Administration of muscle-targeting complexes to treat dystrophinopathies
Patent Information
- Application Number
- JP2024517157
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-03
- Filing Date
- 2022-09-15
- Publication Date
- 2025-09-25
AI Technical Summary
Current treatments for dystrophinopathies, such as Duchenne muscular dystrophy, are inadequate in effectively promoting dystrophin protein expression or activity, particularly in cases where mutations lead to reduced functional dystrophin levels.
Administration of muscle-targeting conjugates covalently attached to oligonucleotides, specifically anti-transferrin receptor 1 (TfR1) antibodies, to enhance dystrophin protein expression or activity by targeting mutant DMD alleles for exon skipping.
The method increases dystrophin protein expression and activity, leading to functional improvements in muscle function and reduced serum creatine kinase activity, indicating therapeutic efficacy for dystrophinopathies.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] Related Applications This application is a continuation of U.S. Provisional Application No. 63 / 348,876, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING DYSTROPHINOPATHIES," filed June 3, 2022; U.S. Provisional Application No. 63 / 293,619, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING DYSTROPHINOPATHIES," filed December 23, 2021; U.S. Provisional Application No. 63 / 250,177, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING DYSTROPHINOPATHIES," filed September 29, 2021; and U.S. Provisional Application No. 63 / 250,177, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING DYSTROPHINOPATHIES," filed September 16, 2021. This application claims the benefit under 35 USC § 119(e) of the filing date of U.S. Provisional Application No. 63 / 245,162, entitled "Inflammatory Cellular Disorders and Therapeutic Agents for the Treatment of Diabetic Dystrophy in Patients with Diabetic Recurrent Syndrome," filed on May 1, 2014, the entire contents of each of which are incorporated herein by reference.
[0002] FIELD OF THE INVENTION This application relates to targeting complexes for delivering effective amounts of oligonucleotide molecular payloads to cells, and their uses, particularly in relation to the treatment of disease.
[0003] Electronic Sequence Listing Reference The contents of the electronic sequence listing (D082470071WO00-SEQ-CBD.xml; size: 60,636 bytes; and created on August 31, 2022) are incorporated herein by reference in their entirety. [Background technology]
[0004] background Dystrophinopathies are a group of distinct neuromuscular diseases caused by mutations in the dystrophin gene. Dystrophinopathies include Duchenne muscular dystrophy, Becker muscular dystrophy, and X-linked dilated cardiomyopathy. Dystrophin (DMD) is a large gene containing 79 exons and approximately 2.6 million total base pairs. Many DMD mutations, including exonic frameshifts, deletions, substitutions, and duplications, can reduce the expression of functional dystrophin, resulting in dystrophinopathies. Summary of the Invention
[0005] Summary of the Invention According to some aspects, the present disclosure provides methods for promoting the expression or activity of a dystrophin protein (e.g., a truncated dystrophin protein) in a subject and / or treating Duchenne muscular dystrophy (DMD). The truncated dystrophin protein is functional (e.g., retains the activity of a wild-type dystrophin protein). In some embodiments, the truncated dystrophin protein retains partial function of a wild-type dystrophin protein. In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of muscle-targeting complexes, each complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 0.5 mg to 5 mg (e.g., 0.7 mg, 1.4 mg, or 2.8 mg) of oligonucleotide of the complex per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 5 mg to 80 mg (e.g., 10 mg, 30 mg, or 60 mg) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides the subject with 5 mg to 40 mg (e.g., about 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides the subject with 1 mg to 8 mg (e.g., 1 mg, 1.5 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, or 8 mg) of the anti-TfR1 antibody (e.g., Fab) conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 5 mg to 120 mg (e.g., about 11 mg, 22 mg, 44 mg, 66 mg, or 88 mg) of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, administration is once every two weeks to once every three months (e.g., once every two weeks, once every four weeks, once every two months, or once every three months).In some embodiments, the subject has a mutant DMD allele associated with Duchenne muscular dystrophy (eg, where the mutant DMD allele comprises a mutation amenable to exon skipping).
[0006] Some aspects of the present disclosure relate to methods of promoting dystrophin protein expression or activity in a subject, comprising administering to the subject a composition comprising an effective amount of conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 1 mg to 90 mg of the anti-TfR1 antibody conjugate per kg of subject, wherein the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, and a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13. a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9 or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10 or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO).
[0007] Some aspects of the disclosure relate to methods of treating Duchenne muscular dystrophy (DMD) in a subject, comprising administering to the subject a composition comprising an effective amount of conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 1 mg to 90 mg of anti-TfR1 antibody of the conjugate per kg of the subject, wherein the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8 or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9 or 14, and a heavy chain complementarity determining region 4 (CDR-H4) comprising the sequence set forth in SEQ ID NO: 4, 10 or 15. The present invention provides a method for detecting a nucleotide sequence of a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9 or 14, a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO).
[0008] In some embodiments, each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody; In each complex, n1 is independently selected from R1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 1-5. In some embodiments, each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2 comprises an anti-TfR1 antibody; In each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 1-5.
[0009] In some embodiments, the anti-TfR1 antibody is a Fab fragment. In some embodiments, the anti-TfR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
[0010] In some embodiments, an effective amount of each administration provides a subject with 1-8 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 1-2 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 1.5 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 2-4 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 3 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 4-8 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 6 mg of conjugated anti-TfR1 antibody per kg of subject.
[0011] In some embodiments, an effective amount of each administration provides a subject with 3-52 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 5-40 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 7-15 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 11 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 15-30 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 22 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 30-59 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides a subject with 44 mg of conjugated anti-TfR1 antibody per kg of subject. In some embodiments, an effective amount of each administration provides the subject with 61-117 mg of conjugated anti-TfR1 antibody per kg of subject, hi some embodiments, an effective amount of each administration provides the subject with 88 mg of conjugated anti-TfR1 antibody per kg of subject.
[0012] In some embodiments, the composition is administered once every two weeks, once every four weeks, once every eight weeks, or once every twelve weeks. In some embodiments, the composition is administered once every four weeks. In some embodiments, the composition is administered once every eight weeks.
[0013] In some embodiments, the composition is in an aqueous solution and further comprises histidine and sucrose. In some embodiments, the histidine is present in the aqueous solution at a concentration of 25 mM. In some embodiments, the sucrose is present in the aqueous solution at a concentration of 10 w / v%. In some embodiments, the aqueous solution has a pH of 6.0.
[0014] In some embodiments, the subject has a mutant dystrophin allele that comprises a mutation suitable for exon 51 skipping, or the mutant dystrophin allele comprises a frameshift mutation in exon 51. In some embodiments, the complex promotes expression or activity of a truncated dystrophin protein in the subject.
[0015] In some embodiments, the subject is a human subject. In some embodiments, the human subject is between 2 and 60 years old. [Brief explanation of the drawings]
[0016] [Figure 1]1A-1B show the activity of anti-TfR1 Fab-oligonucleotide conjugates in inducing DMD exon 51 skipping in myotubes from DMD patients. The anti-TfR1 Fab-oligonucleotide conjugates contain an anti-TfR1 Fab having a VH / VL sequence shown in Table 2, covalently linked (by lysine conjugation) to a DMD exon 51-skipping oligonucleotide (SEQ ID NO: 21) via a linker containing a valine-citrulline sequence. Figure 1A shows that a composition comprising the anti-TfR1 Fab-oligonucleotide conjugate resulted in enhanced exon skipping in myotubes from DMD patients compared to the same DMD exon 51-skipping oligonucleotide not covalently linked to a Fab. Figure 1B shows that anti-TfR1 Fab-oligonucleotide conjugates resulted in dose-dependent exon 51 skipping after treatment with anti-TfR1 Fab conjugates to final concentrations of 2.5 μM (low), 5 μM (medium), and 10 μM (high) oligonucleotide equivalents.
[0017] [Figure 2] Figures 2A-2E show oligonucleotide levels in the quadriceps (Figure 2A), diaphragm (Figure 2B), heart (Figure 2C), gastrocnemius (Figure 2D), and tibialis anterior (Figure 2E) muscles of mdx mice after administration of a single dose of anti-TfR1 Fab-oligonucleotide (Fab-oligo) conjugate equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide. The anti-TfR1 Fab-oligo conjugate contains an anti-mouse TfR1 (R17-217) Fab covalently linked to a DMD exon 23-skipping oligonucleotide via a linker containing a valine-citrulline sequence.
[0018] [Figure 3]Figures 3A-3E show the levels of exon 23 skipping in the quadriceps (Figure 3A), diaphragm (Figure 3B), heart (Figure 3C), gastrocnemius (Figure 3D), and tibialis anterior (Figure 3E) muscles of mdx mice after administration of a single dose of the anti-TfR1 Fab-oligo conjugates described in Figures 2A-2E at doses equivalent to 10 mg / kg oligonucleotide or 30 mg / kg oligonucleotide.
[0019] [Figure 4] Figures 4A-4E show the levels of dystrophin expression by quantitative Western blot in the quadriceps (Figure 4A), diaphragm (Figure 4B), heart (Figure 4C), gastrocnemius (Figure 4D), and tibialis anterior (Figure 4E) muscles of mdx mice after administration of a single dose of the anti-TfR1 Fab-oligo conjugates described in Figures 2A-2E at a dose equivalent to 10 mg / kg of oligonucleotide or 30 mg / kg of oligonucleotide. Figures 4A-4C also show example Western blot images of dystrophin expression in the quadriceps (Figure 4A), diaphragm (Figure 4B), and heart (Figure 4C) muscles of mdx mice after administration of a single dose of the anti-TfR1 Fab-oligo conjugates described in Figures 2A-2E at a dose equivalent to 30 mg / kg of oligonucleotide.
[0020] [Figure 5] Figures 5A-5C show immunofluorescence (IF) images visualizing dystrophin localization to the sarcolemma in the quadriceps muscle (Figure 5A), diaphragm (Figure 5B), and heart (Figure 5C) of mdx mice after administration of a single dose of the anti-TfR1 Fab-oligoconjugates described in Figures 2A-2E at doses equivalent to 10 mg / kg of oligonucleotide or 30 mg / kg of oligonucleotide. Figure 5A also shows quantification of the IF data for the quadriceps muscle, showing the dystrophin-positive fiber fraction (PDPF).
[0021] [Figure 6]Figures 6A-6B show the levels of exon 51 skipping in the heart (Figure 6A) and diaphragm (Figure 6B) of cynomolgus monkeys after administration of a single dose of anti-TfR1 Fab-oligoconjugate equivalent to 60 mg / kg of oligonucleotide or two doses (days 1 and 15) of anti-TfR1 Fab-oligoconjugate equivalent to 30 mg / kg of oligonucleotide. The levels of exon skipping were analyzed two weeks after the single 60 mg / kg dose (day 15) or two weeks after the second 30 mg / kg dose (day 29). The anti-TfR1 Fab-oligoconjugates contain an anti-TfR1 Fab with the VH / VL sequences shown in Table 2, which is covalently linked (by lysine conjugation) to a DMD exon 51-skipping oligonucleotide (SEQ ID NO: 21) via a linker containing a valine-citrulline sequence.
[0022] [Figure 7] Figures 7A-7C show the levels of exon 51 skipping in the quadriceps muscle (Figure 7A), diaphragm (Figure 7B), and heart (Figure 7C) of cynomolgus monkeys after administration of (i) two doses (days 1 and 15) of anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotide ("2x30", measured at 4 weeks), (ii) a weekly dose for 4 weeks of anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotide ("4x30", measured at 4 weeks), or (iii) a weekly dose for 5 weeks of anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotide ("5x30", measured at 8 weeks). The anti-TfR1 Fab-oligonucleotide conjugate contains an anti-TfR1 Fab having the VH / VL sequence shown in Table 2, which is covalently linked (by lysine conjugation) to a DMD exon 51-skipping oligonucleotide (SEQ ID NO: 21) via a linker containing a valine-citrulline sequence.
[0023] [Figure 8] Figures 8A-8E show that a single dose of anti-TfR1 Fab-oligonucleotide conjugate, but not unconjugated exon 23-skipping oligonucleotide, induces dose-dependent levels of oligonucleotide in the skeletal and cardiac muscles of mdx mice. Five-week-old mdx mice were injected via the tail vein with vehicle, 30 mg / kg of unconjugated exon 23-skipping oligonucleotide, or anti-TfR1 Fab-oligonucleotide conjugate at doses equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide, and the mice were sacrificed at the indicated time points. Using hELISA, the levels of the indicated oligonucleotide in skeletal and cardiac muscles were determined. Data represent the mean ± SD. *p<0.05, **p<0.01, ****p<0.0001. hELISA, hybridization enzyme-linked immunosorbent assay; PMO, phosphorodiamidate morpholino oligomer; WT, wild-type.
[0024] [Figure 9] Figures 9A-9E show that a single dose of anti-TfR1 Fab-oligonucleotide conjugate resulted in dose-dependent enhancement of Dmd exon 23 skipping in skeletal and cardiac muscle of mdx mice compared with a single dose of unconjugated exon 23-skipping oligonucleotide. Five-week-old mdx mice were injected via the tail vein with vehicle, 30 mg / kg of unconjugated exon 23-skipping oligonucleotide, or anti-TfR1 Fab-oligonucleotide conjugate at doses equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide, and the mice were sacrificed at the indicated time points. Exon 23 skipping was measured by RT-PCR and capillary electrophoresis. Skipping rates were calculated as described in Materials and Methods. Data represent the mean ± SD. *p<0.05, **p<0.01, ****p<0.0001. PMO, phosphorodiamidate morpholino oligomer; RT-PCR, reverse transcription polymerase chain reaction; WT, wild type.
[0025] [Figure 10] Figures 10A-10F show that a single dose of anti-TfR1 Fab-oligonucleotide conjugate resulted in dose-dependent enhancement of dystrophin protein expression in the skeletal and cardiac muscles of mdx mice compared with a single dose of unconjugated exon 23-skipping oligonucleotide. Five-week-old mdx mice were injected via the tail vein with vehicle, 30 mg / kg of unconjugated exon 23-skipping oligonucleotide, or anti-TfR1 Fab-oligonucleotide conjugate at a dose equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide, and the mice were sacrificed at the indicated time points. Figure 10A shows representative Western blot images of dystrophin expression 28 days after a single dose of anti-TfR1 Fab-oligonucleotide conjugate at a dose equivalent to 30 mg / kg of oligonucleotide, or a matched 30 mg / kg dose of unconjugated exon 23-skipping oligonucleotide. Dystrophin levels in these samples exceeded the upper limit of the standard curve, and these Western blots were not used for quantification. Additional Western blotting was performed on samples diluted within the standard curve range and used for quantification. All bands were quantified based on the standard curve, which was generated on the same gel and using the same muscle tissue matrix. Figures 10B-10F show quantification of dystrophin protein levels by fluorometric analysis of Western blot images. Data represent the mean ± SD. *p<0.05, **p<0.01, ****p<0.0001. PMO, phosphorodiamidate morpholino oligomer; WT, wild type.
[0026] [Figure 11]Figures 11A-11D show that a single dose of anti-TfR1 Fab-oligonucleotide conjugate is sufficient to restore dystrophin localization to the sarcolemma in skeletal and cardiac muscles of mdx mice. Five-week-old mdx mice were injected via the tail vein with vehicle or a dose of anti-TfR1 Fab-oligonucleotide conjugate equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide, and the mice were sacrificed at the indicated time points. Figure 11A shows representative immunofluorescence images of dystrophin (green) and laminin (red) staining of quadriceps muscle cross sections isolated from vehicle-treated wild-type or mdx mice, or from mdx mice treated with an anti-TfR1 Fab-oligonucleotide conjugate equivalent to 30 mg / kg of oligonucleotide, 4, 8, and 12 weeks after administration. Individual fields quantified for the 30 mg / kg oligonucleotide group at 8 weeks are shown in Figure 15. Figure 11B shows quantification of dystrophin-positive fibers in the quadriceps muscle of mdx mice. Figures 11C and 11D show representative immunofluorescence images of dystrophin (green) and laminin (red) staining of cross sections of the diaphragm (Figure 11C) and heart (Figure 11D) isolated from vehicle-treated mdx mice or from mdx mice treated with anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotide 4 or 8 weeks after administration. Data represent the mean ± SD. ****p<0.0001. PMO, phosphorodiamidate morpholino oligomer; WT, wild type.
[0027] [Figure 12]Figure 12 shows that dystrophin restored by anti-TfR1 Fab-oligonucleotide conjugates is localized to the muscle membrane of mdx mice. Five-week-old mdx mice were injected via the tail vein with vehicle or a dose of anti-TfR1 Fab-oligonucleotide conjugate equivalent to 30 mg / kg of oligonucleotide, and the mice were sacrificed 4 weeks after administration. Diaphragms were isolated, and longitudinal sections were stained with dystrophin (green) and laminin (red) to visualize the distribution of membrane-localized dystrophin along the entire length of muscle fibers. PMO, phosphorodiamidate morpholino oligomer.
[0028] [Figure 13] Figures 13A-13C show that treatment with anti-TfR1 Fab-oligonucleotide conjugates, but not with unconjugated exon 23-skipping oligonucleotides, results in improved functional outcomes in mdx mice. Functional assessments were performed 2 weeks after administration of vehicle to 5-week-old wild-type or mdx mice injected with 30 mg / kg of unconjugated exon 23-skipping oligonucleotides or anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotides. Figure 13A shows serum creatine kinase (CK) activity. Figure 13B shows total distance traveled on a running wheel over consecutive 24-hour periods. Figure 13C shows the percent change in total distance traveled in an open field before and after hindlimb fatigue testing. Data are presented as mean ± SD. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. ns, not significant; PMO, phosphorodiamidate morpholino oligomer; WT, wild type.
[0029] [Figure 14]Figures 14A-14B show representative fluorescent Western blot images and standard curve quantification. Figure 14A shows a representative fluorescent Western blot image in which each gel was run along with a standard curve of wild-type mouse protein diluted into mdx mouse protein. Raw fluorescence was measured in the dystrophin and alpha-actinin channels for each standard and unknown sample. Figure 14B shows standard curve quantification. Dystrophin / alpha-actinin ratios were generated and plotted against the known wild-type protein ratios in each standard to generate an equation. Unknown samples were then interpolated from their dystrophin / alpha-actinin ratios based on the standard curve equation. If the raw dystrophin signal of an unknown sample was above the standard curve, the sample was diluted until it fell within the standard curve. WT, wild-type.
[0030] [Figure 15] Figure 15 shows immunofluorescence micrographs used to quantify the percentage of positive muscle fibers in the quadriceps muscles of mdx mice (see also Figures 11A-11B). Five-week-old mdx mice were injected via the tail vein with anti-TfR1 Fab-oligonucleotide conjugates at a dose equivalent to 30 mg / kg of oligonucleotide. Immunofluorescence images of dystrophin (green) and laminin (red) staining of isolated quadriceps muscles 8 weeks after administration.
[0031] [Figure 16]Figures 16A-16B show that treatment with anti-TfR1 Fab-oligonucleotide conjugates reduces serum creatine kinase activity in mdx mice. Five-week-old mdx mice injected via the tail vein with anti-TfR1 Fab-oligonucleotide conjugates at doses equivalent to 10 mg / kg or 30 mg / kg of oligonucleotide were sacrificed, and serum creatine kinase (CK) was assessed 28 (Figure 16A) or 56 (Figure 16B) days after administration. Data are normalized to the mean serum CK of vehicle-treated mdx mice at the matched time points. Data represent the mean ± SD. *p<0.05; **p<0.01. CK, creatine kinase; PMO, phosphorodiamidate morpholino oligomer.
[0032] [Figure 17] Figures 17A-17B show that anti-TfR1 Fab-oligonucleotide conjugate-mediated dystrophin restoration results in improved functional outcomes in mdx mice. Functional assessments were performed 4 weeks after administration of 5-week-old wild-type or mdx mice with vehicle, 30 mg / kg of unconjugated exon 23-skipping oligonucleotide, or 30 mg / kg of the anti-TfR1 Fab-oligonucleotide conjugate at a dose equivalent to the oligonucleotide. Figure 17A shows the total distance traveled on a running wheel over consecutive 24-hour periods. Figure 17B shows the percent change in total distance traveled in an open field before and after hindlimb fatigue. Data are presented as mean ± SD. *p ≤ 0.05, **p ≤ 0.01. ns, not significant; PMO, phosphorodiamidate morpholino oligomer; WT, wild type. DETAILED DESCRIPTION OF THE INVENTION
[0033] Detailed Description of the Invention According to some aspects, the present disclosure provides methods for promoting the expression or activity of a dystrophin protein (e.g., a truncated dystrophin protein) in a subject and / or treating Duchenne muscular dystrophy (DMD). The truncated dystrophin protein is functional (e.g., retains the activity of a wild-type dystrophin protein). In some embodiments, the truncated dystrophin protein retains partial function of a wild-type dystrophin protein. In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of muscle-targeting complexes, each complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 0.5 mg to 5 mg (e.g., about 0.7 mg, 1.4 mg, or 2.8 mg) of oligonucleotides of the complex per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 5 mg to 80 mg (e.g., 10 mg, 30 mg, or 60 mg) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides the subject with 5 mg to 40 mg (e.g., about 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides the subject with 1 mg to 8 mg (e.g., about 1.5 mg, 3.0 mg, or 6.0 mg) of the anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, an effective amount provides the subject with 5 mg to 120 mg (e.g., about 11 mg, 22 mg, 44 mg, 66 mg, or 88 mg) of the conjugate anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, administration is between once every two weeks and once every three months (eg, once every two weeks, once every four weeks, once every two months, or once every three months).In some embodiments, the subject has a mutant DMD allele associated with Duchenne muscular dystrophy (eg, where the mutant DMD allele comprises a mutation amenable to exon skipping).
