AAVR knockout mice combined with human liver chimerism and methods of use and production thereof

JP2024534266A5Pending Publication Date: 2025-09-05アバクロームインコーポレイティド
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024537307
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-30
Filing Date
2022-08-30
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

Existing chimeric humanized mouse models for assessing AAV vector transduction efficiency are limited by the transduction of non-human animal cells, which hinders the evaluation of AAV vector efficacy in human hepatocytes.

Method used

Development of a chimeric non-human animal model with human hepatocytes and a deletion or mutation in the adeno-associated virus receptor (AAVR) to create a deficiency or dysfunction, allowing for the assessment of AAV transduction efficiency in human hepatocytes.

Benefits of technology

The model enables precise determination of AAV transduction efficiency in human hepatocytes, distinguishing between AAVR-dependent and -independent transduction mechanisms, thereby improving the evaluation of AAV vector efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure provides immunodeficient or immunocompromised chimeric non-human animals with a deleted or impaired function of the adeno-associated virus receptor (AAVR) comprising human hepatocytes, methods for preparing the chimeric non-human animals comprising the human hepatocytes, and methods for utilizing the chimeric non-human animals comprising the human hepatocytes to assess the transduction efficiency of adeno-associated virus (AAV) and to determine mechanisms of inhibition / modulation of AAV transduction in human hepatocytes.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and benefit of U.S. Provisional Patent Application No. 63 / 238,386, filed August 30, 2021, the contents of which are incorporated herein by reference in their entirety.

[0002] Incorporation by reference of sequence listing The Sequence Listing XML associated with this application has been provided electronically in XML file format and is incorporated herein by reference. The name of the XML file containing the Sequence Listing XML is "AVCR-003_001WO_ST26". The XML file is 35,504 bytes in size, was created on August 24, 2022, and was submitted electronically via the United States Patent and Trademark Office (USPTO) Patent Center. [Background technology]

[0003] 2. Background of the Invention Adeno-associated virus (AAV) vectors are used as viral delivery agents for gene therapy and for creating human disease models. Chimeric humanized mouse models have been used by researchers to determine the transduction efficiency of AAV vector serotypes and their variants, but most AAV serotypes are of limited utility because they preferentially transduce mouse hepatocytes over human hepatocytes. The present disclosure solves these needs in the art by providing an adeno-associated virus receptor (AAVR) knockout human liver chimeric non-human animal model and a method of using it to evaluate AAV transduction efficiency. Summary of the Invention

[0004] Summary of the Invention The present disclosure provides chimeric non-human animals comprising human hepatocytes, wherein the chimeric non-human animals comprise: a) a deficiency or impairment of T-, B- and / or NK cells that allows for re-populating the liver of the non-human animal with human hepatocytes that establish human chimerism; and b) a deletion or mutation in an adeno-associated virus receptor (AAVR) that results in a deficiency or impairment of the non-human animal's AAVR.

[0005] The present disclosure provides a chimeric non-human animal comprising human hepatocytes, wherein the chimeric non-human animal is capable of expressing IL-2Rg - / - / Rag2 - / - In some embodiments, the chimeric non-human animal further comprises a deletion or mutation in the AAVR that results in a deficiency or dysfunction of the non-human animal AAVR. - / - In some embodiments, the chimeric non-human animal does not comprise a transgene. In some embodiments, the transgene is an antibiotic resistance cassette.

[0006] The present disclosure also provides methods of preparing a chimeric non-human animal comprising human hepatocytes, the methods comprising: (a) a deficiency or impairment of T-, B- and / or NK cells that allows for reconstitution of human hepatocytes in the liver of the non-human animal that establishes human chimerism, the non-human animal comprising a deletion or mutation in AAVR resulting in a non-functional non-human animal AAVR; and (b) transplanting the human hepatocytes into the non-human animal. In some embodiments of the methods of preparing a chimeric non-human animal comprising human hepatocytes of the present disclosure, step (b) further comprises applying selection pressure.

[0007] The present disclosure also provides a method for preparing a chimeric non-human animal comprising human hepatocytes, the method comprising: (a) expressing IL-2Rg - / - / Rag2 - / -(b) providing a non-human animal, wherein the non-human animal comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR; and (b) transplanting human hepatocytes into the non-human animal. In some embodiments of the methods of the disclosure, the non-human animal further comprises a step of: - / - In some embodiments of the methods of preparing a chimeric non-human animal comprising human hepatocytes of the present disclosure, step (b) further comprises applying a selection pressure.

[0008] In some embodiments of the methods of the present disclosure, the chimeric non-human animal does not comprise a transgene. In some embodiments of the methods of the present disclosure, the transgene is an antibiotic resistance cassette. The present disclosure also provides chimeric non-human animals produced by the methods disclosed herein.

[0009] The application of the aforementioned selective pressure can include not providing nitisinone (NTBC) to the non-human animal in step (b) of the method of preparing a chimeric non-human animal comprising human hepatocytes of the present disclosure. In some embodiments, the preparation method includes removing the selective pressure after step (b) of the method disclosed herein. Removing the selective pressure can include providing nitisinone (NTBC) to the chimeric non-human animal after step (c) of the method disclosed herein.

[0010] The present disclosure also provides a method for determining the transduction efficiency of an AAV vector in human hepatocytes, the method comprising: (a) providing a chimeric non-human animal prepared by any one of the methods of the present disclosure; (b) infecting the non-human animal of step (a) with an amount of an AAV vector; and (c) determining the level of transduction of the AAV vector into the human hepatocytes and the hepatocytes of the AAVR KO non-human animal (non-human animal hepatocytes). In some embodiments of the method of the present disclosure, in step (c), the level of transduction of the AAV vector into the human hepatocytes or non-human animal hepatocytes is measured as: (i) the percentage of human hepatocytes transduced by the AAV vector, or the percentage of non-human animal hepatocytes transduced by the AAV vector, respectively, in the non-human animal; or (ii) the percentage of the total amount of human hepatocytes or non-human animal hepatocytes transduced by the AAV vector, respectively, in the non-human animal.

[0011] In some embodiments of the methods disclosed herein, the method further includes the step of (d) selecting the AAV vector as efficient for transducing human hepatocytes if: (i) less than a predetermined percentage of the total amount of the AAV vector is transduced into non-human animal hepatocytes; (ii) at least a predetermined percentage of the total amount of the AAV vector is transduced into human hepatocytes; (iii) the percentage of non-human animal hepatocytes transduced by the AAV vector is less than a predefined value; and / or (iv) the percentage of human hepatocytes transduced by the AAV vector is greater than a predefined value.

[0012] The present disclosure also provides a method of determining the transduction efficiency of two or more non-identical AAV vector(s) in human hepatocytes, the method comprising: (a) providing two or more chimeric AAVR KO non-human animals produced by any one of the methods of the present disclosure; (b) infecting each of the non-human animals of step (b) with a predetermined amount of two or more non-identical AAV vectors, where one non-human animal is infected with one AAV vector; and (c) determining a level of transduction of the AAV vector into human hepatocytes and AAVR KO non-human animal hepatocytes (non-human animal hepatocytes) in each of the two or more non-human animals of step (a). In some embodiments of the method of this disclosure, the method further comprises: (d) comparing the level of transduction of each of the two or more AAV vectors into the non-human hepatocytes determined in step (c); and / or (e) comparing the level of transduction of each of the two or more AAV vectors into the human hepatocytes determined in step (c). In some embodiments of the methods of the present disclosure, the methods include (f) selecting one or more AAV vector(s) as efficient for transducing human hepatocytes if: (i) less than a predetermined percentage of the total amount of AAV vectors is transduced into non-human animal hepatocytes; (ii) at least a predetermined percentage of the total amount of AAV vectors is transduced into human hepatocytes; (iii) the percentage of non-human animal hepatocytes transduced by the AAV vector is less than a predefined value; and / or (iv) the percentage of human hepatocytes transduced by the AAV vector is greater than a predefined value.

[0013] The present disclosure also provides a method for determining the efficiency of systemic AAV vector-mediated gene therapy, the method comprising: (a) providing a chimeric non-human animal prepared by any of the methods of the present disclosure; (b) infecting the non-human animal of step (a) at least for the first time with a predetermined amount of an AAV vector; and (c) determining the level of transduction of the AAV vector into human hepatocytes of the AAVR KO non-human animal. In some embodiments of the methods of the present disclosure, the method comprises: (d) infecting the non-human animal for a second time with a predetermined amount of an AAV vector; (e) maintaining the infected non-human animal of step (d) for a predetermined period of time; and (g) determining the level of transduction of the AAV vector into human hepatocytes of the AAVR KO non-human animal. In some embodiments of the methods of the present disclosure, the method further comprises: (i) comparing the level of transduction of the AAV vector into human hepatocytes between the first and second infections.

[0014] The present disclosure also provides a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes, the method comprising: (a) providing two or more non-human animals prepared by any one of the methods of the present disclosure divided into two groups, group A and group B, each group comprising one or more non-human animals, wherein group A receives wild-type human hepatocytes, and group B receives human hepatocytes comprising an AAVR deletion or mutation resulting in non-functional human AAVR (Hu AAVR (b) receiving one or more infected non-human animals of each group of step (a) with an AAV vector; and (c) determining a level of transduction of the AAV vector into human hepatocytes of the non-human animals of group A and group B, wherein the level of transduction of the AAV vector in group A is indicative of AAVR-dependent transduction efficiency, and the level of transduction in group B is indicative of AAVR-independent transduction efficiency.

[0015] The disclosure also provides a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the method comprising: (a) providing two groups of non-human animals, group A and group B, where group A comprises one or more of T-, B- and NK cells that are deficient or dysfunctional in the non-human animal, and group B comprises one of T-, B- and NK cells that are deficient or dysfunctional in the non-human animal, and further comprising determining whether or not the AAVR has been induced to result in a non-functional non-human animal AAVR. wherein one or more of the deficient or impaired T-, B- and NK cells allow reconstitution of human hepatocytes establishing human chimerism in the liver of the non-human animal; (b) transplanting the human hepatocytes into one or more of the non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of AAV vector transduction into the human hepatocytes and non-human hepatocytes of the non-human animals of groups A and B. In some embodiments of the methods of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, step (b) further comprises applying selection pressure.

[0016] The disclosure also provides a method for determining AAVR-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into human hepatocytes, the method comprising: (a) providing two groups of non-human animals, group A and group B, where group A is an animal that is capable of expressing one or more IL-2Rg - / - / Rag2 - / - Group B includes one or more IL-2Rg receptors that further include a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR. - / - / Rag2 - / -(b) transplanting human hepatocytes into one or more of the non-human animals of both groups of step (a); (c) infecting the non-human animals of both groups of step (b) with an AAV vector; and (d) determining the level of transduction of the AAV vector into the human hepatocytes and non-human hepatocytes of the non-human animals of groups A and B. In some embodiments of the methods of this disclosure, the non-human animals further comprise Fah - / - In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, step (b) further comprises applying selective pressure. In some embodiments of the method of the present disclosure, applying selective pressure comprises not applying nitisinone (NTBC) to the non-human animal of step (b). In some embodiments of the method of the present disclosure, the method further comprises removing selective pressure after step (b).

[0017] In some embodiments of the methods of the present disclosure, the method further comprises: (e) comparing the levels of AAV vector transduction into human hepatocytes and non-human hepatocytes of the non-human animal between group A and group B, (i) wherein a difference between the levels of AAV transduction into the non-human hepatocytes and human hepatocytes of group A is indicative of both AAVR-dependent and independent modulation and / or inhibition of AAV vector uptake into human hepatocytes; (ii) wherein a difference between the levels of AAV transduction into the non-human hepatocytes and human hepatocytes of group B is indicative of both AAVR-independent modulation and / or inhibition of AAV vector uptake into human hepatocytes; and (iii) wherein a difference between the levels of AAV transduction into human hepatocytes in groups B and A is indicative of AAVR-dependent modulation and / or inhibition of AAV vector uptake into human hepatocytes.

[0018] In another aspect, provided herein is a chimeric non-human animal comprising at least two human tissues, wherein the chimeric non-human animal further comprises: (a) a deficiency or impairment in T-, B- and / or NK cells that allows for the reconstitution of one or more human tissues establishing human chimerism in the non-human animal; and (b) a deletion or mutation in the adeno-associated virus receptor (AAVR) that results in a deficiency or impairment in the non-human animal AAVR. In another aspect, provided herein is a chimeric non-human animal comprising one or more human tissues, wherein the chimeric non-human animal further comprises: - / - / Rag2 - / - In some embodiments, the chimeric non-human animal is a chimeric non-human animal, and wherein the chimeric non-human animal further comprises a deletion or mutation in AAVR resulting in a deficiency or dysfunction of the non-human animal AAVR. In some embodiments, the chimeric non-human animal is a chimeric non-human animal that expresses IL-2Rg. - / - / Rag2 - / - / Fah - / - It is a non-human animal.

