Immune cells with co-expressed shRNA and logic gate system

Abstract

Provided herein are recombinant nucleic acids encoding chimeric priming receptors that bind ALPG / P, chimeric antigen receptors that bind MSLN, and shRNAs that target FAS, PTPN2, and / or TOX. Also provided are systems for the chimeric priming receptors that bind ALPG / P, chimeric antigen receptors that bind MSLN, and shRNAs that target FAS, PTPN2, and / or TOX, cells that express such proteins and shRNAs, and methods of their use.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 255,887, filed October 14, 2021, U.S. Provisional Application No. 63 / 255,889, filed October 14, 2021, U.S. Provisional Application No. 63 / 255,891, filed October 14, 2021, and U.S. Provisional Application No. 63 / 303,422, filed January 26, 2022, each of which is incorporated by reference herein in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy was created in XX / 20XX, is named XXXXXUS_sequencelisting.xml, and is X,XXX,XXX bytes in size. [Background technology]

[0003] background Cancer is a disease characterized by the uncontrolled proliferation of cells. Many approaches to treating cancer have been attempted, including drug and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells the new ability to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.

[0004] Immunotherapy using CAR-T cells holds promise because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them.

[0005] After engineering T cells with CARs, the resulting CAR-T cells are introduced into patients to attack tumor cells. CAR-T cells can be derived either from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). When CAR-T cells are infused into a patient, they come into contact with target antigens on cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate anti-tumor cytokine production, and target tumor cell killing.

[0006] However, several concerns and limitations remain with CAR-T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of the target antigen, resulting in off-target toxicity. However, several limitations remain with CAR-T cell-based immunotherapy. Furthermore, CAR-T cells may lack peripheral blood survival, have reduced proliferation and effector function, be susceptible to suppression and exhaustion, and may not result in memory T cell persistence. Therefore, additional therapies that target intrinsic pathways, for example, to reduce off-target toxicity, are needed to address these obstacles. Summary of the Invention

[0007] overview

[0006] In one aspect, provided herein are one or more recombinant nucleic acids encoding a first chimeric polypeptide comprising a priming receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), and at least one nucleic acid sequence at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0008] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds germline alkaline phosphatase (ALPG / P).

[0009] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6.

[0010] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds mesothelin (MSLN), and the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16.

[0011] In some embodiments, the at least one nucleic acid sequence comprises each of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39; and (2) a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40.

[0012] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds mesothelin (MSLN).

[0013] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16.

[0014] In some embodiments, the second extracellular antigen-binding domain comprises a single domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12.

[0015] In one aspect, the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds placental / germline alkaline phosphatase (ALPG / P), wherein the first extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, and CDR-L1 comprises the sequence set forth in SEQ ID NO: 4. wherein CDR-L2 comprises the sequence set forth in SEQ ID NO:5 and CDR-L3 comprises the sequence set forth in SEQ ID NO:6; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0016] In some embodiments, the first extracellular antigen binding domain VH chain sequence comprises the sequence set forth in SEQ ID NO:7.

[0017] In some embodiments, the first extracellular antigen binding domain VL chain sequence comprises the sequence set forth in SEQ ID NO:8.

[0018] In some embodiments, the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO:9.

[0019] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds mesothelin (MSLN).

[0020] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16.

[0021] In some embodiments, the second extracellular antigen-binding domain VH comprises the sequence set forth in SEQ ID NO:17.

[0022] In some embodiments, the second extracellular antigen-binding domain comprises a single domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12.

[0023] In some embodiments, the second extracellular antigen-binding domain VHH chain sequence comprises the sequence set forth in SEQ ID NO:13.

[0024] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40.

[0025] In some embodiments, the recombinant nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 168, 167, or 166.

[0026] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0027] In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39.

[0028] In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:40.

[0029] In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0030] In one aspect, provided herein is one or more recombinant nucleic acids comprising: a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40.

[0031] In one aspect, provided herein is one or more recombinant nucleic acids comprising: a first nucleic acid at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid at least 15 nucleotides in length that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0032] In some embodiments, the first, second and third nucleic acid sequences are at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

[0033] In some embodiments, the first, second, and third nucleic acid sequences are short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), or antisense oligonucleotides.

[0034] In some embodiments, the first, second, and third nucleic acid sequences are shRNAs.

[0035] In some embodiments, the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71.

[0036] In some embodiments, the first nucleic acid sequence comprises the sequence set forth in SEQ ID NO:49.

[0037] In some embodiments, the first nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0038] In some embodiments, the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97.

[0039] In some embodiments, the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:82.

[0040] In some embodiments, the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97.

[0041] In some embodiments, the first nucleic acid sequence comprises the sequence set forth in SEQ ID NO:49 and the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:82.

[0042] In some embodiments, the second nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0043] In some embodiments, the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98-125.

[0044] In some embodiments, the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:99 or 104.

[0045] In some embodiments, the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98-125.

[0046] In some embodiments, the first nucleic acid sequence comprises the sequence set forth in SEQ ID NO:49 and the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:99 or 104.

[0047] In some embodiments, the second nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0048] In one aspect, the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular antigen binding domain that specifically binds mesothelin (MSLN), wherein the extracellular antigen binding domain comprises a single domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12. and a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0049] In some embodiments, the VHH chain sequence comprises the sequence set forth in SEQ ID NO:13.

[0050] In one aspect, the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular antigen binding domain that specifically binds mesothelin (MSLN), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16. Provided herein are one or more recombinant nucleic acids encoding a second chimeric polypeptide and a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0051] In some embodiments, the VH comprises the sequence set forth in SEQ ID NO:17.

[0052]

[0010] In one aspect, provided herein is one or more recombinant nucleic acids encoding: a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds germline alkaline phosphatase (ALPG / P); a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen-binding domain that specifically binds mesothelin (MSLN); and a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0053] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40.

[0054] In some embodiments, the recombinant nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 168, 167, or 166.

[0055] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0056] In some embodiments, the first and second nucleic acid sequences are at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0057] In some embodiments, the first and second nucleic acids are short hairpin RNAs (shRNAs), small interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), or antisense oligonucleotides.

[0058] In some embodiments, the first and second nucleic acids are shRNAs.

[0059] In some embodiments, the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71.

[0060] In some embodiments, the first nucleic acid sequence comprises the sequence set forth in SEQ ID NO:49.

[0061] In some embodiments, the first nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0062] In some embodiments, the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97.

[0063] In some embodiments, the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:82.

[0064] In some embodiments, the second nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0065] In some embodiments, the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98-125.

[0066] In some embodiments, the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:99 or 104.

[0067] In some embodiments, the second nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0068] In some embodiments, the priming receptor comprises, from N-terminus to C-terminus, a first extracellular antigen-binding domain, a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites, and an intracellular domain comprising a human or humanized transcriptional effector, wherein binding of ALPG / P by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites.

[0069] In some embodiments, the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain.

[0070] In some embodiments, the first hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0071] In some embodiments, the first hinge comprises the sequence set forth in SEQ ID NO:18.

[0072] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.

[0073] In some embodiments, the first transmembrane domain comprises the sequence set forth in SEQ ID NO:19.

[0074] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0075] In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:23.

[0076] In some embodiments, the priming receptor further comprises a translocation blocking sequence between the first transmembrane domain and the intracellular domain.

[0077] In some embodiments, the translocation-blocking sequence comprises the sequence set forth in SEQ ID NO:20.

[0078] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO:24.

[0079] In some embodiments, the CAR comprises, from N-terminus to C-terminus, a second extracellular antigen-binding domain, a second transmembrane domain, an intracellular costimulatory domain, and an intracellular activation domain.

[0080] In some embodiments, the second extracellular antigen-binding domain specifically binds mesothelin (MSLN), and the second extracellular antigen-binding domain comprises a single-domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12.

[0081] In some embodiments, the VHH chain sequence comprises the sequence set forth in SEQ ID NO:13.

[0082] In some embodiments, the second extracellular antigen-binding domain specifically binds mesothelin (MSLN), and the extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16.

[0083] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:17.

[0084] In some embodiments, the CAR comprises a second hinge domain.

[0085] In some embodiments, the second hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0086] In some embodiments, the second transmembrane domain comprises a CD8α transmembrane domain.

[0087] In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain.

[0088] In some embodiments, the intracellular activation domain comprises a CD3 zeta domain.

[0089] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 30 or 31.

[0090] In some embodiments, when a single target cell expresses each of ALPG / P and MSLN, the priming receptor and CAR are capable of binding to the target cell.

[0091] In some embodiments, the target cell is a human cell.

[0092] In some embodiments, the target cells are cancer cells.

[0093] In some embodiments, the cancer cells are solid cancer cells or liquid cancer cells.

[0094] In some embodiments, the cancer cells are ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.

[0095] In some embodiments, a recombinant nucleic acid comprises two or more nucleic acid fragments.

[0096] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

[0097] In some embodiments, the recombinant nucleic acid further comprises a first constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0098] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0099] In some embodiments, the recombinant nucleic acid further comprises a second constitutive promoter operably linked to the nucleotide sequence encoding the first nucleic acid complementary to human FAS.

[0100] In some embodiments, the recombinant nucleic acid further comprises a second constitutive promoter operably linked to a nucleotide sequence encoding a second nucleic acid that is complementary to human PTPN2 or TOX.

[0101] In some embodiments, the recombinant nucleic acid further comprises a second constitutive promoter operably linked to a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a second nucleic acid complementary to human PTPN2 or TOX.

[0102] In some embodiments, the recombinant nucleic acid comprises, from 5' to 3', a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS, human PTPN2, or human TOX; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0103] In some embodiments, the recombinant nucleic acid comprises, from 5' to 3', a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS; a nucleotide sequence encoding a second first nucleic acid that is complementary to human PTPN2 or TOX; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0104] In some embodiments, the recombinant nucleic acid comprises, from 5' to 3', an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS; a nucleotide sequence encoding a second first nucleic acid that is complementary to human PTPN2 or TOX; the first constitutive promoter; and a nucleotide sequence encoding a priming receptor.

[0105] In some embodiments, the nucleotide sequence encoding the priming receptor comprises the sequence set forth in SEQ ID NO:36.

[0106] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 37 or 38.

[0107] In some embodiments, the recombinant nucleic acid further comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm, wherein the 5' homology-directed repair arm and the 3' homology-directed repair arm are complementary to the insertion site in the host cell chromosome.

[0108] In some embodiments, the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-cleaving 2A peptide (P2A).

[0109] In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0110] In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the priming receptor.

[0111] In some embodiments, the recombinant nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).

[0112] In some embodiments, the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor, or the WPRE is at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0113] In some embodiments, the recombinant nucleic acid further comprises an SV40 polyA element.

[0114] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector.

[0115] In some embodiments, the expression vector is a non-viral vector.

[0116] In one aspect, provided herein is an expression vector comprising a recombinant nucleic acid disclosed herein.

[0117] In some embodiments, the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

[0118] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0119] In some embodiments, the GHS locus is the GS94 locus.

[0120] In one aspect, provided herein is an immune cell comprising at least one recombinant nucleic acid(s) disclosed herein and / or a vector disclosed herein.

[0121] In some embodiments, the immune cells are primary human immune cells.

[0122] In some embodiments, the primary human immune cells are autologous immune cells.

[0123] In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors.

[0124] In some embodiments, the primary immune cells are primary T cells.

[0125] In some embodiments, the primary immune cells are primary human T cells.

[0126] In some embodiments, the primary immune cells are virus-free.

[0127] In some embodiments, the immune cells are autoimmune cells.

[0128] In some embodiments, the immune cells are allogeneic immune cells.

[0129]

[0010] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid, the at least one recombinant nucleic acid comprising: a priming receptor comprising a first extracellular antigen-binding domain that specifically binds ALPG / P; and a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds MSLN; a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39; and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41; wherein the recombinant nucleic acid is inserted within a target region in the genome of the primary immune cell; and the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0130]

[0013] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid(s), wherein the at least one recombinant nucleic acid(s) comprises a first nucleic acid comprising the sequence set forth in SEQ ID NO: 49 and a second nucleic acid comprising the sequence set forth in SEQ ID NO: 82, and is inserted within a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid(s) into the primary immune cell.

