High molecular weight modified dsRNA composition

JP2024532413A5Pending Publication Date: 2025-09-04NANOSUR LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024513327
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-31
Filing Date
2022-08-31
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

Existing dsRNA compositions for insect control are susceptible to degradation by nucleases, leading to inefficiencies in gene silencing and high production costs due to the need for chemical modifications that are not economically scalable.

Method used

Development of chemically modified double-stranded RNA (MdsRNA) with high molecular weight polyalkyloxy modifications at the 2'-OH position, combined with low molecular weight moieties, to enhance stability and bioavailability, allowing for scalable production.

Benefits of technology

The MdsRNA compositions exhibit increased stability against nucleases, improved bioavailability, and cost-effective large-scale production, effectively silencing target gene expression in insects, fungi, and weeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023034849000001
    Figure 2023034849000001
  • Figure 2023034849000002
    Figure 2023034849000002
  • Figure 2023034849000003
    Figure 2023034849000003
Patent Text Reader

Abstract

Post-transcriptionally chemically modified double-stranded RNA (MdsRNA) with high molecular weight polyalkyloxy modifications at the 2'-OH position are described. This modification allows for greater bioavailability of the compound, superior stability of the compound, and allows for greater stability against nucleases. MdsRNA can be produced economically in a readily scalable manner. Compositions of MdsRNA with chemically modified nucleotides are described, such that the MdsRNA is modified to include high molecular weight polyalkyloxy polymers. Synthetic methods for efficiently making these MdsRNA and methods of using the MdsRNA are described.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 239,165, filed August 31, 2021, the entire teachings of which are incorporated herein by reference.

[0002] Inclusion by reference of XML documentation This application incorporates by reference the sequence listing contained in the following eXtensible Markup Language (XML) file being submitted concomitantly with this application: a) Filename: 55811003001.xml; created on August 29, 2022 with a size of 278,517 bytes. [Background technology]

[0003] Insects dominate all terrestrial environments that support human life and are therefore usually mankind's most important competitors for food, fiber, and other natural resources. Insects have a direct impact on agri-food production by chewing crop leaves, sucking out plant sap, laying young in roots, stems or leaves, and spreading plant pathogens. Insects feed on natural fibers, destroy wooden building materials, destroy stored grains, and accelerate decay processes.

[0004] The economic impact of insects is measured by the money and resources it costs to prevent and control pest infestations, as well as the market value of the products they destroy and the costs of the damage they cause. Although the dollar value of these losses is nearly impossible to calculate, especially when they adversely affect human health and welfare, economists generally agree that insects consume or destroy approximately 10% of the gross national product of industrialized countries and up to 25% of the gross national product of some developing countries.

[0005] One possible method for controlling insect populations is the use of RNA interference (RNAi), a naturally occurring biological process by which double-stranded ribonucleic acid (dsRNA) silences (knocks down) target gene expression in a sequence-specific manner. Cellular enzymes use dsRNA to target and cleave single-stranded RNA (ssRNA), including messenger RNA (mRNA) and non-translated RNA. RNAi is known to occur in many eukaryotic organisms, including plants, insects, mites, fungi, and animals, and offers great potential for selective and efficient regulation of gene expression.

[0006] dsRNA has an antisense strand that comprises a sequence that is complementary to the sequence of mRNA or non-translated RNA, and a sense strand that comprises a sequence that is complementary to the guide strand sequence and is substantially identical to the sequence of mRNA or non-translated RNA.The sense and antisense sequences can be on separate RNA strands or on a single strand.When on a single strand, the complementary sequences are connected by non-hybridizing hairpin or loop sequences.

[0007] In the prior art, targeted RNAi-mediated gene suppression of plants, insects, mites, and fungi infesting crops has been achieved using exogenously supplied unmodified dsRNA (UdsRNA) (U.S. Pat. No. 9,121,022; Ivashuta et al. 2015; U.S. Pat. App. Pub. No. 20160215290; Koch et al. 2016). When dsRNA is used to induce RNAi in insects and is supplied in the insect's diet, it has been found that dsRNAs of 60 base pairs (bp) or longer are sometimes required for efficient uptake and processing (Bolognesi et al. 2012).

[0008] Preparation of UdsRNA longer than about 30 base pairs (bp) has been achieved by in vitro transcription (Timmons 2006) and fermentation (Fire et al. 1998). Commercially viable large-scale methods for the preparation and purification of UdsRNA have been described (Arhancet et al., U.S. Pat. No. 9,822,361 B2). However, UdsRNA is susceptible to degradation by nucleases in the environment and in the host, reducing its effectiveness in inhibiting gene expression (Baum 2016).

[0009] DsRNA degradation has been addressed in in vitro and in vivo studies and for human therapeutics by using chemical synthesis of small (<30bp) interfering dsRNA (siRNA) with nucleotides modified by chemical means (Ku et al. 2015). The formulation of siRNA with chemically modified nucleotides involves successive chemical reactions of protection-deprotection for each nucleotide added in the elongation of the single-stranded RNA (ssRNA) strand (Micura 2002). The complexity and expense of such a process increases significantly in RNA molecules longer than about 30bp that trigger RNAi (RNAi triggers). Chemically synthesized siRNAs targeting insects using nucleotides chemically modified at the 2'-OH position of ribose have also been described (Gong et al. 2013), but the cost and complexity of synthesis of modified siRNAs are not economically feasible or sufficiently scalable to prepare chemically modified dsRNA in quantities exceeding several grams or in lengths greater than about 30bp.

[0010] Post-transcriptional chemical modification of ssRNA for analytical purposes has also been described by Merino (2005). Merino reacted ssRNA with N-methylisatoic anhydride (NMIA) in an aqueous medium containing 10% DMSO to generate 2'-O-esters of N-methyl-anthranilic acid at single-stranded nucleotides. Derivatization by this method was inefficient; less than 15% of the ssRNA strands in the reaction vessel were modified, and those that were modified had, on average, a single 2'-O-ester of NMIA per ssRNA strand. Under these conditions, dsRNA reacted with more than 80-fold lower efficiency, with less than 0.18% of the nucleotides in the stem region being modified, and only within one nucleotide at the stem end (i.e., within one nucleotide of the single-stranded region). Similar results have been observed for the reaction of RNA with other reaction participants (Nodin 2015). 1-Methyl-7-nitroisatoic anhydride (1M7), benzoyl cyanide (BzCN), 2-methyl-3-furoic acid imidazolide (FAI) and 2-methylnicotinic acid imidazolide (NAI) have been used to post-transcriptionally generate 2'-ribose esters of RNA but had similarly low rates of modification, with modifications occurring primarily at the ribose of the unpaired nucleotide or the paired nucleotide adjacent to them.

[0011] Unmodified polyribonucleic acid is an exceptionally unstable molecule. Unlike DNA, it contains a hydroxyl group at the 2' position of the ribose, which makes the RNA polymer susceptible to hydrolysis. Deprotonation of the 2'-OH followed by nucleophilic attack of the 2' oxygen on the phosphorus backbone is the primary molecular mechanism for cleavage of the phosphodiester bond by a variety of nucleolytic enzymes, including ribonuclease A (Elliot and Ladomery, 2011). Stabilization of the nucleic acid backbone against nucleolytic degradation has been a defining challenge for the evolution of siRNA-based therapeutics (Nair et al., 2014). The challenge of RNA stability is particularly important in the intestinal environment, which is rich in nucleolytic activity by a variety of endonucleases and phosphodiesterases involved in the digestion of nucleic acids (Whitt and Savage, 1988; Liu et al., 2015). A highly effective method to stabilize RNA molecules is the derivatization of the 2'-O group. A variety of modifications at this position have been demonstrated to improve the enzymatic stability of a variety of RNA molecules, including nanoassemblies (Liu et al. 2010) and RNAi silencing molecules (Khvorova and Watts, 2017). These modifications are commonly applied during the chemical synthesis of small interfering RNA (siRNA). Summary of the Invention [Problem to be solved by the invention]

[0012] While there have been many advances in the use of dsRNA, especially when it has chemical modification at 2'-OH position (specifically polyalkyloxypolymer), there is still a need for chemically modified dsRNA compositions that are more efficient, more soluble, and more bioavailable than those that have been available in the past.There is also a need for synthetic methods that make these chemically modified dsRNA compositions in an efficient manner that allows large-scale production. [Means for solving the problem]

[0013] Described herein are post-transcriptionally chemically modified double-stranded RNAs (MdsRNAs) with high molecular weight polyalkyloxy modifications at the 2'-OH position. These modifications allow for greater bioavailability of the compounds, better stability of the compounds, and greater stability against nucleases. As described herein, these MdsRNAs can be produced economically in a readily scalable manner.

[0014] The present disclosure describes compositions of modified double-stranded RNA (MdsRNA) having chemically modified nucleotides, such that the MdsRNA is modified to include high molecular weight polyalkyloxy polymers, and optionally further includes 2'-O chemically modified nucleotides to include low molecular weight (LMW) moieties (LMW modified nucleotides). The present disclosure also describes synthetic methods for efficiently making these modified MdsRNAs.

[0015] Thus, in one aspect, the disclosure provides a post-transcriptionally chemically modified double-stranded RNA (MdsRNA), wherein about 30% or less of all nucleotides independently have the formula (I): [ka] or an acceptable salt thereof, 1 The present invention provides compositions comprising MdsRNA, including double-stranded RNA comprising the MdsRNA sequence (as defined herein).

[0016] In an embodiment of this aspect, the post-transcriptional chemical modification of the duplex RNA comprises about 30% or less of all nucleotides being modified with a high molecular weight polyalkyloxy polymer. In another embodiment, the post-transcriptional chemical modification of the duplex RNA further comprises at least about 2% of all nucleotides being modified with an LMW moiety. In one embodiment, the post-transcriptional chemical modification of the duplex RNA further comprises about 2% to about 50% of all nucleotides being modified with an LMW moiety. In an embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 3:5:2. In another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 3:6.5:0.5. In yet another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 1:7:2. In yet another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.5:9:0.5. In yet another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.3:4:5.7. In yet another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.01:4:5.99. In yet another embodiment, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.06:0:96.4.

[0017] In another aspect, the disclosure provides a post-transcriptionally chemically modified double-stranded RNA (MdsRNA), wherein about 30% or less of all nucleotides are independently represented by the formula (I): [ka] or an acceptable salt thereof, 1The present invention provides a method for preparing a composition comprising MdsRNA, the composition comprising a double-stranded RNA comprising MdsRNA (as defined herein).

[0018] Methods are disclosed for making embodiments of the compositions described herein. In one embodiment of the method of preparing the composition, the post-transcriptional chemical modification of the duplex RNA comprises not more than about 30% of all nucleotides being modified with a high molecular weight polyalkyloxy polymer. In another embodiment of the method of preparing the composition, the post-transcriptional chemical modification of the duplex RNA further comprises at least about 2% of all nucleotides being modified with an LMW moiety. In one embodiment, the post-transcriptional chemical modification of the duplex RNA further comprises about 2% to about 50% of all nucleotides being modified with an LMW moiety. In one embodiment of the method of preparing the composition, the post-transcriptional chemical modification of the duplex RNA comprises a ratio of high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides of about 3:5:2. In another embodiment of the method of preparing the composition, the post-transcriptional chemical modification of the duplex RNA comprises a ratio of high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides of about 3:6.5:0.5. In yet another embodiment of the method for preparing a composition, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 1:7:2. In yet another embodiment of the method for preparing a composition, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.5:9:0.5. In yet another embodiment of the method for preparing a composition, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.3:4:5.7. In yet another embodiment of the method for preparing a composition, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.01:4:5.99. In yet another embodiment of the method for preparing a composition, the post-transcriptional chemical modification of the duplex RNA comprises high molecular weight modified nucleotides to LMW modified nucleotides to unmodified nucleotides in a ratio of about 0.06:0:96.4.

[0019] In a further aspect, the disclosure provides methods of modifying expression of a polynucleotide of interest in an insect, fungus, weed or mite using any of the compositions, target insects, fungi, weeds or mites, and sequences described herein.

[0020] The foregoing will be apparent from the following more particular description of example embodiments. [Brief description of the drawings]

[0021] [Figure 1] FIG. 1 shows the cumulative mortality of diamondback moth larvae following administration of selected compounds of formula (I). [Diagram 2] FIG. 2 shows the reduction in dsRNA content on cabbage leaves in the field for C2 treatment, unmodified dsSNF7, and the modified dsSNF7 treatments NS2 (PEG-dsSNF7) and NS5 (NMIA-dsSNF7). [Diagram 3] FIG. 3 shows mortality of diamondback moth larvae in fields 3 days (3DA-A) and 4 days (4DA-A) after administration of selected compounds of formula (I). [Figure 4] Figure 4 shows agarose gel electrophoresis analysis of 300 bp dsRNA modified with 10k activated PEG. Lines: 1-DNA ladder; 2-original dsRNA; 3-10kPEG-MdsRNA reaction mixture. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] definition The term "about" is used herein to mean approximately, approximately, around, or within the range of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending boundaries above and below the numerical values ​​set forth. In general, the term "about" is used herein to modify numerical values ​​above and below a stated value by a variance of 20 percent (higher or lower).

[0023] The term "sequence" or "nucleotide sequence" as used herein refers to a sequence or order of nucleobases, nucleotides and / or nucleosides, written as a sequence of letters using standard nucleotide nomenclature and significant to the modified nucleotides described herein. The sequences described herein are listed from the 5' end to the 3' end. One of ordinary skill in the art would understand that the reverse complement (i.e., written from the 3' end to the 5' end) can be a perfect reverse complement or a strand that includes a stretch of contiguous nucleotides from about 11 nucleotides to about 60 nucleotides in length, where each such stretch of about 11 to about 60 contiguous nucleotides is the reverse complement of a stretch of equal length in the sequences described herein.

[0024] In some embodiments, the MdsRNA is at least 40, at least 30, at least 50, at least 70, at least 80, at least 90, or at least 100 base pairs in length. The MdsRNA sense strand comprises a sense sequence, and the MdsRNA antisense strand comprises an antisense sequence. The antisense sequence is 100% (fully) complementary, or at least 90% (substantially) complementary, or at least 80% (partially) complementary to a nucleotide sequence present in the transcribed mRNA or untranslated RNA (i.e., expressed RNA) of the target gene. The sense sequence is 100% (fully) complementary, or at least 90% (substantially) complementary, or at least 80% (partially) complementary to the antisense sequence. The sense sequence may also be 100% identical, at least 90% identical, or at least 80% identical to a nucleotide sequence present in the mRNA or untranslated RNA of the target gene (target sequence). The sense sequence and the corresponding antisense sequence are partially (at least 80%), substantially (90%), or completely (100%) complementary to each other. In some embodiments, the region of complementarity (antisense sequence) or identity (sense sequence) between the MdsRNA and the corresponding sequence in the transcribed mRNA or untranslated RNA sequence of the target gene is more than 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length. In some embodiments, the antisense sequence comprises a contiguous sequence of more than 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length that is 100% complementary or at least 80% complementary to the corresponding contiguous sequence in the transcribed mRNA or untranslated RNA of the target gene. The sense and antisense sequences of the MdsRNA can be either the same length or 60 different lengths. Suitable sense and antisense sequences are identified using known methods readily available in the art.

[0025] As used herein, the term "nucleotide" refers to a single base pair unit that contains a purine or pyrimidine base pair moiety (e.g., a unit of Formula I or an unmodified ribose). The term may refer to a nucleotide unit with or without an attached intersubunit bond, although when referring to a "charged subunit," the charge typically resides in the intersubunit bond.

[0026] The purine or pyrimidine base pair moiety, also referred to herein simply as a "nucleobase," "base," or "bases," may be adenine, cytosine, guanine, uracil, thymine, or inosine. pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., lipothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidine or 6-alkylpyrimidine (e.g., 6-methyluridine), propyne, quesosine, 2-thiouridine, 4-thiouridine, wybutoxosine, 4-acetyltidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethyl ... Also included are bases such as dimethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, β-D-galactosylketosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, 13-D-mannosylketosine, uridine-5-oxyacetic acid, 2-thiocytidine, threonine derivatives and others (Burgin et al., 1996, Biochemistry, 35:14090; Uhlman & Peyman, supra). "Modified bases" in this embodiment refers to nucleotide bases other than adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), as exemplified above; such bases can be used at any position in the antisense molecule. One of skill in the art will recognize that Ts and Us are interchangeable, depending on the use of the oligomer.For example, in the case of other antisense chemistries such as 2'-O-methyl antisense oligonucleotides, which are more RNA-like, the T base may be represented as U.

[0027] As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the nucleotides in the MdsRNA are post-synthetically modified. Modified nucleotides include, but are not limited to, nucleotides with ribose 2'-OH substitutions. By "independently", it should be understood that each of the modified nucleotides may have the same modification or different modifications selected from high molecular weight polyalkyloxy polymers and low molecular weight moieties, if present.

[0028] "Unmodified" dsRNA is an RNA molecule that has not been chemically modified.

[0029] As used herein, the term "polyalkoxy" or "polyalkyloxy", as used interchangeably herein, refers to suitable water-soluble polymers characterized by repeating alkoxy units. Selected, but non-limiting examples of such polymers include polyethylene glycol (PEG), polypropylene glycol (PPG), poloxamer, hyaluronic acid, polyvinyl alcohol, polyoxazoline, polyanhydride, poly(orthoester), polycarbonate, polyurethane, polyacrylic acid, polyacrylamide, polyacrylate, polymethacrylate, polyorganophosphazene, polysiloxane, polyvinylpyrrolidone, polycyanoacrylate, polyester, or derivatives of any of the above.

[0030] In some embodiments, the term "polyalkoxy" or "polyalkyloxy" as used herein refers to a suitable linear or branched polyethylene glycol (PEG) polymer. In some embodiments, the polyalkoxy is a linear or branched polypropylene glycol (PPG) polymer. In some embodiments, the polyalkyloxy is a poloxamer. In some embodiments, the polymer is an ethylene glycol-propylene glycol block copolymer poloxamer. In another embodiment, the polymer is poly(ethylene glycol)-block-poly(propylene glycol)-block-poly(ethylene glycol), PEG-PPG-PEG poloxamer. In yet another embodiment, the polymer is an ethylene oxide-propylene oxide triblock copolymer. In some embodiments, the polyalkyloxy has a molecular weight of at least about 400 Da, at least about 1 kDa, at least about 5 kDa, or at least about 10 kDa. In another embodiment, the molecular weight of the polyalkyloxy is about 400 Da to about 40 kDa, or about 5 kDa to about 40 kDa.

[0031] The term "poloxamer" as used herein refers to a non-ionic triblock copolymer consisting of a central hydrophobic chain of polyoxypropylene flanked by two hydrophilic chains of polyoxyethylene. Selected, but non-limiting, examples of poloxamers include poloxamers 407, 338, 188, 184, and 401 (i.e., F127, F108, L68, L64, and L121 Pluronic®, BASF). Multiplying the first two numbers by 100 gives the approximate molecular weight of the polyoxypropylene core, and multiplying the final number by 10 gives the percentage of polyoxyethylene content. "L" stands for liquid and "F" stands for flake solid.

[0032] The amphiphilic nature of the resulting polymer-modified dsRNAs of the present disclosure, i.e., the presence of both hydrophilic and lipophilic groups, modulates their physical and chemical properties, such as solubility, absorption and permeability through plant tissue and target cell membranes, and resistance to nucleases. The polymers that produced the most effective MdsRNAs have a hydrophilic-lipophilic (Lipohilic) balance (HLB) number ranging from 8 to 27. In one embodiment, the HLB is from about 2 to about 30. In another embodiment, the HLB is from about 15 to about 27.