[0019] In another aspect, provided herein is a method for preparing a chimeric non-human animal comprising one or more human tissues, the method comprising: (a) providing deficient or impaired T-, B- and / or NK cells in a non-human animal that allow for reconstitution of human tissues that establish human chimerism in the non-human animal, the non-human animal comprising an AAVR deletion or mutation resulting in a non-functional non-human animal AAVR; and (b) transplanting one or more human tissues into the non-human animal. ... - / - / Rag2 - / - The method includes the steps of: (a) providing a non-human animal, wherein the non-human animal comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR; and (b) transplanting human tissue into the non-human animal. In some embodiments, the non-human animal further comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR. - / - Includes.

[0020] In another aspect, provided herein is a method for determining the transduction efficiency of an AAV vector in one or more human tissues, the method comprising: (a) providing a non-human animal as described herein; (b) infecting the non-human animal of step (a) with a predetermined amount of an AAV vector; and (c) determining the level of transduction of the AAV vector into a human tissue of the AAVR KO non-human animal.

[0021] In another aspect, provided herein is a method for determining the transduction efficiency of two or more non-identical AAV vector(s) in at least two one or more human tissues, the method comprising: (a) providing two or more AAVR KO non-human animals described herein; (b) infecting each of the non-human animals of step (a) with a predetermined amount of two or more non-identical AAV vectors, wherein each non-human animal is infected with one AAV vector; and (c) determining the level of transduction of the AAV vectors into at least one human tissue in each of the two or more non-human animals of step (b).

[0022] In another aspect, provided herein is a method for determining the efficiency of systemic AAV vector-mediated gene therapy, comprising: (a) providing a non-human animal as described herein; (b) at least initially infecting the non-human animal of step (a) with a predetermined amount of an AAV vector; and (c) determining the level of transduction of the AAV vector into human tissue of the AAVR KO non-human animal.

[0023] In another aspect, provided herein is a method of determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent transduction efficiency of an AAV vector in one or more human tissues, the method comprising: (a) providing non-human animals divided into two groups, group A and group B, each group comprising one or more non-human animals, wherein group A is transplanted with wild-type human tissue and group B is transplanted with human tissue comprising an adeno-associated virus receptor (AAVR) deletion or mutation resulting in non-functional human AAVR, the two or more non-human animals further comprising: - / - / Rag2 - / - / and / or Fah - / - (b) infecting one or more non-human animals in each group of step (a) with an AAV vector; and (c) determining the level of transduction of the AAV vector into one or more human tissues of the non-human animals in groups A and B, wherein the level of transduction in group A is indicative of AAVR-dependent transduction efficiency of the AAV vector, and the level of transduction in group B is indicative of AAVR-independent transduction efficiency.

[0024] In another aspect, provided herein is a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into human tissue, the method comprising: (a) providing groups of non-human animals, group A and group B, where group A comprises one or more T-, B-, and NK cells that are deficient or dysfunctional in the non-human animal, and group B comprises one T-, B-, and NK cell that are deficient or dysfunctional in the non-human animal, and further comprising administering to the non-human animal a non-functional non-human animal AAVR; (b) transplanting one or more human tissues into one or more non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of transduction of the AAV vector into human tissues of the non-human animals of groups A and B.

[0025]

[0013] In another aspect, provided herein is a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into one or more human tissues, the method comprising: (a) providing two groups of non-human animals, group A and group B, wherein group A is a human animal that is capable of expressing one or more IL-2Rg - / - / Rag2 - / - Group B includes one or more IL-2Rg receptors that further include a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR. - / - / Rag2 - / - (b) transplanting one or more human tissues into one or more non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of transduction of the AAV vector into the human tissues of the non-human animals of groups A and B. In some embodiments, the non-human animals further comprise Fah - / - Includes.

[0026] It will be understood that throughout this specification the word "comprising" or variations thereof, such as "comprises" or "comprising", implies the inclusion of a stated element, integer or step, or group of elements, integers or steps, but does not exclude any other element, integer or step, or group of elements, integers or steps.

[0027] About may be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about."

[0028] While the present disclosure will be described in conjunction with its detailed description, the foregoing description is intended to illustrate, but not limit, the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0029] The patent and scientific literature referred to herein establishes knowledge available to those skilled in the art. All U.S. patents and published or unpublished U.S. patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are incorporated by reference. Genbank and NCBI submissions designated by deposit numbers listed herein are incorporated by reference. All other published references, documents, manuscripts and scientific papers listed herein are incorporated by reference. [Brief description of the drawings]

[0030] BRIEF DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0031] The above and further features will be more clearly understood from the following detailed description when considered in conjunction with the accompanying drawings.

[0032] [Figure 1] 1A-1B depict the generation of AAVR CRISPR-KO strains. FIG. 1A is a schematic diagram of the AAVR gene with boxes depicting exons (exon 1 (E1) to exon 6 (E6)). FIG. 1B depicts gel electrophoresis pictures of PCR amplification showing the generation of homozygous and heterozygous AAVR KO mice using intronic primers. Shown are wild-type (2.3 kbp) and knockout (0.2 kbp) bands in the gel electrophoresis gel from the generated homozygous and heterozygous animals.

[0033] [Diagram 2] Figures 2A-2B depict the genotyping scheme and probes / primers for TIRFA (transgene-free Il2rg- / - / Rag2- / - / Fah- / - / AAVR- / -) KO mice. Figure 2A is a schematic of semi-quantitative PCR using Taqman probes. Figure 2B depicts the primer sequences and reporters used in semi-quantitative PCR.

[0034] [Diagram 3]Figure 3 depicts transduction of human liver chimeric mice with different AAV serotypes. The x-axis depicts the identity of the AAV vector with respect to capsid (serotype / variant), promoter type and detectable / reporter gene used to transduce FRG (Fah- / - / Rag2- / - / Il2rg- / -) human liver chimeric mice as indicated. The y-axis depicts the transduction rate of human hepatocytes (white bars) and mouse hepatocytes (black bars) in the human chimeric liver of FRG human liver chimeric mice. Data shown in each bar are the mean ± SEM of 5-11 sets of images of each chimeric mouse liver. Figure 3 depicts data partially adapted from Bissig-Choisat B. et al. (Nature communications, 2015).

[0035] [Figure 4] Figures 4A-4F depict the transduction of human liver chimeric FRG mice with AAV8 and AAV9, adapted from Bissig-Choisat B (Nature communications 2015). Figures 4A-4C show the transduction of hepatocytes of FRG mice transduced with AAV8. Figures 4D-4F show the transduction of hepatocytes of FRG mice transduced with AAV9. Transduced mouse hepatocytes are indicated by arrows, and transduced human hepatocytes are indicated by arrowheads. Figures 4B and 4F are magnified specimens (scale bar 50∞m) marked by white squares in Figures 4A and 4D, respectively.

[0036] [Diagram 5]Figures 5A-5L depict transduction of AAVR knockout human liver chimeric TIRFA (transgene-free Il2rg- / - / Rag2- / - / Fah- / - / AAVR- / -) mice with AAV9. Figures 5A-5F depict representative immunofluorescence staining panels from duplicate experiments showing transduction of hepatocytes with AAV9 in human liver chimeric mice with homozygous deletion of AAVR (TIRFA / AAVR- / -). Figures 5G-5L depict duplicate experiments showing transduction of hepatocytes with AAV9 in human liver chimeric TIRFA mice with heterozygous deletion of AAVR (TIRFA / AAVR+ / -). Figures 5A, 5D, 5G, and 5J depict panels showing staining (dTomato) of AAV vector transduction. Figures 5B, 5E, 5H and 5K depict panels showing human hepatocyte FAH staining (human LDHA). Figures 5C, 5F, 5I and 5L depict overlays of staining for AAV vector transduction and human hepatocytes.

[0037] [Figure 6] Figures 6A and 6B depict AAV8 transduction in humanized TIRF and TIRFA mice. Humanized TIRF (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr+ / +) (Figure 6A) and humanized TIRFA (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr- / -) (Figure 6B) mice were injected with 1x1012 GCs per mouse of AAV8 carrying the td-Tomato expression cassette. Mice were euthanized 72 hours later and livers were collected and stained for the human marker LDH (light grey) and the viral transgene td-Tomato (black) to show co-localization.

[0038] [Figure 7]Figures 7A and 7B depict AAV9 transduction in humanized TIRF and TIRFA mice. Humanized TIRF (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr+ / +) (Figure 7A) and humanized TIRFA (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr- / -) (Figure 7B) mice were injected with 1x1012 GCs per mouse of AAV9 carrying the td-Tomato expression cassette. Mice were euthanized 72 hours later and livers were collected and stained for the human marker LDH (light grey) and the viral transgene td-Tomato (black) to show co-localization.

[0039] [Figure 8] Figures 8A and 8B depict quantification of AAV transduction efficiency of human hepatocytes in humanized TIRFA mice. Humanized TIRF mice (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr+ / +) and humanized TIRFA mice (transgene-free Il2rg- / - / / Rag2- / - / Fah- / - / Aavr- / -) were injected with 1x1012 GCs per mouse of AAV8 (Figure 8A) or AAV9 (Figure 8B) carrying a td-Tomato expression cassette. Mice were euthanized 72 hours later, and livers were collected and stained for human marker LDH and viral transgene (td-Tomato). Quantification of co-localization of td-Tomato and LDH, e.g., AAV transduction of human hepatocytes in TIRF and TIRFA mice, is depicted. Three mice with 3-5 liver sections each were used for this determination.

[0040] [Figure 9] FIG. 9 is a schematic showing the experimental set-up of the teratoma assay described in Example 5.

[0041] [Figure 10]Figure 10 depicts the fluorescence of freshly harvested livers and teratomas. Humanized and non-humanized TIRFA mice were subcutaneously injected with induced pluripotent stem (iPS) cells ~1x107, and after teratomas developed (~3 months after injection), 1x1012 GCs per mouse carrying an expression cassette for GFP were injected intravenously. 72 hours after AAV injection, mice were euthanized. Livers and teratomas were exposed to a low-wavelength lamp to reveal tissue fluorescence. Note: The patchy fluorescence in the liver of TIRFA mice is derived from human liver regions.

[0042] [Figure 11] Figure 11 depicts the AAV9 transduction efficiency of human cells in teratomas of TIRFA mice without human liver. TIRFA mice were subcutaneously injected with induced pluripotent stem (iPS) cells ~1x107, and after teratomas developed (~3 months after injection), 1x1012 GCs per mouse of AAV9 carrying an expression cassette for GFP were injected intravenously. 72 hours after AAV injection, mice were euthanized and teratomas were analyzed by H&E staining (11A) and GFP immunostaining (11B). Serial sections of teratomas are shown, showing the differential transduction efficiency of different human tissues in teratomas.

[0043] [Figure 12] Figure 12 depicts the AAV9 transduction efficiency of human small intestinal cells in teratomas of TIRFA mice without human liver. The teratomas are the same as those shown in Figure 11, but here shown is selection of endodermal tissue, e.g., small intestinal tissue, in teratomas transduced with AAV9-GFP.

[0044] [Figure 13] Figure 13 depicts AAV9 transduction efficiency of human mesoderm in teratomas of TIRFA mice without human liver. The teratomas are the same as those shown in Figure 11, but here shown is a selection of mesodermal tissues transduced with AAV9-GFP.

[0045] [Figure 14] Figures 14A-14D depict AAV9 transduction efficiency of human teratomas in TIRFA mice with human liver. Human liver TIRFA mice were subcutaneously injected with induced pluripotent stem (iPS) cells ~10E7, and after teratomas developed (~3 months after injection), 1x1012 GCs per mouse of AAV9 carrying an expression cassette for GFP were injected intravenously. 72 hours after AAV injection, mice were euthanized and analyzed by H&E staining (14A and 14C) and GFP immunostaining (14B and 14D). Serial sections of teratomas are shown showing the differential transduction efficiency of human teratomas tissue. Arrows (14C and 14D) indicate non-transduced smooth muscle tissue, and arrowheads (14C and 14D) indicate transduced glandular structures. The box in 14A is the enlarged area of ​​the teratoma in 14C, and the box in 14B is the enlarged area in 14D. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0046] Detailed Description of the Invention The present disclosure provides chimeric non-human animals comprising human hepatocytes, wherein the chimeric non-human animal comprises: a) a deficiency or impairment of T-, B- and / or NK cells that allows for reconstitution of human hepatocytes establishing human chimerism in the liver of the non-human animal; and b) a deletion or mutation in the adeno-associated virus receptor (AAVR) that results in a deficiency or impairment of the non-human animal AAVR.

[0047] The present disclosure relates to a chimeric non-human animal comprising human hepatocytes, wherein the chimeric non-human animal is capable of expressing IL-2Rg - / - / Rag2 - / - In some embodiments, the chimeric non-human animal further comprises a chimeric non-human animal, and wherein the chimeric non-human animal comprises a deletion or mutation in AAVR that results in a deficiency or dysfunction of the non-human animal AAVR. - / - Includes.