[0131]

[0013] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid(s), wherein the at least one recombinant nucleic acid(s) comprises a first nucleic acid comprising the sequence set forth in SEQ ID NO: 49 and a second nucleic acid comprising the sequence set forth in SEQ ID NO: 99 or 104, and is inserted within a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0132] In one aspect, a virus-free viable primary cell comprising a ribonucleoprotein (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to ALPG / P, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to MSLN, and a first nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39. Provided herein are virus-free viable primary cells encoding a first nucleic acid sequence and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40, or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

[0133] In one aspect, provided herein is a virus-free viable primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprise a first nucleic acid comprising the sequence set forth in SEQ ID NO: 49 and a second nucleic acid comprising the sequence set forth in SEQ ID NO: 82, and wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0134] In one aspect, provided herein is a virus-free viable primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprise a first nucleic acid comprising the sequence set forth in SEQ ID NO: 49 and a second nucleic acid comprising the sequence set forth in SEQ ID NO: 99 or 104, and wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0135] In some embodiments, the cells comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 168, 167, or 166.

[0136] In some embodiments, the first nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the first nucleic acid.

[0137] In some embodiments, expression of FAS in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the first nucleic acid.

[0138] In some embodiments, the second nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0139] In some embodiments, expression of PTPN2 in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0140] In some embodiments, the second nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0141] In some embodiments, expression of TOX in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0142] In some embodiments, expression of FAS, PTPN2 and / or TOX is determined by a nucleic acid assay or a protein assay.

[0143] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0144] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

[0145] In one aspect, provided herein is a population of cells comprising a plurality of immune cells disclosed herein.

[0146] In one aspect, provided herein is a pharmaceutical composition comprising an immune cell disclosed herein or a population of cells disclosed herein and a pharmaceutically acceptable excipient.

[0147] In one aspect, provided herein is a pharmaceutical composition comprising a recombinant nucleic acid disclosed herein or a vector disclosed herein and a pharmaceutically acceptable excipient.

[0148] In one embodiment, there is provided a method for editing immune cells, comprising: providing a ribonucleoprotein (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a recombinant nucleic acid disclosed herein, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of an immune cell; non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; editing an immune cell via insertion of a recombinant nucleic acid disclosed herein into an insertion site in the genome of the immune cell; A method is provided herein, comprising:

[0149] In some embodiments, the non-viral introducing comprises electroporation.

[0150] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0151] In some embodiments, the target region of the cell's genome is the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0152] In some embodiments, the GSH locus is the GS94 locus.

[0153] In some embodiments, the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.

[0154] In some embodiments, the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, and optionally, the circular recombinant nucleic acid is a plasmid.

[0155] In some embodiments, the immune cells are primary human immune cells.

[0156] In some embodiments, the immune cells are allogeneic immune cells.

[0157] In some embodiments, the immune cells are autoimmune cells.

[0158] In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0159] In some embodiments, the immune cells are primary T cells.

[0160] In some embodiments, the immune cells are primary human T cells.

[0161] In some embodiments, the immune cells are virus-free.

[0162] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the recombinant nucleic acid in vitro.

[0163] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell disclosed herein or a pharmaceutical composition disclosed herein.

[0164] In some embodiments, the disease is cancer.

[0165] In some embodiments, the cancer is a solid or liquid cancer.

[0166] In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.

[0167] In some embodiments, administration of the immune cells enhances an immune response in the subject.

[0168] In some embodiments, the enhanced immune response is an adaptive immune response.

[0169] In some embodiments, the enhanced immune response is an innate immune response.

[0170] In some embodiments, the enhanced immune response is increased expression of at least one cytokine or chemokine.

[0171] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ.

[0172] In some embodiments, the method further comprises administering to the subject an immunotherapy, either simultaneously with or after the immune cells.

[0173] In one aspect, provided herein is a method of inhibiting target cells in a subject, the method comprising administering to the subject an immune cell disclosed herein, wherein the immune cell inhibits the target cells.

[0174] In some embodiments, the target cells express ALPG / P and MSLN.

[0175] In some embodiments, the target cells are cancer cells.

[0176] In one aspect, provided herein is a method of inducing expression of a chimeric antigen receptor in an immune cell with a priming receptor, the method comprising: obtaining an immune cell, wherein the immune cell comprises a recombinant nucleic acid disclosed herein and / or a vector disclosed herein; and contacting the immune cell with a target cell expressing ALPG / P and MSLN, wherein binding of the priming receptor to ALPG / P on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor.

[0177] In one aspect, provided herein is a method of modulating the activity of an immune cell, the method comprising obtaining an immune cell, wherein the immune cell comprises a recombinant nucleic acid disclosed herein and / or a vector disclosed herein, and contacting the immune cell with a target cell expressing ALPG / P and MSLN, wherein binding of a priming receptor to ALPG / P on the target cell induces activation of the priming receptor and expression of a chimeric antigen receptor, and binding of the chimeric antigen receptor to MSLN on the target cell modulates the activity of the immune cell.

[0178] In some embodiments, modulating immune cell activity comprises enhancing an immune response.

[0179] In some embodiments, the enhanced immune response is an adaptive immune response.

[0180] In some embodiments, the enhanced immune response is an innate immune response.

[0181] In some embodiments, the immune cell activity is increased expression of at least one cytokine or chemokine.

[0182] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ.

[0183] In some embodiments, expression of FAS in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the first nucleic acid.

[0184] In some embodiments, expression of PTPN2 in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0185] In some embodiments, expression of TOX in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the second nucleic acid.

[0186] In some embodiments, expression of FAS, PTPN2 and / or TOX in immune cells is determined by a nucleic acid assay or a protein assay.

[0187] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0188] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation. [Brief explanation of the drawings]

[0189] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings.

[0190] [Figure 1] Schematic of logic gate expression in a T cell activation assay.

[0191] [Figure 2] We provide flow cytometry data showing that T cells expressing both logic gates (LG1 and LG3) exhibited priming receptor expression but minimal CAR expression in the absence of priming antigen stimulation and in the presence of T cell activation stimulation.

[0192] [Figure 3] A shows no cytotoxicity observed from RNP-only negative control T cells. B shows minimal Logic Gate-expressing T cell activity against single-antigen-positive K562-ALPG cells. C shows no Logic Gate-expressing T cell activity against single-antigen-positive K562-MSLN cells. D shows tumor-specific activity in Logic Gate-expressing T cells.

[0193] [Figure 4] 1 shows that logic gate 1 T cells exhibited both more rapid and more complete killing of K562-ALPG / MSLN target cells relative to logic gate 3 T cells.

[0194] [Figure 5] Figure 1A shows cytokine production by logic gate-expressing T cells (LG1 and LG3), CAR-expressing T cells, or negative control cells after incubation with K562 cell line. Figure 1B shows cytokine production by logic gate-expressing T cells (LG1 and LG3), CAR-expressing T cells, or negative control cells after incubation with K562MSLN cell line. Figure 1C shows cytokine production by logic gate-expressing T cells (LG1 and LG3), CAR-expressing T cells, or negative control cells after incubation with K562ALPG cell line. Figure 1D shows cytokine production by logic gate-expressing T cells (LG1 and LG3), CAR-expressing T cells, or negative control cells after incubation with K562ALPG / MSLN cell line.

[0195] [Figure 6]A shows ALPG expression in AsPC-1 cells, K562ALPG / MSLN cells, and K562-EFG cells. B shows ALPG IHC staining in AsPC-1 cells and primary ovarian cancer tumors.

[0196] [Figure 7] A shows MSLN expression in AsPC-1 cells, K562ALPG / MSLN cells, and K562-EFG cells. B shows ALPG IHC staining in AsPC-1 cells and primary ovarian cancer tumors.

[0197] [Figure 8] A shows ALPG expression in K562ALPG low- and high-expressing cells. B shows ALPG expression in K562ALPG low- and high-expressing cells, AsPC-1 cells, and K562-EFG cells. C shows priming receptor and CAR expression on engineered T cells before and after incubation with K562ALPG low- and high-expressing cells.

[0198] [Figure 9] (A) shows ALPG expression in SKOV3-EFG cells, K562ALPG / MSLN cells, and K562 EFG cells. (B) shows MSLN expression in SKOV3-WT cells, K562ALPG / MSLN cells, and K562 EFG cells. (C) shows IL-2 cytokine production after incubating T cells expressing the indicated LG or CAR with SKOV3-EFG cells. (D) shows IFNγ cytokine production after incubating T cells expressing the indicated LG or CAR with SKOV3-EFG cells.

[0199] [Figure 10] A shows ALPG expression on ovarian cancer samples. B shows MSLN expression on ovarian cancer samples. C shows dose assays for percent target cell killing and increasing percentage of ALPG-negative cells incubated with T cells expressing the indicated logic gate or CAR.

[0200] [Figure 11] A shows IL-2 cytokine production after incubation of logic gate-expressing or CAR-expressing T cells with target cells in the presence of CA125. B shows IL-2 cytokine production after incubation of logic gate-expressing or CAR-expressing T cells with target cells in the presence of MSLN.

[0201] [Figure 12] A shows tumor volume in a K562 dual flank model in a K562MSLN tumor, which models a healthy mesothelium, after treatment with a constitutive CAR. B shows tumor volume in a K562ALPG / MSLN tumor, which models an on-target tumor, after treatment with a constitutive CAR. C shows tumor volume in a K562MSLN tumor after treatment with logic gate 1 T cells. D shows tumor volume in a K562ALPG / MSLN tumor after treatment with logic gate 1 T cells. E shows tumor volume in a K562MSLN tumor after treatment with logic gate 3 T cells. F shows tumor volume in a K562ALPG / MSLN tumor after treatment with logic gate 3 T cells. In each figure, the bottom line shows tumor volume after treatment with the indicated T cells, and the top line shows tumor volume after treatment with control T cells.

[0202] [Figure 13] A shows tumor volume in the MSTO model after treatment with a low dose of the indicated engineered T cells. B shows tumor volume after treatment with a medium "stress" dose of the indicated engineered T cells. A shows tumor volume after treatment with a high dose of the indicated engineered T cells. D shows T cell proliferation in blood samples after treatment with the indicated T cells.

[0203] [Figure 14](A) Flow analysis of T cells found in peripheral blood after treatment with control T cells; (B) Flow analysis of T cells found in peripheral blood after treatment with a medium dose of CAR1-expressing T cells; (C) Flow analysis of T cells found in peripheral blood after treatment with a medium dose of LG1-expressing T cells; (D) Flow analysis of T cells found in peripheral blood after treatment with a high dose of LG1-expressing T cells, CAR-expressing T cells, or negative control cells.

[0204] [Figure 15] A shows the percentage of edited cells with the indicated shRNA after 9 days of growth. B shows the total edited cells with the indicated shRNA after 9 days of growth.

[0205] [Figure 16] Targeted gene knockdown of both indicated genes when used in combination is shown.

[0206] [Figure 17] (A) The shRNA module targeting FAS, PTPN2, and TOX provides stable knockdown of FAS under quiescent conditions for at least 7 weeks after editing. (B) FAS, PTPN2, and NR4A1 protein levels were also significantly reduced 6 days after editing.

[0207] [Figure 18] 1 shows that target gene knockdown in T cells was maintained over chronic stimulation.

[0208] [Figure 19] A shows that there was strong FAS knockdown in cells from the shRNA. B shows that T cells with FAS knockdown retained over 80% viability when normalized to T cells with control shRNA only after 24 hours of treatment with anti-FAS activating antibody.

[0209] [Figure 20]1 shows that T cells engineered with combinatorial shRNA modules showed no evidence of an increased risk of transformation.

[0210] [Figure 21] Figure 1 shows that T cells engineered with combinatorial shRNA modules showed no evidence of reduced cytotoxic activity over a 48-hour luciferase assay in the target antigen-expressing K562 cell line.

[0211] [Figure 22] 10 shows that T cells engineered with the shRNA knockdown module showed no evidence of reduced cytotoxic activity over a 48 hour Incucyte assay on the target antigen-expressing MSTO cell line.

[0212] [Figure 23] Cumulative T cell proliferation during chronic antigen stimulation after shRNA knockdown of the indicated targets is shown.

[0213] [Figure 24] A. T cells engineered with an shRNA module targeting PTPN2 exhibited a cell cycle signature after chronic antigen stimulation. B. T cells engineered with an shRNA module targeting PTPN2 exhibited a cell cycle signature after chronic antigen stimulation.

[0214] [Figure 25] Interferon gamma expression in T cells after shRNA knockdown of the indicated targets is shown.

[0215] [Figure 26] A. T cells engineered with an shRNA module targeting PTPN2 retained their effector signature after chronic antigen stimulation. B. T cells engineered with an shRNA module targeting PTPN2 retained their effector signature after chronic antigen stimulation.

[0216] [Figure 27] Shown are CD4 or CD8% T cell percentages and relative amounts of T effector cells (Te), T effector memory cells (Tem), T central memory cells (Tcm), or memory stem T cells (Tscm) in engineered T cell populations after shRNA knockdown of the indicated targets.

