RNA editing via recruitment of spliceosome components
Patent Information
- Application Number
- JP2024513942
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-25
- Filing Date
- 2022-09-02
- Publication Date
- 2025-10-06
AI Technical Summary
Current RNA editing technologies for human gene therapy are inefficient and pose safety concerns due to low efficiency and immunogenicity, limiting their effectiveness in replacing disease-causing sequences.
The use of engineered small nuclear RNAs (esnRNAs) that recruit spliceosome components to promote trans-splicing between a target RNA and an RNA donor molecule, enhancing the efficiency of RNA editing by incorporating therapeutic sequences into human cells.
This approach achieves high-efficiency RNA trans-splicing, allowing for the replacement of defective sequences in human cells, effectively treating genetic disorders and modifying both coding and non-coding regions of target RNAs, thereby increasing protein production or altering RNA behavior.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 240,428, filed September 3, 2021, and U.S. Provisional Application No. 63 / 345,660, filed May 25, 2022, which applications are incorporated herein by reference. [Background technology]
[0002] There is a long-standing and unmet need to replace disease-causing RNA sequences.The present disclosure provides compositions and methods for replacing specific RNA sequences in RNA molecules of human cells.In certain aspects, the present disclosure provides compositions and methods for replacing selected RNA sequences in target RNA.In some embodiments, the present disclosure provides RNA donor molecules for use with engineered small nuclear RNAs in the context of human gene therapy, which recruit spliceosome components to the RNA donor and promote editing of target RNA to treat disease.
[0003] Effective treatment of human genetic diseases requires efficient replacement of defective gene sequences in human cells. RNA editing has been proposed as a human gene therapy, but has not been successful in clinical trials due to low efficiency and limited size and composition of RNA editing. Furthermore, the use of immunogenic proteins for RNA and DNA editing is accompanied by safety issues. This disclosure describes improvements in RNA editing that can address this long-desired but unmet need. Summary of the Invention [Means for solving the problem]
[0004] In certain aspects, disclosed herein are compositions comprising engineered small nuclear RNA that facilitates trans-splicing of a target RNA molecule and an RNA donor molecule. In some embodiments, the RNA donor molecule comprises an engineered small nuclear RNA domain. In some embodiments, the engineered small nuclear RNA molecule is derived or isolated from a human small nuclear RNA gene selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12. In some embodiments, the engineered small nuclear RNA molecule is derived or isolated from the U1 small nuclear RNA gene or a variant of the U1 small nuclear RNA gene and contains an RNA motif that is partially or fully complementary to the RNA donor molecule and begins less than 16 nucleobases from the 5' end. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is partially or fully complementary to the RNA donor molecule. In some embodiments, the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the engineered small RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene or a variant of the U1 small nuclear RNA gene. In some embodiments, the engineered small RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene. In some embodiments, the variant of the U1 small nuclear RNA gene is selected from the group consisting of vU1.4, vU1.11, vU1.8, vU1.7, vU1.5, vU1.12. In some embodiments, the small nuclear RNA molecule comprises RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the composition further comprises an RNA binding protein that enhances the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. In some embodiments, the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the RNA donor molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the translation enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) Post-transcriptional Regulatory Element (WPRE), MALAT1-derived triple helix, Hepatitis B Virus PRE (HPRE), and iron-responsive element. In some embodiments, the composition further comprises an RNA-binding protein that enhances the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. In some embodiments, the RNA donor molecule comprises RNA, DNA, DNA / RNA hybrids, nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the nucleic acid molecule further comprises a heterologous promoter. In some embodiments, described herein is a vector comprising the composition of the claims disclosed herein.In some embodiments, the vector is selected from the group consisting of adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer. In some embodiments, described herein is a cell comprising a vector described herein. In some embodiments, described herein is a method for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a treatment comprising a composition described herein or a vector described herein. In some embodiments, described herein is a method for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein. In some embodiments, described herein is a method for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a composition described herein or a vector described herein. In some embodiments, described herein is a method for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein.
[0005] In certain aspects, disclosed herein are compositions comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule, the RNA donor molecule comprising (a) one or more replacement domains encoding a therapeutic sequence operably linked thereto, (b) one or more intron domains that promote RNA splicing of the replacement domains, and (c) one or more antisense domains that promote binding to the target RNA molecule. In some embodiments, the RNA donor molecule comprises an engineered small nuclear RNA domain. In some embodiments, the engineered small nuclear RNA molecule is derived or isolated from a human small nuclear RNA gene selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12. In some embodiments, the engineered small nuclear RNA molecule is derived or isolated from a U1 small nuclear RNA gene or a variant of the U1 small nuclear RNA gene, and contains an RNA motif that is partially or completely complementary to the RNA donor molecule and begins less than 16 nucleobases from the 5' end. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is partially or completely complementary to the RNA donor molecule. In some embodiments, the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the engineered small nuclear RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene or a variant of the U1 small nuclear RNA gene. In some embodiments, engineered small RNA molecules comprise sequences derived or isolated from the U1 small nuclear RNA gene and variants of the U1 small nuclear RNA gene.In some embodiments, the variant of the U1 small nuclear RNA gene is selected from the group consisting of vU1.4, vU1.11, vU1.8, vU1.7, vU1.5, vU1.12. In some embodiments, the small nuclear RNA molecule comprises RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the composition further comprises an RNA binding protein that strengthens the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or fully complementary to a sequence in the RNA donor molecule. In some embodiments, the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the RNA donor molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the translation enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), MALAT1 derived triple helix, Hepatitis B virus PRE (HPRE), and iron responsive element. In some embodiments, the composition further comprises an RNA binding protein that enhances the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency.In some embodiments, the RNA donor molecule comprises RNA, DNA, DNA / RNA hybrids, nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the nucleic acid molecule further comprises a heterologous promoter. Described herein in some embodiments is a vector comprising the composition of the claims disclosed herein. In some embodiments, the vector is selected from the group consisting of an adeno-associated virus, a retrovirus, a lentivirus, an adenovirus, a nanoparticle, a micelle, a liposome, a lipoplex, a polymersome, a polyplex, and a dendrimer. Described herein in some embodiments is a cell comprising a vector described herein. Described herein in some embodiments is a method for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a treatment comprising a composition described herein or a vector described herein. Described herein in some embodiments is a method for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein. In some embodiments, described herein are methods for treating a disease, comprising administering a therapeutically effective amount of a composition described herein or a vector described herein to a patient in need of treatment. In some embodiments, described herein are methods for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein.
[0006] In certain aspects, disclosed herein is a composition comprising an RNA donor molecule, the composition comprising: (a) one or more replacement domains encoding operably linked therapeutic sequences; (b) one or more intron domains facilitating RNA splicing of the replacement domains; and (c) one or more antisense domains facilitating binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain facilitating trans-splicing of the RNA donor molecule. In some embodiments, the engineered small nuclear RNA domain is located less than 200 bases away from the splice donor site in the RNA donor molecule. In some embodiments, the engineered small nuclear RNA domain is isolated or derived from a human small nuclear RNA gene. In some embodiments, the human small nuclear RNA gene is selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12. In some embodiments, the engineered small nuclear RNA domain is synthetic and binds to a component of the spliceosome. In some embodiments, the engineered small nuclear RNA domain comprises a sequence isolated or derived from a variant of the human U1 gene. In some embodiments, the engineered small nuclear RNA domain comprises a sequence derived from the human U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene. In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the composition further comprises an RNA binding protein that strengthens the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule.In some embodiments, the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the RNA donor molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. In some embodiments, the RNA donor molecule further comprises an untranslated region that enhances translation. In some embodiments, the translation enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), triple helix from MALAT1, PRE (HPRE) of Hepatitis B virus, and iron-responsive element. In some embodiments, the composition further comprises an RNA binding protein that enhances the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. In some embodiments, the RNA donor molecule comprises RNA, DNA, DNA / RNA hybrid, nucleic acid analog, chemically modified nucleic acid, or chimera composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the nucleic acid molecule further comprises a heterologous promoter. In some embodiments, described herein is a vector comprising the composition of the claims disclosed herein. In some embodiments, the vector is selected from the group consisting of adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer. In some embodiments, described herein is a cell comprising the vector described herein.In some embodiments, described herein are methods for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a treatment comprising a composition described herein or a vector described herein. In some embodiments, described herein are methods for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein. In some embodiments, described herein are methods for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a composition described herein or a vector described herein. In some embodiments, described herein are methods for repairing a genetic defect in a subject, comprising administering to the subject a composition described herein or a vector described herein.
[0007] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference herein. [Brief description of the drawings]
[0008] [Figure 1]A-C show one embodiment of the method described herein. A shows the concept of human genetic disease in which mutated ("defective") DNA sequences are transcribed into RNA that contributes to disease directly ("RNA pathogenesis") or indirectly via translation into disease-causing proteins ("pathogenic protein translation"). B shows a system consisting of a donor RNA and an engineered small nuclear RNA ("esnRNA"). Combining the RNA donor molecule with the esnRNA results in hybridization of the RNA donor to a target RNA carrying a mutation, followed by association of the esnRNA with the RNA donor, which recruits spliceosome components and results in trans-splicing between the RNA donor molecule and the target RNA, thereby resulting in a corrected target RNA in which the selected sequence in the target RNA has been replaced by the RNA donor molecule. C shows how the components interact. Base pairing between the RNA donor and the target RNA brings these molecules into close proximity. Base pairing between the esnRNA and the RNA donor brings the spliceosome components into close proximity, facilitating the trans-splicing reaction between the target RNA and the RNA donor.
[0009] [Diagram 2] A-B show two non-limiting embodiments. A shows a version that results in a substitution in an internal sequence within the target RNA molecule. In this embodiment, the internal sequence is replaced with an RNA donor molecule while retaining the 5'-end and 3'-end of the target RNA. B shows that the 5'-end portion of the target RNA is replaced while retaining the 3'-end of the target RNA.
[0010] [Diagram 3]A-B show two non-limiting embodiments. In one embodiment (A), the esnRNA and the RNA are separate molecules and the esnRNA and the RNA donor associate in the manner outlined in FIG. 1C. In B, the esnRNA is a domain within the RNA donor. In both cases, the esnRNA sequence acts by the same mechanism, recruiting spliceosome components to the RNA donor, thereby driving trans-splicing between the target RNA and the RNA donor.
[0011] [Figure 4] A-D show experiments designed to clarify the importance of esnRNA in relation to the replacement of internal sequences in the target RNA. A shows the design of a split GFP reporter with N- and C-terminal portions of GFP ("C-GFP") but lacking the internal GFP sequence required for fluorescence. In the reporter, this internal GFP sequence is replaced with a short exon with a stop codon flanked by introns. The internal sequence is a replacement sequence within the RNA donor molecule flanked by one intron domain and one antisense domain. B shows activity of the reporter alone, where cis-splicing produces a GFP sequence interrupted by a stop codon, so no GFP signal is produced. C shows activity of the reporter in the presence of an RNA donor molecule without esnRNA, where again cis-splicing occurs predominantly, so no GFP signal is produced. D shows activity of the reporter in the presence of an RNA donor molecule with esnRNA, where trans-splicing occurs predominantly, so GFP signal is produced.
[0012] [Diagram 5]Panels A-B show experiments designed to clarify the importance of esnRNA in relation to replacement of 5'-terminal sequences in target RNA. Panel A shows the design of a split GFP reporter with the C-terminal portion of GFP ("C-GFP") but lacking the N-terminal GFP sequence required for fluorescence. In the reporter, this N-terminal GFP sequence is replaced by a short exon flanked by introns. The N-terminal sequence ("N-GFP") is a replacement sequence in the RNA donor molecule flanked by one intron sequence and one antisense domain. Panel B shows activity of the reporter alone, where cis-splicing produces a GFP sequence lacking the N-terminal portion of GFP, so no GFP signal is produced. Panel C shows activity of the reporter in the presence of an RNA donor molecule without esnRNA, where cis-splicing also occurs predominantly and thus GFP signal is not efficiently produced. Panel D shows activity of the reporter in the presence of an RNA donor molecule with esnRNA, where trans-splicing occurs predominantly and thus GFP signal is efficiently produced.
[0013] [Figure 6]A shows experimental data investigating the importance of certain features of esnRNAs in relation to the replacement of specific sequences in the target RNA. Various esnRNAs (designated A-H) were constructed that are derived from human U1 snRNA but have mutations at the 5' end that generate a region complementary to the RNA donor molecule. The targets of these antisense domains are outlined in B. Human cells were treated with the RNA donor and various esnRNAs along with the reporter system described in Figure 5. The resulting GFP signal showed that two esnRNAs ("esnRNA B" and "esnRNA C") showed the highest GFP signal, thus indicating the most efficient insertion of the RNA donor molecule into the target RNA. These data indicate that the choice of target site is a critical factor to achieve efficient insertion of the RNA donor sequence into the target RNA by esnRNA. "Negative control" refers to the experimental condition in which the RNA donor does not contain an antisense domain targeting the reporter. "wt esnRNA" refers to the experimental condition in which the RNA donor indeed targets the reporter, but the esnRNA is identical to unmodified wild-type human U1 snRNA.
[0014] [Figure 7] Experimental data examining the importance of the presence of esnRNA in relation to the substitution of specific sequences within the target RNA. In the absence of esnRNA molecules, no sequenced clones aligned with full-length GFP (0 of 23 sequenced clones shown in the right panel). In the presence of esnRNA, 4 clones aligned with full-length GFP (4 of 24 sequenced clones shown in the right panel). These perfectly aligned clones are designated "Clones 1-4". The sequences of these clones flanking the junction of the RNA donor-derived sequence and the target RNA-derived sequence show perfect alignment between all clones, indicating the expected full-length GFP sequence.
[0015] [Figure 8]A-B are experimental data investigating the importance of various features of esnRNA in relation to the substitution of specific sequences in the target RNA. Cells were transfected with esnRNA B or various mutant forms of esnRNA B and the reporter system (RNA donor and reporter) outlined in Figure 5. The GFP signal obtained indicates that the presence of stem-loop structures in esnRNA is important for esnRNA activity. Indeed, removal or mutation of stem-loop structures (stem-loop 1, stem-loop 2, or stem-loop 4) that recruit spliceosome factors reduces the insertion of the RNA donor into the target RNA. A shows the results. B shows various mutations.
[0016] [Figure 9] A-B are experimental data investigating the importance of antisense domains in esnRNA in relation to the replacement of specific sequences in the target RNA. Cells were transfected with esnRNA B or various mutant forms of esnRNA B and the reporter system (RNA donor and reporter) outlined in Figure 5. The resulting GFP signal (A) shows that reducing the length of the sequence in the esnRNA that is complementary to the RNA donor results in a lower GFP signal, and therefore less efficient insertion of the RNA donor into the target RNA. The esnRNA "+" indicates the presence of an esnRNA that contains a 10-base complementary sequence to the RNA donor. "9b", "4b", and "2b" indicate 9-, 4-, and 2-base complementary sequences between the esnRNA and the RNA donor, respectively (B). The "+" of the RNA donor indicates the presence of an RNA donor that contains a sequence complementary to the target RNA, and "-" indicates the presence of a control RNA donor that is not complementary to the target RNA. A shows the results. B shows various mutations.
[0017] [Figure 10]Experimental data describing the activity of different esnRNAs in relation to the replacement of specific sequences in the target RNA. Different esnRNAs (numbers 1-61 and compare esnRNA B) derived from U1 snRNA and variants of U1 snRNA were constructed. All esnRNAs have a mutation at the 5' end that creates a region complementary to the RNA donor molecule. Human cells were treated with the RNA donor and different esnRNAs together with the reporter system described in Figure 5. The resulting GFP signal indicates the efficiency associated with RNA editing. These data indicate that the use of sequences derived from variants of U1 snRNA is an important tool to increase the efficiency of RNA editing by trans-splicing. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0018] In one aspect, disclosed herein is an RNA technology that allows the replacement of any sequence in a specific RNA molecule in a living cell. Without being bound by theory, this technology based on RNA trans-splicing utilizes the spliceosome that is naturally present in human cells to provide the catalytic activity of this trans-splicing process. Typically, RNA splicing occurs within an RNA molecule, where exons are joined and introns are removed from an immature messenger RNA molecule (pre-mRNA) to form a mature messenger RNA molecule (mRNA). This process is called cis-splicing. RNA trans-splicing is a process in which spliceosomes join exons derived from distinct and separate RNA molecules. This process occurs rarely in human cells, but the current systems that promote RNA trans-splicing are active at low levels. Described herein are compositions that increase the efficiency of RNA trans-splicing. These improved RNA trans-splicing compositions can be used to replace mutant sequences in target RNA molecules to address human diseases. The substitution of any RNA sequence is a general capability with a myriad of specific applications, some of which are being explored as relevant proof-of-concept experiments. RNA trans-splicing can insert engineered sequences into a target RNA and confer new activities to the target RNA, such as altering RNA stability or altering RNA translation. This feature can be used to increase protein production by the target RNA. In its broadest sense, this RNA trans-splicing technology can impart any change to both the coding and non-coding regions of the target RNA.
[0019] The disclosed RNA trans-splicing technology involving the use of RNA donor molecules and esnRNA molecules is the first to demonstrate high efficiency RNA trans-splicing to multiple RNA targets. High efficiency RNA trans-splicing has three main advantages over previous RNA trans-splicing systems. First, this improved efficiency allows for replacement of defective RNA sequences at levels sufficient to reconstitute the activity of mutant genes and treat recessive genetic disorders. In fact, at least 15% efficiency is required to treat many recessive genetic disorders, with 100% efficiency being a complete replacement of sequences in the target RNA. Second, this improved efficiency allows for replacement of defective RNA sequences at levels sufficient to treat genetic disorders with toxic gain-of-function mutations. Many diseases in this class require high efficiency replacement of mutant sequences, as eliminating RNAs with toxic mutations is required to treat these diseases. As a result, even higher efficiencies are required (50%+). Finally, the RNA trans-splicing technology described herein shows itself to be one of the more widely applicable and efficient of the technologies, due to its broad ability to correct multiple target RNAs. This is an extremely general capability, and the present disclosure provides a demonstration of an RNA trans-splicing system that can efficiently replace sequences in multiple target RNAs.