[0033] As used herein, the term "high molecular weight polyalkyloxy" refers to a compound, substituent, or other chemical moiety that includes a polyalkyloxy group having a molecular weight of at least about 400 Da. In some embodiments, the molecular weight of the polyalkyloxy is at least about 1 kDa. In some embodiments, the molecular weight of the polyalkyloxy is at least about 5 kDa. In other embodiments, the molecular weight of the polyalkyloxy is at least about 10 kDa. In other embodiments, the molecular weight of the polyalkyloxy is from about 400 Da to about 40 kDa. In yet other embodiments, the molecular weight of the polyalkyloxy is from about 5 kDa to about 40 kDa.

[0034] As used herein, the term "low molecular weight (LMW) modified nucleotide" refers to a nucleotide having a 2'-OH low molecular weight modification. A low molecular weight modification is a moiety of 1,000 daltons or less. For example, R 2 Examples of modifications when identified as: 25 Alkyl, C1-C 25 Alkenyl, C1-C 25 Alkynyl, C5-C 12 Aryl or C5-C 12 and heteroaryl, any of which may optionally be selected from halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 One or more substituents selected from alkoxy (i.e., R 2In some embodiments, at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the nucleotides in the MdsRNA are post-transcriptionally chemically modified with LMW-modified nucleotides. In some embodiments, the chemical modification is an ester of N-methyl-anthranilic acid (from modification with N-methylisatoic anhydride (NMIA)), an ester of N-benzyl-anthranilic acid (from modification with N-benzylisatoic anhydride (NBIA)), dimethylfuroyl, an ester of a fatty acid (e.g., C1-C18, such as, but not limited to, lauryl, oleic acid, linoleic acid), acetate, propionate, an ester of an amino acid (e.g., tyrosine, tryptophan, leucine), a low molecular weight PEG, or a nitrogen-containing moiety.

[0035] Without being limited by theory, it is believed that the presence of LMW moieties allows the composition to be more fully dissolved in organic solvents for delivery of the composition to plants and ultimately to target insects. The composition can be more concentrated in an economical amount for the end user. Furthermore, it has been shown that the degradation rate of the composition in the area of ​​use is reduced by filling the space in MdsRNA that is not modified with high molecular weight polyalkyloxy polymers. In other words, nucleotides that are not modified with high molecular weight polyalkyloxy polymers can be modified with low molecular weight moieties as described herein. The degree of modification of the nucleotide with low molecular weight moieties will depend on the desired properties of the composition with respect to the degradation rate, solubility and concentration, among other benefits.

[0036] As used herein, the term "alkyl" or "alkyl group" refers to a univalent group derived from an alkane by removing a hydrogen atom from any carbon atom, such as -C n H 2n+1Alkyl groups can be straight or branched chain or cyclic and include methyl, ethyl, propyl, isopropyl, butyl, hexyl, etc. As used herein, lower alkyl groups contain 1 to 25 carbon atoms in the main chain.

[0037] As used herein, the term "alkenyl" refers to an alkyl group having one carbon-carbon double bond and having the general formula -C n H 2n-1 Alkenyl is an acyclic branched or unbranched hydrocarbon having the formula: wherein one or more of the hydrogen atoms may be substituted. The alkyl group may be straight or branched chain and includes ethenyl, propenyl, isopropenyl, butenyl, isobutenyl, hexenyl, and the like. As used herein, alkenyl contains 2 to 25 carbon atoms in the main chain.

[0038] The term "alkoxide" or "alkoxy" as used herein is a conjugated group of an alcohol. The alcohol can be linear, branched, or cyclic and includes aryloxy compounds, including methoxy, ethoxy, isoproyloxy, butoxy, and the like.

[0039] As used herein, the term "alkynyl" refers to a group having a carbon-carbon triple bond and the general formula -C n H 2n-3 They may be straight or branched chain and include ethynyl, propynyl, butynyl, isobutynyl, hexynyl, and the like. As used herein, lower alkynyl contains 2 to 25 carbon atoms in the main chain.

[0040] The terms "aryl" or "Ar" as used herein, alone or as part of another group, refer to an optionally substituted homocyclic aromatic group. Aryl groups can be monocyclic or bicyclic groups containing 5 to 12 carbons in the ring portion, such as phenyl, biphenyl, naphthyl, substituted phenyl, substituted biphenyl, or substituted naphthyl.

[0041] The term "heteroaryl" as used herein, alone or as part of another group, refers to an optionally substituted aromatic group having at least one heteroatom in at least one ring. In some embodiments, the heteroaromatic group contains 5 or 6 atoms in each ring. In some embodiments, the heteroaromatic group contains 1 or 2 oxygen atoms and / or 1 to 4 nitrogen atoms in the ring and is bonded to the remainder of the molecule through a carbon. Exemplary groups include furyl, benzofuryl, oxazolyl, isoxazolyl, oxadiazolyl, benzoxazolyl, benzoxadiazolyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, pyridyl, pyrimidyl, pyrazinyl, pyridazinyl, indolyl, isoindolyl, indolizinyl, benzimidazolyl, indazolyl, benzotriazolyl, tetrazolopyridazinyl, carbazolyl, purinyl, quinolinyl, isoquinolinyl, imidazopyridyl, and the like. Exemplary substituents include one or more of the following groups: hydrocarbyl, substituted hydrocarbyl, alkyl, alkoxy, acyl, acyloxy, alkenyl, alkenoxy, aryl, aryloxy, amino, amido, acetal, carbamyl, carbocyclo, cyano, ester, ether, halogen, heterocyclo, hydroxyl, keto, ketal, phosphor, nitro, and thio.

[0042] The term "heteroatom" refers to atoms other than carbon and hydrogen.

[0043] The terms "halogen" or "halo," as used herein, alone or as part of another group, refer to chlorine, bromine, fluorine, or iodine.

[0044] The term "greater stability" as used herein refers to the compounds of the present application when compared to unmodified dsRNA or low molecular weight polyalkyloxy modified MdsRNA. In some embodiments, greater stability refers to increased persistence in agricultural fields, in plant tissues, on plant leaves, etc. In some embodiments, greater stability refers to increased in vivo half-life. In some embodiments, greater stability refers to increased resistance to physiological pathologies. In other embodiments, greater stability refers to increased resistance to nucleases.

[0045] As used herein, "acceptable salts" refers to salts derived from suitable inorganic and organic acids and bases which, within the scope of sound judgment, are suitable for use in contact with the tissues of humans, lower animals, and plants without undue toxicity, irritation, allergic response, or the like, and which are commensurate with a reasonable risk-benefit ratio.

[0046] The salts of the disclosed compounds can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two.

[0047] As used herein, the term "scalable" refers to the ability of a process to produce commercially significant quantities of a target chemical. For example, the present process may allow for production of a compound on a hundreds of milligrams scale. In some examples, the present process may allow for production of a compound on a gram scale. In some examples, the present process may allow for production on a kilogram scale. In some examples, the present process may allow for production on a 1,000 kilogram scale.

[0048] As used herein, the term "activation agent" or "activating agent" refers to a compound that increases the nucleophilicity or electrophilicity of a targeting moiety. The change in electron density can be the result of ionic or covalent attachment from an activating group. In some embodiments, the activators described herein increase the electrophilicity of a target carbonyl. Non-limiting examples of activating agents include Lewis acids, protons, and coupling reagents. Non-limiting examples of coupling reagents include benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP), benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (PyBOP), (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, hexafluorophosphate benzotriazole tetramethyluronium (HBTU), N,N'-dicyclohexylcarbodiimide (DCC), carbonyldiimidazole (CDI), and 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate, hexafluorophosphate azabenzotriazole tetramethyluronium (HATU).

[0049] The term "suitable leaving group" as used herein refers to a molecular fragment that leaves a pair of electrons in anisotropic bond cleavage. Leaving groups serve to facilitate reactions by lowering the energy of activation. Non-limiting examples of suitable leaving groups include halides, tosylated or mesylated alcohols, pseudohalides, amines, heterocycles, and the like. In certain embodiments, a suitable leaving group is imidazole.

[0050] As used herein, the term "anhydrous solvent" refers to a solvent that has been physically or chemically treated to reduce the water content of the solvent. An anhydrous solvent may contain less than about 1% water by weight, less than about 0.3% water by weight, or less than about 0.1% water by weight.

[0051] composition MdsRNA is described in which up to about 30% of all ribose rings are chemically modified at the 2'-OH position with a high molecular weight polyalkyloxy polymer, and optionally, at least about 2% of all nucleotides are chemically modified with an LMW modifying moiety. MdsRNA is capable of inhibiting gene expression in a sequence-specific manner, for example, via RNA interference or antisense mechanisms.

[0052] Thus, in one aspect, provided herein is a post-transcriptionally chemically modified double-stranded RNA (MdsRNA) in which no more than about 30% of all nucleotides independently have the formula (I): [ka] or an acceptable salt thereof, B is a nucleobase; R 1 teeth, [ka] (wherein y is an integer of 1 to 8, x is an integer of 12 to 1000, a is an integer of 12 to 1000, b is an integer of 12 to 1000, and c is an integer of 12 to 1000))

[0053] In another aspect, provided herein is a post-transcriptionally chemically modified double-stranded RNA (MdsRNA), in which no more than about 30% of all nucleotides are independently represented by the formula (I): [ka] or an acceptable salt thereof, B is a nucleobase; R 1 teeth, [ka] (wherein y is an integer of 1 to 8, x is an integer of 12 to 1000, a is an integer of 12 to 1000, b is an integer of 12 to 1000, and c is an integer of 12 to 1000); and Optionally, at least about 2% of all nucleotides independently have the formula (III): [ka] or an acceptable salt thereof, B is a nucleobase; R 2 is C1~C 25 Alkyl, C1-C 25 Alkenyl, C1-C 25 Alkynyl, C5-C 12 Aryl or C5-C 12 heteroaryl, where R 2 In some cases, halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 The present invention relates to a composition comprising MdsRNA, the composition comprising MdsRNA, the duplex RNA ...

[0054] An embodiment of this aspect of the composition follows.

[0055] In one embodiment, R 1 is selected from the following: [ka]

[0056] In another embodiment, x is an integer from 80 to 1000.

[0057] In another embodiment, x is an integer from 50 to 900.

[0058] In another embodiment, a is an integer from 80 to 1000.

[0059] In yet another embodiment, b is an integer from 80-1000.

[0060] In a further embodiment, c is an integer from 80 to 1000.

[0061] In one embodiment, R 1 has a molecular weight of 5,000 to 15,000 Da.

[0062] In one embodiment, R 1 has a molecular weight of 5,000 to 40,000 Da.

[0063] In one embodiment, R 1 is polyethylene glycol (PEG).

[0064] In one embodiment, R 1 is poloxamer 407, 338, 188, 184, 401 or any combination thereof.

[0065] In one embodiment, a is 101, b is 56, and c is 101.

[0066] In one embodiment, R 1 is a HMW polymer with an HLB ranging from about 2 to about 30. 1 is a HMW polymer with an HLB ranging from about 15 to about 27.

[0067] In one embodiment, R 2 is N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl or benzoyl.

[0068] In one embodiment, R 1 teeth, [ka] and R 2is N-methylanthranoyl.

[0069] In one embodiment, R 1 teeth, [ka] and R 2 is lauroyl.

[0070] In one embodiment, R 1 teeth, [ka] and R 2 is linoleyl.

[0071] In one embodiment, R 1 teeth, [ka] and R 2 is Oleil.

[0072] In embodiments, the ratio of Formula (I) to Formula (III) to unmodified nucleotides is about 3:5:2; 3:6.5:0.5; 1:7:2; 0.05:9:0.5; 1.3:4:5.7; 0.01:4:5.99; 0.06:0:96.4.

[0073] In an embodiment, about 2% to about 50% of all nucleotides are modified with an LMW moiety.

[0074] In another embodiment, the MdsRNA comprises a sequence complementary to an RNA expressed in a target insect. For example, an effective sequence or target gene useful in the products and methods of the present disclosure will inhibit expression of a target gene, affect the insect midgut, increase mortality, induce growth inhibition, or arrest aging development.

[0075] In some embodiments, the target insect is Plutella xylostella, gypsy moth, Solenopsis invicta, fall armyworm, Colorado potato beetle, Canola flea beetle, Aedes aegypti, or Western corn rootworm. In another embodiment, the target insect is Acyrthosiphon pisum, soybean aphid, or Piezodorus guildinii. In another embodiment, the target is a mite, such as Verroa mite. In another embodiment, the target is a weed, such as common amaranth. In yet another embodiment, the target is a fungus such as Plutella retroflexus, Fusarium graminearum (Gibberella zeae) or Botrytis. Thus, the MdsRNA used in the compositions of the present disclosure will be a nucleotide sequence that can inhibit expression of a target gene or region in these insects. For example, the MdsRNA includes sequences complementary to target regions in Plutella xylostella, such as, but not limited to, AChE2, P450, P450 CYP6BF1v1, cytokine receptor DOMELESS, DOUX, protein MESH transcript variant X1, venom carboxylesterase-6 and VPASE-E. In another embodiment, the MdsRNA comprises a sequence complementary to a target region in Fall Armyworm, such as, but not limited to, P450 CYP9A58, cytokine receptor DOMELESS, Dredd, VPASE, protein MESH transcript variant X1, P450 CYP321A8, P450 CYP6B2-like.

[0076] In another embodiment, the MdsRNA comprises a sequence complementary to a target region in Western corn rootworm, such as, but not limited to, SNF7.

[0077] In certain embodiments, the MdsRNA comprises a sequence selected from one of SEQ ID NOs: 1-269 and their reverse complements. In particular embodiments, the sequence is selected from one of SEQ ID NOs: 13 or 248-251 and their reverse complements. In certain embodiments, the target insect is a Lepidopteran and may be targeted using any one of SEQ ID NOs: 1-269. In certain embodiments, the Lepidopteran is targeted using any one of SEQ ID NOs: 13 or 248-251.

[0078] In another aspect, provided herein is a post-transcriptionally modified double-stranded RNA (MdsRNA) in which about 30% or less of all nucleotides are independently represented by the formula (I): [ka] or an acceptable salt thereof, B is a nucleobase; R 1 is a linear or branched polyalkyloxy having a molecular weight of about 400 Da to about 15 kDa, Optionally, at least about 2% of all nucleotides independently have the formula (III): [ka] or an acceptable salt thereof, B is a nucleobase; and R 2 is C1~C 25 Alkyl, C1-C 25 Alkenyl, C1-C 25 Alkynyl, C5-C 12 Aryl or C5-C 12 heteroaryl, where R 2 In some cases, halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 The present invention relates to a composition comprising MdsRNA, the composition comprising MdsRNA, the duplex RNA ...

[0079] An embodiment of this aspect of the composition follows.

[0080] In one embodiment, R 1 is a linear or branched polyalkyloxy or poloxamer having a molecular weight of about 1 kDa to about 15 kDa.

[0081] In another embodiment, R 1 is a linear or branched polyalkyloxy or poloxamer having a molecular weight of about 5 kDa to about 15 kDa.

[0082] In another embodiment, R 1 is a linear or branched polyalkyloxy or poloxamer having a molecular weight of about 5 kDa to about 10 kDa.

[0083] In one embodiment, R 1 is a polyethylene glycol polymer.

[0084] In one embodiment, R 1 is a poloxamer. In one embodiment, the poloxamer is a triblock polymer comprising poly(ethylene glycol)-block-poly(propylene glycol)-block-poly(ethylene glycol).

[0085] In one embodiment, R 1 is a HMW polymer with an HLB ranging from about 2 to about 30. 1 is a HMW polymer with an HLB ranging from about 15 to about 27.

[0086] In one embodiment, R 2 is C1~C 25 In one embodiment, C1-C 25 Alkyl, halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 In one embodiment, the alkyl group is substituted with one or more substituents selected from C1 to C6.25 Alkyl, halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 and alkoxy.

[0087] In one embodiment, R 2 is N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl or benzoyl.

[0088] In embodiments, the ratio of Formula (I) to Formula (III) to unmodified nucleotides is about 3:5:2; 3:6.5:0.5; 1:7:2; 0.05:9:0.5; 1.3:4:5.7; 0.01:4:5.99; 0.06:0:96.4.

[0089] In an embodiment, about 2% to about 50% of all nucleotides are modified with an LMW moiety.

[0090] In another embodiment, the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, weed, fungus or acar, as discussed herein, the sequence listing and examples of this disclosure.

[0091] In one embodiment, R 1 teeth, [ka] (wherein y is an integer of 1 to 8, x is an integer of 12 to 1000, a is an integer of 12 to 1000, b is an integer of 12 to 1000, and c is an integer of 12 to 1000).

[0092] In one embodiment, R 1 teeth, [ka] wherein at least 2% of all nucleotides independently comprise an LMW-modified nucleotide of formula (III) as defined above.

[0093] In another embodiment, x is an integer from 80 to 1000.

[0094] In another embodiment, x is an integer from 50 to 900.

[0095] In another embodiment, a is an integer from 80 to 1000.

[0096] In yet another embodiment, b is an integer from 80-1000.

[0097] In a further embodiment, c is an integer from 80 to 1000.

[0098] In one embodiment, R 1 has a molecular weight of 5,000 to 15,000 Da.

[0099] In one embodiment, R 1 has a molecular weight of 5,000 to 40,000 Da.

[0100] In one embodiment, R 1 is polyethylene glycol (PEG).

[0101] In one embodiment, R 1 is poloxamer 407, 338, 188, 184, 401, or any combination thereof.

[0102] In one embodiment, a is 101, b is 56, and c is 101.

[0103] In one embodiment, R 1 is a HMW polymer with an HLB ranging from about 2 to about 30. 1 is a HMW polymer with an HLB ranging from about 15 to about 27.

[0104] In one embodiment, R 2 is N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl or benzoyl.

[0105] In embodiments, the ratio of Formula (I) to Formula (III) to unmodified nucleotides is about 3:5:2; 3:6.5:0.5; 1:7:2; 0.05:9:0.5; 1.3:4:5.7; 0.01:4:5.99; 0.06:0:96.4.

[0106] In an embodiment, about 2% to about 50% of all nucleotides are modified with an LMW moiety.

[0107] In one embodiment, the sequence of the MdsRNA is selected from one of 13 or 248-251.

[0108] In another embodiment, the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, weed, fungus or acar, or in any of the targets discussed herein and in the sequence listing and examples of this disclosure.

[0109] In one embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above.

[0110] In another embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above.

[0111] In yet another embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above.

[0112] In another embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above. In another embodiment, the terminal -H can be replaced with -CH3.

[0113] In a further embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above. In another embodiment, the terminal -H can be replaced with -CH3.

[0114] In another embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above. In another embodiment, the terminal -H can be replaced with -CH3.

[0115] In a further embodiment, the compound of formula (I) is [ka] or an acceptable salt thereof, where each variable is defined above. In another embodiment, the terminal -H can be replaced with -CH3.

[0116] In some embodiments, each B in formula I is the same.

[0117] In another embodiment, each B in formula I is different.

[0118] In some embodiments, each R of formula I 1 is the same.

[0119] In some embodiments, each R of formula I 1 is different.

[0120] In some embodiments, the base pairs in the MdsRNA are at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 350, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1,000 in length. In some embodiments, the base pairs in the MdsRNA are from about 40 base pairs to about 1,000 base pairs. In another embodiment, the MdsRNA is from about 50 base pairs to about 900 base pairs. In some embodiments, the MdsRNA is from about 70 base pairs to about 800 base pairs. In another embodiment, the MdsRNA is from about 80 base pairs to about 700 base pairs. In some embodiments, the MdsRNA is from about 90 base pairs to about 600 base pairs. In one embodiment, the MdsRNA is from about 100 to about 500 nucleotides, hi another embodiment, the MdsRNA is from about 200 to about 400 base pairs.

