Engineering cells for cell-based therapies and related compositions and methods

JP2024534003A5Pending Publication Date: 2025-08-20SANA BIOTECHNOLOGY INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024508436
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-11
Filing Date
2022-08-11
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Allogeneic cell therapy is limited by the need for blood group matching to avoid graft rejection and immune reactions, as the presence of blood typing antigens can trigger an immune response in recipients.

Method used

Genetic manipulation of cells to knock out or down genes associated with blood type, such as ABO, FUT1, and RHD, using site-specific nucleases like CRISPR/Cas systems, to alter the blood type and reduce immunogenicity.

Benefits of technology

This approach enhances the safety and efficacy of allogeneic cell therapy by reducing the risk of immune rejection and allowing universal donor compatibility, enabling the use of cells with altered blood types that are less immunogenic.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Methods are provided for genetically modifying cells to knock out or modify one or more genes associated with blood group, e.g., ABO, FUT1, RHD. Also provided are cells and compositions derived therefrom, and methods of use thereof to treat various human diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 232,142, filed August 11, 2021, the contents of which are incorporated by reference in their entirety. Summary of the Invention

[0002] A new cell therapy approach called adoptive cell transfer (ACT) is rapidly changing the landscape of human disease treatment. In ACT, cells are taken from the patient (autologous) or a healthy donor (allogeneic), these cells are manipulated (e.g., by genetic, mRNA, or protein modifications), and the cells are transplanted into the patient to fight disease. One of the complications of allogeneic therapy is that it requires blood type matching between the donor and the recipient. Blood type is determined by the presence or absence of certain antigens on the surface of red blood cells (RBCs) and many other cells in the body. The presence of these antigens can trigger an attack of the injected cells by the recipient's immune system, so safe and effective allogeneic therapy relies on blood type matching.

[0003] As of 2019, a total of 41 human blood group systems have been recognized by the International Society of Blood Transfusion (ISBT). The two most commonly referenced blood group systems are ABO and Rh. The presence or absence of A and B antigens determines the four main blood types (A, B, AB, and O). In addition to the A and B antigens, the Rh factor can be either present (+) or absent (-), which creates the eight most common blood types (A+, A-, B+, B-, AB+, AB-, O+, and O-). Some of the blood group determining antigens are controlled by a single gene.

[0004] The presence of blood group determining antigens is usually associated with the absence of antibodies against those antigens in the subject's plasma, thereby preventing potential agglutination reactions. Thus, for allogeneic therapy, blood group compatibility is important to avoid graft rejection and other undesirable immune reactions. Because individuals with type O do not have A, B, or Rh antigens on the surface of their cells, such individuals are usually referred to as universal donors for any recipient with any blood type.

[0005] The present technology provides methods for genetically engineering cells to knock out, knock down, or otherwise alter one or more genes associated with blood group, e.g., ABO, FUT1, RHD, to improve the efficacy and safety of allogeneic cell therapy. Also provided herein are cells and compositions derived therefrom, as well as methods of use thereof to treat various human diseases.

[0006] In some aspects, methods are provided for genetically modifying one or more genes associated with blood group in a cell, the methods comprising introducing into the cell a site-specific nuclease or a nucleotide sequence encoding a site-specific nuclease, wherein the one or more genes associated with blood group are selected from the group consisting of ABO, FUT1, and RHD. In some embodiments, the methods further comprise introducing into the cell a guide RNA (gRNA) targeting the ABO, FUT1, or RHD locus.

[0007] In some aspects, a gRNA is provided for use in genetically modifying one or more genes associated with blood type in a cell, wherein the one or more genes associated with blood type are selected from the group consisting of ABO, FUT1, and RHD.

[0008] In some embodiments, the site-specific nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, CRISPR-associated transposases, and CRISPR / Cas nucleases.

[0009] In some embodiments, the site-specific nuclease is Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12j, Cas12k ... A CRISPR / Cas nuclease selected from the group consisting of as12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7.

[0010] In some embodiments, the gRNA comprises a CRISPR RNA (crRNA) and optionally a trans-activating CRISPR RNA (tracrRNA). In some embodiments, the gRNA comprises a crRNA and a tracrRNA as two separate molecules. In some embodiments, the gRNA comprises a crRNA and a tracrRNA as a single guide RNA (sgRNA). In some embodiments, the sgRNA comprises a complementary region, a crRNA repeat region, a tetraloop, and a tracrRNA.

[0011] In some embodiments, the crRNA repeat region comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:18. In some embodiments, the tetraloop comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:6 or SEQ ID NO:17. In some embodiments, the tracrRNA comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:15, or SEQ ID NO:16.

[0012] In some embodiments, the crRNA comprises a complementary region specific to a region of the ABO locus, including, for example, a coding sequence (CDS), an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region. In some embodiments, the complementary region comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 20-203.

[0013] In some embodiments, the crRNA comprises a complementary region specific to a region of the FUT1 locus, including, for example, a CDS, an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region. In some embodiments, the complementary region comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 204-420.

[0014] In some embodiments, the crRNA comprises a complementary region specific to a region of the RHD locus, including, for example, a CDS, an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region. In some embodiments, the complementary region comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 421-580.

[0015] In some embodiments, the genetic modification occurs via non-homologous end joining (NHEJ). In some embodiments, the genetic modification occurs via homology-directed repair (HDR). In some embodiments, the genetic modification includes both HDR-induced and NHEJ-induced modifications.

[0016] In some embodiments, a composition is provided that comprises a gRNA according to various embodiments of the present technology. In some embodiments, the composition further comprises a nucleotide sequence encoding a site-specific nuclease or a site-specific nuclease protein as described herein.

[0017] In some embodiments, a composition comprising a gRNA according to various embodiments of the present technology is formulated for delivery into a cell. In some embodiments, the cell further comprises a nucleotide sequence encoding a site-specific nuclease or a site-specific nuclease protein as described herein.

[0018] In some aspects, a method of identifying a new genomic locus for genetically modifying one or more genes associated with blood group in a cell is provided, the method comprising: (a) locating the genomic locus based on a known gRNA; and (b) scanning a region of about 500-4000 bp on each side of the genomic locus for a PAM sequence, where the one or more genes associated with blood group are selected from the group consisting of ABO, FUT1, and RHD. In some embodiments, the known gRNA targets the ABO, FUT1, or RHD locus. In some embodiments, the gRNA comprises a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 20-580.

[0019] In some aspects, various embodiments of the technology provide cells with one or more genes associated with genetically modified blood types. In some embodiments, the cells are autologous cells. In some embodiments, the cells are allogeneic cells. In some embodiments, the cells are pluripotent stem cells, embryonic stem cells (ESCs), or induced pluripotent stem cells (iPSCs). In some embodiments, the cells are differentiated from pluripotent stem cells (e.g., ESCs or iPSCs). In some embodiments, the cells are primary cells. In some embodiments, the cells are blood cells, such as red blood cells, platelet cells, mast cells, basophils, eosinophils, neutrophils, monocytes, natural killer (NK) cells, natural killer T (NKT) cells, macrophages, T cells, B cells, or plasma cells. In some embodiments, the cells are T cells, NK cells, or NKT cells. In some embodiments, the cells are cardiomyocytes. In some embodiments, the cells are retinal pigment epithelial cells (RPE). In some embodiments, the cell is an endothelial cell. In some embodiments, the cell is a β islet cell. In some embodiments, the cell is a glial precursor cell (GPC).

[0020] In some embodiments, the cells are modified to reduce expression of one or more MHC I molecules and / or one or more MHC II molecules, optionally wherein the one or more MHC I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, and optionally wherein the one or more MHC II molecules are selected from the group consisting of HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO. In some embodiments, the modification is by modulation of the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci. In some embodiments, modulation of the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci comprises a B2M, TAP1, CIITA, MIC-A, and / or MIC-B knockout. In some embodiments, modulation of the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci comprises knock-in of a transgene at the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci.

[0021] In some embodiments, the transgene encodes one or more tolerogenic factors selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fe receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, SERPINB9, CCL21, and MFGE8. In some embodiments, the one or more tolerogenic factors comprise CD47, e.g., human CD47. In some embodiments, the human CD47 comprises an amino acid sequence that is at least 80% identical to an amino acid sequence set forth in any one of SEQ ID NOs: 583-588. In some embodiments, the human CD47 comprises an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in SEQ ID NO:584. In some embodiments, the one or more tolerogenic factors comprises HLA-E. In some embodiments, the one or more tolerogenic factors comprises CD24. In some embodiments, the one or more tolerogenic factors comprises PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD24, CD47, and PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD46. In some embodiments, the one or more tolerogenic factors comprise CD55. In some embodiments, the one or more tolerogenic factors comprise CD59. In some embodiments, the one or more tolerogenic factors comprise C1 inhibitor. In some embodiments, the one or more tolerogenic factors comprise CD46, CD55, CD59, and C1 inhibitor. In some embodiments, the one or more tolerogenic factors include HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor.

[0022] In some embodiments, the cells are modified to have reduced expression of one or more MHC I molecules and / or one or more MHC II molecules; increased expression of CD47, and optionally CD24 and PD-L1; and increased expression of CD46, CD55, CD59, and CR1.

[0023] In some embodiments, the cells are modified to have reduced expression of one or more MHC I molecules; reduced expression of TXNIP; increased expression of PD-L1 and HLA-E; and optionally increased expression of A20 / TNFAIP3 and / or MANF.

[0024] In some embodiments, the cells are modified to increase expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8.

[0025] In some aspects, pharmaceutical compositions are provided that include cells having one or more genes associated with blood type genetically modified according to various embodiments of the present technology.

[0026] In some aspects, methods of treating a disease in a subject in need thereof are provided, the methods comprising administering to the subject cells having one or more genes associated with blood type genetically modified according to various embodiments of the present technology, or a pharmaceutical composition comprising the same.

[0027] In some embodiments, the disease is cancer, e.g., a hematological malignancy. In some embodiments, the hematological malignancy is selected from the group consisting of myeloid neoplasms, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), B-cell acute lymphocytic leukemia (B-ALL), T-cell acute lymphocytic leukemia (T-ALL), T-cell lymphoma, and B-cell lymphoma.

[0028] In some embodiments, the disease is an autoimmune disease, such as lupus, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, psoriatic arthritis, multiple sclerosis, Crohn's disease, ulcerative colitis, Addison's disease, Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, and celiac disease.

[0029] In some embodiments, the disease is diabetes mellitus, including type I diabetes, type II diabetes, prediabetes, and gestational diabetes.

[0030] In some embodiments, the disease is a neurological disease, such as catalepsy, epilepsy, encephalitis, meningitis, migraine, Huntington's disease, Alzheimer's disease, Parkinson's disease, Pelizaeus-Merzbacher disease, and multiple sclerosis.

[0031] In some embodiments, the disease is a cardiac disease, e.g., childhood cardiomyopathy, age-related cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, chronic ischemic cardiomyopathy, peripartum cardiomyopathy, inflammatory cardiomyopathy, idiopathic cardiomyopathy, other cardiomyopathies, myocardial ischemia-reperfusion injury, ventricular dysfunction, heart failure, congestive heart failure, coronary artery disease, end-stage heart disease, atherosclerosis, ischemia, hypertension, restenosis, angina, rheumatic heart, arterial inflammation, cardiovascular disease. , myocardial infarction, myocardial ischemia, congestive heart failure, myocardial infarction, cardiac ischemia, cardiac trauma, myocardial ischemia, vascular disease, acquired heart disease, congenital heart disease, atherosclerosis, coronary artery disease, dysfunctional conduction system, dysfunctional coronary arteries, pulmonary hypertension, cardiac arrhythmias, muscular dystrophies, abnormal muscle mass, muscle degeneration, myocarditis, infectious myocarditis, drug or toxin induced muscle abnormalities, hypersensitivity myocarditis, cardiac hypertrophy, mitral regurgitation, and autoimmune endocarditis. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] The present technology provides methods for engineering cells (including by gene editing) to alter the expression of one or more genes associated with blood group, such as ABO, FUT1, and / or RHD. Also provided are site-specific nucleases and guide RNAs for use in these methods, as well as compositions and vectors thereof. Additionally, the present technology provides genetically modified cells and cell populations generated using these gene editing methods, as well as methods of using these cells and cell populations to treat various human diseases.