[0034] Further aspects of the disclosure, including explanations of defined terms, are provided below.
[0035] definition Administering: As used herein, the term "administering" or "administration" means providing a conjugate to a subject in a physiologically and / or (e.g., and) pharmacologically useful manner (e.g., treating a condition in the subject).
[0036] Approximately: As used herein, the term "approximately" or "about," when applied to one or more values of interest, refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about," unless otherwise indicated or clear from the context (except when such number exceeds 100% of the feasible value), refers to a broad range of values that fall within 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value.
[0037] Antibody: As used herein, the term "antibody" refers to a polypeptide that includes at least one immunoglobulin variable domain or at least one antigenic determinant, e.g., a paratope, that specifically binds to an antigen. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody, except that in some embodiments, the antibody is a Fab fragment, a Fab' fragment, a F(ab')2 fragment, an Fv fragment, or an scFv fragment. In some embodiments, the antibody is a nanobody derived from a camelid antibody or a nanobody derived from a shark antibody. In some embodiments, the antibody is a diabody. In some embodiments, the antibody comprises a framework with human germline sequences. In another embodiment, the antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgA1, IgA2, IgD, IgM, and IgE constant domains. In some embodiments, an antibody comprises a heavy (H) chain variable region (abbreviated herein as VH) and / or (e.g., and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, an antibody comprises a constant domain, e.g., an Fc region. An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy and light chain constant domain amino acid sequences and their functional variations are known. With respect to the heavy chain, in some embodiments, the heavy chain of an antibody described herein can be an alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In some embodiments, the heavy chain of an antibody described herein can comprise a human alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In specific embodiments, an antibody described herein comprises a human gamma 1 CH1, CH2, and / or (e.g., and) CH3 domain. In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (γ) heavy chain constant region, such as any known in the art.Non-limiting examples of human constant region sequences are described in the art; see, for example, U.S. Patent No. 5,693,780 and Kabat EA et al., (1991), supra. In some embodiments, the VH domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, the antibody is modified, for example, via glycosylation, phosphorylation, sumoylation, and / or (e.g., and) methylation. In some embodiments, the antibody is a glycosylated antibody conjugated to one or more sugar or carbohydrate molecules. In some embodiments, one or more sugar or carbohydrate molecules are conjugated to the antibody via N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and / or (e.g., and) phosphoglycosylation. In some embodiments, the one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecules are branched oligosaccharides or branched glycans. In some embodiments, the one or more sugar or carbohydrate molecules comprise a mannose unit, a glucose unit, an N-acetylglucosamine unit, an N-acetylgalactosamine unit, a galactose unit, a fucose unit, or a phospholipid unit. In some embodiments, the antibody is a construct comprising a polypeptide comprising one or more antigen-binding fragments of the present disclosure linked to a linker polypeptide or an immunoglobulin constant domain. The linker polypeptide comprises two or more amino acid residues linked by a peptide bond and is used to link one or more antigen-binding moieties. Examples of linker polypeptides have been reported (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123).Furthermore, an antibody can be part of a larger immunoadhesion molecule formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides. Examples of such immunoadhesion molecules include the use of streptavidin core regions to generate tetrameric scFv molecules (Kipriyanov, SM, et al. (1995) Human Antibodies and Hybridomas 6:93-101), and the use of cysteine residues, marker peptides, and C-terminal polyhistidine tags to generate bivalent, biotinylated scFv molecules (Kipriyanov, SM, et al. (1994) Mol. Immunol. 31:1047-1058).
[0038] CDR: As used herein, the term "CDR" refers to a complementarity-determining region within an antibody variable sequence. A typical antibody molecule comprises a heavy chain variable region (VH) and a light chain variable region (VL), which are typically involved in antigen binding. The VH and VL regions can be further subdivided into hypervariable regions, also known as "complementarity-determining regions" ("CDRs"), interspersed with more conserved regions known as "framework regions" ("FRs"). Each VH and VL is typically composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The extent of the framework regions and CDRs can be precisely identified using methodologies known in the art, for example, by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or (e.g., and) contact definition, all of which are well known in the art.For example, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDepartment of Health and Human Services, NIH Publication No. 91-3242; IMGT (registered trademark), the international ImMunoGeneTics information system (registered trademark) http: / / www.imgt.org, Lefranc, M.-P. et al., Nucleic Acids Res.,27:209-212(1999);Ruiz,M.et al.,Nucleic Acids Res.,28:219-221(2000);Lefranc,M.-P.,Nucleic Acids Res.,29:207-209(2001);Lefranc,M.-P.,Nucleic Acids Res.,31:307-310(2003);Lefranc,M.-P.et al.,In Silico Biol.,5,0006(2004)[Epub],5:45-60(2005);Lefranc,M.-P.et al.,Nucleic Acids Res.,33:D593-597(2005);Lefranc,M.-P.et al.,Nucleic Acids Res.,37:D1006-1012(2009);Lefranc,M.-P.et al.,Nucleic Acids Res.,43:D413-422(2015);Chothia et al.,(1989)Nature 342:877;Chothia,C.et al. (1987) J. Mol. Biol. 196:901-917, Al-lazikani et al. See, e.g., J. Molec. Biol. 273:927-948; and Almagro, J. Mol. Recognit. 17:132-143 (2004). See also hgmp.mrc.ac.uk and bioinf.org.uk / abs. As used herein, CDRs may refer to CDRs defined by any method known in the art.Two antibodies having the same CDRs means that the two antibodies have the same amino acid sequence of their CDRs when determined in the same way, for example, by the IMGT definition.
[0039] Each heavy chain and light chain variable region has three CDRs, which are designated as CDR1, CDR2 and CDR3 for each variable region.As used herein, the term "CDR set" refers to a group of three CDRs that occur in a single variable region that can bind to antigen.The exact boundaries of these CDRs are defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs may be referred to as Kabat CDRs. Sub-portions of the CDRs may be designated L1, L2, and L3, or H1, H2, and H3, with "L" and "H" designating the light chain and heavy chain regions, respectively. These regions may be referred to as Chothia CDRs, whose boundaries overlap with the Kabat CDRs. Other boundaries defining CDRs that overlap with the Kabat CDRs are described by Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45(1996)). Still other CDR boundary definitions may not strictly adhere to one of the above systems, but may still overlap with the Kabat CDRs, and may be shortened or extended in light of predictions or experimental findings that a particular residue or group of residues, or even an entire CDR, does not significantly affect antigen binding. The methods used herein may utilize CDRs defined according to any of these systems. Examples of CDR definition systems are provided in Table 1. [Table 1]
[0040] Complementary: As used herein, the term " complementary " refers to the ability for precise pairing between two nucleotides or two pairs of nucleotides.In particular, complementary is a term that characterizes the degree of hydrogen bond pairing that causes binding between two nucleotides or two pairs of nucleotides.For example, if the base of an oligonucleotide at a certain position can hydrogen bond with the base of target nucleic acid (for example, mRNA) at corresponding position, then the bases are considered to be complementary to each other at this position.Base pairing can include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (for example, Wobble base pairing and Hoogsteen base pairing). For example, in some embodiments, for complementary base pairing, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), cytosine-type bases (C) are complementary to guanosine-type bases (G), and universal bases, such as 3-nitropyrrole or 5-nitroindole, can hybridize to and are considered complementary to any A, C, U, or T. Inosine (I) is also considered a universal base in the art and is considered complementary to any A, C, U, or T.
[0041] Covalently linked: As used herein, the term "covalently linked" refers to the characteristic of two or more molecules being linked together via at least one covalent bond. In some embodiments, two molecules can be covalently linked together by a single bond, such as a disulfide bond or disulfide bridge, that acts as a linker between the molecules. However, in some embodiments, two or more molecules can be covalently linked together via a molecule that acts as a linker that connects two or more molecules together through multiple covalent bonds. In some embodiments, the linker can be a cleavable linker. However, in some embodiments, the linker can be a non-cleavable linker.
[0042] DMD: As used herein, the term "DMD" refers to the gene encoding dystrophin protein, which is an important component of the dystrophin-glycoprotein complex that bridges the internal cytoskeleton and extracellular matrix in muscle cells, especially muscle fibers. Deletions, duplications, and point mutations in DMD can cause dystrophinopathies, such as Duchenne muscular dystrophy, Becker muscular dystrophy, or cardiomyopathy. Alternative promoter usage and alternative splicing result in a large number of different transcript variants and protein isoforms for this gene. In some embodiments, the dystrophin gene can be human (gene ID: 1756), non-human primate (e.g., gene ID: 465559), or rodent gene (e.g., gene ID: 13405, gene ID: 24907). In addition, multiple human transcript variants encoding different protein isoforms have been characterized (e.g., as annotated under GenBank RefSeq accession numbers: NM_000109.3, NM_004006.2 (SEQ ID NO: 24), NM_004009.3, NM_004010.3, and NM_004011.3).
[0043] DMD allele: As used herein, the term "DMD allele" refers to any one of the alternative forms (for example, wild type or mutant) of DMD gene.In some embodiments, DMD allele can encode dystrophin that maintains its normal and typical function.In some embodiments, DMD allele can contain one or more mutations that cause muscular dystrophy.The common mutation that causes Duchenne muscular dystrophy involves frameshift, deletion, substitution and duplication mutation in one or more of the 79 exons present in dystrophin allele, such as exon 8, exon 23, exon 41, exon 44, exon 50, exon 51, exon 52, exon 53 or exon 55. Further examples of DMD mutations are disclosed, for example, in Flanigan KM et al., Mutational spectrum of DMD mutations in dystrophinopathy patients: application of modern diagnostic techniques to a large cohort. Hum Mutat. 2009 Dec;30(12):1657-66, the entire contents of which are incorporated herein by reference.
[0044] Dystrophinopathy: As used herein, the term "dystrophinopathy" refers to a muscle disease resulting from one or more mutant DMD alleles. Dystrophinopathy encompasses a spectrum of conditions (ranging from mild to severe), including Duchenne muscular dystrophy, Becker muscular dystrophy, and DMD-associated dilated cardiomyopathy (DCM). In some embodiments, at one end of the spectrum, dystrophinopathy is phenotypically associated with asymptomatic increases in serum concentrations of creatine phosphokinase (CK) and / or muscle spasms accompanied by myoglobinuria (e.g., and). In some embodiments, at the other end of the spectrum, dystrophinopathy is phenotypically associated with progressive muscle diseases generally classified as Duchenne or Becker muscular dystrophy when skeletal muscle is primarily affected, or DMD-associated dilated cardiomyopathy (DCM) when the heart is primarily affected. Symptoms of Duchenne muscular dystrophy include muscle loss or degeneration, decreased muscle function, pseudohypertrophy of the tongue and calf muscles, increased risk of neurological abnormalities, and shortened lifespan. Duchenne muscular dystrophy is associated with Online Mendelian Inheritance in Man (OMIM) Entry #310200. Becker muscular dystrophy is associated with OMIM Entry #300376. Dilated cardiomyopathy is associated with OMIM Entry X#302045.
[0045] Exonic splicing enhancer (ESE): As used herein, the term "exonic splicing enhancer" or "ESE" refers to a nucleic acid sequence motif within an exon of a gene, pre-mRNA, or mRNA that directs or enhances splicing of the pre-mRNA into mRNA, as described, for example, in Blencowe et al., Trends Biochem Sci 25, 106-10. (2000), which is incorporated herein by reference. ESEs are splicing functions. ESEs can direct or enhance splicing to remove, for example, one or more introns and / or one or more exons from a gene transcript. ESE motifs are typically 6 to 8 nucleobases in length. SR proteins (e.g., proteins encoded by genes SRSF1, SRSF2, SRSF3, SRSF4, SRSF5, SRSF6, SRSF7, SRSF8, SRSF9, SRSF10, SRSF11, SRSF12, TRA2A, or TRA2B) bind to ESEs through their RNA recognition motif regions to facilitate splicing. ESE motifs can be identified through several methods, including those described in Cartegni et al., Nucleic Acids Research, 2003, Vol. 31, No. 13, 3568-3571, which is incorporated herein by reference.
[0046] Framework: As used herein, the term "framework" or "framework sequence" refers to the remaining sequence of the variable region minus the CDRs. Because the exact definition of a CDR sequence can be determined by various systems, the meaning of a framework sequence is subject to correspondingly different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 of the light chain, and CDR-H1, CDR-H2, and CDR-H3 of the heavy chain) also divide the framework regions on the light and heavy chains into four subregions (FR1, FR2, FR3, and FR4) on each chain, where CDR1 is located between FR1 and FR2, CDR2 is located between FR2 and FR3, and CDR3 is located between FR3 and FR4. Without specifying the specific subregion as FR1, FR2, FR3, or FR4, the framework regions referred to by others represent the combined FRs in the variable region of a single naturally occurring immunoglobulin chain. As used herein, FR refers to one of the four subregions, and FR(s) refers to two or more of the four subregions that make up the framework region. Human heavy and light chain acceptor sequences are known in the art. In one embodiment, acceptor sequences known in the art can be used in the antibodies disclosed herein.
[0047] Human antibody: As used herein, the term "human antibody" is intended to encompass antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present disclosure may, for example, include amino acid residues in the CDRs, particularly CDR3, that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term "human antibody," as used herein, is not intended to encompass antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, are grafted onto human framework sequences.
[0048] Humanized antibody: The term "humanized antibody" refers to an antibody that contains heavy and light chain variable region sequences from a non-human species (e.g., mouse), but in which at least a portion of the VH and / or (e.g., and) VL sequences have been altered to be more "human-like," i.e., more similar to human germline variable sequences. One type of humanized antibody is a CDR-grafted antibody in which human CDR sequences are introduced onto non-human VH and VL sequences to replace the corresponding non-human CDR sequences. In one embodiment, humanized anti-transferrin receptor antibodies and antigen-binding portions are provided. Such antibodies can be produced by obtaining a murine anti-transferrin receptor monoclonal antibody using conventional hybridoma technology, followed by in vitro humanization using genetic engineering, e.g., as disclosed by Kasaian et al. in PCT Publication No. WO 2005 / 123126.
[0049] Kabat numbering: The terms "Kabat numbering," "Kabat definition," and "Kabat labeling" are used interchangeably herein. These art-recognized terms refer to a system for numbering amino acid residues that are more variable (i.e., hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody or its antigen-binding portion (Kabat et al. (1971) Ann. NY Acad. Sci. 190:382-391 and Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDapartment of Health and Human Services, NIH Publication No. 91-3242). For the heavy chain variable region, the hypervariable region spans amino acid positions 31-35 for CDR1, amino acid positions 50-65 for CDR2, and amino acid positions 95-102 for CDR3. For the light chain variable region, the hypervariable region spans amino acid positions 24-34 for CDR1, amino acid positions 50-56 for CDR2, and amino acid positions 89-97 for CDR3.
[0050] Morpholino: As used herein, the term "morpholino", also referred to as "phosphorodiamidate morpholino oligomer", refers to a molecular structure containing nucleobases attached to a backbone of methylene morpholine rings linked through phosphorodiamidate groups. In some embodiments, the oligonucleotide may be a morpholino-based compound. Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510; Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Patent No. 5,034,506, issued July 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010, the entire disclosures of which are incorporated herein by reference).
[0051] Oligonucleotide: As used herein, the term "oligonucleotide" refers to an oligomeric nucleic acid compound up to 200 nucleotides in length. Examples of oligonucleotides include, but are not limited to, RNAi oligonucleotides (e.g., siRNA, shRNA), microRNA, gapmers, mixmers, phosphorodiamidate morpholinos, peptide nucleic acids, aptamers, guide nucleic acids (e.g., Cas9 guide RNA), etc. Oligonucleotides can be single-stranded or double-stranded. In some embodiments, oligonucleotides can contain one or more modified nucleosides (e.g., 2'-O-methyl sugar modifications, purine or pyrimidine modifications). In some embodiments, oligonucleotides can contain one or more modified internucleoside linkages. In some embodiments, oligonucleotides can contain one or more phosphorothioate linkages, which can be in Rp or Sp stereochemical configuration.
[0052] Complementary region: As used herein, the term "complementary region" refers to a nucleotide sequence, e.g., of an oligonucleotide, that is sufficiently complementary to the cognate nucleotide sequence of a target nucleic acid, such that the two nucleotide sequences can anneal to each other under physiological conditions (e.g., within a cell). In some embodiments, the complementary region is fully complementary to the cognate nucleotide sequence of the target nucleic acid. However, in some embodiments, the complementary region is partially complementary (e.g., at least 80%, 90%, 95%, or 99% complementary) to the cognate nucleotide sequence of the target nucleic acid. In some embodiments, the complementary region contains 1, 2, 3, or 4 mismatches compared to the cognate nucleotide sequence of the target nucleic acid.
[0053] Specific binding: As used herein, the term "specific binding" refers to the ability of a molecule to bind to a binding partner with a degree of affinity or avidity that allows the molecule to be used to distinguish the binding partner from an appropriate control in a binding assay or other binding context. With respect to an antibody, the term "specific binding" refers to the ability of the antibody to bind to a particular antigen, as described herein, with a degree of affinity or avidity that allows the antibody to be used to distinguish the particular antigen from others, compared to one or more appropriate reference antigens, for example, to the extent that it allows preferential targeting to particular cells, e.g., muscle cells, through binding to the antigen. In some embodiments, an antibody requires at least about 10 -4 M, 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M or lower K D In some embodiments, the antibody specifically binds to a transferrin receptor, e.g., an epitope in the apical domain of a transferrin receptor.
[0054] Subject: As used herein, the term "subject" refers to a mammal. In some embodiments, the subject is a non-human primate or rodent. In some embodiments, the subject is a human. In some embodiments, the subject is a patient, e.g., a human patient, having or suspected of having a disease. In some embodiments, the subject is a human patient having or suspected of having a disease caused by a mutant DMD gene sequence, e.g., a mutation in an exon of the DMD gene sequence. In some embodiments, the subject has a dystrophinopathy, e.g., Duchenne muscular dystrophy.
[0055] Transferrin receptor: As used herein, the term "transferrin receptor" (also known as TFRC, CD71, p90, TFR, or TFR1) refers to an internalized cell surface receptor that binds to transferrin to facilitate endocytic iron uptake. In some embodiments, the transferrin receptor can be of human (NCBI gene ID 7037), non-human primate (e.g., NCBI gene ID 711568 or NCBI gene ID 102136007), or rodent (e.g., NCBI gene ID 22042) origin. In addition, multiple human transcript variants encoding different receptor isoforms have been characterized (e.g., as annotated under GenBank RefSeq accession numbers: NP_001121620.1, NP_003225.2, NP_001300894.1, and NP_001300895.1).
[0056] Ranges: All ranges provided in this disclosure include the endpoints.
[0057] Complex Provided herein are methods for promoting dystrophin protein expression or activity and / or treating Duchenne muscular dystrophy (DMD) in a subject, comprising administering an effective amount of a muscle-targeting complex to the subject, wherein the complex comprises a targeting agent, e.g., an antibody, covalently linked to an oligonucleotide. In some embodiments, the complex comprises a muscle-targeting antibody covalently linked to one or more oligonucleotides. In some embodiments, the oligonucleotide is a PMO. In some embodiments, the oligonucleotide is an oligonucleotide that targets a mutant DMD allele to promote exon skipping.
[0058] The conjugates used in the methods described herein generally include a linker that covalently connects an antibody described herein (e.g., any one of the anti-TfR1 antibodies) to an oligonucleotide (e.g., a PMO). The linker includes at least one covalent bond.
[0059] In some embodiments, the conjugate used in the methods described herein has the formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently comprises an oligonucleotide-containing compound (e.g., a PMO), and R 2 comprises an antibody (e.g., an anti-TfR1 antibody), wherein in each complex, n1 independently represents the R 1 In some embodiments, each R 1 In some embodiments, each R 1 In some embodiments, R 2 is an antibody (e.g., an anti-TfR1 antibody). In some embodiments, R 2 is an anti-TfR1 Fab.
[0060] In some embodiments, in each conjugate, n1 is independently an integer greater than or equal to 1. In some embodiments, the antibody comprises a sequence set forth in Table 2. By way of example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19, and / or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. In some embodiments, the antibody is a Fab fragment.
[0061] In some embodiments, the value of n1 for each or any conjugate (e.g., any conjugate in any of the compositions or methods disclosed herein) is an integer from 1 to the number of amino acid residues (e.g., the number of lysine residues) in the antibody to which conjugation is desired or targeted. In some embodiments, for each conjugate, the value of n1 is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, for each conjugate, the value of n1 is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, for each conjugate, the value of n1 is independently in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3.
[0062] In some embodiments, the conjugates used in the methods described herein are presented as a composition (e.g., in an aqueous solution) for administration to a subject. In some embodiments, the composition comprises multiple conjugates and further comprises histidine and / or sucrose. In some embodiments, the multiple different conjugates comprise a common targeting agent (e.g., an antibody) and a common oligonucleotide (PMO). In such embodiments, the different conjugate types are characterized by having different numbers of oligonucleotides covalently linked to the antibody. For example, in some embodiments, the composition for administration to a subject comprises multiple conjugate types, each conjugate type having a structure represented by Formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently includes compounds that include oligonucleotides (e.g., PMOs), and R 2 includes an antibody (e.g., an anti-TfR1 antibody), and for each complex type, n1 is independently the R 1n is an integer equal to or greater than 1 representing the number of instances of the compound, and different complex types of the composition are characterized by having different n values (e.g., n values in the ranges of 1 to 27, 1 to 26, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, or 1 to 3).