[0121] Target sequences useful in the products and methods of the present disclosure are selected to target the lowest guanine-cytosine (GC) content, for example, about 60% or less and preferably about 40% or less of the GC content of the target insect, fungus or weed, allowing the highest level of modification under mild reaction conditions. In another embodiment, the MdsRNA targets a sequence with a low guanine-cytosine content. In an embodiment, the guanine-cytosine content is about 50% or less. In an embodiment, the guanine-cytosine content is about 40% or less. In an embodiment, the guanine-cytosine content is about 30% to about 40%. In an embodiment, the guanine-cytosine content is about 30%, about 35%, about 40%, about 50% or about 55%. The degree of modification of nucleotides depends on the GC content of the dsRNA. The degree of modification (e.g., the percentage of modifiable nucleotides) can range from about 2% to about 90%, where about 2% to about 30% can be high molecular weight polyalkyloxy polymer and about 2% to about 90% can be low molecular weight filler moieties.

[0122] Without being bound by theory, it is believed that when reaction conditions are such that the sense and antisense strands in a dsRNA are only partially dissociated (i.e., only partially zipped), e.g., at temperatures below 60° C. or at low concentrations of solvents or cosolvents that can dissociate the sense and antisense strands, e.g., at DMSO concentrations below 70%, or at temperatures below 60° C. and below 70% DMSO, the ribose at nucleotides located less than 10 contiguous nucleotides from the beginning or end of a perfectly paired stretch of the dsRNA can be preferentially modified, i.e., modified to a greater extent than the ribose at nucleotides located more than 10 contiguous nucleotides away. For example, under such partially non-zipping reaction conditions, the ribose at nucleotides 1-10 and 290-300 in a 300 bp dsRNA can be modified to a greater extent than the ribose at positions 11-289.

[0123] Post-transcriptionally modified double-stranded RNA (MdsRNA) compounds are significantly less susceptible to degradation by nucleases in the environment and in the host. MdsRNA downregulates the expression of polynucleotides present in the target host by the RNAi mechanism. MdsRNA compounds consist of UdsRNA in which some of the H atoms of its 2'OH group are replaced with different chemical moieties, for example, benzoyl, lauroyl, oleyl, linoleyl, N-methylanthranoyl, nicotinoyl, or furoyl (US Pat. No. 10,131,911). These chemical moieties are generally non-toxic and in any case susceptible to eventual degradation in the environment, thereby reducing negative environmental effects. MdsRNA is expected to be non-toxic, similar to UdsRNA.

[0124] In some embodiments, the MdsRNA sense strand is connected to the antisense strand. The sense strand may be connected to the antisense strand via a non-hybridizing hairpin or loop sequence. The loop sequence may be from about 4 to about 100 or more nucleotides in length. In some embodiments, the loop is 150 or more nucleotides in length (Hauge et al. 2009). In some embodiments, the MdsRNA further comprises one or more additional sequences, including but not limited to: a promoter sequence, a 5' sequence, a 3' sequence, a terminator sequence, and a polyA sequence.

[0125] A promoter is a region (sequence) of DNA that initiates transcription of a gene. A promoter can be a bacterial promoter, an archaeal promoter, a eukaryotic promoter, or a Pol I, Pol II, or Poll III promoter. In some embodiments, a bacterial promoter contains the sequence 5'-TTGACA-3' about 35 units upstream from the transcription start site and the sequence 5'-TATAAT-3' about 10 bp upstream from the transcription start site. Other promoters suitable for use with different expression systems are well known in the art.

[0126] Certain embodiments of the present disclosure require that a higher molecular weight polyalkyloxy polymer is covalently attached to the 2'-OH position of the intersubunit linkage. Preferred embodiments of the present disclosure require that a low percentage (e.g., less than about 30%) of all subunits are replaced with such polymers. In some embodiments, the percentage of all subunits to be replaced with such polymers is about 1%. In some embodiments, the percentage of substituted subunits is about 1% to about 30%. In other embodiments, the percentage of substituted subunits is about 1% to about 5%. In still other embodiments, the percentage of substituted subunits is less than about 1%. In other embodiments, the percentage of substituted subunits is about 0.1% to about 1%. Compounds of the present disclosure exhibit equivalent or superior properties to compounds having a lower weight polyalkyloxy polymer at the 2'-OH position.

[0127] Without being bound by any theory, the compounds of the present disclosure exhibit equivalent or superior properties to compounds having lower weight polyalkyloxy polymer compounds, because the compounds have better solubility, enhanced bioavailability, and are resistant to nucleases. Surprisingly, the compounds easily cross cell membranes, whereas PEG and similar groups are known to block passage through membranes. Also unexpectedly, the polyalkyloxy polymers of the present disclosure, even at low percentage levels (e.g., about 1% to about 30%), confer advantageous stability properties over other compounds having significantly higher percentages of PEG or PEG-type substitution (e.g., the compounds are resistant to exonucleases at about 1% to about 30%).

[0128] Without being bound by any theory, the compounds of the present disclosure (i.e., compounds with high molecular weight polyalkyloxy polymers) are resistant to hydrolysis by carboxylic acid esterases. This may be due to the polyalkyloxy polymer being sterically too large for the catalytic pocket of esterases. As the polyalkyloxy polymer becomes larger, it can hydrogen bond more with the 2'OH group of unmodified nucleotides, and therefore, even low levels of modification, as described herein, can cause further steric hindrance. Finally, as described herein, the modification of MdsRNA strands can occur preferentially at the ends of MdsRNA strands due to the steric hindrance of the molecules. Thus, while the MdsRNA strands are resistant to exonucleases, they are still available to endonucleases, allowing the compounds of the present disclosure to be more easily imported into the RNAi process.

[0129] The embodiments and aspects in this and other sections of the disclosure relating to compositions, methods of making compositions, nucleotide sequences and uses for target insects, fungi, weeds or mites are intended to be encompassed by the present disclosure herein.

[0130] Selected Array In one embodiment, the sequence is Plutella xylostella acetylcholinesterase 2 mRNA, GenBank AY061975.1 nucleotides #s:512-811; [ka]

[0131] In another embodiment, the sequence is Plutella xylostella acetylcholinesterase 1 mRNA, GenBank: AY970293.1 nucleotides #s: 889-1188; [ka]

[0132] In another embodiment, the sequence is Plutella xylostella tyrosine hydroxylase mRNA, GenBank: JN410829.1 nucleotides #s: 301-600; [ka]

[0133] In another embodiment, the sequence is Plutella xylostella integrin beta 1 mRNA, GenBank: GQ178290.1 ​​nucleotides #s: 531-830; [ka]

[0134] In another embodiment, the sequence is Plutella xylostella charged multivesicular body protein 4b-like mRNA (XM_011555904.1) nucleotides #s:321-620; [ka]

[0135] In another embodiment, the sequence is Plutella xylostella peptidoglycan recognition protein mRNA, GenBank: EU399240.1 nucleotides #s: 31-330; [ka]

[0136] In another embodiment, the sequence is Plutella xylostella mRNA in vacuolar ATP synthase subunit E, GenBank: AB189032.1 (same as NM_001305532.1) nucleotides #s: 64 to 363; [ka]

[0137] In another embodiment, the sequence is Western corn rootworm (Diabrotica virgifera virgifera) charged multivesicular body protein 4b (LOC114337301), mRNA sequence ID: XM_028287710.1; [ka]

[0138] In another embodiment, the sequence is Acyrthosiphon pisum V-type proton ATPase subunit E GenBank#: XM_008185078.2 nucleotides#s: 540 to 724; [ka]

[0139] In another embodiment, the sequence is the (RIFA) actin muscle of Solenopsis invicta (LOC105205816, GenBank: XM_011175337.1 nucleotides #465-763; [ka]

[0140] In yet another embodiment, the sequence is Gibberella zeae isolated NX3 cytochrome P450 51B gene GenBank: FJ216402.1 nucleotide positions 804 to 1023; [ka]

[0141] In another embodiment, the sequence is Fusarium graminearum PH-1 cytochrome P450 51 NCBI Reference Sequence: XM_011327038.1 nucleotide positions 163 to 400; [ka]

[0142] Method for preparing high molecular weight polyalkyloxy polymers by ionic solvation In another aspect, provided herein is a post-transcriptionally chemically modified double-stranded RNA (MdsRNA), in which no more than about 30% of all nucleotides are independently represented by the formula (I): [ka] or an acceptable salt thereof, B is a nucleobase; R 1 teeth, [ka] (wherein y is an integer of 1 to 8, x is an integer of 12 to 1000, a is an integer of 12 to 1000, b is an integer of 12 to 1000, and c is an integer of 12 to 1000), (a) A compound of formula (II): [ka] with an activator to form a compound of formula (IIA) [ka] where X is a suitable leaving group. and forming; (b) A compound of formula (IA): [ka] with a compound of formula (IIA) to form a compound of formula (I); The method includes:

[0143] In another aspect, provided herein is a post-transcriptionally chemically modified double-stranded RNA (MdsRNA), in which no more than about 30% of all nucleotides are independently represented by the formula (I): [ka] or an acceptable salt thereof, B is a nucleobase; R 1 teeth, [ka] (wherein y is an integer of 1 to 8, x is an integer of 12 to 1000, a is an integer of 12 to 1000, b is an integer of 12 to 1000, and c is an integer of 12 to 1000); and Optionally, at least about 2% of all nucleotides independently have the formula (III): [ka] or an acceptable salt thereof, B is a nucleobase; R 2 is C1~C 25 Alkyl, C1-C 25 Alkenyl, C1-C 25 Alkynyl, C5-C 12 Aryl or C5-C 12 heteroaryl, where R 2 In some cases, halo, C 1~12 Alkyl, C1-C 12 Aminoalkyl or C1-C 12 2. A method for preparing a composition comprising MdsRNA, comprising the steps of: (a) A compound of formula (II): [ka] with an activator to produce a compound of formula (IIA): [ka] where X is a suitable leaving group. and forming; (b) A compound of formula (IA): [ka] with a compound of formula (IIA) to form a compound of formula (I); (c) optionally a compound of formula (V): [ka] with an activator to produce a compound of formula (VA): [ka] where X is a suitable leaving group. and forming; (d) optionally a compound of formula (IA): [ka] with a compound of formula (VA) to form a compound of formula (III); The method includes:

[0144] In certain embodiments, (a) and (b) are carried out in an anhydrous solvent.

[0145] In certain embodiments, (c) and (d) are carried out in an anhydrous solvent.

[0146] In certain embodiments, the anhydrous solvent is selected from DMSO or DCM.

[0147] In another embodiment, (a) and (b) are carried out without intervening purification.

[0148] In another embodiment, (c) and (d) are carried out without intervening purification.

[0149] In yet another embodiment, there is a purification step between (a) and (b).

[0150] In another embodiment, there is a purification step between (c) and (d).

[0151] In some embodiments, the ionic solvent is added after (a).

[0152] In some embodiments, the ionic solvent is added after (c).

[0153] In certain embodiments, the ionic solvent is selected from benzyltributylammonium chloride or benzyltrimethylammonium chloride.

[0154] In another embodiment, the activating agent is carbonyldiimidazole.

[0155] In yet another embodiment, a suitable leaving group is [ka] (In the formula, [ka] represents the covalent point of attachment to the carbonyl of formula (IIA). It is.

[0156] In yet another embodiment, a suitable leaving group is [ka] (In the formula, [ka] represents the covalent point of attachment to the carbonyl of formula (VA). It is.

[0157] In a further embodiment, (b) has a ratio of less than 10 equivalents of a compound of Formula (IIA) per nucleotide of the dsRNA.

[0158] In a further embodiment, (d) has a ratio of about 2 equivalents to about 50 equivalents of a compound of Formula (VA) per nucleotide of the dsRNA.

[0159] In another embodiment, (b) has a ratio of less than 2 equivalents of the compound of Formula (IIA) per nucleotide of the dsRNA.

[0160] In another embodiment, (d) has a ratio of about 4 equivalents to about 25 equivalents of a compound of Formula (VA) per nucleotide of the dsRNA.

[0161] In another embodiment, the compound of formula (II) is anhydrous.

[0162] In another embodiment, the compound of formula (V) is anhydrous.

[0163] In yet another embodiment, R 1 teeth, [ka] is selected from.

[0164] In another embodiment, x is an integer from 80 to 1000.

[0165] In another embodiment, x is an integer from 50 to 900.

[0166] In another embodiment, a is an integer from 180 to 1000.

[0167] In yet another embodiment, b is an integer from 80-1000.

[0168] In a further embodiment, c is an integer from 80 to 1000.

[0169] In one embodiment, R 1 has a molecular weight of 5,000 to 10,000 Da.

[0170] In one embodiment, R 1 has a molecular weight of 5,000 to 40,000 Da.

[0171] In one embodiment, R 1 is polyethylene glycol (PEG).

[0172] In one embodiment, R 1 is poloxamer 407, 338, 188, 184, 401, or any combination thereof.

[0173] In one embodiment, a is 101, b is 56, and c is 101.

[0174] In one embodiment, R 1 is a HMW polymer with an HLB ranging from about 2 to about 30. 1 is a HMW polymer with an HLB ranging from about 8 to about 27.

[0175] In some embodiments, steps (c) and (d) are present.

[0176] In some embodiments, steps (b) and (d) are performed sequentially.

[0177] In some embodiments, steps (b) and (d) are performed simultaneously.

[0178] In another embodiment, the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, fungus, weed or mite, including, but not limited to, a target (insect, fungus, weed or mite), a target sequence and a target region, as discussed in detail in this disclosure.

[0179] In another embodiment, R 2is selected from N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl or benzoyl.

[0180] The embodiments in other sections of this disclosure relating to compositions, methods of making compositions, nucleotide sequences and uses for target insects, fungi, weeds or mites are intended to be encompassed by this disclosure herein.

[0181] In some embodiments, the disclosed preparation method is superior to previous methods in both cost and scalability. Previous synthesis methods required water or another suitable polar protic solvent to reduce the need for excessive solvent dilution. However, this caused significant decomposition of the required polyalkyloxypolymer anhydride. Previous methods sometimes used as much as 200 equivalents of modifying group per bp of dsRNA. The addition of an ionic solvent provides a great unexpected benefit of reducing the amount of solvent used, reducing the decomposition of starting materials, and allowing efficient synthesis of the desired product. In some embodiments of the method, (b) has a ratio of less than 0.05 equivalents of the compound of formula (IIA) (e.g., polyalkyloxypolymer) per bp of dsRNA. In another embodiment of the method, (b) has a ratio of less than 0.1 equivalents of the compound of formula (IIA). In certain embodiments of the method, (b) has a ratio of about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, or about 1.0 equivalents of the compound of Formula (IIA) per bp of the dsRNA.

[0182] Without wishing to be bound by any particular theory, ionic solvents do not act as phase transfer catalysts. Rather, ionic solvents unexpectedly act as good solvators. Ionic solvents also help to aid the "unzip" of dsRNA by shielding the charge on the molecule. Such use of such ionic solvents has not been reported in the prior art.

[0183] Thus, in certain embodiments, ionic solvents improve dissociation of dsRNA by shielding the resulting charge on the single-stranded RNA.

[0184] Methods for preparing low molecular weight modifications by ionic solvation In another aspect, provided herein is a post-transcriptionally modified double-stranded RNA (MdsRNA) in which about 30% or less of all nucleotides are independently represented by the formula (VI): [ka] or an acceptable salt thereof, B is a nucleobase; R 3 are amino acids, fatty acids, alkyl; substituted alkyl; alkenyl; substituted alkenyl; alkynyl; substituted alkynyl; aryl; substituted aryl; C1-C10 alkyl, C1-C10 alkenyl, or C1-C10 alkynyl (alkyl and alkenyl may be linear, branched, or cyclic); hydrogen; methyl; ethyl; propyl; isopropyl; butyl; isobutyl; tert-butyl; pentyl; hexyl; cyclohexyl; heptyl; octyl; nonyl; decyl; vinyl; allyl; ethynyl; benzyl; cinnamyl; C6-C14 aryl; C6-C14 substituted aryl; heterocyclyl; C5-C14 heterocyclyl; phenyl; mono- or di-substituted phenyl (substituents may be C 1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl; 2-nitrophenyl; 4-nitrophenyl; 2; 4-dinitrophenyl; 2-trifluoromethylphenyl; 4-trifluoromethylphenyl; styryl; C8-C16 substituted styryl; 2-aminophenyl; mono- or di-substituted 2-aminophenyl (wherein the substituents are selected from C1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl); N-alkyl-2-aminophenyl or N-aryl-2-aminophenyl (wherein the alkyl is of the formula -C m H 2m+1where m is an integer less than or equal to 12, and aryl is an aromatic moiety); 2-amino-3-methyl-phenyl; 2-amino-5-chlorophenyl; 2-methyl-5-chlorophenyl; N-methyl-2-aminophenyl; N-ethyl-2-aminophenyl; N-propyl-2-aminophenyl; N-butyl-2-aminophenyl; N-pentyl-2-aminophenyl; N-methyl-2-amino-4-nitrophenyl; 2-methyl-3-furyl; 2-methylnicotyl (m ethylnicotyl) or N-trifluoromethyl-2-aminophenyl;Silanyl;Substituted silanyl;C1-C10 alkylsilanyl;C3-C12 trialkylsilanyl;C2-C12 alkoxyalkyl;C2-C12 alkoxyalkenyl;C2-C12 alkylthioalkyl;Alkylsulfonyl;C1-C10 alkylsulfonyl;C1-C10 haloalkyl;C1-C10 haloalkenyl or C1-C10 aminoalkyl;-(CH2CH2O) p CH3, -(CH2CH2O) p H or -(CH2CH2O) p COOR 4 (In the formula, p is an integer of 2 to 8; R 4 is H, alkyl, substituted alkyl, aryl, or substituted aryl; -(CH2CH2O)8COOH; -CH2CH2OH; -(CH2CH2O)4OH; -(CH2CH2O)6OH; -(CH2CH2O)8OH; -(CH2CH2O)8COOMe; -(CH2CH2O)4OMe; -(CH2CH2O)6OMe; -(CH2CH2O)8OMe; -CH2OCH3; -CH2OCH2CH3; or -CH2OCH2CH2OCH3), comprising the steps of: (a) A compound of formula (IV): [ka] with an activator to form a compound of formula (IVA) [ka] where X is a suitable leaving group. and forming; (b) A compound of formula (VIA): [ka] with a compound of formula (IVA) to form a compound of formula (VI); The method includes:

[0185] In certain embodiments, (a) and (b) are carried out in an anhydrous solvent.

[0186] In certain embodiments, the anhydrous solvent is selected from DMSO or DCM.

[0187] In another embodiment, (a) and (b) are carried out without intervening purification.

[0188] In yet another embodiment, there is a purification step between (a) and (b).

[0189] In some embodiments, the ionic solvent is added after (a).

[0190] In certain embodiments, the ionic solvent is selected from benzyltributylammonium chloride or benzyltrimethylammonium chloride.

[0191] In another embodiment, the activating agent is carbonyldiimidazole.

[0192] In yet another embodiment, a suitable leaving group is [ka] (In the formula, [ka] represents the covalent point of attachment to the carbonyl of formula (IVA). It is.

[0193] In a further embodiment, (b) has a ratio of about 2 equivalents to about 50 equivalents of a compound of Formula (IVA) per nucleotide of the dsRNA.

[0194] In another embodiment, (b) has a ratio of about 4 equivalents to about 25 equivalents of the compound of Formula (IVA) per nucleotide of the dsRNA.

[0195] In another embodiment, the compound of formula (IV) is anhydrous.

[0196] In another embodiment, R 3 is selected from N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl or benzoyl.

[0197] In another embodiment, the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, fungus, weed or mite, including, but not limited to, a target (insect, fungus, weed or mite), a target sequence and a target region, as discussed in detail in this disclosure.

[0198] The embodiments in other sections of this disclosure relating to compositions, methods of making compositions, nucleotide sequences and uses for target insects, fungi, weeds or mites are intended to be encompassed by this disclosure.