[0033] While the present disclosure can be implemented in various forms, the following description of some embodiments is provided with the understanding that the disclosure should be considered as an example of the present invention and is not intended to limit the present invention to the specific embodiments shown. Each heading is provided for convenience only and should not be construed as limiting the present invention in any manner. An embodiment shown under any heading may be combined with an embodiment shown under any other heading.

[0034] The use of numerical values ​​in the various quantitative values ​​specified herein, unless expressly indicated otherwise, is described as an approximation, as if the word "about" were placed before both the minimum and maximum values ​​in the described range. It should be understood that, although not always explicitly stated, all numerical designations are preceded by the word "about". It should be understood that such range formats are used for convenience and brevity, and should be interpreted flexibly to include not only the numerical values ​​explicitly stated as limits of a range, but also all of the individual numerical values ​​and subranges encompassed within the range, as if each numerical value and subrange were explicitly stated. For example, a ratio in the range of about 1 to about 200 should be understood to include not only the explicitly stated limits of about 1 and about 200, but also individual ratios such as about 2, about 3, and about 4, as well as subranges such as about 10 to about 50, about 20 to about 100, etc. It should also be understood, although not always explicitly stated, that the reagents described herein are merely exemplary, and equivalents thereof are known in the art.

[0035] To the extent that any material incorporated by reference herein conflicts with the present disclosure, the present disclosure controls.

[0036] definition The term "about" as used herein when referring to a measurable value, such as an amount or concentration, is intended to encompass a variation of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

[0037] The term "antibody" is used to refer to naturally occurring antibodies as well as genetically engineered or otherwise modified forms of immunoglobulins or portions thereof, including chimeric, human, humanized, or synthetic antibodies. Antibodies may be monoclonal or polyclonal. In embodiments where the antibody is an immunogenically active portion of an immunoglobulin molecule, the antibody may include, but is not limited to, single chain variable fragment antibodies (scFv), disulfide-linked Fv, single domain antibodies (sdAb), VHH antibodies, antigen-binding fragments (Fab), Fab', F(ab')2 fragments, or diabodies. scFv antibodies are derived from antibodies by linking the variable regions of the immunoglobulin heavy (VH) and light (VL) chains with a short linker peptide. Similarly, disulfide-linked Fv antibodies can be generated by linking the VH and VL using an interdomain disulfide bond. In contrast, sdAbs consist only of the variable regions of either the heavy or light chains and are usually the smallest antigen-binding fragments of antibodies. VHH antibodies are antigen-binding fragments of only the heavy chains. Diabodies are dimers of scFv fragments consisting of VH and VL regions non-covalently linked by a small peptide linker or covalently linked to each other. The antibodies disclosed herein, including those comprising immunogenically active portions of immunoglobulin molecules, retain the ability to bind to a specific antigen.

[0038] The term "antigen" refers to an immunogenic molecule that elicits an immune response. This immune response may involve antibody production, activation of specific immunocompetent cells, or both. Antigens may be, for example, peptides, glycopeptides, polypeptides, glycopolypeptides, polynucleotides, polysaccharides, lipids, and the like. It is readily apparent that antigens may be synthetically produced, recombinantly produced, or derived from biological samples. Exemplary biological samples that may contain one or more antigens include tissue samples, tumor samples, cells, biological fluids, or combinations thereof. Antigens may also be produced by cells that have been modified or engineered to express the antigen.

[0039] The term "autoimmune disease", "autoimmune disorder", "inflammatory disease" or "inflammatory disorder" refers to any disease or disorder in which a subject mounts an immune response against its own tissues and / or cells. Autoimmune disorders can affect nearly every organ system in a subject (e.g., a human), including, but not limited to, diseases of the nervous system, gastrointestinal system, and endocrine system, as well as skin and other connective tissues, eyes, blood and blood vessels. Examples of autoimmune diseases include, but are not limited to, Hashimoto's thyroiditis, systemic lupus erythematosus, Sjogren's syndrome, Graves' disease, scleroderma, rheumatoid arthritis, multiple sclerosis, myasthenia gravis, and diabetes.

[0040] The term "codon-optimized" or "codon optimization" when referring to a nucleotide sequence is based on the discovery that the frequency of occurrence of synonymous codons (i.e., codons that code for the same amino acid) in coding nucleotides is biased in different species. Due to such codon degeneracy, the same polypeptide can be encoded by various nucleotide sequences. Codon optimization refers to the process of replacing certain codons in a coding nucleotide sequence with synonymous codons based on the preferences of the host cell without changing the resulting polypeptide sequence. Various codon optimization methods are known in the art, including, for example, at least those disclosed in U.S. Pat. Nos. 5,786,464 and 6,114,148.

[0041] The term "construct" refers to any polynucleotide that contains a recombinant nucleic acid molecule. The construct may be in a vector (e.g., bacterial vector, viral vector) or integrated into a genome. A "vector" is a nucleic acid molecule that can introduce a specific nucleic acid sequence into a cell or another nucleic acid sequence, or as a means of transporting another nucleic acid molecule. A vector can be, for example, a plasmid, a cosmid, a virus, an RNA vector, or a linear or circular DNA or RNA molecule that can include chromosomal, non-chromosomal, semisynthetic, or synthetic nucleic acid molecules. Exemplary vectors are vectors capable of autonomous replication (episomal vectors), vectors capable of delivering a polynucleotide to a cell genome (e.g., viral vectors), or vectors capable of expressing a nucleic acid molecule to which the vector is linked (expression vectors).

[0042] The term "expression" refers to the process by which a polypeptide is produced based on a coding sequence of a nucleic acid molecule, such as a gene. This process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof. An expressed nucleic acid molecule is typically operably linked to an expression control sequence (e.g., a promoter).

[0043] The terms "hypoimmunogenic", "hypoimmunogenic", "hypoimmunogenic", "hypoimmune", or "hypoimmune" are used interchangeably to describe cells that are less susceptible to immune rejection by a subject into which such cells are transplanted. For example, compared to unaltered or unmodified wild-type cells, such hypoimmunogenic cells may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99% or more less susceptible to immune rejection by a subject into which such cells are transplanted. In some examples described herein, genome editing techniques are used to modulate the expression of MHC I and MHC II genes, thereby generating hypoimmunogenic cells. In other examples described herein, tolerogenic factors are introduced into cells, which, when expressed, may modulate or affect the ability of the cells to be recognized by the host immune system, thereby conferring hypoimmunogenicity. The low immunogenicity of a cell can be determined by evaluating the ability of the cell to induce adaptive and innate immune responses. Such immune responses can be measured, for example, by measuring the effect of the low immunogenic cells on T cell proliferation, T cell activation, T cell killing, NK cell proliferation, NK cell activation, and macrophage activity using assays recognized by those skilled in the art. The low immunogenic cells can be reduced in killing by T cells and / or NK cells or reduced in phagocytosis by macrophages when administered to a subject, compared to unmodified or wild-type cells. In some cases, the low immunogenic cells induce a reduced or attenuated immune response in a recipient subject compared to the corresponding unmodified wild-type cells. In some cases, the low immunogenic cells are non-immunogenic or fail to induce an immune response in a recipient subject.Detailed descriptions of the hypoimmunogenic cells, methods for their production, and methods for their use can be found in WO2016183041 filed May 9, 2015, WO2018132783 filed January 14, 2018, WO2018176390 filed March 20, 2018, WO2020018615 filed July 17, 2019, WO2020018620 filed July 31, 2020, and WO2020018631 filed July 17, 2019. No. 6,393,941, filed on Jul. 31, 2020, WO2021022223, filed on Aug. 24, 2020, WO2021041316, filed on Apr. 27, 2020, and WO2021222285, filed on Apr. 27, 2021, the disclosures of which, including the examples, sequence listings, and figures, are incorporated by reference in their entireties.

[0044] The term "nucleic acid" or "polynucleotide" refers to a polymeric compound comprising covalently linked nucleotides containing naturally occurring subunits (e.g., purine or pyrimidine bases). Purine bases include adenine and guanine, while pyrimidine bases include uracil, thymine, and cytosine. Nucleic acid molecules include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), where DNA includes cDNA, genomic DNA, and synthetic DNA, any of which may be single-stranded or double-stranded. A nucleic acid molecule that encodes an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence.

[0045] The term "subject" refers to a mammalian subject, preferably a human. A "subject in need thereof" may refer to a subject who has been diagnosed with a disease or is at high risk of developing a disease. The terms "subject" and "patient" are used interchangeably herein.

[0046] As used herein, a "therapeutically effective amount" is an amount that produces a desired effect in a subject in treating a disease. In certain embodiments, a therapeutically effective amount is an amount that produces a maximum therapeutic effect. In other embodiments, a therapeutically effective amount produces a therapeutic effect that is less than the maximum therapeutic effect. For example, a therapeutically effective amount can be an amount that produces a therapeutic effect while avoiding one or more side effects associated with a dosage that produces a maximum therapeutic effect. The therapeutically effective amount of a particular composition will vary based on a variety of factors, including, but not limited to, the characteristics of the therapeutic composition (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological state of the subject (e.g., age, weight, sex, type and stage of disease, medical history, general physical condition, responsiveness to a given dosage, and other current medications), the nature of the pharmacologic carriers, excipients, and preservatives in the composition, and the route of administration. Those skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, i.e., by monitoring the subject's response to administration of the therapeutic composition and adjusting the dosage accordingly. For further guidance, see Remington: The Science and Practice of Pharmacy, 22 nd Edition, Pharmaceutical Press, London, 2012 and Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12 th Edition, McGraw-Hill, New York, NY, 2011, the entire disclosure of which is incorporated herein by reference.

[0047] As used herein, the term "tolerogenic factors" includes hypoimmune factors, complement inhibitors, and other factors that modulate or affect the ability of cells to be recognized by the immune system of the host or recipient subject upon administration, transplantation, or engraftment.

[0048] The terms "treat", "treating" and "treatment" as used herein with respect to disease refer to partially or completely alleviating a disease, preventing a disease, reducing the likelihood of disease onset or recurrence, slowing the progression or onset of a disease, eliminating, reducing or slowing the onset of one or more symptoms associated with a disease, or increasing progression-free or overall survival of a disease. For example, "treating" may refer to preventing or slowing an existing disease from progressing and / or slowing the onset of certain symptoms of a disease. In some embodiments, the terms "treat", "treating" or "treatment" refer to a subject having a less severe disease compared to a subject not receiving treatment. In some embodiments, the terms "treat", "treating" or "treatment" refer to a subject receiving a treatment as disclosed and described herein having one or more symptoms of a disease alleviated compared to a subject not receiving such treatment.

[0049] A "vector" refers to a DNA construct containing a nucleic acid molecule operably linked to a suitable control sequence capable of causing expression of the nucleic acid molecule in a suitable host. Such control sequences may include a promoter to cause transcription, an optional operator sequence to control such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and sequences that control the termination of transcription and translation. A vector may be a plasmid, a phage particle, a virus, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or in some cases, may be integrated into the genome itself.