[0063] In some embodiments, in the methods described herein, the composition for administration to a subject comprises (e.g., a trace amount of) an unconjugated antibody and an antibody conjugated to one or more oligonucleotides. In some embodiments, the unconjugated antibody has the formula (I): [R 1 ] n1 -R 2 where n1 is 0. Thus, in some embodiments, in the methods described herein, the composition for administration to a subject may be referred to as a compound of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently comprises a group comprising an oligonucleotide, and R 2 comprises an antibody, and n1 independently represents the R 1 In some embodiments, the number of instances of Structural Formula (I): [R 1 ] n1 -R 2 The proportion of the compound is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05% or less than 0.01%.
[0064] In some embodiments, R in the complex 1 Each instance of R is conjugated to a different amino acid residue of the antibody. In some embodiments, each different amino acid comprises an ε-amino group (e.g., lysine, arginine). However, in some embodiments, R 1 In some embodiments, each different amino acid to which R is covalently linked is a cysteine. 1is directly covalently linked to an amino acid residue of the antibody, except that in some embodiments, R 1 is indirectly covalently linked to an amino acid of the antibody, for example, covalently linked to a glycosylation site on the amino acid.
[0065] In some embodiments, R 1 is directly covalently linked to an amino acid residue of the antibody, except that in some embodiments, R 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid. 1 is not covalently linked to an amino acid residue present in the CDR region of the antibody.
[0066] In some embodiments, the conjugate used in the methods described herein has the formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently comprises a group of formula (Ia): [ka] In the formula, R 3 is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO); where, in each conjugate, n1 is independently the R 1 is an integer (e.g., 1 or greater) representing the number of instances of each R 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 In some embodiments, R comprises an antibody that is a Fab fragment. 3 is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO) comprising the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 2 contains Fab, and each R 1is covalently linked (e.g., indirectly or directly, e.g., directly) to a different amino acid residue of the Fab at attachment point A, optionally where each different amino acid residue is a lysine. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3).
[0067] In some embodiments, the conjugate used in the methods described herein has the formula (I): [R 1 ] n1 -R 2 wherein each R 1 comprises a group of formula (Ib): [ka] where -pN indicates the base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21), and where, for each complex, n1 independently represents the R 1 is an integer (e.g., 1 or greater) representing the number of instances of each R 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 contains Fab, and each R 1is covalently linked (e.g., indirectly or directly, e.g., directly linked) to different amino acid residues of the Fab at attachment point A, optionally where each different amino acid residue is a lysine.
[0068] In some embodiments, the conjugate used in the methods described herein has the formula (I): [R 1 ] n1 -R 2 wherein each R 1 comprises a group of formula (Ic): [ka] wherein, for each complex, n1 is independently selected from R 1 is an integer (e.g., 1 or greater) representing the number of instances of 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 contains Fab, and each R 1 is covalently linked (e.g., indirectly or directly, e.g., directly linked) to different amino acid residues of the Fab at attachment point A, optionally where each different amino acid residue is a lysine.
[0069] In some embodiments, the conjugate used in the methods described herein comprises the structure of formula (Id): [ka] where -pN indicates the base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); where R 2comprises an antibody (e.g., Fab) comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently an integer (e.g., 1 or greater) representing the number of instances of the group enclosed by the square brackets, where each instance of the group enclosed by the square brackets is covalently linked to a different amino acid residue of the antibody (e.g., Fab), and optionally wherein each different amino acid residue is lysine. In some embodiments, R 2 comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or an antibody (e.g., Fab) comprising a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody (e.g., a Fab) comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody (e.g., a Fab) comprising a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2In some embodiments, R comprises an antibody (e.g., a Fab) comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 comprises an antibody (e.g., a Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 comprises antibodies (e.g., Fab) that are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) through different amino acid residues of the antibodies (e.g., Fab), optionally wherein each different amino acid residue is a lysine.
[0070] In some embodiments, the conjugates described herein comprise a structure of formula (A): [ka] wherein n is 0-15 (e.g., 3) and m is 0-15 (e.g., 4). In some embodiments, the antibody is an an-TfR1 antibody (e.g., an anti-TfR1 antibody provided in Table 2). In some embodiments, the oligonucleotide is a PMO and comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the amide shown adjacent to the anti-TfR1 antibody in the structure results from reaction with an amine, e.g., lysine epsilon amine, of the anti-TfR1 antibody. In some embodiments, the conjugates described herein comprise an anti-TfR1 Fab covalently linked to the 5' end of the PMO via a lysine of the Fab. In some embodiments, the antibody comprises a sequence set forth in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19, and / or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.
[0071] antibody In some embodiments, the conjugate used in the methods described herein comprises an antibody that binds to human transferrin receptor 1 (TfR1). An example of a human transferrin receptor 1 amino acid sequence corresponding to NCBI sequence NP_003225.2 (transferrin receptor protein 1 isoform 1, homo sapiens) is as follows: (SEQ ID NO: 35).
[0072] Table 2 provides examples of anti-TfR1 antibody sequences useful in the conjugates provided herein. [Table 2]
[0073] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 1 (according to the IMGT definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 2 (according to the IMGT definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 3 (according to the IMGT definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 4 (according to the IMGT definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the IMGT definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the IMGT definition system).
[0074] In some embodiments, an anti-TfR1 antibody of the disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 7 (according to the Kabat definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 8 (according to the Kabat definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 9 (according to the Kabat definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 10 (according to the Kabat definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 11 (according to the Kabat definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the Kabat definition system).
[0075] In some embodiments, an anti-TfR1 antibody of the disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 12 (according to the Chothia definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 13 (according to the Chothia definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 14 (according to the Chothia definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 15 (according to the Chothia definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the Chothia definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 16 (according to the Chothia definition system).
[0076] In some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a heavy chain variable region (VH) that contains 25 or fewer amino acid mutations (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid mutation) in the framework regions compared to a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively, or in addition (e.g., in addition), the anti-TfR1 antibodies of the present disclosure comprise a light chain variable region (VL) that contains 25 or fewer amino acid mutations (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid mutation) in the framework regions compared to a VL comprising the amino acid sequence of SEQ ID NO: 18.
[0077] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VH comprising an amino acid sequence that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical within its framework regions to a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively, or additionally (e.g., in addition), in some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VL comprising an amino acid sequence that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical within its framework regions to a VL comprising the amino acid sequence of SEQ ID NO: 18.
[0078] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively, or additionally (e.g., in addition), in some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.
[0079] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a heavy chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, an anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identical to the amino acid sequence of SEQ ID NO: 19. Alternatively, or additionally (e.g., in addition), an anti-TfR1 antibody of the present disclosure comprises a light chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identical to the amino acid sequence of SEQ ID NO: 20. Alternatively, or additionally (e.g., in addition), an anti-TfR1 antibody of the present disclosure is a Fab comprising a light chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identical to the amino acid sequence of SEQ ID NO:20.
[0080] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19. In some embodiments, an anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19. Alternatively, or additionally (e.g., in addition), an anti-TfR1 antibody of the present disclosure comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20. Alternatively, or additionally (e.g., in addition), an anti-TfR1 antibody of the present disclosure is a Fab comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
[0081] In some embodiments, the anti-TfR1 antibodies provided herein may have one or more post-translational modifications. In some embodiments, N-terminal cyclization, also known as pyroglutamate formation (pyroGlu), may occur in antibodies at N-terminal glutamate (Glu) and / or glutamine (Gln) residues during production. Therefore, it should be understood that an antibody identified as having a sequence containing an N-terminal glutamate or glutamine residue encompasses antibodies that have undergone pyroglutamate formation due to post-translational modification. In some embodiments, pyroglutamate formation occurs within the heavy chain sequence. In some embodiments, pyroglutamate formation occurs within the light chain sequence.
[0082] Oligonucleotides In some embodiments, the oligonucleotide of the conjugate used in the methods described herein is a single-stranded oligonucleotide. In some embodiments, the oligonucleotide is useful for targeting DMD (e.g., for exon skipping). In some embodiments, the oligonucleotide useful for targeting DMD (e.g., for exon skipping) targets a DMD allele (e.g., a mutant DMD allele). In some embodiments, the oligonucleotide useful for targeting DMD (e.g., for exon skipping) targets a region of DMD RNA (e.g., the Dp427m transcript of SEQ ID NO: 24). In some embodiments, the oligonucleotide useful for targeting DMD (e.g., for exon skipping) comprises a region of complementarity to DMD RNA (e.g., the Dp427m transcript of SEQ ID NO: 23). In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) contain a region of complementarity to an exon (e.g., exon 8, 23, 43, 44, 45, 46, 50, 51, 52, 53, or 55) or intron of DMD RNA. In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) target a splice donor site, a splice acceptor site, a branch point, or an exon splicing enhancer (ESE) of the DMD RNA (e.g., the Homo sapiens dystrophin (DMD) gene (e.g., the DMD pre-mRNA encoded by NCBI accession number NG_012232.1). In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) target an exon splicing enhancer (ESE) sequence within DMD (e.g., the ESE sequence of exon 23, 44, 45, 46, 50, 51, 52, 53, or 55).
[0083] Examples of DMD RNA sequences and exon sequences that can be targeted by the oligonucleotides of the complex are provided below.
[0084] Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA (NCBI Reference Sequence: NM_004006.2) (SEQ ID NO: 23).
[0085] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 51 (nucleotide positions 7554-7786 of NCBI reference sequence: NM_004006.2) CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCTCCAAACTAGAAATGCCATCTTCCTTGATGTTGGAGGTACCTGCTCTGGCAGATTTCAACCGGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGAGGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG (SEQ ID NO: 24)
[0086] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 8 (nucleotide positions 894-1075 of NCBI reference sequence: NM_004006.2) ATGTTGATACCACCTATCCAGATAAGAAGTCCATCTTAATGTACATCACATCACTCTTCCAAGTTTTGCCTCAACAAGTGAGCATTGAAGCCATCCAGGAAGTGGAAATGTTGCCAAGGCCACCTAAAGTGACTAAAGAAGAACATTTTCAGTTACATCATCAAATGCACTATTCTCAACAG (SEQ ID NO: 25)
[0087] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 23 (nucleotide positions 3194-3406 of NCBI reference sequence: NM_004006.2) GCTTTACAAAGTTCTCTGCAAGAGCAACAAAGTGGCCTATACTATCTCAGCACCACTGTGAAAGAGATGTCGAAGAAAGCGCCCTCTGAAATTAGCCGGAAATATCAATCAGAATTTGAAGAAATTGAGGGACGCTGGAAGAAGCTCTCCTCCCAGCTGGTTGAGCATTGTCAAAGCTAGAGGAGCAAATGAATAAACTCCGAAAAATTCAG (SEQ ID NO: 26)
[0088] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 43 (nucleotide positions 6362-6534 of NCBI reference sequence: NM_004006.2) AATATAAAGATAGTCTACAACAAAGCTCAGGTCGGATTGACATTATTCATAGCAAGAAGACAGCAGCATTGCAAAGTGCAACGCCTGTGGAAAGGGTGAAGCTACAGGAAGCTCTCCCAGCTTGATTTCCAATGGGAAAAAAGTTAACAAAATGTACAAGGACCGACAAGG (SEQ ID NO: 27)
[0089] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 44 (nucleotide positions 6535-6682 of NCBI reference sequence: NM_004006.2) GCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATGATATAAAGATATTTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCCTGAGAATTGGGAACATGCTAAATACAAATGGTATCTTAAG (SEQ ID NO: 28)
[0090] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 45 (nucleotide positions 6683-6858 of NCBI reference sequence: NM_004006.2) GAACTCCAGGATGGCATTGGGCAGCGCAAACTGTTGTCAGAACATTGAATGCAACTGGGGAAGAAATAATTCAGCAATCCTCAAAAACAGATGCCAGTATTCTACAGGAAAAATTGGGAAGCCTGAATCTGCGGTGGCAGGAGGTCTGCAAACAGCTGTCAGACAGAAAAAAGAG (SEQ ID NO: 37)
[0091] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 46 (nucleotide positions 6859-7006 of NCBI reference sequence: NM_004006.2) GCTAGAAGAACAAAAGAATATCTTGTCAGAATTTCAAAGAGATTTAAATGAATTTGTTTTATGGTTGGAGGAAGCAGATAACATTGCTAGTATCCCACTTGAACCTGGAAAAGAGCAGCAACTAAAAGAAAAGCTTGAGCAAGTCAAG (SEQ ID NO: 29)
[0092] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 50 (nucleotide positions 7445-7553 of NCBI reference sequence: NM_004006.2) AGGAAGTTAGAAGATCTGAGCTCTGAGTGGAAGGCGGTAAACCGTTTACTTCAAGAGCTGAGGGCAAAGCAGCCTGACCTAGCTCCTGGACTGACCACTATTGGAGCCT (SEQ ID NO: 30)
[0093] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 51 (nucleotide positions 7554-7786 of NCBI reference sequence: NM_004006.2) CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCTCCAAACTAGAAATGCCATCTTCCTTGATGTTGGAGGTACCTGCTCTGGCAGATTTCAACCGGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGAGGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG (SEQ ID NO: 31)
[0094] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 52 (nucleotide positions 7787-7904 of NCBI reference sequence: NM_004006.2) GCAACAATGCAGGATTTGGAACAGAGGCGTCCCCAGTTGGAAGAACTCATTACCGCTGCCCAAAATTTGAAAAACAAGACCAGCAATCAAGAGGCTAGAACAATCATTACGGATCGAA (SEQ ID NO: 32)
[0095] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 53 (nucleotide positions 7905-8116 of NCBI reference sequence: NM_004006.2) TTGAAAGAATTCAGAATCAGTGGGATGAAGTACAAGAACACCTTCAGAACCGGAGGCAACAGTTGAATGAAATGTTAAAGGATTCAACACAATGGCTGGAAGCTAAGGAAGAAGCTGAGCAGGTCTTAGGACAGGCCAGAGCCAAGCTTGAGTCATGGAAGGAGGGTCCCTATACAGTAGATGCAATCCAAAAGAAAATCACAGAAACCAAG (SEQ ID NO: 33)
[0096] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 55 (nucleotide positions 8272-8461 of NCBI reference sequence: NM_004006.2) GGTGAGTGAGCGAGAGGCTGCTTTGGAAGAAACTCATAGATTACTGCAACAGTTCCCCTGGACCTGGAAAAGTTTCTTGCCTGGCTTACAGAAGCTGAAACAACTGCCAATGTCCTACAGGATGCTACCCGTAAGGAAAGGCTCCTAGAAGACTCCAAGGGAGTAAAAGAGCTGATGAAACAATGGCAA (SEQ ID NO: 34)
[0097] In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) are 15-40 (e.g., 15-40, 15-35, 15-30, 15-25, 15-20, 20-40, 20-35, 20-30, 20-25, 25-40, 25-35, 25-30, 25-28, 28-30, 30-40, 30-32, 32-35, 30-35, or 35-40) nucleotides in length. In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, optionally 20-35, or 30 nucleotides in length.
[0098] In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides to a DMD RNA. In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides to an exon of a DMD RNA.
[0099] In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides to the DMD sequence set forth in any one of SEQ ID NOs: 23-34.
[0100] In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides to the target sequence set forth in SEQ ID NO: 22 (CTAGAAATGCCATCTTCCTTGATGTTGGAG). In some embodiments, oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides of the sequence set forth in SEQ ID NO: 21 (CTCCAACATCAAGGAAGATGGCATTTCTAG).
[0101] In some embodiments, an oligonucleotide useful for targeting DMD (e.g., for exon skipping) comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, any one of the oligonucleotides provided herein is a PMO.
[0102] It should be understood that in some embodiments, methylation of the nucleobase uracil at the C5 position forms thymine. Thus, in some embodiments, a nucleotide or nucleoside having a C5 methylated uracil (or 5-methyl-uracil) can be equivalently identified as a thymine nucleotide or nucleoside.
[0103] In some embodiments, any one or more of the thymine bases (T) in any one of the oligonucleotides provided herein (e.g., the oligonucleotide set forth in SEQ ID NO: 21) can independently and optionally be uracil bases (U), and / or any one or more of the U's in the oligonucleotides provided herein can independently and optionally be T.
[0104] composition In some embodiments, a composition comprising a complex (i.e., multiple complexes) is formulated in a manner suitable for the methods described herein. In some embodiments, a composition comprising a muscle-targeting complex is delivered to a subject using a formulation that minimizes degradation, facilitates delivery and / or (e.g., and) uptake, or provides another beneficial property to the complex in the formulation. Thus, in some embodiments, a composition comprising a complex (e.g., multiple complexes comprising a PMO covalently linked to a Fab) is formulated with histidine and / or sucrose. In some embodiments, a composition comprising a muscle-targeting complex (e.g., a complex comprising a PMO covalently linked to a Fab) is formulated with histidine and / or sucrose in an aqueous solution. In some embodiments, a composition comprising multiple complexes, histidine, and sucrose can be lyophilized (e.g., for storage). In some embodiments, the lyophilized composition can be reconstituted (e.g., with water) for administration to a subject. The composition (e.g., in an aqueous solution or a lyophilized composition) can be suitably prepared so that a sufficient amount of the complex enters the target muscle cells upon administration, either into the environment surrounding the target cells or systemically in a subject.
[0105] In some embodiments, in the methods described herein, a composition for administration to a subject (e.g., in an aqueous solution) comprises a conjugate (i.e., a plurality of conjugates), each of which comprises a phosphorodiamidate morpholino oligomer (PMO) covalently linked to an antibody. In some embodiments, in the methods described herein, a composition for administration to a subject (e.g., in an aqueous solution) comprises conjugates, each of which comprises a phosphorodiamidate morpholino oligomer (PMO) covalently linked to an anti-TfR1 antibody, optionally wherein the antibody in such conjugate comprises CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 as set forth in Table 2, and further, in some embodiments, wherein the composition further comprises histidine (e.g., L-histidine) and sucrose. In some embodiments, the antibody is an anti-TfR1 Fab.
[0106] In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound having a structure of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently includes compounds that include oligonucleotides (e.g., PMOs), and R 2 wherein R 2 contains an antibody (e.g., an anti-TfR1 antibody), and in each complex, n1 is independently the R 1 is an integer greater than or equal to 1 that represents the number of instances of
[0107] In some embodiments, the value of n1 for each conjugate in the composition independently and optionally ranges from 1 to 10 ... 2), where n1 is an integer up to the number of amino acid residues (e.g., the number of lysine residues) for which conjugation is desired or targeted. In some embodiments, the value of n1 for each conjugate in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, the value of n1 for each conjugate in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, the value of n1 for each conjugate in the composition is independently and arbitrarily selected from integers in the ranges of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3. In some embodiments, the average value of n1 for the conjugates in the composition is in the ranges of 1 to 3, 1 to 5, 1 to 10, 1 to 26, or 1 to 27.
[0108] In some embodiments, in the methods described herein, the composition for administration to a subject comprises (e.g., a trace amount of) an unconjugated antibody and an antibody conjugated to one or more oligonucleotides. In some embodiments, the unconjugated antibody has the formula (I): [R 1 ] n1 -R 2 where n1 is 0. Thus, in some embodiments, in the methods described herein, the composition for administration to a subject may be referred to as a compound of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently comprises a group comprising an oligonucleotide, and R 2 comprises an antibody, and n1 independently represents the R 1 In some embodiments, the number of instances of formula (I): [R 1 ] n1 -R2 The proportion of compounds having the structure is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%.
[0109] In some embodiments, R in the conjugates herein (e.g., conjugates of the compositions provided herein) 1 Each instance of R is conjugated to a different amino acid residue of the antibody. In some embodiments, each different amino acid comprises an ε-amino group (e.g., lysine, arginine). However, in some embodiments, R 1 In some embodiments, each different amino acid to which R is covalently linked is a cysteine. 1 is directly covalently linked to an amino acid residue of the antibody, except that in some embodiments, R 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid. In some embodiments, R is covalently linked to an amino acid residue present in a CDR region of the antibody. 1 In some embodiments, the antibody is provided with a formulation in which only trace amounts, undetectable amounts, or no R covalently linked complexes are present. 1 In some embodiments, the complex to which is covalently linked is not detectable in the formulation using standard detection techniques.
[0110] In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently comprises a group of formula (Ia): [ka] In the formula, R 3is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO); where, in each conjugate, n1 is independently the R 1 is an integer (e.g., 1 or greater) representing the number of instances of each R 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 In some embodiments, R comprises an antibody that is a Fab fragment. 3 is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO) comprising the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 2 comprises an antibody (e.g., Fab), and each R 1 is covalently linked (e.g., indirectly or directly, e.g., directly) to a different amino acid residue of an antibody (e.g., a Fab) at attachment point A, optionally where each different amino acid residue is a lysine. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, in the methods described herein, a composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0.
[0111] In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein R in the complex of the compositions provided herein comprises a complex comprising the structure 1 Each example includes a group of formula (Ib): [ka] where -pN indicates the base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21), and where, for each complex, n1 independently represents the R 1 is an integer (e.g., 1 or greater) representing the number of instances of each R 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 comprises an antibody (e.g., Fab), and each R 1 is covalently linked (e.g., indirectly or directly, e.g., directly) to different amino acid residues of an antibody (e.g., a Fab) at attachment point A, optionally where each different amino acid residue is a lysine. In some embodiments, in the methods described herein, a composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein n1 is 0.