[0199] In some embodiments, the disclosed preparation method is superior to previous methods in both cost and scalability. Previous synthesis methods required water or another suitable polar protic solvent to reduce the need for excessive solvent dilution. However, this caused significant decomposition of the required anhydride. Previous methods sometimes used as much as 200 equivalents of the modifying group per bp of dsRNA. The addition of an ionic solvent provides a great unexpected benefit of reducing the amount of solvent used, reducing the decomposition of the starting material, and allowing efficient synthesis of the desired product. In some embodiments of the method, (b) has a compound of formula (IVA) at an equivalent ratio of less than 0.05 per bp of dsRNA. In another embodiment of the method, (b) has a compound of formula (IVA) at an equivalent ratio of less than 0.1. In a particular embodiment of the method, (b) has a compound of formula (IVA) at an equivalent ratio of 0.2 per bp of dsRNA.

[0200] Without being bound by any particular theory, ionic solvents do not act as phase transfer catalysts.Rather, ionic solvents unexpectedly act as good solvators.Ionic solvents also help to aid the "unzip" of dsRNA by shielding the charge on the molecule.This use of such ionic solvents has not been reported in the prior art.

[0201] Low molecular weight compositions are described in US Pat. Nos. 10,131,911, 10,640,769, and 11,174,480, the entire teachings of which are incorporated by reference.

[0202] How to use In another aspect of the disclosure, provided herein is a method of modifying expression of a polynucleotide of interest in an insect, comprising administering a composition of the disclosure.

[0203] In some embodiments, the target gene is selected such that inhibition of expression of the target gene kills the animal, fungus or weed, inhibits the growth or appetite of the animal, fungus or weed, or slows the reproduction of the animal, fungus or weed. Inhibition of expression of the target gene can control the animal, fungus or weed, kill the animal, fungus or weed, inhibit the growth or appetite of the animal, fungus or weed, or slows the reproduction of the animal, fungus or weed. In some embodiments, the insect, fungus or plant is of agricultural significance. In some embodiments, the agriculturally significant animal, fungus or plant is an insect, fungus or weed. In some embodiments, the expression modification reduces the birth rate of the target insect. In some embodiments, the described MdsRNAs can be used to control the animal, fungus or plant in agricultural or urban environments, kill the animal, fungus or plant, inhibit the growth, appetite or feeding of the animal, fungus or plant, or slow the reproduction of the animal, fungus or plant. In some embodiments, the plant target gene is selected such that inhibition of expression of the gene in the plant increases plant growth, viability, quality or yield.

[0204] In another embodiment, the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect. For example, an effective sequence or target gene useful in the products and methods of the present disclosure will inhibit the expression of a target gene, acting on the midgut of the insect, and increasing mortality or inducing growth inhibition, or arresting aging development.

[0205] In some embodiments, the target insect is Plutella xylostella, gypsy moth, Solenopsis invicta, fall armyworm, Colorado potato beetle, Canola flea beetle, Aedes aegypti, or Western corn rootworm. In another embodiment, the target insect is Acyrthosiphon pisum, soybean aphid, or Piezodorus guildinii. In another embodiment, the target is a mite, such as Verroa mite. In another embodiment, the target is a weed, such as common amaranth. In yet another embodiment, the target is a fungus such as Plutella retroflexus, Fusarium graminearum (Gibberella zeae) or Botrytis. Thus, the MdsRNA used in the compositions of the present disclosure will be a nucleotide sequence that can inhibit expression of a target gene or region in these insects. For example, the MdsRNA includes sequences complementary to target regions in Plutella xylostella, such as, but not limited to, AChE2, P450, CYP6BF1v1, DOUX, cytokine receptor DOMELESS, protein MESH transcript variant X1, venom carboxylesterase-6 and VPASE-E. In another embodiment, the MdsRNA comprises a sequence complementary to a target region in Fall Armyworm, such as, but not limited to, P450, cytokine receptor DOMELESS, VPASE, Dredd, protein MESH transcript variant X1, P450 CYP9A58, P450 CYP321A8, P450 CYP6B2-like.

[0206] In another embodiment, the MdsRNA comprises a sequence complementary to a target region in Western corn rootworm, such as, but not limited to, SNF7.

[0207] In certain embodiments, the MdsRNA comprises a sequence selected from one of SEQ ID NOs: 1-269 and their complete or incomplete reverse complements. In particular embodiments, the sequence is selected from one of SEQ ID NOs: 13 or 248-251 and their complete or incomplete reverse complements. In certain embodiments, the target insect is a Lepidopteran and may be targeted using any one of SEQ ID NOs: 1-269 and their complete or incomplete reverse complements to each identified sequence. In certain embodiments, the Lepidopteran is targeted using any one of SEQ ID NOs: 13 or 248-251.

[0208] In some embodiments, the target insect is a Lepidopteran. In some embodiments, the Lepidopteran is an armyworm, a corn earworm, a cabbage white butterfly, or a cotton bollworm.

[0209] In another embodiment, the MdsRNA comprises a sequence complementary to a P450, CYP6FB1v1, MESH, AChE2, VPASE, DOMELESS, DOUX, or venom target region in a Lepidopteran.

[0210] In some embodiments, treatment for at least about 30% control of the target insects. In some embodiments, treatment for at least about 50% control of the target insects. In some embodiments, treatment shows greater than about 50% control of the target insects. In some embodiments, treatment shows from about 50% to about 90% control of the target insects. In some embodiments, treatment shows from about 50% to about 75% control of the target insects. In some embodiments, treatment shows from about 30% to about 50% control of the target insects.

[0211] The compositions and methods described herein are further illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting. It will be understood that variations in proportions and substitutions of the components shown will be apparent to those skilled in the art and are within the scope of the embodiments of the present disclosure. Theoretical aspects are presented with the understanding that the applicant does not seek to be bound by the presented theory. All parts or amounts are by weight unless otherwise specified.

[0212] Agriculture / Pesticide Compositions In some embodiments, compositions are described that include the described MdsRNA. In some embodiments, the MdsRNA-containing compositions are formulated for agricultural use (agrochemical compositions).

[0213] As used herein, an agrochemical composition comprises an effective amount of at least one MdsRNA and optionally one or more acceptable carriers or excipients. Carriers and excipients are substances other than MdsRNA that have been properly evaluated for safety and are intentionally included in the composition. Excipients can act to a) aid in the processing of MdsRNA during manufacture, b) protect, support or improve the stability or bioavailability of MdsRNA, c) aid in product identification, and / or d) improve any other aspect of the overall safety, efficacy of delivery of MdsRNA during storage or use. An acceptable carrier or excipient may or may not be an inert substance. As used herein, "effective amount" refers to the amount of MdsRNA to produce the intended result.

[0214] Carriers and excipients include, but are not limited to: absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binding agents, binders, buffers (pH adjusters), chelating agents, coatings, colors, delivery enhancers, dextran, dextrose, diluents, tablet disintegrants, dispersants, emulsifiers, bulking agents, fillers, foam control agents, glidants, water retention agents, lubricants, oils, dyes, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0215] In some embodiments, the agrochemical composition includes one or more adjuvants or surfactants. In some embodiments, the one or more adjuvants or surfactants are independently selected from anionic surfactants, cationic surfactants, amphoteric surfactants, non-ionic surfactants, anti-condensates, thickeners, emulsifiers, spreading agents, stickers, organosilanes, fatty acid esters, and oils. In certain embodiments, the one or more adjuvants or surfactants are optionally selected from non-ionic organosilicone surfactants (e.g., KINETIC® from Helena; a non-ionic organosilicone-based wetter / spreader / penetrant spray aid), DYNE-AMIC® (Helena; a mixture of highly modified methylated seed oils combined with a proprietary organosilicone-based non-ionic surfactant), and SILWET® (Momentive; a non-ionic surfactant).

[0216] In some embodiments, the pesticide composition comprises one or more agents selected from: herbicides, fungicides, insecticides, acaricides, and fertilizers.

[0217] The described MdsRNAs and compositions comprising MdsRNAs can be processed in a number of different ways known to those of skill in the art to facilitate application of such materials onto plants or in feed, and for use in field or urban environments. The described MdsRNAs and compositions comprising MdsRNAs disclosed herein can be packaged or contained in kits, containers, packs or dispensers.

[0218] In some embodiments, the agrochemical composition comprises two or more different MdsRNAs. The MdsRNAs can have different antisense sequences complementary to the same target gene, different antisense sequences complementary to different target genes in the same or different hosts, different or similar lengths, or different or similar post-transcriptional modifications.

[0219] In some embodiments, the agricultural chemical composition is an emulsifiable agricultural concentrate. In some embodiments, the emulsifiable agricultural concentrate further comprises at least one agent, which may be, but is not limited to; a carrier or an organic solvent, a surfactant, an excipient, a herbicide, a fungicide, an insecticide, a fertilizer, or a combination thereof.

[0220] In some embodiments, the pesticide composition comprises one or more herbicides. Non-limiting examples of suitable herbicides include, but are not limited to, imidazolinone, acetochlor, acifluorfen, aclonifen, acrolein, AKH-7088, alachlor, alloxydim, ametryn, amidosulfuron, amitrole, ammonium sulfamate, anilophos, asulam, atrazine, azafenidine, azimsulfuron, BAS 620H, BAS 654 00H, BAY FOE 5043, Benazolin, Benfluralin, Benfuresate, Bensulfuron-methyl, Benslide, Bentazon, Benzofenap, Bifenox, Biranaphos, Bispyribac-sodium, Bromacil, Bromobutide, Bromofenoxime, Bromoxynil, Butachlor, Butamiphos, Butralin, Butroxydim, Butyrate, Cafenstrole, Carbetamide, Carfentrazone-ethyl, Chlormethoxyfen, Chloramben, Chlorbromuron, Chloridazone, Chlorimuron-ethyl, Chloroacetic acid, Chlorotoluron, Chlorpropham, Chlorsulfuron, Chlorthal-dimethyl, Chlorthiamid, Cinmethylin, Cinosulfuron, Clethodim, Clodinafop-propargyl, Clomazone, Clomeprop, Clopyralid, Chloransulam-methyl, Cyanazine, Cycloate, Cyclosulfamuron, Cycloxydim, Cyhalofop p-butyl, 2,4-D, dymron, dalapon, dazomet, 2,4DB, desmedipham, desmetrin, dicamba, dichlobenil, dichlorprop, dichlorprop-P, diclofop-methyl, difenzoquat methylsulfate, diflufenican, dimefuron, dimepiperate, dimethachlor, dimethamethrin, dimethenamid, dimethipine, dimethylarsinic acid, dinitramine, dinocap, dinoterb, dif enamide, diquat dibromide, dithiopyr, diuron, DNOC, EPTC, esprocarb, ethalfluralin, ethametsulfuron-methyl, ethofumesate, ethoxysulfuron, etobenzanide, fenoxaprop-P-ethyl, fenuron, ferrous sulfate, flamprop-M, flazasulfuron, fluazifop-butyl, fluazifop-P-butyl, fluchloralin, flumetsulam, flumiclorac-pentyl,Flumioxazin, Fluometuron, Fluoroglycofen-ethyl, Flupoxam, Flupropanate, Flupyrsulfuron-methyl-sodium, Flurenol, Fluridone, Flurochloridone, Fluroxypyr, Flurtamone, Fluthiacet-methyl, Fomesafen, Fosamin, Glufosinate-ammonium, Glyphosate, Glyfosinate, Halosulfuron-methyl, Haloxyfop, HC-252, Hexazinone, Imazamethabenz-methyl, Imazamox, Imazapyr, Imazaquin, Imazethapyr, Imazosuron, Imidazirinone, Indanofan, Inoxynil, Isoproturon, Isouron, Isoxaben, Isoxaflutole, Lactofen, Lenacil, Linuron, MCPA, MCPA-Thioethyl, MCPB, Mecoprop, Mecoprop-P, Mefenacet, Metamitron, Metazachlor, Methabenzthiazuron, Methylarsonic acid, Methyldimron, Methylisothiocyanate, Methobenzuron, Metobromuron, Metolachlor, Metosulam, Metoxuron, Metribuzin, Metsulfuron-methyl, Molinate, Monolinuron, Naproanilide, Napropamide, Naproxamate Thalam, Nebulon, Nicosulfuron, Nonanoic acid, Norflurazon, Oleic acid (fatty acid), Orbencarb, Oryzalin, Oxadiargyl, Oxadiazon, Oxasulfuron, Oxyflorfen, Paraquat dichloride, Pebulate, Pendimethalin, Pentachlorophenol, Pentanochlor, Pentoxazone, Petroleum, Phenmedipham, Picloram, Piperophos, Pretilachlor, Primisulfuron-methyl, Prodiamine, Prometon, Prometryn, Propachlor, Propanil, Propaquizafop, Propazine, Propham, Propyla Sochlor, propyzamide, prosulfocarb, prosulfuron, pyraflufen-ethyl, pyrazolinate, pyrazosulfuron-ethyl, pyrazoxyfen, pyributicarb, pyridate, pyriminobac-methyl, pyrithiobac-sodium, quinclorac, quinmerac, quinoclamine, quizalofop, quizalofop-P, rimsulfuron, sethoxydim, siduron, simazine, simetryn, sodium chlorate, STS series (sulfonylurea), sulcotrione, sulfentrazone, sulfometuron-methyl, sulfosulfuron, sulfuric acid, tar oil,2,3,6-TBA, TCA-sodium, tebutam, tebuthiuron, terbacil, terbumeton, terbuthylazine, terbutryn, thenylchlor, thiazopyr, thifensulfuron-methyl, thiobencarb, thiocarbazil, tralkoxydim, tri-alert, triasulfuron, triaziflam, tribenuron-methyl, triclopyr, trietazine, trifluralin, triflusulfuron-methyl, vernolate, and combinations thereof.

[0221] In some embodiments, the pesticide composition comprises one or more fungicides. Suitable fungicides include, but are not limited to, 3,3'-ethylenebis(tetrahydro-4,6-dimethyl-2H-1,3,5-thiadiazine-2-thione), zinc or manganese ethylene bis(dithiocarbamate), bis(dimethyldithiocarbamoyl)disulfide, zinc propylene-bis-(dithiocarbamate), bis(dimethyldithiocarbamoyl)ethylenediamine, nickel dimethyl-dithiocarbamate, methyl 1-(butylcarbamoyl)-2-benzimidazole carbamate, 1,2-bis(3-methoxycarbonyl)-2-benzoimid ... carbamate fungicides such as 1-isopropyl-2-thioureido)benzene, 1-isopropylcarbamoyl-3-(3,5-dichlorophenyl)-hydantoin, potassium N-hydroxymethyl-N-methyldithiocarbamate, and 5-methyl-10-butoxycarbonylamino-10,11-dehydrodibenzo(b,f)azepine; pyridine fungicides such as zinc bis(1-hydroxy-2(1H)pyridinethionate) and 2-pyridinethiol-1-oxide sodium salt; O,O-diisopropyl S-benzylphosphorothioate and O- Phosphorus fungicides such as ethyl S,S-diphenyldithiophosphate; phthalimide fungicides such as N-(2,6-diethylphenyl)phthalimide and N-(2,6-diethylphenyl)-4-methylphthalimide; dicarboximide fungicides such as N-trichloromethylthio-4-cyclohexene-1,2-dicarboximide and N-tetrachloroethylthio-4-cyclohexene-1,2-dicarboximide; 5,6-dihydro-2-methyl-1,4-oxathine-3-carboxanilide-4,4-dioxide and 5,6-dihydro-2-methyl-1,4-oxathine-3-carboxanilide-4,4-dioxide. Oxathine fungicides such as dro-2-methyl-1,4-oxathine-3-carboxanilide; naphthoquinone fungicides such as 2,3-dichloro-1,4-naphthoquinone, 2-oxy-3-chloro-1,4-naphthoquinone copper sulfate; pentachloronitrobenzene; 1,4-dichloro-2,5-dimethoxybenzene; 5-methyl-s-triazole (3,4-b)benzothiazole; 2-(thiocyanomethylthio)benzothiazole; 3-hydroxy-5-methylisoxazole; N-2,3-dichlorophenyltetrachlorophthalamic acid;5-Ethoxy-3-trichloromethyl-1-2,4-thiadiazole;2,4-Dichloro-6-(O-chloroanilino)-1,3,5-triazine;2,3-Dicyano-1,4-dithio-anthraquinone;Copper 8-quinolinate, polyoxin;Validamycin;Cycloheximide;Iron methanearsonate;Diisopropyl-1,3-dithiolan-2-ylidenemalonate;3-Allyloxy-1,2-benzisothiazole-1,1-dioxide;Kasugamycin;Blasticidin S;4,5,6,7-Tetra-chlorophthalide;3-(3, 5-Dichlorophenyl)-5-ethenyl-5-methyloxazolidine-2,4-dione;N-(3,5-dichlorophenyl)-1,2-dimethylcyclopropane-1,2-dicarboximide;Sn-butyl-5'-para-t-butylbenzyl-N-3-pyridyldithiocarbonylimidate;4-Chlorophenoxy-3,3-dimethyl-1-(1H,1,3,4-triazol-1-yl)-2-butanone;Methyl-D,LN-(2,6-dimethylphenyl)-N-(2'-methoxyacetyl)alaninate;N-Propyl-N-[2-( 2,4,6-Trichlorophenoxy)ethyl]phosphoro(phosphor)-1-carboxamide;N-(3,5-Dichlorophenyl)-succinimide;Tetrachloroisophthalonitrile;2-Dimethylamino-4-methyl-5-n-butyl-6-hydroxypyrimidimine;2,6-Dichloro-4-nitroaniline;3-Methyl-4-chlorobenzothiazol-2-one;1,2,5,6-Tetrahydro-4H-pyrrolo[3,2,1-I,j]phosphoro(phosphor)-2-one;3'-Isopropoxy-2-methyl-benzaniline lide;1-[2-(2,4-dichlorophenyl)-4-ethyl-1,3-dioxolan-2-ylmethyl]-1H,1,2,4-triazole;1,2-benzisothiazolin-3-one;basic copper chloride;basic copper sulfate;N'-dichlorofluoromethylthio-N,N-dimethyl-N-phenylsulfamide;ethyl-N-(3-dimethylamino-propyl)thiocarbamate hydrochloride;piomycin;S,S-6-methylquinoxaline-2,3-diyldithio-carbonate;complex of zinc and maneb;di-zinc bis(dimethyldithiocarbamate) ethylene bis(dithiocarbamate) and glyphosate; strobilurin fungicides such as chlorothalonil, azoxystrobin, pyraclostrobin and trifloxystrobin; and triazole fungicides such as myclobutanil, propiconazole, tebuconazole, tetraconazole, and combinations thereof.

