If the in-frame "corrected exon" also encodes a binder, a fusion between the binder and the membrane-tethering element occurs, resulting in surface expression of both. Correctly targeted integration therefore results in in-frame expression of the membrane-tethering element alone or as part of a fusion with the new binder. Furthermore, if a library of new binders lacks the membrane-tethering element and is not correctly integrated, they will not be selected. Thus, expression of the binder itself on the cell surface can be used to select for a population of cells that have been correctly targeted and integrated.

[0114] Number of clones and diversity of the library The loci identified by the methods for identifying loci can be used to construct a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders. Similarly, the methods for generating a library are for generating a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders. In the context of this application, library refers to a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders obtainable by one of these methods, unless otherwise specified. Preferred libraries and their characteristics are defined in this section.

[0115] 10 7 ~10 10 Yeast display libraries have previously been constructed, demonstrating that binders can be obtained without population immunization or prior selection [9, 55, 56, 57]. Many previously published mammalian display libraries have used antibody genes derived from immunized donors or even highly enriched antigen-specific B lymphocytes, given the limitations on library size and variability when using cells derived from higher eukaryotes. As a result of the efficiency of gene targeting in the methods of the present invention, large naive libraries can be constructed in higher eukaryotic cells, such as mammalian cells, consistent with those described for simpler eukaryotes, such as yeast.

[0116] After the donor DNA is integrated into the cellular DNA, the resulting recombinant cells are cultured to allow their replication, generating clones of cells from each of the initially generated recombinant cells. Thus, each clone is derived from a single original cell in which the donor DNA was integrated at the integration site formed by the site-specific nuclease. The method according to the invention is associated with high efficiency and high fidelity integration of donor DNA, and libraries according to the invention can be produced with at least 100, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 or 1010 It may contain clones.

[0117] Without being bound by this theory, it is possible to target 10% or more of the transfected mammalian cells using nuclease-mediated integration. 10 More than 10 cells (e.g., 2 x 10 6 It is also feasible to grow and transform large numbers of cells (from 5 liters of cells growing at 10 cells / ml). Transfection of such large numbers of cells can be performed using standard methods, including polyethylenimine-mediated transfection, as described herein. In addition, the method can be used to grow large numbers of cells up to 10 10 Highly efficient electroporation of 10 cells in 5 minutes is available (e.g., http: / / www.maxcyte.com). Thus, using the approach of the present invention, 9 It is possible to generate libraries of more than 10 clones.

[0118] If the population of donor DNA molecules used to form the library contains multiple copies of the same sequence, two or more clones containing DNA encoding the same binder can be obtained. For example, as detailed elsewhere herein, if two or more recognition sequences for site-specific nucleases are present, clones may contain donor DNA encoding two or more different binders. Thus, the diversity of the library may differ from the number of clones obtained in terms of the number of different binders encoded or expressed.

[0119] Clones in the library preferably contain donor DNA encoding one or two members of the binder repertoire and / or preferably express only one or two members of the binder repertoire. The limited number of distinct binders per cell is advantageous in identifying clones and / or DNA encoding specific binders identified when screening a library for a given target. This is easiest when clones encode a single member of the binder repertoire. However, when clones selected from a library encode a small number of distinct binders, for example, when a clone can encode two members of the binder repertoire, it is also easy to identify the appropriate coding DNA for the desired binder. As discussed elsewhere herein, because diploid cells contain a double fixation locus on each chromosomal copy and donor DNA can be integrated into one or both fixation loci, it is particularly convenient to generate clones encoding one or two binders by selecting recognition sequences for site-specific nucleases that occur once per chromosomal copy of the diploid genome. Thus, each clone in the library may express only one or two members of the binder repertoire.

[0120] Binders displayed on the surface of cells in the library can be identical (have the same amino acid sequence) to other binders displayed on the same cell. A library can be composed of clones of cells each displaying a single member of the binder repertoire or clones displaying multiple members of the binder repertoire per cell. Alternatively, a library can contain some clones displaying a single member of the binder repertoire and some clones displaying multiple (e.g., two) members of the binder repertoire.

[0121] Thus, a library according to the invention may contain clones encoding two or more members of a binder repertoire, with the donor DNA integrated at a double fixation locus or at multiple independent fixation loci.

[0122] As mentioned above, it is easiest to identify the coding DNA of a binder when the corresponding clone expresses only one binder. Typically, a molecule of donor DNA encodes a single binder. A binder can be multimeric, such that a molecule of donor DNA contains multiple genes or open reading frames corresponding to various subunits of a multimeric binder.

[0123] The library according to the invention comprises at least 100, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 or 10 10 Each binder may encode different binders. If the binder is multimeric, diversity can be provided by one or more subunits of the binder. A multimeric binder can combine one or more variable subunits with one or more constant subunits, where the constant subunits are identical (or of more limited diversity) across all clones in the library. In generating a library of multimeric binders, combinatorial diversity is possible when a first repertoire of binder subunits can be paired with any of a second repertoire of binder subunits.

[0124] Library characteristics and structure The method according to the invention allows the construction of eukaryotic cell libraries that have many advantageous properties. The libraries preferably have any one or more of the following characteristics: 1. Diversity. The library should have at least 100, 10 3 , 10 4 , 10 5 , 106 , 10 7 , 10 8 or 10 9 The vector may encode and / or express different binders. 2. Homogeneous integration. A library can be composed of clones containing donor DNA integrated into a fixed locus or a limited number of fixed loci in cellular DNA. Thus, each clone in the library contains donor DNA at a fixed locus or at least one of multiple fixed loci. Preferably, clones contain donor DNA integrated into one or two fixed loci in cellular DNA. As described elsewhere herein, the integration site is at a recognition sequence for a site-specific nuclease. Integration of donor DNA to generate recombinant DNA is described in detail elsewhere herein, and different results may occur depending on the number of integration sites. If a single potential integration site is present in the cells used to generate the library, the library will be a library of clones containing donor DNA integrated into a single fixed locus. Thus, all clones in the library will contain a binder gene at the same location in cellular DNA. Alternatively, if multiple potential integration sites are present, the library can be a library of clones containing donor DNA integrated into multiple fixed loci and / or different fixed loci. Preferably, each clone in the library contains donor DNA integrated at a first and / or second anchor locus. For example, a library may contain clones in which donor DNA is integrated at a first anchor locus, clones in which donor DNA is integrated at a second anchor locus, and clones in which donor DNA is integrated at both the first and second anchor loci. In preferred embodiments, clones in a library have only one or two anchor loci, although it is possible to integrate donor DNA at multiple loci if desired for a particular application. Thus, in some libraries, each clone may contain donor DNA integrated at any one or more of several anchor loci, e.g., three, four, five, or six anchor loci.In the case of a library containing binder subunits integrated at separate sites, clones of the library may contain DNA encoding a first binder subunit integrated at a first anchoring locus and DNA encoding a second binder subunit integrated at a second anchoring locus, and the clones express a multimeric binder comprising the first and second subunits. 3. Uniform transcription. The relative level of binder transcription among different clones in a library is maintained within controlled limits because donor DNA is integrated into a controlled number of loci and into the same locus (fixed locus) in different clones. Relatively uniform transcription of binder genes results in comparable levels of binder expression on or from clones in the library. Binders displayed on the surface of cells in the library can be identical (have the same amino acid sequence) to other binders displayed on the same cell. A library can be composed of clones of cells each displaying a single member of the binder repertoire or clones displaying multiple members of the binder repertoire per cell. Alternatively, a library can contain some clones displaying a single member of the binder repertoire and some clones displaying multiple (e.g., two) members of the binder repertoire. Preferably, the clones in the library express one or two members of the binder repertoire. For example, a library of eukaryotic cell clones according to the present invention can contain at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 or 10 9The cells can express a repertoire of different binders, e.g., IgG, Fab, scFv, or scFv-Fc antibody fragments, each containing donor DNA integrated into a fixed locus in the cellular DNA. The donor DNA encodes the binder and may further contain genetic elements for selection of cells into which the donor DNA has integrated into the fixed locus. Cells of the library may contain DNA encoding an exogenous site-specific nuclease.

[0125] These and other features of the library are further described elsewhere herein.

[0126] The present invention extends to libraries either in pure form as a population of library clones in the absence of other eukaryotic cells, or to libraries mixed with other eukaryotic cells. The other cells can be eukaryotic cells of the same type (e.g., the same cell line) or different cells. Further advantages can be obtained by combining two or more libraries according to the invention, or by combining a library according to the invention with a second library or a second cell population, to facilitate or expand screening or for other uses described herein or that will be apparent to one of skill in the art.

[0127] A library according to the invention, one or more clones from the library, or host cells into which DNA encoding binders from the library has been introduced can be provided in cell culture medium. The cells can be cultured and then concentrated to form a cell pellet for convenient transport or storage.

[0128] The library is typically provided in vitro. The library may be contained in a vessel such as a cell culture flask containing the cells of the library suspended in culture medium, or in a vessel containing a pellet or concentrated suspension of eukaryotic cells comprising the library. The library may comprise at least 75%, 80%, 85%, or 90% of the eukaryotic cells in the vessel.

[0129] It is understood that the fixed locus into which the donor DNA is integrated for the libraries of the invention corresponds to the location of the recognition sequence in the method for generating the libraries of the invention, and therefore all preferences for the location of the recognition sequence described herein are also applicable to the fixed locus of the libraries of the invention.

[0130] binder A "binder" according to the present invention is a binder molecule and refers to a specific binding partner for another molecule. Typical examples of specific binding partners are antibody-antigen and receptor-ligand.

[0131] The repertoire of binders encoded by the library typically shares a common structure and has one or more regions of diversity. Thus, the library allows for the selection of members of a desired molecular structural class, such as peptides or scFv antibody molecules. For example, binders can be polypeptides that share a common structure and have one or more regions of amino acid sequence diversity.

[0132] This can be illustrated by considering a repertoire of antibody molecules. These may be of a common structural class, such as IgG, Fab, scFv-Fc, or scFv, that differ in one or more regions of their sequence. Antibody molecules typically have sequence variation in their complementarity determining regions (CDRs), the regions primarily responsible for antigen recognition. A repertoire of binders of the invention may be a repertoire of antibody molecules that differ in one or more CDRs, for example there may be sequence diversity in all six CDRs or in one or more specific CDRs, such as the heavy chain CDR3 and / or the light chain CDR3.

[0133] Antibody molecules and other binders are described in more detail elsewhere herein. However, the potential of the present invention extends beyond antibody display to include the display of libraries of peptides or engineered proteins, including receptors, ligands, individual protein domains, and alternative protein scaffolds [58, 59]. Site-specific integration by nucleases can be used to create libraries of other types of binders previously engineered using other display systems. Many of these involve monomeric binding domains, such as DARPins and lipocalins, affibodies, and adhirons [58, 59, 152]. Display in eukaryotic cells, particularly mammalian cells, also opens the possibility of isolating and engineering binders or targets, including more complex multimeric targets. For example, T cell receptors (TCRs) have evolved to be expressed on T cells and recognize peptides presented in complex with MHC molecules on antigen-presenting cells. Libraries encoding and expressing a repertoire of TCRs can be generated, and these libraries can be screened to identify binding to MHC-peptide complexes, as further described elsewhere herein.

[0134] In the case of multimeric binders, donor DNA encoding the binders can be provided as one or more DNA molecules. For example, if individual antibody VH and VL domains are to be expressed separately, they can be encoded on separate molecules of donor DNA. Donor DNA is integrated into cellular DNA at multiple integration sites, e.g., the VH binder gene is integrated at one locus and the VL binder gene is integrated at a second locus. Methods for introducing donor DNA encoding separate binder subunits are described in more detail elsewhere herein. Alternatively, both subunits or portions of a multimeric binder can be encoded on the same molecule of donor DNA that is integrated at a fixed locus.

[0135] The binder can be an antibody molecule or a non-antibody protein containing an antigen-binding site. The antigen-binding site can be provided by placing a peptide loop on a non-antibody protein scaffold, such as fibronectin or cytochrome B, or by randomizing or mutating amino acid residues in the loop within the protein scaffold to bind to the desired target [60, 61, 62]. Protein scaffolds for antibody mimetics are disclosed in WO 0034784, which describes proteins (antibody mimetics) containing fibronectin type III domains with at least one randomized loop. A suitable scaffold onto which one or more peptide loops, e.g., a set of antibody VH CDR loops, can be grafted can be provided by any domain member of the immunoglobulin gene superfamily. The scaffold can be a human or non-human protein.

[0136] The use of antigen-binding sites on non-antibody protein scaffolds has been reviewed previously

[63] . Typical examples are proteins with a stable backbone and one or more variable loops, in which the amino acid sequence of one or more loops is specifically or randomly mutated to create an antigen-binding site that binds the target antigen. Such proteins include the IgG-binding domain of protein A from S. aureus, transferrin, tetranectin, fibronectin (e.g., the 10th fibronectin type III domain), and lipocalins. Other approaches include small constrained peptides based on, for example, "knottin" or cyclotide scaffolds

[64] . Given their small size and complexity, particularly with regard to the correct formation of disulfide bonds, the use of eukaryotic cells to select novel binders based on these scaffolds may be advantageous. Given the common function of these peptides in nature, libraries of binders based on these scaffolds may be advantageous for generating small, high-affinity binders for specific applications in blocking ion channels and proteases.

[0137] In addition to the antibody sequence and / or antigen-binding site, the binder can contain other amino acids that form a peptide or polypeptide, such as a folded domain, or can confer another functional property to the molecule in addition to the ability to bind to the antigen. The binder can carry a detectable label or be conjugated to a toxin or targeting moiety or enzyme (e.g., via a peptidyl bond or linker). For example, the binder can contain a catalytic site (e.g., in the enzyme domain) and an antigen-binding site, where the antigen-binding site binds to and thus targets the antigen. The catalytic site can inhibit the biological function of the antigen, for example, by cleavage.

[0138] antibody molecule Antibody molecules are preferred binders. Antibody molecules may be whole antibodies or immunoglobulins (Ig), and have four polypeptide chains (two identical heavy chains and two identical light chains). The heavy and light chains form a pair, each having a VH-VL domain pair that contains an antigen-binding site. The heavy and light chains also contain constant domains: light chain CL and heavy chain CH1, CH2, CH3, and sometimes CH4 (a fifth domain, CH4, is present in human IgM and IgE). The two heavy chains are linked by disulfide bridges at a flexible hinge region. An antibody molecule may contain VH and / or VL domains.

[0139] The most common naturally occurring format of antibody molecules is IgG, a heterotetramer consisting of two identical heavy chains and two identical light chains. The heavy and light chains are composed of modular domains with a conserved secondary structure consisting of a four-stranded antiparallel beta sheet and a three-stranded antiparallel beta sheet, stabilized by a single disulfide bond. Each antibody heavy chain has an N-terminal variable domain (VH) and three relatively conserved "constant" immunoglobulin domains (CH1, CH2, and CH3), whereas the light chain has one N-terminal variable domain (VL) and one constant domain (CL). Disulfide bonds stabilize the individual domains and form covalent bonds to bind the four chains into a stable complex. The VL and CL of the light chain associate with the VH and CH1 of the heavy chain, and these elements can be expressed alone to form Fab fragments. The CH2 and CH3 domains (also called "Fc domains") associate with another CH2:CH3 pair to form a tetrameric Y-shaped molecule with the variable domains of the heavy and light chains at the ends of the "Y." The CH2 and CH3 domains are involved in interactions with effector cells and complement components within the immune system. Recombinant antibodies have traditionally been expressed in IgG format or as Fab (consisting of a VH:CH1 dimer and a light chain). Additionally, artificial constructs called single-chain Fvs (scFvs) can be used, consisting of DNA encoding the VH and VL fragments genetically fused to DNA encoding a flexible linker.

[0140] The binders may be human antibody molecules, and therefore, where constant domains are present, these are preferably human constant domains.

[0141] The binder may be an antibody fragment or a smaller antibody molecule format such as a single-chain antibody molecule. For example, the antibody molecule may be an scFv molecule consisting of a VH domain and a VL domain connected by a linker peptide. In an scFv molecule, the VH domain and the VL domain form a VH-VL pair, and the complementarity-determining regions of the VH and VL combine to form an antigen-binding site.

[0142] Other antibody fragments that constitute an antibody antigen-binding site include, but are not limited to, (i) a Fab fragment consisting of the VL, VH, CL, and CH1 domains; (ii) an Fd fragment consisting of the VH and CH1 domains; (iii) an Fv fragment consisting of the VL and VH domains of a single antibody; (iv) a dAb fragment consisting of the VH or VL domain [65, 66, 67]; (v) isolated CDR regions; (vi) an F(ab')2 fragment, a bivalent fragment comprising two linked Fab fragments; (vii) an scFv in which the VH and VL domains are linked by a peptide linker, allowing the two domains to associate to form an antigen-binding site [68, 69]; (viii) a bispecific single-chain Fv dimer (International Application PCT / US92 / 09965); and (ix) a "diabody," a multivalent or multispecific fragment constructed by gene fusion (International Publication No. WO 94 / 13804)

[70] . Fv, scFv or diabody molecules can be stabilized by the incorporation of disulfide bridges linking the VH and VL domains

[71] .