[0217] [Figure 28] A shows tumor growth in mice after treatment with the indicated CAR T cells or control T cells. B shows T cell proliferation in peripheral blood after treatment with the indicated CAR T cells or control T cells.

[0218] [Figure 29] Shown are tumor volumes following tumor growth in mice following treatment with the indicated amounts of CAR T cells or control T cells.

[0219] [Figure 30] A shows quantification of T cell types in edited CD8+ T cell populations after treatment with T cells with shRNA knockdown of the indicated targets. B shows the number of edited T cells in mouse tumors or spleens after treatment with T cells with shRNA knockdown of the indicated targets.

[0220] [Figure 31] Mouse weights are shown after treatment with T cells with shRNA knockdown of the indicated targets.

[0221] [Figure 32] Lysis of target cells expressing MSLN, or ALPG and MSLN, after incubation with T cells expressing logic gates and FAS / PTPN2 shRNA is shown.

[0222] [Figure 33]Relative FAS expression in T cells expressing the ALPG / MSLN logic gate and FAS / PTPN2 shRNA is shown compared to control cells expressing the ALPG / MSLN logic gate alone.

[0223] [Figure 34] A shows in vivo tumor volume after treatment with T cells from donor 2 expressing the ALPG / MSLN logic gate and FAS / PTPN2 shRNA compared to control T cells expressing the ALPG / MSLN logic gate alone. B shows in vivo tumor volume after treatment with T cells from donor 3 expressing the ALPG / MSLN logic gate and FAS / PTPN2 shRNA compared to control T cells expressing the ALPG / MSLN logic gate alone.

[0224] [Figure 35] A shows in vivo tumor volume after treatment with T cells from donor 2 expressing the ALPG / MSLN logic gate and FAS / PTPN2 or FAS / TOX shRNA compared to control T cells (RNP). B shows in vivo tumor volume after treatment with T cells from donor 3 expressing the ALPG / MSLN logic gate and FAS / PTPN2 or FAS / TOX shRNA compared to control T cells (RNP).

[0225] [Figure 36A] FAS mRNA levels after shRNA knockdown are shown. [Figure 36B] PTPN2 mRNA levels after shRNA knockdown are shown. [Figure 36C] TOX mRNA levels after shRNA knockdown are shown. [Figure 36D] ZC3H12A mRNA levels after shRNA knockdown are shown.

[0226] [Figure 37] FAS protein levels after shRNA knockdown are shown.

[0227] [Figure 38] We show that knocking out FAS improved cell proliferation and effector function.

[0228] [Figure 39] A provides a diagram of the knockdown system and an exemplary shRNA-CAR dual construct. B shows robust dual knockdown (>50%) of FAS and an additional target using shRNA.

[0229] [Figure 40] A provides a diagram of exemplary control and shFAS systems. B shows that FAS knockdown provided more than two-fold improved protection from FAS-mediated apoptosis.

[0230] [Figure 41] Figure 1 shows that dual knockdown of FAS with additional genes enhanced the in vivo efficacy of CAR T cells (CD19-41BBZ knocked into the TRAC locus) in the systemic NALM6 model.

[0231] [Figure 42A] Schematics of exemplary complete shRNA and logic gate constructs are provided. [Figure 42B] Similar transgene knock-in efficiencies were observed with each of the constructs. [Figure 42C] Figure 1 shows that T cells expressing the priming receptor (PrimeR) had minimal CAR expression due to the function of a logic gate that gates CAR expression upon exposure to ALPG+ target cells. [Figure 42D] The CD4 / CD8 composition of the KI+ population for all engineered T cells (or transduced for lentiviral populations), the bulk T cell population for RNP, and untransduced (UNT) cells is shown.

[0232] [Figure 43]1 shows memory phenotyping of LG1 and FAS / PTPN2 shRNA circuits.

[0233] [Figure 44] A shows shRNA knockdown of FAS. B shows shRNA knockdown of PTPN2.

[0234] [Figure 45] 1 shows that AB-1013, AB-1014, and AB-1015 induced ALPG-dependent CAR expression.

[0235] [Figure 46] 1 shows that AB-1013, AB-1014, and AB-1015 killed a priming antigen heterogeneous target cell population.

[0236] [Figure 47] A shows that CAR-only T cells inhibited the growth of K526MSLN tumor cells. B shows that CAR-only T cells inhibited the growth of K526MSLN / ALPG tumor cells. C shows that AB-1013, AB-1014, and AB-1015 shRNA + logic gate circuit T cells did not inhibit the growth of K526MSLN tumor cells. D shows that AB-1013, AB-1014, and AB-1015 shRNA + logic gate circuit T cells inhibited the growth of K526MSLN / ALGP tumor cells.

[0237] [Figure 48] We show that cells expressing only LG1 (AB-X logic gate) showed better tumor control than SS1-CAR and comparable tumor control to TC-210.

[0238] [Figure 49] Figure 1 shows that three shRNA+LG1 circuit T cells (AB-1013, AB-1014, and AB-1015) showed improved T cell proliferation and tumor control (e.g., less tumor growth) compared to LG1 T cells in continuous stimulation assays.

[0239] [Figure 50A] Figure 50B shows that T cells expressing a constitutive anti-MSLN CAR killed both K562MSLN and K562ALPG / MSLN cells, and cytotoxicity from shRNA+ logic gate T cells (AB-1013, AB-1014, and AB-1015) was specific only to dual-antigen K562ALPG / MSLN cells. Figure 50B shows that IFNγ production from logic gate / shRNA circuit T cells was restricted to samples with dual-antigen K562ALPG / MSLN target cells. [Figure 50B] Figure 1 shows that IFNγ production from logic gate / shRNA circuit T cells was restricted to samples with dual antigen K562ALPG / MSLN target cells.

[0240] [Figure 51] Figure 1 shows that AB-1015 was associated with a modest increase in ALPG-independent killing activity and increased IFNγ expression in K562MSLN cells compared to AB-1013 and AB-1014.

[0241] [Figure 52] All three shRNA+ logic gated T cells induced target killing.

[0242] [Figure 53] Figure 1 shows that cell transformation was not observed in T cells edited with the three shRNA+LG1 circuits (AB-1013, AB-1014, or AB-1015).

[0243] [Figure 54]A shows that MSLN CAR T cells did not recognize SLC2A9+ cells (THP-1 cells). B shows that MSLN CAR T cells did not recognize K562 negative control cells. C shows that MSLN CAR T cells bound to positive control MSLN-expressing cells. D shows that MSLN CAR T cells did not recognize GP2+ cells.

[0244] [Figure 55] 1 shows that no evidence of polyreactivity was observed with MSLN CAR cells against A498 or H1975 cells.

[0245] [Figure 56] (A) shows randomization of mouse groups 5 days after implantation. (B) shows that AB-1015 T cells reduced tumor volume in an in vivo ovarian cancer model. (C) shows mouse weight after tumor implantation following treatment with AB-1015 T cells. Treatment with AB-1015 T cells did not result in weight loss. DETAILED DESCRIPTION OF THE INVENTION

[0246] definition Terms used in the claims and specification, unless otherwise specified, are defined as set forth below.

[0247] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a segment of DNA located along a chromosome that encodes a specific protein or segment of a protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. A gene may further include a terminator, an enhancer, and / or a silencer.

[0248] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0249] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS) or genomic safe harbor (GSH) sites. As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene, as defined herein, may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.

[0250] As used herein, the term "insertion" refers to a nucleotide sequence that is integrated (inserted) into a target locus or a safe harbor site. An insertion can be used to refer to a gene or genetic element that is integrated into a target locus or a safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into a genomic region known to those skilled in the art.

[0251] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create compatible overlaps, and then joining the molecules together using ligase. Those skilled in the art will be very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, drawings, and tables.

[0252] The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are referred to as small guide RNAs (sgRNAs).

[0253] Cas9 homologs are found in a wide variety of fungi, including, but not limited to, bacteria from the following taxa: Actinobacteria, Aquificae, Bacteroidetes / Chlorobi, Chlamydiae / Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737; Nat. Rev. Microbiol. 2011 June;9(6):467-477; Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.

[0254] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin or derived therefrom). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0255] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0256] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, optionally sorted, and used directly, for example, without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-γ, or a combination thereof.

[0257] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and identified a specific foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or mammalian-derived T cells. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +T cells can be any type of T cell, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral T cells, including, but not limited to, blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδ T cells, and the like. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells) and effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or chimeric antigen receptor (CAR). T cells can also be differentiated from stem or progenitor cells.

[0258] "CD4+ T cells" refer to a subset of T cells that express CD4 on their surface and are involved in cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II-restricted immune responses. On T lymphocytes, the CD4 antigen defines helper / inducer subsets.

[0259] "CD8+ T cells" refer to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.

[0260] As used herein, the phrase "hematopoietic stem cells" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can also be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells express c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 -、 CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells express CD150 + CD48 - CD244 - is.

[0261] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic cells can be obtained or provided by isolating hematopoietic stem cells and differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into additional cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.

[0262] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.

[0263] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, i.e., covalently linking them to a nucleic acid sequence in the chromosomal DNA of the cell. It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" can further include the replacement of the deleted endogenous sequence or nucleotides with one or more inserted nucleotides.

[0264] As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, e.g., by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in connection with expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in connection with expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.

[0265] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequence, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.

[0266] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0267] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a native polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a naturally occurring polypeptide having less than 100% sequence identity to the native polypeptide) or a fragment thereof.

[0268] As used herein, the terms "complementary" or "complementarity" refer to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described herein can include a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a sequence, e.g., a genomic sequence in a cell.

[0269] The term "encoding" refers to a protein-coding sequence or a non-protein-coding sequence, including, but not limited to, a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0270] As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein that is encoded by a gene (recombinant DNA) and has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g., a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0271] "Protein," "polypeptide," and "peptide" are used interchangeably herein.

[0272] As used herein, the terms "operably linked" or "operably linked" refer to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if it is capable of affecting the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a control sequence in both sense and antisense orientations.

[0273] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively developing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).

[0274] As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG) and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of skill in the art.

[0275] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.

[0276] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived entirely from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0277] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0278] As contemplated herein, gene editing can involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such a knocked-in DNA sequence may include an entire gene or multiple genes, and may include regulatory sequences associated with a gene or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a recombinant protein can be inserted into the genome of a cell harboring a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either deleting or adding a nucleotide sequence, which leads to a disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.

[0279] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination of one or more nucleotides at the repair site.

[0280] As used herein, "homology-directed repair" or HDR refers to the cellular process in which the broken or nick end of a DNA strand is repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repeat region on the same or different chromosome) located elsewhere in the genome. Alternatively, exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in the sequence at the target site. In this way, specific mutations can be introduced at the break site.

[0281] As used herein, single-stranded DNA template or double-stranded DNA template refers to the DNA oligonucleotide that can be used by cell as template for HDR.Generally, single-stranded DNA template or double-stranded DNA template has at least one region of homology with target site.In some cases, single-stranded DNA template or double-stranded DNA template has two homologous regions adjacent to the region that contains the heterologous sequence that is inserted into target cleavage site.

[0282] The terms "vector" and "plasmid" are used interchangeably and, as used herein, refer to a polynucleotide vehicle useful for introducing genetic material into a cell. A vector can be linear or circular. A vector can integrate into a target genome of a host cell or replicate independently within the host cell. A vector can include, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integrative vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0283] As used herein, the term "introducing" in the context of introducing a nucleic acid or a complex containing a nucleic acid, such as an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or RNP-DNA template complex from outside the cell to inside the cell. In some cases, introducing refers to the translocation of the nucleic acid or complex from outside the cell to the nucleus of the cell. Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.

[0284] As used herein, the term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide construct that includes regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can facilitate transcription of the selected polynucleotide within the host cell, or transcription and translation of the selected polynucleotide within the host cell. The expression cassette can, for example, be integrated into the genome of the host cell or can be present in an expression vector.

[0285] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder described herein.

[0286] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0287] The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, a composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and that does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0288] The term "in situ" refers to processes that occur within living cells grown isolated from an organism, for example, grown in tissue culture.

[0289] The term "in vivo" refers to a process that occurs within a living organism.

[0290] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.

[0291] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0292] The term "percent identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have the same specified percentage of nucleotide or amino acid residues when compared and aligned for maximum correspondence, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0293] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence(s) relative to the reference sequence based on the designated program parameters.

[0294] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally Ausubel et al., infra).

[0295] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0296] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0297] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of the disease.

[0298] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.

[0299] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0300] As used herein, the term "treating" includes any effect that results in an improvement of the condition, disease, disorder, etc. or improves the symptoms thereof, e.g., alleviating, reducing, modulating, ameliorating, or eliminating.