[0222] In some embodiments, the pesticide composition comprises one or more insecticides. Suitable insecticides include, but are not limited to, O,O-diethyl O-(2-isopropyl-4-methyl-6-pyrimidinyl) phosphorothioate, O,O-dimethyl S-2-[(ethylthio)ethyl] phosphorodithioate, O,O-dimethyl O-(3-methyl-4-nitrophenyl)-thiophosphate, O,O-dimethyl S-(N-methylcarbamoylmethyl)-phosphorodithioate, O,O-dimethyl S-(N-methyl-N-formylcarbamoylmethyl) phosphoro-dithioate, O,O-dimethyl S-2-[ (ethylthio)ethyl] phosphorodithioate, O,O-diethyl S-2-[(ethylthio)ethyl] phosphorodithioate, O,O-dimethyl-1-hydroxy-2,2,2-trichloroethylphosphonate, O,O-diethyl-O-(5-phenyl-3-isoxazolyl) phosphorothioate, O,O-dimethyl O-(2,5-dichloro-4-bromophenyl) phosphorothioate, O,O-dimethyl O-(3-methyl-4-methylmercaptophenyl)-thiophosphate, O-ethyl Op-cyanophenanthate Nylphenyl-phosphorothioate, O,O-Dimethyl-S-(1,2-dicarbethoxyethyl) phosphorodithioate, 2-chloro-(2,4,5-trichlorophenyl)vinyl dimethyl phosphate, 2-chloro-1-(2,4-dichlorophenyl)-vinyl dimethyl phosphate, O,O-Dimethyl Op-cyanophenyl phosphorothioate, 2,2-dichlorovinyl dimethyl phosphate, O,O-Diethyl O-2,4-dichlorophenyl phosphorothioate, Ethyl mercaptophenyl acetate O ,O-Dimethyl phosphoro-dithioate, S-[(6-chloro-2-oxo-3-benzoxazolinyl)methyl]O,O-Diethyl phosphorodithioate, 2-Chloro-1-(2,4-dichlorophenyl)vinyl diethyl phosphate, O,O-Diethyl O-(3-oxo-2-phenyl-2H-pyridazin-6-yl) phosphorothioate, O,O-Dimethyl S-(1-methyl-2-ethylsulfinyl)-ethyl phosphorothioate, O,O-Dimethyl S-phthalimidomethyl phosphorodithioate, O,O-Diethyl S-(N-ethoxycarbonyl-N-methylcarbamoylmethyl)phosphorodithioate, O,O-Dimethyl S-[2-methoxy-1,3,4-thiadiazole-5-(4H)-I-(4)-methyl]dithiophosphate, 2-Methoxy-4H-1,3,2-benzoxaphosphorine 2-sulfide, O,O-Diethyl O-(3,5,6-trichloro-2-pyridyl)phosphorothioate, O-Ethyl O-2,4-dichlorophenylthionobenzenephosphonate, S-[4,6-diamino-s-triazine-2-yl] O,O-Diethyl O-(methylsulfinyl)phenyl phosphoro-thioate, O-Ethyl O-nitrophenyl phenyl phosphoro-thioate, O,S-Dimethyl N-acetyl phosphoroamidothioate, 2-Diethylamino-6-methylpyridin-4-yl-diethyl phosphoro-thioate, 2-Diethylamino-6-methylpyridin-4-yl-dimethyl phosphoro-thioate, O,O-Diethyl O-(methylsulfinyl)phenyl phosphoro-thioate, O-Ethyl S-propyl O-2,4-dichlorophenyl phosphoro-thioate and c Phosphate insecticides such as is-3-(dimethoxyphosphinoxy)N-methyl-cis-crotonamide; 1-naphthyl N-methylcarbamate, S-methyl N-[methylcarbamoyloxy]thioacetimidate, m-tolylmethylcarbamate, 3,4-xylylmethylcarbamate, 3,5-xylylmethylcarbamate, 2-sec-butylphenyl N-methylcarbamate, 2,3-dihydro-2,2-dimethyl-7-benzofuranylmethyl-carbamate, 2-isopropoxyphenyl N-methylcarbamate, 1 carbamate insecticides such as N,N-dimethyl N'-(2-methyl-4-chlorophenyl)formamidine hydrochloride, nicotine sulfate, milbemycin, 6-methyl-2,3-quinoxaline dithio cyclic S,S-dithiocarbonate, 2,4-dinitro-6-sec-butylphenyl dimethyl-acrylate, 1,1-bis(p-chlorophenyl) 2,2,Other insecticides include 2-trichloroethanol, 2-(p-tert-butylphenoxy)isopropyl-2'-chloroethyl sulfite, azoxybenzene, di-(p-chlorophenyl)-cyclopropylcarbinol, di[tri(2,2-dimethyl-2-phenylethyl)tin]oxide, 1-(4-chlorophenyl)-3-(2,6-difluorobenzoyl)urea, S-tricyclohexyltin O,O-diisopropylphosphorodithioate, and combinations thereof.

[0223] In some embodiments, the agrochemical composition comprises one or more fertilizers. A variety of fertilizers are suitable for inclusion in the composition. The fertilizer may be a single nutrient fertilizer (N, P or K), a dual fertilizer (e.g., NP, NK or PK), an NPK fertilizer or a multi-nutrient fertilizer (e.g., capable of providing one or more of calcium, magnesium, sulfur, copper, iron, manganese, molybdenum, zinc, boron, silicon, cobalt or vanadium). The fertilizer may be of natural or synthetic origin. The fertilizer may be liquid or solid and may provide delayed or controlled release.

[0224] In some embodiments, the MdsRNA is present in the composition at less than 50% by weight. In some embodiments, the amount of MdsRNA in the agricultural composition is less than 5% by weight of the composition. In some embodiments, the MdsRNA is present in the composition at less than about 1%, less than about 0.9%, less than about 0.8%, less than about 0.7%, less than about 0.6%, less than about 0.5%, less than about 0.4%, less than about 0.3%, less than about 0.2%, less than about 0.1%, less than about 0.05%, less than about 0.01%, or less than about 0.001% by weight.

[0225] In some embodiments, the pesticide composition is formulated as a liquid. The liquid formulation can be prepared by mixing the MdsRNA and other agents in the weight ratios described below in the liquid until dissolution of all components is achieved. The liquid can be aqueous, ionic or organic. Suitable liquids include, but are not limited to, water, alcohols (e.g., methanol and ethanol), ketones (e.g., acetone, methyl ethyl ketone and cyclohexanone), aromatic hydrocarbons (e.g., benzene, toluene, xylene, ethylbenzene and methylnaphthalene), aliphatic hydrocarbons (e.g., hexane and kerosene), esters (e.g., ethyl acetate and butyl acetate), nitriles (e.g., acetonitrile and isobutyronitrile), ethers (e.g., dioxane and diisopropyl ether), acid amides (e.g., dimethylformamide and dimethylacetamide) and halogenated hydrocarbons (e.g., dichloroethane, trichloroethylene and carbon tetrachloride).

[0226] In some embodiments, the liquid formulation is an aqueous formulation. In some embodiments, the aqueous formulation contains only water, MdsRNA and other agents. In some embodiments, additional compounds, solvents or auxiliary agents are provided in the aqueous formulation.

[0227] In some embodiments, the agrochemical composition is formulated as a powder or dust. The powder or dust can be granulated so that the powder or dust is suitable for direct application to crops (i.e., by spraying on the crops) or can be granulated for eventual dissolution in a solvent such as water. In some embodiments, the composition is a lyophilizate. Typically, the MdsRNA and other agents are lyophilized together. In some embodiments, one or more MdsRNAs and other agents can be lyophilized separately.

[0228] A variety of suitable solid and gaseous carriers can be used in the composition.Suitable solid carriers include, but are not limited to, clay (e.g., kaolin clay, diatomaceous earth, synthetic hydrated silica, attapulgite clay, bentonite and acid clay), talc, bulking agents, inorganic minerals (e.g., sericite, powdered quartz, powdered sulfur, activated carbon, calcium carbonate and hydrated silica) fine powder or granules, and fertilizer salts (e.g., ammonium sulfate, ammonium phosphate, ammonium nitrate, urea and ammonium chloride).Suitable gaseous carriers include, for example, butane gas, carbon dioxide and fluorocarbon gas.

[0229] In some embodiments, the agrochemical composition comprises a dispersant. Examples of dispersants include, but are not limited to, methyl cellulose, polyvinyl alcohol, sodium lignin sulfonate, polymeric alkyl naphthalene sulfonate, sodium naphthalene sulfonate, polymethylene bisnaphthalene sulfonate, neutralized polyoxyethylated derivatives, and ring-substituted alkylphenol phosphates. Stabilizers can also be used to produce stable emulsions. Exemplary stabilizers include, but are not limited to, magnesium, aluminum silicate, and xanthan gum.

[0230] In some embodiments, the pesticide composition is formulated in the form of an aerosol as a spray.When formulated as an aerosol spray, the composition is generally placed in a container under pressure together with a propellant.Examples of suitable propellants include fluorotrichloromethane and dichlorodifluoromethane.

[0231] In some embodiments, the pesticide composition comprises a seed. In some embodiments, the pesticide composition comprises an antifungal agent MdsRNA and a seed. In some embodiments, the pesticide composition comprises an MdsRNA, a seed, and further comprises a fungicide.

[0232] In some embodiments, the amount of MdsRNA in the fungicidal composition (agrochemical composition comprising a fungicide) is less than about 5%, less than about 1%, less than about 0.9%, less than about 0.8%, less than about 0.7%, less than about 0.6%, less than about 0.5%, less than about 0.4%, less than about 0.3%, less than about 0.2%, less than about 0.1%, less than about 0.05%, less than about 0.01%, or less than about 0.001% by weight of the fungicidal composition. The weight of the fungicidal composition does not include the weight of the seeds.

[0233] In some embodiments, the fungicidal composition is present in the seed coat or is present inside the seed. In some embodiments, the fungicidal composition is formed on the seed such that the composition completely or partially covers the outer surface of the seed. Methods of coating seeds include those known in the art.

[0234] Methods for controlling agricultural pests In some embodiments, MdsRNA or compositions comprising MdsRNA are used to control agricultural pests or treat agricultural pest infestations. The MdsRNA can be administered to the pest, to an area occupied by the pest, or to a food source for the pest.

[0235] In some embodiments, a method for treating or controlling a pest is provided. In some embodiments, the pest is an insect, a fungus, a mite, or a weed. The method includes applying a composition comprising one or more of the described MdsRNAs to the area to be treated. In some embodiments, the MdsRNA is present in the composition in an amount of less than 5% by weight. In some embodiments, the composition is applied directly to a surface. In some embodiments, the surface is a plant surface on which the targeted insect or fungal pest feeds.

[0236] In some embodiments, gene expression levels and / or mRNA levels of the target gene in the target host are reduced by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% following application of the MdsRNA or a composition containing the MdsRNA, hi some embodiments, mortality of agricultural pests is increased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% following application of the MdsRNA or a composition containing the MdsRNA.

[0237] As used herein, control of a pest means reducing crop damage or loss of yield caused by a pest, or increasing the incidence of a pest, inhibiting the growth or appetite or intake of a pest, or slowing the reproduction of a pest, compared to the crop damage, yield incidence, reduction in growth, appetite, intake or reproduction measured in the absence of treatment with MdsRNA.

[0238] Crop applications In some embodiments, a method for reducing the expression of a target gene in a target plant other than a weed is described. The method comprises applying a composition comprising one or more of the MdsRNAs described to the plant. In some embodiments, the plant is a crop plant. A crop plant is a plant that can be grown and harvested for profit or survival. A crop plant can be, but is not limited to, a food plant, a horticultural plant, a floricultural plant, or an industrial plant. In some embodiments, the plant is a cultivated plant. The plant can be in a laboratory, a greenhouse, a nursery, a field, an orchard, or other agricultural environment, a garden, or other natural or urban environment. In some embodiments, the target plant is a plant that is considered desirable in a particular situation or location.

[0239] insect invasion In some embodiments, the animal is an insect. In some embodiments, the insect is a Coleopteran (such as a beetle). The Coleopteran can be, but is not limited to, a bark beetle, an elm beetle, a longhorn beetle, a serpent beetle, a pine bark beetle, a longhorn beetle, or a Colorado beetle. In some embodiments, the insect is a Lepidopteran (such as a butterfly or moth). The Lepidopteran can be, but is not limited to, an armyworm, a corn earworm, a cabbage white butterfly, or a cotton boll worm. In some embodiments, the insect is a Hymenopteran (such as a sawfly, a wasp, a bee, an ant, etc.). Hymenopteran can be, but is not limited to, fire ants, Argentine ants, carpenter ants, leaf-cutter ants, wheat stem sawfly, larch sawfly, pine sawfly, or bedbug. In some embodiments, the insect is Dipteran (such as flies). Dipteran can be, but is not limited to, flies, mosquitoes, gnats, or leaf-mining insects. In some embodiments, the insect is Hemipteran (such as true bugs). Hemipteran can be, but is not limited to, aphids, leafhoppers, bugs, whiteflies, mealybugs, or fleas. In some embodiments, the insect is Western corn rootworm.

[0240] In some embodiments, the insects are insects that have resistance to one or more conventional known insecticides. In some embodiments, insects such as fire ants may have negative impacts on biodiversity (Wojcik et al. 2001) and / or resistance to insecticides (Zhang et al. 2016). In some embodiments, insects such as mosquitoes may impact human health as vectors of diseases such as, but not limited to: malaria, dengue, Zika, and chikungunya (Hemingway et al. 2004). In some embodiments, insects such as Asian citrus psyllids are vectors of citrus greening (Tiwari et al. 2011) (Tiwari et al. 2011).

[0241] Coleopteran, Lepidopteran, Hymenopteran, Dipteran and Hemipteran insect pests are known to be susceptible to RNAi induced by direct injection or by feeding on plant material treated with siRNA precursors. Field application of naked RNA is generally not practical due to the susceptibility of RNA to environmental specific and non-specific degradation (Baum 2016). Furthermore, RNA is highly susceptible to degradation during the process of feeding and during passage through the insect gut. For example, in general, Lepidoptera appear to degrade RNA much more vigorously than Coleoptera, which may account for their relatively poor susceptibility to RNAi-mediated control methods. The stability of the described MdsRNAs serves to protect them from host nucleases before delivery to the RNAi pathway and to limit non-specific environmental degradation. Nonetheless, the described MdsRNAs are sufficiently biodegradable to allow for environmental safety considerations.

[0242] A composition comprising one or more MdsRNAs can be applied to a plant prior to infection to prevent insect infection. The composition may also be applied after the appearance of symptoms of infection to treat insect infection. The composition can be applied in a variety of ways depending on the plant part to be treated. By way of example, the composition can be applied to plant seeds prior to sowing to prevent insect infection of the seeds. The composition can be applied to the soil at or just before sowing to prevent insect infestation of newly sown seeds (i.e., pre-emergence). In some embodiments, the composition can be applied to the plant after plant emergence or to the plant foliage after emergence (i.e., post-emergence) to either treat or prevent insect infestation. In exemplary embodiments, application is performed during the germination stage, fruiting stage, vegetative growth stage, and reproductive growth stage. In some embodiments, application is performed during the vegetative growth stage and reproductive growth stage.

[0243] Application of the composition to the pre-emergent seeds can include various seed coating techniques such as film coating, pelleting, encapsulation, drum coating and fluidized bed coating, etc. Application to the post-emergent plants can include spraying or dusting techniques.

[0244] An effective amount of the composition can be applied to the plant or seed by several methods generally known in the art. As one of ordinary skill in the art will recognize, the amount of the composition that comprises an "effective amount" can and will vary depending on the plant and its development stage, the fungal target, and the environmental conditions. Generally speaking, in a typical application, the plant or its progeny is treated with an amount of the composition sufficient to provide a concentration of active ingredient of about 0.01 mg / kg to about 10% by weight. It is contemplated that the method includes more than one application of the composition to the plant or its progeny. For example, the number of applications can range from about 1 to about 5 or more times. The applications detailed herein can be performed at the same or different stages of the plant's life cycle.

[0245] fungal infection In some embodiments, MdsRNA is used to treat or prevent fungal infections. In some embodiments, fungi include, but are not limited to, genera Hypocrealesan, Venturia, Podosphaera, Erysiphe, Monolinia, Mycosphaerella, Uncinula; Basidiomycete, Hemileia, Rhizoctonia, Puccinia, Fungi imperfecti, Mycosphaerella ... imperfecti, Botrytis, Helminthosporium, Rhynchosporium, Fusarium, Septoria, Cercospora, Alternaria, Pyricularia, Pseudocercosporella, Oomycete fungi, Phytophthora, Peronospora, Bremia, Pythium, Plasmopara, Phakopsora Pachyrhizi, P. meibomiaemeibomiae, Sclerophthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, Peronosclerospora maydis, Physopella zeae, Cercospora zeae-maydis, Colletotrichum graminicola graminicola, Hypocreales, Gibberella zeae, Exserohilum turcicum, Kabatiellu zeae, Bipolaris maydis, Gibberella avenacea, Fusarium culmorum, Fusarium oxysporum, Fusarium sporotrichioides or Fusarium graminearum. In some embodiments, treatment of Fusarium graminearum can reduce mycotoxin production, the risk of emerging resistance to demethylation inhibitor (DMI)-based fungicides, or carcinogenicity concerns with traditional DMIs such as tebuconazole.

[0246] In some embodiments, the described agrochemical compositions can be applied to plants prior to infection to prevent fungal infection. In some embodiments, the described agrochemical compositions can be applied to plants after the appearance of symptoms of infection to treat fungal infection. The compositions can be applied in a variety of ways depending on the plant part to be treated. As an example, the compositions can be applied to plant seeds before sowing to prevent fungal infection of the seeds. The compositions can be applied to the soil at the time of sowing or just before sowing to prevent microbial infestation of newly sown seeds (i.e., as pre-emergence). In some embodiments, the compositions can be applied to plants after plant emergence or to plant leaves after emergence (i.e., as post-emergence) for either treatment or prevention of microbial infestation. In exemplary embodiments, application is performed during the germination period, fruiting period, vegetative growth period, and reproductive growth period. More typically, application is performed during the vegetative growth period and reproductive growth period.

[0247] Application of the composition to the pre-emergent seeds can include various seed coating techniques such as film coating, pelleting, encapsulation, drum coating and fluidized bed coating, etc. Application to the post-emergent plants can include spraying or dusting techniques.

[0248] An effective amount of the composition can be applied to the plant or seed by several methods generally known in the art. As one of ordinary skill in the art will recognize, the amount of the composition that comprises an "effective amount" can and will vary depending on the plant and its development stage, the fungal target, and the environmental conditions. Generally speaking, in a typical application, the plant or its progeny is treated with an amount of the composition sufficient to provide a concentration of active ingredient of about 0.01 mg / kg to about 5,000 mg / kg. It is contemplated that the method includes more than one application of the composition to the plant or its progeny. For example, the number of applications can range from about 1 to about 5 times or more. The applications detailed herein can be performed at the same or different stages of the plant's life cycle.

[0249] weed The compositions of the present disclosure can be used to control, prevent, remove, or delay the growth of weeds. Weeds are plants that are considered undesirable in a particular situation or location. Weeds can be, but are not limited to, Palmer Amaranth, Common Lambsquarters, Horseweed, Morning Glory, Waterhemp, Nutsedge, Kochia, Common Ragweed, Giant Ragweed, or Nightshade. EXAMPLES

[0250] Example 1. Preparation of high molecular weight polyalkyloxy polymer dsRNA in DMSO PEG activation 1 equivalent of PEG-acetic acid is dissolved in dimethyl sulfoxide (DMSO) at 50mg / ml, and 1.05 equivalents of carbonyldiimidazole (CDI) is added to this solution. The reaction mixture is stirred under argon for at least 2 hours, preferably overnight. Then, this solution is added directly to dsRNA according to ionic solvation.

[0251] Reaction of dsRNA with activated PEG Benzyl triethyl ammonium chloride (benzyl-TriBA-Cl) was dissolved in DMSO at 200 mM. An aliquot of this solution was added to the lyophilized dsRNA in a reaction tube. The tube was warmed to 65°C in a shaker for 1 hour. The temperature was then reduced to 55°C and a catalytic amount of pyridine was added, followed by 200μg / μL of DMAP solution. 200ug / uL of activated PEG solution was added in 1-3 portions. The mixture was maintained at 55°C for 90 minutes, then quenched with 500mM citrate at pH 4.5 and diluted to 40mL with water. The resulting mixture containing crude PEG-dsRNA was purified using tangential flow filtration, TFF, to obtain MdsRNA with a purity of >90%.

[0252] The following MdsRNAs were prepared according to the procedure described above.

[0253] [Table 1]

[0254] As can be seen in Figure 4, an agarose gel (2%) analysis (line 3) of the activated 10kPEG / dsRNA reaction mixture shows the covalent modification of the 300 bp molecule with, for example, 1, 2, 3, or 4 strands of 10kPEG polymers. The original unmodified dsRNA molecule is entirely consumed during the reaction.