[0143] A variety of other antibody molecules containing one or more antibody antigen-binding sites have been engineered, including, for example, Fab2, Fab3, diabodies, triabodies, tetrabodies, and minibodies (small immune proteins). Antibody molecules and methods for their construction and use have been described

[72] .

[0144] Other examples of binding fragments include Fab', which differs from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region, and Fab'-SH, a Fab' fragment in which the cysteine ​​residues of the constant domains bear free thiol groups.

[0145] dAbs (domain antibodies) are small monomeric antigen-binding fragments of antibodies, i.e., the variable regions of the antibody heavy or light chains. VH dAbs occur naturally in camelids (camels, llamas, etc.) and can be generated by immunizing camelids with a target antigen, isolating antigen-specific B cells, and directly cloning dAb genes from individual B cells. dAbs can also be produced in cell culture. Their small size, good solubility, and temperature stability make them particularly physiologically useful and amenable to selection and affinity maturation. Camelid VH dAbs have been developed for therapeutic use under the name "Nanobodies™."

[0146] Synthetic antibody molecules can be formed by expression from genes generated by synthetically constructed oligonucleotides in suitable expression vectors, for example as described by Knappik et al.

[73] or Krebs et al.

[74] .

[0147] Bispecific or bifunctional antibodies are second-generation monoclonal antibodies in which two distinct variable regions are combined within the same molecule

[75] . Their use has been demonstrated in both diagnostic and therapeutic fields due to their ability to recruit novel effector functions or target several molecules on the surface of tumor cells. When bispecific antibodies are used, they can be traditional bispecific antibodies, which can be produced in a variety of ways

[76] , e.g., chemically or from hybrid hybridomas, or any of the bispecific antibody fragments mentioned above. These antibodies can be obtained by chemical methods [77, 78] or somatic cell methods [79, 80], but can also be preferentially obtained by genetic engineering techniques that allow forced heterodimerization and thus facilitate the purification process of the desired antibody

[81] . Examples of bispecific antibodies include those produced by BiTE™ technology, which uses the binding domains of two antibodies with different specificities and can be directly linked via a short, flexible peptide. This allows the two antibodies to be combined on a single short polypeptide chain. Diabodies and scFvs can be constructed without an Fc region, using only variable domains, potentially reducing the effects of anti-idiotypic reaction.

[0148] Bispecific antibodies can be constructed as whole IgG, as bispecific Fab'2, as Fab'PEG, as diabodies, or as bispecific scFv. Furthermore, two bispecific antibodies can be linked to form a tetravalent antibody using standard methods known in the art.

[0149] In contrast to bispecific whole antibodies, bispecific diabodies can also be particularly useful. Diabodies (and many other polypeptides, such as antibody fragments) of appropriate binding specificity can be easily selected. If one arm of the diabody remains constant, e.g., has specificity for an antigen of interest, a library can be created in which the other arm is varied and antibodies of appropriate specificity are selected. Bispecific whole antibodies can be generated by alternative engineering methods, such as those described in Ridgeway et al., 1996.

[0150] The libraries according to the invention can be used to select antibody molecules that bind to one or more antigens of interest. Selection from libraries is described in more detail below. After selection, the antibody molecules can be engineered into different formats and / or to contain additional features. For example, the selected antibody molecules can be converted into a different format, such as one of the antibody formats described above. The selected antibody molecules and antibody molecules comprising the VH and / or VL CDRs of the selected antibody molecules are aspects of the invention. The antibody molecules and the nucleic acids encoding them can be provided in isolated form.

[0151] Antibody fragments can be obtained starting from antibody molecules by methods such as digestion with enzymes, for example pepsin or papain, and / or by cleavage of disulfide bridges by chemical reduction. Alternatively, antibody fragments can be obtained by recombinant genetic techniques well known to those skilled in the art, or by peptide synthesis, for example by an automated peptide synthesizer, or by nucleic acid synthesis and expression.

[0152] It is possible to take monoclonal and other antibodies and use techniques of recombinant DNA technology to produce other antibodies or chimeric molecules that bind to target antigens. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or CDRs, of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for example, EP-A-184187, GB-A-2188638A, EP-A-239400, and many subsequent publications.

[0153] Antibody molecules can be selected from the library and then modified, for example, the in vivo half-life of the antibody molecule can be increased by chemical modification, such as PEGylation or incorporation into liposomes.

[0154] Source of binder genes The traditional route to generating monoclonal antibodies utilizes the immune system of laboratory animals such as mice or rabbits to generate pools of high affinity antibodies, which are then isolated using hybridoma technology. The libraries of the present invention provide an alternative route to identify antibodies resulting from immunization. VH and VL genes can be amplified from B cells of immunized animals, cloned into appropriate vectors for introduction into eukaryotic cell libraries, and subsequently selected from these libraries. Phage display and ribosome display allow for the generation of very large libraries (10 9This allows the construction of large numbers of clones (more than 100 clones), enabling the isolation of human antibodies without immunization. Library generation according to the present invention can also be used in conjunction with such methods. Following rounds of phage display selection, the selected population of binders can be introduced into eukaryotic cells by nuclease-mediated integration as described herein. This allows for the initial use of very large libraries based on other systems (e.g., phage display) to enrich the population of binders, while still allowing for efficient screening using eukaryotic cells as described above. Thus, the present invention can combine the best features of both phage display and eukaryotic cell display to provide a high-throughput system for quantitative screening and selection.

[0155] It has previously been demonstrated that using phage display and yeast display, it is also possible to generate binders without relying on immunization, provided a display library of sufficient size is used. 7 Multiple binders have been generated from non-immune antibody libraries of more than 100 clones

[83] . This allows for the generation of binders against targets that are difficult to achieve using traditional immunization routes, such as antibodies against "self-antigens" or epitopes that are conserved across species. For example, human / mouse cross-reactive binders can be enriched by sequential selection of human and then mouse versions of the same target. This ease is particularly important in enabling the generation of human antibodies, which are preferred for therapeutic approaches, because it is not possible to specifically immunize humans against most targets of interest.

[0156] Previous examples of mammalian display have been limited in library size and quality, and binders have only been generated using repertoires pre-enriched for binders, e.g., from immunization or engineering of existing binders. The ability to generate large libraries in eukaryotic cells, particularly higher eukaryotic cells, offers the possibility of isolating binders directly from these libraries, starting with non-immune binders or binders not previously selected in other systems. By creating libraries according to the present invention, it is possible to generate binders from non-immune sources. This opens the possibility of using binder genes from multiple sources. Binder genes can be derived by PCR from natural sources, such as antibody genes. Binder genes can also be recloned from existing libraries, such as antibody phage display libraries, and cloned into donor vectors suitable for nuclease-mediated integration into target cells. Binders can be wholly or partially synthetic in origin. Additionally, various types of binders are described elsewhere herein, for example, binder genes may encode antibodies, or alternative scaffolds [58, 59], peptides, or engineered proteins, or protein domains.

[0157] binder display Libraries constructed in accordance with the present invention can be cultured to express binders in either a soluble, secreted form or a transmembrane form. Expressed binders are said to be "displayed" when they are retained on the surface of the cells that encode them. In this context, terms such as "binder display," "surface / surface display," "on-cell display," and "display of binders" can be used interchangeably. In this context, libraries may also be referred to as displays or display libraries.

[0158] Preferably, the library in which the expressed binders are displayed will provide a repertoire of binders for screening against a target of interest.

[0159] The binder can contain or be linked to a membrane anchor, such as a transmembrane domain, for extracellular display of the binder on the cell surface. This can include direct fusion of the binder to a membrane localization signal, such as a GPI recognition sequence, or a transmembrane domain, such as the transmembrane domain of the PDGF receptor

[84] . Retention of the binder on the cell surface can also be achieved indirectly by association with another cell-surface-carried molecule expressed within the same cell. This associated molecule can itself be part of a heterodimeric binder, such as a tethered antibody heavy chain associated with a light chain partner that is not directly tethered.

[0160] While cell surface immobilization facilitates binder selection, many applications require the preparation of cell-free, secreted binders. Using a recapture method to attach secreted binders to cell surface receptors makes it possible to combine membrane-tethering and soluble secretion. One approach is to format a library of binders as secreted molecules that can associate with membrane-anchored molecules expressed in the same cells, which can function to capture the secreted binders. For example, in the case of binder molecules fused to antibodies or antibody Fc domains, the membrane-tethered Fc can "sample" secreted binder molecules expressed in the same cells, resulting in the display of a monomeric fraction of the expressed binder molecules and the secretion of the remainder in a divalent form (U.S. Patent No. 8,551,715). An alternative is to use an tethered IgG-binding domain, such as protein A.

[0161] Other methods for retaining secreted antibodies on the cells that produce them are reviewed in Kumar et al. (2012)

[85] and include encapsulation of cells in microdrops, matrix-assisted capture, affinity capture surface display (ACSD), secretion and capture technology (SECANT), and "cold capture"

[85] . In the ACSD and SECANT

[85] examples, biotinylation is used to facilitate immobilization of streptavidin or capture antibodies on the cell surface. The captured molecule then captures the secreted antibody. In the SECANT example, biotinylation of the secreted molecule occurs in vivo. Using the "cold capture" technique, secreted antibodies can be detected on the producing cells using antibodies against the secreted molecule. This has been proposed to be due to association of the secreted antibody with the cell glycocalyx

[86] . Alternatively, it has been suggested that the secreted product is captured by staining antibodies on the cell surface before it is endocytosed

[87] . The above method has been used to identify high-expressing clones within a population, but could potentially be adapted to identify binding specificities if the association is sufficiently persistent at the cell surface.

[0162] Even when binders are directly anchored to the cell surface, it is possible to produce a soluble product. For example, the gene encoding the selected binder can be recovered and cloned into an expression vector lacking a membrane-anchoring sequence. Alternatively, an expression construct can be used in which the transmembrane domain is encoded within an exon flanked by recombination sites, such as the ROX recognition site for Ore recombinase

[88] . The exon encoding the transmembrane domain can be removed by transfection with a gene encoding Dre recombinase to switch expression to a secreted form.

[0163] Using any of the methods described above or any other suitable approach, binders expressed by clones of the library can be displayed on the surface of their expressing cells.

[0164] Display of scFvs on the surface of mammalian cells fused to Fc domains While many antibody phage display libraries are formatted to display scFvs, eukaryotic display systems allow for display in Fab or IgG formats. To maximize the potential of IgG / Fab expression, particularly when using scFvs from other display systems, it is necessary to obtain selected linked VH and VL domains in a bacterial expression system and express them in a eukaryotic system fused to appropriate constant domains. Described herein are methods for converting scFv populations to immunoglobulin (Ig) or fragment antigen-binding (Fab) formats so that the original VH and VL chain pairings are maintained. The present invention allows for conversion using individual clones, oligoclonal mixes, or the entire population formatted as scFvs while maintaining the original VH and VL chain pairings. This method proceeds by generating an intermediate, non-replicating "minicircle" DNA, which results in a new "stuffer" DNA fragment. The circular DNA is linearized (e.g., by restriction digestion or PCR), changing the relative positions of the original VH and VL fragments and placing the "stuffed" DNA between them. Once linearized, the product can be cloned into a vector of choice, e.g., a mammalian expression vector. In this way, all elements except VH and VL can be replaced. Elements for bacterial expression can be replaced with elements for mammalian expression and fusion to alternative partners. The complete conversion process requires only a single E. coli transformation step to generate a population of bacterial colonies, each carrying a plasmid encoding a unique IgG- or Fab-formatted recombinant antibody. Beyond the conversion of scFv to IgG / Fab, this method can be used to reformat and clone any two linked DNA elements into a vector, such that after reformatting, each DNA element maintains its original pairing but is surrounded by different DNA regulatory mechanisms. In contrast to the present method, which proceeds via a non-replicative circular intermediate, previous methods have been described in which two sequential cloning steps are used to replace these elements

[0117] .

[0165] A method for reconstituting a binder or population of binders can include converting an scFv to an Ig or a fragment thereof, such as a Fab. This method can involve converting the nucleic acid encoding the scFv to DNA encoding an immunoglobulin (Ig) or a fragment thereof, such as a Fab format, such that the original variable VH and VL chain pairing is maintained. Preferably, this conversion proceeds via a circular DNA intermediate, which can be non-replicative "minicircle" DNA. This method requires a single transformation of Escherichia coli (E. coli) to directly generate bacterial transformants harboring a plasmid encoding the Ig or Fab DNA.

[0166] This method can be used to reformat monoclonal, oligoclonal, or polyclonal clones. It can be used to convert entire output populations "en masse" from any commonly used display technology, including phage display, yeast display, or ribosome display.

[0167] More generally, this method allows any two connected DNA elements to be reformatted into a vector in which the DNA elements are cloned under the control of separate promoters or separated by alternative control elements, but the original DNA pairing is maintained.

[0168] Following isolation and optional reconstitution of DNA encoding the binders, the DNA can be introduced into additional cells to form a derivative library as described elsewhere herein, or DNA encoding one or more specific binders of interest can be introduced into host cells for expression. The host cells can be of a different type compared to the cells from which the library was derived. Generally, the DNA is provided in a vector. The DNA introduced into the host cells can integrate into the cellular DNA of the host cells. Host cells expressing secreted soluble antibody molecules can then be selected.

[0169] Host cells encoding one or more binders can be placed in a medium and cultured to allow expression of the one or more binders.

[0170] Derivative Library Following the method for generating a library, one or more library clones can be selected and used to generate additional second-generation libraries. When a library is generated by introducing DNA into eukaryotic cells as described herein, the library can be cultured to express binders, and one or more clones expressing the binder of interest can be recovered by selecting binders against a target, for example, by a method for identifying binders against a target. These clones can then be used to generate a derivative library containing DNA encoding a second repertoire of binders, preferably using the method for generating a library.

[0171] To generate a derivative library, the donor DNA of one or more recovered clones is mutated to provide a second repertoire of binders. The mutation can be the addition, substitution, or deletion of one or more nucleotides. If the binder is a polypeptide, the mutation is the addition, substitution, or deletion of one or more amino acids to change the sequence of the encoded binder. The mutation can be focused on one or more regions, such as one or more CDRs of an antibody molecule, to provide a repertoire of binders of a common structural class that differ in one or more regions of diversity, as described elsewhere herein.

[0172] Generating a derivative library may include isolating donor DNA from one or more recovered clones, introducing mutations into the DNA to provide a derivative population of donor DNA molecules that encode the second repertoire of binders, and introducing the derivative population of donor DNA molecules into cells to form a derivative library of cells comprising DNA encoding the second repertoire of binders.

[0173] Isolating donor DNA may involve obtaining and / or identifying DNA from clones. Such methods may include amplifying binder-encoding DNA from recovered clones and introducing mutations, for example, by PCR. DNA may be sequenced and mutated DNA may be synthesized.

[0174] Alternatively, mutations can be introduced into the donor DNA of one or more recovered clones by mutagenizing DNA within the clones. Thus, a derivative library can be generated from one or more clones without the need for DNA isolation, for example, by endogenous mutation in avian DT40 cells.

[0175] Antibody display itself is particularly suited to the generation of derivative libraries. Once antibody genes are isolated, various mutagenesis approaches (e.g., error-prone PCR, oligonucleotide-directed mutagenesis, chain shuffling) can be used to generate display libraries of related clones from which improved variants can be selected. For example, DNA encoding a population, oligoclonal mix, or population of selected VH clones can be chain-shuffled and subcloned into a vector encoding the appropriate antibody format and encoding an appropriately formatted repertoire of VL chains.

[0118] Alternatively, again using the VH example, VH clones, oligoclonal mixes, or populations can be introduced into a population of eukaryotic cells that encode and express a population of appropriately formatted light chain partners (e.g., IgG- or Fab-formatted heavy chains and VL-CL chains for association). VH populations can arise from any of the sources described above, including scFv genes from B cells of immunized animals or selected phage populations. In the latter example, it is possible to combine chain shuffling and reformatting (eg, into IgG format) in one step by cloning the selected VH into a repertoire of light chains.

[0176] A particular advantage of eukaryotic cell display is the ability to control the stringency of the selection / screening step. By lowering the antigen concentration, cells expressing the highest affinity binders in the population can be distinguished from clones with lower affinities. Visualization and quantification of the affinity maturation process using flow cytometry is a major advantage of eukaryotic cell display, as it provides an early indication of the positive rate of the naive library and allows direct comparison of the affinity of selected clones to the parent population during selection. After selection, the affinity of individual clones can be determined by preincubation with various antigen concentrations and analysis by flow cytometry, by homogeneous time-resolved fluorescence (TRF) assays, or by surface plasmon resonance (SPR) (Biacore).

[0177] Screening to identify binders to a target of interest. As noted above, eukaryotic cell libraries can be used in methods of screening for binders that recognize a target. Such methods include: Providing a library by the method for making a library of the invention, or by using a locus according to the invention, or by providing a library according to the invention; culturing cells of the library to express the binders; exposing the binder to the target to allow recognition of the target by one or more cognate binders, if present; and Detecting whether the target is recognized by a cognate binder may include:

[0178] A method according to this aspect may in the context of this application be referred to as a method for identifying binders to a target, in this context also binder selection or binder screening refers to such a method.