[0020] The incorporation of esnRNA molecules to form the present technology provides the additional ability to modify both the coding and non-coding sequences of the target RNA. By replacing the 5' or 3' untranslated regions of the target RNA with high efficiency, the behavior of the RNA, such as translation or turnover, can be altered. The end result of these actions is an increase in protein from the target RNA or other downstream effects associated with altered RNA levels.
[0021] RNA molecules for promoting trans-splicing In certain embodiments, the compositions described herein include an RNA molecule for promoting trans-splicing. In one aspect, the compositions described herein are RNA donor molecules. In some embodiments, the RNA donor binds to a target RNA molecule and an esnRNA molecule to promote trans-splicing. In another embodiment, the RNA donor molecule includes an esnRNA domain.
[0022] In some embodiments, the RNA donor molecule does not include an esnRNA domain. An example is shown in FIG. 3A. In one aspect, described herein is an esnRNA molecule and an RNA donor molecule that includes three domains. In some embodiments, the RNA donor molecule includes a replacement domain. The replacement domain can be inserted into the target RNA molecule via a trans-splicing reaction. In some embodiments, the RNA donor molecule includes an antisense domain that is complementary to the target RNA. In some embodiments, the RNA donor molecule includes an intron domain that facilitates a trans-splicing reaction between the RNA donor molecule and the target RNA. In some embodiments, the esnRNA molecule is isolated or derived from a human small nuclear RNA gene, but is modified to contain a sequence complementary to the RNA donor molecule. Without being bound by theory, the combination of the trans-splicing RNA donor molecule and the esnRNA in contact with the RNA donor molecule results in the replacement of a selected sequence in the target RNA in a manner that is sufficient to efficiently replace a disease-causing RNA sequence in a human cell to address the disease. In some embodiments, the disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequence-specific manner and replacing disease-causing RNA sequences within these RNA molecules with high efficiency. In some embodiments, the implementation of RNA donor molecules and esnRNAs shows utility in a variety of contexts, including replacing disease-causing sequences or inserting engineered sequences into target RNAs. In some embodiments, the engineered sequences can modify the translation or stability of the target RNA, increasing or decreasing protein production or target RNA levels. In some embodiments, the disclosure provides vectors, compositions and cells that include or encode RNA donor molecules and esnRNA molecules, as well as methods of using trans-splicing RNA compositions.
[0023] In certain aspects, described herein are compositions comprising an engineered small nuclear RNA ("esnRNA") molecule derived or isolated from a human spliceosomal snRNA gene and an RNA donor molecule comprising (a) at least one domain that promotes trans-splicing ("intron domain"), (b) at least one binding domain ("antisense domain") that comprises or consists of a sequence complementary to a pre-mRNA ("target RNA") present in a human cell, and (c) a coding domain ("replacement domain") that is inserted into the target RNA via trans-splicing. The esnRNA molecule binds to the RNA donor molecule and recruits spliceosomal components, promoting trans-splicing between the RNA donor molecule and the target RNA, thereby inserting the RNA donor molecule sequence into the target RNA. In other embodiments, the disclosure provides compositions comprising a nucleic acid sequence encoding an RNA donor molecule and an esnRNA molecule. In other embodiments, the disclosure provides compositions comprising two nucleic acid sequences that respectively encode an RNA donor molecule and an esnRNA.
[0024] In certain embodiments, described herein is a single RNA molecule containing two domains (RNA donor domain and esnRNA domain), where the single RNA molecule selectively binds to a target RNA molecule and promotes a trans-splicing reaction with the target RNA molecule with high efficiency. In certain embodiments, the present disclosure provides vectors, compositions and cells that contain or encode the single RNA molecule. In certain embodiments, the present disclosure provides methods of using the single RNA molecule, vectors, compositions and cells of the present disclosure to treat a disease or disorder.
[0025] In some embodiments, the RNA donor molecule comprises an esnRNA domain. An example is shown in FIG. 3B. In one aspect, disclosed herein is an RNA donor molecule comprising at least four domains. In some embodiments, the RNA donor molecule comprises a replacement domain. The replacement domain can be inserted into the target RNA molecule via a trans-splicing reaction. In some embodiments, the RNA donor molecule comprises an antisense domain complementary to the target RNA. In some embodiments, the RNA donor molecule comprises an intron domain that facilitates a trans-splicing reaction between the RNA donor molecule and the target RNA. In some embodiments, the RNA donor molecule comprises an esnRNA domain isolated or derived from a human small nuclear RNA gene.
[0026] The present disclosure provides, in some embodiments, compositions comprising an RNA donor molecule comprising: (a) at least one domain that promotes trans-splicing ("intron domain"); (b) at least one binding domain ("antisense domain") that comprises or consists of a sequence complementary to a pre-mRNA ("target RNA") present in a human cell; (c) a coding domain ("replacement domain") that is inserted into the target RNA via trans-splicing; and (d) an engineered small nuclear RNA ("esnRNA") domain that comprises an esnRNA sequence. The esnRNA domain recruits spliceosome components to promote trans-splicing between the RNA donor molecule and the target RNA, thereby inserting the RNA donor molecule sequence into the target RNA. In other embodiments, the disclosure provides compositions comprising a nucleic acid sequence that encodes an RNA donor molecule.
[0027] esnRNA molecules and domains In some embodiments, the methods and compositions described herein include an esnRNA molecule that includes an esrRNA domain. In some embodiments, the methods and compositions described herein include an RNA donor molecule that includes an esRNA domain. In some embodiments, the esnRNA domain is derived or isolated from a human small nuclear RNA gene and is selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12.
[0028] The compositions comprising esnRNA molecules and esnRNA domains disclosed herein include any sequence derived or isolated from a human small nuclear RNA gene, including but not limited to U1, U2, U4, U5, U6, U7, U11, and U12. The esnRNA molecule may contain a sequence complementary to an RNA donor molecule. This complementary sequence may be located at or near the 5' end of the esnRNA molecule. Complementary sequences include, but are not limited to, 5'CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the above complementary sequences may or may not have some or all of the thymidine bases replaced with uracil, and trans-splicing enhancer sequences include, but are not limited to, 5'-CGAGCUCUCU-3', 5'-AACGAGCUCU-3', 5'-CGCAACGAGC-3', 5'-UAUCGCAACG-3', 5'-AAUAAUAUCG-3', 5'-UAAGAGAGCU-3', 5'-AAGAGAGCUC-3', 5'-AGAGAGCUCGUUGC-3', 5'-GAGAGCUCGU-3', 5'-AGAGCUCGUUGCGA-3', and 5'-GAGCUCGUUG-3'.
[0029] In some embodiments, the esnRNA domain contains one or more stem-loop-forming RNA sequences derived or isolated from human small nuclear RNA genes. In one embodiment, such an esnRNA domain has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or original sequence. In one embodiment, such an esnRNA domain has up to about 80%, up to about 85%, up to about 90%, up to about 91%, up to about 92%, up to about 93%, up to about 94%, up to about 95%, up to about 96%, up to about 97%, up to about 98%, up to about 99%, or 100% sequence identity to its corresponding wild-type or original sequence.
[0030] In some embodiments, the esnRNA molecule or esnRNA domain is not derived from any organism and is composed of synthetic sequences that bind to spliceosomal proteins.
[0031] In some embodiments, the esnRNA domain is located at least about 1 nucleotide away from the replacement domain. In some embodiments, the esnRNA domain is located at least about 2 nucleotides, at least about 3 nucleotides, at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, at least about 7 nucleotides, at least about 8 nucleotides, at least about 9 nucleotides, at least about 10 nucleotides, at least about 11 nucleotides, at least about 12 nucleotides, at least about 13 nucleotides, at least about 14 nucleotides, at least about 15 nucleotides, at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides, at least about 23 nucleotides, at least about 24 nucleotides, at least about 25 nucleotides, at least about 26 nucleotides, at least about 27 nucleotides, at least about 28 nucleotides, at least about 29 nucleotides in the 5' direction from the first or last nucleotide of the replacement sequence in the RNA donor molecule. leotide, at least about 30 nucleotides, at least about 31 nucleotides, at least about 31 nucleotides, at least about 32 nucleotides, at least about 33 nucleotides, at least about 34 nucleotides, at least about 35 nucleotides, at least about 36 nucleotides, at least about 37 nucleotides, at least about 38 nucleotides, at least about 39 nucleotides, at least about 40 nucleotides, at least about 41 nucleotides, at least about 42 nucleotides, at least about 43 nucleotides, at least about 44 nucleotides, at least about 45 nucleotides, at least about 46 nucleotides, at least about 47 nucleotides, at least about 48 nucleotides, at least about 49 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides,Located at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, or more than 500 nucleotides apart. In some embodiments, the esnRNA domain is located in the 5' direction from the first or last nucleotide of the replacement sequence in the RNA donor molecule, up to about 2 nucleotides, up to about 3 nucleotides, up to about 4 nucleotides, up to about 5 nucleotides, up to about 6 nucleotides, up to about 7 nucleotides, up to about 8 nucleotides, up to about 9 nucleotides, up to about 10 nucleotides, up to about 11 nucleotides, up to about 12 nucleotides, up to about 13 nucleotides, up to about 14 nucleotides, up to about 15 nucleotides, up to about 16 nucleotides, up to about 17 nucleotides, up to about 18 nucleotides, up to about 19 nucleotides, up to about 20 nucleotides, up to about 21 nucleotides, up to about 22 nucleotides, up to about 23 nucleotides, up to about 24 nucleotides, up to about 25 nucleotides, up to about 26 nucleotides, up to about 27 nucleotides, up to about 28 nucleotides, up to about 29 nucleotides, up to about 30 nucleotides, up to about 31 nucleotides, up to about 32 nucleotides, up to about 33 nucleotides, up to about 34 nucleotides, up to about 35 nucleotides, up to about 36 nucleotides, up to about 37 nucleotides, up to about 38 nucleotides, up to about 39 nucleotides, up to about 40 nucleotides, up to about 41 nucleotides, up to about 42 nucleotides, up to about 43 nucleotides, up to about 44 nucleotides, up to about 45 nucleotides, up to about 46 nucleotides, up to about 47 nucleotides, up to about 48 nucleotides, up to about 49 nucleotides, up to about about 28 nucleotides, up to about 29 nucleotides, up to about 30 nucleotides, up to about 31 nucleotides, up to about 31 nucleotides, up to about 32 nucleotides, up to about 33 nucleotides, up to about 34 nucleotides, up to about 35 nucleotides, up to about 36 nucleotides, up to about 37 nucleotides, up to about 38 nucleotides, up to about 39 nucleotides, up to about 40 nucleotides, up to about 41 nucleotides, up to about 42 nucleotides, up to about 43 nucleotides, up to about 44 nucleotides, up to about 45 nucleotides, up to about 46 nucleotides, up to about 47 nucleotides, up to about 48 nucleotides, up to about 49 nucleotides, up to about 50 nucleotides, up to about 55 nucleotides, up to about 60 nucleotides, up to about 65 nucleotides, up to about 70 nucleotides, up to about 75 nucleotides, up to about 80 nucleotides, up to about 85 nucleotides,The sequences are located at most about 90 nucleotides, at most about 95 nucleotides, at most about 100 nucleotides, at most about 110 nucleotides, at most about 120 nucleotides, at most about 130 nucleotides, at most about 140 nucleotides, at most about 150 nucleotides, at most about 160 nucleotides, at most about 170 nucleotides, at most about 180 nucleotides, at most about 190 nucleotides, at most about 200 nucleotides, at most about 250 nucleotides, at most about 300 nucleotides, at most about 400 nucleotides, at most about 500 nucleotides, or at more than about 500 nucleotides apart.
[0032] In some embodiments of the compositions of the present disclosure, there may be an esnRNA sequence that promotes trans-splicing. In some embodiments of the compositions of the present disclosure, the esnRNA is derived or isolated from the human U1 snRNA gene. In some embodiments of the compositions of the present disclosure, the sequence esnRNA is derived or isolated from a U1 snRNA variant.In some embodiments of the compositions of the present disclosure, the U1 snRNA variant is selected from the list consisting of (the genomic location in parentheses after the name is according to the UCSC Human Genome Assembly 2006): tU1.1 [chr1:16713367-16712967], tU1.2 [chr1:16866030-16865630], vU1.1 [chr1:142438700-142438300], vU1.2 [chr1:142464813-142464413], vU1.4 [chr1:14302 2739-143022339], vU1.5[chr1:143202968-143202568], vU1.7[chr1:144680790-144680390], vU1.8[chr1:145022927-1450 22527], vU1.9[chr1:145977791-145977391], vU1.10[chr1:146301289-146300889], vU1.11[chr1:146327427-146327027], vU1.15[chr1:146871696-146871296], vU1.16[chr1:147033726-147033326], vU1.17[chr1:147460893-147460493], vU1.18 [chr1:147490845-147490445], vU1.19[chr1:147780880-147780480], tU1.3[chr1:16939762-16940162], tU1.4[chr1:1709 5226-17095626], vU1.3[chr1:142478876-142479276], vU1.6[chr1:144094114-144094514], vU1.12[chr1:146341486-1463 41886], vU1.13[chr1:146460770-146461170], vU1.14[chr1:146608089-146608489], vU1.20[chr1:147872535-147872935].
[0033] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA1): CGAGCTCCTCTgCAGGGGAAAGCGCGAACGCAGTACCACTACCACAAATTATGCAATCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCAACACATCTGGAGTGCAATGGATAAGCCTCGCCCTGGGAAAACCACCTTCGTGATCATGTTATCTCCCCTG.
[0034] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA2):CGAGCTCTCTgTCCAGGGGAAAGCACAAACAGTTCCCCACTGCCACAAATTATGTAGTCGAGATTCCCTCATTTGGGGAAATCACAGGGGTCAGCACATCCAGAGTAAAATTGCTAAGCCTTGCCCTGGAAAAACCACCTTCGTGATCATAACATTTCTTCTG.
[0035] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA3):CGAGCTCTCTgCAGGGAAAAACACAGACACAGTTCCCCACTGCCACAAATTATGTAATCAAGATTCCCACATTCGGGGAAATCACAGGGGTCAGCACATCCACAGTAAAACTGCTAAGCCTTGCTCTGGAAAAACCACCTTCGTGATCATAACATTTCTTCTG.
[0036] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA4):CGAGCTCTCTgCAGGGGAAAGCGCGGACGCAGTCCCCCACTACCACAAATTATGCAGTCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCAGCACATCCGGAGTGCAATGGATAAGCCTCGCCCTGGGAAAACCACCTTCGTGATCATGGTATCTCCCCTG.
[0037] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA5):CGAGCTCTCTgGGGGGAAAAGAGCGAACGCAGTCTCCCACTACCACAAATTATGCAGTCGAGCTTCCCACATTTGGGGAAGTTGCACGAATTAGCTTCGCCCTGCGAAAACCACCTTCGTAAACACGATTTTTCTTCTGCTAGGTAAATGTGAGTCTGCACGC.
[0038] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA6): CGAGCTCCTCTgCAGAGGACAGCGCGAACGCAGTCCCCCACTACCACAAATTATGCAGTCGAGTTTCCCACATTTGGGGAAACGGCAGGGGTCAGCACATCCGGAGTGCAATGGATAAGCCTCTCCCTGGGAAAACCACCTTCGTGATCATCGTATCTCCCCTG.
[0039] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA7):CGAGCTCTCTgTCCAGGGGAAAGCACAAACAGTTCCCCACTGCCACAAATTATGTAGTCGAGATTCCCTCATTTGGGGAAATCACAGGGGTCAGCACATCCAGAGTAAAATTGCTAAGCCTTGCCCTGGAAAAACCACCTTCGTGATCATAACATTTCTTCTG.
[0040] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA8):CGAGCTCTCTgCAGAGGAAAGCGCGAACGCAGTCCCCCACTACCACAAATTATGCAATCGAGTTTCCCACGTTTGGGGAAATCGCAGAGGTCAGCACATCCGGAACACAATGGATAACCCTCGCCCTGAGAAAAACCACCTTCGTTTAGATAATAGTATCTCCCCTG.
[0041] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA9): CGAGCTCTCTgCAAGAGAAAGCGCGAACGTAGTTCCCTACTATCACAAATTATGCACTCGAGTTTCCCACACTTGGGAAATCGCAGGGGTCAGCACATCCGGAACGCAATGGATAAGCTTCGCCCTGAGAAAAACCACCTTCGTGATCATGGTATCTCCCCTT.
[0042] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA10):CGAGCTCTCTgCAGGGGAAAGCGCGAACGCAGTCCCCTACTATCACAAGTTATGCAGTCGAGTTCCTCACATTGGGGGAAAATGGCAGGGGTCAGTACACCCGGAACATAACGGATAAGCCTCGCCCTGAGAAAACCACCTTCGTGATCATGGTATCTCCCCCG.
[0043] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA11):CGAGCTCTCTgCAGGGGAAAACGCGAACACAGTCCCCTACTATCACAAGTTATGCAGTCGAGTTCCTCACATTGGGGGAAAATGGCAGGGGTCAGTACACCCGGAACATAACGGATAAGCCTCGCCCTGAGAAAACCACCTTCGTGATCATGGTATCTCCCCCG.
[0044] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA12):CGAGCTCTCTgCAGGGGAGATAGTATGATCATGAAAGTGGTTTTTCCAGAGCGAGGCTTATCCATTGCACTCCGGATGTGTTGACCTCTGCGATTTCCCCAACTGTGGGAAACTCGACTGCGTAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG.
[0045] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA13):CGAGCTCTCTgCAGGGGAGATACTATTATCAAACGAAGGTGGTTTTTCTCAGGGCGAGGCTTATCCATTGTGTTCCGGATGTGCTGACCTCTGCGATTTCCCCAAACGTGGGAAACTCGACTGCATAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTTTCCTCTG.