[0255] Example 2. Preparation of high molecular weight polyalkyloxy polymer dsRNA using DCM for activation reaction One equivalent of PEG-acetic acid was dissolved in dichloromethane (DCM) at 300 mg / ml, and 1.05 equivalents of CDI were added to this solution. The reaction mixture was stirred under argon for at least 2 hours, preferably overnight. The reaction mixture was then diluted to 5 mg / ml with fresh DCM and extracted with 0.5 volumes of 1N HCL, followed by 0.5 volumes of saturated NaCl. The aqueous layer was then washed with ethyl acetate, followed by DCM. The combined organic layers were dried over sodium sulfate, and the solvent was evaporated under vacuum to obtain a viscous liquid. The viscous liquid was triturated with 2 volumes of acetonitrile (CAN), stripped under a stream of argon to remove water, and then dried under high vac and P2O5 for several hours. The resulting solid was reacted with dsRNA according to the ionic solvation method. The following MdsRNA was prepared according to this procedure:

[0256] [Table 2]

[0257] Example 3. Preparation of high molecular weight polyalkyloxy polymer dsRNA in DMSO Activation of polyalkyloxy polymer PEG Polyaloxy polymers were reacted with a linker to introduce a reactive COOH at one end of the polymer chain. One equivalent of polyalkyloxy polymer was dissolved in 1,4-dioxane. DMAP (0.5 equivalents), DIEA (3 equivalents), and the corresponding anhydride (1.5 equivalents) were added and the reaction mixture was stirred at room temperature overnight. The mixture was then diluted with DCM and extracted with sodium bicarbonate and brine. The organic layer was dried over sodium sulfate and concentrated under reduced pressure. The resulting gum was triturated with fresh DCM and the solid polyalkyloxy-COOH was collected by filtration.

[0258] 1 equivalent of polyalkyloxy-COOH was dissolved in dimethylsulfoxide (DMSO) at 50 mg / ml, and 1.05 equivalents of carbonyldiimidazole (CDI) was added to the solution. The reaction mixture was stirred under argon for at least 2 hours, preferably overnight. The solution was then added directly to the dsRNA.

[0259] Using the above preparation method, the following activated polyalkyloxy polymers were prepared and used to obtain the desired MdsRNA: methoxy PEG acetate (MPEGA) 1K, 2K, 5K, and 10K; methoxy PEG acetate (MPEGA-Y) 40K, Y-shape; methoxy PEG succinate (MPEGS) 5K; methoxy PEG glutamate (MPEGG) 5K; methoxy PEG 3,3-methyl glutamate (MPEGM) 5K; carbamoyl PEG 5K (CPEG), poloxalene succinic L64, 2, 9K; poloxalene succinic L68; poloxalene succinic L121; poloxalene succinic F108, 14K; poloxalene succinic F127, 12.5K.

[0260] Reaction of dsRNA with activated polyalkyloxy polymer PEG Benzyltributylammonium chloride was dissolved in DMSO at 200 mM. An aliquot of this solution was added to the lyophilized dsRNA in a reaction tube. The tube was warmed to 65°C in a shaker for 1 hour. The temperature was then reduced to 55°C and a catalytic amount of pyridine was added followed by 200μg / μL of DMAP solution. 200ug / uL of activated polyalkyloxypolymer solution was added in small portions. The mixture was kept at 55°C for 90 minutes, then quenched with 500mM citrate at pH 4.5 and diluted to 40mL with water. The resulting mixture containing crude M-dsRNA was purified using tangential flow filtration (TFF) to obtain MdsRNA with a purity of more than 90%. MdsRNA was characterized by gel electrophoresis on non-denaturing agarose gels and denaturing polyacrylamide gels.

[0261] The degree of modification (% modified), i.e., the ratio of the number of bases esterified with the polymer to the total number of bases in the dsRNA, was determined by a combination of hydrolysis / HPLC-ELSD method. The hydrolysates of MdsRNA samples were obtained when a mixture of an aqueous solution of the purified product and a 0.5 M NaOH solution was heated at 99°C. The resulting polyalkyloxy polymers and RNA nucleotides were quantified using a Shimadzu LC-2030C HPLC equipped with a C18 100A LC column (250 x 4.6 mm) and an ELSD. A calibration curve was generated using the dsRNA starting material and the polyalkyloxy polymer as standards.

[0262] The insecticidal activity of MdsRNA was screened using a leaf disk assay. MdsRNA targeting diamondback moth (DBM) (P. xylostella) was tested against DBM larvae using cabbage leaf disks. MdsRNA treatments were dissolved and diluted in water with adjuvant to obtain the desired concentrations. The desired treatment solution was sprayed onto both sides of fresh cabbage leaf disks (3.5 cm diameter). Each treatment was applied in triplicate, with water only as a control. The disks were placed on moist paper towels in a container. Diamondback moth (P. xylostella) eggs (8-12 eggs) were transferred to each treatment disk, and the containers were incubated at 26°C and 72% relative humidity (RH). On days 2, 3, and 4, new treatment disks were prepared, and untreated disks were prepared daily thereafter. On days 5 and 8, larval mortality and stunting were recorded. The % efficacy and standard deviation were calculated for each treatment and used to rate the treatments on a scale of 1 to 3 as follows: % efficacy 0-30% grade = 1; % efficacy 30-50% grade = 2, % efficacy > 50% grade = 3. Treatments with a grade of 3 were advanced to further optimization studies.

[0263] MdsRNA targeting Fall Armyworm (FAW) (S. frugiperda) was tested against DBM larvae using corn leaf squares (9 cm2). One FAW egg was placed on each corn leaf and the containers were incubated as above. A minimum of 10 replicates per treatment and negative controls were performed. New treated leaf squares were prepared on days 4, 5, and 6, and untreated disks were prepared daily thereafter. Larval mortality and stunting were recorded on days 8 and 11. % efficacy was calculated for each treatment and used to rate the treatments on a scale of 1 to 3 as follows: % efficacy 0-30% grade = 1; % efficacy 30-50% grade = 2, % efficacy > 50% grade = 3. Treatments with a grade of 3 were advanced to further optimization studies.

[0264] The following MdsRNAs were prepared according to the procedure described above.

[0265] [Table 3]

[0266] [Table 4]

[0267] [Table 5]

[0268] [Table 6]

[0269] [Table 7]

[0270] Example 4. Preparation of high molecular weight polyalkyloxy polymer-NMIA dsRNA MPEGA-dsAChE2 was prepared and purified according to the procedure described in Example 3 using methoxy-PEG acetate 10K at input 0.1. Benzyl-TriBA-Cl was dissolved in DMSO at 200 mM. An aliquot of this solution (3.4 mL) was added to lyophilized MPEGA-dsAChE (34 mg) in a reaction tube. The tube was warmed to 65° C. in a shaker for 1 h. The temperature was then reduced to 55° C. and 110 μL of pyridine was added, followed by 500 μL of a 200 μg / μL DMAP solution and 442 μL of a 200 μg / μL NMIA solution. After 5 min, another 442 μL of NMIA solution was added (input=10, RNA nucleotides in moles of NMIA / mol). The mixture was kept at 55° C. for 90 min, then quenched with 500 mM citrate and diluted to 40 mL with water. The resulting mixture containing crude PEG-NMA-dsAChE2 was purified using tangential flow filtration, TFF, to obtain MdsRNA with a purity of more than 90%. PEG-NMA-dsAChE2 was characterized by gel electrophoresis on non-denaturing agarose gels and denaturing polyacrylamide gels. % modification by HPLC: PEG 1%, NMIA 37%.

[0271] Example 5. Preparation of high molecular weight polyalkyloxy polymer-FA dsRNA Following a procedure similar to that described in Example 4, MPEGA-P450 5K (115) was reacted with activated lauryl (LAU), oleic (OLE) and linoleic (LIN) fatty acids to give the MPEGA-FA-P450 materials listed in Table 4.

[0272] [Table 8]

[0273] Example 6. Cabbage disc assay The insecticidal activity of the modified dsRNA materials was tested against DBM larvae using a cabbage leaf disc bioassay, where DBM eggs were collected from the field. Cabbage leaves were collected at stages 4-5. The leaves were prepared by washing with tap water using a nozzle to remove insects, fines, etc. The leaves were then wiped with paper towels. Leaf discs measuring 3.5 cm in diameter were cut out from the cabbage leaves using a metal cutter. An aqueous solution of the desired treatment solution was prepared at a concentration of 500 ppm or 150 ppm, and 60 uL was sprayed onto both sides of the disc. After the treatments were applied to both sides of the leaf discs, four 1 cm diameter discs were then cut out from the treated 3.5 cm. The resulting treated 1 cm diameter discs were used in the assay. Three diamondback moth (P. xylostella) eggs were placed on each treated disc placed in a Petri dish. The plates were incubated at 26°C and 72% room humidity (RH). After 48 hours, only one newborn was transferred to a new (second) treated disk. 24 hours after the second treated disk, a third treated disk was prepared. The larvae were then offered an untreated disk daily for up to 10 days. Mortality was recorded daily from the second day after incubation. Mortality was calculated for each test for the duration of the experiment, and cumulative mortality after 5 days and 7 or 9 days was calculated. After 7 days of incubation, the number of 2nd or 1st instar larvae was added to the number of dead larvae. The efficacy of some PEG-P450(115) examples on DBM larvae is shown in Figure 1. The efficacy of two PEG-dsRNA examples on DBM eggs collected in the field versus the efficacy of a leading commercial product is shown in Figure 3 and Table 5.

[0274] [Table 9]

[0275] Example 7. Preparation of NMA dsRNA using ion solvation method Benzyltributylammonium chloride was dissolved in DMSO at 200 mM. An aliquot of this solution was added to the lyophilized dsRNA in a reaction tube. The tube was warmed to 65°C in a shaker for 1 hour. The temperature was then reduced to 55C and 110uL of pyridine was added, followed by 200ug / uL of DMAP solution and two portions of 200ug / uL of N-methylisatoic anhydride (NMIA) solution. The mixture was maintained at 55°C for 90 minutes, then quenched with 500mM citrate and diluted with water. The resulting mixture containing crude NMA-dsRNA was purified using tangential flow filtration, TFF, to obtain MdsRNA with a purity of more than 90%. The following NMA-dsRNAs were prepared according to the above procedure: NMA-P450 (115) (37% NMA), NMA-VPASE (7) (81% NMA), NMIA-AChE (1) (40%, 80% NMA), NMA-B1 (4), NMA-TH (3). This procedure was also used to prepare dsRNA analogs at NBA, dimethylfuroyl, -Tyr, -Trp, -Leu, and octanoyl. This procedure can be used for other modifications, including but not limited to lauroyl, linoleyl.

[0276] Example 8. Persistence of PEG-dsRNA in cabbage fields The longevity of RNAi active ingredients in the field has always been of paramount importance in the development of advanced insecticides. RNA is known to be a highly unstable molecule that is vulnerable to enzymatic degradation. Estimates of the half-life of dsRNA in the field range from 0.5 to 0.7 days after foliar application on soybean plants (Bachman et al., 2020). The time decay of dsRNA sequences sprayed on cabbage leaves for natural dsRNA and 2'-O modified dsRNA was tested in a small plot field study.

[0277] Cabbage leaf samples exposed to the spray were collected using a leaf puncher at these time points after exposure: 0 (1 hour), 1, 2, 3, and 5 days. For each data point, 12 leaf circles from 12 individual plants from each plot were collected and immediately frozen on dry ice. Bags should then be stored on dry ice or in a -80°C freezer until ready for analysis.

[0278] The dsRNA used in this study is the dsSNF7 sequence previously reported in a field dissipation study (Bachman et al., 2020). QuantGene, a nucleic acid detection platform marketed by Invitrogen, was the preferred analytical method used to quantify dsRNA sequences on the foliage of cabbage plants after spraying. The sequences and corresponding Quantigene probe sets were previously published (Armstrong et al., 2013). The sequences are not specific to diamondback moth (DBM) and are used here for analytical purposes only. Untreated (unmodified) dsSNF7, treated C2, were used as comparisons.

[0279] Two modification groups were used: N-methylanthranoyl and PEGA. dsRNA modified with these two groups showed exceptional biological activity against DBM in previous studies (see, e.g., Example 3, Table 3). Treatment NS2 (PEGA-NMA-dsSNF7, MdsRNA90, Table 3) showed a profile different from all other dsRNAs, including NS5 (NMA-dsSNF7, approximately 100% NMA), suggesting the presence of a highly stabilized MdsRNA fraction that showed little degradation within the tested time frame (see Figure 2).

[0280] Sequences - Lepidoptera dsRNA sequences SEQ ID NOs:1-12 are provided above.