[0112] In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein each instance R within the complex of the compositions provided herein comprises a complex comprising the structure 1 comprises a group of formula (Ic): [ka] wherein, for each complex, n1 is independently selected from R 1is an integer (e.g., 1 or greater) representing the number of instances of 1 is R at attachment point A. 2 In some embodiments, R 2 includes antibodies comprising the sequences set forth in Table 2. By way of example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2In some embodiments, R comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 comprises an antibody (e.g., Fab), and each R 1 is covalently linked (e.g., indirectly or directly, e.g., directly) to different amino acid residues of an antibody (e.g., a Fab) at attachment point A, optionally where each different amino acid residue is a lysine. In some embodiments, in the methods described herein, a composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein n1 is 0.
[0113] In some embodiments, in the methods described herein, a composition (e.g., in an aqueous solution) for administration to a subject comprises a conjugate comprising the structure of Formula (Id): [ka] where -pN indicates the base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); where R 2comprises an antibody (e.g., Fab) comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; in each complex, n1 is independently an integer (e.g., 1 or greater) representing the number of instances of the group enclosed by the square brackets, where each instance of the group enclosed by the square brackets is covalently linked to a different amino acid residue of the antibody (e.g., Fab), and optionally wherein each different amino acid residue is lysine. In some embodiments, R 2 includes antibodies (e.g., Fabs) comprising the sequences set forth in Table 2. For example, in some embodiments, R 2 comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or an antibody (e.g., Fab) comprising a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, R 2 In some embodiments, R comprises an antibody (e.g., a Fab) comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody (e.g., a Fab) comprising a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2In some embodiments, R comprises an antibody (e.g., a Fab) comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 comprises an antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, in each conjugate, n1 is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, in each conjugate, n1 is independently an integer greater than or equal to 1. In some embodiments, R 2 comprises antibodies (e.g., Fabs) that are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues of the antibodies (e.g., Fabs), optionally where each different amino acid residue is lysine. In some embodiments, in the methods described herein, the composition (e.g., in aqueous solution) for administration to a subject further comprises a conjugate wherein n1 is 0.
[0114] In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a structure of Formula (A): [ka] wherein n is 0 to 15 (e.g., 3) and m is 0 to 15 (e.g., 4). In some embodiments, the antibody is an anti-TfR1 antibody (e.g., an anti-TfR1 antibody provided in Table 2). In some embodiments, the oligonucleotide is a PMO and comprises the base sequence of SEQ ID NO: 21. In some embodiments, the amide shown adjacent to the antibody in the structure results from reaction with an amine of the antibody, e.g., a lysine epsilon amine. In some embodiments, the antibody comprises a sequence set forth in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19, and / or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.
[0115] In some embodiments, in the methods described herein, a composition (e.g., in an aqueous solution) for administration to a subject comprises a conjugate, wherein the concentration of the conjugate in the formulation therein is 1-50 mg / mL of the conjugate, optionally 10-50 mg / mL, or 20-35 mg / mL (e.g., 1-10 mg / mL, 10-15 mg / mL, 15-20 mg / mL, 20-22 mg / mL, 22-24 mg / mL, 24-26 mg / mL, 24-25 mg / mL, 25-26 mg / mL, 22-24 ... 5 mg / mL, 25-27 mg / mL, 27-29 mg / mL, 29-30 mg / mL, 25-30 mg / mL, 29-31 mg / mL, 30-31 mg / mL, 31-32 mg / mL, 30-32 mg / mL, 32-33 mg / mL, 32-35 mg / mL, 30-35 mg / mL, 35-40 mg / mL, 40-45 mg / mL, 45-50 mg / mL), optionally about 25 mg / mL (e.g., 25 mg / mL), or about 30 mg / mL (e.g., 30 mg / mL).
[0116] In some embodiments, any one or more complexes for use in the methods described herein are formulated with histidine (e.g., L-histidine) and sucrose in an aqueous solution or in lyophilized form (e.g., lyophilized powder).
[0117] In some embodiments, any one or more complexes for use in the methods described herein are formulated with histidine (e.g., L-histidine) and sucrose in an aqueous solution. In some embodiments, the histidine (e.g., L-histidine) is at a concentration of 10-50 mM, 10-20 mM, 20 mM-30 mM, or 20 mM-40 mM, such as 20-22 mM, 22-24 mM, 24-25 mM, 25-26 mM, 24-26 mM, 26-27 mM, 24-27 mM, 27-28 mM, 28-29 mM, 30 mM, 31 mM, 32 mM, 33 mM, 34 mM, 35 mM, 36 mM, 37 mM, 38 mM, 39 mM, 40 mM, 41 mM, 42 mM, 43 mM, 44 mM, 45 mM, 46 mM, 47 mM, 48 mM, 49 mM, 50 mM, 51 mM, 52 mM, 53 mM, 54 mM, 55 mM, 56 mM, 57 mM, 58 mM, 59 mM, 60 mM, 61 mM, 62 mM, 63 mM, 64 mM, 65 mM, 66 mM, 67 mM, 68 mM, 69 mM, 70 mM, 71 mM, 72 mM, 73 mM, 74 mM, 75 mM, 76 mM, 77 mM, 78 mM, 79 mM, 80 mM, 81 mM, 82 mM, 83 mM, 84 mM, 85 mM, 86 mM, 87 mM, 88 mM, 89 mM, 90 mM, 91 mM, 92 mM, 93 mM, 94 mM, 95 mM, It is present in aqueous solution at a concentration within the range of 29 mM, 29-30 mM, 27-30 mM, about 22-27 mM, about 23-26 mM, about 24-26 mM, about 26-28 mM, about 28-30 mM, about 30-32 mM, about 32-35 mM, about 35-40 mM, 40-45 mM, 45-50 mM, about 25 mM, or optionally 25 mM. In some embodiments, sucrose is present in the aqueous solution at a concentration of 5% to 15% weight per volume (w / v%), e.g., 8-15% w / v%, 9-15% w / v%, 9-11% w / v%, 9.5-11% w / v%, or, for example, 5-6 w / v%, 6-7 w / v%, 7-8 w / v%, 8-9 w / v%, 9-10 w / v%, 10-11 w / v%, 11-12% w / v%, 10-12 w / v%, 12-13% w / v%, 13-14% w / v%, 12-14 w / v%, 14-15 w / v%, or 8-12 w / v%. In some embodiments, sucrose is present in the aqueous solution at a concentration of 8-12 w / v% (e.g., 10 w / v%). In some embodiments, the aqueous solution has a pH in the range of 5.0 to 7.0, for example, 5.0 to 5.2, 5.2 to 5.4, 5.4 to 5.6, 5.6 to 5.8, 5.8 to 6.0, 5.9 to 6.0, 5.9 to 6.1, 6.0 to 6.1; for example, 5.5 to 6.5, or for example, 5.5 to 5.8, 5.8 to 6.0, 5.9 to 6.1, 6.0 to 6.1, 6.0 to 6.2, 6.2 to 6.4, 6.4 to 6.5, 6.5 to 6.7, 6.7 to 6.8, 6.8 to 6.9, 6.9 to 7.0, 7.0 to 7.1, or 5.8 to 6.2. In some embodiments, the aqueous solution has a pH in the range of 5.8 to 6.2 (eg, 5.8 to 6.0, 5.8 to 6.1, 5.9 to 6.1).In some embodiments, the aqueous solution has a pH in the range of 5.9 to 6.2, hi some embodiments, the aqueous solution has a pH in the range of 6.0 to 6.1 (e.g., about 6.0, or 6.0).
[0118] In some embodiments, any one of the compositions (e.g., aqueous solutions) for use in the methods described herein comprises one or more complexes, histidine and sucrose, wherein the histidine (e.g., L-histidine) is present in the composition (e.g., aqueous solution) at a concentration of 25 mM, wherein the sucrose is present in the composition (e.g., aqueous solution) at a concentration of 10 w / v%, and wherein the composition (e.g., aqueous solution) is at a pH of about 6.0 (e.g., 6.0, 5.9 to 6.1).
[0119] In some embodiments, any one of the compositions (e.g., aqueous solutions) for use in the methods described herein comprises one or more complexes, histidine, and sucrose, wherein the histidine (e.g., L-histidine) is present in the aqueous solution at a concentration of 25 mM, wherein the sucrose is present in the aqueous solution at a concentration of 10 w / v%, wherein the pH is about 6.0 (e.g., 6.0, 5.9-6.1), the concentration of the complex in the formulation is 10-50 mg / ml, or 20-35 mg / mL (e.g., 1-10 mg / mL, 1 0~15mg / mL, 15~20mg / mL, 20~22mg / mL, 22~24mg / ml, 24~26mg / ml, 22~25mg / mL, 25~27mg / mL, 27~29mg / mL, 29~31mg / ml, 29~30mg / mL, 30~31mg / ml, 31~32mg / ml, 25~30mg / mL, 30~32mg / mL, 32~35mg / mL, 30~35mg / mL, 35~40mg / mL, 40~45mg / mL, 45~50mg / mL), optionally 25mg / mL or 30mg / mL.
[0120] As described herein, in some embodiments, the compositions for use in the methods described herein are formulated in an aqueous solution containing sucrose. In some embodiments, sucrose acts at least partially as a cryoprotectant. In some embodiments, the sucrose is derived from plants, such as grasses, fruits, or vegetables (e.g., root vegetables) (e.g., beets (e.g., sugar beets, e.g., Saccharum spp.)), sugarcane (e.g., Beta vulgaris), dates, sugar maples, sweet sorghum, apples, oranges, carrots, molasses, maple syrup, corn sweeteners), or animal products (e.g., honey). In some embodiments, the sucrose is derived from beets or sugarcane (e.g., beet sucrose, sugarcane bisucrose). In some embodiments, cryoprotectants other than sucrose, such as trehalose, mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone, can be used. However, in some embodiments, a collapse temperature modifier (eg, dextran, ficoll, or gelatin) may be provided in the composition.
[0121] In some embodiments, provided are products (e.g., lyophilized compositions described herein) produced by a process comprising lyophilizing an aqueous solution of a composition described herein (e.g., in aqueous form).
[0122] In some embodiments, a composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral administration, e.g., intravenous administration, intradermal administration, and subcutaneous administration. Typically, the route of administration is intravenous or subcutaneous.
[0123] Method of Use / Treatment / Administration Conjugates comprising an anti-TfR1 antibody (e.g., a Fab) covalently linked to a molecular payload (e.g., an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO)) described herein are effective in treating subjects with a dystrophinopathy, e.g., Duchenne muscular dystrophy. In some embodiments, the conjugate comprises a molecular payload that is an oligonucleotide, e.g., an oligonucleotide that facilitates exon skipping of mRNA expressed from a mutant DMD allele.
[0124] In some embodiments, the subject can be a human subject, a non-human primate subject (e.g., a cynomolgus monkey), a rodent subject, or any suitable mammalian subject. In some embodiments, the subject is a human. In some embodiments, the subject is a human subject between 2 and 60 years of age (e.g., between 2 and 60, 2 and 50, 2 and 40, 2 and 30, 2 and 20, 2 and 10). In some embodiments, the subject is a human subject between 5 and 30 years of age (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). In some embodiments, the subject is a human subject between 5 and 12 years of age (e.g., 5, 6, 7, 8, 9, 10, 11, or 12). In some embodiments, the subject is diagnosed with 4 to 16 (e.g., 4 to 16, 5 to 16, 6 to 16, 7 to 16, 8 to 16, 9 to 16, 10 to 16, 11 to 16, 12 to 16, 13 to 16, 14 to 16, 15 to 16, 4 to 15, 5 to 15, 6 to 15, 7 to 15, 8 to 15, 9 to 15, 10 to 15, 11 to 15, 12 to 15, 13 to 15, 14 to 15, 4 to 14, 5 to 14, 6 to 14, 7 to 14, 8 to 14, 9 to 14, 10 to 14, 11 to 14, 12 to 14, 13 to 14, 4 to 13, 5 to 13, 6 to 13, 7 to 13 ... Human subjects are aged 13, 9-13, 10-13, 11-13, 12-13, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 4-11, 5-11, 6-11, 7-11, 8-11, 9-16, 10-11, 4-10, 5-10, 6-10, 7-10, 8-10, 9-10, 4-9, 5-9, 6-9, 7-9, 8-9, 4-9, 5-9, 6-9, 7-9, 8-9, 4-8, 5-8, 6-8, 7-8, 4-7, 5-7, 6-7, 4-6, 5-6, or 4-5). In some embodiments, the subject is a human subject who is about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 years old.
[0125] In some embodiments, the subject may have Duchenne muscular dystrophy or other dystrophinopathy. In some embodiments, the subject has a mutant DMD allele, which may optionally include at least one mutation in a DMD exon that causes a frameshift mutation and leads to improper RNA splicing / processing. In some embodiments, the subject suffers from severe dystrophinopathy symptoms, such as muscle atrophy or muscle loss. In some embodiments, the subject has asymptomatic increases in serum concentrations of creatine phosphokinase (CK) and / or muscle spasms (e.g., and) accompanied by myoglobinuria. In some embodiments, the subject has a progressive muscular disease, such as Duchenne or Becker muscular dystrophy or DMD-related dilated cardiomyopathy (DCM). In some embodiments, the subject does not suffer from dystrophinopathy symptoms. In some embodiments, the subject is ambulatory. In some embodiments, the subject is non-ambulatory. In some embodiments, the subject can walk. In some embodiments, the subject cannot walk. In some embodiments, the subject is non-ambulatory and has not been able to walk for less than two years prior to being treated by the methods described herein.
[0126] In some embodiments, the subject has a mutation in the DMD gene that is amenable to exon 51 skipping. In some embodiments, the complexes described herein are effective in treating subjects with a mutation in the DMD gene that is amenable to exon 51 skipping. In some embodiments, the complexes include an oligonucleotide, e.g., a pre-mRNA, e.g., an oligonucleotide that facilitates skipping of exon 51 of a pre-mRNA encoded from a mutant DMD gene (e.g., a mutant DMD gene amenable to exon 51 skipping).
[0127] In some embodiments, the subject has a Brooke Upper Extremity Scale score of 1 or 2. The Brooke Upper Extremity Scale uses a scale of 1 to 6, with 1 indicating an individual's full ability to lift both arms in a complete circle until they touch, and 6 indicating an individual is unable to raise their hands to their mouth and has no useful function of the hands (see, e.g., Brooke et al. (1981). Muscle Nerve 4(3):186-197, incorporated herein by reference).
[0128] In some embodiments, the subject is not receiving or has not received treatment with a glucocorticoid (e.g., prednisone, prednisolone, deflazacort). In some embodiments, the subject is also receiving or has received treatment with a glucocorticoid. In some embodiments, the subject is receiving or has received a stable dose of a glucocorticoid (e.g., prednisone, prednisolone, deflazacort). In some embodiments, the subject has received a stable dose of a glucocorticoid (e.g., prednisone, prednisolone, deflazacort) for at least 12 weeks (e.g., at least 12 weeks, at least 16 weeks, at least 20 weeks, at least 24 weeks, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months or more) prior to being treated by the methods described herein.
[0129] One aspect of the present disclosure includes methods involving administering to a subject a composition (e.g., an aqueous solution) comprising an effective amount of a conjugate described herein. In some embodiments, an effective amount of a composition (e.g., an aqueous solution) comprising a conjugate comprising an antibody described herein (e.g., a Fab) covalently linked to an oligonucleotide (e.g., a PMO) described herein can be administered to a subject in need of treatment. In some embodiments, the composition (e.g., an aqueous solution) is administered systemically. In some embodiments, a pharmaceutical composition comprising a conjugate described herein can be administered by a suitable route, which may include, for example, intravenous administration as a bolus or by continuous infusion over a period of time. In some embodiments, administration can be by intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intrasynovial, or intrathecal routes. In some embodiments, a composition (e.g., an aqueous solution) comprising a conjugate described herein is administered by infusion (e.g., intravenous infusion).
[0130] In some embodiments, compositions comprising the conjugates described herein may be in solid, aqueous, or liquid form. In some embodiments, the aqueous or liquid form may be sprayed or lyophilized. In some embodiments, the sprayed or lyophilized form may be reconstituted with an aqueous or liquid solution.
[0131] In some embodiments, a method for treating a subject with a mutant DMD allele associated with Duchenne muscular dystrophy (DMD) and / or a use for treating a subject with a mutant DMD allele associated with Duchenne muscular dystrophy (DMD) is provided, comprising administering to the subject an effective amount of a composition comprising a complex or a plurality of complexes described herein. In some embodiments, a method for promoting dystrophin protein expression or activity in a subject and / or a use for promoting dystrophin protein expression or activity in a subject is provided, comprising contacting a cell with an effective amount of a composition comprising a plurality of complexes described herein. In some embodiments, the dystrophin protein is a truncated dystrophin protein. The truncated dystrophin protein is functional (e.g., retains the activity of wild-type dystrophin protein). In some embodiments, the truncated dystrophin protein retains partial function of wild-type dystrophin protein. In some embodiments, the method comprises administering a lyophilized form (e.g., lyophilized powder) of a composition comprising a plurality of complexes described herein, reconstituting the lyophilized form of the composition in an aqueous solution, and administering the aqueous solution to a subject in need thereof. For example, in some embodiments, a lyophilized form of a composition comprising a conjugate or multiple conjugates is shipped and / or stored in lyophilized form, reconstituted in an aqueous solution at the location for administration (e.g., at a healthcare provider's location), and administered in reconstituted form (e.g., as an aqueous solution) by injection or intravenously, e.g., by infusion. In some embodiments, the subject has a mutant DMD allele comprising a mutation suitable for exon 51 skipping. In some embodiments, the mutant DMD allele comprises a frameshift mutation in exon 51.
[0132] In some embodiments, the composition is administered via site-specific or local delivery techniques, examples of which include an implantable depot source of the complex, a local delivery catheter, a site-specific carrier, direct injection, or direct application.
[0133] In some embodiments, in any one of the methods described herein, the effective amount is between 1 mg and 110 mg (e.g., 1 mg and 110 mg, 1 mg and 100 mg, 1 mg and 90 mg, 1 mg and 80 mg, 1 mg and 70 mg, 1 mg and 60 mg, 1 mg and 50 mg, 1 mg and 40 mg, 1 mg and 30 mg, 1 mg and 20 mg, 1 mg and 10 mg, 5 mg and 110 mg) of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject. g, 5mg~100mg, 5mg~90mg, 5mg~80mg, 5mg~70mg, 5mg~60mg, 5mg~50mg, 5mg~40mg, 5mg~30mg, 5mg~20mg, 5mg~10mg, 1 0mg~100mg, 10mg~90mg, 10mg~80mg, 10mg~70mg, 10mg~60mg, 10mg~50mg, 10mg~40mg, 10mg~30mg, 10mg~20mg, 20mg ~100mg, 20mg~90mg, 20mg~80mg, 20mg~70mg, 20mg~60mg, 20mg~50mg, 20mg~40mg, 20mg~30mg, 30mg~100mg, 30mg~9 0mg, 30mg~80mg, 30mg~70mg, 30mg~60mg, 30mg~50mg, 30mg~40mg, 40mg~100mg, 40mg~90mg, 40mg~80mg, 40mg~70mg , 40mg to 60mg, 40mg to 50mg, 50mg to 100mg, 50mg to 90mg, 50mg to 80mg, 50mg to 70mg, 50mg to 60mg, 60mg to 100mg, 60mg to 90mg, 60mg to 80mg, 60mg to 70mg, 70mg to 100mg, 70mg to 90mg, 70mg to 80mg, 80mg to 100mg, 80mg to 90mg, or 90mg to 100mg) is provided to the subject.
[0134] In some embodiments, in any one of the methods described herein, the effective amount is 1 mg to 25 mg (e.g., 1 mg to 25 mg, 1 mg to 20 mg, 1 mg to 15 mg, 1 mg to 11 mg, 1 mg to 10 mg, 1 mg to 8 mg, 1 mg to 5 mg, 1.5 mg to 25 mg, 1.5 mg to 20 mg, 1.5 mg to 15 mg, 1.5 mg to 10 ... mg to 6 mg, 1.5 mg to 5 mg, 2 mg to 25 mg, 2 mg to 20 mg, 2 mg to 15 mg, 2 mg to 11 mg, 2 mg to 10 mg, 2 mg to 5 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 11 mg, 5 mg to 10 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 25 mg, 15 mg to 20 mg, or 20 mg to 25 mg) is provided to the subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 1 mg, 1.5 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, or 25 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject.
[0135] In some embodiments, in any one of the methods described herein, the effective amount is about 1.09 mg, 1.31 mg, 1.53 mg, 1.75 mg, 1.97 mg, 2.19 mg, 2.40 mg, 2.62 mg, 2.84 mg, 3.06 mg, 3.28 mg, 3.50 mg, 3.72 mg, 3.93 mg, 4.15 mg, 4.37 mg, 4.59 mg, 4.81 mg, 5.03 mg, 5.25 mg, 5.46 mg, 5.68 mg, 5.90 mg of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject. g, 6.12 mg, 6.34 mg, 6.56 mg, 6.77 mg, 6.99 mg, 7.21 mg, 7.43 mg, 7.65 mg, 7.87 mg, 8.09 mg, 8.30 mg, 8.52 mg, 8.74 mg, 8.96 mg, 9.18 mg, 9.40 mg, 9.62 mg, 9.83 mg, 10.05 mg, 10.27 mg, 10.49 mg, 10.71 mg, 10.93 mg, 13.11 mg, 15.30 mg, 17.48 mg, 19.67 mg, 21.85 mg or 24.04 mg is provided to the subject.