[0046] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA14):CGAGCTCTCTgCAGAAGAAATGTTATGATCACGAAGGTGGTTTTTCCAGAGCAAGGCTTAGCAGTTTTACTGTGGATGTGCTGACCCCTGTGATTTCCCCGAATGTGGGAATCTTGATTACATAATTTGTGGCAGTGGGGAACTGTGTCTGTGTTTTCCCCTG.
[0047] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA15):CGAGCTCTCTgcagggGAAAGCGCGAACGCAGTACCACTACCACAAcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0048] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA16):CGAGCTCTCTgcagggGGGAAAGCACAAACAGTTCCCCACTGCCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0049] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA17):CGAGCTCTCTgcagggAAAAACACAGACACAGTTCCCCACTGCCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0050] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA18):CGAGCTCTCTgcagggGAAAGCGCGGACGCAGTCCCCCACTACCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0051] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA19):CGAGCTCTCTgcagggAAAAGAGCGAACGCAGTCTCCCACTACCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0052] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA20):CGAGCTCTCTgcagggGACAGCGCGAACGCAGTCCCCCACTACCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0053] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA21):CGAGCTCTCTgcagggGGGAAAGCACAAACAGTTCCCCACTGCCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0054] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA22):CGAGCTCTCTgcagggGAAAGCGCGAACGCAGTCCCCCACTACCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0055] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA23):CGAGCTCTCTgcagggGAAAGCGCGAACGTAGTTCCCTACTATCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0056] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA24):CGAGCTCTCTgcagggGAAAGCGCGAACGCAGTCCCCTACTATCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0057] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA25):CGAGCTCTCTgcagggGAAAACGCGAACACAGTCCCCTACTATCACcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0058] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA26):CGAGCTCTCTgcagggGAGATAGTATGATCATGAAAGTGGTTTTTCcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0059] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA27):CGAGCTCTCTgcagggGAGATACTATTATCAAACGAAGGTGGTTTTcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0060] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA28):CGAGCTCTCTgcagggGAAATGTTATGATCACGAAGGTGGTTTTTCcagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0061] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA29):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccATTATGCAATCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0062] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA30):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGTAGTCGAGATTCCCTCATTTGGGGAAATCACAGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0063] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA31):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGTAATCAAGATTCCCACATTCGGGGAAATCACAGGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0064] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA32):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGCAGTCGAGTTTCCCACATTTGGGGAAATCGCAGGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0065] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA33):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGCAGTCGAGCTTCCCACATTTGGGGAAGTTGCACGAAcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0066] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA34):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGTAGTCGAGATTCCCTCATTTGGGGAAATCACAGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0067] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA35):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGCAATCGAGTTTCCCACGTTTGGGGAAATCGCAGAGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0068] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA36):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAATTATGCACTCGAGTTTCCCACACTTGGGGAAATCGCAGGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0069] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA37):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAGTTATGCAGTCGAGTTCCTCACATTGGGGGAAAATGGCAGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0070] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA38):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAGTTATGCAGTCGAGTTCCTCACATTGGGGGAAAATGGCAGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0071] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA39):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccCAGAGCGAGGCTTATCCATTGCACTCCGGATGTGTTGACCTCTGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0072] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA41):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccTCTCAGGGCGAGGCTTATCCATTGTGTTCCGGATGTGCTGACCTcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0073] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA42):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccCAGAGCAAGGCTTAGCAGTTTTACTGTGGATGTGCTGACCCCTGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0074] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA44):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgAACACATCTGGAGTGCAATGGATAAGactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0075] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA46):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCAGAGTAAAATTGCTAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0076] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA47):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCGGAGTGCAATGGATAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0077] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA48):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTTAGCTTCGCCCTGCGAAAACCACCTactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0078] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA49):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCGGAGTGCAATGGATAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0079] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA51):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCAGAGTAAAATTGCTAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0080] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA52):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCGGAACACAATGGATAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0081] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA53):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgTCAGCACATCCGGAACGCAATGGATAactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0082] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA54):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgGTCAGTACACCCGGAACATAACGGATactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0083] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA55):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgGTCAGTACACCCGGAACATAACGGATactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0084] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA56):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgCGATTTCCCCAACTGTGGGAAACTCGactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0085] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA57):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgCTGCGATTTCCCCAAACGTGGGAAACactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg.
[0086] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA58): CGAGCTCCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtCTTCGTGATCATGTTATCTCCCCTG.
[0087] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA59):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtACCTTCGTGATCATAACATTTCTTCTG.
[0088] In some embodiments of the compositions of the present disclosure, the sequence of the esnRNA comprises or consists of (esnRNA60):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtACCTTCGTGATCATAACATTTCTTCTG.
[0089] In some embodiments of the compositions of the disclosure, the sequence of the esnRNA comprises or consists of (esnRNA61):CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtACCTTCGTGATCATGGTATCTCCCCTG.
[0090] Antisense Domain In some embodiments of the present disclosure, the antisense domain of the present disclosure binds to a target sequence.In some embodiments of the present disclosure, the antisense domain of the present disclosure binds to a target RNA.
[0091] In some embodiments of the present disclosure, the antisense domain is selected such that successful trans-splicing removes the micro open reading frame in the target RNA. In this way, the trans-splicing system removes the micro open reading frame and increases protein production from the target RNA.
[0092] In some embodiments of the compositions of the present disclosure, the sequence comprising the antisense domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or any percentage in between, complementarity to the target RNA sequence. In some embodiments, the sequence comprising the antisense domain has up to about 50%, up to about 55%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 80%, up to about 87%, up to about 90%, up to about 91%, up to about 92%, up to about 93%, up to about 94%, up to about 95%, up to about 96%, up to about 97%, up to about 98%, up to about 99%, or any percentage therebetween, to the target RNA sequence. In some embodiments, the antisense domain has 100% complementarity to the target RNA sequence. In some embodiments, the antisense domain, while complementary to a target RNA sequence, comprises or consists of at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 210 nucleotides, at least about 220 nucleotides, at least about 230 nucleotides, at least about 240 nucleotides, at least about 250 nucleotides, at least about 260 nucleotides, at least about 270 nucleotides, or more than at least about 270 nucleotides.In some embodiments, the antisense domain, while complementary to a target RNA sequence, comprises or consists of up to about 20 nucleotides, up to about 30 nucleotides, up to about 40 nucleotides, up to about 50 nucleotides, up to about 60 nucleotides, up to about 70 nucleotides, up to about 80 nucleotides, up to about 90 nucleotides, up to about 100 nucleotides, up to about 110 nucleotides, up to about 120 nucleotides, up to about 130 nucleotides, up to about 140 nucleotides, up to about 150 nucleotides, up to about 160 nucleotides, up to about 170 nucleotides, up to about 180 nucleotides, up to about 190 nucleotides, up to about 200 nucleotides, up to about 210 nucleotides, up to about 220 nucleotides, up to about 230 nucleotides, up to about 240 nucleotides, up to about 250 nucleotides, up to about 260 nucleotides, up to about 270 nucleotides, or more than about 270 nucleotides.
[0093] In some embodiments of the disclosed compositions and methods, the target sequence is at least about 5 nucleotides, at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides. nucleotides, at least about 100 nucleotides, at least about 125 nucleotides, at least about 150 nucleotides, at least about 175 nucleotides, at least about 200 nucleotides, at least about 225 nucleotides, at least about 250 nucleotides, at least about 275 nucleotides, at least about 300 nucleotides, at least about 325 nucleotides, at least about 350 nucleotides, at least about 375 nucleotides, at least about 400 nucleotides, at least about 425 nucleotides, at least about 450 nucleotides, at least about 475 nucleotides, at least about 500 nucleotides, or more than 500 nucleotides.In some embodiments, the target sequence comprises or consists of up to about 5 nucleotides, up to about 10 nucleotides, up to about 15 nucleotides, up to about 20 nucleotides, up to about 25 nucleotides, up to about 30 nucleotides, up to about 35 nucleotides, up to about 40 nucleotides, up to about 45 nucleotides, up to about 50 nucleotides, up to about 55 nucleotides, up to about 60 nucleotides, up to about 65 nucleotides, up to about 70 nucleotides, up to about 75 nucleotides, up to about 80 nucleotides, up to about 85 nucleotides, up to about 90 nucleotides, up to about 95 nucleotides, up to about 100 nucleotides, up to about 125 nucleotides, up to about 150 nucleotides, up to about 175 nucleotides, up to about 200 nucleotides, up to about 225 nucleotides, up to about 250 nucleotides, up to about 275 nucleotides, up to about 300 nucleotides, up to about 325 nucleotides, up to about 350 nucleotides, up to about 375 nucleotides, up to about 400 nucleotides, up to about 425 nucleotides, up to about 450 nucleotides, up to about 475 nucleotides, or up to about 500 nucleotides. In some embodiments, the target sequence comprises or consists of about 5 to about 500 nucleotides. In some embodiments, the target sequence comprises or consists of about 50 to about 250 nucleotides. In some embodiments, the target sequence comprises or consists of about 5 to about 50 nucleotides.
[0094] In some embodiments of the compositions of the present disclosure, the pathogenic RNA molecule is a target RNA. In some embodiments, the target RNA comprises a target sequence that is complementary to the antisense domain of the trans-splicing RNA of the present disclosure.
[0095] In some embodiments of the disclosed compositions and methods, the target sequence is contained within a single contiguous stretch of the target RNA. In some embodiments, the target sequence may consist of or include one or more nucleotides that are not spread between the single contiguous stretch of the target RNA.
[0096] In some embodiments, the antisense domain is complementary to a gene (corresponding accession number in brackets, corresponding disease in parentheses) encoding a target RNA that may have a disease-causing mutation and is selected from the group consisting of: TNFRSF13B [ENSG00000240505] (common variable immunodeficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG [ HBB [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000244734] (beta-thalassemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (alpha-thalassemia); U2AF1 [ENSG00000160201] (myelodysplastic syndromes); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG000001209 48, ENSG00000089280, ENSG00000015479, ENSG00000142168, ENSG00000147894] (amyotrophic lateral sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (frontotemporal dementia with parkinsonism); CDH23, MYO7A, USH2A [ENSG00000107736, ENSG00000137474, ENSG00000042781] (Asha -Syndrome);GALC [ENSG00000054983] (Krabbe disease);SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann-Pick disease);PRNP [ENSG00000171867] (Prion disease);SCN1A [ENSG00000144285] (Dravet syndrome);PINK1, ATPGAP2 [ENSG00000158828] (Early-onset Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14[ENSG00000124788, ENSG00 000204842, ENSG00000066427, ENSG00000196155, ENSG00000173898, ENSG00000141837, ENSG00000163635, ENSG00000128881, ENSG00000156 475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG0 0000141837, ENSG00000273079, ENSG00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646] (inherited epilepsy disorders); ATM [ENSG00000149311] (ataxia telangiectasia); GL B1 [ENSG00000170266] (GM1 gangliosidosis); GBA [ENSG00000177628] (Gaucher disease); GM2A [ENSG00000196743] (GM2 gangliosidosis); UBE3A [ENSG00000114062] (Angelman syndrome); SLC2A1 [ENSG00000117394] (glucose transporter 1 deficiency); LAMP2 [ENSG00000005893] (Danon disease); GLA [ENSG00000102393] (Fabry disease);PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG0000012 3240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (open-angle glaucoma); IDUA [ENSG00000127415] (Hurler syndrome or mucopolysaccharidosis type 1); IDS [ENSG00000010404] (Hunter syndrome or mucopolysaccharidosis type 2); CLN3 [ENSG00000188603] (Batten disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789] (limb-girdle muscular dystrophy) DYSF [ENSG00000135636] (limb-girdle muscular dystrophy type 2B); SGCA [ENSG00000108823] (limb-girdle muscular dystrophy type 2D); SGCB [ENSG00000163069] (limb-girdle muscular dystrophy type 2E); SGCG [ENSG00000102683] (limb-girdle muscular dystrophy type 2C); SGCD [ENSG00000170624] (limb-girdle muscular dystrophy type 2F); DUX4 [ENSG00000260596] (facioscapulohumeral muscular dystrophy); F9 [ENS G00000101981] (hemophilia B); F8 [ENSG00000185010] (hemophilia A); USHA2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 [ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161] (retinitis pigmentosa); CFTR [ENSG00000001626] (cystic fibrosis);GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing loss); POU3F3 [ENSG00000198914] (nonsyndromic hearing loss);
[0097] Replacement Domain In some embodiments, the methods and compositions described herein include an RNA donor molecule that includes a replacement domain. In some embodiments, the replacement domain is derived or isolated from the target RNA.
[0098] In some embodiments, the replacement domain is composed of a sequence derived or isolated from a human gene. In some embodiments, the sequence comprising the replacement domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 95%, at least about 97%, at least about 99% or any percentage therebetween with the human gene. In some embodiments, the replacement domain has 100% identity with the sequence derived or isolated from the human gene. In some embodiments, the substitution domain comprises or consists of at least about 2 nucleotides, at least about 5 nucleotides, at least about 10 nucleotides, at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 210 nucleotides, at least about 220 nucleotides, at least about 230 nucleotides, at least about 240 nucleotides, at least about 250 nucleotides, at least about 260 nucleotides, at least about 270 nucleotides, more than 270 nucleotides, or any number of nucleotides in between.In some embodiments, the replacement domain comprises or consists of up to about 2 nucleotides, up to about 5 nucleotides, up to about 10 nucleotides, up to about 20 nucleotides, up to about 30 nucleotides, up to about 40 nucleotides, up to about 50 nucleotides, up to about 60 nucleotides, up to about 70 nucleotides, up to about 80 nucleotides, up to about 90 nucleotides, up to about 100 nucleotides, up to about 110 nucleotides, up to about 120 nucleotides, up to about 130 nucleotides, up to about 140 nucleotides, up to about 150 nucleotides, up to about 160 nucleotides, up to about 170 nucleotides, up to about 180 nucleotides, up to about 190 nucleotides, up to about 200 nucleotides, up to about 210 nucleotides, up to about 220 nucleotides, up to about 230 nucleotides, up to about 240 nucleotides, up to about 250 nucleotides, up to about 260 nucleotides, up to about 270 nucleotides, or any number of nucleotides in between.
[0099] Compositions comprising replacement domains disclosed herein include any strategy in which replacement or insertion of an RNA sequence may be an effective therapeutic approach. Examples of replacement domains include, but are not limited to, sequences derived or isolated from the following genes (gene accession ID in brackets and associated disease in parentheses): TNFRSF13B [ENSG00000240505] (common variable immunodeficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked multiple myelopathy); combined immunodeficiency); HBB [ENSG00000244734] (beta-thalassemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (alpha-thalassemia); U2AF1 [ENSG00000160201] (myelodysplastic syndromes); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG00000120948, ENSG0000008 9280, ENSG00000015479, ENSG00000142168, ENSG00000147894] (amyotrophic lateral sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (frontotemporal dementia with parkinsonism); CDH23, MYO7A, USH2A [ENSG00000107736, ENSG00000137474, ENSG00000042781] (Usher syndrome); G ALC [ENSG00000054983] (Krabbe disease); SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann-Pick disease); PRNP [ENSG00000171867] (prion disease); SCN1A [ENSG00000144285] (Dravet syndrome); PINK1, ATPGAP2 [ENSG00000158828] (Early-onset Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14[ENSG00000124788, ENSG00 000204842, ENSG00000066427, ENSG00000196155, ENSG00000173898, ENSG00000141837, ENSG00000163635, ENSG00000128881, ENSG00000156 475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG0 0000141837, ENSG00000273079, ENSG00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646] (inherited epilepsy disorders); ATM [ENSG00000149311] (ataxia telangiectasia); GL B1 [ENSG00000170266] (GM1 gangliosidosis); GBA [ENSG00000177628] (Gaucher disease); GM2A [ENSG00000196743] (GM2 gangliosidosis); UBE3A [ENSG00000114062] (Angelman syndrome); SLC2A1 [ENSG00000117394] (glucose transporter 1 deficiency); LAMP2 [ENSG00000005893] (Danon disease); GLA [ENSG00000102393] (Fabry disease);PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG0000012 3240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (open-angle glaucoma); IDUA [ENSG00000127415] (Hurler syndrome or mucopolysaccharidosis type 1); IDS [ENSG00000010404] (Hunter syndrome or mucopolysaccharidosis type 2); CLN3 [ENSG00000188603] (Batten disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789] (limb-girdle muscular dystrophy) DYSF [ENSG00000135636] (limb-girdle muscular dystrophy type 2B); SGCA [ENSG00000108823] (limb-girdle muscular dystrophy type 2D); SGCB [ENSG00000163069] (limb-girdle muscular dystrophy type 2E); SGCG [ENSG00000102683] (limb-girdle muscular dystrophy type 2C); SGCD [ENSG00000170624] (limb-girdle muscular dystrophy type 2F); DUX4 [ENSG00000260596] (facioscapulohumeral muscular dystrophy); F9 [ENS G00000101981] (hemophilia B); F8 [ENSG00000185010] (hemophilia A); USHA2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 [ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161] (retinitis pigmentosa); CFTR [ENSG00000001626] (cystic fibrosis);GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing loss); POU3F3 [ENSG00000198914] (nonsyndromic hearing loss);
[0100] In some embodiments, the replacement domain is codon optimized.
[0101] In addition to sequences derived from human genes, replacement domains may include sequences derived from other organisms to alter the stability, translation, processing, or localization of the target RNA. Examples of replacement domains derived from non-human sources include, but are not limited to, sequences that increase protein production, such as the Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), the triple helix from MALAT1, the Hepatitis B virus PRE (HPRE), and sequences derived or isolated from iron-responsive elements of the CAGYCX (Y=U or A; X=U, C, or A) type.
[0102] Intron domain In certain aspects, the RNA donor molecule described herein comprises an intron domain.In some embodiments, the intron domain retains the binding site that is preferentially targeted by the RNA binding protein that comprises disease-causing mutation.In some embodiments, the dissociation constant of these mutant RNA binding proteins and the intron domain is lower than the dissociation constant of the RNA binding protein without mutation and the intron domain.