[0048] In some embodiments of the chimeric non-human animals of the present disclosure, the chimeric non-human animal comprises IL-2rg - / - / Rag2 - / - / Fah - / - In some embodiments of the chimeric non-human animal of the present disclosure, the human hepatocytes that account for at least 5%; at least 10%; at least 20%; at least 30%; at least 40%; at least 50%; at least 70%; at least 80%; at least 90%; at least 95% or at least 99% of all hepatocytes in the liver of the chimeric non-human animal are human hepatocytes.In some embodiments of the chimeric non-human animal of the present disclosure, the human hepatocytes account for at least 70% (e.g., 70%, 80%, 90%, 95% or 97%) of all hepatocytes in the liver of the chimeric non-human animal.

[0049] In some embodiments of the chimeric non-human animals of the present disclosure, upon infection with the AAV vector, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5% of the endogenous hepatocytes of the non-human chimeric animal are transduced by the AAV vector.

[0050] In some embodiments of the chimeric non-human animals of the present disclosure, upon infection with the AAV vector, at least 10%, at least 20%, at least 30%, at least 50%, at least 70%, at least 80%, or at least 90% of the human hepatocytes are transduced with the AAV vector. In some embodiments of the chimeric non-human animals of the present disclosure, upon infection with the AAV vector, at least 50% (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%) of the human hepatocytes are transduced with the AAV vector.

[0051] Adeno-associated virus (AAV), a member of the parvovirus family, is a small, non-enveloped, icosahedral virus with a single-stranded linear DNA genome of 4.7 kilobases (kb) to 6 kb. The life cycle of AAV includes a latent phase after infection during which the AAV genome is integrated into the host genome, and an infectious phase during which the integrated AAV genome is sequentially rescued, replicated, and packaged into infectious virus after infection with either adenovirus or herpes simplex virus. The non-pathogenic, broad host range of infection, including non-dividing cells, and integrative properties make AAV an attractive delivery vehicle.

[0052] In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is any one of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is AAV serotype 8. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is AAV serotype 9. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is an AAV serotype that specifically infects or transduces the liver of a subject. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is an AAV serotype that specifically infects or transduces hepatocytes. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is a hybrid of two or more AAV serotypes. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV is a variant selected from any one of 6.2, 2, rh64R1, rh10, 8, 9 and AAV9-PHP.B. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV vector encodes a detectable molecule. In some embodiments of the chimeric non-human animal of the present disclosure, the detectable molecule is a fluorescent protein, an enzyme, or a peptide. In some embodiments of the chimeric non-human animal of the present disclosure, the detectable molecule is GFP, RFP, YFP, CFP, dTomato, mCherry, or LacZ (β-galactosidase). In some embodiments of the chimeric non-human animal of the present disclosure, the AAV vector comprises an inducible promoter or a constitutive promoter. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV vector comprises a tissue-specific promoter. In some embodiments of the chimeric non-human animal of the present disclosure, the inducible promoter is a tetracycline-inducible promoter or a CMV promoter. In some embodiments of the chimeric non-human animal of the present disclosure, the AAV vector encodes one or more heterologous proteins. In some embodiments of the chimeric non-human animals of the present disclosure, the one or more heterologous proteins can be selected from any one of an immunogenic protein or peptide, a therapeutic protein, a regulatory protein, or a marker / detectable protein.

[0053] In some embodiments of the chimeric non-human animals of the present disclosure, the chimeric non-human animal can be any one of a primate, bird, mouse, rat, poultry, dog, cat, cow, horse, goat, camel, sheep, and pig. In some embodiments of the chimeric non-human animals of the present disclosure, the chimeric non-human animal is a mouse.

[0054] The present disclosure also provides a method of preparing a chimeric non-human animal comprising human hepatocytes, the method comprising: (a) providing a non-human animal with deficient or impaired T-, B- and / or NK cells that allow for reconstitution of human hepatocytes establishing human chimerism in the liver of the non-human animal, wherein the non-human animal comprises a deletion or mutation in AAVR resulting in a non-functional non-human animal AAVR; and (b) transplanting the human hepatocytes into the non-human animal. In some embodiments of preparing a chimeric non-human animal comprising human hepatocytes of the present disclosure, step (b) further comprises applying selection pressure.

[0055] The present disclosure also provides a method for preparing a chimeric non-human animal comprising human hepatocytes, the method comprising: (a) expressing IL-2Rg - / - / Rag2 - / - (b) providing a non-human animal, wherein the non-human animal comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR; and (b) transplanting human hepatocytes into the non-human animal. In some embodiments of the methods of the disclosure, the non-human animal further comprises Fah - / - In some embodiments of the methods of preparing a chimeric non-human animal comprising human hepatocytes of the present disclosure, step (b) further comprises applying a selection pressure.

[0056] In some embodiments of the method of this disclosure, applying the selective pressure comprises not providing nitisinone (NTBC) to the non-human animal of step (b). In some embodiments of the method of this disclosure, the method further comprises removing the selective pressure after step (c) of the method disclosed herein. Removing the selective pressure can comprise providing nitisinone (NTBC) to the chimeric non-human animal after step (c) of the method disclosed herein. In some embodiments of the method of this disclosure, the chimeric non-human animal does not comprise a transgene. In some embodiments of the method of this disclosure, the transgene is an antibiotic resistance cassette. The present disclosure also provides chimeric non-human animals produced by the methods disclosed herein.

[0057] In some embodiments of the preparation methods of the disclosure, the chimeric non-human animal is - / - / Rag2 - / - / Fah - / - In some embodiments of the preparation methods of the present disclosure, the chimeric non-human animal is an IL-2Rg - / - / Rag2 - / - / Fah - / - a chimeric non-human animal, wherein the chimeric non-human animal does not comprise an antibiotic selection gene cassette.

[0058] In some embodiments of the preparation method of the present disclosure, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95% or at least 97% of all hepatocytes in the liver of the chimeric non-human animal are human hepatocytes.In some embodiments of the preparation method of the present disclosure, at least 70% (e.g., 70%, 80%, 90%, 95% or 97%) of all hepatocytes in the liver of the chimeric non-human animal are human hepatocytes.

[0059] In some embodiments of the preparation methods of the disclosure, after infection with the AAV vector, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5% of the endogenous hepatocytes of the non-human chimeric animal are transduced by the AAV vector.

[0060] In some embodiments of the preparation method of the present disclosure, after infection with the AAV vector, at least 10%, at least 20%, at least 30%, at least 50%, at least 70%, at least 80%, or at least 90% of the human hepatocytes are transduced with the AAV vector. In some embodiments of the preparation method of the present disclosure, after infection with the AAV vector, at least 50% (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%) of the human hepatocytes are transduced with the AAV vector.

[0061] In some embodiments of the preparation method of this disclosure, the AAV is any one of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11. In some embodiments of the preparation method of this disclosure, the AAV is AAV serotype 8. In some embodiments of the preparation method of this disclosure, the AAV is AAV serotype 9. In some embodiments of the preparation method of this disclosure, the AAV is an AAV serotype that specifically infects and / or transduces the liver of a subject. In some embodiments of the preparation method of this disclosure, the AAV is an AAV serotype that specifically infects and / or transduces hepatocytes. In some embodiments of the preparation method of this disclosure, the AAV is a hybrid of two or more AAV serotypes. In some embodiments of the preparation method of this disclosure, the AAV is a variant selected from any one of 6.2, 2, rh64R1, rh10, 8, 9 and AAV9-PHP.B. In some embodiments of the preparation method of this disclosure, the AAV vector encodes a detectable molecule. In some embodiments of the preparation method of this disclosure, the detectable molecule is a fluorescent protein, an enzyme, or a peptide. In some embodiments of the preparation method of this disclosure, the detectable marker is GFP, RFP, YFP, CFP, dTomato, mCherry, or LacZ (β-galactosidase). In some embodiments of the preparation method of this disclosure, the AAV vector comprises an inducible promoter or a constitutive promoter. In some embodiments of the preparation method of this disclosure, the AAV vector comprises a tissue-specific promoter. In some embodiments of the preparation method of this disclosure, the inducible promoter is a tetracycline-inducible promoter or a CMV promoter. In some embodiments of the preparation method of this disclosure, the AAV vector encodes one or more heterologous proteins. In some embodiments of the preparation method of this disclosure, the one or more heterologous proteins can be selected from any one of immunogenic proteins or peptides, therapeutic proteins, regulatory proteins, or markers / detectable proteins.In some embodiments of the preparation method of the present disclosure, the AAV vector comprises a unique nucleic acid sequence in the genome of the vector, where the unique nucleic acid sequence can be transcribed into a detectable RNA sequence or barcode RNA sequence. The detectable RNA sequence or barcode RNA sequence of the AAV vector is different from the detectable RNA sequence or barcode RNA sequence of any other vector used in the method of the present disclosure. The AAV vector can comprise any unique nucleic acid sequence in the genome of the AAV vector, or a detectable RNA sequence or barcode RNA sequence of an AAV vector known in the art (e.g., Adachi K et al., Molecular Therapy Volume 22, Supplement 1, May 2014; Adachi K et al., Nature Communications volume 5, Article number: 3075 (2014); Pekrun K et al., JCI Insight. 2019;4(22):e131610; US20190135871A1; and WO2020160508A1).

[0062] In some embodiments of the preparation method of this disclosure, the AAVR of the non-human animal can be deleted by CRISPR / Cas9-mediated deletion of the non-human animal AAVR, or by knockdown with an exogenous agent, or by a first dose of a virus encoding Cre recombinase or a Cre transgenic non-human animal, by a floxed allele of the non-human animal AAVR gene. In some embodiments of the preparation method of this disclosure, the AAVR of the non-human animal can be deleted by one or more RNA interference (RNAi) targeting AAVR mRNA. In some embodiments of the preparation method of this disclosure, the variant AAVR can include one or more modified amino acids with respect to the amino acid sequence of wild-type AAVR, which results in a reduced surface expression level or cell surface transport compared to wild-type AAVR. In some embodiments of the preparation methods of this disclosure, the variant AAVR comprises one or more altered amino acids and / or deletions of a signaling peptide, one or more polycystic kidney disease-like (PKD) domains, a motif with eight cysteines at the N-terminus (MANEC) domain, a transmembrane domain and / or a cytosolic tail compared to the amino acid sequence of a wild-type AAVR.

[0063] In some embodiments of the preparation method of the present disclosure, the chimeric non-human animal can be any one of a primate, a bird, a mouse, a rat, a poultry, a dog, a cat, a cow, a horse, a goat, a camel, a sheep, and a pig. In some embodiments of the preparation method of the present disclosure, the chimeric non-human animal is a mouse.

[0064] The present disclosure also provides a method for determining the transduction efficiency of an AAV vector in human hepatocytes, the method comprising: (a) providing a chimeric non-human animal prepared by any one of the methods of the present disclosure; (b) infecting the non-human animal of step (a) with a predetermined amount of an AAV vector; (c) maintaining the infected non-human animal of step (b) for a predetermined period of time; and (d) determining the level of transduction of the AAV vector into human hepatocytes and into hepatocytes of an AAVR KO non-human animal (non-human animal hepatocytes).

[0065] In some embodiments of the method of determining transduction efficiency disclosed herein, the level of transduction of the AAV vector into human hepatocytes or non-human animal hepatocytes in step (d) is measured as: (i) the percentage of human hepatocytes transduced by the AAV vector or the percentage of non-human animal hepatocytes transduced by the AAV vector, respectively, in the non-human animal; or (ii) the percentage of the total amount of AAV vector transduced into human hepatocytes or non-human animal hepatocytes, respectively, in the non-human animal.

[0066] In some embodiments of the method of determining transduction efficiency disclosed herein, the method further comprises the step of: (f) selecting the AAV vector as efficient for transducing human hepatocytes if: (i) less than a predetermined percentage of the total amount of the AAV vector is transduced into non-human animal hepatocytes; (ii) at least a predetermined percentage of the total amount of the AAV vector is transduced into human hepatocytes; (iii) the percentage of non-human animal hepatocytes transduced by the AAV vector is less than a predefined value; and / or (iv) the percentage of human animal hepacytosys transduced by the AAV vector is greater than a predefined value.

[0067] The present disclosure also provides a method for determining the transduction efficiency of two or more non-identical AAV vector(s) in human hepatocytes, the method comprising: (a) providing two or more chimeric AAVR KO non-human animals produced by any one of the methods of the present disclosure; (b) infecting each of the non-human animals of step (a) with a predetermined amount of two or more non-identical AAV vectors, where one non-human animal is infected with one AAV vector and the other animal is infected with the other AAV vector; (c) maintaining the infected non-human animals of step (b) for a predetermined period of time; and (d) determining the level of transduction of the AAV vector into human hepatocytes and AAVR KO non-human animal hepatocytes (non-human animal hepatocytes) in each of the two or more non-human animals of step (c). In some embodiments of the methods of this disclosure, the method further comprises removing the selection pressure after step (b). In some embodiments of the methods of this disclosure, the method further comprises: (e) comparing the level of transduction of each of the two or more AAV vectors into the non-human hepatocytes determined in step (d); and / or (f) comparing the level of transduction of each of the two or more AAV vectors into the human hepatocytes determined in step (d). In some embodiments of the methods of this disclosure, the method further comprises: (g) selecting one or more AAV vector(s) as efficient for transducing human hepatocytes if: (i) less than a predetermined percentage of the total amount of AAV vectors is transduced into the non-human animal hepatocytes; (ii) at least a predetermined percentage of the total amount of AAV vectors is transduced into the human hepatocytes; (iii) the percentage of non-human animal hepatocytes transduced by the AAV vector is less than a predetermined value; and / or (iv) the percentage of human animal hepatocytes transduced by the AAV vector is greater than a predetermined value.