[0179] The method for identifying binders to a target can be carried out using various target molecule classes, such as proteins, nucleic acids, carbohydrates, lipids, and small molecules. The target can be provided in a soluble form. The target can be labeled for easy detection, for example, it can carry a fluorescent label or be biotinylated. Cells expressing target-specific binders can be isolated using directly or indirectly labeled target molecules, and the binder captures the labeled molecule. For example, cells bound to fluorescently labeled targets through binder-target interaction can be detected and sorted by flow cytometry or FACS to isolate the desired cells. Selection involving cytometry requires target molecules that are directly fluorescently labeled or labeled with a molecule that can be detected with a secondary reagent; for example, biotinylated targets can be added to cells, and binding to the cell surface can be detected with fluorescently labeled streptavidin, such as streptavidin-phycoerythrin. A further possibility is to immobilize the target molecule or a secondary reagent that binds to the target on a solid surface, such as magnetic or agarose beads, to allow enrichment of cells that bind to the target. For example, cells that bind to a biotinylated target via binder-target interaction can be isolated on a streptavidin-coated substrate, such as streptavidin-coated beads.

[0180] For libraries used in methods for identifying binders to a target, oversampling, i.e., screening more clones than the number of independent clones present in the library, is preferred to ensure effective representation of the library. Identifying binders from the very large libraries provided by the present invention can be performed by flow sorting, but this would take several days, especially if the library is oversampled. Alternatively, initial selection can be based on the use of recoverable antigens, such as biotinylated antigens that are recovered on streptavidin-coated magnetic beads. Thus, streptavidin-coated magnetic beads can be used to capture cells bound to the biotinylated antigen. Magnetic bead selection can be used as the sole selection method, or it can be performed in conjunction with flow cytometry, which can achieve excellent resolution, for example, distinguishing between clones with high expression levels and clones with high affinity [56, 57].

[0181] The in vitro nature of display technology approaches allows for controlled selection in ways not possible with immunization, for example, selection of specific conformational states of the target [90, 91]. Targets can be tagged by chemical modification (fluorescein, biotin) or genetic fusion (e.g., epitope tags such as FLAG tags, or proteins fused to another protein domain or entire protein). Tags can be nucleic acids (e.g., DNA, RNA, or nonbiological nucleic acids); the tag can be a moiety fused to the target nucleic acid or chemically bound to another type of molecule, such as a protein. This can be by chemical conjugation or enzymatic attachment

[92] . Nucleic acids can also be fused to targets by translational processes, such as ribosome display. The "tag" can be another modification that occurs in cells (e.g., glycosylation, phosphorylation, ubiquitination, alkylation, PASylation, SUMOylation, and other modifications listed in the Post-Translational Protein Database (db-PTM) at http: / / dbptm.mbc.nctu.edu.tw / statistics.php) and can be detected by a secondary reagent, thereby providing binders that bind to unknown target proteins based on the specific modification.

[0182] Targets can be detected using existing binders that bind to the target molecule, such as target-specific antibodies. Using existing binders for detection has the added benefit of identifying binders within a library of binders that recognize a different epitope than the binder used for detection. In this way, binder pairs could be identified for use in applications such as sandwich ELISA. Purified target molecules would be preferred, if possible. Alternatively, the target can be displayed on the surface of a population of target cells, with binders displayed on the surface of library cells, which involves exposing the binders to the target by contacting the library cells with the target cells. Recovery of cells expressing the target (e.g., using biotinylated cells expressing the target) allows for enrichment of cells expressing binders to them. This approach is useful when low-affinity interactions are involved due to the potential for strong avidity effects.

[0183] The target molecule can also be an unpurified recombinant or unpurified native target, provided that the detected molecule is available for identification of cellular binding (as described above). Additionally, binding of a target molecule to cells expressing a binder can be detected indirectly by the association of the target molecule with another molecule being detected; for example, a cell lysate containing a tagged molecule can be incubated with a library of binders to identify not only binders to the tagged molecule but also binders to its associated partner protein. This results in a panel of antibodies against these partners that can be used for partner detection or identification (e.g., using mass spectrometry). Cell sorting can be used to enrich for targets from specific subcellular locations. Alternatively, differential biotinylation of surface or cytoplasmic fractions can be used with streptavidin detection reagents for eukaryotic cell display [93, 94]. The use of detergent-solubilized target preparations is a particularly useful approach for intact membrane proteins, such as GPCRs and ion channels, which are otherwise difficult to prepare. The presence of detergents can have deleterious effects on eukaryotic cells displaying binders, necessitating recovery of the binder genes without additional propagation of the selected cells.

[0184] Following detection of target recognition by the cognate binder, the cells of the clone containing DNA encoding the cognate binder can be recovered, and the DNA encoding the binder can then be isolated (e.g., identified or amplified) from the recovered clone, thereby obtaining the DNA encoding the binder that recognizes the target.

[0185] Exemplary binders and targets are detailed elsewhere herein. A typical example is a library of antibody molecules, which can be screened for binding to a target antigen of interest. Other examples include screening a library of TCRs against target MHC:peptide complexes or screening a library of MHC:peptide complexes against target TCRs.

[0186] TCR:MHC and other receptor interactions As explained above, in the method for identifying binders to a target, the binder and target can be TCR and MHC:peptide complexes, respectively, or vice versa. Thus, the display library can be a library of TCRs on the surface of yeast cells and mammalian cells. Such libraries can be used to select TCRs with altered recognition properties. Alternatively, the display library can be a library of peptide or MHC variants for recognition by TCRs.

[0187] T cell receptors (TCRs) are expressed on T cells and have evolved to recognize peptides presented in complexes with MHC molecules on antigen-presenting cells. TCRs are heterodimers consisting of 95% α and β heterodimers and 5% γ and δ heterodimers. Both monomeric units possess an N-terminal immunoglobulin domain with three variable complementarity-determining regions (CDRs) that are involved in promoting target interaction. Functional TCRs exist within complexes with other subunits, and signaling is enhanced by costimulation with CD4 and CD8 molecules (specific for class I and class II MHC molecules, respectively). In antigen-presenting cells, proteins are processed and presented on the cell surface in complexes with MHC molecules, which are themselves part of multimeric protein complexes. TCRs that recognize "self" peptides are eliminated during development, leaving the system primed to recognize foreign peptides presented on antigen-presenting cells and trigger an immune response. The outcome of peptide:MHC complex recognition depends on the identity of the T cell and the affinity of the interaction.

[0188] For example, it would be useful to identify genes encoding TCRs or MHC:peptide complexes that promote interactions involved in pathological conditions occurring in autoimmune diseases. For example, in retargeting T cells for cancer or enhancing the effectiveness of existing T cells, it would be desirable to engineer TCRs to alter binding, e.g., increase affinity for the target of interest.

[95] Alternatively, the behavior of regulatory or suppressor T cells could be modified therapeutically to direct or enhance cancer immunotherapy, for example, by introducing specific TCRs into T cells or using expressed TCR proteins as therapeutic entities.

[96]

[0189] The display of libraries of TCRs on the surface of yeast and mammalian cells has previously been demonstrated. In yeast cells, it was necessary to engineer the TCR and present it in a single-chain format. Because the affinity of the interaction between the TCR and peptide:MHC complex is low, the soluble component (e.g., peptide:MHC in this case) is typically displayed in a multimeric format. TCR specificities have been engineered for peptides in complex with MHC class I

[97] and MHC class II

[98] . TCRs have also been expressed on the surface of mutant mouse T cells (lacking TCR α and β chains), and mutant TCRs with improved binding properties have been isolated

[99] . For example, Chervin et al. introduced TCRs by retroviral infection and generated an effective library size of 10 clones

[0100] . Using nuclease-mediated incorporation of binders as proposed here, a similar approach can be used to engineer T cells. Display libraries can be used to screen libraries of peptide or MHC variants for recognition by TCRs, as well as to select TCRs with altered recognition properties. For example, peptide:MHC complexes have been used for epitope mapping of TCRs displayed on insect cells and presented in a multimeric format

[0101] .

[0190] As described above, screening methods can involve probing a repertoire of cell surface binders with targets presented as soluble molecules, which may be multimeric targets. An alternative that may be particularly useful for multimeric targets is to directly screen for cell-cell interactions in which the binder and target are presented on the surface of different cells. For example, if activation of a TCR of interest results in expression of a reporter gene, this can be used to identify activating peptides or activating MHC molecules presented in a peptide:MHC library. In this particular example, the reporter cells do not encode library members but can be used to identify cells that encode library members. This approach can potentially be extended to a "library-versus-library" approach. For example, extending the above example, a TCR library can be screened against a peptide:MHC library. More broadly, the example of screening a library of binders displayed on the surface of one cell with a binding partner on another cell can be extended to identify binders that inhibit or activate other types of cell-cell interactions, such as those in the Notch or Wnt pathways. Thus, the present invention can be used in alternative cell-based screening systems, including recognition systems based on cell-cell interactions.

[0191] As an example, chimeric antigen receptors (CARS) represent a fusion between an antibody-binding domain (usually formatted as an scFv) and a signaling domain. These have been introduced into T cells with the goal of redirecting T cells in vivo to attack tumor cells through antibody recognition and binding to tumor-specific antigens. Several different factors can influence the success of this strategy, including the antibody specificity, format, antibody affinity, linker length, fusion signaling module, expression level in T cells, T cell subtype, and the combination of CAR interactions with other signaling molecules [102, 103]. The ability to generate large libraries of CARs from primary T cells incorporating the above variables individually or in combination will enable a functional search for effective and optimal CAR constructs. This functional "search" can be carried out in vitro or in vivo. For example, Alonso-Camino (2009) fused an scFv recognizing CEA to a chain of the TCR:CD3 complex and introduced this genetic construct into a human Jurkat cell line

[0104] . Upon interaction with CEA present on either HeLa cells or tumor cells, they showed upregulation of the early T cell activation marker CD69. This approach can be used to identify CAR fusion constructs with appropriate activating or inhibitory properties using cultured or primary cells.

[0192] Further functionality of the CAR construct can be evaluated in vivo. For example, a library of CARs constructed in primary mouse T cells can be introduced into tumor-bearing mice to identify T cell clones stimulated to proliferate by contact with the tumor. Optionally, this T cell library can be pre-selected based on antigen-binding specificity using the methods described above. In either case, the new library of binders can be used to replace existing binder molecules (e.g., MHC or TCR or antibody variable domains).

[0193] Phenotypic screening In a preferred method of identifying a binder to a target, the binder successfully alters cell signaling and / or cell behavior as a result of the action of the binder on the target. In a more preferred method, the binder is an antibody.

[0194] Antibodies that alter cell signaling by binding to ligands or receptors have a proven track record in pharmaceutical development, and the demand for such therapeutic antibodies continues to grow. Such antibodies and other classes of functional binders also have the potential to control cell behavior in vivo and in vitro. However, the ability to control and guide cell behavior depends on the availability of natural ligands that regulate specific signaling pathways. Unfortunately, many natural ligands, such as those that regulate stem cell differentiation (e.g., FGF, TGF-β, Wnt, and members of the Notch superfamily), often exhibit promiscuous interactions and have poor expression / stability profiles, limiting their availability. Given their specificity, antibodies offer great potential for controlling cell behavior.

[0195] Identifying functional antibodies that alter cell signaling has traditionally been relatively time-consuming and labor-intensive, involving clone selection, antibody expression, characterization by sequence and binding properties, conversion to a mammalian expression system, and addition to functional cell-based assays. The eukaryotic cell display approach described herein reduces this labor, but still requires antibody generation and addition to a separate reporter cell culture. Therefore, a preferred alternative may be to directly screen a library of eukaryotic cell-expressed binders for the effects of binding on cell signaling or cell behavior by using the production cells themselves as reporter cells. After introduction of the antibody gene, clones within the resulting cell population that exhibit altered reporter gene expression or altered phenotype can be identified.

[0196] Several recent publications describe the construction of antibody libraries by cloning repertoires of antibody genes into reporter cells [47, 105, 106]. These systems combine expression and reporting in a single cell, typically introducing a population of antibodies selected against a given target (e.g., using phage display).

[0197] A population of antibody genes can be introduced into reporter cells to generate a library using the methods described herein, and clones within the population with antibody-induced changes in phenotype (e.g., changes in gene expression or survival) can be identified. For this phenotype-guided selection to work, a link must be maintained between the antibody genes present in the expressing cells (genotype) and the outcome of antibody expression (phenotype). This has previously been achieved by tethering antibodies to the cell surface, as described for antibody display

[47] , or by using semi-solid media to maintain secreted antibodies in proximity to the producing cells.

[0105] Alternatively, antibodies and other binders can be retained intracellularly.

[0107] Binders retained on the cell surface or in the surrounding media can interact with endogenous or exogenous receptors on the cell surface, causing receptor activation. This can lead to changes in reporter gene expression or changes in cellular phenotype. Alternatively, antibodies can block receptors or ligands, reducing receptor activation. Genes encoding binders that alter cellular behavior can then be recovered for production or further engineering.

[0198] As an alternative to this "targeted" approach, it is possible to introduce a "naive" antibody population that has not been preselected against a specific target.

[0108] Cellular reporting systems are used to identify members of the population with altered behavior. Because there is no prior knowledge of the target, this non-targeted approach pre-enrichs the antibody population against the target, making a large antibody repertoire particularly necessary. This approach would benefit from the use of nuclease-mediated transgene integration as described in this invention.

[0199] The "functional selection" approach can be used for other applications requiring libraries of eukaryotic cells, particularly higher eukaryotic cells such as mammalian cells. Antibodies can be fused to signaling domains such that binding to the target triggers receptor activation. Kawahara et al. constructed chimeric receptors in which an extracellular scFv targeting fluorescein was fused to a spacer domain (the D2 domain of the Epo receptor) and various intracellular cytokine receptor domains, including the thrombopoietin (Tpo) receptor, erythropoietin (Epo) receptor, gp130, IL-2 receptor, and EGF receptor [109, 110, 111]. These were then introduced into an IL-3-dependent proB cell line (BaF3)

[27] , where the chimeric receptors were shown to exhibit antigen-dependent activation, leading to IL-3-independent proliferation. This same approach was used in model experiments to demonstrate antigen-mediated chemoattraction of BaF3 cells

[0110] . This approach has been extended beyond stable cell cultures to primary cells, as exemplified by the survival and proliferation of Tpo-responsive hematopoietic stem cells or IL2-dependent primary T cells, where normal stimulation with Tpo and IL-2 was replaced by fluorescein stimulation of the scFv chimeric receptor, respectively. Thus, a chimeric antibody-receptor chimera-based system can be used to promote target-dependent gene expression or phenotypic changes in primary cells or stable reporter cells. This capability can be used to identify fusion binders that promote signaling responses or binders that inhibit these responses.

[0200] In a modification of the above approach, separate VH and VL domains from an anti-lysozyme antibody were fused to the Epo intracellular domain.

[0113] Cells proliferated in response to the addition of lysozyme, demonstrating antigen-induced dimerization or stabilization of the separate VH and VL fusion partners. Thus, three interacting elements come together for optimal response in this system.

[0201] Although described herein with reference to antibody molecules, the above methods for identifying binders (i.e., antibody molecules) to a target can also be adapted and performed with libraries of other types of binders.

[0202] Protein fragment complementation represents an alternative system for studying and selecting protein-protein interactions in mammalian cells [114, 115]. This involves restoring the function of a split reporter protein through a protein-protein interaction. Reporter proteins that have been used include ubiquitin, DNAE intein, β-galactosidase, dihydrofolate reductase, GFP, firefly luciferase, β-lactamase, and TEV protease. For example, a recent example of this approach is the mammalian membrane two-hybrid (MaMTH) approach, in which the association of a bait protein, split ubiquitin, and a transcription factor fused to a partner protein, split ubiquitin, restores ubiquitin recognition, liberates the transcription factor, and triggers reporter gene expression

[0116] . Again, binders that disrupt or enhance this interaction can be identified by perturbing signaling.

[0203] Recovery and reformatting of binder and coding DNA After a binder has been identified by a method for identifying binders to a target, a typical next step is to isolate (e.g., identify or amplify) the DNA encoding the binder. Optionally, it may be desirable to modify the nucleic acid encoding the binder, for example, to reconstitute the binder and / or insert the coding sequence into a different vector. Thus, a preferred method for identifying a binder to a target involves isolating DNA encoding a binder that recognizes the target. More preferred methods are described below.

[0204] When the binder is an antibody molecule, a preferred method for identifying binders to a target comprises isolating DNA encoding the antibody molecule from clonal cells, amplifying the DNA encoding at least one antibody variable region, preferably both the VH and VL domains, and inserting the DNA into a vector to provide a vector encoding the antibody molecule. Multimeric antibody molecules having constant domains can be converted to single-chain antibody molecules for expression in a soluble, secreted form.

[0205] Antibodies can be displayed in a variety of formats, but whatever the format of the antibody chosen, once the antibody genes are isolated they can be rearranged into several different formats. Once the VH or VL domains are isolated, they can be recloned into expression vectors containing the desired partner domains.