[0103] RNA motifs In some embodiments, the esnRNA molecules described herein contain an RNA motif complementary to the RNA donor molecule. In some embodiments of the compositions of the present disclosure, the RNA motif begins at the 5' end of the esnRNA molecule. In some embodiments, the RNA motif begins at the 5' end of the esnRNA molecule at least about 3 bases, at least about 4 bases, at least about 5 bases, at least about 6 bases, at least about 7 bases, at least about 8 bases, at least about 9 bases, at least about 10 bases, at least about 11 bases, at least about 12 bases, at least about 13 bases, at least about 14 bases, at least about 15 bases, at least about 16 bases, at least about 17 bases, at least about 18 bases, at least about 19 bases, at least about 20 bases, at least about 21 bases, at least about 22 bases, at least about 23 bases, at least about 24 bases, at least about 25 bases, at least about 26 bases, at least about 27 bases, at least about 28 bases, at least about 29 bases, at least about 30 bases, at least about 31 bases, at least about 32 bases, at least about 33 bases, at least about 34 bases, at least about 35 bases, at least about 36 bases, at least about 40 bases, at least about 50 bases, at least about 60 bases, at least about 70 bases, at least about 80 bases, at least about 100 bases, or more, are complementary to the RNA donor molecule. In some embodiments, up to about 3 bases, up to about 4 bases, up to about 5 bases, up to about 6 bases, up to about 7 bases, up to about 8 bases, up to about 9 bases, up to about 10 bases, up to about 11 bases, up to about 12 bases, up to about 13 bases, up to about 14 bases, up to about 15 bases, up to about 16 bases, up to about 17 bases, up to about 18 bases, up to about 19 bases, up to about 20 bases, up to about 21 bases, up to about 22 bases, up to about 23 bases, up to about 24 bases, up to about 25 bases, up to about 26 bases, up to about 27 bases, up to about 28 bases, up to about 29 bases, up to about 30 bases, up to about 31 bases, up to about 32 bases, up to about 33 bases, up to about 34 bases, up to about 35 bases, up to about 36 bases, up to about 40 bases, up to about 50 bases, up to about 60 bases, up to about 70 bases, up to about 80 bases, or up to about 100 bases are complementary to the RNA donor molecule.
[0104] In some embodiments, the esnRNA molecule is at least about 1 nucleotide, at least about 2 nucleotides, at least about 3 nucleotides, at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, at least about 7 nucleotides, at least about 8 nucleotides, at least about 9 nucleotides, at least about 10 nucleotides, at least about 11 nucleotides, at least about 12 nucleotides, at least about 13 nucleotides, at least about 14 nucleotides, at least about 15 nucleotides, at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides, at least about 23 nucleotides, at least about 24 nucleotides, at least about 25 nucleotides, at least about 26 nucleotides, at least about 27 nucleotides, at least about 28 nucleotides, at least about 29 nucleotides, at least about 30 nucleotides, At least about 31 nucleotides, at least about 31 nucleotides, at least about 32 nucleotides, at least about 33 nucleotides, at least about 34 nucleotides, at least about 35 nucleotides, at least about 36 nucleotides, at least about 37 nucleotides, at least about 38 nucleotides, at least about 39 nucleotides, at least about 40 nucleotides, at least about 41 nucleotides, at least about 42 nucleotides, at least about 43 nucleotides, at least about 44 nucleotides, at least about 45 nucleotides, at least about 46 nucleotides, at least about 47 nucleotides, at least about 48 nucleotides, at least about 49 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides,Contains an RNA motif complementary to the RNA donor molecule that is at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 500 or more nucleotides, or any number of nucleotides in between. In some embodiments, the RNA motif is located in the 5' direction from the first nucleotide of the esnRNA molecule, up to about 1 nucleotide, up to about 2 nucleotides, up to about 3 nucleotides, up to about 4 nucleotides, up to about 5 nucleotides, up to about 6 nucleotides, up to about 7 nucleotides, up to about 8 nucleotides, up to about 9 nucleotides, up to about 10 nucleotides, up to about 11 nucleotides, up to about 12 nucleotides, up to about 13 nucleotides, up to about 14 nucleotides, up to about 15 nucleotides, up to about 16 nucleotides, up to about 17 nucleotides, up to about 18 nucleotides, up to about 19 nucleotides, up to about 20 nucleotides, up to about 21 nucleotides, up to about 22 nucleotides, up to about 23 nucleotides, up to about 24 nucleotides, up to about 25 nucleotides, up to about 26 nucleotides, up to about 27 nucleotides, up to about 28 nucleotides, up to about 29 nucleotides, up to about 30 nucleotides, up to about 31 nucleotides, up to about 32 nucleotides, up to about 33 nucleotides, up to about 34 nucleotides, up to about 35 nucleotides, up to about 36 nucleotides, up to about 37 nucleotides, up to about 38 nucleotides, up to about 39 nucleotides, up to about 40 nucleotides, up to about 41 nucleotides, up to about 42 nucleotides, up to about 43 nucleotides, up to about 44 nucleotides, up to about 45 nucleotides, up to about 46 nucleotides, up to about 47 nucleotides, up to about 48 nucleotides, up to about 49 nucleotides, up to about 8 nucleotides, up to about 29 nucleotides, up to about 30 nucleotides, up to about 31 nucleotides, up to about 31 nucleotides, up to about 32 nucleotides, up to about 33 nucleotides, up to about 34 nucleotides, up to about 35 nucleotides, up to about 36 nucleotides, up to about 37 nucleotides, up to about 38 nucleotides, up to about 39 nucleotides, up to about 40 nucleotides, up to about 41 nucleotides, up to about 42 nucleotides, up to about 43 nucleotides, up to about 44 nucleotides, up to about 45 nucleotides, up to about 46 nucleotides, up to about 47 nucleotides, up to about 48 nucleotides, up to about 49 nucleotides, up to about 50 nucleotides, up to about 55 nucleotides, up to about 60 nucleotides, up to about 65 nucleotides, up to about 70 nucleotides, up to about 75 nucleotides, up to about 80 nucleotides, up to about 85 nucleotides,up to about 90 nucleotides, up to about 95 nucleotides, up to about 100 nucleotides, up to about 110 nucleotides, up to about 120 nucleotides, up to about 130 nucleotides, up to about 140 nucleotides, up to about 150 nucleotides, up to about 160 nucleotides, up to about 170 nucleotides, up to about 180 nucleotides, up to about 190 nucleotides, up to about 200 nucleotides, up to about 250 nucleotides, up to about 300 nucleotides, up to about 400 nucleotides, up to about 500 nucleotides, up to about 500 nucleotides or more apart.
[0105] In some embodiments, the esnRNA molecule contains an RNA motif complementary to the RNA donor molecule and is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. In some embodiments, the RNA motif comprises 5'-CGAGCTCTCT-3'. In some embodiments, the RNA motif comprises 5'-AACGAGCTCT-3'. In some embodiments, the RNA motif comprises 5'-CGCAACGAGC-3'. In some embodiments, the RNA motif comprises 5'-TATCGCAACG-3'. In some embodiments, the RNA motif comprises 5'-AATAATATCG-3'. In some embodiments, the RNA motif comprises 5'-TAAGAGAGCT-3'. In some embodiments, the RNA motif comprises 5'-AAGAGAGCTC-3'. In some embodiments, the RNA motif comprises 5'-AGAGAGCTCGTTGC-3'. In some embodiments, the RNA motif comprises 5'-GAGAGCTCGT-3'. In some embodiments, the RNA motif comprises 5'-AGAGCTCGTTGCGA-3'. In some embodiments, the RNA motif comprises 5'-GAGCTCGTTG-3'.
[0106] In some embodiments, the esnRNA molecule contains an RNA motif that is complementary to the RNA donor molecule, that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or any percentage in between. In some embodiments, the RNA motif is up to about 50%, up to about 55%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 80%, up to about 87%, up to about 90%, up to about 91%, up to about 92%, up to about 93%, up to about 94%, up to about 95%, up to about 96%, up to about 97%, up to about 98%, up to about 99%, or any percentage therebetween, to the RNA donor molecule. In some embodiments, the RNA motif is 100% complementary to the RNA donor molecule.
[0107] In some embodiments, the esnRNA molecule and the RNA donor molecule form a complex called an esnRNA-donor complex.
[0108] In some embodiments, the esnRNA-donor complex associates with the target RNA via base pairing.
[0109] UTR In some embodiments, the RNA donor molecule further comprises a 5' untranslated region. In some embodiments, the 5' untranslated region increases the stability of the RNA donor molecule. In some embodiments, the 5' untranslated region decreases the stability of the RNA donor molecule. In some embodiments, the 5' untranslated region alters the localization of the RNA donor molecule. In some embodiments, the 5' untranslated region alters the processing of the RNA donor molecule.
[0110] In some embodiments, the RNA donor molecule further comprises a 3' untranslated region. In some embodiments, the 3' untranslated region increases the stability of the RNA donor molecule. In some embodiments, the 3' untranslated region decreases the stability of the RNA donor molecule. In some embodiments, the 3' untranslated region alters the localization of the RNA donor molecule. In some embodiments, the 3' untranslated region alters the processing of the RNA donor molecule.
[0111] Nucleic acid modification In some embodiments, the RNA donor molecule or esnRNA is RNA, DNA, a DNA / RNA hybrid, and / or comprises at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. As used herein, the term "nucleic acid analog" refers to a compound that has a structural similarity to the standard purine or pyrimidine bases present in DNA or RNA. Nucleic acid analogs may contain modified sugars and / or modified nucleobases compared to the purine or pyrimidine bases naturally occurring in DNA or RNA. In some embodiments, the nucleic acid analog is a 2'-deoxyribonucleoside, 2'-ribonucleoside, 2'-deoxyribonucleotide, or 2'-ribonucleotide, where the nucleobase includes a modified base (e.g., xanthine, uridine, oxanine (oxanosine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyl dC, 5-hydroxybutynyl-2'-deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyurazine, isodeoxycytidine, other 0-1 purine analogs, N-6-hydroxylaminopurine, nebularine, 7-deazahypoxanthine, other 7-deazapurines, and 2-methylpurines, etc.). In some embodiments, the nucleic acid analog may be selected from the group consisting of inosine, 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In other embodiments, the nucleic acid analog is a nucleic acid mimic, such as artificial nucleic acids and xenonucleic acids (XNAs).
[0112] nucleic acid Also provided herein are nucleic acid sequences encoding the RNA donor molecules and esnRNA molecules disclosed herein for use in the gene transfer and expression techniques described herein. Although not necessarily explicitly stated, it is understood that the sequences provided herein can be used to provide substantially identical sequences that produce not only expression products, but also proteins with the same biological properties. These "biologically equivalent" or "biologically active" or "equivalent" polypeptides are encoded by equivalent polynucleotides described herein. They may have nucleic acid sequences that are at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identical to a reference nucleic acid sequence when compared using sequence identity methods performed under default conditions. Some specific sequences are provided as examples of certain embodiments. Furthermore, an equivalent polynucleotide is one that hybridizes under stringent conditions to a reference polynucleotide or its complement.
[0113] The nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein can be codon-optimized. Codon optimization refers to the fact that the frequency of usage of certain codons differs in various cells. This codon bias corresponds to the bias in the relative abundance of certain tRNAs in that cell type. It is possible to increase expression by changing the codons in the sequence to match the relative abundance of the corresponding tRNA. It is also possible to decrease expression by deliberately selecting codons whose corresponding tRNAs are rare in a particular cell type. The codon usage table can be used not only for mammalian cells, but also for various other organisms. Based on the genetic code, nucleic acid sequences encoding various replacement domains can be generated. In some embodiments, such sequences are optimized for expression in host or target cells, such as the host cells (such as mammalian cells, e.g., human cells) used to express the RNA donor molecules containing the replacement domains in which the disclosed methods are performed. By using the codon preferences and codon usage tables of a particular species, it is possible to engineer isolated nucleic acid molecules encoding replacement domains that utilize the codon usage preferences of a particular species, such as those that encode proteins having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the corresponding wild-type protein. For example, the replacement domains disclosed herein can be designed to have codons that are preferentially used by a particular organism of interest. In one example, the nucleic acid sequence of the replacement domain is optimized for expression in a human cell, such as having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or original nucleic acid sequence.In some embodiments, the isolated RNA donor molecule encoding at least one replacement domain (which may be part of a vector) comprises at least one replacement domain coding sequence that is codon-optimized for expression in eukaryotic cells or at least one replacement domain coding sequence that is codon-optimized for expression in human cells. In one embodiment, such a codon-optimized replacement domain coding sequence has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or original sequence. In another embodiment, the eukaryotic codon-optimized nucleic acid sequence encodes a replacement domain that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or original protein. In another embodiment, various clones containing functionally equivalent nucleic acids, such as nucleic acids that differ in sequence but encode the same replacement domain protein sequence, can be routinely generated. Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, where multiple codons can encode the same amino acid residue.Thus, for example, leucine may be coded for by CTT, CTC, CTA, CTG, TTA, or TTG, serine may be coded for by TCT, TCC, TCA, TCG, AGT, or AGC, asparagine may be coded for by AAT or AAC, aspartic acid may be coded for by GAT or GAC, cysteine may be coded for by TGT or TGC, alanine may be coded for by GCT, GCC, GCA, or GCG, glutamine may be coded for by CAA or CAG, tyrosine may be coded for by TAT or TAC, and isoleucine may be coded for by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in a variety of sources (see, for example, Stryer, 1988, Biochemistry, 3rd Edition, WH5 Freeman and Co., NY).
[0114] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized through hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonds may occur by Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific manner. The complex may contain two strands forming a duplex structure, three or more strands forming a multistranded complex, single strands that self-hybridize, or any combination of these. A hybridization reaction may constitute one step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
[0115] Examples of stringent hybridization conditions include an incubation temperature of about 25°C to about 37°C, a hybridization buffer concentration of about 6x SSC to about 10x SSC, a formamide concentration of about 0% to about 25%, and a washing solution of about 4x SSC to about 8x SSC. Examples of moderate hybridization conditions include an incubation temperature of about 40°C to about 50°C, a buffer concentration of about 9x SSC to about 2x SSC, a formamide concentration of about 30% to about 50%, and a washing solution of about 5x SSC to about 2x SSC. Examples of high stringency conditions include an incubation temperature of about 55°C to about 68°C, and a buffer concentration of about 1x SSC to about 0.1x SSC.
[0116] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for purposes of comparison. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence has less than 40% identity, or alternatively less than 25% identity, with one of the sequences described herein.
[0117] promoter In some embodiments of the compositions of the present disclosure, the sequence encoding the RNA donor molecule further comprises a sequence encoding a promoter capable of expressing the RNA donor molecule in a eukaryotic cell.
[0118] In some embodiments of the compositions of the present disclosure, the sequence encoding the engineered small nuclear RNA molecule further comprises a sequence encoding a promoter capable of expressing the engineered small nuclear RNA molecule in a eukaryotic cell.
[0119] vector In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a viral vector. In some embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In some embodiments, the viral vector comprises sequences isolated or derived from a lentivirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adenovirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.
[0120] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises inverted terminal repeats or capsid sequences isolated or derived from AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV).
[0121] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, an exosome, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for expressing specific genetic material formed by recombinant means.
[0122] In some embodiments of the compositions and methods of the present disclosure, the expression vector, viral vector or non-viral vector provided herein includes, but is not limited to, an expression control element. As used herein, "expression control element" refers to any sequence that regulates the expression of a coding sequence such as a gene. Examples of expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, 5' or 3' untranslated regions, and introns.
[0123] Expression control elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a control sequence that is a region of a polynucleotide sequence that controls the initiation and rate of transcription. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments, expression control by a promoter is tissue-specific. Non-limiting examples of promoters include CMV, CBA, CAG, Cbh, EF-1a, PGK, UBC, GUSB, UCOE, hAAT, TBG, desmin, MCK, C5-12, NSE, synapsin, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, nβ2, PPE, ENK, EAAT2, GFAP, MBP, H1, and U6 promoters. In some embodiments, a promoter is a sequence isolated or derived from a promoter capable of driving the expression of a transfer RNA (tRNA). In some embodiments, the promoter is isolated or derived from alanine tRNA promoter, arginine tRNA promoter, asparagine tRNA promoter, aspartic acid tRNA promoter, cysteine tRNA promoter, glutamine tRNA promoter, glutamic acid tRNA promoter, glycine tRNA promoter, histidine tRNA promoter, isoleucine tRNA promoter, leucine tRNA promoter, lysine tRNA promoter, methionine tRNA promoter, phenylalanine tRNA promoter, proline tRNA promoter, serine tRNA promoter, threonine tRNA promoter, tryptophan tRNA promoter, tyrosine tRNA promoter, or valine tRNA promoter.In some embodiments, the promoter is isolated or derived from valine tRNA promoter.
[0124] In some embodiments of the compositions of the present disclosure, the eukaryotic cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell.
[0125] An "enhancer" is a region of DNA to which an activator protein can bind and increase the likelihood or frequency of transcription. Non-limiting examples of enhancers and post-transcriptional regulatory elements include the CMV enhancer and the WPRE.
[0126] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include vector elements such as, but not limited to, IRES or 2A peptide sites to obtain "multicistronic" or "polycistronic" or "bicistronic" or "tricistronic" construct structures, i.e., structures with double, triple or multiple coding regions or exons, which themselves have the ability to express two or more proteins from mRNA from a single construct. Multicistronic vectors simultaneously express two or more separate proteins from the same mRNA. Two commonly used strategies to construct multicistronic structures are through the use of IRES or 2A self-cleaving sites. "IRES" refers to an internal ribosome entry site or part thereof of viral, prokaryotic or eukaryotic origin used in polycistronic vector constructs. In some embodiments, IRES is an RNA element that allows cap-dependent translation initiation. The term "self-cleaving peptide" or "sequence encoding a self-cleaving peptide" or "2A self-cleaving site" refers to a linking sequence used in a vector construct to incorporate a site that facilitates ribosomal skipping, thereby generating two polypeptides from a single promoter. Such self-cleaving peptides include, but are not limited to, sequences encoding T2A and P2A peptides or self-cleaving peptides.