[0068] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, in (i), the predetermined percentage of the total amount of the AAV vector transduced into the non-human animal hepatocyte is ≦100%, ≦90%, ≦80%, ≦70%, ≦50%, ≦20%, ≦10%, or ≦5%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocyte is 70% to 90%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocyte is 50% to 70%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocyte is 20% to 50%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 10% to 20%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 5% to 10%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 0% to 5%.

[0069] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, in (ii), the predetermined percentage of the total amount of the AAV vector transduced into the human hepatocytes is ≧99%, ≧95%, ≧90%, ≧80%, ≧70%, ≧50%, ≧20%, or ≧10%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 95% to 100%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 90% to 95%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 80% to 90%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into human hepatocytes is 70% to 80%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into human hepatocytes is 50% to 70%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into human hepatocytes is 20% to 50%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into human hepatocytes is 10% to 20%.

[0070] In some embodiments of the method for determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 0% to 5%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 95% to 100%. In some embodiments of the method for determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 5% to 10%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 90% to 95%. In some embodiments of the method for determining the transduction efficiency of an AAV vector of the present disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 10% to 20%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 80% to 90%. In some embodiments of the method for determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 20% to 50%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 50% to 80%. In some embodiments of the method for determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 50% to 70%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 20% to 50%. In some embodiments of the method for determining the transduction efficiency of an AAV vector of this disclosure, the percentage of the total amount of the AAV vector transduced into the non-human animal hepatocytes is 70% to 80%, and the percentage of the total amount of the AAV vector transduced into the human hepatocytes is 10% to 20%. In some embodiments of the method of determining the transduction efficiency of an AAV vector disclosed herein, the percentage of the total amount of AAV vector transduced into non-human animal hepatocytes is between 80% and 90%, and the percentage of the total amount of AAV vector transduced into human hepatocytes is between 10% and 20%.

[0071] The percentage of the total amount of AAV vector transduced into non-human animal hepatocytes and non-human hepatocytes depends on the specific AAV serotype used to infect the chimeric non-human animal of the present disclosure. In some embodiments, the transduction of AAV vector into non-human hepatocytes can be mediated only by AAVR. In some embodiments, the transduction of AAV vector into non-human hepatocytes can be mediated only by one or more receptors other than AAVR (non-AAVR receptors). In some embodiments, the transduction of AAV vector into non-human hepatocytes can be mediated by both AAVR and one or more receptors other than AAVR (non-AAVR receptors).

[0072] The percentage of the total amount of AAV vector transduced into the non-human animal hepatocytes can be determined by any method known in the art, including collecting the liver of the chimeric non-human animal infected with the AAV vector, determining the amount of AAV vector recovered from the human hepatocytes or non-human hepatocytes or both isolated from the liver, and comparing or determining the ratio of the determined amount of AAV vector recovered to the total amount of AAV vector used to infect the animal. In some embodiments, the determined amount of AAV vector recovered from the liver or the ratio of the determined amount of AAV vector recovered to the total amount of AAV vector used to infect the animal can be correlated with the percentage of endogenous cells / non-human hepatocytes of the chimeric non-human animal transduced with AAV.

[0073] In some embodiments, the percentage of the total amount of AAV vector transduced into non-human animal hepatocytes can be determined by generating a standard curve by comparing / plotting the average detectable signal intensity or the total number of transduced mouse cells / hepatocytes in a control non-human animal for / against increasing amounts of AAV vector used to transduce the non-human animal. The control non-human animals described herein are either wild type or IL-2Rg - / - / Rag2 - / - Non-human animals, or IL-2Rg - / - / Rag2 - / - / Fah - / -The non-human animal may be a non-human animal with a deficiency or dysfunction of T-, B- and / or NK cells without a deletion or mutation of adeno-associated virus receptor (AAVR). The percentage of the total amount of AAV vector transduced into the non-human animal hepatocytes or human hepatocytes or both of the chimeric non-human animal of the method of the present disclosure can be determined based on the standard curve described herein. In some embodiments, all or at least 99% of the total amount of AAV vector used to infect the control non-human animal is estimated to be transduced into the non-human animal hepatocytes.

[0074] In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the predetermined value of the percentage of non-human animal hepatocytes transduced by the AAV vector in (iii) is ≦50%, ≦40%, ≦30%, ≦20%, ≦10%, or ≦5%.

[0075] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is 40% to 50%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is 30% to 40%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is 20% to 30%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is 10% to 20%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is 5% to 10%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is between 0% and 5%.

[0076] In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the predetermined value of the percentage of human animal hepatocytes transduced by the AAV vector in (iv) is ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%.

[0077] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human hepatocytes transduced by the AAV vector is 90% to 97%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human hepatocytes transduced by the AAV vector is 80% to 90%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human animal hepatocytes transduced by the AAV vector is 70% to 80%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human hepatocytes transduced by the AAV vector is 50% to 70%. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human hepatocytes transduced by the AAV vector is 20% to 50%. In some embodiments of the methods of determining the transduction efficiency of an AAV vector of this disclosure, the percentage of human hepatocytes transduced by the AAV vector is between 10% and 20%.

[0078] In some embodiments of the disclosed method of determining the transduction efficiency of an AAV vector, the percentage of non-human animal hepatocytes transduced by the AAV vector can be 40% to 50%, 30% to 40%, 20% to 30%, 10% to 20%, 5% to 10%, or 0% to 5%; and the percentage of human animal hepatocytes transduced by the AAV vector can be 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0079] The percentage of non-human animal hepatocytes and non-human hepatocytes transduced by AAV vectors depends on the specific AAV serotype used to infect the chimeric non-human animal of the present disclosure. In some embodiments, the transduction of AAV vectors into human or non-human hepatocytes can be mediated only by AAVR. In some embodiments, the transduction of AAV vectors into human or non-human hepatocytes can be mediated only by one or more receptors other than AAVR (non-AAVR receptors). In some embodiments, the transduction of AAV vectors into human or non-human hepatocytes can be mediated by both AAVR and one or more receptors other than AAVR (non-AAVR receptors). The transduction of AAV into human or non-human hepatocytes can be mediated by either AAVR or non-AAVR receptors, depending on the specific serotype or serotype variant of AAV. The transduction of AAV into human or non-human hepatocytes can be mediated by either AAVR or non-AAVR receptors, depending on the specific capsid protein of AAV.

[0080] In some embodiments of the methods of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 1 ~1×10 15 In some embodiments of the method of determining the transduction efficiency of an AAV vector in an infection of the present disclosure, the amount of AAV vector in the infection is 1×10 2 ~1×10 12 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 4 ~1×10 10 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 6 ~1×10 8 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 1~1×10 3 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 2 ~1×10 5 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 5 ~1×10 8 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 8 ~1×10 12 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in an infection is 1×10 12 ~1×10 15 Viral genome / non-human animal.

[0081] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for at least 1 day. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for at least 1 week. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for at least 2 weeks. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for at least 4 weeks. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for 1 to 5 days. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for 5 to 10 days. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for 10 to 15 days. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the maintenance of the infected non-human animal is performed for 15 to 20 days. In some embodiments of the disclosed method of determining the transduction efficiency of an AAV vector, the infected non-human animal is maintained for 20 to 25 days. In some embodiments of the disclosed method of determining the transduction efficiency of an AAV vector, the infected non-human animal is maintained for 25 to 30 days.

[0082] In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is any one of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is AAV serotype 8. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is AAV serotype 9. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is an AAV serotype that specifically infects or transduces the liver of a subject. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is an AAV serotype that specifically infects or transduces hepatocytes. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is a hybrid of two or more AAV serotypes. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV is a variant selected from any one of 6.2, 2, rh64R1, rh10, 8, 9 and AAV9-PHP.B. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV vector encodes a detectable marker. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the detectable marker is a fluorescent protein, an enzyme, or a peptide. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the detectable marker is GFP, RFP, YFP, CFP, dTomato, mCherry or LacZ (β-galactosidase). In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV vector comprises an inducible promoter or a constitutive promoter. In some embodiments of the method of determining the transduction efficiency of an AAV vector of this disclosure, the AAV vector comprises a tissue-specific promoter. In some embodiments of the methods of determining the transduction efficiency of an AAV vector of this disclosure, the inducible promoter is a tetracycline-inducible promoter or a CMV promoter.In some embodiments of the method for determining the transduction efficiency of an AAV vector of this disclosure, the AAV vector encodes one or more heterologous proteins. In some embodiments of the method for determining the transduction efficiency of an AAV vector of this disclosure, the one or more heterologous proteins can be selected from any one of an immunogenic protein or peptide, a therapeutic protein, a regulatory protein, or a marker / detectable protein.

[0083] The present disclosure also provides a method of determining the efficiency of systemic AAV vector-mediated gene therapy, the method comprising: (a) providing a chimeric AAVR KO non-human animal prepared by any of the methods of the present disclosure; (b) infecting the non-human animal of step (a) at least for the first time with a predetermined amount of an AAV vector; (c) maintaining the infected non-human animal of step (b) for a predetermined period of time; and (d) determining the level of transduction of the AAV vector into human hepatocytes of the AAVR KO non-human animal. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the method comprises: (e) infecting the non-human animal for a second time with a predetermined amount of an AAV vector; (f) maintaining the infected non-human animal of step (e) for a predetermined period of time; and (g) determining the level of transduction of the AAV vector into human hepatocytes of the AAVR KO non-human animal. In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, the method further includes: (i) comparing the level of transduction of human hepatocytes during the first and second infections with the AAV vector.

[0084] In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the amount of AAV vector in the first and second infection is the same.In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the amount of AAV vector in the first and second infection is different.In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the amount of AAV vector in the first infection is higher than the amount of AAV vector in the second infection.In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the amount of AAV vector in the first infection is lower than the amount of AAV vector in the second infection.

[0085] In some embodiments of the methods of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 1 ~1×10 15 In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 2 ~1×10 12 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 4 ~1×10 10 In some embodiments of the method of determining the transduction efficiency of an AAV vector of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 6 ~1×10 8 In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 1 ~1×10 3In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 2 ~1×10 5 In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 5 ~1×10 8 In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 8 ~1×10 12 In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the amount of AAV vector in the first and / or second infection is 1×10 12 ~1×10 15 Viral genome / non-human animal.

[0086] In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for at least 1 day. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for at least 1 week. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for at least 2 weeks. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for at least 4 weeks. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for 1 to 5 days. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for 5 to 10 days. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of this disclosure, the maintenance of the infected non-human animal is performed for 10 to 15 days. In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, the maintenance of the infected non-human animal is performed for 15 to 20 days. In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, the maintenance of the infected non-human animal is performed for 20 to 25 days. In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, the maintenance of the infected non-human animal is performed for 25 to 30 days.

[0087] In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, after initial infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is ≦50%, ≦40%, ≦30%, ≦20%, ≦10%, or ≦5%.

[0088] In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the initial infection is 40% to 50%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the initial infection is 30% to 40%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the initial infection is 20% to 30%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the initial infection is 10% to 20%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of non-human animal hepatocytes transduced by the AAV vector after initial infection is between 5% and 10%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of non-human animal hepatocytes transduced by the AAV vector after initial infection is between 0% and 5%.

[0089] In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, after the second infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is ≦50%, ≦40%, ≦30%, ≦20%, ≦10%, or ≦5%.

[0090] In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is 40% to 50%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is 30% to 40%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is 20% to 30%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is 10% to 20%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is between 5% and 10%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is between 0% and 5%.

[0091] In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, after initial infection, the percentage of human animal hepatocytes transduced by the AAV vector is ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%.

[0092] In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the initial infection is 90% to 100%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the initial infection is 80% to 90%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the initial infection is 70% to 80%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the initial infection is 50% to 70%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of human animal hepatocytes transduced by the AAV vector after initial infection is between 20% and 50%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of human animal hepatocytes transduced by the AAV vector after initial infection is between 10% and 20%.

[0093] In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, after the second infection, the percentage of human hepatocytes transduced by the AAV vector is ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%.

[0094] In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the second infection is 90% to 100%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the second infection is 80% to 90%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the second infection is 70% to 80%. In some embodiments of the method of determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the second infection is 50% to 70%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, after the second infection, the percentage of human animal hepatocytes transduced by the AAV vector is between 20% and 50%. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, after the second infection, the percentage of human animal hepatocytes transduced by the AAV vector is between 10% and 20%.

[0095] In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, after initial infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is between 40% and 50%, between 30% and 40%, between 20% and 30%, between 10% and 20%, between 5% and 10%, or between 0% and 5%; and the percentage of human hepatocytes transduced by the AAV vector is between 10% and 20%, between 20% and 30%, between 30% and 40%, between 40% and 50%, between 50% and 70%, between 70% and 80%, between 80% and 90%, or between 90% and 100%.