[0050] How to genetically engineer cells Certain embodiments are provided herein methods of genetically engineering a cell or cell population to knock out, knock down, or otherwise alter the expression of one or more genes associated with blood groups, including, but not limited to, ABO, FUT1, and RHD. As used herein, "knock out" includes deleting all or a portion of a target nucleotide sequence to prevent the function of the target gene. For example, knock out can be achieved by altering a target nucleotide sequence by inducing an indel in a functional domain (e.g., a DNA binding domain) of the target nucleotide sequence, or by using base editing or prime editing to alter a genomic sequence to change a single nucleic acid base to an alternative base. "Knock down" refers to a genetic modification that results in a reduction in the expression of the edited gene. As used herein, "indel" refers to a mutation resulting from the insertion, deletion, or combination thereof of a nucleotide base in a genome. Thus, an indel typically inserts or deletes a nucleotide from a sequence. As will be appreciated by those skilled in the art, an indel in a coding region of a genomic sequence will result in a frameshift mutation unless the length of the indel is a multiple of three. The gene editing systems of the present disclosure, e.g., CRISPR / Cas systems, can be used to induce indels of any length in a target polynucleotide sequence.

[0051] In certain embodiments, the method provided herein utilizes gene editing.Gene editing is a type of genetic engineering that can insert, delete, modify or replace nucleotide sequence in the genome of living organisms.Current gene editing techniques generally utilize the inherent mechanism that cells use to repair double-strand breaks (DSBs) in DNA.

[0052] Eukaryotic cells repair DSBs by two primary repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). HDR typically occurs in late S or G2 phase, when sister chromatids are available to serve as repair templates. NHEJ is more common and can occur in any phase of the cell cycle, but is more error-prone. In gene editing, NHEJ is commonly used to create insertion / deletion mutations (indels), which can shift the open reading frame (ORF) and cause changes in the coding region or associated regulatory regions, resulting in targeted loss of function in the target gene. In contrast, HDR is the preferred pathway to create targeted knock-ins, knock-outs, or insertions of specific mutations in the presence of a repair template with homologous sequences. For example, several methods are known to those skilled in the art to improve the efficiency of HDR, including chemical regulation (e.g., treating cells with inhibitors of key enzymes in the NHEJ pathway), timed delivery of gene editing systems to the S and G2 phases of cell cycle, arresting cell cycle at the S and G2 phases, and introducing repair templates with homologous sequences.The methods provided herein may utilize HDR-mediated repair, NHEJ-mediated repair, or a combination thereof.

[0053] A. Gene Editing Systems In some embodiments, the methods provided herein for genetically modifying a cell or cell population to knock out, knock down, or otherwise modify one or more genes utilize site-specific nucleases, including, for example, prime editing, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeat (CRISPR) / Cas systems.

[0054] 1. Prime and PASTE Editing Prime editing is a versatile and precise genome editing method that uses a catalytically impaired Cas9 endonuclease fused to an engineered reverse transcriptase programmed with a prime editing guide RNA (pegRNA) that specifies the target site and codes for the desired edit to write new genetic information directly into a designated DNA site. See, e.g., Anzalone et al., Nature, 576:149-157 (2019), WO2021072328, WO2022067130, all of which are incorporated by reference in their entirety. Cas9 and reverse transcriptase can also be used to insert an integrase site into the genome for insertion of a nucleic acid of interest in a process called Programmable Addition via Site-specific Targeting Elements (PASTE) editing. See, e.g., Loannidi et al., bioRxiv 2021.11.01.466786; doi.org / 10.1101 / 2021.11.01.466786, all of which are incorporated by reference in their entireties.

[0055] 2.ZFN ZFNs are fusion proteins that contain numerous site-specific DNA binding domains adapted from zinc finger-containing transcription factors bound to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA binding or zinc finger domains. See, for example, Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions, and typically recognizes a 3-4 bp DNA sequence. Tandem domains may therefore potentially bind long nucleotide sequences that are unique within the genome of a cell.

[0056] Various zinc fingers with known specificity can be combined to generate multi-finger polypeptides that recognize sequences of about 6, 9, 12, 15, or 18 bp. A variety of selection and modular assembly techniques are available for generating zinc fingers (and combinations thereof) that recognize specific sequences, including fuzzy display, yeast one-hybrid system, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to a predefined nucleic acid sequence. The criteria for engineering zinc fingers to bind to a predefined nucleic acid sequence are known in the art. See, for example, Sera et al., Biochemistry (2002) 41: 7074-7081, Liu et al., Bioinformatics (2008) 24: 1850-1857.

[0057] ZFNs containing FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences located on either side of the site, one on the forward strand and the other on the reverse strand. When the ZFNs bind on either side of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to induce a specific mutation with the aid of a repair template containing the desired mutation flanked by homology arms. The repair template is usually an exogenous double-stranded DNA vector that is introduced into the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.

[0058] 3. TALEN TALENs are another example of artificial nucleases that can be used to edit target genes. TALENs are derived from a DNA-binding domain called a TALE repeat, which usually contains a tandem array with 10-30 repeats that bind and recognize long DNA sequences. Each repeat is 33-35 amino acids long, of which two adjacent amino acids (called repeat-variable di-residues or RVDs) confer specificity for one of four DNA base pairs. Thus, there is a one-to-one correspondence between repeats and base pairs in the target DNA sequence.

[0059] TALENs are artificially produced by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) to a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations have been made to FokI for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39: e82; Miller et al., Nature Biotech. (2011) 29: 143-148; Hockemeyer et al., Nature Biotech. (2011) 29: 731-734; Wood et al., Science (2011) 333: 307; Doyon et al., Nature Methods (2010) 8: 74-79; Szczepek et al., Nature Biotech (2007) 25: 786-793; Guo et al., J. Mol. Biol. (2010) 200: 96. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains in the proper orientation and spacing for sites in the target genome. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain, and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29: 143-148.

[0060] By combining engineered TALE repeats with nuclease domains, site-specific nucleases can be produced that are specific to any desired DNA sequence.Similar to ZFNs, TALENs can be introduced into cells to generate DSBs at desired target sites in genomes, and can be used to knock out genes or knock in mutations in a similar HDR-mediated pathway.See Boch, Nature Biotech. (2011) 29: 135-136; Boch et al., Science (2009) 326: 1509-1512; Moscou et al., Science (2009) 326: 3501.

[0061] 4. Meganuclease Meganucleases are enzymes in the endonuclease family that are characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). Meganucleases are grouped into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best known meganucleases are proteins in the LAGLIDADG family, which owe their name to a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. In contrast, GIY-YIG family members have the GIY-YIG module, which is 70-100 residues long and contains four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. The His-Cys family of meganucleases is characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0062] Because of the low probability of identifying a natural meganuclease for a specific target DNA sequence due to the high specificity requirements, various methods, including mutagenesis and high-throughput screening methods, have been used to generate meganuclease variants that recognize unique sequences. For example, strategies are known in the art for engineering meganucleases with altered DNA binding specificity to bind to a given nucleic acid sequence. For example, Chevalier et al., Mol. Cell. Cell. (2002) 10:895-905, Epinat et al., Nucleic Acids Res (2003) 31:2952-2962, Silva et al., J Mol. Biol. (2006) 361:744-754, Seligman et al., Nucleic Acids Res(2002)30:3870-3879, Sussman et al.,J Mol Biol(2004)342:31-41, Doyon et al.,J Am Chem Soc(2006)128:2477-2484, Chen et al.,Protein Eng Des Sel(2009)22:249-256, Arnould et al.,J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0063] Similar to ZFN and TALEN, meganuclease can create DSB in genomic DNA, which can create frameshift mutation when improperly repaired, for example, via NHEJ, leading to reduced expression of target gene in cell. Alternatively, foreign DNA can be introduced into cell in addition to meganuclease. Depending on the sequence of foreign DNA and chromosomal sequence, this process can be used to modify target gene. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0064] 5. Transposase Transposase is an enzyme that binds to the ends of transposons and catalyzes their movement to another part of the genome by a cut-and-paste mechanism or replicative transposition mechanism. By coupling transposase with other systems, such as the CRISPR / Cas system, new gene editing tools can be developed that allow site-specific insertion or manipulation of genomic DNA. There are two known DNA integration methods using transposons, using catalytically inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSBs in the genome, which may ensure safer and more specific DNA integration.

[0065] 6. CRISPR / Cas The CRISPR system was originally discovered in prokaryotes (e.g., bacteria and archaea) as a system involved in defense against invading phages and plasmids, providing a form of adaptive immunity. It has now been adapted and used as a widespread gene editing tool in research and clinical applications.

[0066] CRISPR / Cas systems generally include at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB at the target site. CRISPR-Cas systems fall into two major classes: Class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids, and Class 2 systems use a single large Cas protein for the same purpose. Class 1 is classified into types I, III, and IV, and Class 2 is classified into types II, V, and VI. The different Cas proteins that have been adapted for gene editing applications include Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, These include, but are not limited to, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. See, for example, Jinek et al., Science (2012) 337 (6096): 816-821; Dang et al., Genome Biology (2015) 16: 280; Ran et al., Nature (2015) 520: 186-191; Zetsche et al., Cell (2015) 163: 759-771; Strecker et al., Nature Comm. (2019) 10: 212; Yan et al., Science (2019) 363: 88-91. The most widely used Cas9 is a type II Cas protein, and is described herein by way of illustrative example. These Cas proteins may originate from different source species. For example, Cas9 may be derived from S. pyogenes or S. aureus.

[0067] Within the original microbial genome, the type II CRISPR system incorporates sequences from the invading DNA between CRISPR repeat sequences encoded as an array in the host genome. Transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which internalizes a portion of the CRISPR repeats as well as a variable sequence transcribed from the invading DNA known as a "protospacer" sequence. Each crRNA hybridizes to a second trans-activating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA guides the Cas9 complex to cleave complementary target DNA sequences, provided they are adjacent to a short sequence known as a "protospacer adjacent motif" (PAM).

[0068] While the above description has focused on the Cas9 nuclease, it should be understood that there are other RNA-guided nucleases that utilize gRNAs that differ in some respects from those described thus far. For example, Cpf1 (CRISPR from Prevotella and Franciscella 1; also known as Cas12a) is an RNA-guided nuclease that requires only crRNA and not tracrRNA to function.

[0069] Since its discovery, the CRISPR system has been adapted to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In its use in gene editing applications, an artificially designed synthetic gRNA replaces the original crRNA:tracrRNA complex, including through a single gRNA in certain embodiments. For example, the gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA usually contains a complementary region (also called a spacer, usually about 20 nucleotides long) that is user-designed to recognize the target DNA of interest. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA sequence and the tracrRNA sequence are linked by a tetraloop, each with a short repeat sequence for hybridizing with each other, thus generating a chimeric sgRNA. By simply changing the sequence of the spacer or complementary region present in the gRNA, the genome target of the Cas nuclease can be changed. The complementary region guides the Cas nuclease to the target DNA site through standard RNA-DNA complementary base-pairing rules.

[0070] For Cas nucleases to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence, resulting in gRNA-DNA pairing if a matching sequence is present. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease, derived from S. pyogenes, recognizes a PAM sequence of 5'-NGG-3', or less efficiently 5'-NAG-3' (where "N" can be any nucleotide). Other Cas nuclease variants using alternative PAMs have also been characterized and successfully used for genome editing. These are summarized in Table 1 below. [Table 1]

[0071] In some embodiments, Cas nucleases may include one or more mutations to alter their activity, specificity, recognition, and / or other properties. For example, a Cas nuclease may have one or more mutations that alter its fidelity to reduce off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 are high-fidelity variants of SpCas9). As another example, a Cas nuclease may have one or more mutations that alter its PAM specificity.

[0072] B. Genomic loci for gene editing In some embodiments of the methods provided herein, the genomic locus for site-specific knockout, knockdown, or other modification is a gene associated with a blood group. In some embodiments, the one or more genes associated with a blood group are selected from the group consisting of ABO, FUT1, and RHD. In some embodiments, two or more sites within a gene are modified. In some embodiments, two or more genes are modified.