[0127] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenoviral / retroviral chimeric vector, a herpes simplex virus I or II vector, a parvoviral vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating preferred aspects of two or more viral vectors. In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector is low toxic. In some embodiments, the AAV vector does not integrate into the host genome, thereby reducing the probability of causing insertional mutagenesis. In some embodiments, the AAV vector may encode a total polynucleotide ranging from .3 kb to 4.75 kb. In some embodiments, examples of AAV vectors that may be used in any of the compositions, systems, methods, and kits described herein include AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV3 vectors, modified AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, AAV.rh74 vectors, modified AAV.rh74 vectors, AAV.rh64R1 vectors, and modified AAV.rh64R1 vectors, and any combinations or equivalents thereof.In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, lentiviral vectors can refer to transgene plasmid vectors as well as transgene plasmid vectors in combination with associated plasmids (e.g., packaging plasmids, rev expression plasmids, envelope plasmids), and lentivirus-based particles capable of introducing exogenous nucleic acids into cells by a viral or viral-like entry mechanism. In some embodiments, examples of lentiviral vectors that can be used in any of the compositions, systems, methods, and kits described herein include human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, sooty mangabeyli immunodeficiency virus (SIVSM) vectors, modified sooty mangabeyli immunodeficiency virus (SIVSM) vectors, African green monkey immunodeficiency virus (SIVAGM) vectors, modified African Examples of such vectors include Simian Green Monkey Immunodeficiency Virus (SIVAGM) vectors, Equine Infectious Anemia Virus (EIAV) vectors, Modified Equine Infectious Anemia Virus (EIAV) vectors, Feline Immunodeficiency Virus (FIV) vectors, Modified Feline Immunodeficiency Virus (FIV) vectors, Visna / Maedi Virus (VNV / VMV) vectors, Modified Visna / Maedi Virus (VNV / VMV) vectors, Caprine Arthritis Encephalitis Virus (CAEV) vectors, Modified Caprine Arthritis Encephalitis Virus (CAEV) vectors, Bovine Immunodeficiency Virus (BIV), or Modified Bovine Immunodeficiency Virus (BIV).
[0128] In some embodiments of the compositions and methods of the present disclosure, the vector comprises or encodes an RNA donor molecule and an esnRNA molecule. In some embodiments, the vector comprises or encodes at least an RNA donor molecule and an esnRNA molecule. In some embodiments, the vector comprises or encodes one or more of the RNA donor molecule(s) and esnRNA molecule(s) of the present disclosure. In some embodiments, the vector comprises or encodes two or more of the RNA donor molecule and esnRNA molecule of the present disclosure. In some embodiments of the compositions and methods of the present disclosure, the vector comprises or encodes an RNA donor molecule. In some embodiments, the vector comprises or encodes at least an RNA donor molecule. In some embodiments, the vector comprises or encodes one or more of the RNA donor molecule(s). In some embodiments, the vector comprises or encodes two or more of the RNA donor molecules.
[0129] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a viral vector. In some embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In some embodiments, the viral vector comprises sequences isolated or derived from a lentivirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adenovirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.
[0130] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises inverted terminal repeats or capsid sequences isolated or derived from AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV).
[0131] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for expressing specific genetic material formed by recombinant means.
[0132] In some embodiments, the liposome, lipoplex, or nanoparticle may further comprise a non-cationic lipid, a PEG-conjugated lipid, a sterol, or any combination thereof.
[0133] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises a non-cationic lipid, wherein the non-cationic lipid is selected from the group consisting of distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POP), and the like. C), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine (16-O-monomethyl PE, etc.), dimethyl-phosphatidylethanolamine (16-O-dimethyl PE, etc.), 18-1-transPE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), dierucoyl phosphatidylcholine (DEPC), palmitoyl oleyl phosphatidylglycerol (POPG), diela. doyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine and non-cationic lipids as described, for example, in WO2017 / 099823 or US2018 / 0028664.
[0134] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises a conjugated lipid, wherein the conjugated lipid is a PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-DMG), or the like. amine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-l-O-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbamate, and N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt.
[0135] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises cholesterol or a cholesterol derivative.
[0136] In some embodiments, the liposome, lipoplex, or nanoparticle further comprises an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of the ionizable lipid, the non-cationic lipid, the conjugated lipid that inhibits particle aggregation, and the sterol can be independently varied. In some embodiments, the lipid nanoparticle comprises an ionizable lipid in an amount of about 20 mol % to about 90 mol % of the total lipid present in the particle, a non-cationic lipid in an amount of about 5 mol % to about 30 mol % of the total lipid present in the particle, a conjugated lipid that inhibits particle aggregation in an amount of about 0.5 mol % to about 20 mol % of the total lipid present in the particle, and a sterol in an amount of about 20 mol % to about 50 mol % of the total lipid present in the particle.
[0137] The ratio of total lipid to DNA vector can be varied as needed. For example, the ratio of total lipid to DNA vector (mass or weight) can be about 10:1 to about 30:1.
[0138] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, "expression control element" refers to any sequence that regulates the expression of a coding sequence, such as a gene. Examples of expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a control sequence that is a region of a polynucleotide sequence that controls the initiation and rate of transcription. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments, expression control by a promoter is tissue-specific. Non-limiting examples of promoters include CMV, CBA, CAG, Cbh, EF-1a, PGK, UBC, GUSB, UCOE, hAAT, TBG, desmin, MCK, C5-12, NSE, synapsin, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, nβ2, PPE, ENK, EAAT2, GFAP, MBP, and U6 promoters. An "enhancer" is a region of DNA to which an activating protein can bind to increase the likelihood or frequency of transcription. Non-limiting examples of enhancers and post-transcriptional regulatory elements include the CMV enhancer and the WPRE.
[0139] Cells and tissues In some embodiments of the compositions and methods of the present disclosure, the cell of the present disclosure is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell. In some embodiments, the cell is a non-human mammalian cell, such as a non-human primate cell. In some embodiments, the cell of the present disclosure is a somatic cell. In some embodiments, the cell of the present disclosure is a germline cell. In some embodiments, the germline cell of the present disclosure is not a human cell.
[0140] In some embodiments of the compositions and methods of the present disclosure, the cell of the present disclosure is a stem cell. In some embodiments, the cell of the present disclosure is an embryonic stem cell. In some embodiments, the embryonic stem cell of the present disclosure is not a human cell. In some embodiments, the cell of the present disclosure is a pluripotent stem cell or a multipotent stem cell. In some embodiments, the cell of the present disclosure is an adult stem cell. In some embodiments, the cell of the present disclosure is an induced pluripotent stem cell (iPSC). In some embodiments, the cell of the present disclosure is a hematopoietic stem cell (HSC).
[0141] In some embodiments of the compositions and methods of the present disclosure, the immune cells of the present disclosure are lymphocytes. In some embodiments, the immune cells of the present disclosure are T lymphocytes (also referred to herein as T cells). Examples of T cells of the present disclosure include, but are not limited to, naive T cells, effector T cells, helper T cells, memory T cells, regulatory T cells (Tregs), and gamma delta T cells. In some embodiments, the immune cells of the present disclosure are B lymphocytes. In some embodiments, the immune cells of the present disclosure are natural killer cells. In some embodiments, the immune cells of the present disclosure are antigen presenting cells.
[0142] In some embodiments of the compositions and methods of the present disclosure, the muscle cells of the present disclosure are myoblasts or muscle cells. In some embodiments, the muscle cells of the present disclosure are cardiomyocytes, skeletal muscle cells, or smooth muscle cells. In some embodiments, the muscle cells of the present disclosure are striated muscle cells.
[0143] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are epithelial cells. In some embodiments, the epithelial cells of the present disclosure form squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified cell epithelium, or transitional cell epithelium. In some embodiments, the epithelial cells of the present disclosure form glands, including but not limited to the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, merocrine gland, serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of an organ, including but not limited to the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of a blood vessel or vein.
[0144] In some embodiments of the compositions and methods of the present disclosure, the brain cells of the present disclosure are neuronal cells. In some embodiments, the neuronal cells of the present disclosure are neurons of the central nervous system. In some embodiments, the neuronal cells of the present disclosure are neurons of the brain or spinal cord. In some embodiments, the neuronal cells of the present disclosure are neurons of the cranial nerves or optic nerves. In some embodiments, the neuronal cells of the present disclosure are neurons of the peripheral nervous system. In some embodiments, the neuronal cells of the present disclosure are glial cells or glial cells. In some embodiments, the glial cells of the present disclosure are glial cells of the central nervous system, including but not limited to oligodendrocytes, astrocytes, ependymal cells, and microglia. In some embodiments, the glial cells of the present disclosure are glial cells of the peripheral nervous system, including but not limited to Schwann cells and satellite cells.
[0145] In some embodiments of the compositions and methods of the present disclosure, the liver cells of the present disclosure are hepatocytes. In some embodiments, the liver cells of the present disclosure are hepatic stellate cells. In some embodiments, the liver cells of the present disclosure are Kupffer cells. In some embodiments, the liver cells of the present disclosure are sinusoidal endothelial cells.
[0146] In some embodiments of the compositions and methods of the present disclosure, the retinal cells of the present disclosure are photoreceptors. In some embodiments, the photoreceptors of the present disclosure are rods. In some embodiments, the retinal cells of the present disclosure are cones. In some embodiments, the retinal cells of the present disclosure are bipolar cells. In some embodiments, the retinal cells of the present disclosure are ganglion cells. In some embodiments, the retinal cells of the present disclosure are horizontal cells. In some embodiments, the retinal cells of the present disclosure are amacrine cells.
[0147] In some embodiments of the compositions and methods of the present disclosure, the cardiac cells of the present disclosure are cardiomyocytes, hi some embodiments, the cardiac cells of the present disclosure are cardiac pacemaker cells.
[0148] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are primary cells.
[0149] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are cultured cells.
[0150] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are in vivo, in vitro, ex vivo, or in situ.
[0151] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are autologous or allogeneic.
[0152] How to use In some embodiments, described herein are compositions comprising two RNA molecules (RNA donor and engineered small nuclear RNA or esnRNA), where the RNA donor selectively binds to a target RNA molecule, while the esnRNA binds to the RNA donor molecule and promotes a trans-splicing reaction with the target RNA molecule. In certain aspects, described herein are non-natural esnRNA molecules that target the non-natural RNA donor molecule and increase recognition of the RNA donor molecule by the endogenous spliceosome. The present disclosure provides vectors, compositions and cells that comprise or encode the RNA donor molecule and the esnRNA molecule. The present disclosure provides methods of using the RNA donor molecule and esnRNA molecule, vectors, compositions and cells of the present disclosure to treat a disease or disorder.
[0153] Without being bound by theory, the combination of a trans-splicing RNA donor molecule and an esnRNA in contact with the RNA donor molecule results in the replacement of a selected sequence in the target RNA in a manner that is sufficiently efficient to replace disease-causing RNA sequences in human cells to address disease. In some embodiments, the disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequence-specific manner and replacing disease-causing RNA sequences in these RNA molecules with high efficiency. In some embodiments, the implementation of RNA donor molecules and esnRNA shows utility in a variety of contexts, including replacing disease-causing sequences or inserting engineered sequences into target RNA. In some embodiments, the engineered sequences can modify the translation or stability of the target RNA, increasing or decreasing protein production or target RNA levels. In some embodiments, the disclosure provides vectors, compositions and cells that include or encode the RNA donor molecules and esnRNA molecules, as well as methods of using the trans-splicing RNA compositions.
[0154] In some embodiments, described herein is an RNA donor molecule that includes four domains. In some embodiments, the combination of the four domains in the RNA donor molecule results in the replacement of a selected sequence in a target RNA in a manner that is sufficiently efficient to replace disease-causing RNA sequences in human cells to address disease. In some embodiments, the present disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequence-specific manner and replacing disease-causing RNA sequences in the RNA molecule with high efficiency. In some embodiments, the implementation of the RNA donor molecule shows utility in a variety of contexts, including replacing disease-causing sequences or inserting engineered sequences into the target RNA. In some embodiments, the engineered sequences can modify the translation or stability of the target RNA, increasing or decreasing protein production or target RNA levels. In some embodiments, the present disclosure provides vectors, compositions and cells that include or encode the RNA donor molecule, as well as methods of using the trans-splicing RNA compositions.
[0155] In some embodiments, the esnRNA and the RNA donor are used to repair a genetic disease, as shown in Figures 1A-1C. In some embodiments, the RNA donor hybridizes to a target RNA carrying a mutation. In some embodiments, base pairing between the RNA donor and the target RNA brings these molecules into close proximity. In some embodiments, base pairing between the esnRNA and the RNA donor brings spliceosome components into close proximity, facilitating a trans-splicing reaction between the target RNA and the RNA donor. In some embodiments, the esnRNA contacts the RNA donor. In some embodiments, contact between the RNA donor and the esnRNA recruits spliceosome components. In some embodiments, trans-splicing occurs between the RNA donor molecule and the target RNA, resulting in a repaired target RNA in which the selected sequence in the target RNA has been replaced with the RNA donor molecule.
[0156] In some embodiments, the compositions described herein can edit the internal sequence of the target RNA. An example is shown in FIG. 2A. In one embodiment, the RNA donor and esnRNA edit the internal sequence. In some embodiments, the compositions described herein can edit the terminal portion of the target sequence. An example is shown in FIG. 2B.
[0157] In some embodiments, described herein are methods for modifying the sequence of an RNA molecule or a protein encoded by an RNA molecule, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.
[0158] The present disclosure provides a method for modifying the activity of a protein encoded by an RNA molecule, the method comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.
[0159] The disclosure provides a method for modifying the sequence of an RNA molecule or a protein encoded by an RNA molecule with an efficiency of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95, or 100%, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with an efficiency of up to about 15%, up to about 20%, up to about 25%, up to about 30%, up to about 35%, up to about 40%, up to about 45%, up to about 50%, up to about 55%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 80%, up to about 85%, up to about 90%, up to about 95, or 100%, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.
[0160] In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 15% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 20% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 30% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 40% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 50% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 60% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 70% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 80% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule. In some embodiments, the method comprises modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 90% efficiency, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.
[0161] The present disclosure provides a method for modifying the sequence of an untranslated region of an RNA molecule, the method comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of an RNA donor molecule (or a portion thereof) to the RNA molecule.
[0162] The present disclosure provides a method for increasing expression of an RNA by insertion of a WPRE or a sequence having similar activity, comprising contacting the RNA molecule with a composition under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or portions thereof) to the RNA molecule.
[0163] The present disclosure provides a method for modifying a composition of a protein encoded by a target RNA, the method comprising contacting the composition with a cell containing the target RNA under conditions suitable for trans-splicing between the composition and the target RNA.
[0164] The present disclosure provides a method of modifying the composition of a target RNA with at least about 20% efficiency, comprising contacting a cell containing the composition and the target RNA under conditions suitable for trans-splicing between the composition and the target RNA, where 100% efficiency constitutes complete replacement of a selected sequence within the target RNA. In some embodiments, the efficiency is at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 89%, at least about 89%, at least about 85%, at least about 90%, at least about 95%, or 100%. In some embodiments, the efficiency is up to about 20%, up to about 25%, up to about 30%, up to about 35%, up to about 40%, up to about 45%, up to about 50%, up to about 55%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 89%, up to about 85%, up to about 90%, up to about 95%, or 100%. In some embodiments, the efficiency is at least about 20%. In some embodiments, the efficiency is at least about 40%. In some embodiments, the efficiency is at least about 60%. In some embodiments, the efficiency is at least about 70%. In some embodiments, the efficiency is at least about 80%. In some embodiments, the efficiency is at least about 90%. In some embodiments, the efficiency is about 100%.
[0165] As described herein, a method of modifying the composition of a protein encoded by a target RNA with at least about 20% efficiency, comprising contacting a cell containing the composition and the target RNA under conditions suitable for trans-splicing between the composition and the target RNA, where 100% efficiency constitutes complete replacement of a selected sequence within the target RNA. In some embodiments, the efficiency is at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 89%, at least about 89%, at least about 85%, at least about 90%, at least about 95%, or 100%. In some embodiments, the efficiency is up to about 20%, up to about 25%, up to about 30%, up to about 35%, up to about 40%, up to about 45%, up to about 50%, up to about 55%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 89%, up to about 85%, up to about 90%, up to about 95%, or 100%. In some embodiments, the efficiency is at least about 20%. In some embodiments, the efficiency is at least about 40%. In some embodiments, the efficiency is at least about 60%. In some embodiments, the efficiency is at least about 70%. In some embodiments, the efficiency is at least about 80%. In some embodiments, the efficiency is at least about 90%. In some embodiments, the efficiency is about 100%.
[0166] The present disclosure provides a method for modifying the composition of a target RNA with high efficiency, comprising contacting a composition with a cell containing the target RNA under conditions suitable for trans-splicing between the composition and the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition comprises a vector comprising or encoding an RNA donor molecule of the present disclosure. In some embodiments, the composition comprises a vector comprising or encoding an RNA donor and an esnRNA of the present disclosure. In some embodiments, the vector is AAV.
[0167] The present disclosure provides a method for modifying the composition of a protein encoded by a target RNA with high efficiency, comprising contacting a cell comprising the composition and the target RNA under conditions suitable for trans-splicing between the composition and the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition comprises a vector comprising or encoding an RNA donor molecule of the present disclosure. In some embodiments, the composition comprises a vector comprising or encoding an RNA donor molecule and an esnRNA molecule of the present disclosure. In some embodiments, the vector is AAV.
[0168] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the present disclosure.
[0169] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the present disclosure, where the composition comprises a vector that includes or encodes an RNA donor molecule of the present disclosure, and where the composition alters the expression level of the RNA molecule or a protein encoded by the RNA molecule of the present disclosure.