[0301] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively activating or increasing, the recited variable.

[0302] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0303] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0304] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0305] Logic Gate System As used herein, "logic gate," "circuit," "circuit receptor," "system," or "system receptor" refers to a bipartite protein expression system comprising a priming receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, and the priming receptor is expressed in the cell. The intracellular domain of the priming receptor is cleaved from the transmembrane domain when the priming receptor binds to its target antigen. The intracellular domain is then able to translocate into the cell nucleus, where it induces expression of the chimeric antigen receptor.

[0306] In one aspect, provided herein is a system comprising a priming receptor that binds ALPG / P and a chimeric antigen receptor that binds MSLN, wherein a transcription factor in the intracellular domain of the priming receptor is capable of inducing CAR expression. Such a system is alternatively referred to as a "logic gate" or "circuit." In some aspects, the system is encoded by a nucleic acid transgene inserted into an immune cell. The system may be encoded on a single nucleic acid insert or fragment that includes both transgenes, or on two nucleic acids that individually encode the system transgenes. The priming receptor and CAR of the system can be arranged in any order on a single nucleic acid. For example, the priming receptor may be at the 5' end and the CAR may be at the 3' end, or the CAR may be at the 5' end and the priming receptor may be at the 3' end.

[0307] The first constitutive promoter can be operably linked to a nucleotide sequence encoding a priming receptor. The inducible promoter can also be operably linked to a nucleotide sequence encoding a CAR. The second constitutive promoter can be operably linked to a first nucleic acid complementary to an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39. The third constitutive promoter can be operably linked to a second nucleic acid complementary to an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or human TOX comprising the sequence set forth in SEQ ID NO: 41.

[0308] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment that includes both the transgene and nucleic acid(s), the recombinant nucleic acid insert can include, in a 5' to 3' direction, a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0309] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment that includes both the transgene and nucleic acid(s), the recombinant nucleic acid insert can include, in a 5' to 3' direction, a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0310] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment containing both the transgene and nucleic acid(s), the recombinant nucleic acid insert can comprise, from 5' to 3', a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; a nucleotide sequence encoding a second nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0311] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment that includes both the transgene and nucleic acid(s), the recombinant nucleic acid insert can include, in a 5' to 3' direction, an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; the first constitutive promoter; and a nucleotide sequence encoding a priming receptor.

[0312] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment that includes both the transgene and nucleic acid(s), the recombinant nucleic acid insert can include, in a 5' to 3' direction, an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a first constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; and a nucleotide sequence encoding a priming receptor.

[0313] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment containing both the transgene and nucleic acid(s), the recombinant nucleic acid insert can comprise, from 5' to 3', an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a first constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; a nucleotide sequence encoding a second nucleic acid that is complementary to human FAS mRNA, human PTPN2 mRNA, or human TOX mRNA; and a nucleotide sequence encoding a priming receptor.

[0314] In some embodiments, when the system is encoded on a single recombinant nucleic acid insert or fragment containing both the transgene and nucleic acid, the recombinant nucleic acid insert can comprise, in a 5' to 3' direction, a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA; a nucleotide sequence encoding a second nucleic acid that is complementary to human PTPN2 mRNA or TOX mRNA; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0315] In another embodiment, the recombinant nucleic acid insert can comprise, from 5' to 3', a first constitutive promoter; a nucleotide sequence encoding a priming receptor; a second constitutive promoter; a nucleotide sequence encoding a second nucleic acid that is complementary to human PTPN2 mRNA or TOX mRNA; a nucleotide sequence encoding a second first nucleic acid that is complementary to human FAS mRNA; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0316] In another embodiment, the recombinant nucleic acid insert can comprise, from 5' to 3', an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS mRNA; a nucleotide sequence encoding a second first nucleic acid that is complementary to human PTPN2 mRNA or TOX mRNA; a second constitutive promoter; and a nucleotide sequence encoding a priming receptor.

[0317] In another embodiment, the recombinant nucleic acid insert can comprise, from 5' to 3', an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a second constitutive promoter; a nucleotide sequence encoding a second nucleic acid that is complementary to human PTPN2 mRNA or TOX mRNA; a nucleotide sequence encoding a second first nucleic acid that is complementary to human FAS mRNA; a second constitutive promoter; and a nucleotide sequence encoding a priming receptor.

[0318] In some embodiments, the recombinant nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 166, 167, 168, 169, 170, or 171. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 166. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 167. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 168. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 169. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 170. In some embodiments, the recombinant nucleic acid comprises the sequence set forth in SEQ ID NO: 171.

[0319] Priming Receptors Placental / germline alkaline phosphatase (ALPG / P; ALPP: NCBI Entrez Gene: 250, UniProtKB / Swiss-Prot: P05187; ALPG: NCBI Entrez Gene: 251, UniProtKB / Swiss-Prot: P10696). In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds to placental alkaline phosphatase (ALPP). In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds to germline alkaline phosphatase (ALPG). As used herein, "placental / germline alkaline phosphatase (ALPG / P)" refers to both placental alkaline phosphatase (ALPP) and germline alkaline phosphatase (ALPG). An antigen-binding domain that specifically binds to ALPG / P is capable of specifically binding to ALPG and / or ALPP.

[0320] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 24. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 25.

[0321] In certain embodiments of the present disclosure, the priming receptor is a synthetic receptor based on the Notch protein. Binding of a natural Notch receptor to its cognate ligand, such as one from the Delta family of proteins, causes intramembrane proteolysis, cleaving an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that functions only when cleaved from Notch. Cleavage can occur through sequential proteolysis by ADAM metalloproteases and the gamma-secretase complex. This intracellular fragment enters the cell's nucleus and activates cell-cell signaling genes. In contrast to natural Notch proteins, synthetic Notch priming receptors replace the natural Notch intracellular fragment with one that causes a gene encoding a selected protein, such as a CAR, to be transcribed upon release of the intracellular fragment from the priming receptor.

[0322] Notch receptors have a modular domain organization. The ectodomain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats responsible for ligand binding. In synthetic or priming Notch receptors, the Notch ligand-binding domain is replaced with a ligand-binding domain that binds to a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors and have been widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notch1 is split by furin cleavage, whereby the N-terminal portion terminates the extracellular subunit and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor contains a transmembrane segment and an intracellular domain (ICD) containing transcriptional regulators.

[0323] Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids described herein. One type of priming receptor contemplated for use in the methods and cells herein comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity to a Notch receptor, including an NRR, a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity to a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity to a Notch receptor (lacking an NRR), a TMD, and an ICD. A "minimal Linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide lacking substantial sequence identity to a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD. "Hinge Notch" receptors comprise a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or existing host receptors), a TMD, and a hinge sequence containing an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature. In some embodiments, the non-naturally occurring receptors disclosed herein bind to a ligand displayed on the target cell surface, triggering proteolytic cleavage of the receptor and the release of transcriptional regulators that regulate custom transcriptional programs within the cell. In some embodiments, the priming receptor does not comprise the LIN-12-Notch repeats (LNR) and / or heterodimerization domain (HD) of a Notch receptor.

[0324] Priming receptor extracellular domain The priming receptors disclosed herein comprise an extracellular domain that specifically binds placental / germline alkaline phosphatase (ALPG / P; ALPP: NCBI Entrez Gene: 250, UniProtKB / Swiss-Prot: P05187; ALPG: NCBI Entrez Gene: 251, UniProtKB / Swiss-Prot: P10696). In some embodiments, the extracellular domain comprises a ligand-binding portion of the receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. Antigen-binding portions can comprise naturally occurring amino acid sequences or can be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0325] With respect to antibody binding to a target molecule, the terms "binds to," "specific binding to," "specifically binds to," "specific for," "selectively binds to," and "selective for" a particular antigen (e.g., a polypeptide target) or epitope on a particular antigen refer to binding that is measurably different from nonspecific or nonselective interactions (e.g., with non-target molecules). For example, an antibody that "selectively binds to" or "specifically binds to" an antigen is an antigen-binding moiety that binds to the antigen with high affinity and does not significantly bind to other, unrelated antigens. Specific binding can be measured, for example, by measuring binding to the target molecule and comparing it to binding to non-target molecules. Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule. In this case, specific binding is indicated if binding of the antibody to the target molecule is competitively inhibited by the control molecule. In some embodiments, the extracellular antigen-binding domain specifically binds alkaline phosphatase germline type (ALPG). In some embodiments, the extracellular domain comprises an antigen-binding moiety that binds to placental alkaline phosphatase (ALPP).

[0326] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X for its partner Y is determined by the dissociation equilibrium constant (K D ) The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including, but not limited to, surface plasmon resonance (SPR) techniques (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0327] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Typically, a naturally occurring four-chain antibody contains six HVRs, three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs typically contain amino acid residues from the hypervariable loops and / or from the complementarity-determining regions (CDRs), the latter being those with the highest sequence variability and / or involved in antigen recognition. With the exception of CDR1 in VH, CDRs typically contain amino acid residues that form the hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity-determining regions" (CDRs), and these terms are used interchangeably herein with respect to the portions of the variable regions that form the antigen-binding region. This particular region is described by Kabat et al., US Department of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and Chothia et al., J Mol Biol 196:901-917 (1987), and the definitions include overlapping or subsets of amino acid residues when compared with each other. However, application of either definition to refer to a CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The exact residue numbers encompassing a particular CDR will vary depending on the sequence and size of the CDR. One of ordinary skill in the art can routinely determine which residues comprise a particular CDR, given the amino acid sequence of the variable region of an antibody.

[0328] The amino acid sequence boundaries of the CDRs can be determined by one of skill in the art using any of several known numbering schemes, including those described by Kabat et al. supra (the "Kabat" numbering scheme), Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (the "Chothia" numbering scheme), MacCallum et al., 1996, J. Mol. Biol. 262:732-745 (the "Contact" numbering scheme), Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 (the "IMGT" numbering scheme), and Honegge and Pluckthun, J. Mol. Biol., 2001, 309:657-70 (the "AHo" numbering scheme), each of which is incorporated by reference in its entirety.

[0329] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat and Chothia schemes. For CDR-H1, residue numbering is provided using both the Kabat and Chothia numbering schemes.

[0330] CDRs can be assigned, for example, using antibody numbering software such as Abnum, available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, which is incorporated by reference in its entirety.

[0331] [Table A]

[0332] The "EU numbering scheme" is generally used when referring to residues in antibody heavy chain constant regions (e.g., as reported in Kabat et al., supra). Unless otherwise noted, the EU numbering scheme is used to refer to residues in antibody heavy chain constant regions described herein.

[0333] [Table A1]

[0334] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In certain such embodiments, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain in the single-chain Fab molecule. As described in more detail herein, an scFv has a variable domain of a light chain (VL), which is connected from its C-terminus to the N-terminus of the variable domain of a heavy chain (VH) by a polypeptide chain. Alternatively, an scFv comprises a polypeptide chain, and the C-terminus of the VH is connected to the N-terminus of the VL by a polypeptide chain.

[0335] A "Fab fragment" (also called fragment antigen binding) contains the constant domain of the light chain (CL) and the first constant domain of the heavy chain (CH1), as well as the variable domains VL and VH on the light and heavy chains, respectively. The variable domains contain the complementarity-determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0336] An "F(ab')2" fragment contains two Fab' fragments linked by a disulfide bond near the hinge region. F(ab')2 fragments can be produced, for example, by recombinant methods or by pepsin digestion of an intact antibody. F(ab')2 fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0337] An "Fv" fragment comprises a non-covalently associated dimer of one heavy- and one light-chain variable domain.

[0338] A "single-chain Fv" or "scFv" comprises the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of scFvs, see Plückthun in *The Pharmacology of Monoclonal Antibodies*, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO 93 / 16185, U.S. Patent No. 5,571,894, and U.S. Patent No. 5,587,458.

[0339] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen, without the presence of other variable domains. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also known as sdAbs or nanobodies. sdAbs are fairly stable and easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, De Haard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol. Biotechnol. 77(1): 13-22).

[0340] Priming receptor CDR, VH, and VL domains In some embodiments, the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO: 9.

[0341] In some embodiments, the CDR-H3 of the priming receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H3 of SEQ ID NO: 3, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H2 of SEQ ID NO: 2, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H1 of SEQ ID NO: 1. 90% or 95% identity to CDR-L3 of SEQ ID NO: 6, CDR-L2 of SEQ ID NO: 5, and CDR-L1 of SEQ ID NO: 4. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO: 3 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, CDR-H2 is CDR-H2 of SEQ ID NO: 2 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, CDR-H1 is CDR-H1 of SEQ ID NO: 1 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, CDR-L3 is CDR-L3 of SEQ ID NO: 6 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, CDR-L2 is CDR-L2 of SEQ ID NO: 5 with a maximum of 1, 2, 3, or 4 amino acid substitutions, and CDR-L1 is CDR-L1 of SEQ ID NO: 4 with a maximum of 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0342] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0343] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0344] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0345] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0346] Table B provides the VH and VL CDR sequences of exemplary ALPG / P antigen-binding domains with the numbering scheme shown.