[0136] In some embodiments, in one of the methods described herein, the effective amount is about 1.19 mg, 1.24 mg, 1.29 mg, 1.34 mg, 1.40 mg, 1.46 mg, 1.53 mg, 1.61 mg, 1.69 mg, 1.78 mg, 1.89 mg, 2.01 mg, 2.38 mg, 2.47 mg of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject. , 2.57mg, 2.68mg, 2.79mg, 2.92mg, 3.06mg, 3.21mg, 3.38mg, 3.57mg, 3.78mg, 4.02mg, 4.76mg, 4.94mg, 5.14mg, 5.35mg, 5.59mg, 5.84mg, 6.12mg, 6.43mg, 6.76mg, 7.14mg, 7.56mg, and 8.03mg are provided to the subject.
[0137] In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 1.5 mg, 3 mg, or 6 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 1.53 mg, 3.06 mg, or 6.12 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject.
[0138] In some embodiments, in any one of the methods described herein, the effective amount is between 5 mg and 120 mg (e.g., 5 mg to 120 mg, 5 mg to 110 mg, 5 mg to 100 mg, 5 mg to 90 mg, 5 mg to 80 mg, 5 mg to 70 mg, 5 mg to 60 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 5 mg to 10 mg, 10 mg to 100 mg, 10 mg to 90 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 100 mg, 20 mg to 90 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg g, 20mg~50mg, 20mg~40mg, 20mg~30mg, 30mg~100mg, 30mg~90mg, 30mg~80mg, 30mg~70mg, 30mg~60mg , 30mg~50mg, 30mg~40mg, 40mg~100mg, 40mg~90mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 5 and providing a dose of 0 mg to 100 mg, 50 mg to 90 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 90 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 100 mg, 70 mg to 90 mg, 70 mg to 80 mg, 80 mg to 100 mg, 80 mg to 90 mg, or 90 mg to 100 mg) to the subject.In some embodiments, in any one of the methods described herein, the effective amount is about 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60mg, 61mg, 62mg, 63mg, 64mg, 65mg, 66mg, 67mg, 68mg, 69mg, 70mg, 71mg, 72mg, 73mg, 74mg, 75mg, 76mg , 77mg, 78mg, 79mg, 80mg, 81mg, 82mg, 83mg, 84mg, 85mg, 86mg, 87mg, 88mg, 89mg, 90mg, 91mg, 92mg, 93m g, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 101 mg, 102 mg, 103 mg, 104 mg, 105 mg, 106 mg, 107 mg, 108 mg, 109 mg, 110 mg, 111 mg, 112 mg, 113 mg, 114 mg, 115 mg, 116 mg, 117 mg, 118 mg, 119 mg or 120 mg is provided to the subject.
[0139] In some embodiments, in any one of the methods described herein, the effective amount is about 8.50 mg, 8.83 mg, 9.18 mg, 9.56 mg, 9.98 mg, 10.43 mg, 10.93 mg, 11.47 mg, 12.08 mg, 12.75 mg, 13.50 mg, 14.34 mg, 17.00 mg, 17.65 mg, 18.36 mg, 19.12 mg, 19.95 mg, 20.86 mg, 21.85 mg, 22.95 mg, 24.15 mg, 25.50 mg, 27.00 mg, 28.68 mg, 34.00 mg, 35.30 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject. , 36.71mg, 38.24mg, 39.91mg, 41.72mg, 43.71mg, 45.89mg, 48.31mg, 50.99mg, 52.95mg, 53.99mg, 55.07mg, 57.37mg, 57.37mg, 59.86mg, 62.58mg, 65.56mg, 67.99mg, 68.84mg, 70.61mg, 72.46mg, 73.43mg, 76.49mg, 79.82mg, 80.99mg, 83.44mg, 86.05mg, 87.42mg, 91.79mg, 96.62mg, 101.99mg, 107.99mg, 114.73mg are provided to the subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 11 mg, 22 mg, 44 mg, 66 mg, or 88 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 10.93 mg, 21.85 mg, 43.71 mg, 65.56 mg, or 87.42 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 10.93 mg, 21.86 mg, 43.72 mg, 65.56 mg, or 87.43 mg of conjugated anti-TfR1 antibody (e.g., Fab) per kg of subject.
[0140] In some embodiments, in any one of the methods described herein, an effective amount provides to a subject 0.5 mg to 10 mg of conjugated oligonucleotide per kg of subject. By way of example, in some embodiments, in any one of the methods described herein, an effective amount provides to a subject 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 10 mg, 1 mg to 7.5 mg, 1 mg to 5 mg, 1 mg to 4.5mg, 1mg to 4mg, 1mg to 3.5mg, 1mg to 3mg, 1mg to 2.5mg, 1mg to 2mg, 2mg to 10mg, 2mg to 7.5mg, 2mg to 5mg, 2mg to 4.5mg, 2mg to 4mg, 2mg to 3.5mg, 2mg to 3mg, 3mg to 10mg, 3mg to 7.5mg, 3mg to 5mg, 3mg to 4.5mg, 3mg to 4mg, 3.5mg to 5mg, 3.5mg to 4.5mg, 4mg to 10mg, 4mg to 7.5mg, or 4mg to 5mg is provided to the subject.
[0141] In some embodiments, in any one of the methods described herein, an effective amount provides to a subject about 0.5 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, or 10 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in any one of the methods described herein, an effective amount provides to a subject about 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3.0 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4.0 mg, 4.1 mg, 4.2 mg, 4.3 mg, 4.4 mg, 4.5 mg, 4.6 mg, 4.7 mg, 4.8 mg, 4.9 mg, 5.0 mg, 5.1 mg, 5.2 mg, 5.3 mg, 5.4 mg, 5.5 mg, 5.6 mg, 5.7 mg, 5.8 mg, 5.9 mg, 6.1 mg, 6.2 mg, 6.3 mg, 6.4 mg, 6.5 mg, 6.6 mg, 6.7 mg, 6.8 mg, 6.9 mg, 7.1 mg, 7.2 mg, 7.3 mg, 7.4 mg, 7.5 mg In some embodiments, in any one of the methods described herein, an effective amount is provided to a subject in the amount of about 0.7 mg, 1.4 mg, or 2.8 mg of conjugated oligonucleotide per kg of subject.
[0142] In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 0.52 mg, 0.56 mg, 0.59 mg, 0.62 mg, 0.65 mg, 0.69 mg, 0.72 mg, 0.75 mg, 0.78 mg, 0.82 mg, 0.85 mg, 0.88 mg, 1.05 mg, 1.11 mg, 1.18 mg, 1.24 mg, 1.31 mg, 1.37 mg, 1.44 mg, 1.50 mg, 1.57 mg, 1.63 mg, 1.70 mg, 1.76 mg, 2.09 mg, 2.22 mg, 2.35 mg, 2.48 mg, 2.61 mg, 2.75 mg, 2.88 mg, 3.01 mg, 3.14 mg, 3.27 mg, 3.40 mg, 3.53 mg of the conjugate oligonucleotide per kg of subject. In some embodiments, in any one of the methods described herein, the effective amount provides about 0.69 mg, 1.37 mg, or 2.75 mg of conjugated oligonucleotide to the subject per kg of subject.
[0143] In some embodiments, in any one of the methods described herein, an effective amount provides a subject with 3 mg to 100 mg of conjugated oligonucleotide per kg of subject. By way of example, in some embodiments, in any one of the methods described herein, an effective amount provides a subject with 3 mg to 100 mg, 3 mg to 55 mg, 3 mg to 50 mg, 3 mg to 10 mg, 5 mg to 80 mg, 5 mg to 50 mg, 5 mg to 40 mg, 10 mg to 70 mg, 10 mg to 50 mg, 10 mg to 30 mg, 20 mg to 60 mg, 20 mg to 40 mg, or 30 mg to 50 mg of conjugated oligonucleotide per kg of subject. In some embodiments, in any one of the methods described herein, an effective amount provides a subject with 3 mg to 52 mg (e.g., about 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of conjugated oligonucleotide per kg of subject.
[0144] In some embodiments, in any one of the methods described herein, an effective amount provides a subject with about 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg of the conjugate oligonucleotide per kg of subject. In some embodiments, in any one of the methods described herein, the effective amount is about 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, 6.47 mg, 7.67 mg, 8.15 mg, 8.63 mg, 9.11 mg, 9.59 mg, 10.07 mg, 10.55 mg, 11.03 mg, 11.50 mg, 11.98 mg, 12.46 mg, 12.94 mg, 15.34 mg, 16.30 mg, 17.2 mg, 18.25 mg, 19.25 mg, 20.25 mg, 21.25 mg, 22.25 mg, 23.25 mg, 24.25 mg, 25.25 mg, 26.25 mg, 27.25 mg, 28.25 mg, 29.25 mg, 30.25 mg, 31.25 mg, 32.25 mg, 33.25 mg, 34.25 mg, 35.25 mg, 36.25 mg, 37.25 mg, 38.25 mg, 39.25 mg, 40.25 mg, 41.25 mg, 42.25 mg, 43.25 mg, 44.25 mg, 45.25 mg, 46.25 mg, 47.25 mg, 48.25 mg, 49.25 mg, 50.25 mg, 51.25 mg, 52.25 mg, 53.25 mg, 54.25 mg 6mg, 18.22mg, 19.17mg, 20.13mg, 21.09mg, 22.05mg, 23.01mg, 23.97mg, 24.45mg, 24.93mg, 25.89mg, 27.32mg, 28.76mg, 30.20mg, 30.68mg, 31.64mg, 32.60mg, 33.08mg, 34.51mg, 35.95mg, 36.43mg, 37.39mg, 38.35mg, 38.83mg, 40.27mg, 42.18mg, 44.10mg, 46.02mg, 47.94mg, 49.85mg or 51.77mg is provided to the subject. In some embodiments, in any one of the methods described herein, the effective amount provides about 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of conjugated oligonucleotide per kg of subject to the subject.
[0145] In some embodiments, in any one of the methods described herein, an effective amount provides to a subject between 5 mg and 100 mg of conjugated oligonucleotide per kg of subject. By way of example, in some embodiments, in any one of the methods described herein, an effective amount provides to a subject between 5 mg and 100 mg, 5 mg and 90 mg, 5 mg and 80 mg, 5 mg and 70 mg, 5 mg and 60 mg, 5 mg and 50 mg, 5 mg and 40 mg, 5 mg and 30 mg, 5 mg and 20 mg, 5 mg and 10 mg, 8 mg and 32 mg, 8 mg and 31 mg, 8 mg and 30 mg, 8 mg and 29 mg, 8 mg and 28 mg, 9 mg and 32 mg, 9 mg and 9 mg of conjugated oligonucleotide per kg of subject. ~31mg, 9mg~30mg, 9mg~29mg, 9mg~28mg, 10mg~100mg, 10mg~90mg, 10mg~80mg, 10mg~70mg, 10mg~60mg, 10mg~50mg, 10mg~40mg, 10m g~32mg, 10mg~31mg, 10mg~30mg, 10mg~29mg, 10mg~28mg, 10mg~20mg, 11mg~32mg, 11mg~31mg, 11mg~30mg, 11mg~29mg, 11mg~28mg, 12mg~32mg, 12mg~31mg, 12mg~30mg, 12mg~29mg, 12mg~28mg, 20mg~100mg, 20mg~90mg, 20mg~80mg, 20mg~70mg, 20mg~60mg, 20mg~5 0mg, 20mg~40mg, 20mg~30mg, 30mg~100mg, 30mg~90mg, 30mg~80g, 30mg~70mg, 30mg~60mg, 30mg~50mg, 30mg~40mg, 40mg~100mg, 40 mg to 90mg, 40mg to 80mg, 40mg to 70mg, 40mg to 60mg, 40mg to 50mg, 50mg to 100mg, 50mg to 90mg, 50mg to 80mg, 50mg to 70mg, 50mg to 60mg, 60mg to 100mg, 60mg to 90mg, 60mg to 80mg, 60mg to 70mg, 70mg to 100mg, 70mg to 90mg, 70mg to 80mg, 80mg to 100mg, 80mg to 90mg, or 90mg to 100mg is provided to the subject.In some embodiments, in any one of the methods described herein, the effective amount is about 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg of the conjugate oligonucleotide per kg of subject. g, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, 90 mg, 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg or 100 mg is provided to the subject. Because the conjugate also includes an antibody covalently linked to the oligonucleotide, the amount of conjugate administered to a subject to provide the subject with an effective amount of the oligonucleotide described herein is greater than 1 kg of the subject's body weight.
[0146] In some embodiments, the methods provided herein comprise a method for producing a compound of formula (I): [R 1 ] n1 -R 2 wherein the average value of n1 of the conjugates in the composition is 2, and administering about 100 mg of conjugate per kg of subject provides 30 mg of oligonucleotide per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1 -R 2wherein the average value of n1 of the conjugates in the composition is 2, and administering about 30 mg of conjugate per kg of subject provides 10 mg of oligonucleotide per kg of subject.
[0147] In some embodiments, the methods provided herein comprise a method for producing a compound of formula (I): [R 1 ] n1 -R 2 wherein the average n1 of the conjugates in the composition is 2.1, and administering about 16 mg of conjugate per kg of subject provides 5 mg of oligonucleotide per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1 -R 2 wherein the average n1 of the conjugates in the composition is 2.1, and administering about 32 mg of conjugate per kg of subject provides 10 mg of oligonucleotide per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1 -R 2 wherein the average n1 of the conjugates in the composition is 2.1, and administering about 64 mg of conjugate per kg of subject provides 20 mg of oligonucleotide per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1 -R 2 wherein the average n1 of the conjugates in the composition is 2.1, and administering about 96 mg of conjugate per kg of subject provides 30 mg of oligonucleotide per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1-R 2 wherein the average n1 of the conjugates in the composition is 2.1, and administering about 128 mg of conjugate per kg of subject provides 40 mg of oligonucleotide per kg of subject.
[0148] In some aspects, provided herein are methods of promoting dystrophin protein expression or activity in a subject. In some aspects, provided herein are methods of treating Duchenne muscular dystrophy (DMD) in a subject.In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein the effective amount is between 0.5 mg and 100 mg (e.g., 0.5 mg and 100 mg, 0.5 mg and 90 mg, 0.5 mg and 80 mg, 0.5 mg and 70 mg, 0.5 mg and 60 mg, 0.5 mg and 50 mg) of oligonucleotide of the conjugate per kg of subject. and providing to a subject an antibody (e.g., Fab) comprising a polypeptide having a sequence set forth in SEQ ID NO: 1, 7, or 12, the polypeptide comprising: 0 mg, 0.5 mg to 40 mg, 0.5 mg to 30 mg, 0.5 mg to 20 mg, 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 to 5 mg, 5 mg to 100 mg, 5 mg to 80 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, or 30 mg to 60 mg. a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 2, 8 or 13; a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 3, 9 or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10 or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16. wherein the oligonucleotide comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO), and optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
[0149] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 0.7 mg, 1.4 mg, 2.8 mg, 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides to the subject 1 mg to 90 mg (e.g., 1 mg to 90 mg, 5 mg to 80 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, or 30 mg to 60 mg) of anti-TfR1 antibody (e.g., Fab) of conjugate per kg of subject, wherein the antibody (e.g., Fab) comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14. 3, 9, or 14; light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15; light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11; and light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO), optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.In some embodiments, an effective amount of the muscle-targeting conjugate is 1.5 mg, 3 mg, 6 mg, 11 mg, 22 mg, 44 mg, or 88 mg of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject.
[0150] In some aspects, provided herein are methods of promoting dystrophin protein expression or activity in a subject. In some aspects, provided herein are methods of treating Duchenne muscular dystrophy (DMD) in a subject. In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides to the subject 5 mg to 100 mg (e.g., 5 mg to 100 mg, 5 mg to 80 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, or 30 mg to 60 mg) of oligonucleotide of the conjugate per kg of subject, wherein the antibody (e.g., Fab) comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14. or 14, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO), optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
[0151] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides to the subject 1 mg to 90 mg (e.g., 1 mg to 90 mg, 5 mg to 80 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, or 30 mg to 60 mg) of anti-TfR1 antibody (e.g., Fab) of conjugate per kg of subject, wherein the antibody (e.g., Fab) comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14. 3, 9, or 14; light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15; light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11; and light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO), optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, an effective amount of the muscle-targeting conjugate is 1.5 mg, 3 mg, 6 mg, 11 mg, 22 mg, 44 mg, or 88 mg of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of subject.
[0152] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of a muscle-targeting complex, wherein the effective amount is between 0.5 mg and 10 mg (e.g., 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 10 mg, 1 mg to 7.5 mg, 1 mg to 1 mg) of oligonucleotide of the complex per kg of subject. and providing to a subject an amount of 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 10 mg, 2 mg to 7.5 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 10 mg, 3 mg to 7.5 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, 4 mg to 10 mg, 4 mg to 7.5 mg, or 4 mg to 5 mg of 1 ... 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2includes an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R 1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, an effective amount provides a subject with 0.7 mg, 1.4 mg, or 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 0.69 mg, 1.37 mg, or 2.75 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R 1 and R 2is defined herein.
[0153] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of a muscle-targeting complex, wherein the effective amount is between 0.5 mg and 10 mg (e.g., 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 10 mg, 1 mg to 7.5 mg, 1 mg to 1 mg) of oligonucleotide of the complex per kg of subject. and providing to a subject an amount of 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 10 mg, 2 mg to 7.5 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 10 mg, 3 mg to 7.5 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, 4 mg to 10 mg, 4 mg to 7.5 mg, or 4 mg to 5 mg of 1 ... 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R 1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, an effective amount provides a subject with 0.7 mg, 1.4 mg, or 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 0.69 mg, 1.37 mg, or 2.75 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R 1 and R2 is defined herein.
[0154] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of a muscle-targeting conjugate, wherein the effective amount is between 0.5 mg and 10 mg (e.g., 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 10 mg, 1 mg to 7.5 mg, 1 mg to 5 mg) of oligonucleotide of the conjugate per kg of subject. mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 10 mg, 2 mg to 7.5 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 10 mg, 3 mg to 7.5 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, 4 mg to 10 mg, 4 mg to 7.5 mg, or 4 mg to 5 mg) to a subject, wherein each conjugate comprises the structure of Formula (Id): [ka] where -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein, for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5, and optionally, wherein the anti-TfR1 antibodies (e.g., Fabs) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues in the antibodies (e.g., Fabs), and optionally, wherein each different amino acid residue is lysine. In some embodiments, an effective amount provides the subject with 0.7, 1.4, or 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides the subject with 0.69 mg, 1.37 mg, or 2.75 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) further comprises a conjugate wherein n1 is 0.
[0155] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, wherein the effective amount provides the subject with 8 mg to 36 mg of oligonucleotide (e.g., 8 mg to 36 mg, 8 mg to 30 mg, 8 mg to 25 mg, 8 mg to 20 mg, 8 mg to 15 mg, 8 mg to 12 mg, 8 mg to 10 mg, 10 mg to 36 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 36 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 36 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 36 mg, 25 mg to 20 mg, 25 mg to 30 mg, or 24 mg to 36 mg) of conjugate per kg of subject, wherein each conjugate is a compound represented by Formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2includes an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R 1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R 1 and R 2 is defined herein.
[0156] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, wherein the effective amount provides the subject with 8 mg to 36 mg of oligonucleotide (e.g., 8 mg to 36 mg, 8 mg to 30 mg, 8 mg to 25 mg, 8 mg to 20 mg, 8 mg to 15 mg, 8 mg to 12 mg, 8 mg to 10 mg, 10 mg to 36 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 36 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 36 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 36 mg, 25 mg to 20 mg, 25 mg to 30 mg, or 24 mg to 36 mg) of conjugate per kg of subject, wherein each conjugate is a compound represented by Formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2 The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R 1 and R 2 is defined herein.
[0157] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of muscle-targeting conjugates, wherein the effective amount provides the subject with 8 mg to 36 mg of oligonucleotide (e.g., 8 mg to 36 mg, 8 mg to 30 mg, 8 mg to 25 mg, 8 mg to 20 mg, 8 mg to 15 mg, 8 mg to 12 mg, 8 mg to 10 mg, 10 mg to 36 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 36 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 36 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 36 mg, 25 mg to 20 mg, 25 mg to 30 mg, or 24 mg to 36 mg) of conjugate per kg of subject, wherein each conjugate comprises the structure of Formula (Id): [ka] where -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein, for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5, and optionally, wherein the anti-TfR1 antibodies (e.g., Fab) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues in the antibody (e.g., Fab), and optionally, wherein each different amino acid residue is lysine. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in aqueous solution) further comprises a conjugate wherein n1 is 0.
[0158] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a muscle-targeting complex, wherein the effective amount is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 45 mg, between 5 mg and 40 mg, between 5 mg and 35 mg) of oligonucleotide of the complex per kg of subject. g, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 52 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 52 mg, 20 mg to 50 mg, 20 mg to 40 mg, 20 mg to 30 mg, 30 mg to 50 mg, 30 mg to 40 mg, 40 mg to 52 mg, or 40 mg to 50 mg) to a subject, wherein each conjugate is a compound represented by formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2includes an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R 1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, an effective amount provides a subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R 1 and R2 is defined herein.
[0159] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a muscle-targeting complex, wherein the effective amount is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 45 mg, between 5 mg and 40 mg, between 5 mg and 35 mg) of oligonucleotide of the complex per kg of subject. g, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 52 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 52 mg, 20 mg to 50 mg, 20 mg to 40 mg, 20 mg to 30 mg, 30 mg to 50 mg, 30 mg to 40 mg, 40 mg to 52 mg, or 40 mg to 50 mg) to a subject, wherein each conjugate is a compound represented by formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; In the formula, each R 1 is R at attachment point A. 2 and optionally, wherein each R 1 is R at attachment point A. 2 are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) to different amino acid residues of an antibody (e.g., a Fab), optionally wherein each different amino acid residue is a lysine; wherein in each complex, n1 is independently selected from R 1 and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5. In some embodiments, an effective amount provides a subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein each R1 and R 2 is defined herein.