[0206] A more preferred method of identifying binders to a target involves a reformatting step that involves reformatting binders consisting of a pair of subunits (e.g., scFv molecules) into a different molecular binder format (e.g., Ig or Fab) in which the original pairing of subunits is maintained. Such methods are described in more detail elsewhere herein and can be used to reformat monoclonal, oligoclonal, or polyclonal clones. This method can be used to convert entire output populations "en masse" from any commonly used display technology, including phage, yeast, or ribosome display.

[0207] Additional embodiments of the present invention are described in the following numbered paragraphs, which form a part of the description. 1. A method for identifying a locus in the genome of a eukaryotic cell, said locus being a candidate for insertion of a binder sequence, said method comprising: a. providing a landing pad array; b. introducing the landing pad sequence into a eukaryotic cell; c. randomly integrating the landing pad sequence into the genome of a eukaryotic cell by transposon-mediated integration; d. Selecting clones that have the landing pad sequence integrated into their genome A method comprising: 2.e. A further step of screening for single copy integration; f. Further steps to identify the locus 2. The method of claim 1, further comprising: 3.g. The additional step of incorporating donor DNA sequences containing one or more transgenes encoding binders into the landing pad sequence; h. Additional Step of Screening for Integration of Donor DNA 3. The method of claim 2, further comprising: 4. The method according to any one of items 1 to 3, wherein the landing pad sequence comprises a recognition sequence for a site-specific nuclease. 5. The method of claim 4, wherein the nuclease recognition sequence is a meganuclease recognition sequence, a zinc finger nuclease recognition sequence, a TALE nuclease recognition sequence or a nucleic acid-guided nuclease recognition sequence, more preferably a meganuclease recognition sequence. 6. The method of paragraph 5, wherein the nuclease recognition sequence is an I-SceI meganuclease recognition sequence. 7. The method of any one of paragraphs 4 to 6, wherein step g of integrating the donor DNA into the cell comprises providing a site-specific nuclease into the cell, wherein the nuclease cleaves a recognition sequence contained in the landing pad. 8. The method of any one of paragraphs 3 to 7, wherein step h of screening for integration of donor DNA comprises screening for display of one or more binders encoded by the donor DNA. 9. The method of any one of items 3 to 8, wherein the donor DNA further comprises homology arms to increase integration efficiency. 10. The method of any one of paragraphs 1 to 9, wherein the landing pad sequence and / or the donor DNA sequence comprises a selectable marker. 11. Use of a locus identified by the method of any one of paragraphs 1 to 10 to construct a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders. 12. At least 10 3 pieces, 10 4 pieces, 10 5 pieces, 10 6 pieces, 10 7 pieces, 10 8 Pieces or 10 911. An in vitro library of eukaryotic cell clones expressing a diverse repertoire of different binders, each cell comprising recombinant DNA, wherein donor DNA encoding the binder or a subunit of the binder is integrated into a fixed locus in the cellular DNA, the locus being identified by the method of any one of paragraphs 1 to 10. 13. The in vitro library of eukaryotic cell clones according to paragraph 12, wherein donor DNA encoding a binder or a subunit of a binder is integrated into at least a first and / or a second anchoring locus in the cellular DNA, and the one or more anchoring loci are identified by the method according to any one of paragraphs 1 to 10. 14. The in vitro library of eukaryotic cell clones of paragraph 12 or 13, wherein the one or more loci are within a gene selected from the group consisting of the NLN gene, the TNIK gene, the PARP11 gene, the RAB40B gene, the ABI2 gene, the RNF19B gene, the PKIA gene, or the FTCD gene. 15. An in vitro library of eukaryotic cell clones according to any one of paragraphs 12 to 14, wherein the one or more loci are within the NLN gene, the TNIK gene or the RAB40B gene, preferably within the NLN gene. 16. An in vitro library of eukaryotic cell clones according to any one of paragraphs 12 to 15, wherein one or more loci are within an intron of a gene. 17. An in vitro library of eukaryotic cell clones according to any one of paragraphs 12 to 16, wherein one or more loci are within intronic open chromatin regions. 18. An in vitro library of eukaryotic cell clones according to any one of paragraphs 12 to 17, wherein one or more loci are within an enhancer region of an intron. 19. An in vitro library of eukaryotic cell clones according to any one of paragraphs 12 to 18, wherein one or more loci are within intron 1, 2 or 6 of NLN-207 of the NLN gene. 20. A binder identified from the library according to any one of paragraphs 12 to 19. 21. A method for generating a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders, comprising: providing a donor DNA molecule encoding a binder and a eukaryotic cell; introducing donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in the cellular DNA, the recognition sequence being within the NLN gene, TNIK gene, PARP11 gene, RAB40B gene, ABI2 gene, RNF19B gene, PKIA gene, or FTCD gene, to create an integration site at which the donor DNA will integrate into the cellular DNA, wherein integration occurs through DNA repair mechanisms endogenous to the cell, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA; and culturing and cloning the recombinant cells, thereby providing a library of eukaryotic cell clones containing donor DNA encoding a repertoire of binders. A method comprising: 22. The method of claim 21, wherein the recognition sequence is within the NLN gene, the TNIK gene, or the RAB40B gene. 23. The method of paragraph 21 or 22, wherein the recognition sequence is within the NLN gene. 24. The method of any one of paragraphs 21 to 23, wherein the recognition sequence is within an intron of the gene. 25. The method of paragraph 24, wherein the recognition sequence is within an open chromatin region of an intron. 26. The method of paragraph 24 or 25, wherein the recognition sequence is within an enhancer region of an intron. 27. The method of any one of paragraphs 24 to 26, wherein the recognition sequence is within intron 1, 2 or 6 of NLN-207 of the NLN gene. 28. The method of any one of paragraphs 21 to 27, wherein the binder is an antibody molecule. 29. The method of paragraph 28, wherein the antibody molecule is a full-length immunoglobulin, IgG, Fab, scFv-Fc or scFv. 30. The method of any one of paragraphs 21 to 29, wherein the binder is multimeric and comprises at least a first and a second subunit. 31. A method for producing a library of eukaryotic clones containing DNA encoding a diverse repertoire of multimeric binders, each binder comprising a first and a second subunit, the method comprising: providing a eukaryotic cell containing DNA encoding a first subunit, and providing a donor DNA molecule encoding a second binder subunit; introducing donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in the cellular DNA as defined in any one of paragraphs 12 to 18 to create an integration site at which the donor DNA becomes integrated into the cellular DNA, wherein integration occurs through the cell's endogenous DNA repair mechanisms, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA; and Culturing the recombinant cells to produce clones containing DNA encoding the first and second subunits of the multimeric binder. A method comprising: 32. A method for producing a library of eukaryotic clones containing DNA encoding a diverse repertoire of multimeric binders, each binder comprising at least a first and a second subunit, the method comprising: providing a first donor DNA molecule encoding a first subunit and providing a eukaryotic cell; introducing a first donor DNA into the cells and providing a site-specific nuclease within the cells, wherein the nuclease cleaves a recognition sequence in the cellular DNA as defined in any one of paragraphs 12 to 18 to create an integration site at which the donor DNA will be integrated into the cellular DNA, wherein integration occurs through the cell's endogenous DNA repair machinery, thereby creating a first set of recombinant cells comprising the first donor DNA integrated into the cellular DNA; culturing the first set of recombinant cells to produce a first set of clones comprising DNA encoding the first subunit; introducing a second donor DNA molecule encoding a second subunit into cells of the first set of clones, wherein the second donor DNA is integrated into the cellular DNA of the first set of clones, thereby creating a second set of recombinant cells comprising the first and second donor DNA integrated into the cellular DNA; and Culturing the second set of recombinant cells to produce a second set of clones, the clones comprising DNA encoding the first and second subunits of the multimeric binder, thereby providing a library of eukaryotic cell clones comprising donor DNA encoding a repertoire of multimeric binders. A method comprising: 33. The method of paragraph 32, wherein the second donor DNA molecule is integrated by a method comprising providing a site-specific nuclease in the cell, the nuclease cleaving a recognition sequence in the cellular DNA to create an integration site at which the donor DNA becomes integrated into the cellular DNA, and the integration occurs through the cell's endogenous DNA repair mechanisms. 34. The method of any one of paragraphs 21 to 33, wherein the binder repertoire is a plurality of polypeptides sharing a common structure, and these polypeptides have one or more regions of amino acid sequence diversity. 35. The method of any one of paragraphs 21 to 34, wherein the repertoire of binders is a repertoire of antibody molecules that differ in one or more complementarity determining regions. 36. The method of any one of clauses 29 to 35, wherein the multimeric binder is an antibody molecule comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain as separate subunits. 37. The method of paragraph 36, wherein the multimeric binder is a whole immunoglobulin. 38. The method of paragraph 36, wherein the multimeric binder is IgG. 39. The method of paragraph 36, wherein the multimeric binder is a Fab. 40. The method of any one of clauses 36 to 39, wherein the first subunit comprises a VH domain and the second subunit comprises a VL domain. 41. The method of any one of clauses 36 to 39, wherein the first subunit comprises a VL domain and the second subunit comprises a VH domain. 42. The method of any one of paragraphs 36 to 41, wherein the antibody molecule further comprises one or more additional subunits, which may be introduced into the same donor DNA as the first or second subunit or may be integrated into separate sites within the cellular DNA. 43. There are 2 x 10 cells 7 43. The method according to any one of items 21 to 42, wherein the cell is a higher eukaryotic cell having a genome size of more than 100 base pairs. 44. The method of any one of paragraphs 21 to 43, wherein the cell is a mammalian cell, an avian cell, an insect cell, or a plant cell. 45. The method of paragraph 44, wherein the cell is mammalian, preferably the cell is a human cell. 46. ​​The method of paragraph 45, wherein the cell is a HEK293 cell, a Chinese hamster ovary (CHO) cell, a T-lymphoid cell or a B-lymphoid cell, or any one of the cell lines listed in the Cancer Cell Line Encyclopedia or the COSMIC catalogue of somatic mutations in cancer. 47. The method of paragraph 46, wherein the cell is a primary T cell or a T cell line. 48. The method of paragraph 46, wherein the cell is a primary B cell, a B cell line, a pre-B cell line, or a pro-B cell line. 49. The method of paragraph 48, wherein the cells are mouse pre-B cell line 1624-5, IL-3-dependent pro-B cell line Ba / F3, or chicken DT40 B cells. 50. The method of any one of paragraphs 21 to 49, wherein the recognition sequence for the site-specific nuclease occurs only once or twice in the cellular DNA. 51. The method of any one of paragraphs 21 to 50, wherein the site-specific nuclease cleaves the cellular DNA to create a double-stranded break that serves as the integration site. 52. The method of any one of paragraphs 21 to 51, wherein the nuclease is a meganuclease. 53. The method of any one of paragraphs 21 to 51, wherein the nuclease is a zinc finger nuclease (ZFN). 54. The method of any one of paragraphs 21 to 51, wherein the nuclease is a TALE nuclease. 55. The method of any one of paragraphs 21 to 51, wherein the nuclease is a nucleic acid-guided nuclease. 56. The method of paragraph 55, wherein the DNA cleavage is induced by a CRISPR / Cas system. 57. The method of any one of paragraphs 21 to 56, wherein the donor DNA is integrated into the cellular DNA by homologous recombination. 58. The method of any one of paragraphs 21 to 56, wherein the donor DNA is integrated into the genomic DNA by non-homologous end joining or microhomology-mediated end joining. 59. The method of any one of paragraphs 21 to 58, wherein the donor DNA contains genetic elements for selection of cells into which the donor DNA is integrated. 60. A method according to any one of paragraphs 21 to 59, wherein integration of the donor DNA into the cellular DNA places expression of the binder and / or expression of the genetic selection element under the control of a promoter present within the cellular DNA. 61. The method of any one of paragraphs 21 to 58, wherein the donor DNA comprises a sequence encoding the binder operably linked to a promoter. 62. The library must contain at least 100 3 pieces, 10 4 pieces, 10 5 Pieces or 10 6 62. The method of any one of paragraphs 21 to 61, comprising clones, each clone derived from an individual recombinant cell generated by integration of donor DNA. 63. The library must contain at least 100 3 pieces, 10 4 pieces, 10 5 Pieces or 10 6 63. The method of any one of clauses 21 to 62, wherein each of the nucleic acid sequences encodes a different binder. 64. The method of any one of clauses 21 to 63, wherein each clone contains integrated donor DNA that encodes only one or two members of the binder repertoire. 65. The method of any one of paragraphs 21 to 64, wherein the eukaryotic cell is diploid and contains a recognition sequence for a site-specific nuclease at a double-fixed locus in the cellular DNA. 66. The method of any one of paragraphs 21 to 63, wherein each clone contains integrated donor DNA encoding a single member of the repertoire of binders. 67. The method of any one of paragraphs 21 to 66, wherein the donor DNA molecules each encode a single binder or binder subunit. 68. The method of any one of paragraphs 21 to 67, wherein the binder is displayed on the cell surface. 69. The method of any one of paragraphs 21 to 68, wherein the binder is secreted from the cell. 70. Culturing the library to express binders; recovering one or more clones expressing the binder of interest; and generating a derivative library from one or more recovered clones, the derivative library comprising DNA encoding a second repertoire of binders; Item 70. The method of any one of items 21 to 69, further comprising: 71. The method of paragraph 70, wherein the step of generating a derivative library comprises isolating donor DNA from one or more recovered clones, introducing mutations into the DNA to provide a derivative population of donor DNA molecules that encode a second repertoire of binders, and introducing the derivative population of donor DNA molecules into cells to form a derivative library of cells comprising DNA encoding the second repertoire of binders. 72. The method of claim 70, wherein the step of generating a derivative library comprises introducing mutations into the donor DNA of one or more recovered clones by inducing DNA mutations within the clones. 73. A method for producing a diverse repertoire of binders, comprising the steps of producing a library by the method of any one of paragraphs 21 to 72, and culturing library cells to express the binders. 74. A library produced by the method of any one of paragraphs 21 to 72. 75. A method of screening for cells of a desired phenotype, the phenotype resulting from expression of a binder by the cells, the method comprising: providing a library by the method for producing a library according to any one of paragraphs 21 to 72, or by the use according to paragraph 11, or by providing a library according to any one of paragraphs 12 to 19 or 74; Culturing the library cells to express the binders; and Detecting whether the desired phenotype is exhibited A method comprising: 76. The method of paragraph 75, wherein the phenotype is expression of a reporter gene in cells expressing the binder. 77. The method of paragraph 75 or 76, further comprising recovering cells of clones expressing binders that produce the desired phenotype. 78. The method of paragraph 77, further comprising the step of isolating DNA encoding the binder from the recovered clones, thereby obtaining DNA encoding a binder that produces the desired phenotype. 79. A screening method for identifying binders to a target of interest, comprising: providing a library by the method for producing a library according to any one of paragraphs 21 to 72, or by the use according to paragraph 11, or by providing a library according to any one of paragraphs 12 to 19 or 74; culturing cells of the library to express the binders; exposing the binder to the target to allow recognition of the target by one or more cognate binders, if present; and Detecting whether the target is recognized by a cognate binder A method comprising: 80. The method of paragraph 75 or paragraph 79, wherein the target is provided in a soluble form. 81. The method of paragraph 75 or paragraph 79, wherein the target is displayed on the surface of a population of target cells and the binder is displayed on the surface of library cells, the method comprising exposing the binder to the target by contacting the library cells with the target cells. 82. The method of any one of clauses 75 to 81, wherein the binder is an antibody molecule and the target is an antigen. 83. The method of any one of clauses 75 to 81, wherein the binder is a TCR and the target is an MHC:peptide complex. 84. The method of any one of paragraphs 79 to 83, further comprising the steps of detecting target recognition by a cognate binder and recovering clonal cells containing DNA encoding the cognate binder. 85. The method of paragraph 84, further comprising the step of isolating DNA encoding a binder from the recovered clones, thereby obtaining DNA encoding a binder that recognizes the target. 86. A method according to paragraph 78 or paragraph 85, comprising the step of introducing a mutation or converting the DNA to modified DNA that encodes the reconstituted binder. 87. The method of paragraph 86, wherein the binder is an scFv and the method comprises converting DNA encoding the scFv into DNA encoding an Ig or a fragment thereof while maintaining the original variable VH and VL chain pairing. 88. The method of paragraph 78, paragraph 85, paragraph 86 or paragraph 87, further comprising the step of introducing the DNA into a host cell.

[0208] General information Unless otherwise defined, all technical and scientific terms used herein have the same meaning as customarily and commonly understood by one of ordinary skill in the art to which this invention belongs and are read in light of the present disclosure.

[0209] Sequence identity It is to be understood that each nucleic acid molecule, or protein fragment, or polypeptide, or peptide, or derived peptide, or construct identified herein by a given sequence identification number (SEQ ID NO:) is not limited to the particular sequence disclosed. Each coding sequence identified herein encodes a given protein fragment, or polypeptide, or peptide, or derived peptide, or construct, or is itself a protein fragment, or polypeptide, or construct, or peptide, or derived peptide.