[0347] [Table B]

[0348] Transmembrane domain As noted above, priming receptors contain a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0349] In some embodiments, the TMD comprises a Notch1 transmembrane domain. In some embodiments, the transmembrane domain comprises the sequence set forth in SEQ ID NO:19.

[0350] Generally, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor that contains at least one gamma-secretase cleavage site. A detailed description of the structure and function of the gamma-secretase complex and its substrate proteins, including amyloid precursor protein (APP) and Notch, can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, wherein the TMD comprises at least one gamma secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as alcadein alpha and alcadein gamma. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a known TMD for a Notch receptor. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a different Notch receptor.For example, in a mini-Notch based on human Notch1, the Notch1 TMD can be replaced with a Notch2 TMD, a Notch3 TMD, a Notch4 TMD, or a Notch TMD from a non-human animal such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus.

[0351] In some embodiments, the priming receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of ADAM10, i.e., MMPs selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences for uPA and tPA include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Thr-Gln-Ser (SEQ ID NO: 188), where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 189), where cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg (SEQ ID NO: 190).Additional suitable linkers that contain a protease cleavage site include sequences cleavable by the following proteases: PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; Examples of receptor-specific proteins include tepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases not native to the host cells in which the receptor is expressed (e.g., TEV) can be used as an additional regulatory mechanism, reducing receptor activation until the protease is expressed or otherwise provided. Additionally, proteases can be tumor- or disease-associated (expressed to a significantly higher degree than normal tissue) and serve as an independent regulatory mechanism. For example, several matrix metalloproteinases are highly expressed in certain cancer types.

[0352] In some embodiments, the amino acid substitution(s) within the TMD comprise one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. Additional sequences and substitutions are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0353] Intracellular domain In some embodiments, the priming receptor comprises one or more intracellular domains derived from or derived from a transcriptional regulator and / or a DNA binding domain. In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:23.

[0354] Transcriptional regulators activate or repress transcription from their cognate promoters. Transcriptional activators typically bind to nearby transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and sterically inhibit transcription initiation by RNA polymerase. Other transcriptional regulators function as either activators or repressors, depending on where they bind and the cellular conditions. Thus, as used herein, "transcriptional activation domain" refers to the domain of a transcription factor that interacts with transcriptional control elements and / or transcriptional regulatory proteins (i.e., transcription factors, RNA polymerases, etc.) to increase and / or activate transcription of one or more genes. Non-limiting examples of transcriptional activation domains include herpes simplex virus VP16 activation domain, VP64 (a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcriptional activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to those of skill in the art. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. The transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutated, or derivative version of the original transcriptional activation domain that has the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator can further comprise a nuclear localization signal.

[0355] In some embodiments, the priming receptor comprises one or more intracellular "DNA-binding domains" (or "DB domains"). Such "DNA-binding domains" refer to sequence-specific DNA-binding domains that bind to specific DNA sequence elements. Thus, as used herein, a "sequence-specific DNA-binding domain" refers to a protein domain portion that has the ability to selectively bind to DNA having a specific, predetermined sequence. The sequence-specific DNA-binding domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to the desired sequence. In some embodiments, the sequence-specific DNA-binding domain is engineered to bind to the desired sequence. Non-limiting examples of proteins having sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5', AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, and Ca. Examples include s10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, as well as TALES.

[0356] In embodiments in which a CRISPR / Cas-like protein is used, the CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the systems described herein. For example, a CRISPR enzyme used as a DNA-binding protein or domain thereof can be mutated relative to the corresponding wild-type enzyme such that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing the DNA-binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that lacks substantially all DNA cleavage activity.

[0357] Juxtamembrane domain The ECD and TMD, or the TMD and ICD, can be linked to each other with a linking polypeptide such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including an NRR), a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD but lacking an NRR (a LIN-12-Notch repeat (LNR) module and a heterodimerization domain), a TMD, and an ICD. A "minimal linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide (such as, but not limited to, a synthetic (GGS)) lacking substantial sequence identity with the Notch receptor. n "Hinge Notch" receptors comprise a hinge sequence comprising a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or pre-existing host receptors), a TMD, and an ICD.

[0358] In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of an LWF motif in receptor constructs is described in U.S. Patent No. 10,858,443, which is incorporated herein by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity to the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD but does not include the LIN-12-Notch repeat (LNR) and / or heterodimerization domain (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD. In some embodiments, the JMD peptide comprises an oligomerization domain that promotes the formation of receptor dimers, trimers, or higher order aggregates. Such JMD peptides are described in WO2021061872, the entire contents of which are incorporated herein by reference.

[0359] In mini-Notch receptors, the linking polypeptide is derived from the Notch JMD sequence after deletion of the NRR and HD domains. The Notch JMD sequence may be from Notch1, Notch2, Notch3, or Notch4, or may be derived from a non-human homologue, such as from Drosophila, Junglefly, or Danio. The remaining 4-50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptide, such as the level of signal transduction upon ligand induction or in the absence of ligand.

[0360] In minimal linker Notch receptors, the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence (including a Notch JMD sequence from Notch1, Notch2, Notch3, or Notch4, or a non-human homolog thereof). Between 4 and 50 amino acid residues can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve the desired activity of the chimeric polypeptides of the present disclosure. The minimal linker sequence can be designed to include or omit a protease cleavage site and can include or omit multiple sites for glycosylation or other types of post-translational modification. In some embodiments, the minimal linker does not include a protease cleavage site or a glycosylation site.

[0361] In some embodiments, the priming receptor further comprises a hinge. Hinge linkers that can be used in priming receptors can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomerization of chimeric polypeptides through intermolecular disulfide bonds. In these cases, within the chimeric receptors disclosed herein, the hinge domain generally comprises a flexible polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD and also provides a site for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain comprises a motif that promotes dimerization of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain comprises a motif that promotes trimerization of the chimeric polypeptides disclosed herein (e.g., a hinge domain from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure can be naturally occurring hinge polypeptide sequences (e.g., derived from naturally occurring immunoglobulins) or can be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or functional variants thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence includes one or more CPPC motifs (SEQ ID NO: 191).

[0362] The hinge polypeptide sequence may also be derived from the CD8α hinge domain, CD28 hinge domain, CD152 hinge domain, PD-1 hinge domain, CTLA4 hinge domain, OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the IgG4 hinge domain or a functional variant thereof.

[0363] The Fn-Notch-linked polypeptide is derived from the Robo1 JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeat and the TMD. The Fn-Notch-linked polypeptide does not contain a Notch negative regulatory region (NRR) or a Notch HD domain. The Fn-linked polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises an Fn-linked polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeat and the TMD can be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence, but with no more than one proline. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with about 50% or more of the amino acids being glycine. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with the amino acids selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn-linked polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptides of the present disclosure.

[0364] Stop-Transfer Sequence In some embodiments, the priming receptor further comprises a translocation blocking sequence (STS) between the transmembrane domain and the intracellular domain. The STS comprises a charged lipophobic sequence. Without being bound by any theory, it is believed that the STS functions as a membrane anchor and prevents the intracellular domain from passing through to the plasma membrane. The use of an STS domain in a priming receptor is described in WO2021061872, the entire contents of which are incorporated herein by reference. Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, S Examples of STS sequences include DC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3, and Notch4. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0365] In some embodiments, the translocation-blocking sequence comprises the sequence set forth in SEQ ID NO:20.

[0366] ALPG / P antibody and antigen-binding fragment In some aspects, provided herein are placental / germline alkaline phosphatase (ALPG / P) antibodies or antigen-binding fragments. In some embodiments, the ALPG / P antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0367] In one aspect, an isolated antibody or antigen-binding fragment thereof that binds to placental / germline alkaline phosphatase (ALPG / P), wherein the isolated antibody or antigen-binding fragment thereof comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 173, 174, 175 or 176, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 177, 178, 179 or 180, and CDR-H and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 183, or 184, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, 185, or 186, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 187.

[0368] In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 8.

[0369] In some embodiments, the CDR-H3 of the ALPG / P antibody or antigen-binding fragment has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 3, 181 or 182; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 2, 177, 178, 179 or 180; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 1, 173, 174, 175 or 176. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 3, 181 or 182 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 2, 177, 178, 179 or 180 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 1, 173, 174, 175 or 176 with a maximum of 1, 2, 3, 4 or 5 amino acid substitutions.

[0370] In some embodiments, the CDR-L3 of the ALPG / P antibody or antigen-binding fragment has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-L3 of SEQ ID NO: 6 or 187, the CDR-L2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-L2 of SEQ ID NO: 5, 185 or 186, and the CDR-L1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-L1 of SEQ ID NO: 4, 183 or 184. In some embodiments, the CDR-L3 is CDR-L3 of SEQ ID NO: 6 or 187 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-L2 is CDR-L2 of SEQ ID NO: 5, 185, or 186 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, and the CDR-L1 is CDR-L1 of SEQ ID NO: 4, 183, or 184 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions.

[0371] In some embodiments, the ALPG / P antibodies or antigen-binding fragments provided herein comprise one to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the ALPG / P antibodies or antigen-binding fragments provided herein comprise one to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0372] In some embodiments, the ALPG / P antibodies or antigen-binding fragments provided herein comprise a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the ALPG / P antibodies or antigen-binding fragments provided herein comprise a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO:8. In some embodiments, the ALPG / P antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein and may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0373] In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 7. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 7. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 7. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 95% sequence identity to CDR1, 2, and 3 of SEQ ID NO: 7.

[0374] In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region in which the complete set of VL CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 8. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region in which the complete set of VL CDR1, 2, and 3 (combined) have at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 8. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region in which the complete set of VL CDR1, 2, and 3 (combined) have at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 8. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region in which the complete set of VL CDR1, 2, and 3 (combined) have at least 95% sequence identity to CDR1, 2, and 3 of SEQ ID NO: 8.

[0375] In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 7. In some embodiments, an ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region in which the complete set of VL CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 8.

[0376] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region, wherein the VH region comprises: (i) a VH complementarity determining region 1 (CDR1) comprising a sequence having up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 1, 173, 174, 175, or 176; (ii) a VH CDR2 comprising a sequence having up to two (e.g., one, two, or zero) amino acid modifications relative to SEQ ID NO: 2, 177, 178, 179, or 180; (iii) a VH CDR3 comprising a sequence with up to two (e.g., one, two, or none) amino acid modifications relative to SEQ ID NO: 3, 181, or 182; (iv) a VL CDR1 comprising a sequence having up to two (e.g., one, two, or zero) amino acid modifications relative to SEQ ID NO: 4, 183, or 184; (v) a VL CDR2 comprising a sequence having up to two (e.g., one, two, or none) amino acid modifications relative to SEQ ID NO: 5, 185, or 186; and (vi) comprises a VL CDR3 comprising a sequence having up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 6 or 187.

[0377] In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution. In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution listed in Table A1.

[0378] In some embodiments, the VH CDR1 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 1, 173, 174, 175, or 176. In some embodiments, the VH CDR2 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 2, 177, 178, 179, or 180. In some embodiments, the VH CDR3 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 3, 181, or 182. In some embodiments, the VL CDR1 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 4, 183, or 184. In some embodiments, the VL CDR2 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 5, 185, or 186. In some embodiments, the VL CDR3 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 6 or 187. In some embodiments, the at most one amino acid modification is an amino acid substitution. In some embodiments, the at most one amino acid modification is a conservative amino acid substitution. In some embodiments, the at most one amino acid modification is an amino acid deletion. In some embodiments, at most one amino acid modification is an amino acid addition.

[0379] In some embodiments, the VH CDR1 comprises the sequence set forth in SEQ ID NO: 1. In some embodiments, the VH CDR2 comprises the sequence set forth in SEQ ID NO: 2. In some embodiments, the VH CDR3 comprises the sequence set forth in SEQ ID NO: 3.

[0380] In some embodiments, the VL CDR1 comprises the sequence set forth in SEQ ID NO: 4. In some embodiments, the VL CDR2 comprises the sequence set forth in SEQ ID NO: 5. In some embodiments, the VL CDR3 comprises the sequence set forth in SEQ ID NO: 6.