[0160] In some embodiments, the methods provided herein comprise administering to a subject a composition comprising an effective amount of a muscle-targeting complex, wherein the effective amount is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 45 mg, between 5 mg and 40 mg, between 5 mg and 35 mg, to a subject), wherein each conjugate comprises a structure of formula (Id): [ka] where -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO); where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO comprises the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2The present invention relates to a method for producing a human IgG1A-mediated IgG1A-associated ... an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 3 (CDR-L2) and a light chain complementarity determining region 4 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein, for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5, and optionally, wherein the anti-TfR1 antibodies (e.g., Fabs) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues in the antibodies (e.g., Fabs), and optionally, wherein each different amino acid residue is lysine. In some embodiments, an effective amount provides a subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, in the methods described herein, the composition for administration to a subject (e.g., in an aqueous solution) further comprises a conjugate wherein n1 is 0.
[0161] In some embodiments, in any one of the methods described herein, the composition is in an aqueous solution and further comprises histidine and sucrose, wherein the histidine is present in the aqueous solution at a concentration of 25 mM, the sucrose is present in the aqueous solution at a concentration of 10 w / v%, and the composition is at a pH of 6.0. In some embodiments, the complex is present in the composition at a concentration within the range of 10 mg / mL to 50 mg / mL (e.g., 10 mg / mL, 15 mg / mL, 20 mg / mL, 25 mg / mL, 30 mg / mL, 35 mg / mL, 40 mg / mL, 45 mg / mL, 50 mg / mL).
[0162] In some embodiments, the subject is administered an effective amount of a conjugate described herein (e.g., 0.5 mg to 10 mg of oligonucleotide of the conjugate per kg of subject (e.g., 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 10 mg, 1 mg to 7.5 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg
[0039] A single dose of any one of compositions comprising (a) to (i) is administered to a subject, the single dose providing (i) to (i) the subject with (ii) 2 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 10 mg, 2 mg to 7.5 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 10 mg, 3 mg to 7.5 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, 4 mg to 10 mg, 4 mg to 7.5 mg, or 4 mg to 5 mg. In some embodiments, the subject is administered an effective amount of a conjugate described herein (e.g., 0.5 mg to 5 mg of oligonucleotide of the conjugate per kg of subject (e.g., 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg, 2 mg, 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, In some embodiments, a subject is administered a single dose of any one of compositions comprising an effective amount of a conjugate described herein (e.g., providing the subject with 0.7 mg, 1.4 mg, or 2.8 mg of oligonucleotide of the conjugate per kg of subject).In some embodiments, the subject is administered a single dose of any one of the compositions comprising an effective amount of the conjugate described herein (e.g., providing the subject with 0.69 mg, 1.37 mg, or 2.75 mg of oligonucleotide of the conjugate per kg of subject). In some embodiments, the subject is administered a single dose of any one of the compositions comprising an effective amount of the conjugate described herein (e.g., providing the subject with 5 mg to 100 mg (e.g., 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg) of oligonucleotide of the conjugate per kg of subject). In some embodiments, the subject is administered an effective amount of a conjugate described herein (e.g., about 3 mg to 52 mg of oligonucleotide of the conjugate per kg of subject (e.g., 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, 6.47 mg, 7.67 mg, 8.15 mg, 8.63 mg, 9.11 mg, 9.59 mg, 10.07 mg, 10.55 mg, 11.03 mg, 11.50 mg, 11.98 mg, 12.46 mg, 12.94 mg, 15.34 mg, 16.30 mg, 17.26 mg, 18.66 mg, 19.66 mg, 20.66 mg, 21.66 mg, 22.66 mg, 23.66 mg, 24.66 mg, 25.66 mg, 26.66 mg, 27.66 mg, 28.66 mg, 29.66 mg, 30.66 mg, 31.66 mg, 32.66 mg, 33.66 mg, 34.66 mg, 35.66 mg, 36.66 mg, 37.66 mg, 38.66 mg, 39.66 mg, 40.66 mg, 41.66 mg, 42.66 mg, 43.66 mg, 44.66 mg, 45.66 mg, 46.66 mg, 47.66 mg, 48.66 mg, 49.66 mg, 50.6 a single dose of any one of the compositions comprising 22.05 mg, 23.01 mg, 23.97 mg, 24.45 mg, 24.93 mg, 25.89 mg, 27.32 mg, 28.76 mg, 30.20 mg, 30.68 mg, 31.64 mg, 32.60 mg, 33.08 mg, 34.51 mg, 35.95 mg, 36.43 mg, 37.39 mg, 38.35 mg, 38.83 mg, 40.27 mg, 42.18 mg, 44.10 mg, 46.02 mg, 47.94 mg, 49.85 mg or 51.77 mg) to a subject is administered. In some embodiments, the subject is administered a single dose of any one of the compositions comprising an effective amount of the conjugates described herein (e.g., providing the subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of the conjugate oligonucleotide per kg of subject).
[0163] In some embodiments, the subject is administered multiple doses of any one of the compositions comprising the conjugates described herein. In some embodiments, the methods described herein involve administering an effective amount of a conjugate (e.g., a muscle-targeting conjugate) described herein (e.g., 0.5 mg to 10 mg of oligonucleotide of the conjugate per kg of subject (e.g., 0.5 mg to 10 mg, 0.5 mg to 7.5 mg, 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, ... mg~10mg, 1mg~7.5mg, 1mg~5mg, 1mg~4.5mg, 1mg~4mg, 1mg~3.5mg, 1mg~3mg, 1mg~2.5mg, 1mg~2mg, 2mg~10mg, 2mg~7.5mg, 2mg~5mg, 2mg~4.5mg, 2mg~4mg, 2mg~3.5mg, 2mg~3mg, 3mg~10mg, 3mg~7.5mg, 3mg~5mg, 3mg~4.5mg, 3mg~4mg, 3.5mg~5mg, 3.5mg~4.5mg, 4mg~1 In some embodiments, the methods described herein comprise administering a composition comprising a conjugate (e.g., a muscle targeting compound) described herein to a subject once per week, once per two weeks, once per three weeks, once per four weeks, once per five weeks, once per six weeks, once per seven weeks, once per eight weeks, once per nine weeks, once per ten weeks, once per eleven weeks, once per twelve weeks, once per thirteen weeks, once per fourteen weeks, once per fifteen weeks, or once per sixteen weeks. In some embodiments, the methods described herein comprise administering a composition comprising a conjugate (e.g., a muscle targeting compound) described herein to a subject once per week, once per two weeks, once per three weeks, once per four weeks, once per five weeks, once per sixteen weeks, once per seventeen weeks, once per eighteen weeks, once per nineteen weeks, once per ten weeks, once per eleven weeks, once per twelve weeks, once per thirteen weeks, once per fourteen weeks, once per fifteen weeks, or once per sixteen weeks. In some embodiments, the method comprises administering to a subject a composition comprising an effective amount of a compound comprising a targeting complex (targeting complex) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life. In some embodiments, the subject is administered multiple doses of any one of the compositions comprising the complexes described herein.
[0164] In some embodiments, the methods described herein involve administering an effective amount of a conjugate (e.g., a muscle-targeting conjugate) described herein (e.g., 0.5 mg to 5 mg of oligonucleotide of the conjugate per kg of subject (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, The method includes administering to a subject a composition comprising a medicament for administering to a subject a dose of 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg)) to the subject once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, or once every 16 weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount (e.g., about 0.7 mg, 1.4 mg, or 2.8 mg of oligonucleotide of the conjugate per kg of subject) of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life.In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount (e.g., about 0.69 mg, 1.37 mg, or 2.75 mg of oligonucleotide of the conjugate per kg of subject) of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life.
[0165] In some embodiments, the methods described herein comprise administering to a subject once every two weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 0.5 mg and 5 mg (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 100 mg) of oligonucleotide of the conjugate per kg of subject. 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) are provided to a subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%).
[0166] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration is between 0.5 mg and 5 mg of oligonucleotide (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 10 ... 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 10 mg, 3 mg to 7.5 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) is provided to a subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%).
[0167] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 0.5 mg and 5 mg (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 100 mg) of oligonucleotide of the conjugate per kg of subject. 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) are provided to a subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%).
[0168] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 0.5 mg and 5 mg (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 100 mg) of oligonucleotide of the conjugate per kg of subject. 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) are provided to a subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%).
[0169] In some embodiments, the subject is administered multiple doses of any one of the compositions comprising the conjugates described herein. In some embodiments, the methods described herein comprise administering to the subject a composition comprising an effective amount of a conjugate (e.g., a muscle-targeting conjugate) described herein (e.g., providing the subject with 5 mg to 100 mg (e.g., 5 mg to 100 mg, 5 mg to 80 mg, 10 mg to 60 mg, 10 mg to 30 mg, or 30 mg to 60 mg) of oligonucleotide of the conjugate per kg of subject) once per week to once every four months. For example, in some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., providing the subject with 5 mg to 100 mg of oligonucleotide of the conjugate (e.g., 5 mg to 100 mg, 5 mg to 80 mg, 10 mg to 60 mg, 10 mg to 30 mg, or 30 mg to 60 mg) per kg of subject) once per week, once per two weeks, once per three weeks, once per four weeks, once per five weeks, once per six weeks, once per seven weeks, once per eight weeks, once per nine weeks, once per ten weeks, once per eleven weeks, once per twelve weeks, once per thirteen weeks, once per fourteen weeks, once per fifteen weeks, or once per sixteen weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life. In some embodiments, the subject is administered multiple doses of any one of the compositions comprising a conjugate described herein. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate (e.g., a muscle-targeting conjugate) described herein (e.g., providing the subject with 3 mg to 52 mg (e.g., 3 mg to 52 mg, 5 mg to 50 mg, 10 mg to 40 mg, 20 mg to 30 mg) of oligonucleotide of the conjugate per kg of subject), between once per week and once every four months.For example, in some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., providing the subject with 3 mg to 52 mg (e.g., 3 mg to 52 mg, 5 mg to 50 mg, 10 mg to 40 mg, 20 mg to 30 mg) of oligonucleotide of the conjugate per kg of subject) once per week, once per two weeks, once per three weeks, once per four weeks, once per five weeks, once per six weeks, once per seven weeks, once per eight weeks, once per nine weeks, once per ten weeks, once per eleven weeks, once per twelve weeks, once per thirteen weeks, once per fourteen weeks, once per fifteen weeks, or once per sixteen weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life.
[0170] In some embodiments, the methods described herein provide for the administration of an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., about 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, 6.47 mg, 7.67 mg, 8.07 mg, 9.07 mg, 10.07 mg, 11.07 mg, 12.07 mg, 13.07 mg, 14.07 mg, 15.07 mg, 16.07 mg, 17.07 mg, 18.07 mg, 19.07 mg, 20.07 mg, 21.07 mg, 22.07 mg, 8.15mg, 8.63mg, 9.11mg, 9.59mg, 10.07mg, 10.55mg, 11.03mg, 11.50mg, 11.98mg, 12.46mg, 12.94mg, 1 5.34mg, 16.30mg, 17.26mg, 18.22mg, 19.17mg, 20.13mg, 21.09mg, 22.05mg, 23.01mg, 23.97mg, 24.45m g, 24.93mg, 25.89mg, 27.32mg, 28.76mg, 30.20mg, 30.68mg, 31.64mg, 32.60mg, 33.08mg, 34.51mg, 35. 95mg, 36.43mg, 37.39mg, 38.35mg, 38.83mg, 40.27mg, 42.18mg, 44.10mg, 46.02mg, 47.94mg, 49.85mg or 51.77 mg) to a subject once every week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, or once every sixteen weeks for the remainder of the subject's life. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount (e.g., about 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of oligonucleotide of the conjugate per kg of subject) of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life.In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount (e.g., about 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject) of a conjugate described herein (e.g., a muscle-targeting conjugate) once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, or once per 16 weeks for the remainder of the subject's life.
[0171] In some embodiments, the methods described herein comprise administering to a subject once every two weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with between 8 mg and 36 mg of oligonucleotide (e.g., between 8 mg and 36 mg, between 8 mg and 30 mg, between 8 mg and 25 mg, between 8 mg and 20 mg, between 8 mg and 15 mg, between 8 mg and 12 mg, between 8 mg and 10 mg, between 10 mg and 36 mg, between 10 mg and 30 mg, between 10 mg and 25 mg, between 10 mg and 20 mg, between 10 mg and 15 mg, between 15 mg and 36 mg, between 15 mg and 30 mg, between 15 mg and 25 mg, between 15 mg and 20 mg, between 20 mg and 36 mg, between 20 mg and 30 mg, between 20 mg and 25 mg, between 25 mg and 36 mg, between 25 mg and 20 mg, between 25 mg and 30 mg, or between 24 mg and 36 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every two weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 3 mg and 52 mg (e.g., 3 mg to 52 mg, 3 mg to 50 mg, 3 mg to 40 mg, 3 mg to 30 mg, 3 mg to 20 mg, 3 mg to 10 mg, 3 mg to 5 mg, 5 mg to 52 mg, 5 mg to 50 mg, 5 mg to 10 ... 45mg, 5mg to 40mg, 5mg to 35mg, 5mg to 30mg, 5mg to 25mg, 5mg to 20mg, 5mg to 15mg, 5mg to 10mg, 10mg to 52mg, 10mg to 50mg, 10mg to 40mg, 10mg to 30mg, 10mg to 20mg, 20mg to 52mg, 20mg to 50mg, 20mg to 40mg, 20mg to 30mg, 30mg to 50mg, 30mg to 40mg, 40mg to 52mg, or 40mg to 50mg) is provided to the subject. In some embodiments, the methods described herein comprise administering to a subject once every two weeks a composition comprising an effective amount of a conjugate (e.g., a muscle-targeting conjugate) described herein (e.g., providing the subject with about 0.7 mg, 1.4 mg, 2.8 mg, 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject).
[0172] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with between 8 mg and 36 mg of oligonucleotide (e.g., between 8 mg and 36 mg, between 8 mg and 30 mg, between 8 mg and 25 mg, between 8 mg and 20 mg, between 8 mg and 15 mg, between 8 mg and 12 mg, between 8 mg and 10 mg, between 10 mg and 36 mg, between 10 mg and 30 mg, between 10 mg and 25 mg, between 10 mg and 20 mg, between 10 mg and 15 mg, between 15 mg and 36 mg, between 15 mg and 30 mg, between 15 mg and 25 mg, between 15 mg and 20 mg, between 20 mg and 36 mg, between 20 mg and 30 mg, between 20 mg and 25 mg, between 25 mg and 36 mg, between 25 mg and 20 mg, between 25 mg and 30 mg, or between 24 mg and 36 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 5 mg, or between 5 mg and 5 mg) of oligonucleotide of the conjugate per kg of subject. 45mg, 5mg to 40mg, 5mg to 35mg, 5mg to 30mg, 5mg to 25mg, 5mg to 20mg, 5mg to 15mg, 5mg to 10mg, 10mg to 52mg, 10mg to 50mg, 10mg to 40mg, 10mg to 30mg, 10mg to 20mg, 20mg to 52mg, 20mg to 50mg, 20mg to 40mg, 20mg to 30mg, 30mg to 50mg, 30mg to 40mg, 40mg to 52mg, or 40mg to 50mg) is provided to the subject. In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., providing the subject with about 0.7 mg, 1.4 mg, 2.8 mg, 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject).
[0173] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with between 8 mg and 36 mg of oligonucleotide of the conjugate (e.g., between 8 mg and 36 mg, 8 mg and 30 mg, 8 mg and 25 mg, 8 mg and 20 mg, 8 mg and 15 mg, 8 mg and 12 mg, 8 mg and 10 mg, 10 mg and 36 mg, 10 mg and 30 mg, 10 mg and 25 mg, 10 mg and 20 mg, 10 mg and 15 mg, 15 mg and 36 mg, 15 mg and 30 mg, 15 mg and 25 mg, 15 mg and 20 mg, 20 mg and 36 mg, 20 mg and 30 mg, 20 mg and 25 mg, 25 mg and 36 mg, 25 mg and 20 mg, 25 mg and 30 mg, or 24 mg and 36 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 5 mg, or between 5 mg and 5 mg) of oligonucleotide of the conjugate per kg of subject. 45mg, 5mg to 40mg, 5mg to 35mg, 5mg to 30mg, 5mg to 25mg, 5mg to 20mg, 5mg to 15mg, 5mg to 10mg, 10mg to 52mg, 10mg to 50mg, 10mg to 40mg, 10mg to 30mg, 10mg to 20mg, 20mg to 52mg, 20mg to 50mg, 20mg to 40mg, 20mg to 30mg, 30mg to 50mg, 30mg to 40mg, 40mg to 52mg, or 40mg to 50mg) is provided to the subject. In some embodiments, the methods described herein comprise administering to a subject once every eight weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., providing the subject with about 0.7 mg, 1.4 mg, 2.8 mg, 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject).
[0174] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with between 8 mg and 36 mg of oligonucleotide (e.g., between 8 mg and 36 mg, between 8 mg and 30 mg, between 8 mg and 25 mg, between 8 mg and 20 mg, between 8 mg and 15 mg, between 8 mg and 12 mg, between 8 mg and 10 mg, between 10 mg and 36 mg, between 10 mg and 30 mg, between 10 mg and 25 mg, between 10 mg and 20 mg, between 10 mg and 15 mg, between 15 mg and 36 mg, between 15 mg and 30 mg, between 15 mg and 25 mg, between 15 mg and 20 mg, between 20 mg and 36 mg, between 20 mg and 30 mg, between 20 mg and 25 mg, between 25 mg and 36 mg, between 25 mg and 20 mg, between 25 mg and 30 mg, or between 24 mg and 36 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration is between 3 mg and 52 mg (e.g., between 3 mg and 52 mg, between 3 mg and 50 mg, between 3 mg and 40 mg, between 3 mg and 30 mg, between 3 mg and 20 mg, between 3 mg and 10 mg, between 3 mg and 5 mg, between 5 mg and 52 mg, between 5 mg and 50 mg, between 5 mg and 5 mg, or between 5 mg and 5 mg) of oligonucleotide of the conjugate per kg of subject. to 45mg, 5mg to 40mg, 5mg to 35mg, 5mg to 30mg, 5mg to 25mg, 5mg to 20mg, 5mg to 15mg, 5mg to 10mg, 10mg to 52mg, 10mg to 50mg, 10mg to 40mg, 10mg to 30mg, 10mg to 20mg, 20mg to 52mg, 20mg to 50mg, 20mg to 40mg, 20mg to 30mg, 30mg to 50mg, 30mg to 40mg, 40mg to 52mg, or 40mg to 50mg) is provided to the subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) (e.g., providing the subject with about 0.7 mg, 1.4 mg, 2.8 mg, 5 mg, 10 mg, 20 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject).
[0175] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.3 mg to 7 mg of oligonucleotide of the conjugate (e.g., 0.35 mg, 0.49 mg, 0.5 mg, 0.65 mg, 0.7 mg, 0.91 mg, 0.98 mg, 1.4 mg, 1.82 mg, 1.96 mg, 2.10 mg, 2.8 mg, 3.0 mg, 3.50 mg, 3.64 mg, 3.90 mg, 5.0 mg, or 6.50 mg) per kg of subject. In some embodiments, the methods described herein comprise administering once to a subject a composition comprising an effective amount of a conjugate (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.7 mg to 2.8 mg of oligonucleotide of the conjugate (e.g., 0.7 mg, 1.4 mg, or 2.8 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once, wherein each administration provides the subject with about 0.7 mg, 1.4 mg, or 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ±up to 30%, ±up to 25%, ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks.
[0176] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.49 mg to 0.91 mg of oligonucleotide of the conjugate per kg of subject (e.g., 0.49 mg, 0.5 mg, 0.65 mg, 0.7 mg, 0.91 mg). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.7 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the values can vary by up to 30% (e.g., ±up to 30%, ±up to 25%, ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks.
[0177] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.98 mg to 1.82 mg (e.g., 0.98 mg, 1.4 mg, 1.82 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 1.4 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the value can vary by up to 30% (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks.
[0178] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 1.96 mg to 3.64 mg of oligonucleotide of the conjugate per kg of subject (e.g., 1.96 mg, 2.10 mg, 2.8 mg, 3.0 mg, 3.50 mg, 3.64 mg). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, with respect to any of the aforementioned amounts of oligonucleotide, the values can vary by up to 30% (e.g., ±up to 30%, ±up to 25%, ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%). In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks.
[0179] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein each effective amount provides the subject with 0.5 mg to 3 mg (e.g., 0.5 mg to 3 mg, 0.5 mg to 2 mg, 0.5 mg to 1 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein each effective amount provides the subject with about 0.7 mg, 1.4 mg, 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein each effective amount provides the subject with about 0.69 mg, 1.37 mg, 2.75 mg of oligonucleotide of the conjugate per kg of subject.
[0180] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 3 mg to 7 mg (e.g., 3 mg to 7 mg, 3 mg to 6 mg, 3 mg to 5 mg, 3 mg to 4 mg, 4 mg to 7 mg, 4 mg to 6 mg, 4 mg to 5 mg, 5 mg to 7 mg, 5 mg to 6 mg, or 6 mg to 7 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, or 6.47 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 5.03 mg of oligonucleotide of the conjugate per kg of subject.
[0181] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with 8 mg to 12 mg of oligonucleotide of the conjugate (e.g., 8 mg to 12 mg, 8 mg to 11 mg, 8 mg to 10 mg, 8 mg to 9 mg, 9 mg to 12 mg, 9 mg to 11 mg, 9 mg to 10 mg, 10 mg to 12 mg, 10 mg to 11 mg, or 11 mg to 12 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 8 mg, 9 mg, 10 mg, 11 mg, or 12 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with about 10 mg of oligonucleotide of the conjugate per kg of subject.
[0182] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with between 7 mg and 13 mg of oligonucleotide (e.g., between 7 mg and 13 mg, 7 mg and 12 mg, 7 mg and 11 mg, 7 mg and 10 mg, 7 mg and 9 mg, 7 mg and 8 mg, 8 mg and 13 mg, 8 mg and 12 mg, 8 mg and 11 mg, 8 mg and 10 mg, 8 mg and 9 mg, 9 mg and 13 mg, 9 mg and 12 mg, 9 mg and 11 mg, 9 mg and 10 mg, 10 mg and 13 mg, 10 mg and 12 mg, 10 mg and 11 mg, 11 mg and 13 mg, 11 mg and 12 mg, or 12 mg and 13 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 7.67 mg, 8.15 mg, 8.63 mg, 9.11 mg, 9.59 mg, 10.07 mg, 10.55 mg, 11.03 mg, 11.50 mg, 11.98 mg, 12.46 mg, or 12.94 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 10.07 mg of oligonucleotide of the conjugate per kg of subject.
[0183] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 16 mg to 26 mg of oligonucleotide (e.g., 16 mg to 26 mg, 16 mg to 25 mg, 16 mg to 20 mg, 16 mg to 18 mg, 18 mg to 26 mg, 18 mg to 25 mg, 18 mg to 20 mg, 20 mg to 26 mg, 20 mg to 25 mg, 20 mg to 22 mg, 22 mg to 26 mg, 22 mg to 25 mg, 22 mg to 23 mg, 24 mg to 26 mg, or 24 mg to 25 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 15.34 mg, 16.30 mg, 17.26 mg, 18.22 mg, 19.17 mg, 20.13 mg, 21.09 mg, 22.05 mg, 23.01 mg, 23.97 mg, 24.93 mg, or 25.89 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 20.13 mg of oligonucleotide of the conjugate per kg of subject.
[0184] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 24 mg to 36 mg (e.g., 24 mg to 36 mg, 24 mg to 33 mg, 24 mg to 30 mg, 24 mg to 27 mg, 27 mg to 36 mg, 27 mg to 33 mg, 27 mg to 30 mg, 30 mg to 36 mg, 30 mg to 33 mg, or 33 mg to 36 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, or 40 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 30 mg of oligonucleotide of the conjugate per kg of subject.
[0185] In some embodiments, the methods described herein comprise administering to a subject once every four weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with 23 mg to 39 mg of oligonucleotide of the conjugate (e.g., 23 mg to 39 mg, 23 mg to 35 mg, 23 mg to 30 mg, 23 mg to 25 mg, 25 mg to 39 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 39 mg, 30 mg to 35 mg, or 35 mg to 39 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein each effective amount provides the subject with about 23.01 mg, 24.45 mg, 25.89 mg, 27.32 mg, 28.76 mg, 30.20 mg, 31.64 mg, 33.08 mg, 34.51 mg, 35.95 mg, 37.39 mg, or 38.83 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein each effective amount provides the subject with about 30.2 mg of oligonucleotide of the conjugate per kg of subject.
[0186] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with 31 mg to 52 mg of oligonucleotide of the conjugate (e.g., 31 mg to 52 mg, 31 mg to 50 mg, 31 mg to 45 mg, 31 mg to 40 mg, 31 mg to 35 mg, 33 mg to 52 mg, 33 mg to 50 mg, 33 mg to 45 mg, 33 mg to 40 mg, 33 mg to 35 mg, 35 mg to 52 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 52 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 52 mg, 45 mg to 50 mg, or 50 mg to 52 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 30.68 mg, 32.60 mg, 34.51 mg, 36.43 mg, 38.35 mg, 40.27 mg, 42.18 mg, 44.10 mg, 46.02 mg, 47.94 mg, 49.85 mg, or 51.77 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every four weeks, wherein the effective amount of each administration provides the subject with about 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein each effective amount provides the subject with between 0.5 mg and 3 mg (e.g., 0.5 mg and 3 mg, 0.5 mg and 2 mg, 0.5 mg and 1 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein each effective amount provides the subject with about 0.7 mg, 1.4 mg, 2.8 mg of oligonucleotide of the conjugate per kg of subject.In some embodiments, the methods described herein comprise administering to a subject once every eight weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 0.69 mg, 1.37 mg, 2.75 mg of oligonucleotide of the conjugate per kg of subject.
[0187] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with 3 mg to 8 mg (e.g., 3 mg to 8 mg, 3 mg to 7 mg, 3 mg to 6 mg, 3 mg to 5 mg, 3 mg to 4 mg, 4 mg to 8 mg, 4 mg to 7 mg, 4 mg to 6 mg, 4 mg to 5 mg, 5 mg to 8 mg, 5 mg to 7 mg, 5 mg to 6 mg, 6 mg to 8 mg, 6 mg to 7 mg, or 7 mg to 8 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, or 6.47 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 5.03 mg of oligonucleotide of the conjugate per kg of subject.
[0188] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 8 weeks, wherein the effective amount of each administration provides the subject with 8 mg to 12 mg of oligonucleotide of the conjugate (e.g., 8 mg to 12 mg, 8 mg to 11 mg, 8 mg to 10 mg, 8 mg to 9 mg, 9 mg to 12 mg, 9 mg to 11 mg, 9 mg to 10 mg, 10 mg to 12 mg, 10 mg to 11 mg, or 11 mg to 12 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 8 weeks, wherein the effective amount of each administration provides the subject with about 8 mg, 9 mg, 10 mg, 11 mg, or 12 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 8 weeks, wherein the effective amount in each administration provides the subject with about 10 mg of oligonucleotide of the conjugate per kg of subject.
[0189] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with between 7 mg and 13 mg of oligonucleotide (e.g., between 7 mg and 13 mg, 7 mg and 12 mg, 7 mg and 11 mg, 7 mg and 10 mg, 7 mg and 9 mg, 7 mg and 8 mg, 8 mg and 13 mg, 8 mg and 12 mg, 8 mg and 11 mg, 8 mg and 10 mg, 8 mg and 9 mg, 9 mg and 13 mg, 9 mg and 12 mg, 9 mg and 11 mg, 9 mg and 10 mg, 10 mg and 13 mg, 10 mg and 12 mg, 10 mg and 11 mg, 11 mg and 13 mg, 11 mg and 12 mg, or 12 mg and 13 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 7.67 mg, 8.15 mg, 8.63 mg, 9.11 mg, 9.59 mg, 10.07 mg, 10.55 mg, 11.03 mg, 11.50 mg, 11.98 mg, 12.46 mg, or 12.94 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 10.07 mg of oligonucleotide of the conjugate per kg of subject.
[0190] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 16 mg to 26 mg of oligonucleotide (e.g., 16 mg to 26 mg, 16 mg to 25 mg, 16 mg to 20 mg, 16 mg to 18 mg, 18 mg to 26 mg, 18 mg to 25 mg, 18 mg to 20 mg, 20 mg to 26 mg, 20 mg to 25 mg, 20 mg to 22 mg, 22 mg to 26 mg, 22 mg to 25 mg, 22 mg to 23 mg, 24 mg to 26 mg, or 24 mg to 25 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 15.34 mg, 16.30 mg, 17.26 mg, 18.22 mg, 19.17 mg, 20.13 mg, 21.09 mg, 22.05 mg, 23.01 mg, 23.97 mg, 24.93 mg, or 25.89 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 20.13 mg of oligonucleotide of the conjugate per kg of subject.
[0191] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with 24 mg to 36 mg (e.g., 24 mg to 36 mg, 24 mg to 33 mg, 24 mg to 30 mg, 24 mg to 27 mg, 27 mg to 36 mg, 27 mg to 33 mg, 27 mg to 30 mg, 30 mg to 36 mg, 30 mg to 33 mg, or 33 mg to 36 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, or 36 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 30 mg of oligonucleotide of the conjugate per kg of subject.
[0192] In some embodiments, the methods described herein comprise administering to a subject once every 8 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with 23 mg to 39 mg of oligonucleotide of the conjugate (e.g., 23 mg to 39 mg, 23 mg to 35 mg, 23 mg to 30 mg, 23 mg to 25 mg, 25 mg to 39 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 39 mg, 30 mg to 35 mg, or 35 mg to 39 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein each effective amount provides the subject with about 23.01 mg, 24.45 mg, 25.89 mg, 27.32 mg, 28.76 mg, 30.20 mg, 31.64 mg, 33.08 mg, 34.51 mg, 35.95 mg, 37.39 mg, or 38.83 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein each effective amount provides the subject with about 30.2 mg of oligonucleotide of the conjugate per kg of subject.
[0193] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 8 weeks, wherein the effective amount of each administration provides the subject with 31 mg to 52 mg of oligonucleotide of the conjugate (e.g., 31 mg to 52 mg, 31 mg to 50 mg, 31 mg to 45 mg, 31 mg to 40 mg, 31 mg to 35 mg, 33 mg to 52 mg, 33 mg to 50 mg, 33 mg to 45 mg, 33 mg to 40 mg, 33 mg to 35 mg, 35 mg to 52 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 52 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 52 mg, 45 mg to 50 mg, or 50 mg to 52 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 30.68 mg, 32.60 mg, 34.51 mg, 36.43 mg, 38.35 mg, 40.27 mg, 42.18 mg, 44.10 mg, 46.02 mg, 47.94 mg, 49.85 mg, or 51.77 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every eight weeks, wherein the effective amount of each administration provides the subject with about 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject, once every 12 weeks, a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with 0.5 mg to 3 mg (e.g., 0.5 mg to 3 mg, 0.5 mg to 2 mg, 0.5 mg to 1 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject, once every 12 weeks, a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 0.7 mg, 1.4 mg, 2.8 mg of oligonucleotide of the conjugate per kg of subject.In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 0.69 mg, 1.37 mg, 2.75 mg of oligonucleotide of the conjugate per kg of subject.
[0194] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 3 mg to 7 mg (e.g., 3 mg to 7 mg, 3 mg to 6 mg, 3 mg to 5 mg, 3 mg to 4 mg, 4 mg to 7 mg, 4 mg to 6 mg, 4 mg to 5 mg, 5 mg to 7 mg, 5 mg to 6 mg, or 6 mg to 7 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 3.83 mg, 4.07 mg, 4.31 mg, 4.55 mg, 4.79 mg, 5 mg, 5.03 mg, 5.27 mg, 5.51 mg, 5.75 mg, 5.99 mg, 6.23 mg, or 6.47 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 5.03 mg of oligonucleotide of the conjugate per kg of subject.
[0195] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 12 weeks, wherein the effective amount of each administration provides the subject with 8 mg to 12 mg of oligonucleotide of the conjugate (e.g., 8 mg to 12 mg, 8 mg to 11 mg, 8 mg to 10 mg, 8 mg to 9 mg, 9 mg to 12 mg, 9 mg to 11 mg, 9 mg to 10 mg, 10 mg to 12 mg, 10 mg to 11 mg, or 11 mg to 12 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every 12 weeks, wherein the effective amount of each administration provides the subject with about 8 mg, 9 mg, 10 mg, 11 mg, or 12 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with about 10 mg of oligonucleotide of the conjugate per kg of subject.
[0196] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with between 7 mg and 13 mg of oligonucleotide (e.g., between 7 mg and 13 mg, 7 mg and 12 mg, 7 mg and 11 mg, 7 mg and 10 mg, 7 mg and 9 mg, 7 mg and 8 mg, 8 mg and 13 mg, 8 mg and 12 mg, 8 mg and 11 mg, 8 mg and 10 mg, 8 mg and 9 mg, 9 mg and 13 mg, 9 mg and 12 mg, 9 mg and 11 mg, 9 mg and 10 mg, 10 mg and 13 mg, 10 mg and 12 mg, 10 mg and 11 mg, 11 mg and 13 mg, 11 mg and 12 mg, or 12 mg and 13 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 7.67 mg, 8.15 mg, 8.63 mg, 9.11 mg, 9.59 mg, 10 mg, 10.07 mg, 10.55 mg, 11.03 mg, 11.50 mg, 11.98 mg, 12.46 mg, or 12.94 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 10.07 mg of oligonucleotide of the conjugate per kg of subject.
[0197] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 16 mg to 26 mg of oligonucleotide (e.g., 16 mg to 26 mg, 16 mg to 25 mg, 16 mg to 20 mg, 16 mg to 18 mg, 18 mg to 26 mg, 18 mg to 25 mg, 18 mg to 20 mg, 20 mg to 26 mg, 20 mg to 25 mg, 20 mg to 22 mg, 22 mg to 26 mg, 22 mg to 25 mg, 22 mg to 23 mg, 24 mg to 26 mg, or 24 mg to 25 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 15.34 mg, 16.30 mg, 17.26 mg, 18.22 mg, 19.17 mg, 20 mg, 20.13 mg, 21.09 mg, 22.05 mg, 23.01 mg, 23.97 mg, 24.93 mg, or 25.89 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 20.13 mg of oligonucleotide of the conjugate per kg of subject.
[0198] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with 24 mg to 36 mg (e.g., 24 mg to 36 mg, 24 mg to 33 mg, 24 mg to 30 mg, 24 mg to 27 mg, 27 mg to 36 mg, 27 mg to 33 mg, 27 mg to 30 mg, 30 mg to 36 mg, 30 mg to 33 mg, or 33 mg to 36 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, or 36 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount of each administration provides the subject with about 30 mg of oligonucleotide of the conjugate per kg of subject.
[0199] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein the effective amount in each administration provides the subject with 23 mg to 39 mg of oligonucleotide of the conjugate (e.g., 23 mg to 39 mg, 23 mg to 35 mg, 23 mg to 30 mg, 23 mg to 25 mg, 25 mg to 39 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 39 mg, 30 mg to 35 mg, or 35 mg to 39 mg) per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 23.01 mg, 24.45 mg, 25.89 mg, 27.32 mg, 28.76 mg, 30.20 mg, 31.64 mg, 33.08 mg, 34.51 mg, 35.95 mg, 37.39 mg, or 38.83 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 30.2 mg of oligonucleotide of the conjugate per kg of subject.
[0200] In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each administration provides the subject with 31 mg to 52 mg of oligonucleotide (e.g., 31 mg to 52 mg, 31 mg to 50 mg, 31 mg to 45 mg, 31 mg to 40 mg, 31 mg to 35 mg, 33 mg to 52 mg, 33 mg to 50 mg, 33 mg to 45 mg, 33 mg to 40 mg, 33 mg to 35 mg, 35 mg to 52 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 52 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 52 mg, 45 mg to 50 mg, or 50 mg to 52 mg) of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 30.68 mg, 32.60 mg, 34.51 mg, 36.43 mg, 38.35 mg, 40 mg, 40.27 mg, 42.18 mg, 44.10 mg, 46.02 mg, 47.94 mg, 49.85 mg, or 51.77 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject once every 12 weeks a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate), wherein each effective amount provides the subject with about 40.27 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein two administrations within the first four weeks provide the subject with a total amount of oligonucleotide of the conjugate equal to the amount of oligonucleotide of the conjugate provided by each subsequent administration.
[0201] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein each of two administrations within the first four weeks provides the subject with an amount of oligonucleotide of the conjugate equal to the amount of oligonucleotide of the conjugate provided by each subsequent administration. In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of the first two doses within the first four weeks provides the subject with a total of 3-52 mg (e.g., 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent dose provides the subject with 3-52 mg (e.g., 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg) of oligonucleotide of the conjugate per kg of subject.
[0202] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of each of the first two doses within the first four weeks provides the subject with 3-52 mg (e.g., 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent dose provides the subject with 3-52 mg (e.g., 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg) of oligonucleotide of the conjugate per kg of subject.
[0203] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of the first two doses within the first four weeks provides the subject with a total of 5-40 mg (e.g., 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent administration provides the subject with 5-40 mg (e.g., 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of oligonucleotide of the conjugate per kg of subject.
[0204] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of each of the first two doses within the first four weeks provides the subject with 5-40 mg (e.g., 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent dose provides the subject with 5-40 mg (e.g., 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg) of oligonucleotide of the conjugate per kg of subject.
[0205] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of the first two doses within the first four weeks provides the subject with a total of 8-36 mg (e.g., 8 mg, 10 mg, 12 mg, 15 mg, 20 mg, 24 mg, 25 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent dose provides the subject with 8-36 mg (e.g., 8 mg, 10 mg, 12 mg, 15 mg, 20 mg, 24 mg, 25 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject.
[0206] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein the effective amount of each of the first two doses within the first four weeks provides the subject with 8-36 mg (e.g., 8 mg, 10 mg, 12 mg, 15 mg, 20 mg, 24 mg, 25 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent dose provides the subject with 8-36 mg (e.g., 8 mg, 10 mg, 12 mg, 15 mg, 20 mg, 24 mg, 25 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject.
[0207] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, and week 4 doses), followed by once every four weeks thereafter, wherein the effective amount for the first two doses within the first four weeks (weeks 0 and 2) is 24 mg to 36 mg total oligonucleotide of the conjugate per kg of subject (e.g., 4 mg for the first dose and 20 mg for the second dose; 8 mg for the first dose and 16 mg for the second dose; 12 mg for the first dose and 12 mg for the second dose; 24 mg for the first dose and 8 mg for the second dose; or 20 mg for the first dose and 4 mg for the second dose; 25 mg for the first dose and 10 mg for the second dose, 15 mg for the first dose and 15 mg for the second dose, 20 mg for the first dose and 10 mg for the second dose, 25 mg for the first dose and 5 mg for the second dose, 6 mg for the first dose and 30 mg for the second dose, 12 mg for the first dose and 24 mg for the second dose, 18 mg for the first dose and 18 mg for the second dose, 24 mg for the first dose and 12 mg for the second dose, or 30 mg for the first dose and 6 mg for the second dose), wherein each subsequent administration provides the subject with 24 mg to 36 mg (e.g., 24 mg, 30 mg, or 36 mg) of conjugated oligonucleotide per kg of subject.
[0208] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (doses at weeks 0, 2, and 4), and then once every four weeks thereafter, wherein the effective amount of the first two administrations within the first four weeks (weeks 0 and 2) provides the subject with a total of 30 mg of oligonucleotide of the conjugate per kg of subject (e.g., 5 mg for the first dose and 25 mg for the second dose; 10 mg for the first dose and 20 mg for the second dose; 15 mg for the first dose and 15 mg for the second dose; 20 mg for the first dose and 10 mg for the second dose; or 25 mg for the first dose and 5 mg for the second dose), wherein each subsequent administration provides the subject with 30 mg of oligonucleotide of the conjugate per kg of subject.
[0209] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein each effective amount of administration within the first four weeks provides the subject with 24 mg to 36 mg (e.g., 24 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent administration provides the subject with 24 mg to 36 mg (e.g., 24 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject.
[0210] It should be understood that once every four weeks is substantially the same as once a month, once every eight weeks is substantially the same as once every two months, once every twelve weeks is substantially the same as once every three months, and once every sixteen weeks is substantially the same as once every four months. Thus, in some embodiments, once every four weeks can mean once a month; once every eight weeks can mean once every two months; once every twelve weeks can mean once every three months; and once every sixteen weeks can mean once every four months. Similarly, in some embodiments, once every four weeks can mean twelve times a year; once every eight weeks can mean six times a year; and once every twelve weeks can mean four times a year.
[0211] In some embodiments, the methods described herein comprise administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a muscle-targeting conjugate) once every two weeks for the first four weeks (week 0, week 2, week 4 doses), and then once every four weeks thereafter, wherein each effective amount of administration within the first four weeks provides the subject with 30 mg of oligonucleotide of the conjugate per kg of subject, and wherein each subsequent administration provides the subject with 30 mg of oligonucleotide of the conjugate per kg of subject.
[0212] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount provides the subject with 8 mg to 36 mg (e.g., 8 mg, 10 mg, 12 mg, 20 mg, 24 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, a formulation of a composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0213] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount provides the subject with 8 mg to 36 mg (e.g., 8 mg, 10 mg, 12 mg, 20 mg, 24 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, a formulation of a composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0214] In some embodiments, the methods described herein comprise administering via injection an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate comprises the structure of Formula (Id): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; optionally, wherein the anti-TfR1 antibodies (e.g., Fabs) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues of the antibody, and optionally, wherein each different amino acid residue is a lysine; wherein for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount provides the subject with 8 mg to 36 mg (e.g., 8 mg, 10 mg, 12 mg, 20 mg, 24 mg, 30 mg, or 36 mg) of oligonucleotide of the conjugate per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, a formulation of a composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0.
[0215] In some embodiments, any one of the methods described herein contemplates varying amounts of oligonucleotide provided to a subject by administering a composition comprising an effective amount of a conjugate described herein. Thus, in some embodiments, an effective amount provides a subject with about 5 mg (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%) to about 100 mg (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 5 mg (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%) to about 50 mg (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%) of the conjugate oligonucleotide per kg of subject.
[0216] In some embodiments, an effective amount provides a subject with about 10 mg (e.g., ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) to about 30 mg (e.g., ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, or 36 mg of conjugated oligonucleotide per kg of subject. For any amount of oligonucleotide progression, the value can vary by up to 20% (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3% or ±up to 1%).