[0281] ID1. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA. NCBI reference sequence: NM_001305532.1.51~150 [ka] ID2. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 151-250 [ka] ID3. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 251-350 [ka] ID4. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 351-450 [ka] ID5. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 451-550 [ka] ID6. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 551-650 [ka] ID7. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 651-750 [ka] ID8. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 1501-1600 [ka] ID9. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 1601-1700 [ka] ID10. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 1401-1500 [ka] ID11. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 51-166 [ka] ID12. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA 1476-1649 [ka] ID13. Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA sequence [ka] ID14.XM_038113977.1|:71-220 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID15.NM_001305532.1|:51~200 Plutella xylostella V-type proton ATPase subunit E (LOC105389010), mRNA [ka] ID16. Plutella xylostella V-type proton ATPase sequence includes both subunits A and E [ka] ID17.101~200 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID18.201~300 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID19.301-400 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID20.401~500 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID21.501-600 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID22.601-700 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID23.801-900 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID24.901~1000 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID25.1001-1100 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID25-2.351~500 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID25-3.951~1100 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID25-4.XM_011559245.2|: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA 351-500, 951-1100 [ka] ID26.101~250 Plutella xylostella strain DBM1Ac-S mitogen-activated protein kinase kinase kinase kinase 4 isoform X1 (MAP4K4) mRNA, complete cds, alternative splicing [ka] ID27.901~1050 Plutella xylostella strain DBM1Ac-S mitogen-activated protein kinase kinase kinase kinase 4 isoform X1 (MAP4K4) mRNA, complete cds, alternative splicing [ka] ID28.51~150 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID29.301~400 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID30.401~500 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID31.501~600 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID32.601~700 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID33.601~700 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID34.801~900 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID35.901~1000 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID36.1001~1100 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID37.1101~1200 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID38.1201~1300 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID40.1301~1400 Diamondback moth (Plutella xylostella) profenoxidase 1 mRNA, complete cds [ka] ID41.1401~1500 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID42.1501~1600 Diamondback moth (Plutella xylostella) profenoxidase 1 mRNA, complete cds [ka] ID43.1601~1700 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID44.1701~1800 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID45.1801~1900 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID46.1901~2000 Plutella xylostella prophenoloxidase 1 mRNA, complete cds [ka] ID46-1.101~200 Diamondback moth (Plutella xylostella) prophenoloxidase 1 mRNA, complete cds [ka] ID46-2. Diamondback moth (Plutella xylostella) prophenoloxidase 1 mRNA, complete cds [ka] ID46-3. Plutella xylostella prophenoloxidase 1 sequence mRNA, complete cds [ka] ID47.151~250 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID48.251~350 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID49.351~450 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID50.451~550 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID51.551~650 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID52.651~750 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID53.751~850 Plutella xylostella glutathione synthetase (GSS), mRNA [ka] ID54.851~950 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID54.951~1050 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID57.1051~1150 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID58.1151~1250 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID59.1251~1350 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID60.1351~1450 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID61.1451~1550 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID62.1551~1650 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID63.1651~1750 Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID63-2.Plutella xylostella glutathione synthetase (Gss), mRNA [ka] ID64.AY904342.1:160-460 Diamondback moth (Plutella xylostella) pheromone biosynthesis activating neuropeptide (PBAN) mRNA, complete cds [ka] ID65.151-250 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID66.251-350 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID67.351-450 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID68.451-550 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID69.551-650 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID70.651-751 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID71.751-850 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID72.851-950 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID73.951-1050 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID74.1051-1150 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID75.201-350 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID76.826-975 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID77.826-975 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), mRNA [ka] ID78.201-350, 826-975 predicted: Plutella xylostella charged multivesicular body protein 4b (LOC105396929), target sequence mRNA [ka] ID79.XM_038113977.1|:101-200 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID80.201-300 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID81.XM_038113977.1|:301-400 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID82.XM_038113977.1|:401-500 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID83.XM_038113977.1|:501-600 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID84.XM_038113977.1|: 601-700 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID85.XM_038113977.1|:1501-1600 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID86.XM_038113977.1|:1601-1700 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID87.XM_038113977.1|:1701-1800 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID88.XM_038113977.1|:1801-1900 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID89.XM_038113977.1|:1901-2000 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID90.XM_038113977.1|:2001-2100 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID91.XM_038113977.1|:2101-2200 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID92.XM_038113977.1|:2301-2400 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID93.XM_038113977.1|:2401-2500 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID94.XM_038113977.1|:2601-2700 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID95.XM_038113977.1|:71-220 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID96.XM_038113977.1|:1971~2120 predicted: Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, mRNA [ka] ID97.300BP Plutella xylostella V-type proton ATPase catalytic subunit A (LOC105392322), transcript variant X1, sequence mRNA [ka] ID98.AY971374.1|:676~975 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID99.101~200 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID100.201~300 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID101.301~400 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID102.AY971374.1|:401~500 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID103.AY971374.1|:501~600 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID104.AY971374.1|:601~700 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID105.701~800 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] IDs106.801~900 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID107.1201~1300 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID108.1301~1400 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID109.AY971374.1|:1401~1500 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID109-2 AY971374.1|:700~849 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID109-3 AY971374.1|:1151~1300 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds [ka] ID109-3.AY971374.1|:1151~1300 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) target sequence mRNA, complete cds [ka] ID109.4.AY971374.1|:650~707 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds ACAGGTCACCTTTTATTTGATGAAAGACCAATTGCAGGCGTGAAGAATGTCCTCAGAT (SEQ ID NO: 130) ID109.5.AY971374.1|:765~822 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds ACCGTTTCTTCCGATCTGTTATACTTGACGTTATAAACAGTCGTAACGGCGCCAAATC (SEQ ID NO: 131) ID109.6AY971374.1|:823~880 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds TTCGAGGAATGACATGGTGGATCTTATTTCCGATTGGAAGAAGAACAAATACATAACG (SEQ ID NO: 132) ID109.7AY971374.1|:1159~1216 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds CCGCATGTATCCTCCAGTCTCGGTGCTCATGAGAGAGATTTACAAAGACTACACGCTA (SEQ ID NO: 133) ID109.8AY971374.1|:1217~1274 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds CCGAATGGTGTGCATCTAAAGAAGGGGATGATGATACATATTCCTGTTTATCATTTGC (SEQ ID NO: 134) ID109.9AY971374.1|:881~938 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds GGAGACAGTATTGATAATGGCATAGACGGTGGAAACAAGAAGGTGCGTATCGAAGTCG (SEQ ID NO: 135) ID109-10 939~996 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds ACGACGAACTTTTGGTGAGCCAATGTGTGCTGTTCTTCCAAGCTGGCTTCCAGCCAAG (SEQ ID NO: 136) ID109-11 1101~1158 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds TGCAGACCGACTGCGTGACCGCCCTGCCTTTCCTCGCCCAGTGCATGGAGGAATCCCT (SEQ ID NO: 137) ID109-11 1159~1216 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, complete cds CCGCATGTATCCTCCAGTCTCGGTGCTCATGAGAGAGATTTACAAAGACTACACGCTA (SEQ ID NO: 138) ID109-12 1217~1274 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds CCGAATGGTGTGCATCTAAAGAAGGGGATGATGATACATATTCCTGTTTATCATTTGC (SEQ ID NO: 139) ID109-13 1275~1333 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds ATCACAATCCGAAGTATTTCCCGGAGCCCGAGGTGTTTCGTCCGGAGCGGTTTTCTGAA (SEQ ID NO: 140) ID109-14 1334~1390 Plutella xylostella cytochrome P450 (CYP6BF1v1) mRNA, complete cds GAAGGACGGAAAAGTATTGTCCCGTATACCTACTTGCCCTTTGGGGACGGGCCGAGG (SEQ ID NO: 141) IDP1.101~250 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP2.251~400 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP3.401~550 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA CAGACAATTTTAAAAACTTTTACCACAGAGGTGTTGAAATCGCTAAGAAAGATAAACTAGCACAAAATGT (SEQ ID NO: 144) Diamondback moth (Plutella xylostella), mRNA ACCTTTCCTGAACGGCAGTCGGTGGAAACTTATGAGACAAAAAATGACGCCGCTGTCACTAGTGCGAAGCTGAAGAACA (SEQ ID NO: 145) IDP4.551~700 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP5.701~850 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP6.851~1000 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP7.751~1050 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] IDP8.450~751 Plutella xylostella cytochrome P450 6k1-like (LOC105392167), mRNA [ka] ID110.KC789751.1|:72~1432 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID111.301~400 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID112.701~800 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds AAGCTTTCAACGAGATCGAAGACTTCTTCATTGGTTCAATAAGTCAAGTGATGAAATCAAGAGAACAAGAAATGTAAAGAGACACGACTTTGCTGAAAT (SEQ ID NO: 153) ID113.1101~1200 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID114.MN480661.1|:55~1500 Spodoptera frugiperda cytochrome P450 CYP6AE44 mRNA, complete cds [ka] ID115.MN480661.1|:701~1001 Spodoptera frugiperda cytochrome P450 CYP6AE44 mRNA, complete cds [ka] ID116. Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA NCBI reference sequence: XM_035591116.1 [ka] [ka] ID117.101-300 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID118.1101-1200 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID119. Spodoptera frugiperda cytochrome P450 CYP9A58 mRNA, complete cds GenBank: MN480666.1|: 101-250, 1101-1250 [ka] ID120.101-200 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID121.201-300 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID122.101-300 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID123.301-400 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID125.1201-1300 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID126.1301-1400 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID127.101-300 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID129.Predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID130.201~300 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID133.801~900 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID135.1201~1300 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID.1749~2049 Plutella xylostella strain DBM1Ac-S ABC transporter subfamily H member 1 (ABCH1) mRNA, complete cds Sequence ID: KP260785.1 [ka] ID137.|MN480666.1|:101~250 Spodoptera frugiperda cytochrome P450 CYP9A58 mRNA, complete cds [ka] ID138.1101~1250 Spodoptera frugiperda cytochrome P450 CYP9A58 mRNA, complete cds [ka] ID139.151-300 predicted: Spodoptera frugiperda ABC transporter G family member 20-like (LOC118270582), transcript variant X1, mRNA [ka] ID140.XM_035586211.1|:2801-3000 predicted: Spodoptera frugiperda ABC transporter G family member 20-like (LOC118270582), transcript variant X1, mRNA [ka] ID141.201-300 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID142.251-350 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID143.351-450 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID144.451-550 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID145.551-650 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID146.551-700 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID147.XM_035601452.1|:201-400 predicted: Spodoptera frugiperda PBAN-type neuropeptide (LOC118281022), mRNA [ka] ID149.151-300 predicted: Spodoptera frugiperda charged multivesicular body protein 4b-like (LOC118279222), mRNA [ka] ID150.801-950 predicted: Spodoptera frugiperda charged multivesicular body protein 4b-like (LOC118279222), mRNA [ka] ID151.151-300 and 801-950 Presented Spodoptera frugiperda charged multivesicular body protein 4b-like (LOC118279222), mRNA [ka] ID152.301-450 and 1851-2000 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID153.301~450 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID154.1851~2000 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID155.201~300 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID156.301~400 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID157.401~500 Spodoptera frugiperda cytokine receptor mRNA, complete cds [ka] ID158.101~200 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID159.201~300 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID160.301~400 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID161.401~500 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID162.801~900 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID163.901~1000 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID164.1001~1100 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID165.1401~1500 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID166.1451~1550 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID167.1501~1600 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID168.1601~1700 Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID169. Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID170. Spodoptera frugiperda Dredd mRNA, complete cds [ka] ID171.200-300 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID172.300-400 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID173.400-500 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID174.500-600 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID175.Predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA 4100-4200 [ka] ID176.600-700 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID177.2600-2700 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID178.2700-2800 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID179.3800-3900 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID180.3900-4000 predicted: Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID181. Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID181. Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID182. Spodoptera frugiperda dual oxidase-like (LOC118269141), transcript variant X1, mRNA [ka] ID183.101-200 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID184.201-300 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID185.301-400 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID186.401-500 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID187.501-600 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID188.601-700 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID189.651-750 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID190. Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID191.201~500 predicted: Spodoptera frugiperda glutathione S-transferase 1-like (LOC118261931), mRNA [ka] ID192.101-200 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID193.201-300 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID194.301-400 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID195.401-500 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID196.1901-2000 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID197.2001-2100 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID198.201-350 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID199.1901-2050 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID200.201-350, 1901-1050 predicted: Spodoptera frugiperda protein mesh (LOC118271033), transcript variant X1, mRNA [ka] ID202.MT544380.1|:101~400 Spodoptera frugiperda clone Sf_17445 protein mesh mRNA, partial cds [ka] ID203.301-400 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID204.401-500 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID205.701-800 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID206.801-900 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID207.1351-1450 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID211. Spodoptera frugiperda, unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID212.401~500 Spodoptera frugiperda V-ATPase subunit A mRNA, complete cds [ka] ID213.1301~1400 Spodoptera frugiperda V-ATPase subunit A mRNA, complete cds [ka] ID214.1501~1600 Spodoptera frugiperda V-ATPase subunit A mRNA, complete cds [ka] ID218.100-159, 1-60, Spodoptera frugiperda V-type proton ATPase catalytic subunit A (LOC118267501), transcript variants X1, X2, X3, and X4 [ka] ID219.XM_035591116.1|:100-1600 predicted: Spodoptera frugiperda cytochrome P450 6B2-like (LOC118273915), mRNA [ka] ID220.301~400 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID221.701~800 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID222.1101~1200 Spodoptera frugiperda cytochrome P450 CY321A8 mRNA, complete cds [ka] ID223.501-600 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variant X1, mRNA [ka] ID.61~360 Plutella xylostella prophenoloxidase 1 mRNA, complete cds GenBank: KT006134.1 [ka] ID.BI-P450 Diamondback moth (Plutella xylostella) cytochrome P450 (CYP6BF1v1) mRNA, GenBank: AY971374.1 nt#s471~520, 556~605, 629~678, 752~802, 856~905, 1317~1366. [ka] ID.201~500 Spodoptera frugiperda cytochrome P450 CYP6AE44 mRNA, complete cds sequence ID: MN480661.1 [ka] ID.1601~1789 Plutella xylostella strain DBM1Ac-S ABC transporter subfamily H member 1 (ABCH1) mRNA, complete cds sequence ID: KP260785.1 [ka] ID.332~632 Plutella xylostella juvenile hormone epoxide hydrolase mRNA, complete cds GenBank: JX297814.2 [ka] ID.M_011553525.1|:161-460 predicted: Plutella xylostella protein mesh-like (LOC105383478), mRNA [ka] XM_011553525.1|:3300-3599 predicted: Plutella xylostella protein mesh-like (LOC105383478), mRNA [ka] ID25-2.351~500 predicted: Plutella xylostella venom carboxylesterase-6 (LOC105388350), mRNA [ka] ID.4~303 Spodoptera frugiperda V-ATPase subunit E mRNA, complete cds Sequence ID: MT707618.1 [ka] ID. Plutella xylostella vacuolar ATP synthase subunit E mRNA, GenBank: AB189032.1 191-240, 505-554, 683-812, 875-924, 1091-1140, 1172-1222 [ka] ID.301-400, 401-500, 1351-1450 predicted: Spodoptera frugiperda unidentified LOC118263801 (LOC118263801), transcript variants X1, X2, and X3, mRNA [ka] ID.252~491 Western corn rootworm (Diabrotica virgifera virgifera) charged multivesicular body protein 4b (LOC114337301), mRNA sequence ID: XM_028287710.1 [ka] ID.87~386 predicted: Diamondback moth (Plutella xylostella) cytokine receptor-like (LOC105380229), mRNA sequence ID: XM_011549746.3 Domeless: [ka] ID.77-376 predicted: Diamondback moth (Plutella xylostella) caspase-8 (LOC105390324), mRNA sequence ID: XM_011561609.3 Dredd: [ka] ID.96~395 Plutella xylostella glutathione synthetase (Gss), mRNA sequence ID: NM_001309054.2GSS1: [ka] ID. Predicted: Plutella xylostella dual oxidase (LOC105389437), mRNA sequence ID: XM_048622382.1 Duox [ka] ID.MH899215.1|:461~761 Diamondback moth (Plutella xylostella) chitinase 5 mRNA, complete cds

Chem.

[0282] References Andres et al.(2015).Setup and validation of shake-flask procedures for the determination of partition coefficients(log D)from low drug amounts.European Journal of Pharmaceutical Sciences,76,181-191. Ansell,et al.(2015).Drug resistance in Giardia duodenalis.Biotechnology advances,33(6),888-901. Barash et al.(2017).Giardia colonizes and encysts in high-density foci in the murine small intestine.mSphere,2(3),e00343-16. Begum et al.(2015).Immune evasion mechanisms of Entamoeba histolytica:progression to disease.Frontiers in microbiology,6,1394. Bendesky et al.(2002).Is metronidazole carcinogenic?Mutation Research / Reviews in Mutation Research,511(2),133-144. Chan et al.(2017).Comparative Analysis Reveals Furoyl in Vivo Selective Hydroxyl Acylation Analyzed by Primer Extension Reagents Form Stable Ribosyl Ester Adducts.Biochemistry,56(13),1811-1814. Chen et al.(2004).Poly-2’-DNP-RNAs with enhanced efficacy for inhibiting cancer cell growth.Oligonucleotides,14(2),90-99. Cosar et al.1959.The activity of 1-(2-hydroxyethyl)-2-methyl5-nitroimidazole(R.P.8823)against experimental Trichomonas vaginalis infections.Ann.Inst.Pasteur(Paris)96:238-24. Cudmore et al.(2004).Treatment of infections caused by metronidazole-resistant Trichomonas vaginalis.Clinical microbiology reviews,17(4),783-793. Davis et al.(2010).Evidence of RNAi in humans from systemically administered siRNA via targeted nanoparticles.nature,464(7291),1067. Diamond et al.(1978).A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba.Transactions of the Royal Society of Tropical Medicine and Hygiene,72(4),431-432. Elliot et al.(2011).Chapter 4:The RNA-Binding Proteins.Molecular Biology of RNA.Oxford University Press. Fire et al.(1998).Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature,391(6669),806-811. Friedman et al.(2015).Highly stable aptamers selected from a 2’-fully modified fGmH RNA library for targeting biomaterials.Biomaterials,36,110-123. Gardner et al.(2001).Treatment of giardiasis.Clinical microbiology reviews,14(1),114-128. Hemingway J et al.”The molecular basis of insecticide resistance in mosquitoes.”Insect Biochemistry and Molecular Biology(2004)34.7:653-665. Jin et al.(2014).Application of dsRNA in cancer immunotherapy:current status and future trends.Anti-Cancer Agents in Medicinal Chemistry(Formerly Current Medicinal Chemistry-Anti-Cancer Agents),14(2),241-255. Khvorova,A.,& Watts,J.K.(2017).The chemical evolution of oligonucleotide therapies of clinical utility.Nature Biotechnology,35(3),238-248. Kujawski et al.(2011).Prediction of log P:ALOGPS application in medicinal chemistry education.Journal of Chemical Education,89(1),64-67. Leeson et al.(2007).The influence of drug-like concepts on decision-making in medicinal chemistry.Nature Reviews Drug Discovery,6(11),881. Liao et al.(2005).Biomembrane-permeable and ribonuclease-resistant siRNA with enhanced activity.Oligonucleotides,15(3),196-205. Lipinski et al.(2004).Lead-and drug-like compounds:the rule-of-five revolution.Drug Discovery Today:Technologies,1(4),337-341. Liu et al.(2010).Fabrication of stable and RNase-resistant RNA nanoparticles active in gearing the nanomotors for viral DNA packaging.ACS nano,5(1),237-246. Liu et al.(2015).Digestion of nucleic acids starts in the stomach.Scientific reports,5,11936. Lopez-Rosas et al.(2012).mRNA decay proteins are targeted to poly (A)+ RNA and dsRNA-containing cytoplasmic foci that resemble P-bodies in Entamoeba histolytica.PloS one,7(9),e45966. Lorenzi et al.(2010).New assembly,reannotation and analysis of the Entamoeba histolytica genome reveal new genomic features and protein content information.PLoS neglected tropical diseases,4(6),e716. Marcial-Quino et al.(2017).RNAi-Mediated Specific Gene Silencing as a Tool for the Discovery of New Drug Targets in Giardia lamblia;Evaluation Using the NADH Oxidase Gene.Genes,8(11),303. Merino et al.(2005).RNA structure analysis at single nucleotide resolution by selective 2’-hydroxyl acylation and primer extension (SHAPE).Journal of the American Chemical Society,127(12),4223-4231 Mortimer et al.(2009).Time-resolved RNA SHAPE chemistry:Quantitative RNA structure analysis in one second snapshots and at single nucleotide resolution.Nature protocols,4(10),1413. Nair et al.(2014).Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAimediated gene silencing.Journal of the American Chemical Society,136(49),16958-16961. Ohnishi et al.(2014).Subjective adverse reactions to metronidazole in patients with amebiasis.Parasitology international,63(5),698-700. Pompey et al.(2015).A single RNaseIII domain protein from Entamoeba histolytica has dsRNA cleavage activity and can help mediate RNAi gene silencing in a heterologous system.PloS one,10(7),e0133740. Prucca et al.(2008).Antigenic variation in Giardia lamblia is regulated by RNA interference.Nature,456(7223),750. Ralston et al.(2011).The ways of a killer:how does Entamoeba histolytica elicit host cell death?Essays in biochemistry,51,193-210. Redaelli et al.(2013).Globalised world,globalised diseases:a case report on an amoebiasis-associated colon perforation.World Journal of Clinical Cases:WJCC,1(2),79. Samarawickrema et al.(1997).Involvement of superoxide dismutase and pyruvate:ferredoxin oxidoreductase in mechanisms of metronidazole resistance in Entamoeba histolytica.The Journal of antimicrobial chemotherapy,40(6),833-840. Santi-Rocca et al.(2008).The lysine-and glutamic acid-rich protein KERP1 plays a role in Entamoeba histolytica liver abscess pathogenesis.Cellular microbiology,10(1),202-217. Savioli et al.2006.Giardia and Cryptosporidium join the‘Neglected Diseases Initiative.’Trends Parasitol.22:203-208. Simjee et al.(1985).A comparative trial tinidazole in the treatment amoebic liver abscess.SAMJ,68,923. Solis et al.(2009).Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.PLoS One,4(12),e8424. Stanley et al.(2003).Amoebiasis.The Lancet,361(9362),1025-3. Tiwari S et al.”Insecticide resistance in field populations of Asian citrus psyllid in Florida.”Pest Management Science(2011)67.10:1258-1268 Ullu et al.(2004).RNA interference in protozoan parasites.Cellular microbiology,6(6),509-519. Vayssie et al.(2004).Double-stranded RNA mediates homologydependant gene silencing of γ-tubulin in the human parasite Entamoeba histolytica.Molecular and biochemical parasitology,138(1),21-28. Whitt et al.(1988).Influence of indigenous microbiota on activities of alkaline phosphatase,phosphodiesterase I,and thymidine kinase in mouse enterocytes.Applied and environmental microbiology,54(10),2405-2410. Wilson et al.(2012).Host-Parasite interactions in Entamoeba histolytica and Entamoeba dispar:what have we learned from their genomes?,Parasite immunology,34(2-3),90-99. Wojcik DP et al.”Red imported fire ants:impact on biodiversity.”American Entomologist-Lanham(2001)47.1:16-23. Yoder et al.,Centers for Disease Control and Prevention(CDC).MMWR Surveill Summ.2010 Jun 11;59(6):15-25. Zhang et al.(2011).Nucleus-localized antisense small RNAs with 5’polyphosphate termini regulate long term transcriptional gene silencing in Entamoeba histolytica G3 strain.Journal of Biological Chemistry,286(52),44467-44479. Zhang et al.“Cloning and Expression of Multiple Cytochrome P450 Genes:Induction by Fipronil in Workers of the Red Imported Fire Ant(Solenopsis invicta Buren).”PloS one 11.3(2016):e0150915. Ivashuta,et al.,“Environmental RNAi in herbivorous insects,”RNA;21(5):850-50(2015). Koch,et al.,“An RNAi-Based Control of Fusarium graminearum Infections Through Spraying of Long dsRNAs Involves a Plant Passage and Is Controlled by the Fungal Silencing Machinery,”PLoS Pathogens;l2(10):el005901(2016). Baum,et al.,“Progress Towards RNAi-Mediated Insect Pest Management,”Advances in Insect Physiology;vol.47:pp.249-295(2014). Baum,J,“Rnai-mediated insect pest management:challenges and opportunities,”XXVth International Congress of Entomology 2016,Orlando,Florida,U.S.A. Bolognesi,et al.”Characterizing the Mechanism of Action of Double-Stranded RNA Activity against Western Corn Rootworm(Diabrotica virgifera virgifera LeConte),”PLoS One;7(10)(2012). Gong, et al., “Testing Insecticidal Activity of Novel Chemically Synthesized siRNA against Plutella xylostella under Laboratory and Field Conditions,” PLoS One; 8(5): e62990 (2013). Micura, ”Small interfering RNAs and their chemical synthesis,” Angewandte Chemie International Ed.; 41(13): 2265 - 9 (2002). Ku, et al., “Chemical and structural modifications of RNAi therapeutics,” Advanced Drug Delivery Reviews; 104: 16 - 28 (2015). Timmons, “Construction of plasmids for RNA interference and in vitro transcription of double - stranded RNA,” Methods in Molecular Biology; 351: 109 - 17 (2006).