[0073] The specific site for editing within a gene may be located within any suitable region of the gene, including, but not limited to, the gene coding region (also known as coding sequence or "CDS"), an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region (e.g., promoter, enhancer). In some embodiments, gene editing occurs at one allele of a particular genomic locus. In some embodiments, gene editing occurs at both alleles of a particular genomic locus.

[0074] 1. ABO The ABO gene encodes the transferase of the ABO blood group system, an enzyme with glycosyltransferase activity that determines an individual's ABO blood type by modifying oligosaccharides on cell surface glycoproteins. The ABO locus encodes three alleles. The A allele produces α-1,3-N-acetylgalactosamine transferase (A-transferase), which catalyzes the transfer of GalNAc residues from UDP-GalNAc donor nucleotides to Gal residues on the acceptor H antigen, converting H antigen to A antigen in A and AB individuals. The B allele encodes α-1,3-galactosyltransferase (B-transferase), which catalyzes the transfer of Gal residues from UDP-Gal donor nucleotides to Gal residues on the acceptor H antigen, converting H antigen to B antigen in B and AB individuals. The O allele lacks both enzyme activities due to a frameshift near the N-terminus, resulting in the translation of an almost entirely different protein. Therefore, neither A nor B antigens are found in O individuals.

[0075] The human ABO gene is located on chromosome 9 at band 9q34.2 (chromosome 9: 133,233,278-133,276,024, reverse strand). The ABO genomic sequence as defined in Ensembl ID ENSG00000175164.16 is set forth in SEQ ID NO:1.

[0076] 2.FUT1 The FUT1 gene encodes galactoside 2-alpha-L-fucosyltransferase 1, which is involved in the synthesis of the H antigen (determinant of blood group O).

[0077] The human FUT1 gene is located on chromosome 19 at band 19q13.33 (chromosome 19: 48,748,011-48,755,390, reverse strand). The FUT1 genomic sequence as defined in Ensembl ID: ENSG00000174951.12 is set forth in SEQ ID NO:2.

[0078] 3.RHD The Rh system is the second most important blood group system, currently comprising 50 antigens, of which the D antigen is the most significant due to its potential to induce an immune system response. The Rh D antigen is encoded by the RHD gene. Other Rh antigen-encoding genes include RHCE, RhAG, RhBG, and RhCG.

[0079] The human RHD gene is located on chromosome 1 at band 1p36.11 (chromosome 1: 25,272,393-25,330,445, forward strand). The RHD genomic sequence as defined in Ensembl ID: ENSG00000187010.21 is set forth in SEQ ID NO:3.

[0080] In some embodiments, modifications to a particular genomic locus may completely prevent expression of a gene (i.e., knock-out). In some embodiments, modifications to a particular genomic locus may result in reduced expression of a gene (i.e., knock-down). In certain of these embodiments, gene knock-out or knock-down may be achieved by any of the site-specific nuclease-based gene editing systems described, including, for example, the CRISPR / Cas system. In some embodiments, gene knock-out or knock-down occurs by insertion-deletion (indel) mutations (e.g., via the NHEJ pathway) at the target locus, including, for example, indels that induce frameshifts or indels in protein coding regions that result in loss-of-function mutations. In some embodiments, gene knock-out or knock-down occurs by deletion of a gene or a portion thereof via either the NHEJ pathway or the HDR pathway, although HDR is the preferred pathway for introducing certain deletions. In some embodiments, gene knock-out or knock-down occurs by silencing or introduction of loss-of-function mutations at the target locus via the HDR pathway.

[0081] In some embodiments, modifications to a particular genomic locus may involve the insertion of an exogenous gene to be expressed (i.e., knock-in) instead of the gene being edited. In certain of these embodiments, gene knock-in may be achieved by the introduction of a transgene that is inserted by site-specific nucleases and homologous recombination. The transgene can be flanked by homology arms (e.g., a left homology arm (LHA) and a right homology arm (RHA) respectively) and delivered to the cell for insertion into the particular locus by HDR-based approaches as described. The homology arms are designed specifically for the target locus to serve as a template for HDR. The length of each homology arm generally depends on the size of the transgene being inserted, with larger inserts requiring longer homology arms. Any of the described gene editing systems may be used for gene knock-in, including, for example, the CRISPR / Cas system. In addition to expression of the transgene, gene knock-in may result in loss or reduction of expression of the original gene at the target locus.

[0082] In some embodiments, gene editing occurs at one or more genomic loci associated with blood type, including, for example, ABO, FUT1, and RHD, resulting in reduced or absent expression of one or more of these genes. By regulating (e.g., reducing or deleting) the expression of the ABO, FUT1, and / or RHD genes, the blood type of a cell can be modified. For example, the blood type of a cell can be changed from A, B, or AB to O by knocking out the A and / or B alleles of the ABO gene. As another example, the blood type of a cell can be changed from Rh+ to Rh- by knocking out the RHD gene.

[0083] C. Guide RNA (gRNA) for Gene Editing In some embodiments, a gRNA is provided for use in targeted gene editing as described herein, particularly in conjunction with a CRISPR / Cas system. The gRNA comprises a crRNA sequence, which in turn comprises a complementary region (also called a spacer) that recognizes and binds to a complementary target DNA of interest. The length of the spacer or complementary region is generally 15-30 nucleotides, usually about 20 nucleotides long, but will vary based on the requirements of the particular CRISPR / Cas system. In certain embodiments, the spacer or complementary region is fully complementary to the target DNA sequence. In other embodiments, the spacer is partially complementary to the target DNA sequence, e.g., at least 80%, 85%, 90%, 95%, 98%, or 99% complementary.

[0084] In certain embodiments, the gRNA provided herein further comprises a tracrRNA sequence, which comprises a scaffold region for binding to a nuclease. The length and / or sequence of the tracrRNA may vary depending on the particular nuclease being used for editing. In certain embodiments, nuclease binding by the gRNA does not require the tracrRNA sequence. In embodiments in which the gRNA comprises a tracrRNA, the crRNA sequence may further comprise a repeat region for hybridizing to a complementary sequence of the tracrRNA.

[0085] In some embodiments, the gRNA provided herein comprises two or more gRNA molecules, such as a crRNA and a tracrRNA, as two separate molecules. In other embodiments, the gRNA is a single guide RNA (sgRNA), including an sgRNA that includes a crRNA and a tracrRNA in a single RNA molecule. In certain of these embodiments, the crRNA and the tracrRNA are linked by an intervening tetraloop.

[0086] In some embodiments, one gRNA can be used in conjunction with a site-specific nuclease for targeted editing of a locus of interest. In other embodiments, two or more gRNAs targeting the same locus of interest can be used in conjunction with a site-specific nuclease.

[0087] In some embodiments, exemplary gRNAs (e.g., sgRNAs) for use with various common Cas nucleases that require both crRNA and tracrRNA, including Cas9 and Cas12b (C2c1), are provided in Table 2. See, e.g., Jinek et al., Science (2012) 337(6096):816-821; Dang et al., Genome Biology (2015) 16:280; Ran et al., Nature (2015) 520:186-191; Strecker et al., Nature Comm. (2019) 10:212. For each exemplary gRNA, the sequences of different portions of the gRNA are shown, including the complementary region or spacer, the crRNA repeat region, the tetraloop, and the tracrRNA. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 4-7. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 8-11. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 12-15. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 16-19.

[0088] In some embodiments, the gRNA comprises a crRNA repeat region comprising, consisting of, or consisting essentially of the nucleotide sequence set forth in SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:18. In some embodiments, the gRNA comprises a tetraloop comprising, consisting of, or consisting essentially of the nucleotide sequence set forth in SEQ ID NO:6 or SEQ ID NO:17. In some embodiments, the gRNA comprises a tracrRNA comprising, consisting of, or consisting essentially of the nucleotide sequence set forth in SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:15, or SEQ ID NO:16. [Table 2]

[0089] In some embodiments, the gRNA comprises a complementary region specific to a blood group locus, e.g., the ABO locus, the FUT1 locus, or the RHD locus. The complementary region may bind to a target sequence in any region of a blood group locus, including, for example, a CDS, an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region (e.g., promoter, enhancer). When the target sequence is a CDS, an exon, an intron, or a sequence spanning a portion of an exon and an intron, the boundaries of the CDS, exon, intron, or exon / intron may be defined according to any splice variant of the target gene. In some embodiments, the genomic locus targeted by the gRNA is located within 4000bp, within 3500bp, within 3000bp, within 2500bp, within 2000bp, within 1500bp, within 1000bp, or within 500bp of any of the loci or regions thereof as described.

[0090] In some embodiments, the gRNA used herein for targeted gene editing comprises a complementary region that recognizes the target genomic sequence of the ABO locus. In certain of these embodiments, the target sequence is located in the CDS, exon, intron, a sequence that spans a portion of an exon and a portion of an adjacent intron, or a regulatory region of the ABO gene. In certain embodiments, the gRNA comprises a complementary region that recognizes the target genomic sequence that is located entirely within an exon of the ABO gene, for example, an exon as specified in Ensembl ENSG00000175164.4, ENST00000611156.4, or ENST00000538324.2, or NCBI NC_000009.11. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 1-63, 806-863, 13857-13926, 14651-14707, 16159-16206, 17893-17983, 18483-18616, 19669-26168, or 42416-42747 of SEQ ID NO: 1. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 824-863, 13857-13926, 14651-14707, 16159-16206, 17893-17928, 18483-18616, or 19669-20849 of SEQ ID NO: 1. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 810-863, 13857-13926, 14651-14707, 16159-16206, 17893-17928, 18483-18501, 18504-18616, or 19669-20849 of SEQ ID NO:1. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 810-863, 13857-13926, 14651-14707, 16159-16206, 17893-17928, 18483-18501, 18504-18616, 19669-20350, or 20355-20423 of SEQ ID NO:1.

[0091] Exemplary target genomic sequences of gRNAs targeting the ABO gene, the strand in which they are located, their associated PAM sequences, and cleavage sites are provided in Table 4. In some embodiments, gRNAs targeting the ABO gene include a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 20-203. In some embodiments, gRNAs targeting the ABO gene include a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to the reverse complement of any of SEQ ID NOs: 20-203.

[0092] In some embodiments, the gRNA used herein for targeted gene editing comprises a complementary region that recognizes a target genomic sequence of the FUT1 locus. In certain of these embodiments, the target sequence is located in a CDS, an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region of the FUT1 gene. In certain embodiments, the gRNA comprises a complementary region that recognizes a target genomic sequence located entirely within an exon of the FUT1 gene, e.g., an exon as specified in Ensembl ENSG00000174951.12 or ENST00000645652.2, or NCBI NG_007510. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 1-101, 1731-2066, 2269-2901, or 4108-7380 of SEQ ID NO:2. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 2750-2901 or 4108-7380 of SEQ ID NO:2. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 33-101, 1731-1743, 1828-2066, 2269-2901, or 4108-7380 of SEQ ID NO:2. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 33-101, 1731-1743, 1828-2066, 2269-2499, or 4108-7380 of SEQ ID NO:2. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 33-101, 1731-1743, 1828-2066, 2666-2901, or 4108-7380 of SEQ ID NO: 2. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 33-101, 1731-1743, 1828-2066, 2750-2901, or 4108-7380 of SEQ ID NO: 2.

[0093] Exemplary target genomic sequences of gRNAs targeting the FUT1 gene, the strand in which they are located, their associated PAM sequences, and cleavage sites are provided in Table 4. In some embodiments, gRNAs targeting the FUT1 gene comprise a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 204-420. In some embodiments, gRNAs targeting the FUT1 gene comprise a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to the reverse complement of any of SEQ ID NOs: 204-420.