[0096] In some embodiments of the disclosed method of determining the efficiency of systemic AAV vector-mediated gene therapy, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is 40% to 50%, 30% to 40%, 20% to 30%, 10% to 20%, 5% to 10%, or 0% to 5%; and the percentage of human hepatocytes transduced by the AAV vector is 0% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0097] In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector is greater than the percentage of human animal hepatocytes transduced by the AAV vector after both the first and second infections. In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the first infection is greater than the percentage of human animal hepatocytes transduced by the AAV vector, and the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is the same as the percentage of human animal hepatocytes transduced by the AAV vector. In some embodiments of the disclosed method for determining the efficiency of systemic AAV vector-mediated gene therapy, after a first infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is greater than the percentage of human animal hepatocytes transduced by the AAV vector, and after a second infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is less than the percentage of human animal hepatocytes transduced by the AAV vector.

[0098] In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, after the first infection, the percentage of non-human animal hepatocytes transduced by AAV vector is the same as the percentage of human animal hepatocytes transduced by AAV vector, and after the second infection, the percentage of non-human animal hepatocytes transduced by AAV vector is less than the percentage of human animal hepatocytes transduced by AAV vector.In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, after the first infection, the percentage of non-human animal hepatocytes transduced by AAV vector is the same as the percentage of human animal hepatocytes transduced by AAV vector, and after the second infection, the percentage of non-human animal hepatocytes transduced by AAV vector is greater than the percentage of human animal hepatocytes transduced by AAV vector.

[0099] In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, after the first infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is less than the percentage of human animal hepatocytes transduced by the AAV vector, and after the second infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is the same as the percentage of human animal hepatocytes transduced by the AAV vector.In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, after the first infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is less than the percentage of human animal hepatocytes transduced by the AAV vector, and after the second infection, the percentage of non-human animal hepatocytes transduced by the AAV vector is greater than the percentage of human animal hepatocytes transduced by the AAV vector.

[0100] In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of human animal hepatocytes transduced by the AAV vector after the second infection is higher than after the first infection. In some embodiments of the method for determining the efficiency of systemic AAV vector-mediated gene therapy of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector after the second infection is higher than after the first infection.

[0101] The present disclosure also provides a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes, the method comprising: (a) providing two or more chimeric non-human animals prepared by any one of the methods of the present disclosure divided into two groups, group A and group B, each group comprising one or more non-human animals, wherein group A receives wild-type human hepatocytes, and group B receives human hepatocytes comprising an AAVR deletion or mutation resulting in non-functional human AAVR (Hu AAVR (b) receiving one or more non-human animals in each group of step (a) from a first in vitro immunization (IIV) or second in vivo immunization (IIV) of the non-human animal of step (a) with an AAV vector; (c) maintaining one or more non-human animals in each group of step (b) for a predetermined period of time; and (d) determining a level of transduction of the AAV vector into human hepatocytes of one or more non-human animals in group A and group B, wherein the level of transduction of the AAV vector in group A is indicative of AAVR-dependent transduction efficiency and the level of transduction in group B is indicative of AAVR-independent transduction efficiency.

[0102] In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, step (a) further comprises applying selective pressure. In some embodiments of the method of this disclosure, applying selective pressure comprises not providing nitisinone (NTBC) to the non-human animal of step (a). In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the method further comprises removing selective pressure after step (b). In some embodiments, removing selective pressure comprises providing NTBC to the chimeric non-human animal after step (b) of the method disclosed herein.

[0103] In some embodiments of the method of determining AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the level of transduction of the AAV vector into human hepatocytes of the non-human animal in groups A and B is determined by the percentage of human animal hepatocytes transduced by the AAV vector in groups A and B, respectively. In some embodiments of the method of determining AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the percentage of human hepatocytes transduced by the AAV vector in group A is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the disclosed method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes, the percentage of human hepatocytes transduced by the AAV vector in group A is 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0104] In some embodiments of the method of determining AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group B is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the method of determining AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group B is 0% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0105] In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the disclosure, the percentage of human animal hepatocytes transduced by the AAV vector in group A is higher than the percentage of human animal hepatocytes transduced by the AAV vector in group B, indicating that the AAV transduction is more AAVR-dependent than AAVR-independent. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the disclosure, the percentage of human animal hepatocytes transduced by the AAV vector in group A is lower than the percentage of human animal hepatocytes transduced by the AAV vector in group B, indicating that the AAV transduction is more AAVR-independent than AAVR-dependent. In some embodiments of the disclosed method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes, the percentage of human animal hepatocytes transduced by the AAV vector in group A is the same as the percentage of human animal hepatocytes transduced by the AAV vector in group B, indicating that the AAV transduction is AAVR-dependent as well as AAVR-independent.

[0106] In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes disclosed herein, the percentage of human hepatocytes transduced by the AAV vector in group A is ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%, and the percentage of human hepatocytes transduced by the AAV vector in group B is 0% to 5%, indicating that the AAV transduction is AAVR-dependent. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes disclosed herein, the percentage of human hepatocytes transduced by the AAV vector in group A is 0% to 5%, and the percentage of human hepatocytes transduced by the AAV vector in group B is ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%, indicating that the AAV transduction is AAVR-independent.

[0107] In the present disclosure, the AAVR-dependent and AAVR-independent transduction of AAV vectors into human hepatocytes in group A and group B, respectively, depends on the serotype or variant of AAV. In the present disclosure, the AAVR-dependent and AAVR-independent transduction of AAV vectors into human hepatocytes in group A and group B, respectively, depends on the specific capsid protein of AAV. In some embodiments, the transduction of AAV vectors into human hepatocytes can be mediated only by AAVR. In some embodiments, the transduction of AAV vectors into human hepatocytes can be mediated only by one or more receptors other than AAVR (non-AAVR receptors). In some embodiments, the transduction of AAV vectors into human hepatocytes can be mediated by both AAVR and one or more receptors other than AAVR (non-AAVR receptors).

[0108] In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the numbers of non-human animals in group A and group B are equal. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the numbers of non-human animals in group A and group B are different.

[0109] In some embodiments of the methods of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes disclosed herein, the amount of AAV vector in the infection is 1×10 1 ~1×10 15 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 2 ~1×10 12 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 4 ~1×10 10 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 6 ~1×10 8 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 1 ~1×10 3 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 2~1×10 5 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 5 ~1×10 8 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 8 ~1×10 12 In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the amount of AAV vector in the infection is 1×10 12 ~1×10 15 Viral genome / non-human animal.

[0110] In some embodiments of the method of determining the transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the maintenance of the infected non-human animal is performed for at least 1 day. In some embodiments of the method of determining the transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the maintenance of the infected non-human animal is performed for at least 1 week. In some embodiments of the method of determining the transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the maintenance of the infected non-human animal is performed for at least 2 weeks. In some embodiments of the method of determining the transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the maintenance of the infected non-human animal is performed for at least 4 weeks. In some embodiments of the method of determining the transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the maintenance of the infected non-human animal is performed for 1 to 5 days. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the maintenance of the infected non-human animal is performed for 5 to 10 days. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the maintenance of the infected non-human animal is performed for 10 to 15 days. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the maintenance of the infected non-human animal is performed for 15 to 20 days. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the maintenance of the infected non-human animal is performed for 20 to 25 days. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the maintenance of the infected non-human animal is performed for 25 to 30 days.

[0111] In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is any one of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is AAV serotype 8. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is AAV serotype 9. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is an AAV serotype that specifically infects or transduces the liver of a subject. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is an AAV serotype that specifically infects or transduces hepatocytes. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is a hybrid of two or more AAV serotypes. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV is a variant selected from 6.2, 2, rh64R1, rh10, 8, 9 and AAV9-PHP.B. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV vector encodes a detectable marker. In some embodiments of the disclosed method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes, the detectable marker is a fluorescent protein, an enzyme, or a peptide.In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the detectable marker is GFP, RFP, YFP, CFP, dTomato, mCherry or LacZ (β-galactosidase). In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV vector comprises an inducible promoter or a constitutive promoter. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the AAV vector comprises a tissue-specific promoter. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of this disclosure, the inducible promoter is a tetracycline-inducible promoter or a CMV promoter. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the AAV vector encodes one or more heterologous proteins. In some embodiments of the method of determining the AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes of the present disclosure, the one or more heterologous proteins can be selected from an immunogenic protein or peptide, a therapeutic protein, a regulatory protein, or a marker / detectable protein.

[0112] The disclosure also provides a method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the method comprising: (a) providing two groups of non-human animals, group A and group B, where group A comprises one or more of T-, B- and NK cells that are deficient or dysfunctional in the non-human animal, and group B further comprises one of T-, B- and NK cells that are deficient or dysfunctional in the non-human animal comprising an AAVR deletion or mutation resulting in a non-functional non-human animal AAVR; (b) transplanting human hepatocytes into one or more of the non-human animals of both groups of step (a); (c) infecting the non-human animals of both groups of step (b) with an AAV vector; (d) maintaining the one or more infected non-human animals of each group of step (c) for a predetermined period of time; and (e) determining the level of AAV vector transduction into human hepatocytes and non-human hepatocytes of the non-human animals of groups A and B.

[0113] "Modification" of AAV vector processing includes, for example, changing the timing or efficacy or transduction, and / or changing the type of cell population transformed by the AAV vector.

[0114] The disclosure also provides a method for determining AAVR-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into human hepatocytes, the method comprising: (a) providing two groups of non-human animals, group A and group B, where group A is an animal that is capable of expressing one or more IL-2Rg - / - / Rag2 - / - Group B includes one or more IL-2Rg polypeptides that further include a deletion or mutation in AAVR resulting in a non-functional non-human animal AAVR. - / - / Rag2 - / -(b) transplanting human hepatocytes into one or more of the non-human animals of both groups of step (a) and applying selection pressure; (c) infecting both groups of non-human animals of step (b) with an AAV vector; (d) maintaining one or more of the infected non-human animals of each group of step (c) for a predetermined period of time; and (e) determining the level of transduction of the AAV vector into the human hepatocytes and non-human hepatocytes of the non-human animals of groups A and B. In some embodiments of the methods of this disclosure, the non-human animals further comprise Fah - / - In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, step (b) further comprises applying selective pressure. In some embodiments of the method of the present disclosure, applying selective pressure comprises not providing nitisinone (NTBC) to the non-human animal of step (b). In some embodiments of the method of the present disclosure, the method further comprises removing selective pressure after step (b). In some embodiments, removing selective pressure can comprise providing NTBC to the chimeric non-human animal after step (b) of the method disclosed herein.

[0115] In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the disclosed method, the method further comprises: (f) comparing the level of AAV vector transduction into human hepatocytes of the non-human animal between group A and group B; (i) wherein the difference between the level of AAV transduction into the non-human hepatocytes and the human hepatocytes of group A is indicative of both AAVR-dependent and independent modification and / or inhibition of AAV vector uptake into human hepatocytes; (ii) wherein the difference between the level of AAV transduction into the non-human hepatocytes and the human hepatocytes of group B is indicative of AAVR-independent modification and / or inhibition of AAV vector uptake into human hepatocytes; and (iii) wherein the difference between the level of AAV transduction into human hepatocytes in group B and group A is indicative of AAVR-dependent modification and / or inhibition of AAV vector uptake into human hepatocytes.

[0116] In some embodiments of the disclosed methods for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the level of AAV vector transduction into human hepatocytes of non-human animals in groups A and B is determined by the percentage of human hepatocytes transduced by the AAV vector in groups A and B, respectively.

[0117] In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector in group A is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector in group A is 0% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0118] In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group A is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group A is 0% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0119] In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into non-human hepatocytes of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector in group B is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into non-human animal hepatocytes of the present disclosure, the percentage of non-human animal hepatocytes transduced by the AAV vector in group B is 0% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0120] In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group B is ≧0%, ≧5%, ≧10%, ≧20%, ≧30%, ≧50%, ≧70%, ≧80%, or ≧90%. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the percentage of human hepatocytes transduced by the AAV vector in group B is 0% to 5%, 5% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%.

[0121] In some embodiments of the disclosed methods for determining AAVR-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into human hepatocytes, the difference between the AAV transduction levels of non-human hepatocytes and human hepatocytes of group A in (i), the difference between the AAV transduction levels of non-human hepatocytes and human hepatocytes of group B in (ii), and the difference between the AAV transduction levels of human hepatocytes in groups B and A can be expressed or shown as a percentage difference or fold change.

[0122] AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes depends on the AAV serotype or variant. AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes depends on the specific capsid protein of the AAV vector.

[0123] In some embodiments of the disclosed method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the number of non-human animals in group A and group B is the same. In some embodiments of the disclosed method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the number of non-human animals in group A and group B is different.

[0124] In some embodiments of the disclosed methods for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 1 ~1×10 15 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 2 ~1×10 12 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 4 ~1×10 10 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 6 ~1×10 8In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 1 ~1×10 3 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 2 ~1×10 5 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 5 ~1×10 8 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 8 ~1×10 12 In some embodiments of the disclosed method for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the amount of AAV vector in the infection is 1×10 12 ~1×10 15 Viral genome / non-human animal.