[0381] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region, wherein the VH region comprises: (i) a VH complementarity-determining region 1 (CDR1) comprising the sequence set forth in SEQ ID NO: 1; (ii) a VH CDR2 comprising the sequence set forth in SEQ ID NO: 2; (iii) a VH CDR3 comprising the sequence set forth in SEQ ID NO: 3; (iv) a VL complementarity-determining region 1 (CDR1) comprising the sequence set forth in SEQ ID NO: 4; (v) a VL CDR2 comprising the sequence set forth in SEQ ID NO: 5, and (ivi) comprises a VL CDR3 comprising the sequence set forth in SEQ ID NO:6.

[0382] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region comprising VH CDR1, VH CDR2, and VH CDR3, wherein VH CDR1, VH CDR2, and VH CDR3 comprise the sequences of SEQ ID NOs: 1, 2, and 3, respectively; and a light chain variable (VL) region comprising VL CDR1, VL CDR2, and VL CDR3, wherein VL CDR1, VL CDR2, and VL CDR3 comprise the sequences of SEQ ID NOs: 4, 5, and 6, respectively.

[0383] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region comprising CDR1, CDR2, and CDR3 of SEQ ID NO:7, and a light chain variable (VL) region comprising CDR1, CDR2, and CDR3 of SEQ ID NO:8.

[0384] In some embodiments, the VH CDR1, VH CDR2 and VH CDR3 sequences are present in a human VH framework.

[0385] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO:7. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to SEQ ID NO:7. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to SEQ ID NO:7. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 95% sequence identity to SEQ ID NO:7.

[0386] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO:8. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region having at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to SEQ ID NO:8. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region having at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to SEQ ID NO:8. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region having at least 95% sequence identity to SEQ ID NO:8.

[0387] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 7. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises a light chain variable (VL) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 8.

[0388] In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises the heavy chain variable (VH) region of SEQ ID NO: 7. In some embodiments, the ALPG / P antibody or antigen-binding fragment comprises the light chain variable (VL) region of SEQ ID NO: 8.

[0389] In some embodiments, the ALPG / P antibody or antigen-binding fragment specifically binds to human ALPG / P.

[0390] In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of about 10 -9 M~about 10 -6 K of M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 5×10 -7 K below M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 1×10 -7 K below M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 5×10 -8 K below M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 2×10 -8 K below M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 1×10-8 K below M D In some embodiments, the ALPG / P antibody or antigen-binding fragment binds to human ALPG / P at a concentration of 1×10 -9 K below M D Combine with.

[0391] Chimeric receptors In one aspect, provided herein is a chimeric receptor that binds to mesothelin (MSLN), wherein the chimeric receptor comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, 202, 203, 204, or 205, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, 206, 207, 208, or 209, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16, 210, or 211.

[0392] In some embodiments, the MSLN chimeric receptor comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 17.

[0393] In some embodiments, the CDR-H3 of the MSLN chimeric receptor has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 16, 210 or 211; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 15, 206, 207, 208 or 209; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 14, 202, 203, 204 or 205. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 16, 210 or 211 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 15, 206, 207, 208 or 209 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 14, 202, 203, 204 or 205 with up to 1, 2, 3, 4 or 5 amino acid substitutions.

[0394] In some embodiments, the MSLN chimeric receptors provided herein comprise one to three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, the MSLN chimeric receptors provided herein comprise two to three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, the MSLN chimeric receptors provided herein comprise three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0395] In some embodiments, the MSLN chimeric receptors provided herein comprise a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 17. In some embodiments, the MSLN chimeric receptors provided herein comprise a VH sequence provided in SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0396] In some aspects, provided herein is a chimeric receptor that binds to mesothelin (MSLN), wherein the chimeric receptor comprises a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12.

[0397] In some embodiments, the MSLN chimeric receptor comprises a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the VHH chain sequence comprises the sequence set forth in SEQ ID NO: 13.

[0398] In some embodiments, the CDR-H3 of the MSLN chimeric receptor has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 12, 200 or 201; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 11, 196, 197, 198 or 199; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 10, 192, 193, 194 or 195. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 12, 200 or 201 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 11, 196, 197, 198 or 199 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 10, 192, 193, 194 or 195 with a maximum of 1, 2, 3, 4 or 5 amino acid substitutions.

[0399] In some embodiments, the MSLN chimeric receptor provided herein comprises one to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the MSLN chimeric receptor provided herein comprises two to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0400] In some embodiments, the MSLN chimeric receptor provided herein comprises a VHH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VHH sequence set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domain provided herein comprises a VHH sequence provided in SEQ ID NO: 13 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0401] In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of one of SEQ ID NOs: 13 or 17. In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of one of SEQ ID NOs: 13 or 17. In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to CDR1, 2, and 3 of one of SEQ ID NOs: 13 or 17. In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 95% sequence identity to CDR1, 2, and 3 of one of SEQ ID NOs: 13 or 17.

[0402] In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) has at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 13. In some embodiments, an MSLN chimeric receptor comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) has at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 17.

[0403] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity determining region 1 (CDR1) comprising a sequence having up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 10, 192, 193, 194, or 195; (ii) a VH CDR2 comprising a sequence having up to two (e.g., one, two, or none) amino acid modifications relative to SEQ ID NO: 11, 196, 197, 198, or 199; and (iii) comprises a VH CDR3 comprising a sequence with up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 12, 200, or 201.

[0404] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity determining region 1 (CDR1) comprising a sequence having up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 14, 202, 203, 204, or 205; (ii) a VH CDR2 comprising a sequence with up to two (e.g., one, two, or none) amino acid modifications relative to SEQ ID NO: 15, 206, 207, 208, or 209; and (iii) comprises a VH CDR3 comprising a sequence with up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 16, 210, or 211.

[0405] In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution. In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution listed in Table A1.

[0406] In some embodiments, the MSLN chimeric receptor VH CDR1 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 10, 192, 193, 194, or 195. In some embodiments, the MSLN chimeric receptor VH CDR2 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 11, 196, 197, 198, or 199. In some embodiments, the MSLN chimeric receptor VH CDR3 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 12, 200, or 201. In some embodiments, the MSLN chimeric receptor VH CDR1 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 14, 202, 203, 204, or 205. In some embodiments, the MSLN chimeric receptor VH CDR2 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 15, 206, 207, 208, or 209. In some embodiments, the MSLN chimeric receptor VH CDR3 comprises a sequence having at most one amino acid modification relative to SEQ ID NO: 16, 210, or 211. In some embodiments, the at most one amino acid modification is an amino acid substitution. In some embodiments, the at most one amino acid modification is a conservative amino acid substitution. In some embodiments, the at most one amino acid modification is an amino acid deletion. In some embodiments, the at most one amino acid modification is an amino acid addition.

[0407] In some embodiments, the MSLN chimeric receptor VH CDR1 comprises the sequence set forth in SEQ ID NO: 10. In some embodiments, the MSLN chimeric receptor VH CDR2 comprises the sequence set forth in SEQ ID NO: 11. In some embodiments, the MSLN chimeric receptor VH CDR3 comprises the sequence set forth in SEQ ID NO: 12.

[0408] In some embodiments, the MSLN chimeric receptor VH CDR1 comprises the sequence set forth in SEQ ID NO: 14. In some embodiments, the MSLN chimeric receptor VH CDR2 comprises the sequence set forth in SEQ ID NO: 15. In some embodiments, the MSLN chimeric receptor VH CDR3 comprises the sequence set forth in SEQ ID NO: 16.

[0409] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity-determining region 1 (CDR1) comprising the sequence set forth in SEQ ID NO: 10; (ii) a VH CDR2 comprising the sequence set forth in SEQ ID NO: 11, and (iii) comprises a VH CDR3 comprising the sequence set forth in SEQ ID NO: 12.

[0410] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity-determining region 1 (CDR1) comprising the sequence set forth in SEQ ID NO: 14; (ii) a VH CDR2 comprising the sequence set forth in SEQ ID NO: 15, and (iii) comprises a VH CDR3 comprising the sequence set forth in SEQ ID NO: 16.

[0411] In some embodiments, the MSLN chimeric receptor comprises a VH region comprising a heavy chain variable (VH) CDR1, a VH CDR2, and a VH CDR3, wherein the VH CDR1, the VH CDR2, and the VH CDR3 comprise the sequences of SEQ ID NOs: 10, 11, and 12, respectively. In some embodiments, the MSLN chimeric receptor comprises a VH region comprising a heavy chain variable (VH) CDR1, a VH CDR2, and a VH CDR3, wherein the VH CDR1, the VH CDR2, and the VH CDR3 comprise the sequences of SEQ ID NOs: 14, 15, and 16, respectively.

[0412] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region comprising CDR1, CDR2, and CDR3 of one of SEQ ID NOs: 13 or 17. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region comprising CDR1, CDR2, and CDR3 of SEQ ID NO: 13. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region comprising CDR1, CDR2, and CDR3 of SEQ ID NO: 17.

[0413] In some embodiments, the VH CDR1, VH CDR2 and VH CDR3 sequences are present in a human VH framework.

[0414] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to one of SEQ ID NOs: 13 or 17. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to one of SEQ ID NOs: 13 or 17. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to one of SEQ ID NOs: 13 or 17. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 95% sequence identity to one of SEQ ID NOs: 13 or 17.

[0415] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 13. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 17.

[0416] In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region of SEQ ID NO: 13. In some embodiments, the MSLN chimeric receptor comprises a heavy chain variable (VH) region of SEQ ID NO: 17.

[0417] In some embodiments, the MSLN chimeric receptor specifically binds to human MSLN.

[0418] In some embodiments, the MSLN chimeric receptor is linked to human MSLN at a concentration of about 10 -9 M~about 10 -6 K of M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at 5×10 -7 K below M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at a concentration of 1×10 -7 K below M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at 5×10 -8 K below M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at 2×10 -8 K below M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at a concentration of 1×10 -8 K below M D In some embodiments, the MSLN chimeric receptor binds to human MSLN at a concentration of 1×10 -9 K below M D Combine with.

[0419] In some embodiments, the MSLN chimeric receptor is a chimeric antigen receptor or a priming receptor.

[0420] Chimeric Antigen Receptor In another embodiment, provided herein is a chimeric antigen receptor comprising an extracellular antigen-binding domain that specifically binds to mesothelin (MSLN; NCBI Entrez Gene: 10232; UniProtKB / Swiss-Prot: Q13421). The recombinant CAR may be a human CAR comprising a fully human sequence, e.g., a naturally occurring human sequence.

[0421] In some embodiments, a chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain. The antigen-recognition domain of a receptor, such as a CAR, can be linked to one or more intracellular signaling components, such as a signaling component that mimics activation via an antigen receptor complex, e.g., a TCR complex, in the case of a CAR, and / or to a signal via another cell surface receptor. Thus, in some embodiments, the extracellular binding component (e.g., a ligand-binding or antigen-binding domain) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, one of the domains within the receptor, e.g., the transmembrane domain naturally associated with the CAR, is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and minimize interaction with other members of the receptor complex.

[0422] In some embodiments, the chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, VH, or single-domain VH antibody, and the intracellular domain comprises an ITAM. In some embodiments, the intracellular signaling domain comprises the signaling domain of the zeta chain of the CD3-zeta (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting the extracellular domain and the intracellular signaling domain.

[0423] In some embodiments, the transmembrane domain comprises the transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane can be directly or indirectly linked. In some embodiments, the extracellular domain and the transmembrane are linked by a spacer, such as any of those described herein. In some embodiments, the chimeric antigen receptor contains, for example, an intracellular domain of a T cell costimulatory molecule between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB.

[0424] Chimeric antigen receptor CDR, VH, VL domains In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain comprises an MSLN antibody or an antigen-binding fragment thereof.

[0425] In some aspects, the chimeric antigen receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 17.

[0426] In some embodiments, CDR-H3 of the chimeric antigen receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-H3 of SEQ ID NO: 16, CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-H2 of SEQ ID NO: 15, and CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-H1 of SEQ ID NO: 14. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 16 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 15 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 14 with up to 1, 2, 3, 4, or 5 amino acid substitutions.

[0427] In some embodiments, a chimeric antigen receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, an antigen-binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 17. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0428] In some embodiments, a chimeric antigen receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 17. In some embodiments, an antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0429] In some aspects, the chimeric antigen receptor extracellular antigen-binding domain comprises a single antibody variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the VHH chain sequence comprises the sequence set forth in SEQ ID NO: 13.

[0430] In some embodiments, the CDR-H3 of the chimeric antigen receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H3 of SEQ ID NO: 12, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H2 of SEQ ID NO: 11, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H1 of SEQ ID NO: 10. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 12 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 11 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 10 with up to 1, 2, 3, 4, or 5 amino acid substitutions.