[0094] In some embodiments, the gRNA used herein for targeted gene editing comprises a complementary region that recognizes a target genomic sequence of the RHD locus. In certain of these embodiments, the target sequence is located in the CDS, exon, intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region of the RHD gene. In certain embodiments, the gRNA comprises a complementary region that recognizes a target genomic sequence located entirely within an exon of the RHD gene, e.g., an exon as specified in Ensembl ENSG00000187010.21, ENST00000328664.9, ENST00000622561.4, ENST00000423810.6, ENST00000342055.9, ENST00000568195.5, ENST00000357542.8, ENST00000417538.6, ENST00000454452.6, or ENST00000648012.1, or NCBI NG_007494.1. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 1-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34550, 35255-35424, 44608-44687, 49497-49570, or 56506-58053 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 117-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 44608-44687, 49497-49570, or 56506-58053 of SEQ ID NO:3.In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 94-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 35255-35424, 44608-44687, 49497-49570, or 56506-58053 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region recognizing a target sequence of 15-30 nucleotides located within, or within, nucleotides 156-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 35255-35424, 44608-44687, 56506-56819 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 156-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 35255-35424, or 56506-56819 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 156-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 44608-44687, or 56506-56819 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 156-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, or 56506-56819 of SEQ ID NO:3.In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 156-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 44608-44687, or 56506-56819 of SEQ ID NO: 3. In certain embodiments, the gRNA comprises a complementary region that recognizes a 15-30 nucleotide target sequence located within nucleotides 106-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, or 56506-56819 of SEQ ID NO: 3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 47-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 44608-44687, 49497-49570, or 56506-56769 of SEQ ID NO:3. In certain embodiments, the gRNA comprises a complementary region that recognizes a target sequence of 15-30 nucleotides located within nucleotides 117-303, 12181-12367, 18249-18399, 28554-28701, 29128-29294, 30930-31067, 34204-34337, 44608-44687, 49497-49570, or 56506-58053 of SEQ ID NO:3.

[0095] Exemplary target genomic sequences of gRNAs targeting the RHD gene, the strand in which they are located, their associated PAM sequences, and cleavage sites are provided in Table 4. In some embodiments, gRNAs targeting the RHD gene comprise a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 421-580. In some embodiments, gRNAs targeting the RHD gene comprise a complementary region that comprises, consists of, or consists essentially of a nucleotide sequence complementary to the reverse complement of any of SEQ ID NOs: 421-580.

[0096] In some embodiments, methods are provided for identifying new loci and / or gRNA sequences for use in gene editing systems as described. For example, with respect to a CRISPR / Cas system, if an existing gRNA for a particular locus (e.g., any of the exemplary gRNAs provided) is known, additional loci can be identified by using an "inch-worming" approach to scan the flanking regions on each side of the known locus for PAM sequences, which are typically present approximately every 100 base pairs (bp) across the genome. Typically, different nucleases have different corresponding PAM sequences, so the PAM sequence will depend on the particular Cas nuclease used. The flanking regions on each side of the locus can be about 500-4000 bp long, e.g., about 500 bp, about 1000 bp, about 1500 bp, about 2000 bp, about 2500 bp, about 3000 bp, about 3500 bp, or about 4000 bp long. If a PAM sequence is identified within the search range, new guides can be designed according to the sequence of the locus for use in conjunction with any of the gene editing systems described.In certain embodiments, the new gRNAs identified using this approach can target genomic loci that are within 4000bp, 3500bp, 3000bp, 2500bp, 2000bp, 1500bp, 1000bp, 500bp, 400bp, 300bp, 200bp, 100bp, or 50bp of any of the genomic cleavage sites provided in Table 4.In certain embodiments, the gRNAs are configured to generate cleavage sites at positions within 5, 10, 15, 20, 30, 40, or 50 nucleotides of any of the genomic cleavage sites provided in Table 4.

[0097] In some embodiments, the incorporation of chemical and / or sequence modifications can alter the activity, stability, and / or other properties of the gRNA. As an example, transiently expressed or delivered nucleic acids can be susceptible to degradation, for example, by cellular nucleases. Thus, the gRNAs described herein can contain one or more modified nucleosides or nucleotides that introduce stability against nucleases. Without being bound to a particular theory, it is believed that certain modified gRNAs described herein can exhibit reduced innate immune responses when introduced into a cell population, particularly cells of the present technology. As used herein, the term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, generally from viruses or bacteria, which involve the expression and release of cytokines, particularly interferons, and the induction of cell death. Other common chemical modifications of gRNAs to improve stability, increase nuclease resistance, and / or reduce immune responses include 2'-O-methyl modifications, 2'-fluoro modifications, 2'-O-methyl phosphorothioate linkage modifications, and 2'-O-methyl 3'thio PACE modifications.

[0098] One common 3' end modification is the addition of a polyA tract containing one or more (typically 5-200) adenine (A) residues. The polyA tract can be included in the nucleic acid sequence encoding the gRNA or can be added to the gRNA during chemical synthesis or after in vitro transcription using a polyadenosine polymerase (e.g., E. coli poly(A) polymerase). In vivo, the polyA tract can be added to the sequence transcribed from a DNA vector by the use of a polyadenylation signal. Other suitable gRNA modifications include, but are not limited to, those described in U.S. Patent Application No. US2017 / 0073674A1 and International Publication No. WO2017 / 165862A1.

[0099] D. Delivery of the gene editing system into cells In some embodiments, compositions are provided that include one or more components of the gene editing system described herein, including one or more gRNAs, a nucleotide sequence encoding a site-specific nuclease (e.g., a Cas nuclease) or a site-specific nuclease protein, and optionally a transgene for targeted insertion. In some embodiments, the compositions are formulated for delivery into a cell.

[0100] In some embodiments, the components of the gene editing system provided herein, including one or more gRNAs, nucleotide sequences encoding site-specific nucleases (e.g., Cas nucleases) or site-specific nuclease proteins, and optionally transgenes for targeted insertion, may be delivered into cells in the form of vectors. The delivery vector may be any type of vector suitable for introducing nucleotide sequences into cells, including, for example, plasmids, adenoviral vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentiviral vectors, phages, and HDR-based donor vectors. Different components may be introduced into cells together or separately, and may be delivered in a single vector or multiple vectors.

[0101] In some embodiments, vectors may be introduced into cells by any method known in the art, including, for example, viral transformation, calcium phosphate transfection, lipid-mediated transfection, DEAE-dextran, electroporation, microinjection, nucleoporation, liposomes, nanoparticles, or other methods.

[0102] In some embodiments, the technology provides a composition comprising a vector according to various embodiments disclosed herein. In some embodiments, the composition may further comprise one or more pharma- ceutically acceptable carriers, excipients, preservatives, or combinations thereof. A "pharma-ceutically acceptable carrier or excipient" refers to a pharma-ceutically acceptable material, composition, or vehicle involved in carrying or transporting a compound of interest from one tissue, organ, or part of the body to another tissue, organ, or part of the body. For example, a carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or any combination thereof. Each component of a carrier or excipient must be "pharma-ceutically acceptable" in that it must be compatible with the other components of the formulation. It must also be suitable for contact with any tissue, organ, or part of the body with which it may come into contact, i.e., it must not have a risk of toxicity, irritation, allergic reaction, immunogenicity, or any other complication that unduly outweighs its therapeutic benefits. Suitable excipients include water, saline, dextrose, glycerol, and the like, and combinations thereof. In some embodiments, the compositions comprising the cells disclosed herein further comprise a suitable infusion medium.

[0103] In some embodiments, cells or compositions thereof are provided that contain one or more components of the gene editing system described herein, including one or more gRNAs, a nucleotide sequence encoding a site-specific nuclease (e.g., a Cas nuclease) or a site-specific nuclease protein, and optionally a transgene for targeted insertion.

[0104] E. Additional Genetic Modifications for Hypoimmunity In some embodiments, in addition to the described gene editing methods to knock out, knock down, or otherwise alter the expression of one or more blood group-related genes (e.g., ABO, FUT1, and RHD) in the cells, the cells may have additional genetic modifications, e.g., in the case of allogeneic cells, to further reduce the risk of potential graft-versus-host disease after infusion into the recipient or the risk of being rejected by the recipient's innate immune system. These additional modifications may include, for example, reducing or eliminating the expression of major histocompatibility complex (MHC) class I and / or MHC class II (MHC I and / or MHC II) genes, which encode cell surface molecules specialized for the presentation of antigenic peptides to immune cells. Reducing the expression of MHC I and / or MHC II molecules in allogeneic cells may prevent recognition of these cells by the recipient's immune cells and thus rejection of the graft. The step of modifying (e.g., reducing or eliminating) MHC I and / or MHC II molecules may occur before, simultaneously with, or after the step of modifying the expression of one or more blood group genes. In humans, MHC is called human leukocyte antigen (HLA). Class I HLA (HLA I), which corresponds to MHC I, contains HLA-A, HLA-B, and HLA-C genes, while class II HLA (HLA I), which corresponds to MHC II, contains HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO genes.

[0105] In some embodiments, additional modifications to the cells to reduce the immunogenicity of the cells include genetically modifying the cells to reduce expression of one or more immune factors, including, for example, class II transactivator (CIITA), beta 2 microglobulin (B2M), NLRC5, CTLA-4, PD-1, HLA-A, HLA-BM, HLA-C, RFX-ANK, NFY-A, RFX5, RFX-AP, NFY-B, NFY-C, IRF1, MIC-A, MIC-B, TXNIP, CD142, CD38, PCDH11Y, NLGN4Y, and TAP1.

[0106] In some embodiments, the cells may be modified to reduce expression of MHC I genes by targeting and modulating one or more of the HLA loci, such as HLA-A, HLA-B, and / or HLA-C, individually or collectively using HLA-Razor. In some embodiments, the modulation occurs by insertion-deletion (indel) modification of one or more of the HLA loci, including HLA-A, HLA-B, and / or HLA-C, for example, by using a CRISPR / Cas system as described. By modulating (e.g., reducing or deleting) the expression of any of the HLA genes, the cells may be rendered less immunogenic and may have a reduced ability to induce an immune response in a recipient subject. In some embodiments, the reduction in expression of any of the HLA loci reduces or eliminates the expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the cells have a knockout of HLA-A, HLA-B, and / or HLA-C. In some embodiments, the genetic modification targeted to any of the HLA loci comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) described herein at the HLA locus. In certain of these embodiments, the insertion of the transgene at any of the HLA loci results in a knockout of HLA-A, HLA-B, and / or HLA-C.

[0107] In some embodiments, the cells may be modified to reduce expression of MHC I genes by targeting and modulating the B2M locus. The B2M gene encodes a component of the MHC I molecule. In some embodiments, the modulation occurs by insertion-deletion (indel) modification or targeted mutation of the B2M locus, for example, by using the CRISPR / Cas system as described. Modulating (e.g., reducing or deleting) the expression of B2M blocks surface trafficking of MHC molecules, thereby rendering the cells less immunogenic. In some embodiments, allogeneic cells modified to reduce expression of MHC I genes have a reduced ability to induce an immune response in a recipient subject. In some embodiments, the reduced expression of B2M reduces or eliminates the expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the cells have a B2M knockout. In some embodiments, the genetic modification targeted to the B2M locus comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) described herein at the B2M locus. In certain of these embodiments, insertion of the transgene into the B2M locus results in a B2M knockout.

[0108] In some embodiments, the cells can be modified to reduce expression of MHC I genes by targeting and modulating the TAP1 locus. TAP1, encoded by the TAP1 gene, associates with TAP2, encoded by the TAP2 gene, to form the transporter associated with antigen processing (TAP) complex, which is found in the endoplasmic reticulum (ER) and transports foreign peptides to the ER for binding to MHC class I proteins and presentation to the immune system on the cell surface. In some embodiments, modulation occurs by insertion-deletion (indel) modification of the TAP1 locus, for example, by using a CRISPR / Cas system as described. By modulating (e.g., reducing or deleting) the expression of TAP1, surface transport of MHC I molecules is blocked, thereby rendering the cells less immunogenic. In some embodiments, reducing the expression of TAP1 reduces or eliminates the expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the cells have a TAP1 knockout. In some embodiments, the genetic modification targeted to the TAP1 locus comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) disclosed herein at the TAP1 locus. In certain of these embodiments, the insertion of the transgene into the TAP1 locus results in a TAP1 knockout.