[0125] In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for at least 1 day. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for at least 1 week. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for at least 2 weeks. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for at least 4 weeks. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for 1 to 5 days. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for 5 to 10 days. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for 10 to 15 days. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for 15 to 20 days. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the infected non-human animal is maintained for 20 to 25 days. In some embodiments of the disclosed methods for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, maintenance of the infected non-human animal is for 25 to 30 days.

[0126] In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the AAV is any one of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the AAV is AAV serotype 8. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the AAV is AAV serotype 9. In some embodiments of the method of this disclosure for determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, the AAV is an AAV serotype that specifically infects or transduces the liver of a subject. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV is an AAV serotype that specifically infects or transduces hepatocytes. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV is a hybrid of two or more AAV serotypes. In some embodiments of the method of determining adeno-associated virus receptor (AAVR-dependent or AAVR-independent) modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV is a variant selected from any one of 6.2, 2, rh64R1, rh10, 8, 9 and AAV9-PHP.B. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV vector encodes a detectable marker. In some embodiments of the disclosed methods of determining AAVR-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into human hepatocytes, the detectable marker is a fluorescent protein, an enzyme, or a peptide.In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the detectable marker is GFP, RFP, YFP, CFP, dTomato, mCherry, or LacZ (β-galactosidase). In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV vector comprises an inducible promoter or a constitutive promoter. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the AAV vector comprises a tissue-specific promoter. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of this disclosure, the inducible promoter is a tetracycline-inducible promoter or a CMV promoter. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the AAV vector encodes one or more heterologous proteins. In some embodiments of the method of determining AAVR-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes of the present disclosure, the one or more heterologous proteins can be immunogenic proteins or peptides, therapeutic proteins, regulatory proteins, or marker / detectable proteins.

[0127] Without wishing to be bound by theory, the disclosed chimeric non-human or humanized animals (e.g., mice) provide the experimental tractability of non-human animals with the physiological accuracy of human hepatocytes, thus allowing for the variation of results from a range of studies with completely different methodologies to determine the efficacy of transducing AAV vectors into human hepatocytes. These mice are believed to be useful for molecular-based functional testing of disease and for preclinical testing of experimental treatments. In some embodiments, the chimeric non-human animals of the present disclosure can be any one of primates, birds, mice, rats, poultry, dogs, cats, cows, horses, goats, camels, sheep, and pigs.

[0128] In another aspect, provided herein is a chimeric non-human animal comprising one or more human tissues, wherein the chimeric non-human animal further comprises: (a) a deficiency or impairment of T-, B- and / or NK cells that allows for the reconstitution of one or more human tissues that establishes human chimerism in the non-human animal; and (b) a deletion or mutation in an adeno-associated virus receptor (AAVR) that results in a deficiency or impairment of the non-human animal AAVR. In some embodiments, the chimeric non-human animal further comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) that results in a deficiency or impairment of the non-human animal AAVR. - / - In some embodiments, the chimeric non-human animal comprises IL-2Rg - / - / Rag2 - / - / Fah - / - Also provided herein are chimeric non-human animals comprising one or more human tissues, wherein the chimeric non-human animals are - / - / Rag2 - / - A chimeric non-human animal, and wherein the chimeric non-human animal further comprises a deletion or mutation in the AAVR that results in a deficiency or impairment of the non-human animal's AAVR.

[0129] The one or more human tissues in any non-human animal provided herein can be any tissue suitable for transplantation into non-human animals.In some embodiments, the one or more human tissues are connective tissue, epithelial tissue, muscle tissue (e.g., smooth muscle tissue, skeletal muscle tissue, or cardiac muscle tissue), or nerve tissue.In some embodiments, the tissue is early nerve, mesodermal, endodermal, or ectodermal tissue.In some embodiments, the human tissue is liver tissue, kidney tissue, pancreatic tissue, small intestine tissue, spleen tissue, heart tissue, lung tissue, skin tissue, bone tissue, eye tissue, hematopoietic tissue, lymphatic tissue, reproductive tissue, mucosal tissue, or stomach tissue.

[0130] The one or more human tissues may be introduced into the non-human animal by any suitable means. For example, the non-human animal may be implanted with induced pluripotent stem cells that then differentiate into one or more human tissues. In some embodiments, the one or more human tissues are present within a teratoma.

[0131] In another aspect, provided herein is a method of preparing a chimeric non-human animal comprising one or more human tissues, the method comprising: (a) providing deficient or impaired T-, B- and / or NK cells in a non-human animal that allow for reconstitution of human tissues that establish human chimerism in the non-human animal, wherein the non-human animal comprises a deletion or mutation in AAVR resulting in a non-functional non-human animal AAVR; and (b) transplanting one or more human tissues into the non-human animal. In some embodiments, the non-human animal further comprises Fah - / - In some embodiments, the non-human animal comprises an IL-2Rg - / - / Rag2 - / - / Fah - / - It is a non-human animal.

[0132] Also provided is a method for preparing a chimeric non-human animal comprising one or more human tissues, the method comprising: (a) administering to the animal an IL-2Rg - / - / Rag2 - / -Also provided herein are methods that include: (a) providing a non-human animal, wherein the non-human animal comprises a deletion or mutation in an adeno-associated virus receptor (AAVR) that results in a non-functional non-human animal AAVR; and (b) transplanting human tissue into the non-human animal. In some embodiments, the non-human animal further comprises a Fah - / - Includes.

[0133] In another aspect, provided herein is a method for determining the transduction efficiency of an AAV vector in one or more human tissues, the method comprising: (a) providing a non-human animal as described herein; (b) infecting the non-human animal of step (a) with a predetermined amount of an AAV vector; and (c) determining the level of transduction of the AAV vector into a human tissue of the AAVR KO non-human animal.

[0134] Also provided herein is a method of determining the transduction efficiency of two or more non-identical AAV vector(s) in at least two human tissues, the method comprising: (a) providing two or more AAVR KO non-human animals described herein; (b) infecting each of the non-human animals of step (a) with a predetermined amount of two or more non-identical AAV vectors, wherein each non-human animal is infected with one AAV vector; and (c) determining the level of transduction of at least one human tissue in each of the two or more non-human animals of step (b). In some embodiments, the method further comprises (d) comparing the level of transduction of each of the two or more AAV vectors into one or more human tissues. In some embodiments, the method further comprises (f) selecting the one or more AAV vector(s) as efficient for transducing human hepatocytes if: (i) less than a predetermined percentage of the total amount of the AAV vector is transduced into non-human tissues of the non-human animal; (ii) at least a predetermined percentage of the total amount of the AAV vector is transduced into one or more human tissues; (iii) the percentage of non-human tissues transduced by the AAV vector is less than a predefined value; and / or (iv) the percentage of human tissues transduced by the AAV vector is greater than a predefined value.

[0135] In some embodiments of the methods disclosed herein, the AAV vector expresses a detectable marker, such as a fluorescent protein, an enzyme, or a peptide. In some embodiments, the AAV vector comprises a unique nucleic acid sequence of the vector's genome, where the unique nucleic acid sequence can be transcribed into a detectable RNA sequence or a barcode RNA sequence.

[0136] Also provided herein is a method for determining the efficiency of systemic AAV vector-mediated gene therapy, the method comprising: (a) providing a non-human animal as described herein; (b) infecting the non-human animal of step (a) with a predetermined amount of an AAV vector at least for the first time; and (c) determining the level of transduction of the AAV vector into one or more human tissues of the AAVR KO non-human animal. In some embodiments, the method further comprises: (d) infecting the non-human animal for a second time with a predetermined amount of an AAV vector; and (e) determining the level of transduction of the AAV vector into one or more human tissues of the AAVR KO non-human animal. In some embodiments, the method further comprises: (f) comparing the level of transduction of the AAV vector into one or more human tissues between the first and second infections. In some embodiments, the amount of AAV vector in the first and / or second infection is 1×10 1 ~1×10 15 Viral genome / non-human animal. In some embodiments, the amount of AAV vector in the first and second infection is the same. In some embodiments, the amount of AAV vector in the first and second infection is different.

[0137] In another aspect, provided herein is a method of determining AAVR-dependent or AAVR-independent transduction efficiency of an AAV vector in one or more human tissues, the method comprising: (a) providing non-human animals divided into two groups, group A and group B, each group comprising one or more non-human animals, wherein group A is transplanted with wild-type human tissue and group B is transplanted with human tissue comprising an adeno-associated virus receptor (AAVR) deletion or mutation resulting in non-functional human AAVR, the two or more non-human animals further comprising: - / - / Rag2 - / - / and / or Fah - / -(b) infecting one or more non-human animals in each group of step (a) with an AAV vector; and (c) determining a level of transduction of the AAV vector into one or more human tissues of the non-human animals in groups A and B, wherein the level of transduction in group A is indicative of AAVR-dependent transduction efficiency of the AAV vector, and the level of transduction in group B is indicative of AAVR-independent transduction efficiency.

[0138] In another aspect, provided herein is a method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human tissue, the method comprising: (a) providing groups of non-human animals, group A and group B, wherein group A comprises one or more T-, B-, and NK cells that are deficient or dysfunctional in the non-human animal, and group B further comprises a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR; (b) transplanting one or more human tissues into one or more non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of transduction of the AAV vector into human tissues of the non-human animals of groups A and B.

[0139]

[0023] In another aspect, provided herein is a method for determining AAVR-dependent or AAVR-independent modulation and / or inhibition of AAV vector transduction into one or more human tissues, the method comprising: (a) providing two groups of non-human animals, group A and group B, wherein group A is a non-human animal that is capable of expressing one or more IL-2Rg - / - / Rag2 - / - Group B includes one or more IL-2Rg receptors that further include a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional non-human animal AAVR.- / - / Rag2 - / - (b) transplanting one or more human tissues into one or more non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of transduction of the AAV vector into the human tissues of the non-human animals of groups A and B. In some embodiments, the non-human animals further comprise Fah - / - Includes.

[0140] In the present disclosure, examples of "chimeric non-human animal" include parts of this non-human animal. The term "chimeric non-human animal part(s)" refers to, for example, non-human animal-derived tissues, body fluids, cells, and their disrupted products or extracts therefrom (examples of which are not particularly limited). Examples of such tissues include, but are not limited to, heart, lung, kidney, liver, gallbladder, pancreas, spleen, small intestine, muscle, blood vessels, brain, testes, ovaries, uterus, placenta, bone marrow, thyroid, thymus, and mammary gland. Examples of body fluids include, but are not limited to, blood, lymph, and urine. The term "cell" refers to cells contained in the aforementioned tissues or body fluids, and examples of which include cultured cells, sperm cells obtained by their isolation or culture, eggs, and fertilized eggs. Examples of cultured cells include both primary cultured cells and cells of established cell lines. Some examples of chimeric non-human animals also include tissues, body fluids, and cells at the developmental stage (embryonic stage), and their disrupted products or extracts. In addition, the mouse-derived cell line of the present disclosure can be established using known methods (Primary Culture Methods for Embryonic Cells (Shin Seikagaku Jikken Koza (New Biochemical Experimental Lecture Series), Vol. 18, pages 125-129, TOKYO KAGAKU DOZIN CO., LTD., and Manuals for. Mouse Embryo Manipulation, pages 262-264, Kindai Shuppan).

[0141] The chimeric non-human animal of the present disclosure can be an immunodeficient chimeric non-human animal (e.g., mouse). The immunodeficient chimeric non-human animal of the present disclosure can be used as a host mouse for transplantation of human hepatocytes. Examples of "immunodeficient non-human animals" can be any chimeric non-human animal that does not reject hepatocytes (especially human hepatocytes) from different animal origins, and include, but are not limited to, SCID (severe combined immunodeficiency) mice that exhibit deficiencies in T- and B-cell lines, nude mice that have lost T-cell function due to genetic deletion in the thymus, and RAG2 knockout mice that are generated by knocking out the RAG2 gene by known gene targeting methods (Science, 244: 1288-1292, 1989).

[0142] The present disclosure further provides a chimeric non-human animal having human hepatocytes. The chimeric non-human animal of the present disclosure can be immunologically deficient. The chimeric non-human animal of the present disclosure can be prepared by transplanting human hepatocytes into an immunodeficient chimeric non-human animal of the present disclosure.

[0143] As the human hepatocytes used for transplantation, human hepatocytes isolated from normal human liver tissue by conventional methods such as collagenase perfusion can be used. The hepatocytes thus separated can also be used after cryopreservation. Alternatively, chimeric non-human animal hepatocytes, defined as human hepatocytes separated by techniques such as collagenase perfusion from the chimeric non-human animal liver in which the chimeric non-human animal hepatocytes are replaced by human hepatocytes, can be used in a fresh state, and the cryopreserved chimeric non-human animal hepatocytes can also be used after thawing.

[0144] Such human hepatocytes can be transplanted into the liver via the spleen of the chimeric non-human animal (e.g., mouse) of the present disclosure. Such human hepatocytes can also be directly transplanted via the portal vein. The number of human hepatocytes to be transplanted may be in the range of about 1 to 2,000,000 cells, and is preferably in the range of about 200,000 to 1,000,000 cells. The sex of the chimeric non-human animal of the present disclosure is not particularly limited. Similarly, the age of the mouse of the present disclosure at the time of transplantation is not particularly limited. When human hepatocytes are transplanted into a young chimeric non-human animal (early age), the chimeric non-human animal grows, so that the human hepatocytes can proliferate more actively. For example, it is preferable to use a mouse about 0- to 40-days-old, particularly a mouse about 8- to 40-days-old.