[0283] Additional references supporting the sequences Method for Modifying Insect Resistance of Plants by Utilizing Rnai Technique. Application No: 31293407 Filed: Dec 4, 2007 Published: Feb 25, 2010 Earliest Priority: Dec 4, 2006 Granted: Nov 25, 2014. Inventors: Chen et al. Novel Insecticidal Toxin Receptors and Methods of Use. International Publication No. 2020 / 036747A1 Patent Application Family: 4s / 4ex Family Jurisdictions: CN, WO, BR, EP Legal Status: Pending Application No: 2019044771 Filed: Aug 2, 2019 Published: Feb 20, 2020 Earliest Priority: Aug 13, 2018. Applicants: Pioneer Hi Bred Int. Inventors: Bazyk et al. Compositions and Methods to Control Insect Pests.US Patent Application Publication No. 2017 / 0253887 A1 Patent Application Family: 4s / 4ex Family Jurisdictions: WO, CA, US, AR Legal Status: Discontinued Application No: 201515511196 Filed: Aug 31, 2015 Published: Sep 7, 2017 Earliest Priority: Sep 17, 2014.Applicants: Pioneer Hi-Bred Int Inc, Du Pont.Inventors: Hu et al. Composition and methods for control of insect infectivity in plants. US Patent Application Publication No. 2012 / 0164205A1. Patent Application. Legal Status: Active. Application No: 201113226353. Filed: Sep 6, 2011. Published: Jun 28, 2012. Earliest Priority: Apr 9, 2004. Granted: Jan 19, 2016. Inventors: Baum et al. Rnai approach for crop pest protection. International Publication No. WO 2018 / 204398 Pamphlet. Earliest Priority: May 1, 2017. Inventor: Bala P. Venkata. RNA-based control of lepidopteran pests. Application No: 2021032334 Filed: May 13, 2021 Published: Nov 18, 2021 Earliest Priority: May 13, 2020. Applicants: Greenlight Biosciences Inc. Inventors: Narva et al. Cui, Gaofeng, et al. “Combined transcriptomic and proteomic analysis of harmine on Spodoptera frugiperda Sf9 cells to reveal the potential resistance mechanism.” Journal of proteomics 211 (2020): 103573. Fuzita, Felipe Jun, et al. “N-glycosylation in Spodoptera frugiperda (Lepidoptera: Noctuidae) midgut membrane-bound glycoproteins.” Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 246 (2020): 110464. Tang, Bowen, et al. “Functional characterization of an α-esterase gene associated with malathion detoxification in Bradysia odoriphaga.” Journal of Agricultural and Food Chemistry 68.22 (2020): 6076 - 6083. Webster,Gregory K.,and Matthew A.Gragg.“Low level detection of nonionic surfactants of pharmaceutical interest.”Analytical Methods 11.26(2019):3314-3323. Ren,Maozhi,et al.“Fighting against fall armyworm by using multiple genes pyramiding and silencing (MGPS) technology.”Sci China Life Sci 62.12(2019):1703-6. Howard,John D.,et al.“Chemically modified dsRNA induces RNAi effects in insects in vitro and in vivo:A potential new tool for improving RNA-based plant protection.”bioRxiv(2022). Yang,Bing,et al.”Analysis of gene expression in the midgut of Bombyx mori during the larval molting stage.”BMC genomics 17.1(2016):1-16. Gomez,Isabel,et al.”Spodoptera frugiperda(JE Smith)aminopeptidase N1 is a functional receptor of the Bacillus thuringiensis Cry1Ca toxin.”Applied and environmental microbiology 84.17(2018):e01089-18. Altstein,Miriam,and Dick R.Naessel.“Neuropeptide signaling in insects.”Neuropeptide systems as targets for parasite and pest control(2010):155-165. Park,Hyun Shin,et al.“Control of RNA with quinone methide reversible acylating reagents.“Organic & Biomolecular Chemistry 19.38(2021):8367-8376. Yang,Zhouning,et al.“SfDredd,a novel initiator caspase possessing activity on effector caspase substrates in Spodoptera frugiperda.”PloS one 11.3(2016):e0151016. Hubert,Florence,et al.“Fast fatty acid analysis by core-shell reversed-phase liquid chromatography coupled to evaporative light-scattering detector.”Food and Nutrition Sciences 8.12(2017):1051-1062. Li,Qilin,et al.“RNA-seq analyses of midgut and fat body tissues reveal the molecular mechanism underlying Spodoptera litura resistance to tomatine.”Frontiers in physiology 10(2019):8. Christiaens,Olivier,et al.“Double-stranded RNA technology to control insect pests:Current status and challenges.”Frontiers in plant science 11(2020):451. Giraudo,Maeva,et al.“Cytochrome P450s from the fall armyworm(S podoptera frugiperda):responses to plant allelochemicals and pesticides.”Insect molecular biology 24.1(2015):115-128. Heckel,David G.”The essential and enigmatic role of ABC transporters in Bt resistance of noctuids and other insect pests of agriculture.”Insects 12.5(2021):389. Hilliou,Frederique,et al.“Resistance in the genus Spodoptera:Key insect detoxification genes.”Insects 12.6(2021):544. Jonusaite,Sima,Andrew Donini,and Scott P.Kelly.“Salinity alters snakeskin and mesh transcript abundance and permeability in midgut and Malpighian tubules of larval mosquito,Aedes aegypti.”Comparative Biochemistry and Physiology Part A:Molecular & Integrative Physiology 205(2017):58-67. Lin,Junhan,et al.“Immune responses to Bacillus thuringiensis in the midgut of the diamondback moth,Plutella xylostella.”Developmental & Comparative Immunology 107(2020):103661. Guo,Zhaojiang,et al.“MAPK signaling pathway alters expression of midgut ALP and ABCC genes and causes resistance to Bacillus thuringiensis Cry1Ac toxin in diamondback moth.”PLoS genetics 11.4(2015):e1005124. Chen,Xien,and Subba Reddy Palli.”Midgut-specific expression of CYP321A8 P450 gene increases deltamethrin tolerance in the fall armyworm Spodoptera frugiperda.”Journal of Pest Science(2022):1-13. Xu,Qiuyun,et al.“Transcriptional profiling of midgut immunity response and degeneration in the wandering silkworm,Bombyx mori.”(2012):e43769. Parsons,Keith Hampton.Advancement of Interpolyelectrolyte Complexes for the Delivery of Genetic Material.Diss.The University of Southern Mississippi,2018. Wang,Rui-Long,et al.“A novel cytochrome P450 CYP6AB14 gene in Spodoptera litura(Lepidoptera:Noctuidae) and its potential role in plant allelochemical detoxification.”Journal of Insect Physiology 75(2015):54-62. Zhu,Bin,et al.“Regulation of GSTu1-mediated insecticide resistance in Plutella xylostella by miRNA and lncRNA.”PLoS Genetics 17.10(2021):e1009888. Davis-Vogel,Courtney,et al.“Identification and comparison of key RNA interference machinery from western corn rootworm,fall armyworm,and southern green stink bug.”PLoS One 13.9(2018):e0203160. Qi,Weiping,et al.“Characterization and expression profiling of ATP-binding cassette transporter genes in the diamondback moth,Plutella xylostella (L.).”BMC genomics 17.1(2016):1-18. Choi,Man-Yeon,and Robert K.Vander Meer.“Phenotypic effects of PBAN RNAi using oral delivery of dsRNA to corn earworm(Lepidoptera:Noctuidae) and tobacco budworm larvae.”Journal of economic entomology 112.1(2019):434-439. Willow, Jonathan, et al. “RNAi targets in agricultural pest insects: advances, knowledge gaps, and IPM.” Frontiers in Agronomy (2021): 99. Xie, Miao, et al. “Molecular characterization of two α-esterase genes involving chlorpyrifos detoxification in the diamondback moth,Plutella xylostella.” Pest management science 73.6(2017):1204-1212. Zou, Xiaopeng, et al. “Glutathione S-transferase SlGSTE1 in Spodoptera litura may be associated with feeding adaptation of host plants.” Insect biochemistry and molecular biology 70(2016):32-43.

[0284] The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety.

Claims

1. 1. A composition comprising post-transcriptionally chemically modified double-stranded RNA (MdsRNA), The MdsRNA is a double-stranded RNA: wherein no more than about 30% of all nucleotides independently have the formula (I): 【Chemical 1】 or an acceptable salt thereof, wherein B is a nucleobase; R 1 teeth, 【Chemistry 2】 wherein y is an integer from 1 to 8, x is an integer from 80 to 1000, a is an integer from 80 to 1000, b is an integer from 80 to 1000, and c is an integer from 80 to 1000; and Optionally, at least about 2% to about 50% of all nucleotides independently have the formula (III): 【Chemistry 3】 or an acceptable salt thereof, wherein B is a nucleobase; R 2 is C 1 ~C 25 Alkyl, C 1 ~C 25 Alkenyl, C 1 ~C 25 Alkynyl, C 5 ~C 12 Aryl or C 5 ~C 12 heteroaryl, wherein R 2 optionally halo, C 1~12 Alkyl, C 1 ~C 12 aminoalkyl, or C 1 ~C 12 alkoxy, optionally including N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleyl, nicotinoyl, or benzoyl; A composition comprising:

2. 2. The composition of claim 1, wherein the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, or the MdsRNA comprises a sequence complementary to a target region in AChE2, P450, DOMELESS, DOUX, MESH, P450 CYP6BF1v1, venom, or VPASE of the diamondback moth; SNF7 of the western corn rootworm; P450, CYP9A58, cytokine receptor DOMELESS, Dredd, VPASE, and protein MESH of the armyworm.

3. 10. A method for preparing a composition comprising the post-transcriptionally chemically modified double-stranded RNA (MdsRNA) of claim 1, comprising: (a) A compound of formula (II): 【Chemistry 4】 with an activating agent to form a compound of formula (IIA) 【Chemistry 5】 where X is a suitable leaving group. and forming; (b) A compound of formula (IA): 【Chemistry 6】 with a compound of formula (IIA) to form a compound of formula (I); (c) optionally a compound of formula (II): 【Chemistry 7】 with an activator to form a compound of formula (IVA) 【Chemistry 8】 wherein X is a suitable leaving group and R 3 is an amino acid, a fatty acid, alkyl; substituted alkyl; alkenyl; substituted alkenyl; alkynyl; substituted alkynyl; aryl; substituted aryl; C1-C10 alkyl, C1-C10 alkenyl, or C1-C10 alkynyl (wherein the alkyl and alkenyl can be linear, branched, or cyclic); hydrogen; methyl; ethyl; propyl; isopropyl; butyl; isobutyl; tert-butyl; pentyl; hexyl; cyclohexyl; heptyl; octyl; nonyl; decyl; vinyl; allyl; ethynyl; benzyl; cinnamyl; C6-C14 aryl; C6-C14 substituted aryl; heterocyclyl; C5-C14 heterocyclyl; phenyl; mono- or di-substituted phenyl (wherein the substituents are C 1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl); 2-nitrophenyl; 4-nitrophenyl; 2,4-dinitrophenyl; 2-trifluoromethylphenyl; 4-trifluoromethylphenyl; styryl; C8-C16 substituted styryl; 2-aminophenyl; mono- or di-substituted 2-aminophenyl, wherein the substituents are selected from C1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl; N-alkyl-2-aminophenyl or N-aryl-2-aminophenyl, wherein alkyl is of the formula -C m H 2m+1 where m is an integer less than or equal to 12, and aryl is an aromatic moiety); 2-amino-3-methyl-phenyl; 2-amino-5-chlorophenyl; 2-methyl-5-chlorophenyl; N-methyl-2-aminophenyl; N-ethyl-2-aminophenyl; N-propyl-2-aminophenyl; N-butyl-2-aminophenyl; N-pentyl-2-aminophenyl; N-methyl-2-amino-4-nitrophenyl; 2-methyl-3-furyl; 2-methylnicotyl or N-trifluoromethyl-2-aminophenyl; silanyl; substituted silanyl; C1-C10 alkylsilanyl; C3-C12 trialkylsilanyl; C2-C12 alkoxyalkyl; C2-C12 alkoxyalkenyl; C2-C12 alkylthioalkyl;Alkylsulfonyl; C1-C10 alkylsulfonyl; C1-C10 haloalkyl; C1-C10 haloalkenyl or C1-C10 aminoalkyl; -(CH2CH2O)pCH3, -(CH2CH2O)pH, or -(CH2CH2O)pCOOR4 (wherein p is an integer from 2 to 8 and R4 is H, alkyl, substituted alkyl, aryl, or substituted aryl); -(CH2CH2O)8COOH; -CH2CH2OH; -(CH2CH2O)4OH; -(CH2CH2O)6OH; -(CH2CH2O)8OH; -(CH2CH2O)8COOMe; -(CH2CH 2 O) 4 OMe; -(CH 2 CH 2 O) 6 OMe; -(CH 2 CH 2 O) 8 OMe; -CH 2 OCH 3 ; -CH 2 OCH 2 CH 3 ; or -CH 2 OCH 2 CH 2 OCH 3 ); and forming; (d) optionally a compound of formula (IA): 【Chemistry 9】 with a compound of formula (IVA) to form a compound of formula (III); A method comprising: (e) optionally, (a), (b), (c), or (d) is carried out in a substantially anhydrous solvent; (f) optionally, the substantially anhydrous solvent is selected from DMSO or DCM; (g) optionally after (a) or (c), an ionic solvent is added; (h) Optionally, the ionic solvent is selected from benzyltributylammonium chloride or benzyltrimethylammonium chloride.

4. The method of claim 3 , wherein the activating agent is carbonyldiimidazole.

5. The preferred leaving groups are 【Chemistry 10】 The method according to claim 3 or 4, wherein

6. 5. The method of claim 3 or 4, wherein the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, or the MdsRNA comprises a sequence complementary to a target region in AChE2, P450, DOMELESS, DOUX, MESH, P450 CYP6BF1v1, venom, or VPASE of the diamondback moth; SNF7 of the western corn rootworm; P450, CYP9A58, cytokine receptor DOMELESS, Dredd, VPASE, and protein MESH of the armyworm.

7. 1. A method for preparing a composition comprising post-transcriptionally chemically modified double-stranded RNA (MdsRNA), the MdsRNA comprising a double-stranded RNA: wherein at least about 2% of the nucleotides independently have the formula (VI): 【Chemistry 11】 or an acceptable salt thereof, wherein B is a nucleobase; R 3 is an amino acid, a fatty acid, alkyl; substituted alkyl; alkenyl; substituted alkenyl; alkynyl; substituted alkynyl; aryl; substituted aryl; C1-C10 alkyl, C1-C10 alkenyl, or C1-C10 alkynyl (wherein the alkyl and alkenyl can be linear, branched, or cyclic); hydrogen; methyl; ethyl; propyl; isopropyl; butyl; isobutyl; tert-butyl; pentyl; hexyl; cyclohexyl; heptyl; octyl; nonyl; decyl; vinyl; allyl; ethynyl; benzyl; cinnamyl; C6-C14 aryl; C6-C14 substituted aryl; heterocyclyl; C5-C14 heterocyclyl; phenyl; mono- or di-substituted phenyl (wherein the substituents are C 1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl); 2-nitrophenyl; 4-nitrophenyl; 2,4-dinitrophenyl; 2-trifluoromethylphenyl; 4-trifluoromethylphenyl; styryl; C8-C16 substituted styryl; 2-aminophenyl; mono- or di-substituted 2-aminophenyl, wherein the substituents are selected from C1-C10 alkyl, C1-C10 alkenyl, C1-C6 alkoxy, halogen, nitro, methylsulfonyl, and trifluoromethyl; N-alkyl-2-aminophenyl or N-aryl-2-aminophenyl, wherein alkyl is of the formula -C m H 2m+1 wherein m is an integer of 12 or less, and aryl is an aromatic moiety); 2-amino-3-methyl-phenyl; 2-amino-5-chlorophenyl; 2-methyl-5-chlorophenyl; N-methyl-2-aminophenyl; N-ethyl-2-aminophenyl; N-propyl-2-aminophenyl; N-butyl-2-aminophenyl; N-pentyl-2-aminophenyl; N-methyl-2-amino-4-nitrophenyl; 2-methyl-3-furyl; 2-methylnicotyl, or N-trifluoromethyl-2-aminophenyl; silanyl; substituted silanyl; C1-C10 alkylsilanyl; C3-C12 trialkylsilanyl; C2-C12 alkoxyalkyl; C2-C12 alkoxyalkenyl; C2-C12 alkylthioalkyl; alkylsulfonyl; C1-C10 alkylsulfonyl; C1-C10 haloalkyl; C1-C10 haloalkenyl, or C1-C10 aminoalkyl; —(CH 2 CH 2 O) p CH 3 , -(CH 2 CH 2 O) p H, or -(CH 2 CH 2 O) p COOR 4 (wherein p is an integer of 2 to 8, and R 4 is H, alkyl, substituted alkyl, aryl, or substituted aryl); —(CH 2 CH 2 O) 8 COOH; -CH 2 CH 2 OH; -(CH 2 CH 2 O) 4 OH; -(CH 2 CH 2 O) 6 OH; -(CH 2 CH 2 O) 8 OH; -(CH 2 CH 2 O) 8 COOMe;-(CH 2 CH 2 O) 4 OMe; -(CH 2 CH 2 O) 6 OMe; -(CH 2 CH 2 O) 8 OMe; -CH 2 OCH 3 ;-CH 2 OCH 2 CH 3 or -CH 2 OCH 2 CH 2 OCH 3 ) selected from Including, (a) A compound of formula (IV): 【Chemistry 12】 with an activator to form a compound of formula (IVA) 【Chemistry 13】 where X is a suitable leaving group. and forming; (b) A compound of formula (VIA): 【Chemistry 14】 with a compound of formula (IVA) to form a compound of formula (VI); A method comprising:

8. (a) or (b) is carried out in an anhydrous solvent; the anhydrous solvent is selected from DMSO or DCM; (a) and (b) are carried out without any intervening purification; there is a purification step between (a) and (b); (a) followed by the addition of an ionic solvent; the ionic solvent is selected from benzyltributylammonium chloride or benzyltrimethylammonium chloride; The method of claim 7 , wherein the activating agent is carbonyldiimidazole.

9. R 3 is N-methylanthranoyl (NMA), N-benzylanthranoyl (NBA), dimethylfuroyl, -Tyr, -Trp, -Leu, octanoyl, lauroyl, linoleyl, oleoyl, nicotinoyl, or benzoyl.

10. 9. The method of claim 7 or 8, wherein the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, or the MdsRNA comprises a sequence complementary to a target region in AChE2, P450, DOMELESS, DOUX, MESH, P450 CYP6BF1v1, venom, or VPASE of the diamondback moth; SNF7 of the western corn rootworm; P450, cytokine receptor DOMELESS, Dredd, VPASE, and protein MESH of the armyworm.

11. 1. A method for modifying the expression of a polynucleotide of interest in either an insect, acar, fungus or weed, comprising administering a composition according to claim 1 or 2, wherein optionally the modified expression increases mortality, induces growth inhibition, arrests age-related development or reduces reproduction of the target insect.

12. The expression is in target regions in AChE2, P450, DOMELESS, DOUX, MESH, P450 CYP6BF1v1, venom or VPASE of diamondback moth; SNF7 of corn rootworm; P450, VPASE, cytokine receptor DOMELESS, Dredd, and protein MESH of armyworm, optionally the target region is in P450 CYP6BF1v1, MESH transcript variant X1 or venom carboxylesterase-6, and optionally the expression is in P450 CYP9A58, P450 CYP321A8, P450 CYP9A59, P450 CYP321A9, P450 CYP9A56, P450 CYP9A55, P450 CYP9A54, P450 CYP9A56, P450 CYP9A58, P450 CYP9A59, P450 CYP9A56 ...

12. The method of claim 11, wherein the target region is in CYP6B2-like, cytokine receptor DOMELESS, Dredd, and protein MESH transcript variant X1.

13. the modified expression reduces the reproduction of Lepidopteran insects, such as the diamondback moth, gypsy moth, or armyworm; or said expression increases mortality, or induces growth inhibition, or arrests aging development, or reduces reproduction in Coleopteran insects, such as the Colorado potato beetle, the Canola flea beetle, or the corn rootworm; or the weed is Palmer Amaranth, or the fungus is Fusarium graminearum or Botrytis, or 12. The method of claim 11, wherein the mite is a Varroa mite.

14. The method of claim 9, wherein the MdsRNA comprises a sequence complementary to an expressed RNA in a target insect, or wherein the MdsRNA comprises a sequence complementary to a target region in AChE2, P450, DOMELESS, DOUX, MESH, P450 CYP6BF1v1, venom or VPASE of the diamondback moth; SNF7 of the western corn rootworm; P450, cytokine receptor DOMELESS, Dredd, VPASE and protein MESH of the armyworm.

15. The modified expression reduces the reproduction of Lepidopteran insects, such as the diamondback moth, gypsy moth, or armyworm; or said expression increases mortality, or induces growth inhibition, or arrests aging development, or reduces reproduction in Coleopteran insects, such as the Colorado potato beetle, the Canola flea beetle, or the corn rootworm; or the weed is Palmer Amaranth, or the fungus is Fusarium graminearum or Botrytis, or 13. The method of claim 12, wherein the mite is a Varroa mite.