[0109] In some embodiments, the cells may be modified to reduce expression of MHC II genes by overexpression of CD74.

[0110] In some embodiments, the cells may be modified to reduce expression of MHC II genes by targeting and modulating the CIITA locus. CIITA is a member of the nucleotide-binding domain (NBD) leucine-rich repeat (LRR) family of proteins and regulates the transcription of MHC II by associating with the MHC enhanceosome. In some embodiments, the modulation occurs by insertion-deletion (indel) modification of the CIITA locus, for example, by using a CRISPR / Cas system as described. In some embodiments, the reduction in expression of CIITA reduces or eliminates the expression of one or more of the HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO genes. In some embodiments, the cells have a CIITA knockout. In some embodiments, the genetic modification targeting the CIITA locus comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) disclosed herein at the CIITA locus. In certain of these embodiments, insertion of the transgene into the CIITA locus results in a CIITA knockout.

[0111] In certain embodiments, the cells include modifications, such as genetic modifications targeting the MIC-A gene. MIC-A is a protein with known isoforms and variants (see, e.g., UniProt Q29983, accessed July 18, 2022), and all such forms of MIC-A are encompassed by the disclosure provided herein. In some embodiments, the genetic modification targeting the MIC-A gene is by using a targeted nuclease system that includes a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the MIC-A gene. In some embodiments, the genetic modification occurs using a CRISPR / Cas system as described. For example, in some embodiments, a gRNA with the targeting sequence GATGACCCTGGCTCATATCA (SEQ ID NO: 581) can be used. In some embodiments, a method of gene editing using a CRISPR / Cas system and a gRNA targeting MIC-A, such as a gRNA having the targeting sequence GATGACCCTGGCTCATATCA (SEQ ID NO:581), knocks out all alleles of MIC-A in a cell. In some embodiments, the cell has a MIC-A knockout. In some embodiments, the genetic modification targeted to the MIC-A locus comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) disclosed herein at the MIC-A locus. In certain of these embodiments, the insertion of the transgene into the MIC-A locus results in a MIC-A knockout.

[0112] In certain embodiments, the cells include modifications, such as genetic modifications targeting the MIC-B gene. MIC-B is a protein with known isoforms and variants (see, e.g., UniProt Q29980, accessed July 18, 2022), and all such forms of MIC-B are encompassed by the disclosure provided herein. In some embodiments, the genetic modification targeting the MIC-B gene is by using a targeted nuclease system that includes a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the MIC-B gene. In some embodiments, the genetic modification occurs using a CRISPR / Cas system as described. For example, in some embodiments, a gRNA with the targeting sequence GTTTCTGCCTGTCATAGCGC (SEQ ID NO: 582) can be used. In some embodiments, the method of gene editing using a CRISPR / Cas system and a gRNA targeting MIC-B, such as a gRNA having the targeting sequence GTTTCTGCCTGTCATAGCGC (SEQ ID NO: 582), knocks out all alleles of MIC-B in a cell. In some embodiments, the cell has a MIC-B knockout. In some embodiments, the genetic modification targeted to the MIC-B locus comprises inserting an exogenous nucleic acid or transgene encoding a polypeptide (e.g., a tolerogenic factor) disclosed herein at the MIC-B locus. In certain of these embodiments, the insertion of the transgene into the MIC-B locus results in a MIC-B knockout.

[0113] In some embodiments, the cells have a genetic modification at the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci, a B2M, TAP1, CIITA, MIC-A, and / or MIC-B knockout, or overexpression of CD74. The B2M, TAP1, CIITA, MIC-A, and / or MIC-B knockout can occur at one allele of each locus, or at both alleles. In some embodiments, the B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci are modified such that the cells have reduced or absent expression of B2M, TAP1, CIITA, MIC-A, and / or MIC-B, respectively. In these embodiments, the cells have reduced expression of MHC I and / or MHC II genes (HLA I and / or HLA II in humans) as a result of deletion or knockout of B2M, TAP1, CIITA, MIC-A, and / or MIC-B, or overexpression of CD74.

[0114] In some embodiments, transgenes for targeted insertion (i.e., knock-in) at genomic loci for genetic modifications as described (e.g., the ABO, FUT1, RHD, B2M, TAP1, CIITA, MIC-A, and / or MIC-B loci) may encode tolerogenic factors that improve the hypoimmunogenicity of the resulting cells, thereby preventing them from being subject to immune rejection when transplanted into a recipient, which may in turn increase the efficacy of cell-based therapies. Examples of tolerogenic factors include, but are not limited to, A20 / TNFAIP3, CD16, CD16 Fe receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, SERPINB9, CCL21, MFGE8, and truncations, variants, or fusions of any of the above.

[0115] In some embodiments, the tolerogenic factor is CD47, a leukocyte surface antigen that plays a role in cell adhesion and regulation of integrins. It is expressed on the surface of cells (e.g., T cells) and transmits a signal that causes circulating macrophages not to phagocytose the cells. Thus, overexpression of CD47 may reduce the immunogenicity of cells when transplanted and improve immune protection in allogeneic recipients.

[0116] CD47 is a transmembrane protein that in humans is encoded by the CD47 gene. CD47 is a member of the immunoglobulin (Ig) superfamily. CD47 has a molecular weight of approximately 50 kDa. CD47 is glycosylated and ubiquitously expressed on virtually all cells in the human body. CD47 has a single IgV-like domain at its N-terminus, a highly hydrophobic stretch with five transmembrane segments, and an alternatively spliced ​​cytoplasmic tail at its C-terminus. In addition, CD47 has two extracellular regions and two intracellular regions between adjacent transmembrane segments. A signal peptide, when present on the CD47 isoform, is located N-terminal to the IgV-like domain.

[0117] CD47 is involved in a variety of cellular processes, including apoptosis, proliferation, adhesion, and migration. CD47 interacts with multiple extracellular ligands, such as TSP-1, integrins, other CD47 proteins, and SIRPα. CD47 / SIRPα interactions regulate numerous cell-cell interactions in many biological systems, such as the immune system, regulating lymphocyte homeostasis, dendritic cell (DC) maturation and activation, proper localization of certain DC subsets in secondary lymphoid organs, and cell transmigration. CD47 on cells, including on donor cells in the context of transplantation or cell therapy applications, can function as a "marker of self" and regulate phagocytosis by binding to SIRPα on the surface of circulating immune cells to deliver an inhibitory "don't kill me" signal. CD47-SIRPα binding results in phosphorylation of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) on SIRPα, which triggers recruitment of SHP1 and SHP2 Src homology phosphatases. These phosphatases then inhibit the accumulation of myosin II at the phagocytic synapse, blocking phagocytosis (Fujioka et al., Mol. Cell. Biol., 16:6887-6899 (1996)). The phagocytosis of target cells by macrophages is ultimately regulated by the balance between activating signals (e.g., FcγR, CRT, LRP-1) and inhibitory signals (e.g., SIRPα-CD47). High expression of CD47 can help cells avoid immune surveillance and subsequent destruction and killing by innate immune cells. Thus, CD47 can be used as a tolerogenic factor to induce immune tolerance, for example, when there is pathological or undesired activation of an otherwise normal immune response. This can occur, for example, when a patient develops an immune response against donor antigens after receiving an allogeneic transplant or allogeneic cell therapy, or when the body responds inappropriately to self-antigens that are implicated in autoimmune diseases.

[0118] The human CD47 gene has six naturally occurring transcripts, five of which each encode a protein isoform of CD47 (Ensembl, Gene:CD47, ENSG00000196776). These six transcripts are designated CD47-201, CD47-202, CD47-203, CD47-204, CD47-205, and CD47-206. The coding DNA sequences (CDS) of the six transcripts are as set forth in SEQ ID NOs: 589-594, respectively. The amino acid sequences of the five protein isoforms are as set forth in SEQ ID NOs: 583-588, respectively (see Table 3).

[0119] The transcript CD47-201 (SEQ ID NO:589) encodes the isoform CD47-201 (SEQ ID NO:583) with 305 amino acids. Isoform CD47-201 is truncated at the C-terminus by 18 amino acids from isoform CD47-202. All splice junctions of the CD47-201 transcript are supported by at least one non-suspect mRNA.

[0120] Transcript CD47-202 (SEQ ID NO: 590) encodes the isoform CD47-202 (SEQ ID NO: 584) with 323 amino acids. CD47-202 is the longest transcript of the human CD47 gene. It is designated as the representative transcript in the Ensembl database. In identifying the representative transcript, Ensembl has in mind to identify transcripts that, overall, have the highest coverage of conserved exons, the highest expression rate, the longest coding sequence, and are represented in other major resources such as NCBI and UniProt. All splice junctions of the CD47-202 transcript are supported by at least one non-suspect mRNA. Amino acids 1-18 are the signal peptide. The amino acid sequence of CD47-202 without the signal peptide is set forth in SEQ ID NO: 585.

[0121] The transcript CD47-203 (SEQ ID NO: 591) encodes the 86 amino acid isoform CD47-203 (SEQ ID NO: 586). The only support for this transcript model comes from a single expressed sequence tag (EST).

[0122] The transcript CD47-204 (SEQ ID NO:592) does not encode any protein. All splice junctions of this transcript are supported by at least one non-suspect mRNA.

[0123] Transcript CD47-205 (SEQ ID NO:593) encodes the 109 amino acid isoform CD47-205 (SEQ ID NO:587). Isoform 205 contains the three transmembrane domains and a truncated intracellular domain from isoform CD47-202. The mRNAs that best support this transcript model have been flagged as suspect or support is provided by multiple ESTs.

[0124] The transcript CD47-206 (SEQ ID NO:594) encodes the isoform CD47-206 (SEQ ID NO:588) having 183 amino acids. Isoform 206 contains a truncated extracellular domain from isoform CD47-202 and five transmembrane domains.

[0125] In some embodiments, a transgene for targeted insertion (i.e., knock-in) at a genomic locus (e.g., B2M, TAP1, CIITA, MIC-A, and / or MIC-B locus) for genetic modification as described may encode CD47, e.g., human CD47. In certain of these embodiments, the human CD47 comprises or consists of an amino acid sequence set forth in any one of SEQ ID NOs: 583-588, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in any one of SEQ ID NOs: 583-588. In some embodiments, human CD47 comprises or consists of an amino acid sequence set forth in SEQ ID NO:584, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:584. In some embodiments, the nucleotide sequence encoding CD47 corresponds to the mRNA sequence of human CD47. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in any one of SEQ ID NOs:589-594. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO:590.

[0126] In some embodiments, the nucleotide sequence encoding CD47 is codon-optimized for expression in a mammalian cell, e.g., a human cell. In some embodiments, the codon-optimized nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO:595. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6]

[0127] Cells, cell populations, and compositions thereof In some aspects, provided herein is a gene-edited cell according to various embodiments disclosed herein. In some embodiments, the cell has a genetic modification at one or more genomic loci associated with blood type, including, for example, ABO, FUT1, and / or RHD loci. In certain of these embodiments, the cell has modified expression of one or more of these genes (e.g., reduced or absent expression). As a result of modifying the expression of ABO, FUT1, and / or RHD genes, the cell can have modified blood type.

[0128] In some embodiments, the cells are autologous, i.e., obtained from the subject to whom the genetically modified cells will be administered, hi some embodiments, the cells are allogeneic, i.e., obtained from someone other than the subject to whom the genetically modified cells will be administered.