[0210] Throughout this application, whenever a reference is made to the SEQ ID NO of a particular nucleotide sequence encoding a given protein fragment, or polypeptide, or peptide, or derived peptide (take SEQ ID NO:X as an example), it can be replaced with the following: i. a nucleotide sequence comprising a nucleotide sequence having at least 60% sequence identity to SEQ ID NO: X; ii. a nucleotide sequence whose sequence differs from the sequence of the nucleic acid molecule in (i) due to the degeneracy of the genetic code; or iii. A nucleotide sequence encoding an amino acid sequence having at least 60% amino acid identity or similarity to the amino acid sequence encoded by nucleotide sequence SEQ ID NO:X.

[0211] Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

[0212] Throughout this application, whenever a particular amino acid sequence SEQ ID NO (take SEQ ID NO: Y as an example), is mentioned, it can be replaced with a polypeptide represented by an amino acid sequence that includes a sequence having at least 60% sequence identity or similarity to amino acid sequence SEQ ID NO: Y. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

[0213] Each nucleotide sequence or amino acid sequence described herein by its percentage of identity or similarity to a given nucleotide sequence or amino acid sequence, in further preferred embodiments, has a similarity or identity to the given nucleotide sequence or amino acid sequence, respectively, of at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 120%, at least 121%, at least 122%, at least 123%, at least 124%, at least 125%, at least 126%, at least 127%, at least 128%, at least 129%, at least 130%, 4%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity or similarity.

[0214] Each non-coding (i.e., promoter or other regulatory region) nucleotide sequence can be replaced by a nucleotide sequence containing a nucleotide sequence having at least 60% sequence identity or similarity with the SEQ ID NO of the specific nucleotide sequence (e.g., SEQ ID NO: A). Preferred nucleotide sequences have at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:A. In preferred embodiments, such non-coding nucleotide sequences, such as promoters, exhibit or exert at least an activity of such non-coding nucleotide sequences, such as the activity of a promoter, that is known to those skilled in the art.

[0215] Terms such as "homology" and "sequence identity" are used interchangeably herein. Sequence identity is described herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred embodiment, sequence identity is calculated based on the entire length of two given SEQ ID NOs, or a portion thereof. A portion preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NOs. In the art, "identity" also refers to the degree of sequence relatedness between amino acid sequences or nucleic acid sequences, as the case may be, as determined by string-to-string matches of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutes with the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in Bioinformatics and the Cell: Modern Computational Approaches in Genomics, Proteomics and Transcriptomics, Xia X., Springer International Publishing, New York, 2018; and Bioinformatics: Sequence and Genome Analysis, Mount D., Cold Spring Harbor Laboratory Press, New York, 2004, each of which is incorporated herein by reference.

[0216] "Sequence identity" and "sequence similarity" can be determined by aligning two peptide sequences or two nucleotide sequences using a global or local alignment algorithm, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman-Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith-Waterman). As a result, sequences can be said to be "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity (described below) when optimally aligned (e.g., by the programs EMBOSS needle or EMBOSS water using default parameters).

[0217] If two sequences have similar lengths, global alignment is appropriately used to determine sequence identity. If the overall lengths of the sequences are substantially different, local alignment, such as alignment using the Smith-Waterman algorithm, is preferred. EMBOSS needle uses the Needleman-Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. EMBOSS water uses the Smith-Waterman local alignment algorithm. Generally, the default parameters for EMBOSS needle and EMBOSS water are: gap opening penalty = 10 (nucleotide sequence) / 10 (protein) and gap extension penalty = 0.5 (nucleotide sequence) / 0.5 (protein). For nucleotide sequences, the default scoring matrix used is DNAfull, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919, incorporated herein by reference).

[0218] Alternatively, percentage similarity or identity can be determined by searching public databases using algorithms such as FASTA and BLAST. Thus, the nucleic acid and protein sequences of some embodiments of the present invention can further be used as "query sequences" to conduct searches in public databases, e.g., to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10, incorporated herein by reference. BLAST nucleotide searches can be performed using the NBLAST program with a score of 100 and a word length of 12 to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecules of the present invention. BLAST protein searches can be performed using the BLASTx program with a score of 50 and a word length of 3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402, incorporated herein by reference. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information, accessible on the World Wide Web at www.ncbi.nlm.nih.gov / .

[0219] In this specification and the claims, the verb "comprise" and its conjugations are used in their open-ended sense, meaning that the items that follow the word are included and that items not specifically mentioned are not excluded. Additionally, the verb "consisting of" may be replaced with "essentially consisting of," meaning that the compositions described herein may contain additional components other than those specifically identified, and that the additional components do not alter the inherent characteristics of the invention. Additionally, the verb "consisting of" may be replaced with "essentially consisting of," meaning that the methods described herein may include additional steps other than those specifically identified, and that the additional steps do not alter the inherent characteristics of the invention.

[0220] The reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that there be only one element. Thus, the indefinite article "a" or "an" normally means "at least one."

[0221] As used herein, "at least" a particular value means greater than or equal to the particular value. For example, "at least 2" is interpreted as the same as "2 or more," i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, ...

[0222] Furthermore, terms such as first, second, and third in the specification and claims are used to distinguish between similar elements and do not necessarily describe an order or chronological sequence. The terms so used are interchangeable under appropriate circumstances, and it is understood that the embodiments of the invention described herein are capable of functioning in orders other than those described or illustrated herein.

[0223] The term "about" or "approximately," when used in connection with a numerical value (e.g., about 10), preferably means that the value can be a given value of ±1% of the value (10).

[0224] As used herein, the term "and / or" indicates that one or more of the stated examples may be present alone or in combination with at least one of the stated examples and up to all of the stated examples.

[0225] Various embodiments are described herein. Each embodiment disclosed herein can be combined into one unless otherwise stated.

[0226] All patent applications, patents, and publications cited herein are incorporated herein by reference in their entirety, except for any definitions, disclaimers or disclaimers of subject matter, and except to the extent that the incorporated material contradicts the explicit disclosure of this specification, in which case the language of the present disclosure shall control.

[0227] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.

[0228] The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention. [Brief explanation of the drawings]

[0229] [Figure 1]Schematic diagram of the pInt105 vector containing a transposon (TR)-flanked I-sceI landing pad cassette. The landing pad contains a promoter (mPGK)-driven expression of the short first exon (Ex1), followed by an intron sequence containing the I-SceI meganuclease recognition sequence. Annotation: TR - inverted terminal repeats of the PiggyBac transposon; mPGK - mouse phosphoglycerate kinase promoter; Ex1 - exon 1 of mouse phosphoglycerate kinase; LHA - left homology arm; I-SceI - meganuclease cleavage site; RHA - right homology arm; Ubi - ubiquitin promoter; Puro - puromycin gene; LoxP - crossover locus (LoxP and Lox2272 are CRE recombinase sites). [Figure 2A-2B] Dot plots showing Fc expression 6 days after transfection without blasticidin selection. HEK293F cells transfected with pINT17-bococizumab and pINT17-5A10i in the presence or absence of AAVS TALEN nuclease are shown in Figure 2A. HEK293F cells transfected with pINT74-bococizumab and pINT74-5A10i in the presence or absence of NLN CRISPR are shown in Figure 2B. [Figure 3A-3B] Histogram overlay plots showing Fc expression in cells transfected with pINT17-bococizumab and 5A10i in the presence of AAVS TALEN nuclease and in cells transfected with pINT74-bococizumab and pINT74-5A10i in the presence of NLN CRISPR at 15 days post-transfection (BSD-resistant population) (FIG. 3A) and 28 days post-transfection (FIG. 3B). Arrows indicate histogram plots of AAVS incorporation. [Figure 4A-4B] The structure of the NLN CHO-K1 gene is shown in Figure 4A, with exons indicated by numbered boxes. Figure 4B shows the GC content of the first 68 kb of NLN CHO intron 1. [Figure 5A-5B]Figure 5A shows the nuclease cleavage position in NLN CHO intron 1. Figure 5B shows the TALEN nuclease right arm DNA insert for integration of CHO NLN intron 1. [Figure 6] Antibody expression profiles 2 days after transfection measured using flow cytometry-based analysis by staining with anti-human Fc antibody. Left: 884_01_G01 integrated into the AAVS locus; Center: 5A10i integrated into NLN intron 1; Right: bococizumab integrated into NLN intron 1. PcDNA stands for transfection without nucleases. [Figures 7A-7B] Antibody expression profiles in cells resistant to BSD 8 days after transfection (Figure 7A) and 14 days after transfection (Figure 7B) were measured using flow cytometry-based analysis by staining with anti-human Fc antibody. Left: 884_01_G01 integrated into the AAVS locus; center: 5A10i integrated into NLN intron 1; right: bococizumab integrated into NLN intron 1. The percentages shown indicate the anti-human Fc antibody-stained cell population, and the numbers shown indicate the cell numbers. PcDNA is an abbreviation for transfection without nuclease. [Figure 8] Antibody expression profiles in cells resistant to BSD measured using flow cytometry-based analysis by staining with anti-human Fc antibody 1 day after transfection (left), 7 days after transfection (center), and 14 days after transfection (right). 5A10i and bococizumab were integrated into NLN intron 1 (pINT58-5A10i and pINT58-bococizumab). PcDNA stands for transfection without nucleases. [Figure 9]Integration efficiency (%) was measured using flow cytometry-based analysis by staining with anti-human Fc antibody 7 days (left) and 14 days (center) after transfection without blasticidin selection. 5A10i and bococizumab were integrated into NLN intron 1 (pINT58-5A10i and pINT58-bococizumab). The right panel shows integration efficiency without the use of nucleases. DETAILED DESCRIPTION OF THE INVENTION

[0230] [Table 1]

[0231] [Table 2]

[0232] [Table 3] [Example]

[0233] Example 1: Generation of Hek293 cell lines with integrated I-SceI meganuclease recognition sites via transposon-mediated integration 1×10 7Hek293 cells were co-transfected with the pINT105 vector, which contains Piggybac (PB) transposon terminal repeats (TRs) flanking a landing pad containing the I-SceI meganuclease recognition sequence and a puromycin resistance gene driven by a ubiquitin promoter (Figure 1; SEQ ID NO: 59), the pcDNA 3.0 vector, and the PBase vector (encoding the mPB transposase) using a MaxCyte (MD, USA) electroporator in an OC100 cuvette according to the manufacturer's protocol. The pcDNA 3.0 vector was an empty vector used as a carrier to normalize DNA concentration during transfection. A control transfection without the PBase vector was also performed. The amount of DNA used is shown in Table 1. After 24 hours, transfected cells were plated onto 10% DMEM agar plates. 24 hours after plating, 2 μg / ml puromycin was added to the cells. After 2 weeks of puromycin selection, 48 colonies were picked and expanded. Cell pellets were frozen for genomic DNA extraction. 10 per clone 7 One vial of cells was frozen and stored in liquid nitrogen.

[0234] [Table 4]

[0235] Twenty clones were mapped to the genomic location of the landing pad integration using sprinklelet PCR as described by Potter and Luo (2010) PLoS ONE 5(4):e1016. One microgram of genomic DNA per clone was digested with Sau3a. Sprinklelet PCR was then performed as follows:

[0236] Step 1: Reaction conditions for annealing sprinklet oligonucleotides Amount of ingredients SPLNK-BOT (150ng / μl) 50μl SPLNK-GATC-TOP (150ng / μl) 50μl 100μl of 10x NEB buffer 2 H2O 800μl Total 1000μl Heat at 95°C for 3 minutes. Allow to cool to room temperature on the bench (approximately 30 minutes). Store 200 μl aliquots at -20°C.

[0237] Step 2: Ligation conditions for ligating digested genomic DNA to annealed sprinklelet oligonucleotides Amount of ingredients 35 μl digested genomic DNA 2.5 μl H2O 5 μl of 10x NEB ligase buffer 6 μl annealed sprinklelet oligonucleotide (from step 1) NEB T4 DNA ligase (400U / μl) 1.5μl Total 50 μl Incubate at room temperature for at least 2 hours. Proceed directly to the first PCR.

[0238] Step 3. First-round sprinklelet PCR First PCR reaction Amount of ingredients 10 μl of ligated genomic DNA H2O 8.25 μl 5μl of 5x Phusion HF buffer 0.5 μl of 10 mm dNTP SPLNK#1.10μM 0.5μl Primer PB#1, 10 μM (see Table 2) 0.5 μl Phusion Taq (Finnzymes, FL) 0.25μl Total 25μl PCR conditions for the first PCR 98°C for 75 seconds 98°C for 20 seconds → 64°C for 15 seconds (x 2 cycles) 98°C for 20 seconds → 58°C or 64°C for 15 seconds (3'SPLNK-PB#1: 58°C, 5'SPLNK-PB#1: 64°C; Table 2) → 72°C for 2 minutes (×30 cycles) 72°C for 7 minutes Keep at 4°C

[0239] Step 4. Second-round sprinklelet PCR Second PCR reaction Amount of ingredients 1 μl of the first PCR product (2-fold dilution) H2O 31.5 μl 10μl of 5x Phusion HF buffer 10mm dNTP 1μl SPLNK#2, 10 μM 1 μl Primer PB#2, 10 μM (see Table 2) 1 μl Phusion Taq 0.5 μl Total 50 μl PCR conditions for the second PCR 98°C for 75 seconds 98°C for 20 seconds → 59°C or 66°C for 15 seconds (3'SPLNK-PB#2: 59°C, 5'SPLNK-PB#2: 66°C; Table 2) → 72°C for 90 seconds (×30 cycles) 72°C for 7 minutes Keep at 4°C

[0240] Step 5. Antarctic Phosphatase / Exonuclease I Treatment AntPho / ExoI Reaction Conditions Amount of ingredients 20 μl of second Sprinklelet PCR product 3.0 μl of 10x NEB AP buffer H2O 3.0 μl NEB Antarctic Phosphatase 2.0 μl (New England Biolabs, MA, USA) NEB Exonuclease I 2.0 μl (New England Biolabs, MA, USA) Total 30μl

[0241] The reaction was incubated for 2 hours at 37° C., followed by 15 minutes at 80° C. 15 μl of the reaction was used for sequencing using the appropriate sequencing primers (SEQ ID NO: 17, SEQ ID NO: 18, Table 2).

[0242] [Table 5]

[0243] PCR of the 5' end of the transposable element was performed, checked on a 0.8% agarose gel, and sequenced. The resulting sequences were blasted using NCBI-blastn to identify the genomic locus for each cell line (Table 3).

[0244] [Table 6]

[0245] [Table 7]

[0246] The sequencing results for each clone are as follows: clone A02-Chr.7 (SEQ ID NO: 34), clone A04-Chr.5 (SEQ ID NO: 35), clone A05-Chr.3 (SEQ ID NO: 36), clone A06-Chr.12 (SEQ ID NO: 37), clone A07-Chr.17 (SEQ ID NO: 38), clone A08-multiple hits (SEQ ID NO: 39), clone A09-Chr.7 (SEQ ID NO: 40), clone A10-Chr. r.11 (SEQ ID NO: 41), clone B04-Chr.2 (SEQ ID NO: 42), clone B06-Chr.3 (SEQ ID NO: 43), clone B07-Chr.1 (SEQ ID NO: 44), clone B11-Chr.8 (SEQ ID NO: 45), clone B12-Chr.15 (SEQ ID NO: 46), clone C01-Chr.17 (SEQ ID NO: 47), clone C02-Chr.2 (SEQ ID NO: 48), clone C03-Chr.9 (SEQ ID NO: 49).

[0247] Example 2: Validation of cell lines by transfecting SceI meganuclease and FGFR1 and FGFR2 as donor DNA Clones generated by PB transposon-mediated integration were validated for integration efficiency, single-copy integration analysis, and antibody expression. To this end, clones were co-transfected with two donor plasmids containing anti-FGFR1 scFv and anti-FGFR2 scFv in Fc format in equal proportions, in the presence or absence of an I-SceI meganuclease plasmid. Transfection with a mixture of anti-FGFR1 and a-FGFR2 antibodies provides an opportunity to examine the proportion of cells containing multiple integration events. For individual cells that correctly integrate a cassette (e.g., anti-FGFR1), there is an approximately 50:50 chance that a second integration will be of an alternative specificity (i.e., anti-FGFR2). Frequent multiple integrations will result in a higher proportion of double-positive clones. The donor plasmids are described in WO 2015 / 166272.

[0248] Transfections were performed in two batches: Batch 1 contained clones A09, A10, B03, B05, B07, B09, and B12. Batch 2 contained clones A02, A04, A05, A06, A07, A08, A11, B01, B04, B06, B10, B11, C01, C02, and C03. The day before transfection, 0.5 × 10 cells or HEK293-F cells were transfected. 6Cells were seeded at 1000 cells / ml. On the day of transfection, cells were transfected using Maxcyte (MD, USA) electroporation according to the manufacturer's protocol. Donor DNA (anti-FGFR1 and anti-FGFR2) was 1 μg each for all transfections (including controls). Meganuclease DNA was 20 μg. HEK293F TALEN cells were used as a control for both batches (described in WO 2015 / 166272). Control cells were transfected with equal proportions of two donor plasmids containing anti-FGFR1 scFv and anti-FGFR2 scFv in Fc format in the presence or absence of an AAVS TALE nuclease plasmid, which can integrate the binder into the AAVS locus via TALEN-mediated integration. The TALEN DNA used was 10 μg (TAL L) and 10 μg (TAL R).