[0145] The transplanted human hepatocytes account for any percentage of human chimerism of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of all hepatocytes within the chimeric liver of the chimeric non-human animal.

[0146] Non-human animals that contain one or more gene deletions are described herein. Generally, biallelic deletions of a gene are indicated by "- / -", e.g., "Fah- / -".

[0147] An exemplary human nucleotide sequence encoding II2-rg protein of the present disclosure consists of or includes Genbank Accession No. NM_000206.2: [ka]

[0148] The corresponding human amino acid sequence of an exemplary II2-rg protein of the present disclosure consists of or includes Genbank Accession No. NP_000197.1: [ka]

[0149] The mouse nucleotide sequence encoding an exemplary II2-rg protein of the present disclosure consists of or includes Genbank Accession No. NM_013563.4: [ka]

[0150] The corresponding murine amino acid sequence of an exemplary II2-rg protein of the present disclosure consists of or includes Genbank Accession No. NP_038591.1: [ka]

[0151] A human nucleotide sequence encoding an exemplary Rag2 protein of the present disclosure consists of or includes Genbank Accession No. NM_000536.3: [ka]

[0152] The corresponding human amino acid sequence of an exemplary Rag2 protein of the present disclosure consists of or includes Genbank Accession No. NP_000527.2: [ka]

[0153] A murine nucleotide sequence encoding an exemplary Rag2 protein of the present disclosure consists of or includes Genbank Accession No. NM_009020.3: [ka] [ka]

[0154] The corresponding mouse amino acid sequence of an exemplary Rag2 gene of the present disclosure consists of or includes Genbank Accession No. NP_033046.1: [ka]

[0155] A human nucleotide sequence encoding an exemplary Fah protein of the present disclosure consists of or includes Genbank Accession No. NM_000137.2: [ka]

[0156] The corresponding human amino acid sequence of an exemplary Fah protein of the present disclosure consists of or includes Genbank Accession No. NP_000128.1: [ka]

[0157] The corresponding mouse nucleic acid sequence encoding an exemplary Fah protein of the present disclosure consists of or includes Genbank Accession No: NM_010176.4: [ka]

[0158] The corresponding murine amino acid sequence encoding an exemplary Fah protein of the present disclosure consists of or includes Genbank Accession No: NP_034306.2: [ka]

[0159] The adeno-associated virus (AAV) receptor (AAVR) disclosed herein is also referred to as dyslexia-associated protein, KIAA0319-like (KIAA0319L) protein, which is a putative type I transmembrane protein with five Ig-like domains in its ectodomain, also referred to as polycystic kidney disease (PKD) domains. Ig-like domains mediate cell-cell adhesion and are present in a variety of well-characterized viral receptors, including those of poliovirus, measles virus, and reovirus (Pillay S. et al., Nature 2016;530:108-112). The PKD of AAVR has been shown to directly bind to the spike region of the AAV2 capsid adjacent to the three-fold axis of the icosahedron (Zhang R. et al., Nat Microbiol, 2019 Apr;4(4):675-682).

[0160] The murine amino acid sequence of an exemplary AAVR of the present disclosure consists of or includes Genbank Accession No. Q8K135: [ka]

[0161] The human amino acid sequence of an exemplary AAVR protein of the present disclosure consists of or includes Genbank Accession No.: NP_079150: [ka] The following examples are provided to better illustrate the claimed disclosure and should not be construed as limiting the scope of the disclosure. To the extent that specific materials are mentioned, this is for illustrative purposes only and is not intended to limit the disclosure. Those skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the disclosure. EXAMPLES

[0162] Working Example Example 1: Il2rg - / - / Rag2 - / - / Fah - / - Preparation of mouse model Since AAV vectors preferably transduce mouse cells, humanized chimeric mouse models are used to test and evaluate the use of AAV vectors for gene therapy. The mouse AAV receptor is important for the transduction of AAV vector serotypes. Transgene-free Il2rg with mouse adeno-associated virus receptor knockout (AAVR KO) gene deletion - / - / Rag2 - / - / Fah - / - A study is described here that describes the generation of a mouse model and its use to determine the transduction efficiency of AAV vectors. Although there are many possible AAV serotypes that may be good clinical candidates for liver gene therapy, transduction efficiency, even in the liver, remains a key point. The immune response to the viral capsid is directly proportional to the dose of AAV injected (Nathwani AC et al., N Engl J Med 2014;371:1994-2004.). Therefore, it is important to use as little AAV as possible to reduce the immune response, but enough AAV to obtain effective transduction and therapeutic effects. This disclosure shows that human liver chimeric mice with a murine AAVR deletion background (AAVR knockout mice) are more specific and valuable for validation of gene therapy for humans, for example, validation of gene therapy vectors in the human context. The disclosed human liver chimeric mice with deleted AAV receptors in mouse tissues are useful for identifying the most suitable and clinically translatable AAV gene therapy vectors and for evaluating transduction efficiency.

[0163] Materials and Methods Generation of AAVR-KO strains by CRISPR / Cas9-mediated exon deletion The design and cloning of sgRNAs for the generation of AAVR KO knockout mice disclosed herein was performed as previously described in the art (Johnson CG et al., Curr Protoc Mol Biol 2020;130:e117). Exons 4 and 5 of the mouse AAVR gene were targeted (FIG. 1A). The sgRNA sequences used in the studies described herein are provided below: sgRNA Ex4 ACTTGCGGAGTACCAGATAC.AGG (SEQ ID NO: 15) sgRNA Ex5 CATTCTTAGGCAGGGTGATC.TGG (SEQ ID NO:16).

[0164] These sgRNAs and Cas9 were transcribed in vitro using MEGAshortscript T7 Transcription Kit (Life tech, AM1354) and mMessage mMachine T7 Ultra Kit (Life tech AM1345), respectively. A mixture of 15ng / μL of each sgRNA and 60ng / μL of Cas9 mRNA in 1×PBS was used for microinjection of zygotes. Cas9 and sgRNA were injected into homozygous zygotes derived from TIRF (transgene-free Il2rg- / - / Rag2- / - / Fah- / -) mice.

[0165] Nineteen founder pups were obtained, four of which died after birth. All pups were screened for the deletion. Seven of the 15 surviving mice were heterozygous for the deletion. A total of four deletions were obtained, some of which were shared in more than one mouse, and all of which led to a premature stop codon after the junction.

[0166] Positive animals were backcrossed twice with the TIRF strain to remove any possible unintended mutations. Heterozygous F2 mice were crossed with each other to obtain homozygous pups. Homozygous mice were normal in size and did not show any abnormal phenotype, but appeared to have fertility problems and homozygous colonies could not be established.

[0167] Genotyping of TIRFA strains All homozygous pups obtained were screened by PCR using the following primers: AAVR_Ex4 For 5'ACAGTTGCCGGTTCCTTCAC 3' (SEQ ID NO: 17) AAVR_In5 Rev 5' CCACATGCACATCACAACCTC 3' (sequence number: 18).

[0168] The expected PCR bands for wild-type and knockout mice were 2.3 Kb and 200 bp, respectively (Figure 1B). The PCR bands corresponding to the deleted alleles were purified and sent for Sanger sequencing. Once the junctions were defined, further progeny were genotyped by semi-quantitative PCR using Taqman probes at Transnetyx (Figures 2A-2B). Taqman probes are single-stranded DNA probes with a fluorophore covalently attached at the 5' end and a quencher at the 3' end. The quencher absorbs fluorescence when in close proximity to the fluorophore. These probes bind to the genomic region of interest that is amplified by Taq polymerase using specific primers. Once the strands are separated for each amplification step, the probe can bind to the strand for which it has affinity. Degradation of the annealed probe occurs in the next round of amplification by the 5' to 3' exonuclease activity of Taq polymerase. The fluorophore is released and the quantitative PCR thermal cycler detects the emitted fluorescence, which accumulates throughout the cycle.

[0169] Transplantation of human hepatocytes into the TIRFA line Human cryopreserved hepatocytes (Lonza) were transplanted into the TIRFA line as previously described (Bissig-Choisat B et al., Nature communications 2015;6:7339; Barzi M et al., Nature communications 2017;8:39). Briefly, the abdominal cavity was opened via a midline abdominal incision and 3 × 10 hepatocytes were transplanted into the TIRFA line in a volume of 100 μl of PBS. 6 Human hepatocytes were injected into the spleen. Immediately after transplantation, selective pressure on the transplanted human hepatocytes was applied by removing the drug NTBC from the drinking water in the following steps: 25% of the colony maintenance dose (100%=7.5mg / l) for 2 days, then 12% for 2 days, and finally 6% for 2 days, before completely discontinuing the drug (Bissig KD et al., The Journal of clinical investigation 2010). To determine the degree of human chimerism, human albumin (ELISA, Bethyl laboratories) was measured in mouse blood, since human albumin levels correlate with the level of human chimerism assessed by immunostaining of human hepatocytes (Bissig KD et al., The Journal of clinical investigation 2010). Only mice with human chimerism >70% were used for AAV injection.

[0170] AAV generation A triple-plasmid transfection protocol was used to generate rAAV vectors (Shen S et al., J Biol Chem 2013;288:28814-28823); the transfection mixture contained: (1) pXR helper plasmid; (2) adenovirus helper plasmid pXX6-80; and (3) dTomato, driven by the CMV promoter adjacent to the AAV2 ITRs. Vector purification was performed using iodixanol gradient ultracentrifugation followed by desalting with ZebaSpin desalting columns (40K MWCO; ThermoScientific, Waltham, MA, USA). vg titers were obtained by qPCR (LightCycler 480; Roche Applied Sciences, Pleasanton, CA, USA) using primers designed to selectively bind to the AAV2 ITRs (forward, 50-AACATGCTACGCAGAGAGGGAGTGG-30 (SEQ ID NO: 19); reverse, 50-CATGAGACAAGGAACCCCTAGTGATGGAG-30 (SEQ ID NO: 20)).

[0171] Immunostaining was performed on formalin-fixed paraffin-embedded livers. Paraffin sections (5 μm thick) were dewaxed and antigen retrieval was performed in citrate buffer (pH 6.0). Immunostaining was performed with rabbit antibody against hFAH (Sigma Aldrich) after blocking with 1% donkey serum + 0.2% Triton. After washing with PBS, sections were stained with fluorescent-labeled secondary antibodies (Jackson Immunoresearch Laboratories) in 1% donkey serum for 30 min, washed again and mounted in Vectashield plus DAPI (Vector Labs).

[0172] Example 2: Transduction efficiency of human and mouse hepatocytes in human liver chimeric mice by different AAV serotypes Since extrapolation of results from animal studies to humans for gene therapy is problematic, human liver chimeric mice (mice with humanized livers) were used to determine AAV transduction efficiency of human hepatocytes in vivo (Bissig-Choisat B et al., Nature communications 2015; Lisowski L et al., Nature 2014). Differences may exist in recombinant genome uptake, delivery to the nucleus, uncoating, second strand synthesis, and transgene persistence and expression, which must be taken into account. Chimeric humanized liver mice therefore provide a unique in vivo platform to further evaluate candidate AAV serotypes for transduction efficiency of human hepatocytes (Bissig-Choisat B et al., Nature communications 2015; Lisowski L et al., Nature 2014), overcoming some of these limitations. In the studies described here, FRG (Fah - / - / Rag2 - / - / Il2rg - / -) mice were reconstituted with healthy human hepatocytes transduced with different AAV serotypes. Each transduced AAV vector expressed a different expression cassette. Their transduction efficiency was evaluated in terms of the percentage of AAV-transduced human and mouse hepatocytes in FRG-human chimeric liver mice by counting human cells immunostained for FAH or human nuclear staining, and transduced cells (positive for LacZ or GFP). The results of the studies described here show that many AAV serotypes validated for transduction efficiency in humanized mice transduce mouse hepatocytes much better than human hepatocytes (Figure 3). Most importantly, two clinically used serotypes, AAV8 and AAV9, also appear to transduce mouse hepatocytes much more readily than human hepatocytes (Figure 4B-4F) (Bissig-Choisat B et al., Nature communications 2015). Because fewer total AAV particles are available for binding to human cells, this "squelching" or "sink" effect of mouse hepatocytes reduces the value of the human liver chimeric mouse system for evaluating the transduction efficiency of AAV vectors for human hepatocytes. This study examines the mechanism of this "squelching" or "sink" effect of mouse hepatocytes on AAV transduction efficiency into human hepatocytes, as well as methods to reduce it.