[0129] In some embodiments, the cell is a mesenchymal stem cell or a hematopoietic stem cell. In some embodiments, the cell is a hematopoietic cell or a blood cell, such as a red blood cell (erythrocyte), a platelet cell (thrombocyte), a mast cell, a basophil, an eosinophil, a neutrophil, a monocyte, a natural killer (NK) cell, a natural killer T (NKT) cell, a macrophage, a lymphocyte (e.g., a T cell, a B cell), or a plasma cell.

[0130] In some embodiments, the cells are T cells, e.g., naive T cells, helper T cells (CD4+), cytotoxic T cells (CD8+), regulatory T cells (Treg), central memory T cells (T CM ), effector memory T cells (T EM ), stem cell memory T cells (T SCM ), or any combination thereof. More specifically, the T cells are naive (never exposed to an antigen; T CM These cells can be T cells (which have increased expression of CD62L, CCR7, CD28, CD3, CD127, and CD45RA, and decreased expression of CD45RO compared to T cells), memory T cells (which have been exposed to antigen and are long-lived), or effector cells (which have been exposed to antigen and are cytotoxic). Memory T cells are CM (Increased expression of CD62L, CCR7, CD28, CD127, CD45RO, and CD95, and decreased expression of CD54RA compared to naive T cells) and T EM (Naive T cells or T CMEffector T cells can be further divided into a subset of T cells (which express reduced levels of CD62L, CCR7, CD28, and CD45RA, and increased levels of CD127, compared to T cells). CM Helper T cells refer to CD8+ cytotoxic T cells that have been exposed to antigen and have reduced expression of CD62L, CCR7, CD28 compared to helper T cells, and are positive for granzymes and perforin. Helper T cells are CD4+ cells that affect the activity of other immune cells by releasing cytokines. CD4+ T cells can activate or suppress adaptive immune responses, and which of these two functions is induced depends on the presence of other cells and signals. T cells can be collected using known techniques, and various subpopulations or combinations thereof can be enriched or depleted by known techniques, such as, for example, affinity binding to antibodies, flow cytometry, or immunomagnetic selection. In some embodiments, T cells can be primary T cells obtained from several sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In other embodiments, T cells can be derived or differentiated from embryonic stem cells (ESCs) or induced pluripotent cells (iPSCs). In some embodiments, the T cells may be engineered to be T cell receptor deficient, for example by deletion of the TRAC or TRB locus, or may be engineered to express a chimeric antigen receptor.

[0131] In some embodiments, the cell is a NK cell. NK cells (also defined as large granular lymphocytes) represent a cell lineage differentiated from common lymphoid progenitors (which also give rise to B and T lymphocytes). Unlike T cells, NK cells do not naturally express CD3 on the plasma membrane. Importantly, NK cells do not express TCRs and typically lack other antigen-specific cell surface receptors as well. The cytotoxic activity of NK cells does not require sensitization, but is enhanced by activation with various cytokines, including IL-2. NK cells are generally believed to lack the appropriate or complete signaling pathways required for antigen-receptor mediated signaling, and therefore are not believed to be capable of antigen receptor-dependent signaling, activation, and proliferation. NK cells are cytotoxic and balance activating and inhibitory receptor signaling to regulate their cytotoxic activity. For example, NK cells expressing CD16 can bind to the Fc domain of antibodies bound to infected cells, resulting in activation of the NK cells. In contrast, activity is reduced against cells expressing high levels of MHC class I proteins. Upon contact with a target cell, NK cells release proteins such as perforin and enzymes such as proteases (granzymes). Perforin can form holes in the cell membrane of the target cell to induce apoptosis or cell lysis. In some embodiments, the NK cells can be primary NK cells obtained from several sources including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NK cells can be derived or differentiated from ESCs or iPSCs. There are several techniques that can be used to generate NK cells from pluripotent stem cells (e.g., iPSCs).See, e.g., Zhu et al., Methods Mol Biol. 2019, 2048:107-119; Knorr et al., Stem Cells Transl Med. 2013 2(4):274-83. doi:10.5966 / sctm.2012-0084; Zeng et al., Stem Cell Reports. 2017 Dec 12; 9(6):1796- 1812; Ni et al., Methods Mol Biol. 2013; 1029:33-41; Bernaregghi et al., Exp Hematol. 2019 71:13-23; Shankar et al., Stem Cell Res Ther. 2020; 11(1):234, all of which are incorporated by reference in their entireties, particularly with respect to methods and reagents for differentiation. Differentiation can be assayed as known in the art, generally by assessing the presence of NK cell associated and / or specific markers, including, but not limited to, CD56, KIR, CD16, NKp44, NKp46, NKG2D, TRAIL, CD122, CD27, CD244, NK1.1, NKG2A / C, NCR1, Ly49, CD49b, CD11b, KLRG1, CD43, CD62L, and / or CD226.

[0132] In some embodiments, the cells are NKT cells. NKT cells are a heterogeneous group of T cells that share properties of both T cells and NK cells. Many of these cells recognize non-polymorphic CD1d molecules, which are antigen-presenting molecules that bind self and foreign lipids and glycolipids. They constitute only about 1% of all peripheral blood T cells. In some embodiments, the NKT cells can be primary NKT cells obtained from several sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NKT cells can be derived or differentiated from ESCs or iPSCs.

[0133] In some embodiments, the cells are pancreatic islet cells, including, for example, β cells (also known as beta cells or β islet cells). Exemplary pancreatic islet cell types include, but are not limited to, pancreatic islet progenitor cells, immature pancreatic islet cells, mature pancreatic islet cells, and the like. In some embodiments, the β islet cells can be primary β islet cells. In some embodiments, the β islet cells can be derived or differentiated from ESCs or iPSCs. Useful methods for differentiating pluripotent stem cells into pancreatic islet cells are described, for example, in US9,683,215, US9,157,062, and US8,927,280. In some embodiments, the β islet cells engineered by the methods disclosed herein secrete insulin. In some embodiments, the β islet cells exhibit at least two properties of endogenous pancreatic islet cells, including, but not limited to, secretion of insulin in response to increased glucose and expression of beta cell markers. In some embodiments, the β islet cells disclosed herein are administered to a subject to treat diabetes. Exemplary beta cell markers or beta cell progenitor markers include, but are not limited to, c-peptide, Pdx1, glucose transporter 2 (Glut2), HNF6, VEGF, glucokinase (GCK), prohormone convertase (PC1 / 3), Cdcpl, NeuroD, Ngn3, Nkx2.2, Nkx6.1, Nkx6.2, Pax4, Pax6, Ptf1a, Isl1, Sox9, Sox17, and FoxA2. In some embodiments, PSCs are differentiated into beta-like cells or islet organoids for transplantation to address type I diabetes mellitus (T1DM). Cell systems are a promising method to address T1DM. See, for example, Ellis et al., Nat Rev Gastroenterol Hepatol. 2017 Oct; 14(10): 612-628 (incorporated herein by reference). Additionally, Pagliuca et al. (Cell, 2014, 159(2):428-39) have reported on the successful differentiation of beta cells from hiPSCs, the contents of which are incorporated by reference in their entirety, and in particular with respect to the methods and reagents disclosed therein for the large-scale production of functional human beta cells from human pluripotent stem cells.Additionally, Vegas et al. have demonstrated the production of human beta cells from human pluripotent stem cells followed by encapsulation to avoid immune rejection by the recipient (Vegas et al., Nat Med, 2016, 22(3):306-11, which is incorporated by reference in its entirety, particularly with respect to the methods and reagents disclosed therein for large-scale production of functional human beta cells from human pluripotent stem cells. Additional disclosure of pancreatic islet cells, including pancreatic beta islet cells, for use in the present technology can be found in WO2020 / 018615, the disclosure of which is incorporated by reference in its entirety.

[0134] In some embodiments, the cell is a pluripotent stem cell, e.g., an ESC or an iPSC. In some embodiments, the cell is a cell differentiated from a pluripotent stem cell, e.g., an ESC or an iPSC. ESCs and iPSCs have the ability to differentiate into any cell type in the body, including, for example, neurons, astrocytes, oligodendrocytes, retinal epithelial cells, epidermal cells, hair cells, keratinocytes, hepatocytes, pancreatic beta islet cells, intestinal epithelial cells, alveolar cells, hematopoietic cells, endothelial cells, cardiac myocytes, smooth muscle cells, skeletal muscle cells, kidney cells, adipocytes, chondrocytes, thyroid cells, NK cells, NKT cells, macrophages, T cells, B cells, and bone cells.

[0135] In some embodiments, the cells are primary cells, including, for example, neurons, astrocytes, oligodendrocytes, retinal epithelial cells, epidermal cells, hair cells, keratinocytes, hepatocytes, pancreatic beta islet cells, intestinal epithelial cells, alveolar cells, hematopoietic cells, mesenchymal stem cells, hematopoietic stem cells, endothelial cells, cardiomyocytes, smooth muscle cells, skeletal muscle cells, kidney cells, adipocytes, chondrocytes, thyroid cells, NK cells, NKT cells, macrophages, T cells, B cells, and bone cells. In some embodiments, the cells are cardiomyocytes, retinal pigment epithelial cells (RPE), endothelial cells, beta islet cells, or glial progenitor cells (GPCs).

[0136] In some aspects, the technology provides pharmaceutical compositions comprising cells according to various embodiments disclosed herein.

[0137] In some embodiments, the composition can have various formulations, such as injectable formulations, lyophilized formulations, liquid formulations, oral formulations, etc., depending on the preferred route of administration.

[0138] In some embodiments, the compositions can be combined in the same dosage unit or individually formulated in separate dosage units. The terms "dosage unit" and "dosage unit" herein refer to a portion of a pharmaceutical composition that contains an amount of a therapeutic agent suitable for single administration to provide a therapeutic effect. Such dosage units may be administered one to multiple times per day (i.e., 1-10 times, 1-8 times, 1-6 times, 1-4 times, or 1-2 times), or as many times as necessary to elicit a therapeutic response.

[0139] In some embodiments, a single dosage unit contains at least about 1×10 2 , 5×10 2 , 1×10 3 , 5×10 3 , 1×10 4 , 5×10 4 , 1×10 5 , 5×10 5 , 1×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 5×10 8 , 1×10 9 , 5×10 9 , 1×10 10 , or 5 × 10 10 Contains cells.

[0140] Treatment In some aspects, methods are provided for treating and / or preventing disease in a subject in need thereof, the methods involving obtaining cells from a subject (autologous) or a donor (allogeneic), genetically modifying the cells according to various embodiments disclosed herein (including targeted gene editing at one or more genomic loci associated with blood type), and administering a therapeutically effective amount of the genetically modified cells or a pharmaceutical composition containing the same to the subject.

[0141] In some embodiments, the disease is cancer. In some embodiments, the cancer is a hematological malignancy. Non-limiting examples of hematological malignancies include myeloid neoplasms, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), B-cell acute lymphocytic leukemia (B-ALL), T-cell acute lymphocytic leukemia (T-ALL), T-cell lymphoma, and B-cell lymphoma.

[0142] In some embodiments, the disease is an autoimmune disease, including, for example, lupus, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, psoriatic arthritis, multiple sclerosis, Crohn's disease, ulcerative colitis, Addison's disease, Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, and celiac disease.

[0143] In some embodiments, the disease is diabetes mellitus, including, for example, type I diabetes, type II diabetes, prediabetes, and gestational diabetes.

[0144] In some embodiments, the disease is a neurological disease, including, for example, catalepsy, epilepsy, encephalitis, meningitis, migraine, Huntington's disease, Alzheimer's disease, Parkinson's disease, Pelizaeus-Merzbacher disease, and multiple sclerosis.