[0249] Transfected cells were plated in 10 cm Petri dishes and subjected to blasticidin selection two days after transfection. The medium in the plates was replenished with fresh medium containing blasticidin every 3–4 days until day 20. Blasticidin-resistant colonies were scored to calculate integration efficiency. Integration efficiencies ranged from 0–1%, and the fold difference in the presence and absence of nuclease varied among clones. Clones A09, B12, and C03 showed a larger fold difference in the presence and absence of I-SceI meganuclease compared to the other clones. Among these three clones, C03 showed the highest integration efficiency (1%). The integration efficiencies of the remaining clones, A04 and B01, were 0.5% and 0.6%, respectively.

[0250] In parallel, transfected cells were cultured in suspension and underwent BSD selection from day 2 to day 20, with medium changes every 3–4 days. On day 20, cells were double-stained with FGFR1-Dy633 and FGFR2-Dy488. Flow cytometry-based analysis was performed using an Intellicyt IQUE screener (Sartorius AG, GE). The cytometer was equipped with 488 nm (blue) and 640 nm (red) lasers and emission filters for PE (LP:-, BP:572 / 28) and To-Pro3 (LP:-, BP:675 / 30). For FGR1 / 2 staining, 10 nM of FGFR1-Dy633 and FGFR2-Dy488 were added to 100 μL of cells. The cells were incubated at 4°C in the dark for 30 minutes. Next, 900 μl of 0.1% PBS was added, followed by centrifugation at 600 × g for 2.5 minutes. The cells were washed with 1 ml of 0.1% BSA and resuspended in 500 μl of 0.1% BSA. 50 μL was removed and added to wells of a 96-well plate for subsequent analysis. Double staining of cells with antigen may indicate multiple copy integration (two or more antibody genes integrated per cell). Antibody-negative populations were observed in all transfected clones. These populations were excluded from the calculations for single-copy and multiple-copy integration analysis. The results are shown in Table 4.

[0251] [Table 8]

[0252] Example 3: Evaluation of the neurolysin (NLN) gene for expression of binders To evaluate the binder expression capacity of the NLN locus, we designed a system for genomic integration of cassettes containing a promoterless blasticidin gene and genes expressing the anti-PCSK9 antibody 5A10i or bococizumab (Boco) into the NLN locus. The vectors pINT17-5A10i and pINT17-bococizumab are second-generation display vectors derived from the pD2 vector described in International Publication No. 2015 / 166272. These vectors are derived from the pINT17-BSD vector (described in Parthiban et al., 2019, mAbs, 11:5, 884-898). The pINT17-BSD vector directs the integration of the cassettes containing the genes expressing 5A10i and bococizumab, respectively, into the AAVS locus.

[0253] Integration of the cassette was achieved via CRISPR-mediated integration by including a gRNA (TCACTCGTATTACGTTTACA, SEQ ID NO: 50) targeting intron 2 of the neurolysin gene (NLN-207) in the cassette. To facilitate homologous recombination, 800 bp homology arms were included on both ends of the cassette. The left homology arm (LHA) was flanked by an AsiSI recognition site at its 5' end and an NsiI recognition site at its 3' end. The right homology arm (RHA) was flanked by a BstZ171 recognition site at its 5' end and an SbfI recognition site at its 3' end. The left homology arm was amplified by PCR using primers LHA_AsiSI-Forw (SEQ ID NO: 60) and NLN_LHA-NsiI-Rev (SEQ ID NO: 61), and the right homology arm was amplified using primers NLN-RHA-BstZ171_Forw (SEQ ID NO: 62) and RHA_SbfI-Rev (SEQ ID NO: 63) (primers are shown in Table 5), ligated into the cassette, and then restriction digestion of the PCR products and vectors pINT17-5A10i and pINT17-bococizumab was performed using the enzymes and ligation described above, resulting in vectors pINT74-5A10i (SEQ ID NO: 64) and pINT74-bococizumab (SEQ ID NO: 65), which direct integration of the constructed gene into intron 2 of NLN (NLN-207).

[0254] [Table 9]

[0255] Template sequences used: NLN Intron 2-CRISPR-1-gBlock (SEQ ID NO: 57), NLN Intron 2-LHA and RHA-gBlock (SEQ ID NO: 58).

[0256] Correct integration of the cassette into the target locus results in expression of a blasticidin resistance gene, allowing correctly integrated clones to grow in the presence of antibiotics, as described in WO 2015 / 166272. The integration efficiency of a cassette designed for integration into NLN intron 2 (NLN-207) was compared with that of a cassette designed for integration into the AAVS locus via TALEN-mediated integration, as described in WO 2015 / 166272. HEK293F cells were transfected using a Maxcyte electroporator (MD, USA) according to the manufacturer's protocol. Control transfections without the TALEN or CRISPR vectors were also performed. Table 6 lists the transfection conditions.

[0257] [Table 10]

[0258] After transfection, cells were plated in the presence or absence of blasticidin. Blasticidin-resistant colonies were stained with methylene blue and counted 12 days after transfection to determine integration efficiency. The integration efficiencies of cells transfected with the AAVS TALEN were 0.26% for pINT17-Boco and 0.35% for pINT17-5A10i, while the integration efficiencies of cells transfected with the NLN CRISPR were 0.23% for pINT74-bococizumab and 0.53% for pINT74-5A10i (Table 7).

[0259] [Table 11]

[0260] Incorporation efficiency was also quantified by measuring Fc expression 6 days after transfection of cells without BSD selection using flow cytometry-based analysis by staining with anti-human Fc antibody (BioLegend cat#409304). Flow cytometry-based analysis was performed using an Intellicyt IQUE screener (Sartorius AG, GE). The cytometer was equipped with 488 nm (blue) and 640 nm (red) lasers and emission filters for PE (LP:-, BP:572 / 28) and To-Pro3 (LP:-, BP:675 / 30). For anti-human Fc antibody staining, 1 × 10 6 Cells were washed twice with 0.1% BSA PBS and incubated with 1 μl of labeled antibody in 100 μL of 1% BSA PBS (7.5% BSA Fraction V - Gibco (Cat. No.: 15260037)) for 30 min at 4 °C, protected from light, washed again with PBS, and analyzed. The difference in the number of Fc-positive cells in the presence and absence of nuclease is a measure of integration efficiency. Cells transfected with 5A10i in the presence of nuclease show integration efficiencies of 3.99% and 3.38% for the AAVS TALEN and NLN CRISPR, respectively (Figure 2A and Figure 2B).

[0261] In parallel, transfected cells were cultured in suspension and subjected to BSD selection. 15 days after transfection, cells were stained with anti-human Fc antibody and subjected to flow cytometry-based analysis. BSD-resistant populations showed Fc expression on the cell surface, and the expression levels were similar between cells integrated at the AAVS locus and those integrated at the NLN locus (Figure 3A).

[0262] Furthermore, 28 days after transfection, the stability of Fc expression was tested by staining the BSD-resistant population with an anti-human Fc antibody. The antibody integrated into the NLN locus shows uniform expression (Figure 3B).

[0263] Example 4: Validation of the NLN locus in CHO cells The purpose of this example was to test stable surface antibody display from the intron 1 locus of neurolysin (NLN) in CHO-s cells.

[0264] Experimental procedure Integration of the antibody genes was performed at the AAVS locus using CRISPR / Cas9 (described in WO 2019 / 110691) or at the NLN intron 1 using TALEN (SEQ ID NO: 66). CHO-s cells were co-transfected with a target plasmid carrying the mutated bococizumab antibody gene (pINT157-884_01_G01 (SEQ ID NO: 67) described in Dyson et al. 2020 mAbs, 12:1, 1829335) for AAVS targeting. CHO-s cells were co-transfected with target plasmids carrying bococizumab and 5A10i (pINT158-bococizumab (SEQ ID NO: 68) and pINT158-5A10i (SEQ ID NO: 69) targeting NLN intron 1. Because 5A10i and bococizumab are well- and poorly functional antibodies, respectively, differential display of the antibodies was expected. This can be assessed by changes in the magnitude of the signal (e.g., MFI) detected by a secondary fluorescent antibody directed against the Fc region of the displayed antibody (the anti-human Fc antibody described in Example 3). The experiment was performed using TALEN. Transfection with pDNA was performed in duplicate (see Tables 8 and 10). Figures 4A and 4B show the NLN gene structure in CHO cells, and Figures 5A and 5B show the design of NLN intron 1 TALEN targeting.

[0265] Cell culture, flow cytometry and staining All CHO-S cell lines were cultured in CD Opticho medium (for CHO-F cells, catalog number 12681-011, Life Technologies, California, USA) supplemented with 8 mM L-Glut (catalog number 25030-024, Life Technologies, California, USA) and typically maintained in 25 mL cultures passaged every 72 / 96 h. The BSD (blasticidin) concentration for selection was 3 μg / ml. Duplicate cultures without BSD selection were also maintained to estimate the transgene integration efficiency.

[0266] Anti-human Fc antibody cell staining and flow cytometry analysis were performed as described in Example 3.

[0267] Transfection Transfections were performed using Maxcyte (MD, USA) transfection according to the manufacturer's protocol (see also Table 6). TALEN-mediated integration was performed as described in WO 2015 / 166272. The transfection scheme is summarized in Table 8 below.

[0268] [Table 12]

[0269] result Anti-human Fc antibody staining 2 days after transfection Two days after transfection, samples were stained with anti-human Fc antibody to detect transient antibody expression. In samples transfected with TALEN mRNA, expression increased in both pcDNA and TALEN pDNA, suggesting early integration / expression of the antibody gene cassette. Differences in the expression profiles of 5A10i and bococizumab were also observed, as expected, due to the "good" and "poor" presentation profiles of the antibody, respectively (Figure 6).

[0270] Anti-human Fc antibody staining (BSD-resistant cells) 8 days after transfection Eight days after transfection, samples taken from cells cultured in the presence of BSD were stained with anti-human Fc antibody to detect antibody cell surface expression. Eight days after transfection is an early time point for the production of clean, stably expressing cell lines, as the cells are still under antibiotic selection. Despite this, a fairly clean population of >78% anti-human Fc antibody-positive cells was observed in cells in which 5A10i was integrated into NLN intron 1, in contrast to cells in which bococizumab was integrated, which displayed less than 7% of the antibody, likely due to poor intrinsic display properties of the antibody (Figure 7A). As expected, samples taken from transfections using pcDNA showed little expression in the absence of nuclease-mediated gene integration.

[0271] Anti-human Fc antibody staining (BSD-resistant cells) 14 days after transfection Fourteen days after transfection, samples taken from cells cultured in the presence of BSD were stained with an anti-human Fc antibody to detect cell surface expression of the antibody. A clear population shift was observed in cells into which 5A10i had been integrated into NLN intron 1 (Figure 7B). This confirmed the usefulness of targeting antibody expression to NLN intron 1. There was a clear difference in expression between 5A10i and bococizumab, confirming the potential for cell surface display based on the biophysical properties of the antibody.

[0272] Integration efficiency 8 and 14 days after transfection (without BSD selection) Samples taken from cells cultured without BSD were stained with anti-human Fc antibody to measure integration efficiency 8 and 14 days after transfection, the results of which are shown in Table 9 below.

[0273] [Table 13]

[0274] Eight days after transfection, samples taken from cells cultured without BSD and stained with anti-human Fc antibody were used to estimate the antibody-gene integration efficiency. For the NLN intron 1 targeting design, an integration efficiency of approximately 2.5% was achieved for both TALEN plasmid DNA and TALEN mRNA, based on the 5A10i antibody.

[0275] Replicate transfection experiments: The following transfections were repeated to confirm the reproducibility of targeting intron 1 of NLN (Table 10).

[0276] [Table 14]

[0277] BSD resistant cells Samples from cell cultures containing BSD were stained with an anti-human Fc antibody 1, 7, and 14 days after transfection. The expression profiles of bococizumab and 5A10i demonstrate differential expression based on the unique biophysical properties of the two antibodies. This result supports the reproducibility and utility of targeting antibody expression for mammalian display (Figure 8).

[0278] Integration efficiency measured 7 days after transfection and 14 days after transfection (without BSD selection) Samples from cell cultures lacking BSD were stained for integration efficiency at 7 and 14 days post-transfection with anti-human Fc antibodies. The numbers indicate the percentage of positive cells within the gate. A maximum integration efficiency of 4.6% was achieved 7 days post-transfection and was still detectable at 3.3% 14 days post-transfection (Figure 9). These figures confirm the integration efficiency previously observed with designs targeting intron 1 of NLN.