[0173] Example 3: Generation of TIRFA mouse model Recently, the AAV receptor (AAVR) was identified (Pillay S et al., Nature 2016). In the studies described here, it was hypothesized that AAVR knockout human liver chimeric mice would be a good model for validation of gene therapy vectors in the human context. The mouse AAVR gene was transfected into TIRF mouse zygotes (transgene-free Il2rg - / - / Rag2 - / - / Fah - / -) (JHEP reference March 2021) was used to delete the AAVR gene using CRISPR techniques. These TIRFA mice generated using the methods described here were viable and had no obvious pathology when heterozygous or homozygous for AAVR gene KO. Initial attempts to breed the homozygous TIRFA mice described here were unsuccessful, and the studies described here were performed using pups from heterozygous breeding pairs. The TIRF(A) mice described here (homozygous, heterozygous and wild type for AAVR) were humanized with human hepatocytes as previously described (Bissig-Choisat B et al., Nature communications 2015; Lisowski L et al., Nature 2014). Humanization of TIRFA animals was assessed using the methods described here and by measurement of human albumin in mouse blood using a human-specific albumin test. Human albumin was detected at 1 mg / mL to 5 mg / ml serum, which is comparable to high human liver chimerism (Bissig KD et al., The Journal of clinical investigation 2010). The results presented herein demonstrate that the present disclosure provides an immune-depleted chimeric mouse model that lacks or is depleted of endogenous AAVR and allows for the reconstitution of human hepatocytes that establish human chimerism in the mouse liver.

[0174] Example 4: Evaluation of transduction efficiency of AAV serotypes in human hepatocytes within humanized TIRFA livers In the study described herein, the transduction efficiency of AAV serotypes in human hepatocytes in humanized TIRFA livers was evaluated. As described in Example 2, AAV serotype 9 (AAV9) gene therapy vectors were generated containing an expression cassette for dTomato under a ubiquitous promoter (hybrid CMV enhancer / chicken β-actin (CBA)). All mice were injected with 1×10 α-AAV9, a dose that transduced all mouse livers in the presence of AAVR. 12vg / mouse was injected into the tail vein. One month after injection, the humanized mice were euthanized and the livers were harvested. In the studies described here, efficient humanization was determined by (FAH immunostaining) and transduction of human hepatocytes by AAV9 was determined by dTomato immunostaining (Figures 5C, 5F, 5I and 5L). The results described here show that AAV9 efficiently transduced human cells and only a few mouse cells in humanized TIRFA mice with homozygous deletion of AAVR, whereas AAV9 transduced only a few mouse cells in humanized TIRFA mice with heterozygous deletion of AAVR (AAVR + / - The majority of transduced cells in humanized TIRFA mice with AAVR + / + The results show that the TIRF-FRG complex is similar to that of wild-type, humanized TIRF, or FRG (FIG. 4D).

[0175] Based on the experimental data disclosed in the above-mentioned examples, the "squelch" or "sink" effect of mouse hepatocytes on transduction by AAV vectors in chimeric non-human animal models can be reduced or inhibited, and transduction of human hepatocytes can be achieved by knockout of the non-human animal AAVR. The examples disclosed herein show that the chimeric non-human animal models disclosed herein can be used to determine the biology and efficiency of AAV transduction into human cells.

[0176] Example 5: Generation of teratomas derived from human iPS cells in TIRFA mice Most AAV serotypes and recombinant capsids have high tropism for the liver, and when AAV is injected intravenously, most AAV transduces liver cells. This is beneficial for many liver-directed gene therapy approaches, but some are intended to target other organs, such as muscle or brain. The liver can therefore act as a sponge for very few AAV to transduce this target tissue (squelch effect). To assess whether the tropism of a specific capsid is higher for any given organ than for the liver, humanized mice need to have liver tissue and other human tissues in the same mouse. Therefore, if the tropism of a capsid is much higher for the liver than for the so-called muscle, this specific capsid is not suitable for transducing the muscle of the patient. To have a dual or multiple organ system in human liver TIRFA mice, induced pluripotent stem (iPS) cell-derived teratomas were generated. Teratomas are fully differentiated and contain functional tissue derived from all three germ layers (endoderm, ectoderm and mesoderm).

[0177] method: Generation of teratomas derived from human iPS cells Human induced pluripotent stem (iPS) cells were cultured on Matrigel using standard iPS cell medium (mTeSR from StemCells Technologies). When the cells reached 80% confluency on a 10 cm dish, they were gently scraped (cell scraper) from the plate in the medium to form cell clumps and spun down at 500 g for 5 min. Cell clumps (~1 × 10 7 The cells (individual cells) were resuspended in 50 to 100 μl of fresh medium and injected subcutaneously into human liver chimeric or non-humanized TIRFA mice.

[0178] Immunostaining of chimeric liver and teratoma: Immunostaining was performed on formalin-fixed paraffin-embedded liver. Paraffin sections (5 μm thick) were dewaxed and antigen retrieval was performed in citrate buffer (pH 6.0). After blocking with 1% donkey serum or with the corresponding reagents (for immunohistochemistry), liver sections were incubated with either mouse antibodies against hLDH (Santa Cruz, 1:100 dilution) and rabbit anti-RFP antibodies (Rockland, 1:100 dilution) for hLDH or with anti-GFP (Abcam, 1:200 dilution) for teratomas. After washing with PBS, the sections were stained with either fluorescently-labeled secondary antibodies (Jackson Immunoresearch Laboratories) or with the corresponding secondary antibodies from ImpressDuet and developed according to the manufacturer's instructions (Vector Labs).

[0179] Humanized liver mice (human liver chimeric mice) were generated by reconstituting the liver of TIRFA mice as previously described. After generation of high human liver chimerism (>20% human tissue), human induced pluripotent stem (iPS) cells were injected subcutaneously. Three to four months after injection, the mice formed clearly visible subcutaneous teratomas. One to three weeks after teratomas formed, AAV9 carrying a ubiquitous GFP expression cassette was injected intravenously.

[0180] result Figure 6A-8B shows 1 x 10 12Figure 6 shows human liver chimeric TIRFA mice, e.g., TIRFA mice reconstituted with human hepatocytes, injected with AAV8 (Figures 6A, 6B, 8A, and 8B) or AAV9 (Figures 7A, 7B, 8A, and 8B) in GC / mouse. Mice were euthanized 72 hours after injection, and livers were harvested and stained for human marker LDH (light gray) and virus transgene td-Tomato (black) to show co-localization. These experiments reveal that AAV8 and AAV9 transduce exclusively human hepatocytes in humanized TIRFA mice, whereas they do not transduce mouse TIRFA hepatocytes because these gene therapy vectors lack AAVR. Control humanized mice (TIRF mice expressing AAVR) reveal transduction of most mouse hepatocytes and very few human hepatocytes (Figures 6A-7B).

[0181] Transduction of human hepatocytes was observed in the livers of chimeric mice, as well as transduction of human cells in teratomas (Figures 10-14D). Of note, not all human cells in the teratomas were equally well transduced, and there were significant differences in transduction efficiency in teratomas, including different human tissues.

Claims

1. 1. A chimeric non-human animal comprising human hepatocytes, wherein the chimeric non-human animal comprises: a) a deficiency or dysfunction of T-, B- and / or NK cells that allows for the reconstitution of human hepatocytes that establish human chimerism in the liver of a non-human animal; and b) a deletion or mutation in the non-human animal adeno-associated virus receptor (AAVR) that results in a deficiency or dysfunction of the AAVR; A chimeric non-human animal comprising:

2. A chimeric non-human animal having two or more human tissues, wherein the chimeric non-human animal comprises: a) a deficiency or dysfunction of T-, B- and / or NK cells that allows for the reconstitution of one or more human tissues that establish human chimerism in the non-human animal; and b) a deletion or mutation in the non-human animal adeno-associated virus receptor (AAVR) that results in a deficiency or dysfunction of the AAVR; A chimeric non-human animal comprising:

3. The chimeric non-human animal is -/- / Rag2 -/- The chimeric non-human animal according to claim 1 or 2, which is a chimeric non-human animal.

4. The chimeric non-human animal further comprises Fah -/- The chimeric non-human animal of claim 3, comprising:

5. A method for producing the chimeric non-human animal according to any one of claims 1 to 4, comprising: (a) providing a deficiency or dysfunction of T-, B-, and / or NK cells that allows for the reconstitution of human tissues that establish human chimerism in a non-human animal, wherein the non-human animal has an AAVR deletion or mutation that results in a non-functional non-human animal AAVR; and (b) transplanting one or more human tissues into said non-human animal; A method comprising:

6. The method described in claim 5, wherein the "(b) step of transplanting one or more human tissues into the non-human animal" includes a step of transplanting human hepatocytes into the non-human animal.

7. A method for determining the transduction efficiency of one or more AAV vectors in one or more human tissues, comprising: (a) providing a non-human animal according to any one of claims 1 to 4; (b) infecting the non-human animal of step (a) with a predetermined amount of an AAV vector; and (c) determining the level of AAV vector transduction into human tissues of humans and AAVR KO non-human animals: A method comprising:

8. The method of claim 7, wherein the method comprises: (a) providing a chimeric non-human animal according to any one of claims 1 to 4, which comprises human hepatocytes; and (c) determining the level of transduction of the AAV vector into human hepatocytes and AAVR KO non-human animal hepatocytes (non-human animal hepatocytes); A method comprising:

9. A method for determining the efficacy of systemic AAV vector-mediated gene therapy, wherein the method comprises: (a) providing a non-human animal according to any one of claims 1 to 4; (b) infecting the non-human animal of step (a) at least initially with a predetermined amount of an AAV vector; (c) determining the level of transduction of the AAV vector into human tissues of the AAVR KO non-human animal; (d) infecting the non-human animal a second time with a predetermined amount of the AAV vector; (e) determining the level of transduction of the AAV vector into human tissues of the AAVR KO non-human animal; and (f) comparing the level of transduction of human tissue by the AAV vector during the first and second infections; A method comprising:

10. The method of claim 9, wherein the method comprises: (a) providing a chimeric non-human animal according to any one of claims 1 to 4, which comprises human hepatocytes; (c) determining the level of transduction of the AAV vector into human hepatocytes of the AAVR KO non-human animal; A method comprising:

11. A method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent transduction efficiency of an AAV vector in one or more human tissues, comprising: (a) providing non-human animals divided into two groups, group A and group B, wherein each group comprises one or more non-human animals, wherein group A is transplanted with wild-type human tissue and group B is transplanted with human tissue comprising a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional human AAVR, wherein the two or more non-human animals further comprise a deficiency or dysfunction of T-, B- and / or NK cells, IL-2Rg − / − / Rag2 − / − / , and / or Fah − / − ; (b) infecting one or more non-human animals in each group of step (a) with an AAV vector; (c) determining the level of transduction of the AAV vector into one or more human tissues of the non-human animals of group A and group B, wherein the level of transduction in group A is indicative of the AAVR-dependent transduction efficiency of the AAV vector, and the level of transduction in group B is indicative of the AAVR-independent transduction efficiency of the AAV vector; A method comprising:

12. The method of claim 11, wherein the method comprises determining the adeno-associated virus receptor (AAVR)-dependent or AAVR-independent transduction efficiency of an AAV vector in human hepatocytes: (a) Group A is transplanted with wild-type human hepatocytes, and Group B is transplanted with human hepatocytes containing a deletion or mutation in the adeno-associated virus receptor (AAVR) resulting in a non-functional human AAVR (Hu AAVR KO human hepatocytes); (c) determining the level of AAV vector transduction into one or more human tissues of the non-human animals of groups A and B comprises determining the level of AAV vector transduction into human hepatocytes of the non-human animals of groups A and B; method.

13. A method for determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human tissue, the method comprising: (a) providing two groups of non-human animals, group A and group B, wherein group A comprises one or more of T-, B-, and NK cells that are deficient or dysfunctional in the non-human animal, and group B further comprises one or more of T-, B-, and NK cells that are deficient or dysfunctional in the non-human animal, comprising a deletion or mutation in an adeno-associated virus receptor (AAVR) that results in a non-functional non-human animal AAVR, wherein the deficiency or dysfunction of one or more of the T-, B-, and NK cells allows for the reconstitution of human tissues that establish human chimerism in the non-human animal; (b) transplanting one or more human tissues into one or more non-human animals of both groups of step (a); (c) infecting both groups of non-human animals of step (b) with an AAV vector; and (d) determining the level of AAV vector transduction into human tissues of the non-human animals of Group A and Group B; A method comprising:

14. The method of claim 13, the method comprising determining adeno-associated virus receptor (AAVR)-dependent or AAVR-independent modification and / or inhibition of AAV vector transduction into human hepatocytes, wherein: (a) deficiency or dysfunction of one or more of T-, B- and NK cells allows for the reconstitution of human hepatocytes that establish human chimerism in the liver of a non-human animal; (b) transplanting one or more human tissues into one or more non-human animals in both groups of step (a) comprises transplanting human hepatocytes into one or more non-human animals in both groups of step (a); and (d) determining the level of transduction of the AAV vector into human tissues of the non-human animals of groups A and B comprises determining the level of transduction of the AAV vector into human hepatocytes and non-human hepatocytes of the non-human animals of groups A and B; method.

15. The method according to claim 13, wherein the non-human animal is an IL-2Rg -/- / Rag2 -/- a non-human animal, optionally the non-human animal further comprising: -/- A method comprising: