Conjugated oligonucleotides and uses thereof
Patent Information
- Application Number
- JP2024519650
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-10
- Filing Date
- 2022-09-29
- Publication Date
- 2025-10-06
AI Technical Summary
Existing oligomeric compounds, such as siRNA and ASOs, face challenges in achieving high specificity and potency while minimizing toxicity and side effects, necessitating improved targeting mechanisms for therapeutic applications.
Development of oligomeric compounds comprising modified oligonucleotides conjugated with bicyclic ligands, which include polypeptide loops attached to a molecular scaffold, allowing targeted delivery to specific cells via the transferrin receptor, while maintaining the activity of both components.
Enhances the specificity and potency of oligonucleotide therapy by enabling targeted delivery to tissues of interest, reducing the required dose and minimizing side effects.
Smart Images

Figure 2023056388000001 
Figure 2023056388000002 
Figure 2023056388000003
Abstract
Description
[Technical field]
[0001] Sequence Listing This application has been filed in electronic format with a sequence listing, which is provided as a file entitled CHEM0103WOSEQ.xml, created on September 29, 2022, and is 3,314 kb in size. The information in the electronic format of this sequence listing is incorporated herein by reference in its entirety.
[0002] The present embodiments provide compounds and methods for targeting cells of interest with oligonucleotides. [Background technology]
[0003] Oligomeric compounds such as siRNA and single-stranded antisense oligonucleotides (ASO) have been shown to be useful in regulating gene expression and have proven to be therapeutically effective. Certain chemical modifications of oligomeric compounds can improve the efficacy, effectiveness, and undesirable side effects of oligomeric compounds, allow for the administration of lower doses, reduce the potential for toxicity, and reduce the overall cost of therapy. Oligomeric compounds can be modified with conjugate groups (e.g., ligands for receptors expressed on cells of interest), resulting in the oligomeric compounds being targeted to one or more tissues of interest.
[0004] Transferrin receptor type 1 (TfR1), also known as CD71, is a transmembrane glycoprotein that binds and internalizes iron-bound transferrin by receptor-mediated endocytosis. Antibody-drug conjugates with anti-TfR1 antibodies have been used to deliver drugs to various tissues, including the CNS and muscle.
[0005] Cyclic peptides are an attractive class of molecules for the development of therapeutic drugs, since they can bind to protein targets with high affinity and specificity. Indeed, some cyclic peptides, such as the antimicrobial peptide vancomycin, the immunosuppressant cyclosporine, or the anticancer drug octreotide (Driggers et al. (2008), Nat. Rev. Drug. Discov. 7(7), 608-24), have already been successfully used in the clinic. The good binding properties are brought about by the relatively large interaction surface formed between the peptide and the target, as well as the reduced conformational flexibility of the cyclic structure. Typically, macrocycles bind surfaces of several hundred square angstroms, such as the cyclic peptide CXCR4 antagonist CVX15 (400 Å; Wu et al. (2007), Science 330, 1066-71), a cyclic peptide with an Arg-Gly-Asp motif that binds to integrin αVb3 (355 Å) (Xiong et al. (2002), Science 296(5565), 151-5), or the cyclic peptide inhibitor upain-1 that binds to urokinase-type plasminogen activator (603 Å; Zhao et al. (2007), J. Struct. Biol. 160(1), 1-10).
[0006] Due to their cyclic configuration, peptide macrocycles are less flexible than linear peptides, resulting in less entropy loss upon binding to targets and higher binding affinity. The reduced flexibility results in a fixed target-specific conformation, resulting in higher binding specificity compared to linear peptides. This effect is exemplified by a potent and selective inhibitor of matrix metalloproteinase 8 (MMP-8), which lost selectivity against other MMPs when its ring was opened (Cherney et al. (1998), J. Med. Chem. 41(11), 1749-51). The favorable binding properties achieved by macrocyclization are even more pronounced in polycyclic peptides with two or more peptide rings, such as vancomycin, nisin, and actinomycin.
[0007] Different research teams have already linked polypeptides with cysteine residues to synthetic molecular structures (Kemp and McNamara (1985), J. Org. Chem; Timmerman et al. (2005), ChemBioChem). Meloen et al. used tris(bromomethyl)benzene and related molecules to rapidly and quantitatively cyclize multiple peptide loops onto synthetic scaffolds for structural mimicry of protein surfaces (Timmerman et al. (2005), ChemBioChem). A method for generating candidate drug compounds, in which the compounds are generated by coupling cysteine-containing polypeptides to molecular scaffolds such as 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA) (Heinis et al. (2014) Angewandte Chemie, International Edition 53(6)1602-1606).
[0008] A phage display-based combinatorial approach has been developed to generate and screen large libraries of bicyclic peptides against targets of interest (Heinis et al. (2009), Nat. Chem. Biol. 5(7), 502-7, and WO2009 / 098450). Briefly, a combinatorial library of linear peptides containing three cysteine residues and two regions of six random amino acids (Cys-(Xaa)6-Cys-(Xaa)6-Cys) was displayed on phage and cyclized by covalently linking the cysteine side chains to a small molecule scaffold. Summary of the Invention
[0009] The embodiments provided herein are directed to an oligomeric compound, which comprises an oligonucleotide and a conjugate group. In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group comprises a conjugate linker that connects the cell targeting moiety to the oligonucleotide. In certain embodiments, the cell targeting moiety comprises or consists of a polypeptide comprising two polypeptide loops attached to a molecular scaffold. In certain embodiments, the cell targeting moiety comprises or consists of a bicyclic ligand. In certain embodiments, the conjugate linker connects the oligonucleotide to the polypeptide. In general, the conjugate linker has a length and / or structure sufficient to separate the oligonucleotide and the bicyclic ligand (e.g., binding to the transferrin receptor) such that the bicyclic ligand does not inhibit the activity of the oligonucleotide (e.g., antisense activity) and the oligonucleotide does not inhibit the activity of the bicyclic ligand (e.g., binding to the transferrin receptor). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0010] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" are not limiting.
[0011] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited herein, including but not limited to patents, patent applications, articles, books, papers, and GenBank, NCBI, and ENSEMBL reference sequence records, are expressly incorporated herein by reference in their entirety as well as with respect to the portions of the documents discussed herein.
[0012] It is understood that the sequence shown in each SEQ ID NO of the oligonucleotides in the examples contained herein is independent of any modifications to the sugar moiety, internucleoside linkage, or nucleobase. Thus, an oligonucleotide defined by a SEQ ID NO can independently contain one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase.
[0013] Throughout this specification, it is understood that the first letter of a peptide sequence is the first amino acid of the peptide at the N-terminus, unless otherwise indicated, and the last letter of a peptide sequence is the last amino acid of the peptide at the C-terminus.
[0014] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, organic synthesis, and medicinal and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0015] Unless otherwise stated, the following terms have the following meanings. As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).
[0016] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.
[0017] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.
[0018] As used herein, "2'-OMe" means a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" means a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.
[0019] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.
[0020] As used herein, "2'-F" refers to a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-fluoro sugar moiety" or "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D-ribosyl configuration.
[0021] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F sugar moiety.
[0022] As used herein, "2'-NMA" refers to a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the ribosyl sugar moiety. A "2'-NMA sugar moiety" is a sugar moiety having a 2'-O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise indicated, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" refers to ON-methylacetamide.
[0023] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.
[0024] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to the sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent group other than H or OH.
[0025] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.
[0026] As used herein, "administering" means providing an oligomeric agent or pharmaceutical composition to a subject.
[0027] As used herein, an "aliphatic amino acid" is an amino acid having a side chain consisting of H and C. Aliphatic amino acids include, but are not limited to, glycine, alanine, leucine, isoleucine, valine, beta-alanine, 2-aminoisobutyric acid.
[0028] As used herein, an "amino acid" is a compound or monomeric subunit of a polypeptide having an amino group, a carboxylic acid group, and at least one carbon covalently bonded between the amino group and the carboxylic acid group, including an optional side chain. An "α-amino acid" contains exactly one carbon between the amino group, with optional side chain, and the carboxylic acid group. A "β-amino acid" contains exactly two optionally substituted carbons between the amino group and the carboxylic acid group.
[0029] As used herein, an "amino acid mimetic" is a compound or monomeric subunit of a peptidomimetic having an amino group surrogate, a carboxylic acid group surrogate, and at least one carbon covalently bonded between the amino group surrogate and the carboxylic acid group surrogate, including an optional side chain.
[0030] As used herein, an "aromatic amino acid" is an amino acid that has an aromatic ring in its side chain. Aromatic amino acids include, but are not limited to, phenylalanine, tyrosine, and tryptophan.
[0031] As used herein, "bicyclic ligand" refers to a ligand that comprises a polypeptide or peptidomimetic that is covalently attached to a molecular scaffold at three distinct sites, forming two polypeptide loops. Typically, such peptides or peptidomimetics include polypeptides having natural or unnatural amino acids or amino acid mimetics that include a first, second, and third amino acid that contain reactive groups that form covalent bonds to the scaffold. In certain embodiments, the peptide or peptidomimetic has at least three cysteine residues (referred to herein as C) that are reactive groups. i , C ii and Ciii As used herein, "loop polypeptide" refers to the portion of a bicyclic ligand that forms two polypeptide loops, including reactive groups, but excluding any N-terminal or C-terminal extensions. As used herein, "loop sequence" refers to the amino acid or amino acid mimetic between the reactive groups.
[0032] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0033] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.
[0034] "Cell targeting moiety" refers to a conjugate group or a portion of a conjugate group that can bind to a specific cell type(s). In certain embodiments, the cell targeting moiety can bind to a cell surface receptor or cell surface moiety. In certain embodiments, the cell targeting moiety can be internalized when interacting with or binding to a cell surface receptor or cell surface moiety. In certain embodiments, the cell targeting moiety comprises a bicyclic polypeptide or a bicyclic ligand. In certain embodiments, the cell targeting moiety consists of a bicyclic polypeptide or a bicyclic ligand.
[0035] As used herein, "cell surface moiety" refers to a moiety that is present on the surface of a cell and is capable of interacting with substances external to the cell. In certain embodiments, a portion of the cell surface moiety is integral to the cell membrane of the cell. Non-limiting examples of cell surface moieties are lipids, proteins, and carbohydrates. In certain embodiments, the cell surface moiety is a cell surface receptor. In certain embodiments, the cell surface receptor is the transferrin receptor.
[0036] As used herein, "cell surface receptor" refers to a protein receptor expressed on the surface of a cell that is capable of interacting with a corresponding ligand. The ligand can be endogenous or exogenous. In certain embodiments, the cell surface receptor is the transferrin receptor.
[0037] As used herein, a "charged amino acid" is an amino acid having a side chain that contains a positive or negative charge in solution at pH=7.0. A "basic amino acid" has a side chain that contains a positive charge when in solution at pH=7.0. Basic amino acids include, but are not limited to, lysine, arginine, and ornithine. An "acidic amino acid" has a side chain that contains a negative charge when in solution at pH=7.0. Acidic amino acids include, but are not limited to, glutamic acid and aspartic acid.
[0038] As used herein, "chirally enriched population" refers to a plurality of molecules having the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are oligomeric compounds disclosed herein. In certain embodiments, the oligomeric compounds are antisense compounds. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that include modified oligonucleotides.
[0039] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, e.g., within a cell or human.
[0040] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid, or at least one region thereof, can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. "Complementary region" in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of the region and the nucleobases of another nucleic acid, or at least one region thereof, can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art and are not considered as complementary nucleobases as defined herein unless otherwise indicated.For example, inosine can pair with adenosine, cytosine, or uracil, but is not considered to be complementary.Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed.As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide means that an oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
[0041] As used herein, "conjugate group" refers to an atomic group that is directly attached to an oligonucleotide. In certain embodiments, the conjugate group comprises a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate group comprises a bicyclic ligand.
[0042] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate group to an oligonucleotide.
[0043] As used herein, "conjugate moiety" refers to an atomic group that is attached to an oligonucleotide via a conjugate linker. In certain embodiments, the conjugate moiety comprises a cell targeting moiety. In certain embodiments, the cell targeting moiety comprises or consists of a bicyclic ligand. In certain embodiments, the cell targeting moiety comprises or consists of a bicyclic polypeptide.
[0044] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.
[0045] As used herein, a "cyclic amino acid" is an amino acid whose side chain is attached to a backbone amide to form a ring structure. "Cyclic amino acids" include, but are not limited to, proline or hydroxyproline.
[0046] As used herein, "gapmer" refers to a modified oligonucleotide having an internal region having multiple nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, the nucleosides comprising the internal region being chemically distinct from the nucleoside(s) comprising the external region. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing." Unless otherwise indicated, "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2'-β-D-deoxyribosyl sugar moiety. Thus, by way of example, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. Unless otherwise indicated, MOE gapmers may include one or more modified internucleoside linkages and / or modified nucleobases, and such modified moieties do not necessarily follow a gapmer pattern of modified sugar moieties.
[0047] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.
[0048] As used herein, "identical" or "percent identical" with respect to amino acid sequences means the percentage of amino acids that are identical between two amino acid sequences when the amino acid sequences are aligned for maximum similarity. "Identical" means that each atom of the amino acid is the same, i.e., amino acids that have substitutions or modifications are not counted as "identical" amino acids.
[0049] As used herein, the term "internucleoside bond" refers to a covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond.A "phosphorothioate internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.
[0050] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.
[0051] As used herein, "N-terminal modification" or "C-terminal modification" means a terminal non-peptide chemical modification to the bicyclic ligand on either side of a polypeptide, such as acylation or amidation, that does not become part of the conjugate linker.
[0052] As used herein, "N-terminal extension" or "C-terminal extension" refers to a non-peptide chemical modification to a bicyclic ligand on either side of the polypeptide between the polypeptide terminus of the bicyclic ligand and a functional group that becomes part of the conjugate linker upon conjugation to an oligonucleotide.
[0053] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or a target nucleic acid when the first and second oligonucleotides are aligned.
[0054] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0055] As used herein, "natural amino acid" means Gly or the L-isomer of each of the following: Ala, Arg, Asn, Asp, Cys, Gln, Glu, His, Ile, Lys, Leu, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val.
[0056] As used herein, a "neutral amino acid" is an amino acid having a side chain that does not contain a positive or negative charge in a solution at pH=7.0. Neutral amino acids include, but are not limited to, glycine, alanine, leucine, isoleucine, valine, serine, cysteine, methionine, proline, threonine, tyrosine, phenylalanine, tryptophan, β-alanine, and 2-aminoisobutyric acid.
[0057] As used herein, "unnatural amino acid" means any amino acid other than the standard 20 amino acids encoded by the human genetic code, including the D-isomers of each of the following: Ala, Arg, Asn, Asp, Cys, Gln, Glu, His, Ile, Lys, Leu, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val.
[0058] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases.
[0059] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.
[0060] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.
[0061] As used herein, "molecular scaffold" means a chemical group that forms a covalent bond with a reactive group of a polypeptide to form at least two polypeptide loops linked by the molecular scaffold. In certain embodiments, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA). In certain embodiments, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(2-bromoethanone) (TATB).
[0062] As used herein, "oligomeric agent" refers to an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.
[0063] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.
[0064] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.
[0065] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, where each nucleoside and internucleoside linkage may be independently modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.
[0066] As used herein, "polypeptide" or "peptide" refers to a compound or fragment of a compound consisting of three or more amino acids linked together through amide bonds. Unless otherwise specified, a polypeptide consists of 3 to 50 amino acids.
[0067] As used herein, "peptidomimetic" means a compound or fragment of a compound that consists of three or more amino acids or amino acid mimetics linked together, where at least two of the subunits are linked by a bond that is not an amide bond. Unless otherwise indicated, a peptidomimetic consists of between 3 and 50 amino acids or amino acid mimetics.
[0068] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to a subject. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, distilled water for injection, sterile physiological saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0069] As used herein, "pharmaceutically acceptable salt(s)" refers to physiologically and pharma- ceutically acceptable salt(s) of an oligomeric compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.
[0070] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.
[0071] As used herein, "prodrug" refers to a therapeutic agent that is in a first form outside the body that is converted to a second form within the subject or cells thereof. Typically, the conversion of the prodrug in the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.
[0072] As used herein, "reactive group" refers to an atom or group of atoms of an amino acid that can form a bond with another compound (e.g., another amino acid or another atom or group of atoms of another compound). In certain embodiments, the reactive group is the sulfur atom of a cysteine amino acid.
[0073] As used herein with respect to oligonucleotides, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.
[0074] As used herein, "side chain" has its normal meaning in the art and refers to the substructure of an amino acid that is not attached to the amino or carboxylic acid group of the amino acid, e.g., to the alpha or beta carbon of the amino acid.
[0075] As used herein, "stabilizing phosphate group" refers to a 5' phosphate moiety that provides stabilization of the 5' phosphate moiety of the 5' terminal nucleoside of an oligonucleotide, compared to the stability of the unmodified 5' phosphate of the unmodified nucleoside under biological conditions. Such stabilization of the 5' phosphate group includes, but is not limited to, resistance to removal by phosphatases. Stabilizing phosphate groups include, but are not limited to, 5'-vinyl phosphonate and 5'-cyclopropyl phosphonate.
[0076] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules that have the stereorandom chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereorandom chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0077] As used herein, "standard cellular assay" refers to the assay(s) described in the Examples and reasonable variations thereof.
[0078] As used herein, a "subject" refers to a human or a non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0079] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0080] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be conjugated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.
[0081] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.
[0082] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0083] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to the end of an oligonucleotide.
[0084] As used herein, "transferrin receptor," "TfR1," and "CD71" refer to mammalian transferrin receptor type 1. "Human transferrin receptor" and "human TfR1" refer to the protein encoded by the gene represented by ENSEMBL ID ENSG00000072274 and / or GenBank Gene ID 7037. "Mouse transferrin receptor" and "mouse TfR1" refer to the protein encoded by the gene represented by ENSEMBL ID ENSMUSG00000022797 and / or GenBank Gene ID 22042.
[0085] As used herein, "antisense activity" refers to any detectable and / or measurable change that can be attributed to the hybridization of an antisense compound to its target nucleic acid.In certain embodiments, antisense activity is the reduction of the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound.In certain embodiments, antisense activity is the regulation of splicing of target pre-mRNA.
[0086] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.
[0087] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0088] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0089] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of an antisense compound that can hybridize to a target nucleic acid and has at least one antisense activity.Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNaseH oligonucleotides.
[0090] As used herein, "sense oligonucleotide" means an oligonucleotide that contains an oligonucleotide portion of a sense compound that is capable of hybridizing to an antisense oligonucleotide.
[0091] As used herein, "RNAi agent" refers to an antisense compound that acts, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNaseH.
[0092] As used herein, "RNaseH agent" refers to an antisense agent that acts via RNaseH to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNaseH agent is single-stranded. In certain embodiments, the RNaseH agent is double-stranded. The RNaseH agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNaseH agent modulates the amount and / or activity of a target nucleic acid. The term RNaseH agent excludes antisense agents that act primarily via RISC / Ago2.
[0093] As used herein, "splice modulating agent" means an antisense agent that acts, at least in part, by modulating the splicing of a target nucleic acid. "Splice modulating" agents include "splice modulating oligonucleotides."
[0094] As used herein, "steric blocker" means an antisense agent that acts, at least in part, by binding directly to a target nucleic acid, thus blocking the interaction of the target nucleic acid with other nucleic acids or proteins.
[0095] As used herein, "treating" means alleviating a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject alleviates symptoms for the same condition in the absence of treatment. In certain embodiments, treating reduces the severity or frequency of a symptom, or delays the onset of a symptom, delays the progression of a symptom, or delays the severity or frequency of a symptom.
[0096] As used herein, a "therapeutically effective amount" refers to an amount of an oligomeric agent or pharmaceutical composition that provides a therapeutic effect to a subject. For example, a therapeutically effective amount ameliorates a symptom of a disease.
[0097] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:
[0098] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 10 to 300 linked nucleosides and the conjugate group comprises a bicyclic ligand and a conjugate linker; the bicyclic ligand comprises a polypeptide consisting of 13-22 linked amino acids or amino acid mimetics, and a molecular scaffold; each of the first, second, and third amino acids of the polypeptide comprises a reactive group, each of which separately forms a bond with the molecular scaffold, thereby forming two polypeptide loops attached to the molecular scaffold; a portion of the bicyclic ligand binds to the type 1 transferrin receptor; An oligomeric compound in which a modified oligonucleotide is covalently attached to a bicyclic ligand via a conjugate linker.
[0099] Embodiment 2. The oligomeric compound of embodiment 1, wherein the conjugate group consists of a bicyclic ligand and a conjugate linker.
[0100] Embodiment 3. An oligomeric compound according to embodiment 1 or 2, wherein the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
[0101] Embodiment 4. The oligomeric compound according to any one of embodiments 1 to 3, wherein the three reactive groups are each a thiol of a cysteine.
[0102] Embodiment 5. The polypeptide has, from N-terminus to C-terminus, the following formula: [B] n -[Z i ]-[J] m -[Z ii ]-[O] o -[Z iii ]-[U] p wherein Z i , Z ii , and Z iii are the first, second, and third amino acids that contain a reactive group; each B, J, O, and U is independently a selected amino acid or amino acid mimetic; n is 0 to 5; m is 3 to 7; o is 3 to 7; p is 0 to 5; The oligomeric compound according to any one of embodiments 1 to 4, wherein the sum of m+o is less than 12.
[0103] Embodiment 6. The oligomeric compound according to embodiment 5, wherein m is 7 and o is 3.
[0104] Embodiment 7. The oligomeric compound according to embodiment 5, wherein m is 2 and o is 9.
[0105] Embodiment 8. The oligomeric compound according to embodiment 5, wherein m and o are both 6.
[0106] Embodiment 9. The oligomeric compound according to embodiment 5, wherein m is 3 and o is 8.
[0107] Embodiment 10. The oligomeric compound according to any one of embodiments 5 to 9, wherein n is 0.
[0108] Embodiment 11. The oligomeric compound according to any one of embodiments 5 to 9, wherein n is 3 or 4.
[0109] Embodiment 12. The oligomeric compound according to any one of embodiments 5 to 11, wherein p is 0.
[0110] Embodiment 13. The oligomeric compound according to any one of embodiments 5 to 11, wherein p is 3 or 4.
[0111] Embodiment 14. The oligomeric compound according to any one of embodiments 1 to 13, wherein the polypeptide has an N-terminal modification.
[0112] Embodiment 15 The oligomeric compound according to embodiment 14, wherein the N-terminal modification is an acetyl group.
[0113] Embodiment 16 The oligomeric compound according to embodiment 14, wherein the N-terminal modification is an azidopropyl group.
[0114] Embodiment 17. The oligomeric compound according to any one of embodiments 1 to 13, wherein the polypeptide has a C-terminal modification.
[0115] Embodiment 18 The oligomeric compound according to embodiment 14, wherein the C-terminal modification is an amide group.
[0116] Embodiment 19. The oligomeric compound according to any one of embodiments 1 to 18, wherein the conjugate linker is attached to the N-terminal amino acid of the bicyclic ligand.
[0117] Embodiment 20. The oligomeric compound according to any one of embodiments 1 to 19, wherein the conjugate linker is attached to the C-terminal amino acid of the bicyclic ligand.
[0118] Embodiment 21. The oligomeric compound according to any one of embodiments 1 to 20, wherein the conjugate linker is attached to the side chain of an amino acid within one of the polypeptide loops of the bicyclic ligand.
[0119] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 21, wherein the bicyclic ligand comprises a C-terminal extension.
[0120] Embodiment 23 The oligomeric compound according to embodiment 22, wherein the C-terminal extension is selected from PEG10 or PEG24.
[0121] Embodiment 24. The oligomeric compound according to any one of embodiments 1 to 23, wherein the bicyclic ligand comprises an N-terminal extension.
[0122] Embodiment 25. The oligomeric compound according to embodiment 24, wherein the N-terminal extension is selected from PEG10 or PEG24.
[0123] Embodiment 26. The oligomeric compound according to any one of embodiments 1 to 25, wherein the conjugate group is attached to the 5'-terminal nucleoside of the modified oligonucleotide.
[0124] Embodiment 27. The oligomeric compound according to embodiment 26, wherein the conjugate group is attached to the 5' position of the 5' terminal nucleoside of the modified oligonucleotide.
[0125] Embodiment 28. The oligomeric compound according to any one of embodiments 1 to 25, wherein the conjugate group is attached to the 3'-terminal nucleoside of the modified oligonucleotide.
[0126] Embodiment 29. The oligomeric compound according to embodiment 28, wherein the conjugate group is attached to the 3' position of the 3' terminal nucleoside of the modified oligonucleotide.
[0127] Embodiment 30. The oligomeric compound according to any one of embodiments 1 to 25, wherein the conjugate group is attached to an internal nucleoside of the modified oligonucleotide.
[0128] Embodiment 31. The oligomeric compound according to any one of embodiments 1 to 25, wherein the conjugate group is attached via a modified internucleoside linkage.
[0129] Embodiment 32. The oligomeric compound according to any one of embodiments 28 to 30, wherein the conjugate group is attached via a 2'-modified furanosyl sugar moiety.
[0130] Embodiment 33. The oligomeric compound according to any one of embodiments 1 to 32, wherein the bicyclic ligand has an amino acid sequence having at least 80% identity to any of SEQ ID NOs: 26-27, 36-56, 58-65, 67-76, 79-88, 90-152, or 192-246.
[0131] Embodiment 34. The oligomeric compound of embodiment 33, wherein the bicyclic ligand has an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity to any of SEQ ID NOs: 26-27, 36-56, 58-65, 67-76, 79-88, 90-152, or 192-246.
[0132] Embodiment 35. [Z i ]-[J] m -[Z ii ]-[O] o -[Z iii ] has an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity to any of SEQ ID NOs: 26-27, 35-56, 58-65, 67-76, 79-88, 90-152, or 192-246.
[0133] Embodiment 36. [Z i ]-[J] m -[Z ii ]-[O] o -[Z iii 36. The oligomeric compound of any one of embodiments 5-35, wherein:
[0134] Embodiment 37. The oligomeric compound according to any one of embodiments 1 to 36, wherein the bicyclic ligand comprises at least one, at least two, or at least three unnatural amino acids.
[0135] Embodiment 38. The oligomeric compound according to embodiment 37, wherein the at least one unnatural amino acid is selected from D-amino acids, allo-isoleucine, 2-amino-3-ethyl-pentanoic acid, aminoisobutyric acid, aminobutyric acid, azetidine, 7-azatryptophan, 6-azidolysine, β-cyclobutylalanine, β-methylisoleucine, 4,4-biphenylalanine, cis-hydroxyproline, cyclobutylglycine, cyclohexylglycine, cyclopentylalanine, cyclopentylglycine, 2,6-dimethyltyrosine, 3,3-diphenylalanine, 4-hydroxy-L-proline, 1-napthaylalanine, 2-naphthylalanine, N-methylalanine, 1-methylhistidine, 3-methylhistidine, N-methyl-tryptophan, pipecolic acid, 4-pyridylalanine, sarcosine, t-butylalanine, or 3-t-butyltyrosine.
[0136] Embodiment 39. The oligomeric compound according to embodiment 38, wherein the at least one unnatural amino acid is selected from 4-trans-hydroxy-L-proline, 6-azidolysine, and t-butylglycine.
[0137] Embodiment 40. The oligomeric compound according to any one of embodiments 1 to 39, wherein the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA).
[0138] Embodiment 41. The oligomeric compound according to any one of embodiments 1 to 39, wherein the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(2-bromoethanone) (TATB).
[0139] Embodiment 42. The oligomeric compound of any one of embodiments 1 to 41, wherein the bicyclic ligand does not inhibit binding of transferrin to the transferrin receptor.
[0140] Embodiment 43. The oligomeric compound according to any one of embodiments 1 to 42, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
[0141] Embodiment 44 The oligomeric compound of embodiment 43, wherein at least one modified sugar moiety comprises a bicyclic sugar moiety.
[0142] Embodiment 45. The oligomeric compound according to embodiment 44, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.
[0143] Embodiment 46 The oligomeric compound according to any one of embodiments 43 to 45, wherein at least one modified sugar moiety comprises a non-bicyclic modified sugar moiety.
[0144] Embodiment 47 The oligomeric compound of embodiment 46, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0145] Embodiment 48. The oligomeric compound according to any one of embodiments 43 to 47, wherein at least one nucleoside of the modified oligonucleotide compound comprises a sugar surrogate.
[0146] Embodiment 49. The oligomeric compound according to any one of embodiments 1 to 48, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
[0147] Embodiment 50. The oligomeric compound according to embodiment 49, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0148] Embodiment 51. The oligomeric compound according to embodiment 49 or 50, wherein each internucleoside linkage is a modified internucleoside linkage.
[0149] Embodiment 52 The oligomeric compound according to embodiment 51, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
[0150] Embodiment 53. The oligomeric compound according to any one of embodiments 1 to 50, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0151] Embodiment 54. The oligomeric compound according to any one of embodiments 1 to 50 or 53, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0152] Embodiment 55. The oligomeric compound according to embodiment 49, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.
[0153] Embodiment 56. The oligomeric compound according to any one of embodiments 49 to 55, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.
[0154] Embodiment 57. The oligomeric compound according to any one of embodiments 49 to 55, wherein each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage or a mesyl phosphoramidate internucleoside linkage.
[0155] Embodiment 58. The oligomeric compound according to any one of embodiments 1 to 57, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0156] Embodiment 59. The oligomeric compound according to embodiment 58, wherein the modified nucleobase is 5-methylcytosine.
[0157] Embodiment 60. The oligomeric compound according to any one of embodiments 1 to 59, wherein the modified oligonucleotide comprises a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides.
[0158] Embodiment 61 The oligomeric compound according to embodiment 60, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.
[0159] Embodiment 62. The oligomeric compound according to embodiment 60 or 61, wherein the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides.
[0160] Embodiment 63 The oligomeric compound according to any one of embodiments 60 to 62, wherein each nucleoside immediately adjacent to the deoxy region contains a modified sugar moiety.
[0161] Embodiment 64. A deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and adjacent on the 3' side to a 3' region consisting of 1 to 6 linked 3' region nucleosides; the 3'-most nucleoside of the 5' region comprises a modified sugar moiety; The oligomeric compound according to any one of embodiments 60 to 63, wherein the 5'-most nucleoside of the 3' region comprises a modified sugar moiety.
[0162] Embodiment 65. The oligomeric compound according to embodiment 64, wherein each nucleoside of the 3' region comprises a modified sugar moiety.
[0163] Embodiment 66. The oligomeric compound according to embodiment 64 or 65, wherein each nucleoside of the 5' region comprises a modified sugar moiety.
[0164] Embodiment 67. The modified oligonucleotide has a sugar motif, the sugar motif being: a 5' region consisting of 1 to 6 linked 5' region nucleosides; an internal region consisting of 6 to 10 linked internal region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; The oligomeric compound of any one of embodiments 1-66, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the internal region nucleosides is selected from a 2'-deoxynucleoside and a 2'-substituted nucleoside.
[0165] Embodiment 68. The modified oligonucleotide has a sugar motif, the sugar motif being: a 5' region consisting of 1 to 6 linked 5' region nucleosides; an internal region consisting of 6 to 10 linked internal region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; The oligomeric compound of embodiment 67, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a cEt nucleoside or a 2'-MOE nucleoside and each of the internal region nucleosides is a 2'-β-D-deoxynucleoside.
[0166] Embodiment 69. The oligomeric compound according to any one of embodiments 1 to 59, wherein each nucleoside of the modified oligonucleotide comprises a 2'-sugar moiety.
[0167] Embodiment 70. The oligomeric compound according to embodiment 69, wherein each 2'-sugar moiety is selected from 2'-OMe, 2'-MOE, or 2'-NMA.
[0168] Embodiment 71. The oligomeric compound according to embodiment 69 or 70, wherein each nucleoside of the modified oligonucleotide comprises the same 2'-sugar moiety.
[0169] Embodiment 72. The oligomeric compound according to any one of embodiments 1 to 71, wherein the conjugate linker is cleavable.
[0170] Embodiment 73. The oligomeric compound according to any one of embodiments 1 to 72, wherein the conjugate linker comprises 1 to 3 linker nucleosides.
[0171] Embodiment 74. The oligomeric compound according to any one of embodiments 1 to 72, wherein the conjugate linker does not comprise any linker nucleosides.
[0172] Embodiment 75. The oligomeric compound according to any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0173] Embodiment 76. The oligomeric compound according to any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0174] Embodiment 77. The oligomeric compound according to any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0175] Embodiment 78. The conjugate group is [ka] and optionally [ka] 75. The oligomeric compound according to any one of embodiments 1 to 74, comprising:
[0176] Embodiment 79. The oligomeric compound according to any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0177] Embodiment 80. The oligomeric compound of any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0178] Embodiment 81. The oligomeric compound of any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0179] Embodiment 82. The oligomeric compound according to any one of embodiments 1 to 74, wherein the conjugate group comprises: [ka]
[0180] Embodiment 83. The oligomeric compound according to any one of embodiments 1 to 82, wherein the modified oligonucleotide is complementary to a target nucleic acid expressed in muscle.
[0181] Embodiment 84. The oligomeric compound according to any one of embodiments 1 to 83, wherein the modified oligonucleotide is capable of reducing the amount of a target nucleic acid by activating RnaseH.
[0182] Embodiment 85. The oligomeric compound according to any one of embodiments 1 to 83, wherein the modified oligonucleotide is capable of reducing the amount of a target nucleic acid by activation of RISC / Ago2.
[0183] Embodiment 86. The oligomeric compound according to any one of embodiments 1 to 83, wherein the modified oligonucleotide is capable of modulating the splicing of a target nucleic acid.
[0184] Embodiment 87. The oligomeric compound according to any one of embodiments 1 to 83, wherein the modified oligonucleotide is a guide RNA, a tracrRNA, or a scout RNA.
[0185] Embodiment 88. The oligomeric compound according to any one of embodiments 1 to 87, wherein the modified oligonucleotide is complementary to the complement of a target nucleic acid expressed in muscle.
[0186] Embodiment 89. The oligomeric compound according to any one of embodiments 83 to 88, wherein the target nucleic acid is associated with a muscle disease.
[0187] Embodiment 90. The oligomeric compound according to any one of embodiments 83 to 89, wherein the target nucleic acid is selected from CaMK2d, NLRP3, PLN, DMD, DMPK, DNM2, DUX4, or HPRT.
[0188] Embodiment 91. The oligomeric compound according to any one of embodiments 83 to 90, wherein the muscle target nucleic acid has a sequence selected from any of SEQ ID NOs: 1 to 15.
[0189] Embodiment 92. The oligomeric compound according to any one of embodiments 83 to 91, wherein the target nucleic acid is expressed in at least one of the following tissues: skeletal muscle (including but not limited to quadriceps, gastrocnemius, tibialis anterior, triceps, masseter, extensor digitorum longus (EDL), soleus, diaphragm), heart, sciatic nerve, aorta, or liver.
[0190] Embodiment 93. The oligomeric compound according to any one of embodiments 1 to 92, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 167 to 191.
[0191] Embodiment 94. The modified oligonucleotide is selected from the group consisting of 10-25, 10-30, 12-20, 12-25, 12-30, 13-20, 13-25, 13-30, 14-20, 14-25, 14-30, 15-20, 15-25, 15-30, 16-18, 16-20, 16-25, 16-30, 17-20, 17-25, 17-30, 18-20, 18-25, 18-30, 19 94. The oligomeric compound according to any one of embodiments 1 to 93, consisting of from 20, 19 to 25, 19 to 30, 20 to 25, 20 to 30, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 23 to 25, 23 to 30, 20 to 100, 40 to 100, 50 to 100, 50 to 200, 100 to 300, 150 to 300, or 200 to 300 linked nucleosides.
[0192] Embodiment 95. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second compound oligomer comprising a second modified oligonucleotide consisting of 16 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide, and the second oligomeric compound is an oligomeric compound according to any one of embodiments 1 to 86 or 89 to 94.
[0193] Embodiment 96 The oligomeric duplex of embodiment 95, wherein the first modified oligonucleotide is complementary to a target nucleic acid in muscle.
[0194] Embodiment 97. The oligomeric duplex of embodiment 96, wherein the duplex is capable of reducing the amount of target nucleic acid by activation of RISC / Ago2.
[0195] Embodiment 98. The oligomeric duplex of any one of embodiments 95 to 97, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.
[0196] Embodiment 99 The oligomeric duplex of embodiment 98, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.
[0197] Embodiment 100. The oligomeric duplex of embodiment 99, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.
[0198] Embodiment 101 The oligomeric duplex of embodiment 100, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
[0199] Embodiment 102 The oligomeric duplex of embodiment 101, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.
[0200] Embodiment 103. The oligomeric duplex of any one of embodiments 95 to 102, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.
[0201] Embodiment 104. The oligomeric duplex according to any one of embodiments 95 to 102, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.
[0202] Embodiment 105. The oligomeric duplex of embodiment 104, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.
[0203] Embodiment 106. The oligomeric duplex according to any one of embodiments 95 to 105, wherein at least one internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage.
[0204] Embodiment 107. The oligomeric duplex of any one of embodiments 95 to 104 or 106, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0205] Embodiment 108. The oligomeric duplex of any one of embodiments 95 to 107, wherein the second modified oligonucleotide comprises at least one modified nucleobase.
[0206] Embodiment 109. The oligomeric duplex of embodiment 108, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.
[0207] Embodiment 110. The oligomeric duplex of any one of embodiments 95 to 109, wherein the first oligomeric compound comprises a 5' stabilizing phosphate group.
[0208] Embodiment 111 The oligomeric duplex of any one of embodiments 95 to 109, wherein the second oligomeric compound comprises a 5' stabilizing phosphate group.
[0209] Embodiment 112 The oligomeric duplex of embodiment 110 or 111, wherein the stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate.
[0210] Embodiment 113 The oligomeric duplex of any one of embodiments 95 to 112, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.
[0211] Embodiment 114 The oligomeric duplex of any one of embodiments 95 to 113, wherein the first modified oligonucleotide comprises a 2'-NMA sugar moiety.
[0212] Embodiment 115. The oligomeric duplex of any one of embodiments 95 to 114, wherein the second modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.
[0213] Embodiment 116 The oligomeric duplex of any one of embodiments 95 to 115, wherein the second modified oligonucleotide compound comprises a 2'-NMA sugar moiety.
[0214] Embodiment 117. A method for modulating a nucleic acid target in a subject, comprising administering to the subject an oligomeric compound described in any one of embodiments 1 to 94 or an oligomeric duplex described in any one of embodiments 95 to 116.
[0215] Embodiment 118. The method of embodiment 117, wherein the nucleic acid target is expressed in at least one of the following tissues: skeletal muscle (including but not limited to quadriceps, gastrocnemius, tibialis anterior, triceps, masseter, extensor digitorum longus (EDL), soleus, diaphragm), heart, sciatic nerve, aorta, or liver.
[0216] Embodiment 119. The method according to embodiment 117 or 118, wherein administration of the oligomeric compound according to any one of embodiments 1 to 94 or the oligomeric duplex according to any one of embodiments 95 to 116 results in a reduction of the nucleic acid target.
[0217] Embodiment 120. The method according to embodiment 117 or 118, wherein administration of the oligomeric compound according to any one of embodiments 1 to 94 or the oligomeric duplex according to any one of embodiments 95 to 116 results in altered splicing of the nucleic acid target.
[0218] Embodiment 121. The method of any one of embodiments 117 to 120, wherein the oligomeric compound or oligomeric duplex is administered by intravenous or subcutaneous administration.
[0219] Embodiment 122. The oligomeric compound or oligomeric duplex is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, 350 mg, 360 mg, 370 mg, 380 mg, 390 mg, 400 mg, 410 mg, 420 mg, 430 mg, 440 mg, 450 mg, 460 mg, 470 mg, 480 mg, 490 mg, 500 mg, 510 mg, 520 mg, 530 mg, 540 mg, 550 mg, 550 mg, 560 mg, 570 mg, 580 mg, 590 mg, 600 mg, 610 mg, 620 mg, 630 mg, 640 mg The method of any one of embodiments 117-120, wherein the compound is administered at a dose of 0 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, or 350 mg.
[0220] Embodiment 123. The method of any one of embodiments 117-122 comprising administering the oligomeric compound or oligomeric duplex once every 4 weeks, once every 6 weeks, once every 8 weeks, once every 12 weeks, once every 16 weeks, once every 20 weeks, once every 24 weeks, once every 6 months, or once a year.
[0221] Embodiment 124. A bicyclic ligand specific for transferrin receptor 1 (TfR1), comprising an amino acid sequence selected from CP[HyP]DAYLGC[tBuGly]SYCEPWK (SEQ ID NO: 245, referred to herein as BCY21757) and CP[HyP]DAYLGC[tBuGly]SYCEPWC (SEQ ID NO: 246, referred to herein as BCY21758), where HyP represents trans-4-hydroxy-L-proline and tBuGly represents t-butyl-glycine.
[0222] Embodiment 125. A bicyclic ligand according to embodiment 124 comprising an N-terminal acetyl group and a C-terminal CONH2 group.
[0223] Embodiment 126. A bicyclic ligand according to embodiment 124 or 125, which is a pharma- ceutically acceptable salt.
[0224] Embodiment 127. A pharmaceutical salt according to embodiment 126, wherein the pharma- ceutically acceptable salt is selected from a sodium salt, a potassium salt, a calcium salt, or an ammonium salt.
[0225] Embodiment 128. The bicyclic ligand of embodiment 124, wherein the first, second, and third cysteine residues in the peptide ligand are covalently linked to the molecular scaffold such that two polypeptide loops are formed on the molecular scaffold.
[0226] Embodiment 129. The bicyclic ligand according to embodiment 125, wherein the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA).
[0227] Certain compounds In certain embodiments, compounds are provided herein that include one or more oligonucleotides and one or more conjugate groups. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an unmodified oligonucleotide. In certain embodiments, the compound includes an oligonucleotide, a cell targeting moiety, and a conjugate linker. In certain embodiments, the oligomeric compound includes an oligonucleotide, a bicyclic ligand, and a conjugate linker. In certain embodiments, the oligomeric compound includes an oligonucleotide, a polypeptide, a conjugate linker, and optionally an N- or C-terminal modification to the polypeptide. In certain embodiments, the oligomeric compound includes an oligonucleotide, two or more polypeptides, a branching group, a conjugate linker, and optionally an N- or C-terminal modification to the polypeptide. In certain embodiments, the conjugate linker connects the polypeptide and / or the bicyclic ligand to the oligonucleotide.
[0228] In certain embodiments, the N-terminus of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 3'-terminus of the oligonucleotide. In certain embodiments, the C-terminus of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 3'-terminus of the oligonucleotide. In certain embodiments, an internal amino acid of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 3'-terminus of the oligonucleotide. In certain embodiments, the N-terminus of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 5'-terminus of the oligonucleotide. In certain embodiments, the C-terminus of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 5'-terminus of the oligonucleotide. In certain embodiments, an internal amino acid of the bicyclic ligand is covalently linked to a conjugate linker, and the conjugate linker is covalently linked to the 5'-terminus of the oligonucleotide. In certain embodiments, the N-terminus of the bicyclic ligand is covalently linked to the conjugate linker, and the conjugate linker is covalently linked to an internal position of the oligonucleotide. In certain embodiments, the C-terminus of the bicyclic ligand is covalently linked to the conjugate linker, and the conjugate linker is covalently linked to an internal position of the oligonucleotide. In certain embodiments, the internal amino acid of the bicyclic ligand is covalently linked to the conjugate linker, and the conjugate linker is covalently linked to an internal position of the oligonucleotide. In certain embodiments, the internal position of the oligonucleotide is the 2' position of the modified sugar moiety. In certain embodiments, the internal position of the oligonucleotide is a modified internucleoside bond.
[0229] Certain conjugate groups In certain embodiments, the conjugate moiety modifies one or more properties of the bound oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties, and clearance properties. In certain embodiments, the conjugate moiety confers new properties to the bound oligonucleotide.
[0230] In certain embodiments, the conjugate group comprises a conjugate moiety and a conjugate linker. In certain embodiments, the conjugate moiety comprises or consists of a cell targeting moiety. In certain embodiments, the cell targeting moiety can bind to a cell surface receptor or cell surface moiety. In certain embodiments, a compound comprising a cell targeting moiety can be internalized when interacting with or binding to a cell surface receptor or cell surface moiety. In certain embodiments, the cell targeting moiety comprises a bicyclic polypeptide or a bicyclic ligand. In certain embodiments, the cell targeting moiety consists of a bicyclic polypeptide or a bicyclic ligand.
[0231] In certain embodiments, the bicyclic ligand comprises a polypeptide comprising at least three reactive groups separated by at least two loop sequences, and a molecular scaffold that forms a covalent bond with the reactive groups of the polypeptide such that at least two polypeptide loops are formed on the molecular scaffold. In certain embodiments, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA). In certain embodiments, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(2-bromoethanone) (TATB). [ka]
[0232] In certain embodiments, the reactive group is cysteine. In certain embodiments, the loop sequence comprises 2, 3, 4, 5, 6, 7, 8, or 9 amino acids. In certain embodiments, the loop sequence comprises three cysteine residues separated by two loop sequences, the first cysteine residue consisting of two amino acids and the second cysteine residue consisting of nine amino acids. In certain embodiments, the loop sequence comprises three cysteine residues separated by two loop sequences, both consisting of six amino acids. In certain embodiments, the loop sequence comprises three cysteine residues separated by two loop sequences, the first loop sequence consisting of eight amino acids and the second loop sequence consisting of three amino acids. In certain embodiments, the loop sequence comprises seven cysteine residues separated by two loop sequences, the first loop sequence consisting of three amino acids and the second loop sequence consisting of three amino acids.
[0233] In certain embodiments, the bicyclic ligand comprises an amino acid sequence selected from the following: C i XXC ii XXXXXXXXXC iii , C i XXXXXXC ii XXXXXXC iii , C i XXXC ii XXXXXXXX iii or C i XXXXXXXC ii XXXC iii , In the formula, C i , C ii and C iii represent the first, second, and third cysteine residues, respectively, and each "X" represents an independently selected natural or unnatural amino acid, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the bicyclic ligand further comprises an N-terminal extension and / or a C-terminal extension.
[0234] In certain embodiments, the bicyclic ligand comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to any of the following sequences: C i SPDAHLGC ii ISYC iii (SEQ ID NO:26), C i SPDAYLGC ii ISYC iii (SEQ ID NO:27), C i P[HyP]DAYLGC ii ISYC iii (SEQ ID NO: 93), C i S[HyP]DAHLGC ii ISYC iii (SEQ ID NO: 95), C i S[Aze]DAHLGC ii ISYC iii (SEQ ID NO: 128), C i P[HyP]DAYLGC ii [tBuGly]SYC iii (SEQ ID NO: 86), C i [K(N3)]PDAHLGC ii ISYC iii (SEQ ID NO: 150), C i S[K(N3)]DAHLGC ii ISYC iii (SEQ ID NO: 151), or C i SPD[K(N3)]HLGC ii ISYC iii (SEQ ID NO: 152), C i , C ii and C iiirepresent the first, second, and third cysteines, respectively, [HyP] represents 4-trans-hydroxy-L-proline, [Aze] represents azetidine, [tBuGly] represents t-butylglycine, and [K(N3)] represents 6-azidolysine. In certain embodiments, the bicyclic ligand further comprises an N-terminal extension and / or a C-terminal extension.
[0235] In certain embodiments, the bicyclic ligand comprises the following amino acid sequence: C i XXDXXXGC ii ISYC iii (SEQ ID NO:35), wherein each X is independently selected from a natural or unnatural amino acid, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the bicyclic ligand further comprises an N-terminal extension and / or a C-terminal extension.
[0236] In certain embodiments, the oligomeric compound comprises two or more bicyclic ligands linked via a conjugate linker comprising a bivalent linker comprising a branching group. In certain embodiments, the bivalent linker comprises one or more PEG repeats. In certain embodiments, the bivalent linker is represented by the following structure: [ka]
[0237] In certain embodiments, the bicyclic ligand can interact with a cell surface receptor on a cell. In certain embodiments, the bicyclic ligand can interact with a cell surface moiety on a cell. In certain embodiments, the bicyclic ligand can bind to a cell surface receptor on a cell. In certain embodiments, the bicyclic ligand can bind to a cell surface moiety on a cell. In certain embodiments, the bicyclic ligand can be internalized by a cell when it interacts or binds to a cell surface receptor or cell surface moiety. In certain embodiments, the cell surface receptor is not ubiquitously expressed (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and the bicyclic ligand selectively delivers the oligonucleotide to a tissue or cell of interest. By way of non-limiting example, the tissue of interest may be any one of the following: brain, spinal cord, retina, heart, kidney, liver, lung, skeletal muscle, cardiac muscle, smooth muscle, adipose, white adipose, brown adipose, spleen, bone, intestine, colon, testis, breast, ovary, placenta, uterus, bladder, pancreas, pituitary gland, prostate, skin, adrenal gland, and thyroid. By way of non-limiting example, the cell of interest may be any one of the following: muscle cell, adipocyte, hepatocyte, cardiac muscle cell, vascular smooth muscle cell, endothelial cell, neuron, blood cell, macrophage, lymphocyte, cancer cell, and immune cell.
[0238] In certain embodiments, the bicyclic ligand can interact or bind with a cell surface receptor. In certain embodiments, the cell surface receptor can internalize the bicyclic ligand. In certain embodiments, the cell surface receptor can internalize an oligonucleotide connected to the bicyclic ligand via a conjugate linker. In certain embodiments, the cell surface receptor is the human transferrin receptor.
[0239] In certain embodiments, the bicyclic ligand has the formula [B] n -[Z i ]-[J] m -[Z ii ]-[O] o -[Z iii ]-[U] pwherein: Z i , Z ii , and Z iii are the first, second, and third amino acids that contain a reactive group; each B, J, O, and U is independently a selected amino acid or amino acid mimetic; n is 0 to 5; m is 3 to 7; o is 3 to 7; p is 0 to 5; The sum of m+o is less than 12.
[0240] In certain embodiments, the bicyclic ligand comprises the structure: [ka] wherein each Xaa is an independently selected amino acid side chain; each Baa is an independently selected amino acid or amino acid mimetic; n is 0 to 5; m is 3 to 7; o is 3 to 7; p is 0 to 5; The sum of m+o is less than 12.
[0241] In certain embodiments, the conjugate linker is attached via one of the N-terminus, C-terminus, or loop amino acids.
[0242] In certain embodiments, the bicyclic ligand has the formula [Z i ]-[J] m -[Z ii ]-[O] o -[Z iii In certain embodiments, the bicyclic ligand comprises the structure: [ka] wherein each Xaa is an independently selected amino acid side chain and each Baa is an independently selected amino acid or amino acid mimetic; m is 3 to 7; o is 3 to 7.
[0243] In certain embodiments, the bicyclic ligand further comprises an N-terminal and / or a C-terminal extension.
[0244] In certain embodiments, the conjugate linker is attached via one of the N-terminus, C-terminus, or loop amino acids.
[0245] In certain embodiments, the bicyclic ligand comprises or consists of a sequence selected from the following table: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] Ac represents acetyl, AzPro represents azidopropyl, Abu represents aminoisobutyric acid, Aib represents aminoisobutyric acid, Aze represents azetidine, B-MeIle represents β-methylisoleucine, C5g represents cyclopentylglycine, Cba represents β-cyclobutylalanine, Cbg represents cyclobutylglycine, Chg represents cyclohexylglycine, Cpg represents cyclopropylglycine, EPA represents 2-amino-3-ethyl-pentanediol, acid, HyP represents trans-4-hydroxy-L-proline, K(N3) represents 6-azidolysine, 1Nal represents 1-naphthylalanine, 2Nal represents 2-naphthylalanine, 4Pal represents 4-pyridylalanine, Pip represents pipecolic acid, tBuAla represents t-butylalanine, tBuGly represents t-butylglycine, 3tBuTyr represents 3-t-butyl-tyrosine, Sar represents sarcosine, and K-Fl represents 6-position of lysine. represents fluorescein bound to the N-terminus of glycine; NMeTrp represents N-methyltryptophan; dP represents D-proline; dA represents D-alanine; dW represents D-tryptophan; dS represents D-serine; dT represents D-threonine; dD represents D-aspartic acid; dN represents D-asparagine; dQ represents D-glutamine; Cis-HyP represents L-4-hydroxyproline; DOPA represents 3,4-dihydroxyphenylalanine, Gla represents L-γ-carboxyglutamic acid, HSer represents homoserine, hTyr represents homotyrosine, 3HyV represents 3-hydroxy-L-valine, Oxa represents oxazolidine-4-carboxylic acid, pCaPe represents L-4-carbamoylphenylalanine, pCoPhe represents 4-carboxy-L-phenylalanine, and K(N3)(PYA-maleimide) represents a modified lysine having the following structure: [ka]
[0246] In certain embodiments, the bicyclic ligand has the structure: [ka] or a salt thereof, wherein Q is N3 (BCY17901, SEQ ID NO:92), NH2 (BCY21758, SEQ ID NO:245), SH (BCY21758, SEQ ID NO:246), a conjugate linker, or a conjugate linker covalently attached to the oligonucleotide.
[0247] In certain embodiments, the bicyclic ligand comprises an amino acid sequence selected from CP[HyP]DAYLGC[tBuGly]SYCEPWK (SEQ ID NO:245, referred to herein as BCY21757) and CP[HyP]DAYLGC[tBuGly]SYCEPWC (SEQ ID NO:246, referred to herein as BCY21758), where HyP represents trans-4-hydroxy-L-proline and tBuGly represents t-butyl-glycine. In certain embodiments, the bicyclic ligand comprises an N-terminal acetyl group and a C-terminal CONH2 group. In certain embodiments, the first, second, and third cysteine residues in the bicyclic ligand are covalently attached to the molecular scaffold such that two polypeptide loops are formed on the molecular scaffold. In certain embodiments, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA).
[0248] Transferrin Receptor In certain embodiments, the bicyclic ligand can interact with type 1 transferrin receptor. In certain embodiments, the bicyclic ligand can bind to type 1 transferrin receptor. In certain embodiments, the bicyclic ligand can bind to type 1 transferrin receptor while not interfering with the binding of natural ligand transferrin. In certain embodiments, the bicyclic ligand inhibits the binding of natural ligand transferrin.
[0249] Certain conjugate linkers In certain embodiments, the oligomeric compound comprises an oligonucleotide and a conjugate group, the conjugate group comprising a conjugate moiety and a conjugate linker. In certain embodiments, the conjugate linker connects the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chemical group. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the conjugate moiety is a bicyclic ligand. In certain embodiments, the conjugate moiety comprises two polypeptide loops attached to a molecular scaffold.
[0250] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0251] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate moiety to a parent compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to react with a specific site of the compound, and the other is selected to react with a peptide extender. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0252] In certain embodiments, the conjugate linker comprises a chemical group that is formed upon reaction between a first functional group and a second functional group. In certain embodiments, the modified oligonucleotide is attached to the first functional group during synthesis, and the conjugate moiety is attached to the second functional group during synthesis. The two compounds are then mixed under certain conditions to obtain the final oligomeric compound. In certain embodiments, the conjugate moiety is a bicyclic ligand. In certain embodiments, the conjugate moiety comprises two polypeptide loops attached to a molecular scaffold. Such reactions, which are compatible with both oligonucleotide and peptide chemistry, have been described previously and are often referred to as "bioconjugation" reactions. These reactions include strain-promoted azide-alkyne cycloaddition (SPAAC), copper-catalyzed click reaction (CuAAC), active ester conjugation to amino-modified oligonucleotides, maleimide-thiol Michael addition, ketol / hydroxylamine ligation, Staudinger ligation, reductive amination, thioether formation, disulfide formation, reductive alkylation, catalyst-free N-arylation, sulfur fluoride exchange click reaction (SuFEX), and inverse demand Diels Alder reaction. Certain such reactions are described, for example, in Jbara, et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”, Angew.Chem.Int.Ed.2021,60(21)12109-12115; Dong, et al., “Sulfur(VI) Fluoride Exchange (SuFEx): Another Good Reaction for Click Chemistry”, Angew.Chem.Int.Ed.2014,53(36):9430-9448.4; Zhang, et al., “Arylation Chemistry for Bioconjugation”, Angew.Chem.Int.Ed.Engl.2019;58(15):4810-4839; Walsh, et al.,“Site-selective modification strategies in antibody-drug conjugates”Chem.Soc.Rev. 2021,50:1305-1353、Tiefenbrunn,et al.,“Chemoselective ligation techniques:modern applications of time-honored chemistry”,Biopolymers,2010,94(1):95-106、Drake, et al.,Bioconjug.Chem.2014,25(7):1331-1341、Bode, Acc.Chem.Res.,2017,50,9,2104-2115、J.Magano,B.Bock,et al,Org.Proc.Res.Dev.2014,18:142-151、Craig S.McKay and M.G.Finn,“Click Chemistry in Complex Mixtures:Bioorthogonal Bioconjugation”,Chemistry & Biology 2014、Mitchell P.Christy et al.,Org.Lett.2020,22:2365、Ren et al.,Angew.Chem.Int.Ed.Engl.2009,48,9658-9662、Rohrbacher,F.et al.,Helv.Chim.Acta.2018,101、Baalmaan,et al,“A Bioorthogonal Click Chemistry Toolbox for Targeted Synthesis of Branched and Well-Defined Protein-Protein Conjugates”,Angew.Chem.Int.Ed.2020(59):12885-12893、Lang,et al,“Biorthogonal Reactions for Labeling Proteins”,J.Am.Chem.Soc,2014,9(1):16-20、Nair,et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry”, Chem. Mater. 2013 26(1):724-744, and Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew. Chem. Int. Ed., 2008, 47:7523-7526.
[0253] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0254] In certain embodiments, the bicyclic ligand comprises an N- or C-terminal extended azide group, which can be optionally linked to an oligomeric compound by cycloaddition with a bicyclo[6.1.0]non-4-yn-9-ylmethylcarbamate oligo or a 2-(cyclooct-2-yn-1-yloxy)acetamide oligo. In certain embodiments, the bicyclic ligand comprises an N- or C-terminal extended amide group, which can be optionally linked to an oligomeric compound by coupling with an oligo-7-amido-7-oxoheptanoic acid. In certain embodiments, the bicyclic ligand comprises an N- or C-terminal extended 2-(aminooxy)acetamide group, which can be optionally linked to an oligomeric compound by condensation with a 5-oxo-5-(4-oxopiperidin-1-yl)pentanamide-oligo. In certain embodiments, the bicyclic ligand comprises an N-terminal or C-terminal extended thiol group, which can optionally be linked to an oligomeric compound by addition to a 3-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)propenamide-oligo.
[0255] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleoside is unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. The linker nucleosides are typically desirably cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.
[0256] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also comprises a conjugate linker that includes linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may include (1) an oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate linker that includes 1-10 linker nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may include an oligonucleotide consisting of 8-30 nucleosides and in which a conjugate linker is not present. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.
[0257] In certain embodiments, it is desirable for the conjugated moiety to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugated moieties are more likely to be taken up by certain cell types, but it is desirable for the conjugated moiety to be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugated linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0258] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester bond between the oligonucleotide and the conjugate group or between the conjugate group.
[0259] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0260] In certain embodiments, the oligomeric compounds disclosed herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, and the oligomeric compounds are prepared using click chemistry known in the art. The compounds are prepared using click chemistry, in which an alkynyl phosphonate internucleoside bond on an oligomeric compound bound to a solid support is converted to a 1,2,3-triazolyl phosphonate internucleoside bond, and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc. 2012, 134(28), 11618-11631), which is incorporated herein by reference in its entirety. Additional conjugate linkers suitable for use in some embodiments can be prepared by click chemistry as described in "Click Chemistry for Biotechnology and Materials Science" (Ed. Joerg Laham, Wiley 2009), which is incorporated herein by reference in its entirety.
[0261] In certain embodiments, a click reaction is used to [ka] with an oligonucleotide having a terminal amine, including but not limited to the following compounds: [ka] The conjugate moiety and the oligonucleotide can be joined by reacting with a cationically unsaturated alkyl group, such as aryl, alkyl, or aryl, to give: [ka] This is reacted with an azide-bearing conjugate moiety to give [ka] where NN=N is formed from the azide group of the conjugate moiety and X represents the remainder of the conjugate moiety. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0262] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker being prepared from the following compound: [ka]
[0263] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0264] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0265] In certain embodiments, the oligomeric compound comprises a conjugate nucleotide linked to a conjugate moiety by a conjugate linker, the compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents a portion of the oligomeric compound that includes an oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0266] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents the remainder of the oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0267] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents the remainder of the oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0268] In certain embodiments, a click reaction is used to [ka] in solution Oligonucleotides with terminal amines, including but not limited to the following compounds: [ka] The conjugate moiety and the oligonucleotide can be joined by reacting together Y and Y together, where Y is the remainder of the oligonucleotide, to give: [ka] This is reacted with an azide-bearing conjugate moiety to give [ka] where NN=N is formed from the azide group of the conjugate moiety and X represents the remainder of the conjugate moiety. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0269] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker being prepared from the following compound: [ka]
[0270] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0271] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0272] In certain embodiments, the oligomeric compound comprises a conjugate nucleotide linked to a conjugate moiety by a conjugate linker, the compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents a portion of the oligomeric compound that includes an oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0273] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents the remainder of the oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0274] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] Wherein NN=N is formed from the azide group of the conjugate moiety, X represents the remainder of the conjugate moiety, and Y represents the remainder of the oligonucleotide. In certain embodiments, the conjugate moiety comprises a bicyclic ligand. In certain embodiments, the conjugate moiety comprises a polypeptide. In certain embodiments, the azide group is attached to an amino acid side chain of the polypeptide. In certain embodiments, the azide group is attached to the N-terminus of the polypeptide. In certain embodiments, the azide group replaces the amino group of a lysine of the polypeptide.
[0275] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] wherein X comprises a conjugate group and Y comprises an oligonucleotide.
[0276] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the oligomeric compound comprising: [ka] wherein X comprises an oligonucleotide and Y comprises a conjugate moiety.
[0277] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0278] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0279] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0280] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0281] In certain embodiments, the oligomeric compound comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, the conjugate linker comprising: [ka]
[0282] Synthetic methods describing the preparation of the above starting materials and intermediates can be found in one or more of the following: Agard, et al., “A Strain-Promoted [3+2] Azide-Alkyne Cycloaddition for Covalent Modification of Biomolecules in Living Systems,” J. Am. Chem. Soc. 2004, 126:15046-15047; Lang, et al., “Biorthogonal Reactions for Labeling Proteins,” J. Am. Chem. Soc. 2014, 9(1):16-20; Nair, et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry,” Chem. Mater. 2013 26(1):724-744; WO2011 / 136645; Komel and Kool, “Oximes and Hydrazones in Bioconjugation: Mechanism and Catalysis,Chem.Rev.,2017,117:10358-10376, Wang,et al.,“Polyfluorophenyl Ester-Terminated Homobifunctional CrossLinkers for Protein Conjugation”,Synlett,2017,28:1934-1938,Kishimoto,et al,“Site-Specific Chemical Conjugation of Antibodies by Using Affinity Peptide for the Development of Therapeutic Antibody Format”,Bioconj.Chem.,2019,30:698-702.
[0283] Certain oligonucleotides In certain embodiments, oligomeric compounds are provided herein that comprise oligonucleotides that consist of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0284] Certain modified nucleosides A modified nucleoside contains a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.
[0285] Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to other types of modified sugar moieties.
[0286] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ), wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10and alkyl, with the 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0287] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.
[0288] In certain embodiments, modified nucleosides of 2'-substituted non-bicyclic nucleosides include a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0289] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0290] Certain modified sugar moieties include a substituent bridging two atoms of the furanosyl ring to form a second ring resulting in a bicyclic sugar moiety, hi certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,741,457, and Swayze et al., US 8,022,193), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R bare independently H, a protecting group, or C-C 12 alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).
[0291] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, wherein x is 0, 1, or 2, n is 1, 2, 3, or 4, and each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl, or a protecting group.
[0292] The molecular weight of the particles was obtained by analyzing the solvent, Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al al.,J.Am.Chem.Soc.,20017,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al.US6,770,748;Imanishi et al.,USRE44,779). al.,US6,794,499, Wengel et al.,US6,670,461, Wengel et al.,US7,034,133,Wengel et al.,US8,080,644,Wengel et al.,US8,034,909,Wengel et al.,US8,153,365 al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al al.,US7,547,684 Seth et al.,US7,666,854 Seth et al.,US8,088,746 Seth et al.,US7,750,131 Seth et al.,US8,030,467 Seth et al al.,US8,546,556;Seth et al.,USSee US Pat. Nos. 8,530,640, Migawa et al., US 9,012,421, Seth et al., US 8,501,805, and U.S. Patent Publication Nos. 2008 / 0039618 (Allerson et al.) and 2015 / 0191727 (Migawa et al.).
[0293] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.
[0294] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).
[0295] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.
[0296] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including additional modified THP compounds having the formula: [ka] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that attaches a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that attaches a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate moiety, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from among hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.
[0297] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0298] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]
[0299] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."
[0300] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0301] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art (see, e.g., review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854).
[0302] Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobase, which are called abasic nucleoside.
[0303] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8- Selected from substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-ones, 1,3-diazaphenothiazin-2-ones, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-ones (G-clamps).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0304] Publications teaching certain preparations of the above modified nucleobases, as well as other modified nucleobases, include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.
[0305] Certain modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside bond.Two major classes of internucleoside linking groups are defined by the presence or absence of phosphorus atom.Exemplary phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiester ("P=O") (also referred to as unmodified or naturally occurring or phosphate bond), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter (typically increase) the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.
[0306] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage is of the formula: [ka] wherein, independently for each internucleoside linkage group of the modified oligonucleotide: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.
[0307] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula: [ka]
[0308] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each include one or more of the following formulas, where "B" represents a nucleobase: [ka]
[0309] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate or other linkages containing chiral centers in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the population of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, and all mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage. Nevertheless, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate or mesyl phosphoramidate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population.In certain embodiments, a particular arrangement of a particular phosphorothioate or mesyl phosphoramidate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Rp) configuration. In certain embodiments, the (Rp) and / or (Sp) phosphorothioate-containing modified oligonucleotides each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.
[0310] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 constituent moieties.
[0311] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, as shown below: [ka] In the formula, each Bx independently represents any nucleobase.
[0312] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore there is only one internucleoside linkage as depicted above. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.
[0313] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and thus only one internucleoside linkage as described above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of the oligonucleotide.
[0314] In certain embodiments, the nucleic acids can be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are illustrated below. [ka] In the formula, each Bx represents any nucleobase.
[0315] A certain motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).
[0316] Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.
[0317] Gapmar In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).
[0318] In certain embodiments, a gapmer wing comprises 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.
[0319] In certain embodiments, the gapmer gap comprises between 7 and 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap is an unmodified 2'-deoxynucleoside.
[0320] In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.
[0321] In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified one comprises the same 2'-modification.
[0322] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides contain unmodified deoxynucleoside sugars. Thus, a 5-10-5 MOE gapmer consists of five linked MOE modified nucleosides in the 5'-wing, ten deoxynucleosides in the gap, and five linked MOE nucleosides in the 3'-wing.
[0323] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.
[0324] Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of a modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0325] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.
[0326] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0327] Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all of the internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.
[0328] A certain length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of target RNA, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.
[0329] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is equal to or less than Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13~19, 13~20, 13~21, 13~22, 13~23, 13~24, 13~25, 13~26, 13~27, 13~28, 13~29, 13~30, 14~15, 14~16, 14~17, 14~18, 14~19, 14~20, 14~21, 14~22, 14~23, 14~24, 14~25, 14~26, 14~27, 14~28, 14~29, 14~3 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19~21, 19~22, 19~23, 19~24, 19~25, 19~26, 19~27, 19~28, 19~29, 19~30, 20~21, 20~22, 20~23, 20~24, 20~25, 20~26, 20~27, 20~28, 20~29, 20~30, 21~22, 21~23, 21~24, 21~25, 21~26, 21~27, 21~28, 21~29, 21~30, 22~23, 22~24, 22~25, 22~26, 22~27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.
[0330] Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.
[0331] Certain populations of modified oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.
[0332] Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.
[0333] Oligomeric duplex In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to the sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region complementary to the target nucleic acid, and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or essentially consists of a modified or unmodified oligonucleotide, a conjugate linker, and a conjugate moiety. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or essentially consists of a modified or unmodified oligonucleotide. In certain embodiments, the second oligomeric compound of the oligomeric duplex comprises or essentially consists of a modified or unmodified oligonucleotide, a conjugate linker, and a conjugate moiety. One or both oligomeric compounds of the oligomeric duplex may include a conjugate linker and a conjugate moiety. In certain embodiments, the oligomeric compound is directly connected to the conjugate linker, and the conjugate linker is directly connected to the conjugate moiety. The oligonucleotides of each oligomeric compound of the oligomeric duplex may include non-complementary overhanging nucleosides. In certain embodiments, the overhanging nucleosides may be complementary to the target nucleic acid. In certain embodiments, the overhanging nucleosides are not the target nucleic acid. In certain embodiments, the two oligonucleotides have at least one mismatch with each other. In certain embodiments, the oligomeric duplex is an antisense agent.
[0334] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 90% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 100% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide having a length of 21 to 23 oligonucleotides. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide having a length of 19 to 21 oligonucleotides.
[0335] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties (e.g., a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-) and non-bicyclic sugar moieties (e.g., a 2'-MOE sugar moiety, a 2'-F sugar moiety, a 2'-OMe sugar moiety, or a 2'-NMA sugar moiety). In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise an unmodified 2'-deoxyribosyl sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe. In certain embodiments, one or more 2'-F sugar moieties have a conformation other than 2'-β-D-ribosyl. In certain embodiments, one or more 2'-F sugar moieties are in a 2'-β-D-xylosyl conformation.
[0336] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, hexitol nucleic acid (HNA), fluorohexitol nucleic acid (F-HNA), glycol nucleic acid (GNA) sugar surrogates, and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate that may be GNA.
[0337] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, the modified internucleoside bond is a mesyl phosphoramidate internucleoside bond. In certain embodiments, the first or second internucleoside linkage from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage. In certain embodiments, the first or second internucleoside linkage from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage.
[0338] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.
[0339] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate internucleoside linkage.
[0340] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can independently be selected from a phosphodiester or a phosphorothioate internucleoside linkage.
[0341] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester or a mesyl phosphoramidate internucleoside linkage.
[0342] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the first modified oligonucleotide can be ssooooooooooooooooooooss, where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the second modified oligonucleotide can be ssooooooooooooooooooss, where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.
[0343] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.
[0344] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilized phosphate group includes a cyclopropylphosphonate or an (E)-vinylphosphonate.
[0345] In some embodiments, the oligomeric duplex has a motif described in WO 2022 / 174053.
[0346] In any of the oligomeric duplexes described herein, the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a conjugate group. Preferably, the second modified oligonucleotide comprises a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at an internal position. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide via a 2' modification of the furanosyl sugar moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide via a modified internucleoside linkage. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at an internal position. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide via a 2' modification of the furanosyl sugar moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide via a modified internucleoside linkage. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1.In certain embodiments, the conjugate group is a bicyclic peptide capable of binding to TfR1.
[0347] Antisense activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in standard cell assays. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that it results in significant undesired antisense activity.
[0348] In certain antisense activities, hybridization of antisense compounds to target nucleic acids results in the recruitment of proteins that cleave the target nucleic acid. For example, certain antisense compounds result in RNaseH-mediated cleavage of target nucleic acids. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, the antisense compounds described herein are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.
[0349] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.Antisense compound incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).
[0350] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an inhibition of the binding interaction of the target nucleic acid with a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.
[0351] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.
[0352] A specific target nucleic acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.
[0353] Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity with bcl-2 mRNA and three mismatches with bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest level than either the 28 or 42 nucleobase oligonucleotides.
[0354] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.
[0355] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against the non-target is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain embodiments, the mismatches are at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain embodiments, the mismatches are at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain embodiments, the mismatches are at 4, 3, 2, or 1 positions from the 3' end of the wing region.
[0356] A specific target nucleic acid Modified oligonucleotides targeting muscle nucleic acids that may be useful in conjunction with the invention provided have been previously described, and in particular modified oligonucleotides may be included in the compositions of the invention. In certain embodiments, the target nucleic acid is a muscle target nucleic acid. In certain embodiments, the target nucleic acid is selected from ACTC1, ACTN2, ACVR1, ACVR1B, C9ORF72, CALR3, CaMK2d, CSRP3, DMD, DMPK, DNM2, DUX4, FBX032, FLNC, FXN, GYS1, HPRT, INHBA, JPH2, KLF15, LDB3, MED1, MED13, MEF2D, MSTN, MYBPC3, MYH6, MYH7, MYL2, MYL3, MLCK1, MYOZ2, MYPN, NEXN, NLRP3, PLN, PPP1R3A, PRKAG2, RYR, SOD1, TCAP, TNN, TNNC1, TNNI3, TNNT2, TPM1, TRIM64, or VCL. In certain embodiments, modified oligonucleotides targeted to one or more such target nucleic acids include one or more modified oligonucleotides described and illustrated in International Patent Publication Nos. W2019 / 090160, W2020 / 028842, W2020 / 028841, W2020 / 028831, W2021 / 142260, W2021 / 142227, W2020 / 028840, W2021 / 142217, W2021 / 142331, or W2021 / 142269.
[0357] In certain embodiments, the muscle target nucleic acid is selected from CaMK2d, NLRP3, PLN, DMD, DMPK, DNM2, DUX4, or HPRT. In certain embodiments, the CaMK2d nucleic acid has a sequence as set forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000004.12, truncating nucleosides 113448001-113765000) or SEQ ID NO: 2 (GENBANK Accession No. NM_001321571.2). In certain embodiments, the NLRP3 nucleic acid has a sequence as set forth in SEQ ID NO: 3 (GENBANK Accession No. NC_000001.11, truncating nucleosides 247413001-247454000) or SEQ ID NO: 4 (GENBANK Accession No. NM_004895.4). In certain embodiments, the PLN nucleic acid has a sequence set forth in SEQ ID NO:5 (GENBANK Accession No. NC_000006.12, truncating nucleosides 118545001-118565000) or SEQ ID NO:6 (GENBANK Accession No. NM_002667.4). In certain embodiments, the DMD nucleic acid has a sequence set forth in SEQ ID NO:7 (GENBANK Accession No. NT_011757.15, truncating nucleosides 28916001-31142000). In certain embodiments, the DMPK nucleic acid has a sequence set forth in SEQ ID NO:8 (GenBank Accession No. NT_011109.15, truncating nucleotides 18540696-18555106) or SEQ ID NO:9 (GENBANK Accession No. NM_001081560.1). In certain embodiments, the DNM2 nucleic acid has a sequence as set forth in SEQ ID NO: 10 (GenBank Accession No. NC_000019.10, truncating nucleosides 10715001-10835000) or SEQ ID NO: 11 (GENBANK Accession No. NM_004945.3). In certain embodiments, the DUX4 nucleic acid has a sequence as set forth in SEQ ID NO: 12 (GENBANK Accession No. NC_000004.12, truncating nucleotides 190171001-190187000) or SEQ ID NO: 13 (GENBANK Accession No. NM_001306068.2). In certain embodiments, the HPRT1 nucleic acid has a sequence as set forth in SEQ ID NO: 253 (ENSEMBL ID ENSG00000165704.15, release 107 (July 2022)).
[0358] In certain embodiments, the modified oligonucleotides targeting CaMK2d include one or more modified oligonucleotides described and shown in International Patent Publication Nos. 2019 / 165067, 2021 / 158810, or 2022 / 058386. In certain embodiments, the modified oligonucleotides targeting NLRP3 include one or more modified oligonucleotides described and shown in International Patent Publication No. 2022 / 178146A1 (incorporated herein by reference). In certain embodiments, the modified oligonucleotides targeting PLN include one or more modified oligonucleotides described and shown in International Patent Publication Nos. 2022 / 173976 (incorporated herein by reference) or 2001 / 16312.In certain embodiments, modified oligonucleotides targeting DMD are disclosed in WO 2018 / 014042, which is incorporated herein by reference, or in any of the publications described in International Patent Publication Nos. 2022 / 020107, 2021 / 025899, 2021 / 003573, 2021 / 142307, 2020 / 257489, 2020 / 219820, 2020 / ... 20 / 214763, 2020 / 198268, 2020 / 089325, 2020 / 028832, 2019 / 200185, 2019 / 090160 No. 2019 / 060775, No. 2019 / 014772, No. 2018 / 129384, No. 2018 / 067973, No. 2018 / 055577, No. 2018 / 0 14043, 2018 / 014042, 2018 / 007475, 2018 / 005805, 2017 / 210647, 2017 / 192679, 2017 / 047707, 2015 / 137409, 2014 / 153220, 2013 / 112053, 2013 / 100190, 2012 / 02998 6, 2011 / 057350, 2010 / 123369, 2010 / 048586, 2009 / 054725, 2007 / 135105, 2006 / 000057, 2004 / 083446, 2004 / 048570, or 2002 / 024906. In certain embodiments, the modified oligonucleotides targeting DMPK comprise one or more of the oligonucleotides described and illustrated in International Patent Publication Nos. 2012 / 012443, 2012 / 012467, 2015 / 021457 (incorporated herein by reference), or International Patent Publication Nos. 2022 / 147209, 2022 / 026152, 2021142234, 2021 / 076856, 2020 / 028861, 2019 / 113393, 2006 / 006948, 2005 / 116204, 2018 / 002812, 2018 / 078131, or 2018 / 078134.In certain embodiments, modified oligonucleotides targeting DNM2 include one or more of the oligonucleotides described and shown in International Patent Publication No. 2019 / 140452, which is incorporated herein by reference, or International Patent Publication No. 2020 / 028844, W015 / 055859, or 2016 / 170162. In certain embodiments, modified oligonucleotides targeting DUX4 include one or more of the oligonucleotides described and illustrated in International Patent Publication Nos. 2016 / 115490, 2022 / 159712 (incorporated herein by reference), or U.S. Patent Publication No. 2021 / 220479, or International Patent Publication Nos. 2022 / 147207, 2022 / 020106, 2021 / 142275, 2020 / 028840, 2020 / 203880, 2020 / 028864, 2019 / 060432, 2017 / 050836, 2016 / 115490, or 2012 / 024535.
[0359] Certain pharmaceutical compositions In certain embodiments, the pharmaceutical compositions described herein comprise one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the pharmaceutical composition comprises or consists essentially of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water. In certain embodiments, the pharmaceutical composition consists or consists essentially of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharma- ceutically acceptable diluent or carrier is distilled water for injection. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists or consists essentially of one or more oligomeric compounds and PBS. In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition consists or consists essentially of artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0360] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds disclosed herein and one or more excipients. In certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0361] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.
[0362] In certain embodiments, pharmaceutical compositions comprising the oligomeric compounds disclosed herein include any pharma- ceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include a conjugate moiety attached to the oligonucleotide, which is cleaved by endogenous nucleases in the body.
[0363] Lipid moieties are used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of oligomeric agents to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of oligomeric agents to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of oligomeric agents to muscle tissue.
[0364] In certain embodiments, the pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.
[0365] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the oligomeric compounds described herein to a particular tissue or cell type, for example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.
[0366] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.
[0367] In certain embodiments, the pharmaceutical compositions disclosed herein are prepared for oral administration. In certain embodiments, the pharmaceutical compositions are prepared for buccal administration. In certain embodiments, the pharmaceutical compositions are prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical compositions include a carrier and are formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may be included.
[0368] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form, ionized (anion) form, or in a form associated with ionization and cation (salt), but aqueous solutions of such compounds exist in equilibrium among such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of forms that are all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are intended to include the corresponding forms as well. As used herein, structures depicting the free acid of a compound followed by the term "or a salt thereof" expressly include all such forms which may be fully or partially protonated / deprotonated / associated with a cation. In certain instances, one or more certain cations are identified.
[0369] In certain embodiments, the oligomeric compounds disclosed herein are in an aqueous solution containing sodium. In certain embodiments, the oligomeric compounds are in an aqueous solution containing potassium. In certain embodiments, the oligomeric compounds are in PBS. In certain embodiments, the oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0370] In this specification, certain doses are described. The doses may be in the form of dosage units. For clarity of explanation, the dose (or dosage unit) of the modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide, excluding the mass of the conjugate group. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic form and the salt form. However, for the purpose of calculating the dose, it is assumed that the modified oligonucleotide or oligomeric compound is present as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of protons is still counted into the weight of the dose, and Na+ ions are not included. + The mass of ions is not counted in the weight of the dose.Furthermore, the mass of conjugate group or bicyclic ligand is not included when calculating the weight of the dose described herein, i.e., the dose is related only to the oligonucleotide or oligomer duplex.Thus, for example, a dose or dosage unit of 3.5 mg of compound (No. 486178) or compound (No. 1590463-BCY17868) is equal to the number of molecules of fully protonated oligonucleotide moiety of the molecule weighing 3.5 mg.This corresponds to 3.7 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound (No. 486178) and 4.7 mg of conjugate compound 1590463-BCY17868. EXAMPLES
[0371] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for additional oligonucleotides having the same or similar motifs.Furthermore, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.
[0372] Example 1: Design and synthesis of bicyclic ligands Polypeptides were synthesized on Rink amide resin using standard Fmoc (9-fluorenylmethyloxycarbonyl) solid phase peptide synthesis by manual coupling (for large scale) or using a Biotage SyroII automated peptide synthesizer (for small scale). After TFA-based cleavage from the resin, the peptides were precipitated with diethyl ether and dissolved in 50:50 acetonitrile / water. The crude peptides (at a concentration of approximately 1 mM) were then cyclized with 1.3 equivalents of the molecular scaffold 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)tris(2-bromoethanone) (TATB) using ammonium bicarbonate (100 mM) as base. Completion of the cyclization was determined by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) or LC-MS. Upon completion, the cyclization reaction was quenched using N-acetylcysteine (10 equivalents relative to peptide) and the solution was lyophilized. The residue was dissolved in an appropriate solvent and purified by RP-HPLC. Peptide fractions of sufficient purity and correct molecular weight (verified by either MALDI-TOF and HPLC or LC-MS) were pooled and lyophilized. Concentrations were determined by UV absorption using extinction coefficients at 280 nm based on Trp / Tyr content. All amino acids are in the L-configuration unless otherwise specified. Each C-terminus is amidated. [Table 2] dY represents D-tyrosine, [HyP] represents 4-trans-hydroxy-L-proline, [Aze] represents azetidine, [tBuGly] represents t-butylglycine, [K(N3)] represents 6-azidolysine, [Pip] represents pipecolic acid, and [K(N3)(PYA-maleimide)] represents a modified lysine having the following structure: [ka]
[0373] Example 2: Design of modified oligonucleotides complementary to mouse DMPK Modified oligonucleotides complementary to mouse DMPK were designed and synthesized (as shown in the table below). Selected compounds in the table below have modifications at the 5' end to allow for conjugation to bicyclic ligands. Compound (number 486178) was previously disclosed in WO2014 / 120861. [Table 3] The subscript "k" represents a cEt nucleoside, the subscript "d" represents a stereostandard DNA nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, the superscript "m" before the C represents 5-methylcytosine, "[nC6o]" represents a 6-aminohexanol linker, "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker, "[sC6o]" represents a 6-mercaptohexanol liner, "[PEG1alkyne]" represents a propargyl-PEG1-acid, and "[T do m C do A d ]" denotes a TCA trinucleotide linker and "[maleimidoC3oyl]" denotes a maleimidopropionyl linker having the following structure: [ka]
[0374] Modified oligonucleotides complementary to 486178 (described hereinabove) were designed and synthesized (as described in the table below). The compounds in the table below have modifications at the 5' end to allow for conjugation to bicyclic ligands. [Table 4] The subscript "k" represents a cEt nucleoside, the subscript "d" represents a stereostandard DNA nucleoside, the subscript "o" represents a phosphodiester internucleoside linkage, the superscript "m" before the C represents 5-methylcytosine, "[nC6o]" represents a 6-aminohexanol linker, and "[BCN]" denotes a (bicyclo[6.1.0]nonyne)-formyl linker.
[0375] Modified oligonucleotides complementary to mouse MALAT were designed and synthesized (as shown in the table below). The compounds in the table below have modifications at the 3' end to allow for conjugation to bicyclic ligands. [Table 5] The subscript "e" represents a 2'-MOE modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, the superscript "m" before the C represents 5-methylcytosine, "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker, "[5Cy3cHex]" represents a 5'-Cy3-cyclohexane moiety (GenePharma 11-4100), and "[3nC7]" represents a 3'-C7 amino modifier having the following structure: [ka]
[0376] Example 3: Design of RNAi compounds targeting HPRT1 Modified oligonucleotides with antisense strands complementary to mouse HPRT were designed and synthesized as shown in the table below. [Table 6] In the above table, the subscript "f" represents a 2'-F modified nucleoside, the subscript "y" represents a 2'-OMe modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, and the subscript "o" represents a phosphodiester internucleoside linkage.
[0377] The sense oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense oligonucleotide, with the last two 3' nucleosides of the antisense oligonucleotide being unpaired to the sense oligonucleotide (are overhanging nucleosides). [Table 7] In the above table, the subscript "f" represents a 2'-F modified nucleoside, the subscript "y" represents a 2'-OMe modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker, "[3nC7]" represents a 3'-C7 amino modifier, and "[maleimidoC3 oil]" represents a maleimidopropionyl linker. [Table 8]
[0378] Example 4: In vitro binding assay for binding of oligomeric compounds containing CD71 bicyclic ligands to the human transferrin receptor CD71 A nanoBRET assay was developed to measure the inhibition constants K of modified oligonucleotides conjugated to CD71 bicyclic ligands and RNAi compounds conjugated to CD71 bicyclic ligands.i The use of the nanoBRET assay for the attachment of oligonucleotides to proteins has been described previously (see, e.g., Vickers and Crooke, PloS One, 2016, 11(8):e061930).
[0379] The hCD71-Nluc fusion protein was constructed by linking NanoLuc (ProMega) to the C-terminal F760 residue of h-CD71 via its N-terminal Val using a GGGSGGSSG flexible linker. The fluorescently labeled (Cy3) modified oligonucleotide 1598988 was conjugated to the bicyclic ligand BCY17871 by strain-promoted azide-alkyne cycloaddition (SPAAC) reaction.
[0380] Crude membrane fractions from HEK293 cells stably expressing hCD71-Nluc were resuspended in PBS and 100 μL (corresponding to 10,000 cells per well) were dispensed into white 96-well assay plates (ThermoFisher Scientific, Cat. No. 136101). Membranes were treated with 11.1 μL of BCY17871-1598988 at serially diluted final concentrations from 1000 to 0.006 nM. The mixtures were incubated at room temperature for 3 h to reach equilibrium. To initiate BRET, 12.4 μL of 100 μM Nluc substrate furimazine was added to each well and the mixtures were incubated for 5–30 min. The assay plates were read at wavelengths of 450 and 600 nm in a Promega GlowMax Discover plate reader and the ratio of emission at wavelengths 450 / 600 was used to obtain %BRET efficiency. The data were subjected to nonlinear regression and then fitted to a hyperbolic function for single-site binding. D was determined to be 57-58 nM.
[0381] To evaluate modified oligonucleotides conjugated to CD71 bicyclic ligands and RNAi compounds conjugated to CD71 bicyclic ligands, the assay was modified as follows: 100 μL of crude membrane fraction from stably transfected hCD71-Nluc HEK293 cells was dispensed into a white 96-well assay plate (ThermoFisher Scientific, Cat. No. 136101). BCY17871-1598988 was used as a tracer compound and was added to each well at a final concentration of 60 nM. Modified oligonucleotides were conjugated to bicyclic ligands by SPAAC reaction. These were then added at a range of concentrations in triplicate assay points and the mixtures were incubated at room temperature for 3 hours. BRET was initiated by the addition of furimazine and the assay was completed as described above. The inhibition constant (K i ) is the K estimated for BCY17871-1598988 obtained in the same run. D The values were obtained by fitting the %BRET efficiency values to a competitive inhibition model. Values are shown in the table below as the average of triplicate data. Each experiment is shown in a separate table.
[0382] The bicyclic ligand was attached to the modified oligonucleotide via a BCN linker. As an example, compound 1590463-BCY17901 is shown below. [ka] (SEQ ID NOs: 92 and 176) [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14]
[0383] A duplex of the modified oligonucleotide was generated by mixing compounds (No. 486178 and 1614438) to generate compound (No. 486178:1614438). [Table 15] [Table 16] [Table 17]
[0384] Example 5: Binding Affinities of Modified Oligonucleotides Conjugated to CD71 Bicyclic Ligands The binding affinity for each of the following modified oligonucleotides conjugated to a CD71 bicyclic ligand was tested on a Biacore X100 surface plasmon resonance (SPR) instrument: 200 units of the modified oligonucleotide conjugated to a CD71 bicyclic ligand were immobilized on a streptavidin chip by injecting a 20 nM solution of 5' biotin-labeled DNA (5' biotin-TEG-DNA complementary to the modified oligonucleotide) duplexed with the modified oligonucleotide conjugated to the CD71 bicyclic ligand in HBS-P (10 mM HEPES, pH 7.4, 150 mM NaCl, 0.0005% surfactant P20) running buffer. CD71 in running buffer was then injected over the modified oligonucleotides conjugated to the CD71 bicyclic ligand duplex immobilized streptavidin chip at increasing concentrations of 6.25 nM, 12.5 nM, 25 nM, 50 nM, and 100 nM at 25° C. Kinetic and equilibrium binding analysis was performed using Biacore X100 evaluation software, applying 1:1 binding fitting. Binding affinities are reported as equilibrium dissociation constants (K D ) [Table 18]
[0385] Example 6: hTFR KI / + Activity and Tolerance of Modified Oligonucleotides Conjugated to CD71 Bicyclic Ligands in Knock-in Mice The human transferrin receptor (hTFR) / CD71 knock-in mice used in these studies have the coding region of mouse exon 2, as well as the splice donor site of mouse intron 2 replaced with the human TFR open reading frame according to NCBI transcript NM_001128148.2. Humanization of the transferrin receptor gene was performed via CRISPR / Cas-9 mediated gene editing, allowing the generation of models with constitutive expression of the humanized transferrin receptor gene. The targeting strategy was based on NCBI transcripts NM_011638.4 (mouse) and NM_001128148.2 (human). Plasmids allowing expression of Cas9 mRNA, specific gRNA, and puromycin resistance cassette, as well as plasmids containing the homology region of the mouse transferrin receptor gene, FRT sites, and replaced human regions, were co-transfected into Taconic Biosciences C57BL / 6N Tac ES cell line. The humanized mice are herein designated hTFR KI / + Called knock-in mice, they express one copy of the mouse TFR gene and one copy of the humanized TFR gene under the control of the endogenous mouse promoter.
[0386] The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using hTFR KI / + In addition, the activity of the compound (number 1468770, described herein above) conjugated to the Fab' fragment of the OKT9 antibody (BioXCell, catalog number: BE0023) targeting human CD71 was tested.
[0387] treatment hTFR KI / +Mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of conjugated modified oligonucleotides intravenously at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotides, compound number 486178, intravenously at the doses shown in the table below. A group of 4 mice received PBS as a negative control.
[0388] RNA analysis Mice were sacrificed one week after the final dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps (Quad), tibialis anterior (TA), diaphragm, triceps, heart, gastroc), aorta, sciatic nerve, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (forward sequence GACATATGCCAAGATTGTGCACTAC, referred to herein as SEQ ID NO: 16; reverse sequence CACGAATGAGGTCCTGAGCTT, referred to herein as SEQ ID NO: 17; probe sequence AACACTTGTCGCTGCCGCTGGC, referred to herein as SEQ ID NO: 18). Results are shown as percentage of mouse DMPK RNA relative to PBS control (% control), normalized to mouse GAPDH. [Table 19]
[0389] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 22) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. Oligomeric compounds that caused changes in the levels of any of the liver or kidney function markers outside the range expected for the modified oligonucleotides were excluded from further study. [Table 20]
[0390] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 22) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes, and platelets were assessed. Results are shown in the table below. Oligomeric compounds that caused changes in blood cell counts outside the expected range were eliminated from further study. [Table 21] [Table 22]
[0391] Body and organ weights hTFR on days 1 and 22 KI / +Mice were weighed and the average weight for each group is shown in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 22) and the average organ weights for each group are shown in the table below. Oligomeric compounds that caused any changes in organ weights outside the expected range for the modified oligonucleotides were eliminated from further studies. [Table 23]
[0392] Example 7: hTFR KI / + Activity and Tolerability of Modified Oligonucleotides Conjugated to CD71 Bicyclic Ligands and Double-Stranded Modified Oligonucleotides Conjugated to CD71 Bicyclic Ligands in Knock-In Mice The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using hTFR KI / + Tested in knock-in mice (described hereinabove). In addition, the activity of compound (number 1468770, described hereinabove) conjugated to the Fab' fragment of the OKT9 antibody (BioXCell, catalog number: BE0023) targeting human CD71 was tested.
[0393] treatment hTFRKI / + mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of conjugated modified oligonucleotides intravenously at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotides, compound number 486178, intravenously at the doses shown in the table below. A group of 4 mice received PBS as a negative control.
[0394] RNA analysis Mice were sacrificed 4 days after the last dose (day 19) and RNA was extracted from various muscle tissues (including quadriceps (Quad), tibialis anterior (TA), diaphragm (Diaphr), triceps, heart, gastroc), aorta, sciatic nerve, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181. Results are shown as percentage of mouse DMPK RNA relative to PBS control (% control), normalized to mouse GAPDH. [Table 24]
[0395] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 19) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. Oligomeric compounds that caused changes in the levels of any of the liver or kidney function markers outside the range expected for the modified oligonucleotides were excluded from further study. [Table 25]
[0396] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 19) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes, and platelets were assessed. Results are shown in the table below. Oligomeric compounds that caused changes in blood cell counts outside the expected range were eliminated from further study. [Table 26] [Table 27]
[0397] Body and organ weights hTFR on days 1 and 19 KI / + Mice were weighed and the average weight for each group is shown in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 19) and the average organ weights for each group are shown in the table below. Oligomeric compounds that caused any changes in organ weights outside the expected range for the modified oligonucleotides were eliminated from further studies. [Table 28]
[0398] Example 8: hTFR KI / + Activity and Tolerability of Modified Oligonucleotides Conjugated to CD71 Bicyclic Ligands in Knock-in Mice, Multiple Doses The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using hTFR KI / +The knock-in mice (described hereinabove) were tested. In addition, the activity and tolerability of the compound (number 1468770, described hereinabove) conjugated to the Fab' fragment of the OKT9 antibody (BioXCell, catalog number: BE0023) targeting human CD71 was tested.
[0399] treatment hTFR KI / + Mice were divided into groups of 3-4 mice each. Each mouse received a total of three doses (days 1, 5, and 9) of the conjugated modified oligonucleotide intravenously (iv) or subcutaneously (sc) at the doses shown in the table below. A group of three mice received a total of three doses (days 1, 5, and 9) of the unconjugated modified oligonucleotide, compound (number 486178), intravenously at the doses shown in the table below. A group of four mice received PBS as a negative control.
[0400] RNA analysis Mice were sacrificed 6 days after the last dose (day 15) and RNA was extracted from various muscle tissues (including quadriceps (Quad), tibialis anterior (TA), diaphragm, triceps, heart, gastroc), aorta, sciatic nerve, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181. Results are shown as percentage of mouse DMPK RNA relative to PBS control (% control), normalized to mouse GAPDH. [Table 29] [Table 30]
[0401] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 15) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. Oligomeric compounds that caused changes in the levels of any of the liver or kidney function markers outside the range expected for the modified oligonucleotides were excluded from further study. [Table 31]
[0402] Hematology Assays Blood obtained from the mice on the day they were sacrificed (day 15) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes, and platelets were assessed. The results are shown in the table below. Oligomeric compounds that caused changes in blood cell counts outside the expected range were eliminated from further study. [Table 32] [Table 33]
[0403] Body and organ weights hTFR on days 1 and 15 KI / +Mice were weighed and the average weight for each group is shown in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 15) and the average organ weights for each group are shown in the table below. Oligomeric compounds that caused any changes in organ weights outside the expected range for the modified oligonucleotides were eliminated from further studies. [Table 34]
[0404] Example 9: hTFR KI / + Activity and tolerability of RNAi compounds conjugated to CD71 bicyclic ligands in knock-in mice The activity and tolerability of RNAi compounds conjugated to CD71 bicyclic ligands were evaluated using the hTFR KI / + The knock-in mice (described hereinabove) were tested. In addition, the activity and tolerability of the compound (number 1468770, described hereinabove) conjugated to the Fab' fragment of the OKT9 antibody (BioXCell, catalog number: BE0023) targeting human CD71 was tested.
[0405] treatment hTFR KI / + Mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of conjugated RNAi compounds intravenously at the doses shown in the table below. A group of 4 mice received PBS as a negative control.
[0406] RNA analysis Mice were sacrificed 4 days after the last dose (day 19) and RNA was extracted from various muscle tissues (including quadriceps (Quad), tibialis anterior (TA), diaphragm (Dia.), triceps, heart, gastroc), aorta, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse HPRT RNA using mouse primer probe set RTS43125 (forward sequence CTCCTCAGACCGCTTTTTGC, referred to herein as SEQ ID NO: 19; reverse sequence TAACCTGGTTCATCATCGCTAATC, referred to herein as SEQ ID NO: 20; probe sequence CCGTCATGCCGACCCGCAGT, referred to herein as SEQ ID NO: 21). Results are shown as percentage of mouse HPRT RNA relative to PBS control (% control), normalized to mouse GAPDH. [Table 35]
[0407] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 19) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. Oligomeric compounds that caused changes in the levels of any of the liver or kidney function markers outside the range expected for the modified oligonucleotides were excluded from further study. [Table 36]
[0408] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 19) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes, and platelets were assessed. Results are shown in the table below. Oligomeric compounds that caused changes in blood cell counts outside the expected range were eliminated from further study. [Table 37] [Table 38]
[0409] Body and organ weights hTFR on days 1 and 19 KI / + Mice were weighed and the average weight for each group is shown in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 19) and the average organ weights for each group are shown in the table below. Oligomeric compounds that caused any changes in organ weights outside the expected range for the modified oligonucleotides were eliminated from further studies. [Table 39]
[0410] Example 10: hTFR with various linker chemistries KI / + Design, activity, and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using hTFR KI / +Tested in knock-in mice (described hereinabove). Several CD71 bicyclic ligands were designed with C-terminal extensions to increase the distance between the oligonucleotide and the polypeptide loop of the bicyclic ligand, as shown in the table below. [Table 40] [ka]
[0411] Bivalent Linkers treatment hTFR KI / + Mice were divided into groups of 4 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of conjugated modified oligonucleotides intravenously at the doses shown in the table below. A group of 4 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotides, compound number 486178, intravenously at the doses shown in the table below. A group of 4 mice received PBS as a negative control.
[0412] RNA analysis Mice were sacrificed 7 days after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps (Quad), tibialis anterior (TA), diaphragm (Diaphr), heart, gastroc), aorta, sciatic nerve, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181. Results are shown as percentage of mouse DMPK RNA relative to PBS control (% control), normalized to mouse GAPDH. [Table 41]
[0413] body weight hTFR on days 1 and 22 KI / +The mice were weighed and the average weight for each group is shown in the table below. [Table 42]
[0414] Example 11: hTFR KI / + Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice, single dose The activity of modified oligonucleotides conjugated to CD71 bicyclic ligands was evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0415] treatment hTFR KI / + Mice were divided into groups of 4 mice each. Each mouse received 3.5 mg / kg of conjugated modified oligonucleotides intravenously (iv) for a total of three doses (days 1, 8, and 15). A group of 4 mice received 35 mg / kg of unconjugated modified oligonucleotides, compound number 486178, intravenously for a total of three doses (days 1, 8, and 15). A group of 4 mice received PBS as a negative control.
[0416] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps (quad), tibialis anterior (TA), gastroc, heart, and diaphragm), liver tissue, and sciatic nerve for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK RNA relative to the amount of DMPK RNA in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. [Table 43]
[0417] body weight hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. [Table 44]
[0418] Example 12: hTFR KI / + Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice, multiple doses The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0419] treatment hTFR KI / +The knock-in mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of compound (number 1590463-BCY17901) intravenously at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotide, compound (number 486178) intravenously. A group of 4 mice received PBS as a negative control.
[0420] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc, and heart) for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are presented as the percentage of mouse DMPK RNA relative to the amount of DMPK RNA in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. ED 50 Values were calculated in GraphPad Prism using a nonlinear fit with a variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope), with the following constraints: Top=100, Bottom=0, Hill slope<-1. [Table 45]
[0421] body weight hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. [Table 46]
[0422] Example 13: Homozygous hTFR KI / KI Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice, multiple doses The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated in homozygous hTFR KI / KI Tested in knock-in mice The human transferrin receptor (hTFR) / CD71 knock-in mice used in these studies have the coding region of mouse exon 2, as well as the splice donor site of mouse intron 2 replaced with the human TFR open reading frame according to NCBI transcript NM_001128148.2. Humanization of the transferrin receptor gene was performed via CRISPR / Cas-9 mediated gene editing, allowing the generation of models with constitutive expression of the humanized transferrin receptor gene. The targeting strategy was based on NCBI transcripts NM_011638.4 (mouse) and NM_001128148.2 (human). Plasmids allowing expression of Cas9 mRNA, specific gRNA, and puromycin resistance cassette, as well as plasmids containing the homology region of the mouse transferrin receptor gene, FRT sites, and replaced human regions, were co-transfected into Taconic Biosciences C57BL / 6N Tac ES cell line. Homozygous humanized mice are herein designated hTFR KI / KI Called knock-in mice, they express two copies of the humanized TFR gene under the control of the endogenous mouse promoter.
[0423] treatment hTFR KI / KIThe knock-in mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of compound (number 1590463-BCY17901) intravenously at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotide, compound (number 486178) intravenously. A group of 4 mice received PBS as a negative control.
[0424] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc, and heart) for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are presented as the percentage of mouse DMPK RNA relative to the amount of DMPK RNA in PBS-treated control animals (as shown in the table below), normalized to GAPDH RNA (% control). ED 50 Values were calculated in GraphPad Prism using a nonlinear fit with a variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope), with the following constraints: Top=100, Bottom=0, Hill slope<-1. [Table 47]
[0425] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 22) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. [Table 48]
[0426] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 22) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and platelets (PLT) were assessed. The results are shown in the table below. "ND" indicates values not determined. [Table 49] [Table 50]
[0427] Body and organ weights hTFR on days 1 and 22 KI / KI The mice were weighed and the average weight for each group is shown in the table below. The liver, kidney and spleen weights were measured on the day the mice were sacrificed (day 22) and the average organ weights for each group are shown in the table below. [Table 51]
[0428] Example 14: Design of RNAi compounds targeting DMPK Modified antisense oligonucleotides complementary to mouse DMPK were designed and synthesized as shown in the table below. [Table 52] In the above table, "vP" represents a 5' vinyl phosphonate moiety, subscript "f" represents a 2'-F modified nucleoside, subscript "y" represents a 2'-OMe modified nucleoside, subscript "e" represents a 2'MOE modified nucleoside, subscript "s" represents a phosphorothioate internucleoside linkage, and subscript "o" represents a phosphodiester internucleoside linkage.
[0429] The sense oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense oligonucleotide, and the last two 3' nucleosides of the antisense oligonucleotide are not paired with the sense oligonucleotide (they are overhanging nucleosides). The modified oligonucleotide compound (No. 1652967) was conjugated to BCY17901 as described herein above. [Table 53] In the above table, the subscript "f" represents a 2'-F modified nucleoside, the subscript "y" represents a 2'-OMe modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, "[3nC7]" represents a 3'-C7 amino modifier, "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker, and "[maleimidoC3oyl]" represents a maleimidopropionyl linker. [Table 54] [Table 55]
[0430] Example 15: hTFR KI / + Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice, multiple doses The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0431] treatment hTFR KI / + The knock-in mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of compound 1590463-BCY17901 intravenously at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of unconjugated modified oligonucleotide, compound (number 486178), intravenously. A group of 4 mice received PBS as a negative control.
[0432] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc), heart, and diaphragm, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK RNA relative to the amount of DMPK RNA in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. ED 50Values were calculated in GraphPad Prism using a nonlinear fit with a variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope), with the following constraints: Top=100, Bottom=0, Hill slope<-1. [Table 56] [Table 57]
[0433] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 22) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. [Table 58]
[0434] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 22) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts were assessed, including monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and platelets (PLT). The results are shown in the table below. [Table 59] [Table 60]
[0435] body weight hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. [Table 61]
[0436] Example 16: hTFR KI / + Activity of RNAi compounds conjugated to CD71 bicyclic ligands in knock-in mice, multiple doses The activity of RNAi compounds (no. 1653456:1547300) conjugated to the bicyclic ligand CD71 was assessed using a heterozygous hTFR KI / + Tested in knock-in mice (described hereinabove). In addition, the activity of compound (number 1653456:1547300, described hereinabove) conjugated to the Fab' fragment of the OKT9 antibody (BioXCell, catalog number: BE0023) targeting human CD71 was tested.
[0437] treatment hTFR KI / +The knock-in mice were divided into groups of 3-4 mice each. Three mice groups received intravenous administration of conjugated RNAi compound 1653456:1547300-OKT9 Fab for a total of three doses (days 1, 8, and 15). Three mice groups received intravenous administration of conjugated RNAi compound 1653456:1678385 for a total of three doses (days 1, 8, and 15) at the doses shown in the table below. A group of four mice received subcutaneous administration of conjugated RNAi compound 1653456:1678385 at 10 mg / kg for a total of three doses (days 1, 8, and 15). A group of four mice received PBS as a negative control.
[0438] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc), heart, and diaphragm, and liver tissues for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK RNA relative to the amount of DMPK RNA in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. ED 50 Values were calculated in GraphPad Prism using a nonlinear fit with variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope) with the following constraints: Top=100, Bottom=0, Hill slope<-1. "NC" indicates that the value was not calculated. [Table 62] [Table 63]
[0439] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), total protein (PROT), creatine (CREAT), and creatine kinase (CK) were measured on the day the mice were sacrificed (day 22) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. [Table 64]
[0440] Hematology Assays Blood obtained from mice on the day they were sacrificed (day 22) was sent to IDEXX BioResearch for blood cell counts. Counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts were assessed, including monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and platelets (PLT). The results are shown in the table below. [Table 65] [Table 66]
[0441] body weight hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. [Table 67]
[0442] Example 17: Design of RNAi compounds targeting DMPK conjugated to CD71 bicyclic ligands Sense modified oligonucleotides were designed and synthesized as shown in the table below. The sense oligonucleotides are complementary to the first 21 nucleosides (5' to 3') of an antisense oligonucleotide compound (No. 1653456, described herein above) where the last two 3' nucleosides of the antisense oligonucleotide are not paired to the sense oligonucleotide (they are overhanging nucleosides). [Table 68] In the above table, the subscript "f" represents a 2'-F modified nucleoside, the subscript "y" represents a 2'-OMe modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, "[nC6o]" represents a 6-aminohexanol linker, and "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker.
[0443] The modified oligonucleotide compounds (Nos. 1709195 and 1590463) were further conjugated to BCY17901 as described in the table below. [Table 69] [Table 70]
[0444] Example 18: Heterozygous hTFR KI / + Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice, multiple doses The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0445] treatment hTFR KI / + The knock-in mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of the conjugated modified oligonucleotide intravenously (iv) or subcutaneously (sc) at the doses shown in the table below. A group of 3 mice received a total of 3 doses (days 1, 8, and 15) of the unconjugated modified oligonucleotide, compound (number 486178), subcutaneously. A group of 4 mice received PBS as a negative control.
[0446] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc, heart, liver) for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK RNA relative to the amount of DMPK in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. ED 50 Values were calculated in GraphPad Prism using a nonlinear fit with a variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope), with the following constraints: Top=100, Bottom=0, Hill slope<-1. [Table 71] [Table 72]
[0447] body weight hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. [Table 73]
[0448] Example 19: Heterozygous hTFR KI / + Activity and Tolerability of RNAi Compounds Conjugated to CD71 Bicyclic Ligands in Knock-in Mice, Multiple Doses The activity and tolerability of RNAi compounds conjugated to CD71 bicyclic ligands were evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0449] treatment hTFR KI / + The knock-in mice were divided into groups of 3 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of conjugated RNAi compounds intravenously (iv) or subcutaneously (sc) at the doses shown in the table below. A group of 4 mice received PBS as a negative control.
[0450] RNA analysis Mice were sacrificed one week after the last dose (day 22) and RNA was extracted from various muscle tissues (including quadriceps, gastroc, heart, liver) for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK RNA relative to the amount of DMPK in PBS-treated control animals (% control), normalized to mouse GAPDH RNA. ED 50 Values were calculated in GraphPad Prism using a nonlinear fit with a variable Hill slope (four parameters), Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^Hill slope), with the following constraints: Top=100, Bottom=0, Hill slope<-1. [Table 74] [Table 75]
[0451] Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver and kidney function, plasma levels of albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), total protein (PROT), creatine (CREAT), iron, and creatine kinase (CK) were measured on the day the mice were sacrificed (day 18) using a clinical chemistry autoanalyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are shown in the table below. [Table 76]
[0452] Body and organ weights hTFR on days 1 and 22 KI / + The mice were weighed and the average weight for each group is shown in the table below. The liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 22) and the average organ weights for each group are shown in the table below. "ND" indicates that the data was not determined. [Table 77]
[0453] Example 20: Design of modified oligonucleotides targeting MALAT conjugated to CD71 bicyclic ligands Modified oligonucleotides complementary to mouse MALAT were designed and synthesized (as shown in the table below). The compounds in the table below have modifications at the 5' end to allow for conjugation to bicyclic ligands. [Table 78] In the above table, the subscript "k" represents a cEt nucleoside, the subscript "d" represents a stereostandard DNA nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, the superscript "m" before the C represents 5-methylcytosine, "[nC6o]" represents a 6-aminohexanol linker, and "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker.
[0454] The modified oligonucleotides were further conjugated to BCY17901 as described in the table below. [Table 79]
[0455] Example 21: Design of RNAi compounds targeting HPRT conjugated to CD71 bicyclic ligands Modified oligonucleotides with antisense strands complementary to mouse HPRT were designed and synthesized as shown in the table below. [Table 80] In the above table, "vP" represents a 5' vinyl phosphonate moiety, subscript "f" represents a 2'-F modified nucleoside, subscript "y" represents a 2'-OMe modified nucleoside, subscript "e" represents a 2'MOE modified nucleoside, subscript "s" represents a phosphorothioate internucleoside linkage, and subscript "o" represents a phosphodiester internucleoside linkage.
[0456] The sense modified oligonucleotides were designed and synthesized as shown in the table below. The sense oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense oligonucleotide, and the last two 3' nucleosides of the antisense oligonucleotide are not paired with the sense oligonucleotide (they are overhanging nucleosides). The sense modified oligonucleotide has a modification at the 3' end that allows for conjugation to a bicyclic ligand. [Table 81] In the above table, the subscript "f" represents a 2'-F modified nucleoside, the subscript "y" represents a 2'-OMe modified nucleoside, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, "[BCN]" indicates a (bicyclo[6.1.0]nonyne)-formyl linker, and "[3nC7]" represents a 3'-C7 amino modifier having the following structure: [ka]
[0457] The sense modified oligonucleotide compound 1653454 was further conjugated to BCY17901 as described in the table below. [Table 82] [Table 83]
[0458] Example 22: Effects of oligomeric agents containing CD71 bicyclic ligands in cynomolgus monkeys Cynomolgus monkeys were treated with modified oligonucleotides conjugated to CD71 bicyclic ligands or RNAi compounds conjugated to CD71 bicyclic ligands selected from the studies described in the Examples above.
[0459] treatment Prior to the study, the monkeys were isolated and observed daily for the animals' overall health. The monkeys were 2-4 years old and weighed 2-4 kg. Female cynomolgus monkeys were divided into 4 groups of 3 monkeys each. Each monkey received an intravenous (iv) infusion (1 h) of the conjugated modified oligonucleotide or conjugated RNAi compound via a percutaneously placed catheter. A new sterile indwelling catheter was placed before each dose. The monkeys were administered 25 mg / kg at 10 mL / kg once a week for a total of 3 doses (days 1, 8, and 15).
[0460] During the study, monkeys were observed at least once daily for signs of illness or distress. Animals that experienced temporary or slight pain or distress due to treatment, injury, or illness were treated by veterinary staff with approved analgesics or pain medications after consultation with the investigator. Animals in poor health or potentially moribund condition were examined by veterinarians and identified for further monitoring and possible euthanasia as soon as possible. Scheduled euthanasia of animals was performed by exsanguination under deep anesthesia on day 28, approximately 13 days after the last dose. The protocols described in the Examples were approved by the Institutional Animal Care and Use Committee (IACUC).
[0461] RNA analysis To assess the effect of conjugated modified oligonucleotides or conjugated RNAi compounds on target RNA expression levels, cross-sectional slices of skeletal muscle tissue (quad, gastroc, tibialis anterior (TA), diaphragm, soleus) and cardiac tissue were harvested from all animals. Approximately 8 mm 2 Alternatively, 300 mg of liver tissue was collected and placed into 2 mL screw-cap tubes (150 mg x 2 tubes).
[0462] The monkeys were sacrificed 2 weeks after the final dose (day 28) and RNA was extracted from muscle tissues (including quadriceps (quad), diaphragm, soleus, tibialis anterior (TA), gastroc, and heart) and liver for quantitative real-time RTPCR analysis to measure the amount of target RNA.
[0463] MALAT RNA levels were measured using NHP primer probe set MALAT1_LTS01104 (forward sequence AAGGAGTGTACCGCTGTACTGTTG, referred to herein as SEQ ID NO:247; reverse sequence CCAAAGCTGCACTGTGCTGTA, referred to herein as SEQ ID NO:248; probe sequence ACACCTTCAGGGACTGGAGCTGCTTTTATC, referred to herein as SEQ ID NO:249). MALAT RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Results are shown as the percentage of monkey MALAT RNA relative to the amount of monkey MALAT RNA in all groups not treated with conjugated modified oligonucleotides targeting MALAT. DMPK RNA levels were measured using NHP primer probe set DMPK_RTS4447 (forward sequence AGCCTGAGCCGGGAGATG, referred to herein as SEQ ID NO:250; reverse sequence GCGTAGTTGACTGGCAAAGTT, referred to herein as SEQ ID NO:251; probe sequence AGGCCATCCGCATGGCCAACC, referred to herein as SEQ ID NO:252). DMPK RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Results are shown as a percentage of monkey DMPK RNA relative to the amount of monkey DMPK RNA in all groups not treated with conjugated modified oligonucleotides or conjugated RNAi compounds targeting DMPK. HPRT RNA levels were measured using NHP primer probe set Rh02800695_m1 (Thermofisher). HPRT RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Results are presented as a percentage of monkey HPRT RNA relative to the amount of monkey HPRT RNA in all groups not treated with conjugated RNAi compounds targeted to HPRT. [Table 84]
[0464] Example 23: Design of modified DMPK-targeting oligonucleotides conjugated to CD71 bicyclic ligands Modified oligonucleotides complementary to mouse DMPK were designed and synthesized (as shown in the table below). The compounds in the table below have modifications at the 5' end to allow for conjugation to bicyclic ligands. [Table 85] In the above table, the subscript "k" represents a cEt nucleoside, the subscript "d" represents a stereostandard DNA nucleoside, the subscript "z" represents a mesyl phosphoramidate internucleoside linkage, the subscript "s" represents a phosphorothioate internucleoside linkage, the subscript "o" represents a phosphodiester internucleoside linkage, the superscript "m" before the C represents 5-methylcytosine, "[nC6o]" represents a 6-aminohexanol linker, and "[BCN]" represents a (bicyclo[6.1.0]nonyne)-formyl linker.
[0465] The modified oligonucleotides were further conjugated to BCY17901 as described in the table below. [Table 86]
[0466] Example 24: Heterozygous hTFR KI / + Activity of modified oligonucleotides conjugated to CD71 bicyclic ligands in knock-in mice The activity and tolerability of modified oligonucleotides conjugated to CD71 bicyclic ligands were evaluated using heterozygous hTFR KI / + Knock-in mice (described herein above) were tested.
[0467] treatment hTFR KI / +The knock-in mice were divided into groups of 4 mice each. Each mouse received a total of 3 doses (days 1, 8, and 15) of 3.5 mg / kg of the conjugated modified oligonucleotide intravenously (iv) or subcutaneously (sc) as shown in the table below. A group of 4 mice received PBS as a negative control.
[0468] RNA analysis Mice were sacrificed on day 22, one week after the last dose for the conjugated modified oligonucleotide group. RNA was extracted from various muscle tissues, including quadriceps and gastric, for quantitative real-time RTPCR analysis to measure the amount of mouse DMPK RNA using mouse primer probe set RTS3181 (described hereinabove). Mouse DMPK RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described hereinabove). Results are shown as the percentage of mouse DMPK relative to the amount of DMPK in sc-PBS-treated control animals (% control), normalized to mouse GAPDH RNA. [Table 87]
[0469] Example 25: Design and activity of RNAi compounds conjugated to CD71 bicyclic ligands [Table 88]
[0470] Various sense modified oligonucleotides are designed. The sense oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense oligonucleotide, and the last two 3' nucleosides of the antisense oligonucleotide are not paired with the sense oligonucleotide (they are overhanging nucleosides). The sense modified oligonucleotide is conjugated to a bicyclic ligand at the 5' end to form the following conjugate: [Table 89]
[0471] Y represents a bicyclic ligand and X represents a modified oligonucleotide consisting of 21 linked nucleic acids conjugated at the 5' end.
[0472] Activity The activity of RNAi compounds conjugated to CD71 bicyclic ligands was assessed using a heterozygous hTFR KI / + Testing is done in knock-in mice (described herein above).
[0473] treatment hTFRKI / + knock-in mice were divided into groups of 2-4 mice each. Each mouse received a single intravenous (iv) or subcutaneous (sc) dose of conjugated modified oligonucleotide or conjugated RNAi compound. Groups of 4 mice received PBS as a negative control.
[0474] RNA analysis Mice are sacrificed one week after administration. For quantitative real-time RTPCR analysis to measure the amount of mouse target RNA, RNA is extracted from various muscle tissues, including quadriceps, gastroc, heart, and liver. Mouse target RNA levels are normalized to mouse GAPDH. Mouse GAPDH is amplified using primer probe set mGapdh_LTS00102 (described hereinabove).
Claims
1. 1. An oligomeric compound comprising a modified oligonucleotide and a conjugate group, said modified oligonucleotide consisting of 10 to 300 linked nucleosides; the conjugate group comprises a bicyclic ligand and a conjugate linker; the bicyclic ligand comprises a polypeptide consisting of 13 to 22 linked amino acids or amino acid mimetics, and a molecular scaffold; wherein the first, second, and third amino acids of the polypeptide each comprise a reactive group, each of which separately forms a bond with the molecular scaffold, thereby forming two polypeptide loops attached to the molecular scaffold; a portion of the bicyclic ligand binds to the transferrin type 1 receptor; the modified oligonucleotide is covalently attached to the bicyclic ligand via the conjugate linker; The oligomeric compound.
2. the conjugate group consists of the bicyclic ligand and a conjugate linker; and / or 2. The oligomeric compound of claim 1, wherein the oligomeric compound consists of the modified oligonucleotide and the conjugate group.
3. 2. The oligomeric compound of claim 1, wherein the three reactive groups are each a thiol of a cysteine.
4. The polypeptide has, from N-terminus to C-terminus, the following formula: [B] n - [Z i ]-[J] m - [Z ii ]-[O] o - [Z iii ]-[U] p wherein Z i , Z ii , and Z iii are the first, second, and third amino acids containing a reactive group; each B, J, O, and U is independently a selected amino acid or amino acid mimetic; n is 0 to 5; m is 3 to 7; o is 3 to 7; p is 0 to 5; the sum of m+o is less than 12; Optionally: (i) m is 7 and o is 3; or (ii) m is 2 and o is 9; or (iii) m and o are both 6; or (iv) m is 3 and o is 8; and / or (a) n is 0; or (b) n is 3 or 4; and / or (I) p is 0; or (II) p is 3 or 4; The oligomeric compound of claim 1.
5. 10. The oligomeric compound of claim 1, wherein the polypeptide has an N-terminal modification: Optionally: (i) the N-terminal modification is an acetyl group; or (ii) the N-terminal modification is an azidopropyl group; or, the polypeptide has a C-terminal modification; optionally, the C-terminal modification is an amide group. The oligomeric compound.
6. the conjugate linker is attached to the N-terminal amino acid of the bicyclic ligand; and / or the conjugate linker is attached to the C-terminal amino acid of the bicyclic ligand; and / or the conjugate linker is attached to the side chain of an amino acid within one of the polypeptide loops of the bicyclic ligand; and / or the bicyclic ligand comprises a C-terminal extension, optionally the C-terminal extension is selected from PEG10 or PEG24; and / or the bicyclic ligand comprises an N-terminal extension, optionally wherein the N-terminal extension is selected from PEG10 or PEG24; The oligomeric compound of claim 1. (i) the conjugate group is attached to the 5'-terminal nucleoside of the modified oligonucleotide; optionally, the conjugate group is attached to the 5'-position of the 5'-terminal nucleoside of the modified oligonucleotide; or (ii) the conjugate group is attached to the 3'-terminal nucleoside of the modified oligonucleotide; optionally, the conjugate group is attached to the 3'-position of the 3'-terminal nucleoside of the modified oligonucleotide; or (iii) the conjugate group is attached to an internal nucleoside of the modified oligonucleotide; or (iv) the conjugate group is attached via a modified internucleoside linkage; Optionally in any of (i) to (iv), the conjugate group is attached via a 2'-modified furanosyl sugar moiety; The oligomeric compound of claim 1.
8. the bicyclic ligand has an amino acid sequence having at least 80% identity to any of SEQ ID NOs: 26-27, 36-56, 58-65, 67-76, 79-88, 90-152, or 192-246; Optionally, the bicyclic ligand has an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity to any of SEQ ID NOs: 26-27, 36-56, 58-65, 67-76, 79-88, 90-152, or 192-246. The oligomeric compound of claim 1.
9. [Z i ]-[J] m - [Z ii ]-[O] o - [Z iii ] has an amino acid sequence having at least 85%, at least 90%, at least 95%, or 100% identity to any of SEQ ID NOs: 26-27, 35-56, 58-65, 67-76, 79-88, 90-152, or 192-246; and / or [Z i ]-[J] m - [Z ii ]-[O] o - [Z iii ] has an amino acid sequence of CXXDXXXGCISYC (SEQ ID NO:35), wherein each "X" is an independently selected amino acid; The oligomeric compound of claim 4.
10. the bicyclic ligand comprises at least one, at least two, or at least three unnatural amino acids; Optionally, the at least one unnatural amino acid is selected from the group consisting of a D-amino acid, allo-isoleucine, 2-amino-3-ethyl-pentanoic acid, aminoisobutyric acid, aminobutyric acid, azetidine, 7-azatryptophan, 6-azidolysine, β-cyclobutylalanine, β-methylisoleucine, 4,4-biphenylalanine, cis-hydroxyproline, cyclobutylglycine, cyclohexylglycine, cyclopentylalanine, cyclopentylglycine, 2,6-dimethyltyrosine, 3,3-diphenyl selected from alanine, 4-trans-hydroxy-L-proline, 1-naphthylalanine, 2-naphthylalanine, N-methylalanine, 1-methylhistidine, 3-methylhistidine, N-methyl-tryptophan, pipecolic acid, 4-pyridylalanine, sarcosine, t-butylalanine, or 3-t-butyltyrosine; optionally, the at least one unnatural amino acid is selected from 4-trans-hydroxy-L-proline, 6-azidolysine, and t-butylglycine; and / or The molecular scaffold comprises: (i) 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triplop-2-en-1-one (TATA); or (ii) 1,1′,1″-(1,3,5-triazinane-1,3,5-triyl)tris(2-bromoethanone) (TATB); and / or the bicyclic ligand does not inhibit the binding of transferrin to the transferrin receptor; The oligomeric compound of claim 1.
11. The bicyclic ligand of claim 1, wherein the bicyclic ligand has the following structure: 【Chemical 1】 or a salt thereof, The oligomeric compound of claim 1.
12. at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety; Optionally, at least one modified sugar moiety comprises a bicyclic sugar moiety; optionally, said bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-; and / or at least one modified sugar moiety comprises a non-bicyclic modified sugar moiety; optionally, said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety; and / or wherein at least one nucleoside of said modified oligonucleotide compound comprises a sugar surrogate; The oligomeric compound of claim 1.
13. (a) the modified oligonucleotide comprises at least one modified internucleoside linkage; optionally: (i) at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; or each internucleoside linkage is a modified internucleoside linkage; optionally, each internucleoside linkage is a phosphorothioate internucleoside linkage; or (ii) at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage; or (b) the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage, and / or each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage; and / or the modified oligonucleotide comprises at least one modified internucleoside linkage, optionally, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; The oligomeric compound of claim 1.
14. each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage; or each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage or a mesyl phosphoramidate internucleoside linkage; 14. The oligomeric compound of claim 13.
15. the modified oligonucleotide comprises at least one modified nucleobase; optionally, the modified nucleobase is 5-methylcytosine. The oligomeric compound of claim 1.
16. the modified oligonucleotide comprises a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides; Optionally, each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside; and / or the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides; and / or each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety; and / or the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and on the 3' side to a 3' region consisting of 1 to 6 linked 3' region nucleosides, the 3'-most nucleoside of the 5' region comprising a modified sugar moiety and the 5'-most nucleoside of the 3' region comprising a modified sugar moiety; optionally, each nucleoside of the 3' region comprises a modified sugar moiety and / or each nucleoside of the 5' region comprises a modified sugar moiety; The oligomeric compound of claim 1.
17. The modified oligonucleotide has a sugar motif, the sugar motif comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; an internal region consisting of 6 to 10 linked internal region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and each of the internal region nucleosides is selected from 2'-deoxynucleosides and 2'-substituted nucleosides; Optionally, The modified oligonucleotide has a sugar motif, the sugar motif comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; an internal region consisting of 6 to 10 linked internal region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; each of the 5'-region nucleosides and each of the 3'-region nucleosides is a cEt nucleoside or a 2'-MOE nucleoside, and each of the internal region nucleosides is a 2'-β-D-deoxynucleoside; The oligomeric compound of claim 1.
18. each nucleoside of said modified oligonucleotide comprises a 2'-sugar moiety; Optionally, each 2'-sugar moiety is selected from 2'-OMe, 2'-MOE, or 2'-NMA; and / or each nucleoside of the modified oligonucleotide contains the same 2'-sugar moiety; The oligomeric compound of claim 1.
19. the conjugate linker is cleavable; and / or (i) the conjugate linker comprises 1 to 3 linker nucleosides; or (ii) the conjugate linker does not contain any linker nucleosides; and / or The conjugate group is: (a) 【Chemistry 2】 ; (b) 【Chemistry 3】 ; (c) 【Chemistry 4】 ; (d) 【Chemistry 5】 、 Optionally, 【Chemistry 6】 ; (e) 【Chemistry 7】 ; (f) 【Chemistry 8】 ; (g) 【Chemistry 9】 ; or (h) 【Chemistry 10】 、 Including, The oligomeric compound of claim 1.
20. The conjugate group: 【Chemistry 11】 2. The oligomeric compound of claim 1 comprising:
21. 2. The oligomeric compound of claim 1, wherein the modified oligonucleotide is complementary to a target nucleic acid expressed in muscle.
22. 2. The oligomeric compound of claim 1, wherein the modified oligonucleotide is a guide RNA, a tracrRNA, or a scout RNA.
23. 2. The oligomeric compound of claim 1, wherein the modified oligonucleotide is complementary to the complement of a target nucleic acid expressed in muscle.
24. the target nucleic acid is associated with a muscle disorder; and / or the target nucleic acid is selected from CaMK2d, NLRP3, PLN, DMD, DMPK, DNM2, DUX4, or HPRT; and / or the muscle target nucleic acid has a sequence selected from any of SEQ ID NOs: 1-15; and / or the target nucleic acid is expressed in at least one of the following tissues: skeletal muscle (including, but not limited to, quadriceps, gastrocnemius, tibialis anterior, triceps, masseter, extensor digitorum longus (EDL), soleus, diaphragm), heart, sciatic nerve, aorta, or liver; 22. The oligomeric compound of claim 21.
25. the nucleobase sequence of said modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 167-191; and / or The modified oligonucleotide may be 10-25, 10-30, 12-20, 12-25, 12-30, 13-20, 13-25, 13-30, 14-20, 14-25, 14-30, 15-20, 15-25, 15-30, 16-18, 16-20, 16-25, 16-30, 17-20, 17-25, 17-30, 18-20, 18 25, 18-30, 19-20, 19-25, 19-30, 20-25, 20-30, 21-25, 21-30, 21-50, 22-25, 22-30, 23-25, 23-30, 20-100, 40-100, 50-100, 50-200, 100-300, 150-300, or 200-300 linked nucleosides; The oligomeric compound of claim 1.
26. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second compound oligomer comprising a second modified oligonucleotide consisting of 16 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide, and the second oligomeric compound is an oligomeric compound according to any one of claims 1 to 21 or 25. The oligomeric duplex.
27. (i) the first modified oligonucleotide is complementary to a target nucleic acid in muscle; and / or (ii) at least one nucleoside of said second modified oligonucleotide comprises a modified sugar moiety; Optionally, the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety; optionally, the bicyclic sugar moiety of the second modified oligonucleotide is -O-CH 2 - and -O-CH(CH 3 )-; Optionally, the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety; optionally, the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety; and / or; (a) at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate; or (b) at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage; optionally, at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage; 27. The oligomeric duplex of claim 26.
28. at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage; and / or each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage; and / or said second modified oligonucleotide comprises at least one modified nucleobase; optionally, said modified nucleobase of said second modified oligonucleotide is 5-methylcytosine; and / or; (a) said first oligomeric compound comprises a 5' stabilizing phosphate group; optionally, said 5' stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; or (b) said second oligomeric compound comprises a 5′ stabilizing phosphate group; optionally, said stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; and / or; (i) the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate; (ii) the first modified oligonucleotide comprises a 2'-NMA sugar moiety; (iii) the second modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate; and / or (iv) the second modified oligonucleotide compound comprises a 2'-NMA sugar moiety; 27. The oligomeric duplex of claim 26.
29. 27. A composition for a method of modulating a nucleic acid target in a subject, the method comprising administering to the subject an oligomeric compound of claim 1 or an oligomeric duplex of claim 26.
30. 30. The composition of claim 29, wherein the nucleic acid target is expressed in at least one of the following tissues: skeletal muscle (including, but not limited to, quadriceps, gastrocnemius, tibialis anterior, triceps, masseter, extensor digitorum longus (EDL), soleus, diaphragm), heart, sciatic nerve, aorta, or liver; and / or (i) administration of the oligomeric compound of claim 1 or the oligomeric duplex of claim 26 results in depletion of said nucleic acid target; or (ii) administration of the oligomeric compound of claim 1 or the oligomeric duplex of claim 26 results in altered splicing of said nucleic acid target; and / or; (a) the oligomeric compound or oligomeric duplex is administered by intravenous or subcutaneous administration; or (b) the oligomeric compound or oligomeric duplex is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, 350 mg, 360 mg, 370 mg, 380 mg, 390 mg, 400 mg, 410 mg, 420 mg, 430 mg, 440 mg, 450 mg, 460 mg, 470 mg, 480 mg, 490 mg, 500 mg, 510 mg, 520 mg, 530 mg, 540 mg, 550 mg, 560 mg, 570 mg, 580 mg, 590 mg, 600 mg, 610 mg, 620 mg, 630 mg, 640 mg, 650 mg, 660 mg, 670 mg, 680 mg, 6 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, or 350 mg; and / or the method comprises administering the oligomeric compound or oligomeric duplex once every 4 weeks, once every 6 weeks, once every 8 weeks, once every 12 weeks, once every 16 weeks, once every 20 weeks, once every 24 weeks, once every 6 months, or once yearly. The composition.
31. 1. A bicyclic ligand specific for transferrin receptor 1 (TfR1), comprising an amino acid sequence selected from CP[HyP]DAYLGC[tBuGly]SYCEPWK (SEQ ID NO:245, referred to herein as BCY21757) and CP[HyP]DAYLGC[tBuGly]SYCEPWC (SEQ ID NO:246, referred to herein as BCY21758), wherein HyP represents trans-4-hydroxy-L-proline and tBuGly represents t-butyl-glycine. The bicyclic ligand.
32. 32. The bicyclic ligand of claim 31 , (i) the bicyclic ligand comprises an N-terminal acetyl group and a C-terminal CONH 2 group; and / or the bicyclic ligand is a pharmaceutically acceptable salt; optionally, the pharmaceutically acceptable salt is selected from a sodium salt, a potassium salt, a calcium salt, or an ammonium salt; or, (ii) the first, second, and third cysteine residues in the peptide ligand are covalently attached to a molecular scaffold such that two polypeptide loops are formed on the molecular scaffold; optionally, the molecular scaffold is 1,1',1"-(1,3,5-triazinane-1,3,5-triyl)triprop-2-en-1-one (TATA); The bicyclic ligand.