[0145] In some embodiments, the disease is a cardiac disease or disorder, i.e., a pathology and / or disorder related to the heart, including the valves, endothelium, infarcted area, or other components or structures of the heart. Cardiac diseases or disorders include, for example, childhood cardiomyopathy, age-related cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, chronic ischemic cardiomyopathy, peripartum cardiomyopathy, inflammatory cardiomyopathy, idiopathic cardiomyopathy, other cardiomyopathies, myocardial ischemia-reperfusion injury, ventricular dysfunction, heart failure, congestive heart failure, coronary artery disease, end-stage heart disease, atherosclerosis, ischemia, hypertension, restenosis, angina, rheumatic heart, arterial inflammation, cardiovascular disease, myocardial infarction, These include myocardial ischemia, congestive heart failure, myocardial infarction, cardiac ischemia, cardiac trauma, myocardial ischemia, vascular disease, acquired heart disease, congenital heart disease, atherosclerosis, coronary artery disease, dysfunctional conduction system, dysfunctional coronary arteries, pulmonary hypertension, cardiac arrhythmias, muscular dystrophies, abnormal muscle mass, muscle degeneration, myocarditis, infectious myocarditis, drug or toxin induced muscle disorders, hypersensitivity myocarditis, cardiac hypertrophy, mitral regurgitation, and autoimmune endocarditis.

[0146] In some embodiments, the genetically modified cells of the present technology or pharmaceutical compositions containing the same may be administered in a manner appropriate to the disease, condition, or disorder to be treated, as determined by a medical professional. In any of the above embodiments, the genetically modified cells may be administered intravenously, intraperitoneally, intratumorally, intrabone marrow, intralymph node, or into the cerebrospinal fluid to encounter the target antigen or cell. The appropriate dose, suitable duration, and frequency of administration of the composition will be determined by factors such as the patient's condition; the size, type, and severity of the disease, condition, or disorder; the undesirable type or level or activity of tagged cells; the specific form of the active ingredient; and the method of administration.

[0147] In some embodiments, the amount of genetically modified cells of the present technology in a pharmaceutical composition is typically about 10 2 More than 1 x 10 cells, e.g., about 1 x 10 2 , 5×10 2 , 1×10 3 , 5×10 3 , 1×10 4 , 5×104 , 1×10 5 , 5×10 5 , 1×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 5×10 8 , 1×10 9 , 5×10 9 , 1×10 10 , 5×10 10 cells, or even more.

[0148] In some embodiments, the methods include administering the genetically modified cells or pharmaceutical compositions containing same to a subject once a day, twice a day, three times a day, or four times a day for about 3 days, about 5 days, about 7 days, about 10 days, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 1.25 years, about 1.5 years, about 1.75 years, about 2 years, about 2.25 years, about 2.5 years, about 2.75 years, about 3 years, about 3.25 years, about 3.5 years, about 3.75 years, about 4 years, about 4.25 years, about 4.5 years, about 4.75 years, about 5 years, or for a period of more than about 5 years. In some embodiments, the genetically modified cells or pharmaceutical compositions containing same can be administered daily, every other day, every third day, weekly, biweekly (i.e., every 2 weeks), every 3 weeks, monthly, bimonthly, or every 3 months.

[0149] In some embodiments, the genetically modified cells or pharmaceutical compositions containing the same may be administered for a predetermined period of time. Alternatively, the genetically modified cells or pharmaceutical compositions containing the same may be administered until a certain therapeutic benchmark is reached. In some embodiments, the methods provided herein include evaluating one or more therapeutic benchmarks in a biological sample, such as, but not limited to, the level of a disease-related biomarker, to determine whether to continue administering the genetically modified cells or pharmaceutical compositions containing the same.

[0150] In some embodiments, the method further comprises administering to the subject a pharma- ceutical effective amount of one or more additional therapeutic agents to obtain an improved or synergistic therapeutic effect. In some embodiments, the one or more additional therapeutic agents are selected from the group consisting of immunotherapeutic agents, chemotherapeutic agents, and biologics. In some embodiments, the one or more additional therapeutic agents are administered to the subject prior to administration of the genetically modified cells or pharmaceutical compositions containing same. In some embodiments, the one or more additional therapeutic agents and the genetically modified cells or pharmaceutical compositions containing same are co-administered to the subject. In some embodiments, the one or more additional therapeutic agents are administered to the subject after administration of the genetically modified cells or pharmaceutical compositions containing same.

[0151] As will be understood by those skilled in the art, one or more additional therapeutic agents and genetically modified cells or pharmaceutical compositions containing same can be administered to a subject in need thereof one or more times in the same or different doses depending on the subject's diagnosis and prognosis. Those skilled in the art will be able to combine one or more of these therapies in different orders to achieve a desired therapeutic outcome. In some embodiments, the combination therapy achieves improved or synergistic effects compared to either treatment administered alone.

[0152] The above detailed description of the embodiments of the present technology is not intended to be exhaustive or to limit the present technology to the precise form disclosed above. Although specific embodiments of the present technology and examples thereof are described above for illustrative purposes, various equivalent modifications are possible within the scope of the present technology, as will be recognized by those skilled in the relevant art. For example, while the steps are presented in a certain order, alternative embodiments may perform the steps in a different order. Also, the various embodiments described herein may be combined to provide further embodiments.

[0153] From the above description, it will be understood that although specific embodiments of the present technology have been described herein for illustrative purposes, well-known components and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments of the present technology. Where the context permits, singular or plural terms may also include the plural or singular terms, respectively. Furthermore, although advantages associated with some embodiments of the present technology have been described in connection with those embodiments, other embodiments may also exhibit such advantages, and not necessarily all embodiments may exhibit such advantages to fall within the scope of the present technology. Thus, the present disclosure and related technology may encompass other embodiments not expressly shown or described herein. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11]

Table 4-12

Table 4-13

Table 4-14

Table 4-15

Table 4-16

Table 4-17

Table 4-18

Table 4-19

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

Claims

1. 1. A method for genetically modifying one or more genes associated with blood type in a cell, the method comprising introducing into the cell a site-specific nuclease or a nucleotide sequence encoding a site-specific nuclease, wherein the one or more genes associated with blood type are selected from ABO, FUT1, and RHD.

2. 2. The method of claim 1, wherein the site-specific nuclease is selected from a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, a CRISPR-associated transposase, and a CRISPR / Cas nuclease.

3. The site-specific nuclease is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, and Cas12c.

3. The method of claim 2, wherein the CRISPR / Cas nuclease is selected from s12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7.

4. 4. The method of claim 3, wherein the method further comprises introducing into the cell a guide RNA (gRNA) that targets the ABO, the FUT1, or the RHD locus.

5. 5. The method of claim 4, wherein the gRNA comprises a crRNA and a trans-activating CRISPR RNA (tracrRNA) as a single guide RNA (sgRNA).

6. The sgRNA (i) a crRNA repeat region comprising the nucleotide sequence set forth in SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:18; (ii) a tetraloop comprising the nucleotide sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 17, and / or (iii) a tracrRNA comprising the nucleotide sequence set forth in SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, or SEQ ID NO:

16. The method of claim 5 , comprising:

7. The crRNA, (i) a complementary region specific to a region of the ABO locus, said complementary region comprising a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 20-203; (ii) a complementary region specific to a region of the FUT1 locus, wherein the complementary region comprises a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 204-420; or (iii) a complementary region specific to a region of the RHD locus, wherein the complementary region comprises a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 421-580; The method of claim 5.

8. 1. A guide RNA (gRNA) for use in genetically modifying one or more genes associated with blood type in a cell, wherein the one or more genes associated with blood type are selected from the group consisting of ABO, FUT1, and RHD.

9. 9. The gRNA of claim 8, wherein the genetic modification is by use of a site-specific nuclease selected from the group consisting of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases, and CRISPR / Cas nucleases.

10. The site-specific nuclease is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, and Cas12.

10. The gRNA of claim 9, wherein the CRISPR / Cas nuclease is selected from the group consisting of Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7.

11. 10. The gRNA of claim 9, wherein the gRNA comprises a crRNA and a trans-activating CRISPR RNA (tracrRNA) as a single guide RNA (sgRNA).

12. The crRNA repeat region (i) a nucleotide sequence set forth in SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:18; (ii) the nucleotide sequence set forth in SEQ ID NO:6 or SEQ ID NO:17, or (iii) a nucleotide sequence set forth in SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:15, or SEQ ID NO:16 The gRNA of claim 11, comprising:

13. 12. The gRNA of Claim 11, wherein the crRNA comprises a complementary region specific to a region of the ABO locus, a complementary region specific to a region of the FUT1 locus, or a complementary region specific to a region of the RHD locus.

14. The complementary region is (i) a nucleotide sequence complementary to the nucleotide sequence set forth in any of SEQ ID NOs: 20-203; (ii) a nucleotide sequence complementary to the nucleotide sequence set forth in any of SEQ ID NOs: 204-420; or (iii) a nucleotide sequence complementary to the nucleotide sequence set forth in any one of SEQ ID NOs: 421 to 580 The gRNA of claim 13, comprising:

15. A composition or cell comprising the gRNA of any one of claims 8 to 14.

16. A novel genome for genetically modifying one or more genes associated with blood type in cells A method for identifying a gene locus, comprising: (a) locating a genomic locus based on a known gRNA; (b) identifying a PAM sequence at about 5′ positions on each side of said genomic locus; and scanning the region from 00 to 4000 bp, wherein one or more of the sequences associated with said blood type are detected. wherein the gene is selected from the group consisting of ABO, FUT1, and RHD, and the gRNA comprises a nucleotide sequence complementary to a nucleotide sequence set forth in any of SEQ ID NOs: 20 to 580.

17. A cell produced by the method according to any one of claims 1 to 7.

18. 18. The cell of claim 17, wherein the cell is a pluripotent stem cell, an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), a mesenchymal stem cell, a hematopoietic stem cell, a blood cell, a primary cell, a cardiomyocyte, a retinal pigment epithelial cell (RPE), an endothelial cell, a beta islet cell, or a glial progenitor cell.

19. 18. The cell of claim 17, wherein the cell is modified to reduce expression of one or more MHC I molecules and / or one or more MHC II molecules.

20. The cell of claim 19, wherein the cell is further modified to express a transgene encoding one or more tolerogenic factors selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, SERPINB9, CCL21, and MFGE8.

21. A pluripotent stem cell or a cell differentiated therefrom, comprising genetic modification of one or more genes associated with blood type, wherein the one or more genes associated with blood type are ABO, FUT1, and / or RHD.

22. A pluripotent cell or a cell differentiated therefrom described in claim 21, wherein the pluripotent stem cell is an embryonic stem cell or an induced pluripotent stem cell.

23. The pluripotent cell or a cell differentiated therefrom described in claim 21, further comprising reduced surface expression of one or more MHC I molecules and / or one or more MHC II molecules, optionally wherein the one or more MHC I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C, and optionally wherein the one or more MHC II molecules are selected from the group consisting of HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO.

24. The pluripotent stem cell or a cell differentiated therefrom described in claim 23, further comprising one or more genetic modifications of B2M, TAP1, CIITA, MIC-A, and / or MIC-B.

25. The pluripotent stem cell or a cell differentiated therefrom according to claim 23, further comprising a gene mutation encoding one or more tolerogenic factors selected from A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, SERPINB9, CCL21, and MFGE8.

26. A pharmaceutical composition comprising the cells described in claim 17.

27. The pharmaceutical composition of claim 26 for treating a disease in a subject in need thereof.

28. Use of the cells of claim 17 in the manufacture of a medicament for treating a disease requiring same.

29. A pharmaceutical composition containing pluripotent stem cells or cells differentiated therefrom described in any one of claims 21 to 25.

30. Use of the pharmaceutical composition of claim 29 for treating a disease in a subject in need thereof.

31. Use of pluripotent stem cells or cells differentiated therefrom described in any one of claims 21 to 25 in the manufacture of a pharmaceutical for treating a disease requiring it.