[0279] References All references mentioned below and anywhere in this disclosure are incorporated herein by reference in their entirety. 1 Russell, S. et al. (1993). Retroviral vectors displaying functional antibody fragments. Nucleic Acids Res, 21(5), 1081-1085. 2 Boublik, Yet al. (1995). Eukaryotic virus display: Engineering the major surface glycoprotein of the Autographa californica nuclear polyhedrosis virus (AcNPV) for the presentation of foreign proteins on the virus surface. Nature Biotechnology, 13(10), 1079-1084. 3 Mottershead,DGet al(2000).Baculoviral display of functional scFv and synthetic IgG-binding domains.Biochemical and Biophysical Research Communications,275(1),84-90. 4 Oker-Blom, C. et al. (2003). Baculovirus display strategies: Emerging tools for eukaryotic libraries and gene delivery. Briefings in Functional Genomics and Proteomics, 2(3), 244-253. 5 Edwards,B.M.et al.(2003).The Remarkable Flexibility of theHuman Antibody Repertoire;Isolation of Over One Thousand Different Antibodies to a Single Protein,BLyS.Journal of Molecular Biology,334(1),103-118.doi:10.1016 / j.jmb.2003.09.054 6 Pershad,K.et al.(2010).Generating a panel ofHighly specific antibodies to 20Human SH2 domains by phage display.Protein Engineering,Design and Selection,23(4),279-288.doi:10.1093 / proteinlgzq003 7 Schofield,D.J.et al.(2007).Application of phage display toHigh throughput antibody generation and characterization.Genome Biol,8(11),R254. 8 Salema,V.et al.(2013).Selection of Single Domain Antibodies from Immune Libraries Displayed on the Surface of E.coli Cells with Two P-Domains of Opposite Topologies.PLoS ONE,8(9),e75126.doi:10.1371 / journal.pone.0075126.s007 9 Chao,G.et al.(2006).Isolating and engineeringHuman antibodies using yeast surface display.Nat Protoc,1(2),755-768. 10 Higuchi,K.et al.(1997).Cell display library for gene cloning of variable regions ofHuman antibodies toHepatitis B surface antigen.J Immunol Methods,202(2),193-204. 11 Ho,M.et al.(2006).Isolation of anti-CD22 Fv withHigh affinity by Fv display onHuman cells.Proc Natl Acad Sci USA,103(25),9637-9642.doi:10.1073 / pnas.0603653103 12 Ho,M.et al.(2009).Display and selection of scFv antibodies onHEK-293T cells.Methods Mol Biol,562,99-113.doi:10.1007 / 978-1-60327-302-2 8 13 Akamatsu,Y.,Pakabunto,K.,Xu,Z.,Zhang,Y.,&Tsurushita,N.(2007).Whole IgG surface display on mammalian cells:Application to isolation of neutralizing chicken monoclonal anti-IL-12 antibodies.Journal of Immunological Methods,327(1-2),40-52.doi:10.1016 / j.jim.2007.07.007 14 Beerli, R.R., Bauer, M., Buser, R.B., Gwerder, M., Muntwiler, S., Maurer, P., et al. Isolation of Human monoclonal antibodies by mammalian cell display. Proc Natl Acad Sci USA. 2008 Sep 23;105(38):14336 - 41. doi:10.1073 / pnas.0805942105 15 Breous - Nystrom, E., Schultze, K., Meier, M., Flueck, L., Holzer, C., Boll, M., et al. (2013). Retrocyte Display(registered trademark) technology: Generation and screening of a High diversity cellular antibody library. Methods, 1 - 11. doi:10.1016 / j.ymeth.2013.09.003 16 Grindley, Whiteson & Rice. Mechanisms of Site - Specific Recombination. Annu Rev Biochem 2006 75:567 - 605 17 Zhou, C., Jacobsen, F.W., Cai, L., Chen, Q., Shen, W.D. (2010). Development of a novel mammalian cell surface antibody display platform. mAbs, 2(5), 508 - 518 18 Li,C.Z.,Liang,Z.K.,Chen,Z.R.,Lou,H.B.,Zhou,Y.,Zhang,Z.H.,et al.(2012).Identification ofHBsAg-specific antibodies from a mammalian cell displayed full-length Human antibody library ofHealthy immunized donor.Cellular and Molecular Immunology,9(2),184-190. 19 Buchholz,F.,Ringrose,L.,Angrand,P.O.,Rossi,F.,&Stewart,A.F.(1996).Different thermostabilities of FLP and Cre recombinases:Implications for applied site-specific recombination.Nucleic Acids Res,24(21),4256-4262. 20 Schaft,J.,Ashery-Padan,R.,VanHoeven,F.D.,Gruss,P.,&Francis Stewart,A.(2001).Efficient FLP recombination in mouse ES cells and oocytes.Genesis,37(1),6-10. 21 Moehle,E.A.,Moehle,E.A.,Rock,J.M.,Rock,J.M.,Lee,Y.-L.,Lee,Y.L.,et al.(2007).Targeted gene addition into a specified location in theHuman genome using designed zinc finger nucleases.Proc Natl Acad Sci USA,104(9),3055-3060.doi:10.1073 / pnas.0611478104 22 Cristea,S.,Freyvert,Y.,Santiago,Y.,Holmes,M.C.,Urnov,F.D.,Gregory,P.D.,Cost,G.J.(2013).In vivo cleavage of transgene donors promotes nuclease-mediated targeted integration.Biotechnology and Bioengineering, / 10(3),871-880.doi:10.1002 / bit.24733 23 Letourneur,F.,Malissen,B.(1989).Derivation of a T cellHybridoma variant deprived of functional T cell receptor alpha and beta chain transcripts reveals a nonfunctional alpha-mRNA of BW5147 origin.European Journal of Immunology,19(12),2269-2274.doi:10.1002 / eji.1830191214 24 Kanayama,N.,Todo,K.,Reth,M.,Ohmori,H.(2005).Reversible switching of immunoglobulinHypermutation machinery in a chicken B cell line.Biochem Biophys Res Commun,327(1),70-75.doi:10.1016 / j.bbrc.2004.11.143 25 Lin,W.,Kurosawa,K.,Murayama,A.,Kagaya,E.,8 Ohta,K.(2011).B-cell display-based one-step method to generate chimericHuman IgG monoclonal antibodies.Nucleic Acids Research,39(3),e14-e14.doi:10.1093 / nar / gkq1122 26 Adachi,N.,So,S.,liizumi,S.,Nomura,Y.,Murai,K.,Yamakawa,C.,et al.(2006).TheHuman pre-B cell line Nalm-6 isHighly proficient in gene targeting byHomologous recombination.DNA and Cell Biology,25(1),19-24.doi:10.1089 / dna.2006.25.19 27 Palacios,R.,8 Steinmetz,M.(1985).IL3-Dependent mouse clones that express B-220 surface antigen,contain Ig genes in germ-line configuration,and generate B lymphocytes in vivo.Cell,41(3),727-734 28 Barretina,J.,Caponigro,G.,Stransky,N.,Venkatesan,K.,Margolin,A.A.,Kim,S.,et al.(2012).The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.Nature,483(7391),603-607.doi:10.1038 / nature11003 29 Forbes,S.A.,Bindal,N.,Bamford,S.,Cole,C.,Kok,C.Y.,Beare,D.,et al.(2011).COSMIC:mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer.Nucleic Acids Research,39(Database issue),D945-50.doi:10.1093 / nar / gkq929 30 Silva,G.,Poirot,L.,Galetto,R.,Smith,J.,Montoya,G.,Duchateau,P.,Paques,F.(2011).Meganucleases and other tools for targeted genome engineering:Perspectives and challenges for gene therapy.Current Gene Therapy,1’ / (1),11-27 31 Epinat,J.C.,Silva,G.H.,Paques,F.,Smith,J.,Duchateau,P.(2013).Engineered meganucleases for genome engineering purposes.Topics in Current Genetics(Vol.23,pp.147-185). 32 Szczepek,M.,Brondani,V.,Buchel,J.,Serrano,L.,Segal,D.J.,Cathomen,T.(2007).Structure-based redesign of the dimerization interface reduces the toxicity of zinc-finger nucleases.Nature Biotechnology,25(7),786-793.doi:10.1038 / nbt1317 33 Doyon,Y.,Vo,T.D.,Mendel,M.C.,Greenberg,S.G.,Wang,J.,Xia,D.F.,et al.(2011).Enhancing zinc-finger-nuclease activity with improved obligateHeterodimeric architectures.Nat Methods,8(1),74-79.doi:10.1038 / nmeth.1539 34 Perez-Pinera,P.,Ousterout,D.G.,Brown,M.T.,Gersbach,C.A.(2012).Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.Nucleic Acids Research,40(8),3741-3752.doi:10.1093 / nar / gkr1 214 35 Urnov,F.D.,Miller,J.C.,Lee,Y.-L.,Beausejour,C.M.,Rock,J.M.,Augustus,S.,et al.(2005).Highly efficient endogenousHuman gene correction using designed zinc-finger nucleases.Nature,435(7042),646-651.doi:10.1038 / nature03556 36 Maresca,M.,Lin,V.G.,Guo,N.,&Yang,Y.(2013).Obligate ligation-gated recombination(ObLiGaRe):custom-designed nuclease-mediated targeted integration through nonhomologous end joining.Genome Research,23(3),539-546.doi:10.1101 / gr.145441.112 37 Bogdanove,A.J.,&Voytas,D.F.(2011).TAL effectors:customizable proteins for DNA targeting.Science,333(6051),1843-1846.doi:10.1126 / science.1204094 38 Reyon,D.,Tsai,S.Q.,Khgayter,C.,Foden,J.A.,Sander,J.D.,8 Joung,J.K.(2012).FLASH assembly of TALENs forHigh-throughput genome editing.Nature Biotechnology,30(5),460-465.doi:10.1038 / nbt.2170 39 Boissel,S.,Jarjour,J.,Astrakhan,A.,Adey,A.,Gouble,A.,Duchateau,P.,et al.(2013).megaTALs:a rare-cleaving nuclease architecture for therapeutic genome engineering.Nucleic Acids Research.doi:10.1093 / nar / gkt1224 40 Beurdeley,M.,Bietz,F.,Li,J.,Thomas,S.,Stoddard,T.,Juillerat,A.,et al.(2013).Compact designer TALENs for efficient genome engineering.Nature Communications,4,1762.doi:10.1038 / ncomms2782 41 Sampson,T.R.,Weiss,D.S.(2014).Exploiting CRISPR / Cas systems for biotechnology.BioEssays:News and Reviews in Molecular,Cellular and Developmenta / Biology,36(1),34-38.doi:10.1002 / bies.201300135 42 Shalem,O.,Sanjana,N.E.,Hartenian,E.,Shi,X.,Scott,D.A.,Mikkelsen,T.S.,et al.(2014).Genome-scale CRISPR-Cas9 knockout screening in Human cells.Science,343(6166),84-87.doi:10.1126 / science.1247005 43 Wang,T.,Wei,J.J.,Sabatini,D.M.,Lander,E.S.(2014).Genetic screens in Human cells using the CRISPR-Cas9 system.Science,343(6166),80-84.doi:10.1126 / science.246981 44 Beard,C.,Hochedlinger,K.,Plath,K.,Wutz,A.,&Jaenisch,R.(2006).Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells.Genesis,44(1),23-28. 45 Orlando,S.J.,Santiago,Y.,DeKelver,R.C.,Freyvert,Y.,Boydston,E.A.,Moehle,E.A.,et al.(2010).Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomalHomology.Nucleic Acids Research,38(15),e152.doi:10.1093 / nar / gkq 512 46 Cadinanos 2007 47 Zhang,H.,Yea,K.,Xie,J.,Ruiz,D.,Wilson,I.A.,Lerner,R.A.(2013).Selecting agonists from single cells infected with combinatorial antibody libraries.Chemistry 8 Biology,20(5),734-741.doi:10.1016 / j.chembiol.2013.04.012 48 Porteus,M.H.,Baltimore,D.(2003).Chimeric nucleases stimulate gene targeting in Human cells.Science,300(5620),763.doi:10.1126 / science.1078395 49 Rouet,P.,Smih,F.,&Jasin,M.(1994).Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease.Molecular and Cellular Biology,14(12),8096-8106. 50 Jasin,M.(1996).Genetic manipulation of genomes with rare-cutting endonucleases.Trends in Genetics,12(6),224-228 51 Davis,L.,&Maizels,N.(2011).DNA nicks promote efficient and safe targeted gene correction.PLoS ONE,6(9),e23981.doi:10.1371 / journal.pone.0023981 52 Fujioka,K.,Aratani,Y.,Kusano,K.,Koyama,H.(1993).Targeted recombination with single-stranded DNA vectors in mammalian cells.Nucleic Acids Res,21(3),407-412 53 Khan,I.F.,Hirata,R.K.,&Russell,D.W.(2011).AAV-mediated gene targeting methods forHuman cells.Nat Protoc,6(4),482-501.doi:10.1038 / nprot.2011.301 54 Deyle,D.R.,8 Russell,D.W.(2009).Adeno-associated virus vector integration.Current Opinion in Molecular Therapeutics,11(4),442-447 55 Benatuil,L.,Perez,J.M.,Belk,J.,Hsieh,C.M.(2010).An improved yeast transformation method for the generation of very largeHuman antibody libraries.Protein Engineering,Design and Selection,23(4),155-159. 56 Feldhaus,M.J.,Siegel,R.W.,Opresko,L.K.,Coleman,J.R.,Feldhaus,J.M.,Yeung,Y.A.,et al.(2003).Flow-cytometric isolation ofHuman antibodies from a nonimmune Saccharomyces cerevisiae surface display library.Nat Biotechnol. 57 Zhao,A.,Nunez-Cruz,S.,Li,C.,Coukos,G.,Siegel,D.L.,8 Scholler,N.(2011).Rapid isolation ofHigh-affinityHuman antibodies against the tumor vascular marker Endosialin / TEM1,using a paired yeast-display / secretory scFv library platform.Journal of Immunological Methods,363(2),221-232.doi:10.1016 / j.jim.2010.09.001 58 Skerra,A.(2007).Alternative non-antibody scaffolds for molecular recognition.Curr Opin Biotechnol,18(4),295-304.doi:10.1016 / j.copbio.2007.04.010 59 Gebauer,M.,&Skerra,A.(2009).Engineered protein scaffolds as next-generation antibody therapeutics.Current Opinion in Chemical Biology,13(3),245-255.doi:10.1016 / j.cbpa.2009.04.627 60 Haan&Maggos(2004)BioCentury,12(5):A1-A6 61 Koide et al.(1998)Journal of Molecular Biology,284:1141-1151. 62 Nygren et al.(1997)Current Opinion in Structural Biology,7:463-469 63 Wess,L.In:BioCentury,The Bernstein Report on BioBusiness,12(42),A1-A7,2004 64 Chang,H.-J.,Hsu,H.-J.,Chang,C.-F.,Peng,H.-P.,Sun,Y.-K.,Yu,H.-M.,et al.(2009).Molecular Evolution of Cystine-Stabilized Miniproteins as Stable Proteinaceous Binders.Structure,17(4),620-631.doi:10.1016 / j.str.2009.01.011 65 Ward,E.S.et al.,Nature 341,544-546(1989) 66 McCafferty et al Nature,348,552-554(1990) 67 Holt et al Trends in Biotechnology 21,484-490(2003) 68 Bird et al,Science,242,423-426,(1988) 69 Huston et al,PNAS USA,85,5879-5883,(1988) 70 Holliger,P.et al,PNAS USA 90 6444-6448,(1993) 71 Reiter,Y.et al,Nature Biotech,14,1239-1245,(1996) 72 Holliger&Hudson,Nature Biotechnology 23(9):1126-1136(2005) 73 Knappik et al.J.Mol.Biol.296,57-86(2000) 74 Krebs et al.Journal of Immunological Methods 254,67-84(2001) 75 Holliger and Bohlen Cancer and metastasis rev.18:411-419(1999) 76 Holliger,P.and Winter G.Current Opinion Biotechnol 4,446-449(1993) 77 Glennie M J et al.,J.Immunol.139,2367-2375(1987) 78 Repp R.et al.,J.Hemat.377-382(1995) 79 Staerz U.D.and Bevan M.J.PNAS 83(1986) 80 Suresh M.R.et al.,Method Enzymol.121:210-228(1986) 81 Merchand et al.,Nature Biotech.16:677-681(1998) 82 Ridgeway,J.B.B.et al,Protein Eng.,9,616-621,(1996) 83 Marks,J.D.,Hoogenboom,H.R.,Bonnert,T.P.,McCafferty,J.,Griffiths,A.D.,&Winter,G.(1991).By-passing immunization.Human antibodies from V-gene libraries displayed on phage.J Mol Biol,222(3),581-597. 84 Gronwald,R.G.K.,Grant,F.J.,Haldeman,B.A.,Hart,C.E.,O’Hara,P.J.,Hagen,F.S.,et al.(1988).Cloning and expression of a cDNA coding for theHuman platelet-derived growth factor receptor:Evidence for more than one receptor class(Vol.85,pp.3435-3439).Presented at the Proceedings of the National Academy of Sciences of the United States of America. 85 Kumar,N.,&Borth,N.(2012).Flow-cytometry and cell sorting:an efficient approach to investigate productivity and cell physiology in mammalian cell factories.Methods,56(3),366-374.doi:10.1016 / j.ymeth.2012.03.004 86 Brezinsky,S.C.G.,Chiang,G.G.,Szilvasi,A.,Mohan,S.,Shapiro,R.I.,MacLean,A.,et al.(2003).A simple method for enriching populations of transfected CHO cells for cells ofHigher specific productivity.J Immuno / Methods,277(1-2),141-155. 87 Pichler,J.,Hesse,F.,Wieser,M.,Kunert,R.,Galosy,S.S.,Mott,J.E.,&Borth,N.(2009).A study on the temperature dependency and time course of the cold capture antibody secretion assay.Journal of Biotechnology,141(1-2),80-83.doi:10.1016 / j.jbiotec.2009.03.001 88 Anastassiadis,K.,Fu,J.,Patsch,C.,Hu,S.,Weidlich,S.,Duerschke,K.,et al.(2009).Dre recombinase,like Cre,is aHighly efficient site-specific recombinase in E.coli,mammalian cells and mice.Disease Models&Mechanisms,2(9-10),508-515.doi:10.1242 / dmm.003087 89 Horlick,R.A.,Macomber,J.L.,Bowers,P.M.,Neben,T.Y.,Tomlinson,G.L.,Krapf,I.P.,et al.(2013).Simultaneous surface display and secretion of proteins from mammalian cells facilitate efficient in vitro selection and maturation of antibodies.J Biol Chem,288(27),19861-19869.doi:10.1074 / jbc.M113.452482 90 Biffi,G.,Tannahill,D.,McCafferty,J.,&Balasubramanian,S.(2013).Quantitative visualization of DNA G-quadruplex structures in Human cells.Nature Chemistry,5(3),182-186.doi:10.1038 / nchem.1548 91 Gao,J.,Sidhu,S.S.,&Wells,J.A.(2009).Two-state selection of conformation-specific antibodies.Proc Natl Acad Sci USA,106(9),3071-3076.doi:10.1073 / pnas.0812952106 92 Gu,G.J.,Friedman,M.,Jost,C.,Johnsson,K.,Kamali-Moghaddam,M.,Pluckthun,A.,et al.(2013).Protein tag-mediated conjugation of oligonucleotides to recombinant affinity binders for proximity ligation.N Biotechno / ,30(2),144-152.doi:10.1016 / j.nbt.2012.05.005 93 Cho,Y.K.,&Shusta,E.V.(2010).Antibody library screens using detergent-solubilized mammalian cell lysates as antigen sources.Profein Eng Des Sei,23(7),567-577.doi:10.1093 / protein / gzq 029 94 Tillotson,B.J.,Cho,Y.K.,&Shusta,E.V.(2013).Cells and cell lysates:a direct approach for engineering antibodies against membrane proteins using yeast surface display.Methods,60(1),27-37.doi:10.1016 / j.ymeth.2012.03.010 95 Kunert,A.,Straetemans,T.,Govers,C.,Lamers,C.,Mathijssen,R.,Sleijfer,S.,Debets,R.(2013).TCR-Engineered T Cells Meet New Challenges to Treat Solid Tumors:Choice of Antigen,T Cell Fitness,and Sensitization of Tumor Milieu.Frontiersin Immunology,4,363.doi:10.3389 / fimmu.2013.00363 96 Liddy,N.,Bossi,G.,Adams,K.J.,Lissina,A.,Mahon,T.M.,Hassan,N.J.,et al.(2012).Monoclonal TCR-redirected tumor cell killing.Nature Medicine,18(6),980-987.doi:10.1038 / nm.2764 97 Holler,P.D.,Holman,P.O.,Shusta,E.V.,O’Herrin,S.,Wittrup,K.D.,8 Kranz,D.M.(2000).In vitro evolution of a T cell receptor withHigh affinity for peptide / MHC.Proc Natl Acad Sci USA,97(10),5387-5392.doi:10.1073 / pnas.080078297 98 Weber,K.S.,Donermeyer,D.L.,Allen,P.M.,8 Kranz,D.M.(2005).Class II-restricted T cell receptor engineered in vitro forHigher affinity retains peptide specificity and function.Proc Natl Acad Sci USA,102(52),19033-19038.doi:10.1073 / pnas.0507554102 99 Kessels,H.W.,van Den Boom,M.D.,Spits,H.,Hooijberg,E.,8 Schumacher,T.N.(2000).Changing T cell specificity by retroviral T cell receptor display.Proc Natl Acad Sci USA,97(26),14578-14583.doi:10.1073 / pnas.97.26.14578 100 Chervin,A.S.,Aggen,D.H.,Raseman,J.M.,8 Kranz,D.M.(2008).EngineeringHigher affinity T cell receptors using a T cell display system.Journal of Immunological Methods,339(2),175-184. 101 Crawford,F.,Jordan,K.R.,Stadinski,B.,Wang,Y.,Huseby,E.,Marrack,P.,et al.(2006).Use of baculovirus MHC / peptide display libraries to characterize T-cell receptor ligands.Immunological Reviews,210,156-170.doi:10.1111 / j.0105-2896.2006.00365.x 102 Hinrichs,C.S.,K Restifo,N.P.(2013).Reassessing target antigens for adoptive T-cell therapy.Nat Biotechnol,31(11),999-1008.doi:10.1038 / nbt.2725 103 Sadelain,M.,Brentjens,R.,8 Riviere,I.(2013).The basic principles of chimeric antigen receptor design.Cancer Discovery,3(4),388-398.doi:10.1158 / 2159-8290.CD-12-0548 104 Alonso-Camino,V.,Sanchez-Martin,D.,Compte,M.,Sanz,L.,8 Alvarez-Vallina,L.(2009).Lymphocyte display:a novel antibody selection platform based on T cell activation.PLoS ONE,4(9),e7174.doi:10.1371 / journal.pone.0007174 105 Melidoni,A.N.,Dyson,M.R.,Wormald,S.,8 McCafferty,J.(2013).Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells.Proceedings of the National Academy of Sciences,110(44),17802-17807.doi:10.1073 / pnas.1312062110 106 Zhang,H.,Wilson,I.A.,&Lerner,R.A.(2012).Selection of antibodies that regulate phenotype from intracellular combinatorial antibody libraries.Proceedings of the National Academy of Sciences,109(39),15728-1 5733.doi:10.1073 / pnas.1214275109 107 Xie,J.,Yea,K.,Zhang,H.,Moldt,B.,He,L.,Zhu,J.,8 Lerner,R.A.(2014).Prevention of cell death by antibodies selected from intracellular combinatorial libraries.Chemistry&Biology,2 / (2),274-283. 108 Yea,K.,Zhang,H.,Xie,J.,Jones,T.M.,Yang,G.,Song,B.D.,8 Lerner,R.A.(2013).Converting stem cells to dendritic cells by agonist antibodies from unbiased morphogenic selections(Vol.110,pp.14966-14971).Presented at the Proceedings of the National Academy of Sciences of the United States of America.doi:10.1073 / pnas.1313671110 109 Kawahara,M.,Kimura,H.,Ueda,H.,8 Nagamune,T.(2004).Selection of genetically modified cell population usingHapten-specific antibody / receptor chimera.Biochem Biophys Res Commun,3’ / 5(1),132-138.doi:10.1016 / j.bbrc.2004.01.030 110 Kawahara,M.,Shimo,Y.,Sogo,T.,Hitomi,A.,Ueda,H.,8 Nagamune,T.(2008).Antigenmediated migration of murine pro-B Ba / F3 cells via an antibody / receptor chimera.Journal of Biotechno / ogy,133(1),154-161.doi:10.1016 / j.jbiotec.2007.09.009 111 Sogo,T.,Kawahara,M.,Ueda,H.,Otsu,M.,Onodera,M.,Nakauchi,H.,8 Nagamune,T.(2009).T cell growth control usingHapten-specific antibody / interleukin-2 receptor chimera.Cytokine,46(1),127-1 36.doi:10.1016 / j.cyto.2008.12.020 112 Kawahara,M.,Chen,J.,Sogo,T.,Teng,J.,Otsu,M.,Onodera,M.,et al.(2011).Growth promotion of genetically modifiedHematopoietic progenitors using an antibody / c-Mpl chimera.Cytokine,55(3),402-408.doi:10.1016 / j.cyto.2011.05.024 113 Ueda,H.,Kawahara,M.,Aburatani,T.,Tsumoto,K.,Todokoro,K.,Suzuki,E.,et al.(2000).Cell-growth control by monomeric antigen:the cell surface expression of lysozyme-specific Ig Vdomains fused to truncated Epo receptor.J Immuno / Methods,241(1-2),159-170. 114 Kerppola,T.K.(2009).Visualization of molecular interactions using bimolecular fluorescence complementation analysis:Characteristics of protein fragment complementation.Chemical Society Reviews,38(10),2876-2886. 115 Michnick,S.W.,Ear,P.H.,Manderson,E.N.,Remy,I.,8 Stefan,E.(2007).Universal strategies in research and drug discovery based on protein-fragment complementation assays.Nature Reviews Drug Discovery,6(7),569-582.doi:10.1038 / nrd231 116 Petschnigg,J.,Groisman,B.,Kotlyar,M.,Taipale,M.,Zheng,Y.,Kurat,C.F.,et al.(2014).The mammalian-membrane two-hybrid assay(MaMTH)for probing membrane-protein interactions in Human cells.Nat Methods.doi:10.1038 / nmeth.2895 117 Renaut,L.,Monnet,C.,Dubreuil,O.,Zaki,O.,Crozet,F.,Bouayadi,K.,et al.(2012).Affinity maturation of antibodies:Optimized methods to generateHigh-quality scfv libraries and isolate igg candidates byHigh-throughput screening.Methods in Molecular Biology(Vol.907,pp.451-461) 118 Dyson,M.R.,Zheng,Y.,Zhang,C.,Colwill,K.,Pershad,K.,Kay,B.K.,et al.(2011).Mapping protein interactions by combining antibody affinity maturation and mass spectrometry.Anal Biochem,417(1),25-35.doi:10.1016 / j.ab.2011.05.005 119 de Felipe P(2002)Polycistronic viral vectors.Curr Gene Ther 2:355-378.doi:10.2174 / 1566523023347742. 120 Foote,J.,Winter,G.(1992).Antibody framework residues affecting the conformation of theHypervariable loops.J Mol Biol,224(2),487-499. 121 Massie,B.,Dionne,J.,Lamarche,N.,Fleurent,J.,Langelier,Y.(1995).Improved adenovirus vector providesHerpes simplex virus ribonucleotide reductase R1 and R2 subunits very efficiently.Nature Biotechnology,13(6),602-608. 122 Kim,D.W.,Uetsuki,T.,Kaziro,Y.,Yamaguchi,N.,8 Sugano,S.(1990).Use of theHuman elongation factor 1 alpha promoter as a versatile and efficient expression system.Gene,91(2),217-223. 123 Holden,P.,Keene,D.R.,Lunstrum,G.P.,Bachinger,H.P.,8Horton,W.A.(2005).Secretion of cartilage oligomeric matrix protein is affected by the signal peptide.J Biol Chem,280(17),17172-17179. 124 Sadelain,M.,Papapetrou,E.P.,8 Bushman,F.D.(2012).SafeHarbours for the integration of new DNA in theHuman genome.Nature Reviews Cancer,12(1),51-58. 125 Sanjana,N.E.,Cong,L.,Zhou,Y.,Cunniff,M.M.,Feng,G.,8 Zhang,F.(2012).A transcription activator-like effector toolbox for genome engineering.Nat Protoc,7(1),171-192.doi:10.1038 / n prot.2011.431 126 Falk,R.,Falk,A.,Dyson,M.R.,Melidoni,A.N.,Parthiban,K.,Young,J.L.,et al.(2012).Generation of anti-Notch antibodies and their application in blocking Notch signalling in neural stem cells.Methods,58(1),69-78.doi:10.1016 / j.ymeth.2012.07.008 127 Martin,C.D.,Rojas,G.,Mitchell,J.N.,Vincent,K.J.,Wu,J.,McCafferty,J.,Schofield,D.J.(2006).A simple vector system to improve performance and utilisation of recombinant antibodies.BMC Biotechnology,6,46. 128 Reyon,D.,Tsai,S.Q.,Khgayter,C.,Foden,J.A.,Sander,J.D.,Joung,J.K.(2012).FLASH assembly of TALENs forHigh-throughput genome editing.Nature Biotechnology,30(5),460-465.doi:10.1038 / nbt.2170 129 Van Der Weyden,L.,Adams,D.J.,Harris,L.W.,Tannahill,D.,Arends,M.J.,Bradley,A.(2005).Null and conditional Semaphorin 3B alleles using a flexible purohtk LoxP / FRT vector.Genesis,44(4),171-178 130 de Felipe,P.,8 Ryan,M.D.(2004).Targeting of proteins derived from self-processing polyproteins containing multiple signal sequences.Traffic,5(8),616-626. 131 Raymond,C.S.,&Soriano,P.(2007).High-efficiency FLP and PhiC31 site-specific recombination in mammalian cells.PLoS ONE,2(1),e162.doi:10.1371 / journal.pone.0000162 132 Kranz,A.,Fu,J.,Duerschke,K.,Weidlich,S.,Naumann,R.,Stewart,A.F.,Anastassiadis,K.(2010).An improved Flp deleter mouse in C57BI / 6 based on Flpo recombinase.Genesis,48(8),512-520.doi:10.1002 / dvg.20641 133 Szymczak AL,Vignali DA(2005)Development of 2A peptide-based strategies in the design of multicistronic vectors.Expert Opin Biol Ther 5:627-638.doi:10.1517 / 14712598.5.5.627 134 Chapple,S.D.,Crafts,A.M.,Shadbolt,S.P.,McCafferty,J.,and Dyson,M.R.(2006).Multiplexed expression and screening for recombinant protein production in mammalian cells.BMC biotechnology 6,49. 135.Zhao,Y.et al.Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression ofHuman disseminated tumor.Cancer Research 70,9053-9061(2010). 136 Szymczak,A.L.et al.Correction of multi-gene deficiency in vivo using a single ’selfcleaving’ 2A peptide -based retroviral vector.Nature biotechnology 22,589-594(2004). 137.Li,Y.et al.Directed evolution ofHuman T-cell receptors with picomolar affinities by phage display.Nat.Biotechnol.23,349-354(2005). 138.Zhao,Y.et al.High-affinity TCRs generated by phage display provide CD4+ T cells with the ability to recognize and kill tumor cell lines.J.Immunol.179,5845-5854(2007). 139.Madura,F.et al.T-cell receptor specificity maintained by altered thermodynamics.The Journal of biological chemistry 288,18766-18775(2013). 140.Pierce,B.G.et al.Computational design of the affinity and specificity of a therapeutic T cell receptor.PLoS Comput Biol 10,e1003478(2014). 141.Sebestyen,Z.et al.Human TCR that incorporate CD3zeta induceHighly preferred pairing between TCRalpha and beta chains following gene transfer.J.Immunol.180,7736-7746(2008). 142.Roszik,J.et al.T-cell synapse formation depends on antigen recognition but not CD3 interaction:studies with TCR:(,a candidate transgene for TCR gene therapy.Eur.J.Immunol.41,1288-1297(2011). 143.Cohen,C.J.,Zhao,Y.,Zheng,Z.,Rosenberg,S.A.Morgan,R.A.Enhanced antitumor activity of murine-humanHybrid T-cell receptor(TCR)in Human lymphocytes is associated with improved pairing and TCRICD3 stability.Cancer Research 66,8878-8886(2006). 144.Huovinen,T.et al.Primer extension mutagenesis powered by selective rolling circle amplification.PLoS ONE 7,e31817(2012). 145.Cribbs,A.P.,Kennedy,A.,Gregory,B.&Brennan,F.M.Simplified production and concentration of lentiviral vectors to achieveHigh transduction in primaryHuman T cells.BMC biotechnology 13,98(2013). 146.Oelke,M.et al.Ex vivo induction and expansion of antigen-specific cytotoxic T cells byHLA-Ig-coated artificial antigen-presenting cells.Nat Med 9,619-624(2003). 147.Wolf l,M.Greenberg,P.D.Antigen-specific activation and cytokine-facilitated expansion of naive,Human CD8+ T cells.Nature Protocols 9,950-966(2014). 148.Lipowska-Bhalla,G.,Gilham,D.E.,Hawkins,R.E.&Rothwell,D.G.Isolation of tumor antigen-specific single-chain variable fragments using a chimeric antigen receptor bicistronic retroviral vector in a Mammalian screening protocol.Hum Gene Ther Methods 24,381-391(2013). 149.Kelly,R.J.,Sharon,E.,Pastan,I.Hassan,R.Mesothelin-targeted agents in clinical trials and in preclinical development.Mol.Cancer Ther.11,517-525(2012). 150.Atanackovic,D.et al.Surface molecule CD229 as a novel target for the diagnosis and treatment of multiple myeloma.Haematologica 96,1512-1520(2011). 151.Bund,D.,Mayr,C.,Kofler,D.M.,Hallek,M.&Wendtner,C.-M.Human Ly9(CD229)as novel tumor-associated antigen(TAA)in chronic lymphocytic leukemia(B-CLL)recognized by autologous CD8+ T cells.Exp.Hematol.34,860-869(2006). 152.Tiede,C.et al.Adhiron:a stable and versatile peptide display scaffold for molecular recognition applications.Protein Eng.Des.Sel.27,145-155(2014). 153.Maresca,M.,Lin,V.G.,Guo,N.&Yang,Y.Obligate ligation-gated recombination(ObLiGaRe):custom-designed nuclease-mediated targeted integration through nonhomologous end joining.Genome Res.23,539-546(2013). 154.McVey,M.Lee,S.E.MMEJ repair of double-strand breaks(director’s cut):deleted sequences and alternative endings.Trends Genet.24,529-538(2008). 155.Nakade,S.et al.Microhomology-mediated end-joining-dependent integration of donor DNA in cells and animals using TALENs and CRISPRICas9.Nat Commun 5,5560(2014). 156.Chiche,L.et al.Squash inhibitors:From structural motifs to macrocyclic knottins.Current Protein 8 Peptide Science 5,341-349.