[0217] In some embodiments, an effective amount provides a subject with about 10 mg (e.g., ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 30 mg (e.g., ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject.
[0218] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount of administration provides the subject with 3 mg to 52 mg of the conjugated oligonucleotide per kg of subject, optionally wherein each effective amount of administration provides the subject with 5 mg to 40 mg of the conjugated oligonucleotide per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, each effective amount of administration provides the subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, each effective amount of administration provides the subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, a formulation of a composition comprising a conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0219] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount of administration provides the subject with 3 mg to 52 mg of the conjugated oligonucleotide per kg of subject, optionally wherein each effective amount of administration provides the subject with 5 mg to 40 mg of the conjugated oligonucleotide per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, each effective amount of administration provides the subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, each effective amount of administration provides the subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, a formulation of a composition comprising a conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0220] In some embodiments, the methods described herein comprise administering via injection an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate comprises the structure of formula (Id): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; optionally, wherein the anti-TfR1 antibodies (e.g., Fabs) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues of the antibody, and optionally, wherein each different amino acid residue is a lysine; wherein for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); wherein each effective amount of administration provides the subject with 3 mg to 52 mg of the conjugated oligonucleotide per kg of subject, optionally wherein each effective amount of administration provides the subject with 5 mg to 40 mg of the conjugated oligonucleotide per kg of subject, optionally wherein the subject is administered the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, each effective amount of administration provides the subject with 5 mg, 10 mg, 20 mg, 30 mg, or 40 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, each effective amount of administration provides the subject with 5.03 mg, 10.06 mg, 20.13 mg, 30.2 mg, or 40.27 mg of the conjugated oligonucleotide per kg of subject. In some embodiments, a formulation of a composition comprising a conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ] n1 -R2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0221] In some embodiments, any one of the methods described herein contemplates varying the amount of oligonucleotide provided to a subject by administering a composition comprising an effective amount of the conjugate described herein. Thus, in some embodiments, an effective amount provides a subject with about 5 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) to about 40 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 5.03 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) to about 40.27 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the conjugate oligonucleotide per kg of subject.
[0222] In some embodiments, an effective amount provides a subject with about 5 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 5.03 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject.
[0223] In some embodiments, an effective amount provides a subject with about 10 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 10.06 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject.
[0224] In some embodiments, an effective amount provides a subject with about 20 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the conjugate oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 20.13 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the conjugate oligonucleotide per kg of subject.
[0225] In some embodiments, an effective amount provides a subject with about 20 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 30.2 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject.
[0226] In some embodiments, an effective amount provides a subject with about 40 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject. In some embodiments, an effective amount provides a subject with about 40.27 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of conjugated oligonucleotide per kg of subject.
[0227] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ib): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); Here, the effective amount for each administration is 0.5 mg to 5 mg of the oligonucleotide complex per 1 kg of subject (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg).
[0033] In some embodiments, the subject receives an effective amount of the conjugate (e.g., 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) to the subject, optionally wherein the subject receives an administration of the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, the effective amount of each administration provides the subject with 0.7 mg, 1.4 mg, 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the formulation of the composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0228] In some embodiments, the methods described herein comprise administering via infusion an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 comprises a group of formula (Ic): [ka] R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; wherein in each complex, n1 is independently selected from R 1 is an integer equal to or greater than 1 representing the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody (e.g., Fab) at attachment point A, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); Here, the effective amount for each administration is 0.5 mg to 5 mg of the oligonucleotide complex per 1 kg of subject (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg, 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg) In some embodiments, the subject receives an effective amount of the conjugate (e.g., 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) to the subject, optionally wherein the subject receives an administration of the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, the effective amount of each administration provides the subject with 0.7 mg, 1.4 mg, 2.8 mg of the conjugate oligonucleotide per kg of subject. In some embodiments, the formulation of the composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ]n1-R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0229] In some embodiments, the methods described herein comprise administering via injection an effective amount of a formulation of a composition comprising conjugates (e.g., in an aqueous solution), wherein each conjugate comprises the structure of Formula (Id): [ka] wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has the base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody (e.g., Fab) comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; optionally, wherein the anti-TfR1 antibodies (e.g., Fabs) are covalently linked (e.g., indirectly or directly linked, e.g., directly linked) via different amino acid residues of the antibody, and optionally, wherein each different amino acid residue is a lysine; wherein for each conjugate, n1 is independently an integer greater than or equal to 1, and optionally, wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; wherein the formulation is at a pH of 5.5 to 6.5 (e.g., 6.0) and comprises histidine (e.g., at a concentration of 25 mM), sucrose (e.g., at a concentration of 10% w / v), and a complex (e.g., at a concentration in the range of 10 mg / mL to 50 mg / mL); Here, the effective amount for each administration is 0.5 mg to 5 mg of the oligonucleotide complex per 1 kg of subject (e.g., 0.5 mg to 5 mg, 0.5 mg to 4.5 mg, 0.5 mg to 4 mg, 0.5 mg to 3.5 mg, 0.5 mg to 3 mg, 0.5 mg to 2.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1.5 mg, 0.5 mg to 1 mg, 1 mg to 5 mg, 1 mg to 4.5 mg, 1 mg to 4 mg, 1 mg to 3.5 mg).
[0033] In some embodiments, the subject receives an effective amount of the conjugate (e.g., 1 mg to 3 mg, 1 mg to 2.5 mg, 1 mg to 2 mg, 2 mg to 5 mg, 2 mg to 4.5 mg, 2 mg to 4 mg, 2 mg to 3.5 mg, 2 mg to 3 mg, 3 mg to 5 mg, 3 mg to 4.5 mg, 3 mg to 4 mg, 3.5 mg to 5 mg, 3.5 mg to 4.5 mg, or 4 mg to 5 mg) to the subject, optionally wherein the subject receives an administration of the composition once every 4 weeks, 8 weeks, or 12 weeks. In some embodiments, the effective amount of each administration provides the subject with 0.7 mg, 1.4 mg, 2.8 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the formulation of the composition comprising the conjugate (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of Formula (I): [R 1 ] n1 -R 2 wherein n1 is 0 and wherein R 1 and R 2 is defined herein.
[0230] In some embodiments, any one of the methods described herein contemplates varying the amount of oligonucleotide provided to a subject by administering a composition comprising an effective amount of a conjugate described herein. In some embodiments, the methods described herein involve administering a conjugate described herein (e.g., a compound of Formula (I): [R 1 ] n1 -R 2to a subject, wherein the effective amount provides the subject with about 0.5 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) to about 5 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of oligonucleotide of the conjugate per kg of subject.
[0231] In some embodiments, the methods described herein comprise preparing a conjugate described herein (e.g., of formula (I): [R 1 ] n1 -R 2 to a subject, wherein the effective amount provides the subject with about 0.7 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the oligonucleotide of the conjugate per kg of subject. In some embodiments, the effective amount provides the subject with about 1.4 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the oligonucleotide of the conjugate per kg of subject. In some embodiments, an effective amount provides a subject with about 2.8 mg (e.g., ± up to 30%, ± up to 25%, ± up to 20%, ± up to 15%, ± up to 10%, ± up to 5%, ± up to 3%, or ± up to 1%) of the conjugated oligonucleotide per kg of subject.
[0232] In some embodiments, the methods described herein comprise preparing a conjugate described herein (e.g., of formula (I): [R 1 ] n1 -R 2
[0023] The method includes administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount of administration provides the subject with 0.3 mg to 7 mg of oligonucleotide of the conjugate (e.g., 0.35 mg, 0.49 mg, 0.5 mg, 0.65 mg, 0.7 mg, 0.91 mg, 0.98 mg, 1.4 mg, 1.82 mg, 1.96 mg, 2.10 mg, 2.8 mg, 3.0 mg, 3.50 mg, 3.64 mg, 3.90 mg, 5.0 mg, or 6.50 mg) per kg of subject. In some embodiments, the effective amount of each administration provides the subject with 0.7 mg to 2.8 mg of oligonucleotide of the conjugate (e.g., 0.7 mg, 1.4 mg, or 2.8 mg) per kg of subject. In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount provides the subject with 0.7 mg to 2.8 mg (e.g., 0.7 mg, 1.4 mg, or 2.8 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount provides the subject with 0.49 mg to 0.91 mg (e.g., 0.49 mg, 0.5 mg, 0.65 mg, 0.7 mg, 0.91 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount provides the subject with 0.7 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id)), wherein each effective amount provides the subject with 0.7 mg of oligonucleotide of the conjugate per kg of subject. 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate (e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id)), wherein each effective amount provides the subject with 0.98 mg to 1.82 mg (e.g., 0.98 mg, 1.4 mg, 1.82 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate (e.g., a conjugate comprising a group of Formula (I): [R 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount provides the subject with 1.4 mg of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id)), wherein each effective amount provides the subject with 1.4 mg of oligonucleotide of the conjugate per kg of subject. 1 ] n1 -R 2
[0023] In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate comprising a structure of Formula (I): [R], e.g., a conjugate comprising a group of Formula (Ia), (Ib), (Ic), or (Id), wherein each effective amount provides the subject with 1.96 mg to 3.64 mg (e.g., 1.96 mg, 2.10 mg, 2.8 mg, 3.0 mg, 3.50 mg, 3.64 mg) of oligonucleotide of the conjugate per kg of subject. In some embodiments, the methods described herein involve administering to a subject a composition comprising an effective amount of a conjugate described herein (e.g., a conjugate comprising a group of Formula (I): [R], 1 ] n1 -R 2(e.g., a conjugate comprising a group of formula (Ia), (Ib), (Ic) or (Id)), wherein each effective amount provides the subject with 2.8 mg of oligonucleotide of the conjugate per kg of subject.
[0233] In some embodiments, the methods described herein comprise providing a compound of formula (I): [R 1 ] n1 -R 2
[0023] In some embodiments, in any one of the methods described herein, the composition for administration to the subject comprises a composition comprising a conjugate comprising any one of the structures of Formula (I): [R 1 ] n1 -R 2 and the amount of anti-TfR1 antibody (e.g., Fab) in the conjugate of the composition sufficient to deliver an amount of the oligonucleotide in the conjugate to a subject can be derived using the following equation (Equation A):
number
[0234] In some embodiments, in any one of the methods described herein, the composition for administration to the subject comprises a compound having Formula (I): [R 1 ] n1 -R 2and the amount of oligonucleotide of the conjugate provided to a subject per kg of subject can be derived using the following equation (Equation B):
number
[0235] In some embodiments, the present disclosure contemplates a variation in the mean value of n1 of up to 30% (e.g., ±up to 30%, ±up to 25%, ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%). In some embodiments, the mean value of n1 for the conjugates of the composition is within the range of 1 to 5 (e.g., 1, 2, 3, 4, or 5). In some embodiments, the methods provided herein comprise the step of preparing a compound of formula (I): [R 1 ] n1 -R 2 wherein the mean value of n1 of the conjugates in the composition is within the range of 1 to 5 (e.g., 1, 2, 3, 4, or 5) with a variation of up to 30% (e.g., ±up to 30%, ±up to 25%, ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%).
[0236] In some embodiments, the present disclosure contemplates a variation in the mean value of n1 of up to 20% (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%). In some embodiments, the mean value of n1 for the conjugates of the composition is within the range of 1 to 5 (e.g., 1, 2, 3, 4, or 5). In some embodiments, the methods provided herein comprise the step of preparing a compound of formula (I): [R 1 ] n1 -R 2wherein the mean value of n1 of the conjugates in the composition is within the range of 1 to 5 (e.g., 1, 2, 3, 4, or 5) with a variation of up to 20% (e.g., ±up to 20%, ±up to 15%, ±up to 10%, ±up to 5%, ±up to 3%, or ±up to 1%).
[0237] It should be understood that the average value of n1 need not be an integer, but can be a decimal. In some embodiments, the average value of n1 is about 1.6, 1.7, 1.8, 1.8, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, or 2.7. In some embodiments, the average value of n1 is about 2. In some embodiments, the average value of n1 is about 2.1. In some embodiments, the average value of n1 is 2, 2.05, 2.1, 2.111, 2.112, 2.113, 2.114, 2.115, 2.12, 2.115, 2.13, 2.135, 2.14, 2.145, or 2.15.
[0238] It should be understood that any amount of oligonucleotide provided herein can be expressed as an amount of anti-TfR1 antibody (e.g., Fab) according to Equation A. Accordingly, it should be understood that a statement herein regarding alternatively pr...
Claims
1. 1. A composition for use in a method of promoting dystrophin protein expression or activity in a subject or treating Duchenne muscular dystrophy (DMD), the method comprising administering the composition to the subject, wherein the composition comprises an effective amount of conjugates, each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 1 mg to 90 mg of conjugate anti-TfR1 antibody per kg of subject, wherein the antibody has a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 1, 7 or 12 and a heavy chain complementarity determining region 2 (CDR-H1) comprising the sequence set forth in SEQ ID NO: 2, 8 or 13. a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence set forth in SEQ ID NO: 3, 9 or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence set forth in SEQ ID NO: 4, 10 or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO).
2. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 1-8 mg of conjugated anti-TfR1 antibody per kg of subject.
3. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 1-2 mg of conjugated anti-TfR1 antibody per kg of subject.
4. 2. The composition for use according to claim 1, wherein each administration provides the subject with 1.5 mg of conjugated anti-TfR1 antibody per kg of subject.
5. 10. The composition for use of claim 1, wherein each administration effective amount provides the subject with 0.49 to 0.91 mg of conjugated oligonucleotide per kg of subject.
6. 2. The composition for use of claim 1, wherein each administration provides the subject with 0.7 mg of the conjugated oligonucleotide per kg of subject.
7. 10. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 2-4 mg of conjugated anti-TfR1 antibody per kg of subject.
8. 2. The composition for use according to claim 1, wherein each administration provides the subject with 3 mg of the conjugated anti-TfR1 antibody per kg of subject.
9. 10. The composition for use of claim 1, wherein each administration effective amount provides the subject with 0.98 to 1.82 mg of conjugated oligonucleotide per kg of subject.
10. 10. The composition for use of claim 1, wherein each administration provides the subject with 1.4 mg of the conjugated oligonucleotide per kg of subject.
11. 10. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 4-8 mg of conjugated anti-TfR1 antibody per kg of subject.
12. 2. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 6 mg of conjugated anti-TfR1 antibody per kg of subject.
13. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 1.96 to 3.64 mg of the conjugated oligonucleotide per kg of subject.
14. 2. The composition for use according to claim 1, wherein each administration provides the subject with 2.8 mg of the conjugated oligonucleotide per kg of subject.
15. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 3-52 mg of conjugated anti-TfR1 antibody per kg of subject.
16. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 5-40 mg of conjugated anti-TfR1 antibody per kg of subject.
17. 10. The composition for use of claim 1, wherein each administration is effective to provide the subject with 3-50 mg of the conjugated oligonucleotide per kg of subject.
18. 10. The composition for use of claim 1, wherein each administration is effective to provide the subject with 5-40 mg of the conjugated oligonucleotide per kg of subject.
19. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 7-15 mg of conjugated anti-TfR1 antibody per kg of subject.
20. 2. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 11 mg of the conjugated anti-TfR1 antibody per kg of the subject.
21. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 3-10 mg of the conjugated oligonucleotide per kg of subject.
22. 10. The composition for use according to claim 1, wherein each administration provides the subject with 5 mg of the conjugated oligonucleotide per kg of subject.
23. 10. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 15-30 mg of conjugated anti-TfR1 antibody per kg of subject.
24. 10. The composition for use according to claim 1, wherein each administration provides the subject with 22 mg of the conjugated anti-TfR1 antibody per kg of the subject.
25. 10. The composition for use of claim 1, wherein each administration effective amount provides the subject with 7-13 mg of the conjugated oligonucleotide per kg of subject.
26. 10. The composition for use of claim 1, wherein each administration provides the subject with 10 mg of the conjugated oligonucleotide per kg of subject.
27. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 30-59 mg of conjugated anti-TfR1 antibody per kg of subject.
28. 2. The composition for use according to claim 1, wherein each administration provides the subject with 44 mg of conjugated anti-TfR1 antibody per kg of subject.
29. 10. The composition for use of claim 1, wherein each administration provides the subject with 10-50 mg of the conjugated oligonucleotide per kg of subject.
30. 10. The composition for use of claim 1, wherein each administration provides the subject with 16-26 mg of conjugated oligonucleotide per kg of subject.
31. 10. The composition for use of claim 1, wherein each administration provides the subject with 20 mg of the conjugated oligonucleotide per kg of subject.
32. 2. The composition for use according to claim 1, wherein each administration provides the subject with 55 mg of the conjugated anti-TfR1 antibody per kg of subject.
33. 10. The composition for use of claim 1, wherein each administration effective amount provides the subject with 25 mg of the conjugated oligonucleotide per kg of subject.
34. 10. The composition for use of claim 1, wherein each administration provides the subject with an effective amount of 61-117 mg of conjugated anti-TfR1 antibody per kg of subject.
35. 2. The composition for use according to claim 1, wherein each administration provides the subject with 88 mg of conjugated anti-TfR1 antibody per kg of subject.
36. 10. The composition for use of claim 1, wherein each administration provides the subject with 31-52 mg of the conjugate oligonucleotide per kg of subject.
37. 10. The composition for use according to claim 1, wherein each administration provides the subject with 40 mg of the conjugated oligonucleotide per kg of subject.
38. 2. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 77 mg of conjugated anti-TfR1 antibody per kg of subject.
39. 10. The composition for use of claim 1, wherein each administration provides the subject with 35 mg of the conjugated oligonucleotide per kg of subject.
40. 2. The composition for use according to claim 1, wherein each administration provides the subject with an effective amount of 66 mg of the conjugated anti-TfR1 antibody per kg of subject.
41. 10. The composition for use according to claim 1, wherein each administration provides the subject with 30 mg of the conjugated oligonucleotide per kg of subject.
42. 10. The composition for use of claim 1, wherein each administration effective amount provides the subject with 20-40 mg of conjugated oligonucleotide per kg of subject.
43. 10. The composition for use of claim 1, wherein each administration provides the subject with 20-30 mg of the conjugated oligonucleotide per kg of subject.
44. 10. The composition for use of claim 1, wherein each administration is effective to provide the subject with 30-40 mg of the conjugated oligonucleotide per kg of subject.
45. 10. The composition for use according to claim 1, wherein the composition is administered once every two weeks, once every four weeks, once every eight weeks, or once every twelve weeks.
46. 10. The composition for use according to claim 1, wherein the composition is administered once every four weeks.
47. 10. The composition for use according to claim 1, wherein the composition is administered once every eight weeks.
48. 10. The composition for use according to claim 1, wherein the composition is formulated for systemic administration or formulated to be administered by injection.
49. 2. The composition for use according to claim 1, wherein the composition is in an aqueous solution and further comprises histidine and sucrose, optionally wherein the histidine is present in the aqueous solution at a concentration of 25 mM, optionally wherein the sucrose is present in the aqueous solution at a concentration of 10% w / v, and optionally wherein the aqueous solution is at a pH of 6.
0.
50. 2. The composition for use according to claim 1, wherein the complex is present in the composition at a concentration ranging from 10 mg / mL to 50 mg / mL, or wherein the complex is present in an aqueous solution at a concentration of 25 mg / mL.
51. 2. The composition for use of claim 1, wherein the subject has a mutant dystrophin allele comprising a mutation suitable for exon 51 skipping, or the mutant dystrophin allele comprises a frameshift mutation in exon 51, and / or the subject has Duchenne muscular dystrophy.
52. 2. The composition for use of claim 1, wherein the complex promotes the expression or activity of a truncated dystrophin protein in a subject.
53. 2. The composition for use of claim 1, wherein administration of the composition results in greater than 1% of dystrophin protein in the subject compared to a control.
54. 2. The composition for use of claim 1, wherein administration of the composition increases the number of dystrophin-positive fibers to about 50% of total muscle fibers in a muscle tissue sample from a subject.
55. 2. The composition for use of claim 1, wherein the subject is a human subject, optionally wherein the human subject is between 2 and 60 years old, or wherein the human subject is between 4 and 16 years old.
56. Each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 contains a group of formula (Ib): 【Chemical 1】 wherein -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), where -p reflects a phosphorodiamidate linkage, and where N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has a base sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO:21); R 2 comprises an anti-TfR1 antibody; and In each complex, n1 is independently selected from R 1 is an integer of 1 or greater representing the number of instances of 1 is covalently linked via attachment point A to a different lysine of the anti-TfR1 antibody, and optionally wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5.
57. Each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein: Each R 1 contains a group of formula (Ic): 【Chemistry 2】 R 2 comprises an anti-TfR1 antibody; and In each complex, n1 is independently selected from R 1 is an integer of 1 or greater representing the number of instances of 1 is covalently linked via attachment point A to a different lysine of the anti-TfR1 antibody, and optionally wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5.
58. The composition for use according to any one of claims 1 to 55, wherein the anti-TfR1 antibody is a Fab fragment.
59. 56. The composition for use according to any one of claims 1 to 55, wherein the anti-TfR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO:
18.
60. The composition for use according to any one of claims 1 to 55, wherein the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO:
20.
61. 61. The composition for use of claim 60, wherein the heavy chain of the antibody comprises an N-terminal glutamate.
62. 56. The composition for use of any one of claims 1 to 55, wherein one or more oligonucleotides are each independently covalently linked to an anti-TfR1 antibody via conjugation to a lysine residue of the antibody.
63. 56. The composition for use of any one of claims 1 to 55, wherein one or more oligonucleotides are each independently covalently linked to an anti-TfR1 antibody via conjugation to a cysteine residue of the antibody.