[0170] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the present disclosure, wherein the composition comprises a vector comprising or encoding an RNA donor molecule and an esnRNA molecule of the present disclosure, and wherein the composition alters the expression level of the RNA molecule or a protein encoded by the RNA molecule of the present disclosure.
[0171] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the present disclosure, where the composition comprises a vector that includes or encodes an RNA donor molecule of the present disclosure, and where the composition alters the activity of a protein encoded by the RNA molecule.
[0172] The present disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the present disclosure, wherein the composition comprises a vector that contains or encodes an RNA donor molecule and an esnRNA molecule of the present disclosure, and wherein the composition alters the activity of a protein encoded by the RNA molecule.
[0173] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, genetic disease or disorder.In some embodiments, genetic disease or disorder is a single gene disease or disorder.In some embodiments, the single gene disease or disorder is an autosomal dominant disease or disorder, an autosomal recessive disease or disorder, an X-linked (X-linked) disease or disorder, an X-linked dominant disease or disorder, an X-linked recessive disease or disorder, a Y-linked disease or disorder, or a mitochondrial disease or disorder. In some embodiments, the monogenic disease or disorder is a common variable immunodeficiency, adenosine deaminase deficiency, X-linked severe combined immunodeficiency, beta-thalassemia, alpha-thalassemia, myelodysplastic syndrome, amyotrophic lateral sclerosis, frontotemporal dementia with parkinsonism, Usher syndrome, Krabbe disease, Niemann-Pick disease, prion disease, Dravet syndrome, juvenile Parkinson's disease, spinocerebellar ataxia, inherited epilepsy disorders, ataxia-telangiectasia, GM1 gangliosidosis, Gaucher disease, GM2 gangliosidosis, Angelman syndrome, glucose transporter type 1 deficiency, Danone syndrome, cerebellar ataxia ... In some embodiments, the genetic disease or disorder may be a polycystic kidney disease, Fabry disease, autosomal dominant polycystic kidney disease, Pompe disease, familial hypercholesterolemia, open angle glaucoma, Hurler syndrome or mucopolysaccharidosis type 1, Hunter syndrome or mucopolysaccharidosis type 2, Batten disease, Duchenne muscular dystrophy, limb-girdle muscular dystrophy type 1B, limb-girdle muscular dystrophy type 2B, limb-girdle muscular dystrophy type 2D, limb-girdle muscular dystrophy type 2E, limb-girdle muscular dystrophy type 2C, limb-girdle muscular dystrophy type 2F, facioscapulohumeral muscular dystrophy, hemophilia B, hemophilia A, retinitis pigmentosa, cystic fibrosis, autosomal dominant hearing impairment, and non-syndromic hearing loss. In some embodiments, the genetic disease or disorder is a polygenic disease or disorder. In some embodiments, the genetic disease or disorder is a polygenic disease or disorder.In some embodiments, the monogenic disease or disorder is an autosomal dominant disease or disorder, including, but not limited to, Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostoses, von Willebrand's disease, and acute intermittent porphyria. In some embodiments, the monogenic disease or disorder is an autosomal dominant disease or disorder, including, but not limited to, albinism, medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, and Roberts syndrome. In some embodiments, the monogenic disease or disorder is an X-linked disease or disorder, including, but not limited to, muscular dystrophy, Duchenne muscular dystrophy, hemophilia, adrenoleukodystrophy (ALD), Rett syndrome, and hemophilia A. In some embodiments, the monogenic disease or disorder is a mitochondrial disorder, including but not limited to Leber's hereditary optic neuropathy.
[0174] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, immune diseases or disorders. In some embodiments, the immune disease or disorder is an immune deficiency disease or disorder, including, but not limited to, B cell deficiency, T cell deficiency, neutropenia, asplenia, complement deficiency, acquired immune deficiency syndrome (AIDS), and immune deficiency due to medical intervention (immunosuppression as an intended or adverse effect of medical therapy). In some embodiments, the immune disease or disorder is, but is not limited to, achalasia, Addison's disease, adult Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, anti-GBM / anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune autonomic neuropathy, autoimmune encephalomyelitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune thyroid ... Immune retinopathy, Autoimmune urticaria, Axonal & Neuronal Neuropathy (AMAN), Baro's disease, Behçet's disease, Benign mucous membrane pemphigoid, Bullous pemphigoid, Castleman's disease (CD), Celiac disease, Chagas disease, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic relapsing multifocal osteomyelitis (CRMO), Churg-Strauss syndrome (CSS) or Eosinophilic granulomatosis (EGPA), Cicatricial pemphigoid, Cogan's syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), discoid lupus, Dressler syndrome, endometriosis, eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture's syndrome, granulomatous polyangiitis cystitis, Graves' disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schönlein purpura (HSP), herpes gestationis or pemphigoid of gestationis (PG), hidradenitis suppurativa (HS) (acne contralateralis), hypogammaglobulinemia, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenic purpura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), juvenile arthritis, juvenile diabetes mellitus (type 1 diabetes), juvenile myositis (JM), Kawasaki disease,Lambert-Eaton syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosus, lignified conjunctivitis, linear immunoglobulin A disease (LAD), lupus, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Mooren's ulcer, Mucha-Habermann disease, multifocal motor neuropathy (MMN) or MMNCB, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neonatal lupus, neuromyelitis optica, neutropenia, ocular scarring Pemphigoid, Optic neuritis, Relapsing rheumatism (PR), PANDAS, Paraneoplastic cerebellar degeneration (PCD), Paroxysmal nocturnal hemoglobinuria (PNH), Parry-Romberg syndrome, Parsplanitis (peripheral uveitis), Parsonage-Turner syndrome, Pemphigus, Peripheral neuropathy, Perivenous encephalomyelitis, Pernicious anemia (PA), POEMS syndrome, Polyarteritis nodosa, Polyglandular syndrome type I, II, III, Polymyalgia rheumatica, Polymyositis, Myocardium Post-infarction syndrome, Post-pericardiotomy syndrome, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progesterone dermatitis, Psoriasis, Psoriatic arthritis, Pure red cell aplasia (PRCA), Pyoderma gangrenosum, Raynaud's phenomenon, Reactive arthritis, Reflex sympathetic dystrophy, Relapsing polychondritis, Restless legs syndrome (RLS), Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt's syndrome, Scleritis, Scleroderma, Sjogren's syndrome, Spermatozoonotic autoimmunity, Autoimmune diseases or disorders, including stiff-person syndrome (SPS), subacute bacterial endocarditis (SBE), Susac syndrome, sympathetic ophthalmia (SO), Takayasu's arteritis, temporal arteritis / giant cell arteritis, thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome (THS), transverse myelitis, type 1 diabetes, ulcerative colitis (UC), unclassifiable connective tissue disease (UCTD), uveitis, vasculitis, vitiligo, Vogt-Koyanagi-Harada disease, or Wegener's granulomatosis.
[0175] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, an inflammatory disease or disorder.
[0176] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a metabolic disease or disorder.
[0177] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a degenerative or progressive disease or disorder. In some embodiments, the degenerative or progressive disease or disorder includes, but is not limited to, amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, and aging.
[0178] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, an infectious disease or disorder.
[0179] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a pediatric or developmental disease or disorder.
[0180] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a cardiovascular disease or disorder.
[0181] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a proliferative disease or disorder. In some embodiments, the proliferative disease or disorder is cancer. In some embodiments, the cancer includes, but is not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical carcinoma, AIDS-related cancer, Kaposi's sarcoma (soft tissue sarcoma), AIDS-related lymphoma (lymphoma), primary CNS lymphoma (lymphoma), anal cancer, appendix cancer, gastrointestinal carcinoid tumor, astrocytoma, atypical teratoid / rhabdoid tumor, central nervous system (brain cancer), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, Ewing's sarcoma, osteosarcoma, malignant fibrous histiocytoma, brain tumor, breast cancer, Burkitt's lymphoma, carcinoma of the carcinoma of the bladder, ... Noid tumor, carcinoma, cardiac (heart) tumor, embryonal tumor, germ cell tumor, primary CNS lymphoma, cervical cancer, intrahepatic cholangiocarcinoma, chordoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), chronic myeloproliferative neoplasm, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, non-invasive ductal carcinoma, germinoma, endometrial carcinoma (uterine cancer), ependymoma, esophageal cancer, nasal neuroblastoma (head and neck cancer), Ewing's sarcoma (bone cancer), extracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, pediatric intraocular melanoma, intraocular melanoma, retinoblastoma, Fallopian tube cancer, malignant fibrous histiocytoma of bone, and osteosarcoma, gallbladder cancer, stomach cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST) (soft tissue sarcoma), pediatric gastrointestinal stromal tumor, germ cell tumor, pediatric extracranial germ cell tumor, extragonadal germ cell tumor, ovarian germ cell tumor, testicular cancer, gestational trophoblastic disease, hairy cell leukemia, head and neck cancer, heart tumor, hepatocellular (liver) carcinoma, histiocytosis, Hodgkin's lymphoma, hypopharyngeal carcinoma (head and neck cancer), intraocular melanoma, pancreatic islet cell tumor, pancreatic neuroendocrine tumor, Kaposi's sarcoma (soft tissue sarcoma), kidney (renal cell) Cancer, Langerhans cell histiocytosis, laryngeal cancer (head and neck cancer), leukemia, lip and oral cavity cancer (head and neck cancer), liver cancer, lung cancer (non-small cell and small cell), childhood lung cancer, lymphoma, male breast cancer, malignant fibrous histiocytoma and osteosarcoma of bone, melanoma, Merkel cell carcinoma (skin cancer), mesothelioma, metastatic squamous cell carcinoma of the neck with unknown primary site (head and neck cancer), midline carcinoma with NUT gene alteration, oral cancer (head and neck cancer), multiple endocrine neoplasia syndrome, multiple myeloma / plasma cell neoplasm, mycosis fungoides (lymphoma), myelodysplastic syndrome, myelodysplastic / myeloproliferative neoplasm,Nasal and paranasal sinus cancer (head and neck cancer), nasopharyngeal cancer (head and neck cancer), neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cavity cancer, lip and oral cavity cancer and oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor (islet cell tumor), papillomatosis, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer (head and neck cancer), pheochromocytoma, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, gestational breast cancer, primary central nervous system (CNS) lymphoma, primary peritoneal cancer, prostate cancer, rectal cancer, recurrent cancer, renal cell (kidney) cancer, retinoblastoma, childhood rhabdomyosarcoma (soft tissue sarcoma), salivary gland cancer (head and neck cancer), sarcoma, small These include, but are not limited to, childhood rhabdomyosarcoma (soft tissue sarcoma), childhood vascular tumors (soft tissue sarcoma), Ewing's sarcoma (bone cancer), Kaposi's sarcoma (soft tissue sarcoma), osteosarcoma (bone cancer), uterine sarcoma, Sezary syndrome, lymphoma, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma of the skin, squamous cell carcinoma of the cervix, gastric cancer, T-cell lymphoma, testicular cancer, pharyngeal cancer (head and neck cancer), nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, renal cell carcinoma, urethral cancer, uterine sarcoma, vaginal cancer, vascular tumors (soft tissue sarcoma), vulvar cancer, Wilms' tumor, and other childhood kidney tumors.
[0182] In some embodiments of the compositions and methods of the present disclosure, the disease or disorder of the present disclosure includes, but is not limited to, a proliferative disease or disorder. In some embodiments, the proliferative disease or disorder is cancer. In some embodiments, the cancer is associated with the presence of a gene fusion that generates a chimeric RNA containing sequences derived from two genes due to DNA deletion or translocation. Gene fusion pairs include MAN2A1 and FER, DNAJB1 and PRKACA, BCR-ABL1, TMPRSS2 and ERG, EWSR1 and FLI1, PML and RARA, EML4 and ALK, KIAA1549 and BRAF, CCDC6 and RET, SS18 and SSX1, RUNX1 and RUNX1T1, PAX3 and FOXO1, NCOA4 and RET, ETV6 and RUNX1, FUS and DDIT3, SS18 and SSX2, NPM1 and and ALK, KMT2A and AFF1, TCF3 and PBX1, STIL and TAL1, COL1A1 and PDGFB, CRTC1 and MAML2, NAB2 and STAT6, EWSR1 and ATF1, ETV6 and NTRK3, EWSR1 and ERG, EWSR1 and WT1, DNAJB1 and PRKACA, PAX7 and FOXO1, FUS and CREB3L2, CBFA2T3 and GLIS2, PAX8 and PPARG, KMT2A and MLLT1, EWS R1 and NR4A3, KMT2A and MLLT3, ASPSCR1 and TFE3, HMGA2 and LPP, JAZF1 and SUZ12, KIF5B and RET, FUS and ERG, SLC45A3 and ERG, NUP214 and ABL1, SET and NUP214, CD74 and ROS1, ETV6 and ABL1, TPM3 and NTRK1, PRKAR1A and RET, EWSR1 and CREB1, KMT2A and AFDN, EWSR1 and DDIT3, CL TC and ALK, ETV6 and PDGFRB, TPM3 and ALK, KMT2A and MLLT10, TMPRSS2 and ETV1, BRD4 and NUTM1, NUP98 and KDM5A, RANBP2 and ALK, CTNNB1 and PLAG1, KMT2A and ELL, TAF15 and NR4A3, FGFR3 and TACC3, PCM1 and JAK2, YWHAE and NUTM2B, STRN and ALK, CRTC3 and MAML2, CDH11 and USP6,CDKN2D and WDFY2, CIC and DUX4, SLC34A2 and ROS1, ATIC and ALK, CD74 and NRG1, MYB and NFIB, PRCC and TFE3, KIF5B and ALK, TMPRSS2 and ETV4, KMT2A and SEPT9, EWSR1 and POU5F1, FGFR1 and PLAG1, MN1 and ETV6, TBL1XR1 and TP63, KMT2A and EPS15, SLC45A3 and ELK4, DHH and RHEBL1, HEY1 and NCOA2, EZR and ROS1, GOPC and ROS1, HMGA2 and WI F1, KMT2A and CREBBP, SS18 and SSX4B, FAM131B and BRAF, EWSR1 and FEV, EWSR1 and PBX1, TPM4 and ALK, SND1 and BRAF, ACTB and GLI1, KMT2A and KNL1, KMT2A and SEPT6, SDC4 and ROS1, TFG and ALK, HNRNPA2B1 and ETV1, PTPRK and RSPO3, JAZF1 and PHF1, HMGA2 and RAD51B, KMT2A and MLLT11, TPR and NTRK1, AKAP9 and BRAF, FUS and CREB3L1, ET V6 and JAK2, HMGA2 and NFIB, KMT2A and AFF3, CHCHD7 and PLAG1, VTI1A and TCF7L2, LIFR and PLAG1, EWSR1 and ETV1, SRGAP3 and RAF1, KMT2A and AFF4, MEAF6 and PHF1, PAX3 and NCOA1, HAS2 and PLAG1, EWSR1 and NFATC2, HIP1 and ALK, GOLGA5 and RET, BCR and JAK2, EWSR1 and ETV4, DCTN1 and ALK, MBTD1 and CXorf67, NDRG1 and ERG, CARS and ALK , SFPQ and TFE3, KMT2A and ARHGAP26, KMT2A and EP300, KMT2A and TET1, PAX5 and JAK2, PPFIBP1 and ALK, YWHAE and NUTM2A, LRIG3 and ROS1, TFG and NTRK1, TPM3 and ROS1, SLC45A3 and ETV1, ERC1 and RET, SEC16A and NOTCH1, KTN1 and RET, SEC31A and JAK2, TCEA1 and PLAG1, QKI and NTRK2, RNF130 and BRAF, EIF3E and RSPO2, EWSR1 and ZNF444,LMNA and NTRK1, PPFIBP1 and ROS1, PWWP2A and ROS1, EWSR1 and YY1, FUS and ATF1, PAX3 and NCOA2, ZC3H7B and BCOR, BRD3 and NUTM1, CANT1 and ETV4, CIC and FOXO4, COL1A1 and USP6, EWSR1 and ZNF384, KMT2A and ABI1, KMT2A and ACTN4, KMT2A and CEP170B, KMT2A and FOXO3, KMT2A and GAS7, KMT2A and MLLT6, KMT2A and SEPT2, KMT2A and SEPT 5, MSN and ALK, VCL and ALK, EZR and ERBB4, RELCH and RET, SLC3A2 and NRG1, TRIM24 and BRAF, KLC1 and ALK, ARID1A and MAST2, GPBP1L1 and MAST2, NFIX and MAST1, NOTCH1 and GABBR2, TADA2A and MAST1, ZNF700 and MAST1, TRIM24 and RET, TRIM33 and RET, SSBP2 and JAK2, KMT2A and EEFSEC, CLCN6 and BRAF, GNAI1 and BRAF, MKRN1 and BRAF, NA CC2 and NTRK2, FGFR1 and TACC1, TRIM27 and RET, HMGA2 and FHIT, HOOK3 and RET, PCM1 and RET, CEP89 and BRAF, CLIP1 and ROS1, ERC1 and ROS1, HLA and A and ROS1, LSM14A and BRAF, MYO5A and ROS1, SHTN1 and ROS1, TP53 and NTRK1, TPM3 and ROS1, ZCCHC8 and ROS1, FGFR3 and BAIAP2L1, KLK2 and ETV1, ACSL3 and ETV1, NUP107 and LGR5, HMGA2 and CCNB1IP1, HMGA2 and COX6C, GATM and BRAF, HACL1 and RAF1, HERPUD1 and BRAF, ZSCAN30 and BRAF, SLC45A3 and BRAF, HMGA2 and LHFPL6, COL1A2 and PLAG1, ESRP1 and RAF1, IRF2BP2 and CDX1, TFG and NR4A3, CLTC and TFE3, EWSR1 and MYB, NONO and TFE3, FCHSD1 and BRAF, HMGA2 and EBF1, ACBD6 and RRP15, AGPAT5 and MCPH1, AGTRAP and BRAF,ARFIP1 and FHDC1, ATG4C and FBXO38, BBS9 and PKD1L1, CENPK and KMT2A, CNBP and USP6, DDX5 and ETV4, EIF3K and CYP39A1, EPC1 and PHF1, ERO1A and FERMT2, ETV6 and ITPR2, EWSR1 and NFATC1, EWSR1 and PATZ1, EWSR1 and SMARCA5, EWSR1 and SP3, FBXL18 and RNF216, FGFR1 and ZNF703, FN1 and ALK, FUS and FEV, GMDS and PDE8B, HMGA2 and and ALDH2, IL6R and ATP8B2, INTS4 and GAB2, JPT1 and USH1G, KLK2 and ETV4, KMT2A and ABI2, KMT2A and ARHGEF12, KMT2A and BTBD18, KMT2A and CASP8AP2, KMT2A and CBL, KMT2A and CIP2A, KMT2A and CT45A2, KMT2A and DAB2IP, KMT2A and FOXO4, KMT2A and FRYL, KMT2A and GMPS, KMT2A and GPHN, KMT2A and LASP1, KMT2A and LPP, KMT2A and MA PRE1, KMT2A and MYO1F, KMT2A and NCKIPSD, KMT2A and NRIP3, KMT2A and PDS5A, KMT2A and PICALM, KMT2A and PRRC1, KMT2A and SARNP, KMT2A and SH3GL1, KMT2A and SORBS2, KMT2A and TOP3A, KMT2A and ZFYVE19, MBOAT2 and PRKCE, MIA2 and GEMIN2, NF1 and ASIC2, NFIA and EHF, NTN1 and ACLY, OMD and USP6, PLA2R1 and RBMS1, PLXND1 and TMCC1, RAF1 and DAZL, RBM14 and PACS1, RGS22 and SYCP1, SEC31A and ALK, SEPT8 and AFF4, SLC22A1 and CUTA, SLC26A6 and PRKAR2A, SLC45A3 and ETV5, SQSTM1 and ALK, SS18L1 and SSX1, SSH2 and SUZ12, SUSD1 and PTBP3, TCF12 and NR4A3, TECTA and TBCEL, THRAP3 and USP6, TMPRSS2 and ETV5, TPR and ALK, UBE2L3 and KRAS, WDCP and ALK,These include, but are not limited to, SS18 and USP6.
[0183] In some embodiments of the method of the present disclosure, the subject of the present disclosure is diagnosed with a disease or disorder.In some embodiments, the subject of the present disclosure exhibits at least one sign or symptom of a disease or disorder.In some embodiments, the subject has a biomarker that predicts the risk of developing a disease or disorder.In some embodiments, the biomarker is a genetic mutation.
[0184] In some embodiments of the method of the present disclosure, the subject of the present disclosure is female.In some embodiments of the method of the present disclosure, the subject of the present disclosure is male.In some embodiments, the subject of the present disclosure has two XX chromosomes or XY chromosomes.In some embodiments, the subject of the present disclosure has two XX chromosomes or XY chromosomes and a third chromosome of either X or Y.
[0185] In some embodiments of the method of the present disclosure, the subject of the present disclosure is a newborn, an infant, a child, an adult, a middle-aged adult, or an elderly adult.In some embodiments of the method of the present disclosure, the subject of the present disclosure is at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, at least about 22 days, at least about 23 days, at least about 24 days, at least about 25 days, at least about 26 days, at least about 27 days, at least about 28 days, at least about 29 days, at least about 30 days, or at least about 31 days after birth. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months of age. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least about 1 year old, at least about 2 years old, at least about 3 years old, at least about 4 years old, at least about 5 years old, at least about 6 years old, at least about 7 years old, at least about 8 years old, at least about 9 years old, at least about 10 years old, at least about 15 years old, at least about 20 years old, at least about 25 years old, at least about 30 years old, at least about 35 years old, at least about 40 years old, at least about 45 years old, at least about 50 years old, at least about 55 years old, at least about 60 years old, at least about 65 years old, at least about 70 years old, at least about 75 years old, at least about 80 years old, at least about 85 years old, at least about 90 years old, at least about 95 years old, at least about 100 years old, or any age or partial age in between.
[0186] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a mammal. In some embodiments, the subject of the present disclosure is a non-human mammal.
[0187] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a human.
[0188] In some embodiments of the methods of the present disclosure, the therapeutically effective amount comprises a single dose of the composition of the present disclosure. In some embodiments, the therapeutically effective amount comprises at least one dose of the composition of the present disclosure. In some embodiments, the therapeutically effective amount comprises one or more doses (multiple doses) of the composition of the present disclosure.
[0189] In some embodiments of the disclosed methods, the therapeutically effective amount eliminates a sign or symptom of a disease or disorder, hi some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of a disease or disorder.
[0190] In some embodiments of the methods of the present disclosure, the therapeutically effective amount eliminates the disease or disorder.
[0191] In some embodiments of the disclosed methods, the therapeutically effective amount prevents the onset of a disease or disorder. In some embodiments, the therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of a disease or disorder. In some embodiments, the therapeutically effective amount improves the prognosis of a subject.
[0192] In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered to the subject systemically. In some embodiments, the compositions of the present disclosure are administered to the subject via an intravenous route. In some embodiments, the compositions of the present disclosure are administered to the subject via injection or infusion.
[0193] In some embodiments of the method of the present disclosure, the composition of the present disclosure is administered locally to the subject. In some embodiments, the composition of the present disclosure is administered to the subject by intraosseous, intraocular, intracerebrospinal or intraspinal route. In some embodiments, the composition of the present disclosure is administered directly to the cerebrospinal fluid of the central nervous system. In some embodiments, the composition of the present disclosure is administered directly to the tissue or fluid of the eye, but is not bioavailable outside the ocular structure. In some embodiments, the composition of the present disclosure is administered to the subject by injection or infusion.
[0194] In some embodiments, the compositions comprising the RNA donor molecules disclosed herein are formulated as pharmaceutical compositions. Briefly, the pharmaceutical compositions for use disclosed herein may comprise a polynucleotide encoding a fusion protein(s) or a fusion protein(s) optionally contained in an AAV that is also optionally immuno-orthogonal, in combination with one or more pharma- ceutical or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise a buffer, such as neutral buffered saline, phosphate buffered saline; a carbohydrate, such as glucose, mannose, sucrose or dextran, mannitol; a protein; an amino acid, such as a polypeptide or glycine; an antioxidant; a chelating agent, such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative. The compositions of the present disclosure may be formulated for oral, intravenous, topical, enteral, intraocular, and / or parenteral administration. In certain embodiments, the compositions of the present disclosure are formulated for intravenous administration.
[0195] Numbered embodiments In certain aspects, disclosed herein are the following embodiments. 1. A composition comprising an RNA donor molecule, the composition comprising: (a) one or more replacement domains encoding operably linked therapeutic sequences; (b) one or more intron domains that facilitate RNA splicing of the replacement domains; (c) one or more antisense domains that facilitate binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain that facilitates trans-splicing of the RNA donor molecule. 2. A composition comprising an engineered small nuclear RNA molecule and an RNA donor molecule, the composition comprising: (a) one or more replacement domains encoding operably linked therapeutic sequences; (b) one or more intron domains that facilitate RNA splicing of the replacement domains; and (c) one or more antisense domains that facilitate binding to a target RNA molecule. 3. The composition of embodiment 2, wherein the engineered small RNA molecule contains a motif complementary to a sequence in the RNA donor molecule, said motif being one of the following sequences: 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. 4. The composition of embodiment 2, wherein said engineered small nuclear RNA molecule is composed, starting from the 5' end, of a sequence complementary to a sequence in said RNA donor molecule, followed by a sequence derived or isolated from the human U1 gene. 5. The composition of embodiment 2, wherein the engineered small nuclear RNA molecule is composed, starting from the 5' end, of a sequence complementary to a sequence in the RNA donor molecule, followed by a sequence derived or isolated from a human snRNA gene. 6. The composition of embodiment 2, wherein said engineered small nuclear RNA is composed, starting from the 5' end, of a sequence that is synthetic or derived or isolated from the human U1 gene, followed by a sequence that is complementary to a sequence in the RNA donor molecule, followed by another sequence derived or isolated from a human snRNA gene. 7. The composition of embodiment 2, wherein said engineered small nuclear RNA is composed, starting from the 5' end, of a sequence derived or isolated from the human U1 gene, followed by a sequence complementary to a sequence in an RNA donor molecule. 8. The substituted domain is selected from the group consisting of GLB1 (GM1 gangliosidosis); GBA (Gaucher disease); GM2A (GM2 gangliosidosis); PCSK9, LDLR, APOB, APOE (familial hypercholesterolemia); GAA (Pompe disease); MYOC, OPTN, TBK1, WDR36, CYPIB1 (open angle glaucoma); IDS (Hunter syndrome or mucopolysaccharidosis type 2); IDUA (Hurler syndrome or mucopolysaccharidosis type 1); CLN3 (Batten disease); F9 (hemophilia B); F8 (hemophilia A), LAMP2 (Danon disease); GLA (Fabry disease); SLC2A1 (glucose transporter type 1 deficiency); UBE3A (Angelman syndrome); MYOC, OPTN, TBK1, WDR36, CYPIB1 (open angle glaucoma); IDUA The composition of any one of embodiments 1 to 7, which is derived or isolated from a human gene selected from the group consisting of: (Hurler syndrome or mucopolysaccharidosis type 1); IDS (Hunter syndrome or mucopolysaccharidosis type 2); CLN3 (Batten disease); LMNA (limb-girdle muscular dystrophy type 1B); DMD (Duchenne muscular dystrophy); DYSF (limb-girdle muscular dystrophy type 2B); SGCB (limb-girdle muscular dystrophy type 2E); SGCG (limb-girdle muscular dystrophy type 2C); SGCA (limb-girdle muscular dystrophy type 2D); SGCD (limb-girdle muscular dystrophy type 2F); DUX4, D4Z4 (facioscapulohumeral muscular dystrophy); USHA2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 (retinitis pigmentosa). 9. The composition of any one of the preceding claims, wherein the replacement domain is derived or isolated from an expression-enhancing sequence selected from the group consisting of the Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), the triple helix from MALAT1, the Hepatitis B Virus PRE (HPRE), and an iron-responsive element. 10. The antisense domain is selected from the group consisting of TNFRSF13B (common common variable immunodeficiency), ADA, CECR1 (adenosine deaminase deficiency), IL2RG (X-linked severe combined immunodeficiency), HBB (beta-thalassemia), HBA1, HBA2 (alpha-thalassemia), U2AF1 (myelodysplastic syndrome), SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 (amyotrophic lateral sclerosis), MAPT, PGRN (frontotemporal dementia with Parkinsonism), CDH23, MYO7A, USH2A (Usher syndrome), GALC (class I immune deficiency), and GALC (class II immune deficiency). Rabbe disease), SMPD1, NPC1, NPC2 (Niemann-Pick disease), PRNP (prion disease), SCN1A (Dravet syndrome), PINK1, ATPGAP2 (Early-onset Parkinson's disease), ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITRP1, TBP, KCND1, FGF14 (Spinocerebellar ataxia), SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 (inherited epilepsy disorders), ATM (ataxia telangiectasia), GLB1 (GM1 gangliosidosis), GBA (Gaucher disease), GM2A (GM2 gangliosidosis), UBE3A (Angelman syndrome), SLC2A1 (glucose transporter type 1 deficiency), LAMP2 (Danon disease), GLA (Fabry disease), PKD1, PKD2 (autosomal dominant polycystic kidney disease), GAA (Pompe disease), PCSK9, LDLR, APOB, APOE (familial hypercholesterolemia) ), MYOC, OPTN, TBK1, WDR36, CYPIB1 (open angle glaucoma), IDUA (Hurler syndrome or mucopolysaccharidosis type 1), IDS (Hunter syndrome or mucopolysaccharidosis type 2), CLN3 (Batten disease), DMD (Duchenne muscular dystrophy), LMNA (limb-girdle muscular dystrophy type 1B), DYSF (limb-girdle muscular dystrophy type 2B), SGCA (limb-girdle muscular dystrophy type 2D), SGCB (limb-girdle muscular dystrophy type 2E), SGCG (limb-girdle muscular dystrophy type 2C), SGCD (limb-girdle muscular dystrophy type 2F), DUX4,The composition according to any one of the preceding embodiments, wherein the sequence is complementary to a sequence derived or isolated from a human gene selected from the group consisting of D4Z4 (facioscapulohumeral muscular dystrophy), F9 (hemophilia B), F8 (hemophilia A), USHA2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 (retinitis pigmentosa), CFTR (cystic fibrosis), GJB2, GJB6, STRC, DFNA1, DFNA14 (autosomal dominant hearing loss), POU3F3 (nonsyndromic hearing loss). 11. The composition of any one of embodiments 1 to 10, wherein the RNA donor molecule comprises an untranslated region that alters the localization, processing, or transport of the RNA donor molecule and / or the esnRNA. 12. A composition according to any one of embodiments 1 to 2, wherein the RNA donor molecule and / or the sequence comprising esnRNA comprises a sequence that is bound by an RNA binding protein that enhances trans-splicing efficiency. 13. The composition of any one of embodiments 1 to 12, wherein the RNA donor molecule is RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. 14. The composition of any one of embodiments 1 to 13, wherein the RNA donor molecule further comprises a heterologous promoter. 15. The composition of any one of embodiments 1 to 14, wherein the esnRNA further comprises a heterologous promoter. 16. The composition of any one of embodiments 15, wherein the promoter is isolated or derived from a promoter capable of driving expression of a transfer RNA (tRNA). 17. A composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule. 18. A composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule, the RNA donor molecule comprising (a) one or more replacement domains encoding an operably linked therapeutic sequence, (b) one or more intron domains that promote RNA splicing of the replacement domain, and (c) one or more antisense domains that promote binding to a target RNA molecule. 19. The composition according to embodiments 17-18, wherein said engineered small nuclear RNA molecule is isolated or derived from a human small nuclear RNA gene. 20. The composition of embodiment 19, wherein the engineered small nuclear RNA domain is synthetic and binds to a component of the spliceosome. 21. The composition of embodiments 17 to 20, wherein the human small nuclear RNA genes are selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12. 22. The composition of any one of embodiments 17 to 21, wherein the engineered small nuclear RNA domain comprises a sequence isolated or derived from a variant of the human U1 gene. 23. The composition of any one of embodiments 17 to 22, wherein the engineered small nuclear RNA molecule is derived or isolated from a U1 small nuclear RNA gene or variant and contains an RNA motif that is partially or fully complementary to the RNA donor molecule and begins less than 16 nucleobases from the 5' end. 24. The composition of any one of embodiments 17 to 23, wherein the engineered small nuclear RNA molecule contains an RNA motif that is partially or fully complementary to the RNA donor molecule. 25. The composition of embodiment 24, wherein the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. 26. The composition of embodiments 17-25, wherein the RNA donor molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. 27. The composition of any one of embodiments 17 to 26, wherein the engineered small RNA molecule comprises a sequence derived or isolated from a U1 small nuclear RNA gene or variant. 28. The composition of any one of embodiments 17 to 27, wherein the engineered small RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene. 29. The composition of any one of embodiments 17 to 28, wherein the RNA donor molecule further comprises an untranslated region that enhances translation. 30. The composition of embodiment 29, wherein the translation enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), a triple helix derived from MALAT1, a PRE (HPRE) of Hepatitis B virus, and an iron-responsive element. 31. The composition of any one of embodiments 17 to 30, further comprising an RNA-binding protein that strengthens the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. 32. The composition of any one of embodiments 17 to 31, wherein the RNA donor molecule and the small nuclear RNA molecule are RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. 33. A composition comprising an RNA donor molecule, the composition comprising: (a) one or more replacement domains encoding operably linked therapeutic sequences; (b) one or more intron domains that facilitate RNA splicing of the replacement domains; and (c) one or more antisense domains that facilitate binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain that facilitates trans-splicing of the RNA donor molecule. 34. The composition of embodiment 33, wherein said engineered small nuclear RNA molecule is isolated or derived from a human small nuclear RNA gene. 35. The composition of embodiment 33 or 34, wherein the engineered small nuclear RNA domain is isolated or derived from a human small nuclear RNA gene. 36. The composition of embodiments 33-35, wherein the engineered small nuclear RNA domain is synthetic and binds to a component of the spliceosome. 37. The composition of embodiments 33 to 36, wherein the human small nuclear RNA genes are selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12. 38. The composition of embodiment 37, wherein the engineered small nuclear RNA domain comprises a sequence isolated or derived from a variant of the human U1 gene. 39. The composition of embodiment 37, wherein the engineered small nuclear RNA domain comprises a sequence derived from the human U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene. 40. The composition of embodiment 39, wherein the engineered small nuclear RNA domain is located less than 200 bases away from a splice donor site in the RNA donor molecule. 41. The composition of embodiment 40, wherein the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'. 42. The composition of embodiments 33-41, wherein the RNA donor molecule contains an RNA motif that is at least 4 nucleotides in length and is partially or completely complementary to a sequence in the RNA donor molecule. 43. The composition of embodiments 33-42, wherein the engineered small RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene or a variant of the U1 small nuclear RNA gene. 44. The composition of embodiments 33-43, wherein the engineered small RNA molecule comprises a sequence derived or isolated from the U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene. 45. The composition of embodiment 44, wherein the RNA donor molecule further comprises an untranslated region that enhances translation. 46. The composition of embodiment 45, wherein the translation enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE), a triple helix derived from MALAT1, a PRE (HPRE) of Hepatitis B virus, and an iron-responsive element. 47. The composition of any one of embodiments 17 to 46, further comprising an RNA-binding protein that strengthens the interaction between the RNA donor molecule and the target RNA molecule and enhances trans-splicing efficiency. 48. The composition of any one of embodiments 17 to 47, wherein the RNA donor molecule and the small nuclear RNA molecule are RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. 49. The composition of any one of embodiments 17 to 48, wherein the nucleic acid molecule further comprises a heterologous promoter. 50. A vector comprising a composition according to any one of embodiments 17 to 49. 51. The vector described in embodiment 50, wherein the vector is selected from the group consisting of adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticles, micelles, liposomes, lipoplexes, polymersomes, polyplexes, and dendrimers. 52. A cell comprising the vector described in embodiment 51. 53. A method for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a treatment comprising an RNA donor molecule and an engineered small nuclear RNA molecule according to embodiment 17 or embodiment 18. 54. A method for repairing a genetic defect in a subject, comprising administering to the subject an RNA donor molecule and an engineered small nuclear RNA molecule according to embodiments 17 to 49. 55. A method for treating a disease, comprising administering to a patient in need thereof a therapeutically effective amount of a treatment comprising an RNA donor molecule according to embodiments 17-49. 56. A method for repairing a genetic defect in a subject, comprising administering to the subject an RNA donor molecule described in embodiments 17 to 49.
[0196] definition Whenever the term "at least", "greater than", or "greater than or equal to" appears before the first number in a series of two or more numbers (after the last number), the term "at least", "greater than" or "greater than or equal to" applies to each number in the series. For example, 1, 2, or 3 or more is equivalent to 1 or more, 2 or more, or 3 or more.
[0197] Whenever the term "not greater than," "less than," or "less than or equal to" appears after the last number in a series of two or more numbers, the term "not greater than," "less than," or "less than or equal to" applies to each number in the series. For example, 3, 2, or 1 or less is equivalent to 3 or less, 2 or less, or 1 or less.
[0198] As used herein, the term "bond" may refer to a weak or strong interaction between two or more atoms or molecules. The interaction may be directly or indirectly mediated by one or more molecules. EXAMPLES
[0199] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
[0200] Example 1: Identification of engineered small nuclear RNAs This study evaluates the activity of engineered small nuclear RNAs in the context of RNA trans-splicing. First, we evaluated whether eight engineered small nuclear RNAs containing various sequences complementary to the RNA donor molecule could enhance the efficiency of RNA trans-splicing of the RNA donor molecule (Figure 6A-6B). These variant RNA donor molecules target a split GFP reporter and only fluoresce after successful trans-splicing with the RNA donor molecule (Figure 4A-4D, 5A-5D). This assay, although qualitative and not fully quantitative, is useful because it is often used by cell biology end users when trying to answer scientific questions regarding the presence, absence, or general extent of RNA. Thus, GFP trans-splicing reporters are widely used in the study of RNA trans-splicing technology. We used the GFP reporter to compare the relative impact of various trans-splicing enhancer sequences on the efficiency of the trans-splicing reaction.
[0201] AGAGCGCCCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCCATCACCCACGGCATGGATGAGCTGTACAAGTGA.
[0202] We next assessed whether the esnRNAs identified in Figures 6A-6B could promote high-fidelity RNA trans-splicing in the context of different reporter systems (Figure 7). In Figure 6A, we used a reporter containing sequences from the human COL17A1 gene, and in Figure 7, we used sequences from human SCN1A for the reporter. Thus, successful trans-splicing between these two targets indicates that this method has broad applicability to address many targets. We used a similar assay with a split GFP reporter that only fluoresces after successful trans-splicing of the RNA donor molecule. (Figures 5A-5D).
[0203]
[0204] We next assessed whether specific features of esnRNAs are required to enhance trans-splicing efficiency between the RNA donor and the target RNA. Starting with the esnRNA identified in Figure 6 (esnRNA B), we deleted or mutated various deleted or mutated portions of the esnRNA that interact with specific spliceosome components (Figure 8B). Specifically, we mutated various tem-loop structures that interact with spliceosome components to repeated regions of adenosines or deleted them. These data, reported in Figure 8A, indicate that recruitment of the spliceosome by esnRNAs is required for the observed enhanced trans-splicing activity.
[0205] The experiment to collect the data described in Figure 8A was carried out with three transient transfection components: reporter plasmid, RNA donor (also encoded on the plasmid and driven by the CMV promoter), and esnRNA B (encoded on the plasmid and driven by the native U1 promoter). Variants of esnRNA B lacking various features of wild-type human U1 snRNA were compared. The human cell line HEK293T was maintained at 37°C in 5% CO2 and plated at 300,000 cells per well of a 24-well plate. Cells were transfected with the above plasmids using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. Of the total plasmids transfected, 1 / 5 was the reporter, 1 / 5 was the RNA donor plasmid, 2 / 5 were the esnRNA plasmid, and 1 / 5 was a transfection control plasmid encoding the CMV promoter driving the expression of mCherry. 48 hours after transfection, cells were harvested and subjected to fluorescence measurements using fluorescence-activated cell sorting with a Sony Spectral Analyzer. Cells that were positive for mCherry signal were identified, and then the average values of GFP and mCherry signals in this population were evaluated. The GFP signal was normalized to the mCherry signal, and the results are reported in Figure 8. Deleting or mutating stem-loops 1, 2, or 4 dramatically reduced the GFP signal. This result indicates that recruitment of spliceosome components is a possible mechanism by which esnRNAs increase trans-splicing between the RNA donor and the target RNA. The complete sequences of the esnRNAs used in Figures 8A-8B areAs follows: esnRNA B:CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggtttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagactgtacgctaagggtcatatcttttttgtttggttgtgtcttggttggcgtctttaaatgttaatcctacagtggagggctgcggaataggaagtaacatgtcgcctgcacccataggagaaaaagcgagcatcagccgtatcggctttgtaacaacaaattagctatcgtgaagtccgctcag;esnRN A「mSL4」:CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtggggactgcgttcgcgcttAAAAAtgactttctggagtttcaaaag tagactgtacgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaagtaacatgtcgcctgcacgccataggaagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag、esnRNA "-SL4":CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtaactttctggagtttcaaaagtagactgtacgcta agggtcatatctttttttgtttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaagtaaca tgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag, esnRN A "-SL1, -SL2":CGAGCTCTCTgcaggggagataccaTggtggttttcccagggcgaggcttatatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttccctgactttctggagttttcaaaagtagactgta cgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaag taacatgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag. The reporter used in FIG. 8A contains (5'→3' direction) a CMV promoter, exon 81 of the human COL17A1 gene, intron 81 of the human COL17A1 gene, and the C-terminal portion of acGFP (127 amino acid residues). The sequence is as shown above.
[0206] Next, we evaluated the degree of reverse complementarity between esnRNA and the RNA donor molecule required to induce efficient trans-splicing. Figures 6A-8B show that recognition of the RNA donor by esnRNA and recruitment of spliceosome factors are necessary to induce efficient trans-splicing between the RNA donor and the target RNA. We then examined whether reducing the reverse complementarity between esnRNA B and the RNA donor molecule would also reduce the trans-splicing efficiency. esnRNA B contains a 10-nucleotide sequence complementary to the reporter. We created sequential mutations of esnRNA B with 9-nucleotide, 4-nucleotide, and 2-nucleotide sequences complementary to the reporter (Figure 9B). Indeed, reducing the degree of reverse complementarity simultaneously reduces the trans-splicing activity (Figure 9A). This result indicates that the association of esnRNA molecules with the RNA donor molecule is necessary to enhance the trans-splicing activity.
[0207] The experiments to collect the data described in Figures 9A-9B were carried out with three transient transfection components: reporter plasmid, RNA donor (also encoded on the plasmid and driven by the CMV promoter), and esnRNA B or various mutants (encoded on the plasmid and driven by the native U1 promoter). The human cell line HEK293T was maintained at 37 °C in 5% CO2 and plated at 300,000 cells per well of a 24-well plate. Cells were transfected with the above plasmids using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. Of the total plasmids transfected, 1 / 5 was the reporter, 1 / 5 was the RNA donor plasmid, 2 / 5 were the esnRNA plasmid, and 1 / 5 was a transfection control plasmid encoding the CMV promoter driving the expression of mCherry. 48 h after transfection, cells were harvested and subjected to fluorescence measurements using fluorescence-activated cell sorting with a Sony Spectral Analyzer. Cells that were positive for mCherry signal were identified and then the average GFP and mCherry signals of this population were evaluated. The GFP signal was normalized to the mCherry signal and the results are reported in Figure 9A. The complete sequence of the esnRNA used in Figure 9A is as follows: esnRNA B:CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcga tttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagact gtacgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaagt aacatgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag, esnRNA9b:GAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagactgtacgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaagtaacatgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag esnRNA 4b:aagaaaCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagactgtacgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaataggaagtaacatgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag esnRNA2b:aagaaaaaCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgc gatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagta gactgtacgctaagggtcatatctttttttgttttggtttgtgtcttggttggcgtcttaaatgttaatcctacagtggagggctgcggaatag gaagtaacatgtcgcctgcacgccataggagaaaaagcgagcatcagccgtatcggctttgtaacacaaattagctatcgtgaagtccgctcag. The reporter used in Figure 9 contains (in the 5' to 3' direction) a CMV promoter, exon 81 of the human COL17A1 gene, intron 81 of the human COL17A1 gene, and the C-terminal portion of acGFP (127 amino acid residues). The sequence is shown above.
[0208] Example 2: Use of esnRNA and RNA donor molecules to increase translation of specific target RNAs In addition to replacing specific mutated sequences in RNA with non-mutated sequences, another useful manipulation of target mRNA molecules is to increase the protein produced by the mRNA. Many attempts have been made to address this problem of insufficient protein production from specific mRNAs, but each approach has major drawbacks. Indeed, small molecule drugs that increase translation by promoting stop codon read-through suffer from extensive off-targets because they promote read-through of non-target mRNAs. Furthermore, premature stop codons are only one of many causes of insufficient protein levels. tRNAs engineered to block premature stop codons suffer from this same fundamental problem (WO2018 / 161032Al). In contrast, RNA trans-splicing systems can replace sequences in any target mRNA with translation-amplifying sequences to increase protein production. Efficient RNA trans-splicing mediated by intronic trans-splicing enhancing sequences (trans-splicing enhancer sequences) could address this long-desired but unmet need for a means to promote the targeted amplification of protein production from specific mRNAs.
[0209] Myotonic dystrophy is caused by RNAs with repetitive "CUG" regions that bind the splicing factor MBNL1. Titration of MBNL1 away from its typical targets leads to widespread dysfunction in RNA alternative splicing, which accounts for most disease manifestations in patients. Increasing MBNL1 protein production by an efficient RNA trans-splicing approach could produce enough MBNL1 protein to reconstitute its typical activity in alternative splicing control and address the disease.
[0210] To evaluate the ability of RNA trans-splicing systems containing trans-splicing enhancer sequences to increase protein production from specific mRNAs, we generated RNA trans-splicing systems with various cis-splicing enhancer sequences and the woodchuck hepatitis virus (WHV) posttranscriptional regulatory element (WPRE).We generated a reporter containing the sequence encoding firefly luciferase and the last two exons and intervening intron of MBNL1.
[0211] Experiments were performed with transiently transfected reporter, RNA donor, and either esnRNA or lentiviral packaged systems using the methods described in Example 1. Several translation-enhancing 3' sequences increased the amount of GFP reporter produced by the combination of RNA donor and esnRNA. The results are shown in Figure 10.
[0212] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be employed in the practice of the invention. The following claims define the scope of the invention, and it is intended to cover methods and structures within the scope of these claims and their equivalents.
Claims
1. A composition comprising or encoding an engineered small nuclear RNA (esnRNA) that promotes trans-splicing between a target RNA molecule and an RNA donor molecule, wherein the RNA donor molecule comprises (a) one or more replacement domains, (b) one or more intron domains, and (c) one or more antisense domains that bind to the target RNA molecule, and the esnRNA comprises an RNA motif that is (i) in the RNA donor molecule or (ii) complementary to the RNA donor molecule.
2. The composition of claim 1 , wherein the RNA donor molecule comprises the esnRNA as an esnRNA domain.
3. The composition of claim 1 , wherein the RNA donor molecule and the esnRNA are separate molecules.
4. 2. The composition of claim 1, wherein the engineered small nuclear RNA is derived or isolated from a human small nuclear RNA selected from the group consisting of U1, U2, U4, U5, U6, U7, U11, and U12, optionally wherein the engineered small nuclear RNA is derived or isolated from a U1 small nuclear RNA or a variant of U1 small nuclear RNA, optionally wherein the variant of U1 small nuclear RNA is selected from the group consisting of vU1.4, vU1.11, vU1.8, vU1.7, vU1.5, and vU1.
12.
5. 2. The composition of claim 1, wherein said RNA motif is at the 5' end of said engineered small nuclear RNA, and optionally said RNA motif begins less than 16 nucleobases from the 5' end of said engineered small nuclear RNA.
6. The composition of claim 1, wherein the RNA motif is partially or fully complementary to an esnRNA binding site in the one or more intron domains of the RNA donor molecule.
7. 10. The composition of claim 1, wherein the engineered small nuclear RNA comprises RNA, DNA, a DNA / RNA hybrid, a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
8. 2. The composition of claim 1, wherein the esnRNA or esnRNA binding site is located within the one or more intron domains and less than 200 bases away from a splice donor site in the RNA donor molecule.
9. The composition of claim 1, wherein the RNA motif is at least 4 nucleotides in length and is partially or completely complementary to the esnRNA binding site in the RNA donor molecule.
10. 2. The composition of claim 1, wherein the RNA motif is selected from the group consisting of 5'-CGAGCTCTCT-3', 5'-AACGAGCTCT-3', 5'-CGCAACGAGC-3', 5'-TATCGCAACG-3', 5'-AATAATATCG-3', 5'-TAAGAGAGCT-3', 5'-AAGAGAGCTC-3', 5'-AGAGAGCTCGTTGC-3', 5'-GAGAGCTCGT-3', 5'-AGAGCTCGTTGCGA-3', and 5'-GAGCTCGTTG-3'.
11. (i) the RNA donor molecule further comprises or encodes an untranslated region comprising a translation enhancing element, optionally wherein the translation enhancing element comprises a sequence derived or isolated from the group consisting of woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), a MALAT1-derived triple helix, a hepatitis B virus PRE (HPRE), and an iron-responsive element; (ii) the composition further comprises or encodes an RNA-binding protein that strengthens the interaction between the RNA donor molecule and the target RNA molecule, increasing trans-splicing efficiency; and / or (iii) The composition of claim 1, wherein the RNA donor molecule further comprises or encodes a heterologous promoter.
12. 12. A vector comprising the composition of any one of claims 1 to 11, optionally wherein the vector is selected from the group consisting of an adeno-associated virus, a retrovirus, a lentivirus, an adenovirus, a nanoparticle, a micelle, a liposome, a lipoplex, a polymersome, a polyplex, and a dendrimer.
13. A cell comprising the vector of claim 12.
14. 12. Use of a composition according to any one of claims 1 to 11 in the manufacture of a medicament for repairing a genetic defect in a subject in need thereof.
15. 12. Use of a composition according to any one of claims 1 to 11 in the manufacture of a medicament for treating a disease in a patient in need thereof.
16. 1. A method for in vitro or ex vivo trans-splicing, said method comprising: (i) an engineered nucleic acid encoding an RNA trans-splicing nucleic acid comprising an exon sequence, an intron domain, and an antisense domain; and (ii) a nucleic acid sequence encoding an engineered small nuclear RNA (esnRNA); contacting the cell with a composition comprising wherein when the composition is contacted with the cell, the engineered nucleic acid and the nucleic acid sequence encoding the esnRNA enter the cell, and the RNA trans-splicing nucleic acid and the esnRNA are produced within the cell; wherein the esnRNA comprises an RNA motif at the 5' end of the esnRNA, and the antisense domain in the RNA trans-splicing nucleic acid is complementary to a target RNA molecule in the cell, thereby causing the exon sequence to be trans-spliced into the target RNA molecule in the cell.
17. A kit for in vitro or ex vivo trans-splicing, said kit comprising: (i) an engineered nucleic acid encoding an RNA trans-splicing nucleic acid comprising an exon sequence, an intron domain, and an antisense domain; and (ii) comprises a nucleic acid sequence encoding an engineered small nuclear RNA (esnRNA); wherein the esnRNA comprises an RNA motif at the 5' end of the esnRNA, and the antisense domain in the RNA trans-splicing nucleic acid is complementary to a target RNA molecule in the cell, thereby causing the exon sequence to be trans-spliced into the target RNA molecule in the cell.
18. A composition comprising or encoding an engineered small nuclear RNA that promotes trans-splicing between a target RNA molecule and an RNA donor molecule.
19. 1. A composition comprising or encoding an engineered small nuclear RNA that promotes trans-splicing between a target RNA molecule and an RNA donor molecule, wherein the RNA donor molecule comprises: (a) one or more replacement domains encoding an operably linked therapeutic sequence; (b) one or more intron domains that promote RNA splicing of the replacement domains; and (c) one or more antisense domains that promote binding to a target RNA molecule.
20. 20. The composition of claim 18 or 19, wherein the RNA donor molecule comprises an engineered small nuclear RNA domain.
21. Use of a vector described in claim 12 in the manufacture of a pharmaceutical for repairing a genetic defect in a subject in need of such repair.
22. Use of the cells described in claim 13 in the manufacture of a pharmaceutical for repairing a genetic defect in a subject in need of repair of the genetic defect.
23. Use of the vector of claim 12 in the manufacture of a pharmaceutical for treating a disease in a patient in need thereof.
24. Use of the cells of claim 13 in the manufacture of a pharmaceutical for treating a disease in a patient in need thereof.
25. A composition described in any one of claims 1 to 11 for repairing a genetic defect in a subject in need of such repair.
26. A composition comprising the vector described in claim 12 for repairing a genetic defect in a subject in need of repair of the genetic defect.
27. A composition comprising the cells described in claim 13 for repairing a genetic defect in a subject in need of repair of the genetic defect.
28. A composition according to any one of claims 1 to 11 for treating a disease in a patient in need thereof.
29. A composition comprising the vector of claim 12 for treating a disease in a patient in need thereof.
30. A composition comprising the cells of claim 13 for treating a disease in a patient in need of such treatment.