Claims

1. 1. A method for producing a library of eukaryotic clones containing DNA encoding a diverse repertoire of binders, comprising: providing a donor DNA molecule encoding said binder and a eukaryotic cell; introducing the donor DNA into the cell and providing a site-specific nuclease within the cell, wherein the nuclease cleaves a recognition sequence in cellular DNA, the recognition sequence being within the NLN gene, the TNIK gene, the PARP11 gene, the RAB40B gene, the ABI2 gene, the RNF19B gene, the PKIA gene, or the FTCD gene, to create an integration site at which the donor DNA will integrate into the cellular DNA, wherein integration occurs through DNA repair mechanisms endogenous to the cell, thereby creating a recombinant cell comprising the donor DNA integrated into the cellular DNA; and culturing said recombinant cells to produce clones, thereby providing a library of eukaryotic cell clones comprising donor DNA encoding said repertoire of binders. A method comprising:

2. The method described in claim 1, wherein the recognition sequence is within the NLN gene, the TNIK gene, or the RAB40B gene.

3. The method described in claim 1, wherein the recognition sequence is within the NLN gene.

4. The method described in claim 1, wherein the recognition sequence is within an intron of the gene.

5. The method described in claim 4, wherein the recognition sequence is within an open chromatin region of the intron.

6. The method of claim 1, wherein the recognition sequence is within intron 1, 2, or 6 of NLN-207 of the NLN gene.

7. The method of claim 1, wherein the binder is an antibody molecule, a T cell receptor, or a chimeric antigen receptor (CAR).

8. The method of claim 7, wherein the antibody molecule is a full-length immunoglobulin, IgG, Fab, scFv-Fc, or scFv.

9. The method of claim 1, wherein the cell is a higher eukaryotic cell having a genome size of more than 2 x 10 7 base pairs.

10. The method of claim 9, wherein the cells are mammalian cells.

11. An in vitro library of eukaryotic cell clones expressing a diverse repertoire of at least 10, 10, 10, 10, 10, or 10 different binders, comprising: each cell contains recombinant DNA, wherein donor DNA encoding a binder or a subunit of a binder has been integrated into a fixed locus in the cellular DNA; An in vitro library, wherein the locus is within a gene selected from the group consisting of the NLN gene, the TNIK gene, the PARP11 gene, the RAB40B gene, the ABI2 gene, the RNF19B gene, the PKIA gene, or the FTCD gene.

12. An in vitro library of eukaryotic cell clones described in claim 11, wherein the locus is within the NLN gene, the TNIK gene, or the RAB40B gene.

13. An in vitro library of eukaryotic cell clones described in claim 11, wherein the locus is within the NLN gene.

14. An in vitro library of eukaryotic cell clones as described in claim 11, wherein the locus is within an intron of the gene.

15. An in vitro library of eukaryotic cell clones described in claim 14, wherein the locus is within an open chromatin region of the intron.

16. An in vitro library of eukaryotic cell clones as described in claim 11, wherein the one or more loci are within intron 1, 2, or 6 of NLN-207 of the NLN gene.

17. An in vitro library of eukaryotic cell clones as described in claim 11, wherein the binders are antibody molecules, T cell receptors, or chimeric antigen receptors (CARs).

18. The library of claim 17, wherein the antibody molecule is a full-length immunoglobulin, an IgG, a Fab, an scFv-Fc, or an scFv.

19. The library of claim 11, wherein the cells are higher eukaryotic cells having a genome size of more than 2 x 10 7 base pairs.

20. The library described in claim 19, wherein the cells are mammalian cells.