[0431] In some embodiments, a chimeric antigen receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, an antigen-binding domain provided herein comprises three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0432] In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain provided herein comprises a VHH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VHH sequence set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domain provided herein comprises a VHH sequence provided in SEQ ID NO: 13 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0433] Table C provides exemplary MSLN antigen-binding domain CDR sequences of the VHH of SEQ ID NO: 13 and the VHH of SEQ ID NO: 17, with the numbering scheme shown.

[0434] [Table C]

[0435] CAR transmembrane domain In some embodiments, the transmembrane domain is derived from either a natural or synthetic source. If the source is natural, in some aspects, the domain is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e., comprising at least the transmembrane region(s) of) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and / or CD154. Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, synthetic transmembrane domains comprise primarily hydrophobic residues such as leucine and valine. In some aspects, triplets of phenylalanine, tryptophan, and valine are found at each end of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain(s).

[0436] In some embodiments, the transmembrane domain of the receptor, e.g., CAR, is the transmembrane domain of human CD28 or a variant thereof, e.g., the 27 amino acid transmembrane domain of human CD28 (Accession Number: P10747.1).

[0437] In some embodiments, the CAR comprises a CD8a TMD. In some embodiments, the CD8a TMD comprises the sequence set forth in SEQ ID NO:27.

[0438] CAR hinge In some embodiments, the CAR further comprises a spacer, which may be or may include at least a portion of an immunoglobulin constant region, or a variant or modified version thereof, such as a hinge region, e.g., a CD8a hinge, an IgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is that of a human IgG, such as IgG4 or IgG1. In some aspects, the portion of the constant region functions as a spacer region between the antigen-recognition component, e.g., an scFv, and the transmembrane domain. The spacer may be of a length that results in increased cellular responsiveness after antigen binding compared to the absence of the spacer. In some examples, the spacer is about 12 amino acids in length, or 12 amino acids or less in length. Exemplary spacers include those having at least about 10-229 amino acids, about 10-200 amino acids, about 10-175 amino acids, about 10-150 amino acids, about 10-125 amino acids, about 10-100 amino acids, about 10-75 amino acids, about 10-50 amino acids, about 10-40 amino acids, about 10-30 amino acids, about 10-20 amino acids, or about 10-15 amino acids, including any integer between any of the endpoints of the recited ranges. In some embodiments, the spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less. Exemplary spacers include a CD8a hinge, an IgG4 hinge alone, an IgG4 hinge linked to CH2 and CH3 domains, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin.Cancer Res., 19:3153 or International Patent Application Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8a hinge. In some embodiments, the CD8a hinge comprises the sequence set forth in SEQ ID NO: 26.

[0439] Some intracellular signaling domains mimic or approximate signaling through natural antigen receptors, signaling through such receptors in combination with costimulatory receptors, and / or signaling through costimulatory receptors alone. In some embodiments, a short oligo- or polypeptide linker, e.g., a linker 2-10 amino acids in length, such as one containing glycine and serine, e.g., a glycine-serine doublet, is present to form the link between the transmembrane domain and the cytoplasmic signaling domain of the receptor.

[0440] CAR intracellular domain In some embodiments, upon ligation of the CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of an immune cell, e.g., a T cell engineered to express the receptor. For example, in some contexts, the receptor induces a T cell function, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, e.g., when it transduces an effector function signal. In some embodiments, the intracellular signaling domain or domains comprise the cytoplasmic sequence of a T cell receptor (TCR), and in some aspects, any derivative or variant of such a molecule that acts in concert with such a receptor in its natural context to signal following antigen receptor engagement, and / or any synthetic sequence having the same functional capability.

[0441] In some embodiments, the receptor comprises a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The stimulatory primary cytoplasmic signaling sequence may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs containing primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d. In some embodiments, the cytoplasmic signaling molecule(s) in the CAR contain a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 zeta.

[0442] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112 AA cytoplasmic domain of human CD3 zeta isoform 3 (Accession Number: P20963.2) or a CD3 zeta signaling domain described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0443] A receptor, e.g., a CAR, can comprise at least one intracellular signaling component(s). In some embodiments, the receptor comprises an intracellular component of the TCR complex, such as a TCR CD3 chain, e.g., a CD3 zeta chain, which mediates T cell activation and cytotoxicity. Thus, in some embodiments, the extracellular domain is linked to one or more cell signaling modules. In some embodiments, the cell signaling module comprises a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., a CAR, further comprises a portion of one or more additional molecules, such as Fc receptor gamma, CD8, CD4, CD25, or CD16. For example, in some embodiments, the CAR comprises a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25, or CD16. In some embodiments, the CAR comprises a CD3 zeta activation domain comprising the sequence set forth in SEQ ID NO: 29.

[0444] In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of 41BB, or a functional variant or portion thereof, e.g., the 42 amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1), or a functional variant or portion thereof.

[0445] In some embodiments, the receptor includes one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., a primary activation domain, in the cytoplasmic portion. Exemplary receptors include CD3-zeta, CD28, and the intracellular component of 4-1BB. In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell costimulatory molecule. In some aspects, the T cell costimulatory molecule is 4-1BB.

[0446] In some embodiments, the receptor comprises the signaling domain and / or transmembrane portion of a costimulatory receptor such as CD28, 4-1BB, OX40, DAP10, and ICOS. In some aspects, the same receptor comprises both an activating component and a costimulatory component.

[0447] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) costimulatory domain linked to a CD3 zeta intracellular domain. In some embodiments, the CAR comprises a 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises the sequence set forth in SEQ ID NO:28.

[0448] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 30, 31, 32, or 33. In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 30.

[0449] In some embodiments, the CAR or other antigen receptor further comprises a marker, such as a cell surface marker, which can be used to confirm the transduction or engineering of cells to express a receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some embodiments, the marker comprises all or a portion (e.g., a truncated form) of CD34, nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a linker sequence, e.g., a cleavable linker sequence or a ribosomal skip sequence, e.g., a polynucleotide encoding T2A. See WO2014031687. In some embodiments, introduction of a construct encoding CAR and EGFRt separated by a T2A ribosomal switch allows expression of the two proteins from the same construct, such that EGFRt can be used as a marker to detect cells expressing such a construct. In some embodiments, the marker, and optionally the linker sequence, can be any of the sequences disclosed in published patent application WO2014031687. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence such as a T2A ribosomal skip sequence.

[0450] In some embodiments, the marker is a molecule that is not naturally found on T cells or that is not naturally found on the surface of T cells, for example, a cell surface protein, or portion thereof.

[0451] In some embodiments, the molecule is a non-self molecule, eg, a non-self protein, ie, a molecule that is not recognized as "self" by the immune system of the host into which the cells are adoptively transferred.

[0452] In some embodiments, the marker does not serve a therapeutic function and / or produce any effect other than being used as a marker for genetic manipulation, e.g., to select successfully engineered cells. In other embodiments, the marker may be a therapeutic molecule or a molecule that exerts some desired effect in other ways, e.g., a ligand for cells encountered in vivo, e.g., a costimulatory or immune checkpoint molecule to enhance and / or attenuate the response of cells upon adoptive transfer and encounter with the ligand.

[0453] A CAR may contain one or more modified synthetic amino acids in place of one or more naturally occurring amino acids. Exemplary modified amino acids include aminocyclohexanecarboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 3-phenylserine, 3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2, These include, but are not limited to, 3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine, and α-tertbutylglycine.

[0454] For example, in some embodiments, a CAR comprises a single chain antibody (sdAb, e.g., containing only a VH region), an antibody or fragment thereof comprising a VH domain and an scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain. In some embodiments, a CAR comprises an antibody or fragment thereof comprising a sdAb and an scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.

[0455] MSLN antibodies and antigen-binding fragments In some aspects, provided herein are MSLN antibodies or antigen-binding fragments thereof. In some embodiments, the MSLN antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, such as increased binding affinity.

[0456] In some embodiments, provided herein is an isolated antibody or antigen-binding fragment thereof that binds to mesothelin (MSLN), wherein the isolated antibody or antigen-binding fragment thereof comprises a single domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12.

[0457] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a single-domain antibody variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences: CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the VHH chain sequence comprises the sequence set forth in SEQ ID NO: 13.

[0458] In some embodiments, the CDR-H3 of the MSLN antibody or antigen-binding fragment has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 12, 200 or 201; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 11, 196, 197, 198 or 199; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 10, 192, 193, 194 or 195. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 12, 200 or 201 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 11, 196, 197, 198 or 199 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, and the CDR-H1 is CDR-H1 of SEQ ID NO: 10, 192, 193, 194 or 195 with a maximum of 1, 2, 3, 4 or 5 amino acid substitutions.

[0459] In some embodiments, the MSLN antibody or antigen-binding fragment provided herein comprises one to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VHH domain set forth in SEQ ID NO: 13. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0460] In some embodiments, the MSLN antibodies or antigen-binding fragments provided herein comprise a VHH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VHH sequence set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domains provided herein comprise a VHH sequence provided in SEQ ID NO: 13 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0461] In some embodiments, an MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 13. In some embodiments, an MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 13. In some embodiments, an MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to CDR1, 2, and 3 of SEQ ID NO: 13. In some embodiments, an MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region in which the complete set of VH CDR1, 2, and 3 (combined) have at least 95% sequence identity to CDR1, 2, and 3 of SEQ ID NO: 13.

[0462] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity determining region 1 (CDR1) comprising a sequence having up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 10, 192, 193, 194, or 195; (ii) a VH CDR2 comprising a sequence having up to two (e.g., one, two, or none) amino acid modifications relative to SEQ ID NO: 11, 196, 197, 198, or 199; and (iii) comprises a VH CDR3 comprising a sequence with up to two (e.g., one, two, zero) amino acid modifications relative to SEQ ID NO: 12, 200, or 201.

[0463] In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution. In some embodiments, each amino acid modification, if present, is a conservative amino acid substitution listed in Table A1.

[0464] In some embodiments, the VH CDR1 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 10, 192, 193, 194, or 195. In some embodiments, the VH CDR2 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 11, 196, 197, 198, or 199. In some embodiments, the VH CDR3 comprises a sequence with at most one amino acid modification relative to SEQ ID NO: 12, 200, or 201. In some embodiments, the at most one amino acid modification is an amino acid substitution. In some embodiments, the at most one amino acid modification is a conservative amino acid substitution. In some embodiments, the at most one amino acid modification is an amino acid deletion. In some embodiments, the at most one amino acid modification is an amino acid addition.

[0465] In some embodiments, the VH CDR1 comprises the sequence set forth in SEQ ID NO: 10. In some embodiments, the VH CDR2 comprises the sequence set forth in SEQ ID NO: 11. In some embodiments, the VH CDR3 comprises the sequence set forth in SEQ ID NO: 12.

[0466] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region, wherein the VH region is (i) a VH complementarity-determining region 1 (CDR1) comprising the sequence set forth in SEQ ID NO: 10; (ii) a VH CDR2 comprising the sequence set forth in SEQ ID NO: 11, and (iii) comprises a VH CDR3 comprising the sequence set forth in SEQ ID NO: 12.

[0467] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region comprising VH CDR1, VH CDR2, and VH CDR3, wherein VH CDR1, VH CDR2, and VH CDR3 comprise the sequences of SEQ ID NOs: 10, 11, and 12, respectively.

[0468] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region comprising CDR1, CDR2, and CDR3 of SEQ ID NO:13.

[0469] In some embodiments, the VH CDR1, VH CDR2 and VH CDR3 sequences are present in a human VH framework.

[0470] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 13. In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 85% (e.g., 85%, 90%, 95%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 13. In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 90% (e.g., 90%, 95%, at least 95%) sequence identity to SEQ ID NO: 13. In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 95% sequence identity to SEQ ID NO: 13.

[0471] In some embodiments, the MSLN antibody or antigen-binding fragment comprises a heavy chain variable (VH) region having at least 80% (e.g., 80%, 85%, 90%, 95%, at least 85%, at least 90%, at least 95%) sequence identity to SEQ ID NO: 13.

[0472] In some embodiments, the MSLN antibody or antigen-binding fragment specifically binds to human MSLN.

[0473] In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of about 10 -9 M~about 10 -6 K of M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 5×10 -7 K below M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 1×10 -7 K below M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 5×10 -8 K below M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 2×10 -8 K below M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 1×10 -8 K below M D In some embodiments, the MSLN antibody or antigen-binding fragment binds to human MSLN at a concentration of 1×10 -9 K below M D Combine with.

[0474] In some embodiments, the MSLN antibody or antigen-binding fragment is a single domain antibody.

[0475] In some embodiments, the MSLN antibody or antigen-binding fragment is a human single-domain antibody.

[0476] In some embodiments, the MSLN antibody or antigen-binding fragment is an isolated single-domain antibody. In some embodiments, the MSLN antibody or antigen-binding fragment is an isolated human single-domain antibody.

[0477] Recombinant Nucleic Acids and Vectors

[0010] In one aspect, provided herein is a recombinant nucleic acid, wherein one or more recombinant nucleic acids encode a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds germline alkaline phosphatase (ALPG / P); a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen-binding domain that specifically binds mesothelin (MSLN); and a nucleic acid sequence at least 15 nucleotides in length, wherein the nucleic acid sequence is selected from the group consisting of a nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; a nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40; and a nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0478] In another aspect, a recombinant nucleic acid, wherein the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds placental / germline alkaline phosphatase (ALPG / P), wherein the first extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, and CDR-L2 comprises the sequence set forth in SEQ ID NO: 5. Provided herein are recombinant nucleic acids encoding a first chimeric polypeptide comprising the sequence: a first chimeric polypeptide comprising the sequence: a CDR-L3 comprising the sequence set forth in SEQ ID NO: 6; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39; and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41.

[0479] In another aspect, a recombinant nucleic acid, wherein the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular antigen binding domain that specifically binds mesothelin (MSLN), wherein the extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 14, CDR-H2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 16. Provided herein are recombinant nucleic acids encoding a peptide; a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0480] In another aspect, a recombinant nucleic acid is provided, wherein the one or more recombinant nucleic acids comprise a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular antigen binding domain that specifically binds mesothelin (MSLN), wherein the extracellular antigen binding domain comprises a single domain antibody comprising a variable heavy (VHH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 12. and a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0481] In some embodiments, the recombinant nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 156-165.

[0482] RNA interference molecules The Fas cell surface death receptor (FAS) is a member of the apoptosis-inducing TNF receptor superfamily. Protein tyrosine phosphatase non-receptor type 2 (PTPN2) is a phosphatase that regulates interferon and many other signaling pathways. Thymocyte selection-associated high-mobility group box (TOX) is a transcription factor that regulates the differentiation of exhausted T cells.

[0483] As used herein, "target gene" refers to a nucleic acid sequence in a cell whose expression can be specifically and effectively regulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene may be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of an individual's immune cells. In some embodiments, the target gene is FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is TOX. In some embodiments, two or more target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the recombinant nucleic acid molecule(s) is shRNA. In some embodiments, the target genes are at least FAS and PTPN2. In some embodiments, the target genes are at least FAS and TOX.

[0484] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39.

[0485] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:40.

[0486] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0487] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40.

[0488] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0489] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294-2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0490] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-56. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 45. In some embodiments, the nucleic acid is capable of reducing expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0491] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-84. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 82. In some embodiments, the nucleic acid is capable of reducing PTPN2 expression in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0492] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98-111. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 99 or 104. In some embodiments, the nucleic acid is capable of reducing TOX expression in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0493] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0494] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule.Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is shRNA.

[0495] Single-stranded hairpin ribonucleic acid (shRNA) is a short double-stranded nucleic acid in which the sense and antisense strands are connected by a hairpin loop. They consist of a stem-loop structure, which can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. When expressed, shRNA is processed into an RNAi species. Expression of shRNA from a plasmid is known to be relatively stable, thereby offering a strong advantage over the use of, for example, synthetic siRNA. shRNA expression units can be incorporated into various plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. Expression of shRNA from a plasmid can be stably incorporated for constitutive expression. shRNA is synthesized in the cell nucleus, further processed, transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. The shRNA is converted into an active siRNA molecule (capable of binding to and sequestering the mRNA transcript encoded by the target gene and / or preventing its translation).

[0496] The Argonaute family of proteins is a major component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that can cleave and release the passenger strand from the stem portion of the shRNA molecule. The remaining three members of the Argonaute family, Ago1, Ago3, and Ago4, which do not have discernible endonuclease activity, also assemble to form RISC and are thought to function in a cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0497] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. 2018232356A1, 2019084552A1, 2019226998A1, 2020014235A1, 2020123871A1, and 2020186219A1, each of which is incorporated by reference herein for all purposes.

[0498] Antisense oligonucleotide structures and chemical modifications are described in International Publication No. WO 20 / 132521, which is incorporated herein by reference.

[0499] dsRNA and shRNA molecules, as well as methods of use and production, are described in US Pat. No. 8,829,264, US Pat. No. 9,556,431, and US Pat. No. 8,252,526, each of which is incorporated herein by reference.

[0500] siRNA molecules, as well as methods of use and production, are described in US Pat. No. 7,361,752 and US Patent Application No. 20050048647, both of which are incorporated herein by reference.

[0501] Additional methods and compositions for RNA interference, e.g., shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, WO 00 / 44895, WO 01 / 36646, WO 99 / 32619, WO 00 / 01846, WO 01 / 29058, WO 00 / 44914, and WO 04 / 030634, each of which is incorporated herein by reference.

[0502] Nucleic acid sequences (or constructs) that can be used to encode the RNAi molecules, e.g., shRNAs, described herein can include a promoter operably linked (or connected) directly or indirectly to the sequence encoding the RNAi molecule. Such promoters can be selected based on the host cell and the desired effect. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as EF1α or inducible RNA polymerase II (pol II)-based promoters. Non-limiting examples of suitable promoters further include tetracycline-inducible or repressible promoters, RNA polymerase I or III-based promoters, pol II-dependent viral promoters, e.g., the CMV-IE promoter, and pol III U6 and H1 promoters. The bacteriophage T7 promoter can also be used (it will be understood that in this case, T7 polymerase must also be present). In particular, nucleic acid sequences need not be limited to the use of any single promoter, as they can include two or more shRNAs (i.e., effector combinations), including, but not limited to, integrated shRNA molecules. Each integrated promoter can control one or any combination of the shRNA molecule components.

[0503] In certain embodiments, the promoter may be preferentially active in target cells; for example, it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such constructs into host cells may be performed under conditions in which two or more recombinant nucleic acids contained within recombinant nucleic acid precursor transcripts initially exist within a single primary transcript, whereby separate RNA molecules (e.g., shRNAs, each containing its own stem-loop structure) are subsequently excised from such precursor transcript by endogenous ribonucleases. The resulting mature recombinant nucleic acids (e.g., shRNAs) can then induce degradation and / or translational repression of target gene mRNA transcripts produced in the cell. Alternatively, each of the precursor stem-loop structures may be produced as part of a separate transcript, in which case each recombinant nucleic acid sequence preferably includes its own promoter and transcription termination sequence. Additionally, multiple recombinant nucleic acid precursor transcripts may exist within a single primary transcript.

[0504] The stem-loop structure of the shRNA recombinant nucleic acids described herein may be about 40-100 nucleotides in length, or preferably about 50-75 nucleotides in length. The stem region may be about 15-45 nucleotides (or more), or about 20-30 nucleotides in length. In some embodiments, the stem region is 22 nucleotides in length. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.

[0505] The stem may contain a fully complementary duplex (but for either 3' tail), but a bulge or internal loop may be present on either arm of the stem. The number of such bulges and asymmetric internal loops is preferably small (e.g., 1, 2, or 3) and about 3 or less nucleotides in size. The terminal loop portion may contain about 4 or more nucleotides, but preferably about 25 or less. The loop portion is preferably 6 to 15 nucleotides in size.

[0506] As described herein, the stem region of shRNA comprises a passenger strand and a guide strand, whereby the guide strand contains a sequence complementary to the target mRNA transcript encoded by the target gene(s).Preferably, the GC content and matching of the guide strand and the passenger strand are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage.Furthermore, the specificity of the guide strand is preferably confirmed through BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0507] The present invention provides that the expression levels of multiple target genes can be regulated using the methods and recombinant nucleic acids described herein. For example, the present invention provides that a first set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a first target gene, and a second set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a second target gene. The different sets of recombinant nucleic acids can be expressed and reside within the same or separate pre-transcripts. In certain embodiments, such a multiplex approach, i.e., the use of the recombinant nucleic acids described herein to regulate the expression levels of two or more target genes, can have an enhanced therapeutic effect on patients. For example, when a patient is provided with cells expressing the recombinant nucleic acid molecules described herein to treat, prevent, or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of recombinant nucleic acid molecules designed to reduce the expression levels of multiple genes involved in immune cell activation or suppression.

[0508] The recombinant nucleic acid molecule(s) described herein may be capable of reducing target gene expression in cells by at least about 50% or more compared to control cells that do not contain the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) (e.g., shRNA) may be capable of reducing the expression of a target gene selected from the group consisting of FAS, PTPN2, and TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to control cells that do not contain the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) can be capable of reducing expression of a target gene selected from the group consisting of FAS, PTPN2, and TOX in immune cells by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or by at least about 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the recombinant nucleic acid molecule(s) are capable of reducing expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the recombinant nucleic acid molecule(s) are capable of reducing expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecule(s).

[0509] Recombinant nucleic acid molecule(s) can be chemically synthesized or in vitro transcribed and can further include one or more modifications to the sugar phosphate backbone or nucleoside residues.

[0510] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transport and chemical-mediated transport, e.g., calcium phosphate, etc. Thus, the recombinant nucleic acid molecule(s) construct can be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, promoting annealing of duplexes for shRNA, stabilizing the annealed shRNA strands, or otherwise increasing inhibition of the target gene.

[0511] Additional Elements In some embodiments, the one or more recombinant nucleic acid(s) further comprise a 5' homology-directed repair arm and / or a 3' homology-directed repair arm, wherein the 5' homology-directed repair arm and / or the 3' homology-directed repair arm are complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more recombinant nucleic acid(s) comprise a 5' homology-directed repair arm and a 3' homology-directed repair arm. In some embodiments, the one or more recombinant nucleic acid(s) are incorporated into an expression cassette or expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acid(s).

[0512] In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are incorporated into two or more expression cassettes or expression vectors. In some embodiments, the expression vector(s) is / are a non-viral vector.

[0513] One or more interfering nucleic acid sequences (e.g., one or more shRNAs) can be encoded in an intron region of a recombinant nucleic acid insert, DNA template, single expression cassette, or single expression vector, which also encodes a priming receptor and / or a CAR. For example, if the DNA template includes a promoter, such as EF1α or an inducible promoter described herein, to drive expression of a CAR or priming receptor, one or more nucleic acid sequences (e.g., shRNA sequences) can be encoded in a promoter intron region. In some embodiments, one or more nucleic acid sequences are encoded in at least one intron region of a recombinant nucleic acid insert or DNA template. In some embodiments, one or more nucleic acid sequences are encoded in at least one EF1α intron region of a recombinant nucleic acid insert or DNA template.

[0514] In some embodiments, the present disclosure contemplates a recombinant nucleic acid DNA template insert comprising one or more transgenes encoding a priming receptor and / or a CAR described herein. In some embodiments, the DNA template insert encodes a priming receptor transgene. In some embodiments, the DNA template insert encodes a chimeric antigen receptor transgene. In some embodiments, the DNA template insert encodes a first nucleic acid complementary to at least 15 nucleotides of the human FAS mRNA sequence and a second nucleic acid complementary to at least 15 nucleotides of the human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a priming receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid complementary to at least 15 nucleotides of the human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid that is complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid that is complementary to at least 15 nucleotides of the human PTPN2 mRNA sequence.

[0515] In some embodiments, one or more recombinant nucleic acid(s) are encoded on a single DNA template insert. In some embodiments, one or more recombinant nucleic acid(s) are encoded on multiple DNA template inserts. For example, one or more recombinant nucleic acid(s) can be encoded on two, three, or four DNA template inserts.

[0516] The DNA template insert can also contain a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine teschovirus-1 (P2A) peptide, Thosea asigna virus (T2A) peptide, equine rhinitis A virus (E2A) peptide, or foot-and-mouth disease virus (F2A) peptide. Self-cleaving 2A peptides enable the expression of multiple gene products from a single construct. (See, for example, Chang et al., "Cleavage efficient 2A peptides for high-level monoclonal antibody expression in CHO cells," MAbs 7(2):403-412 (2015)).

[0517] The DNA template insert may also contain a WPRE element, which is generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007) and Zufferey, R., et al. J Virol. 1999 Apr;73(4):2886-92, both of which are incorporated herein by reference.

[0518] The DNA template insert can also include an SV40 polyA tail.

[0519] Recombinant cells The transgenes expressing the priming receptor and CAR system can be introduced into cells, e.g., T cells, using, for example, site-specific techniques. For site-specific integration of the transgene (e.g., the priming receptor and CAR), the transgene can be targeted to a safe harbor locus or TRAC. Examples of site-specific techniques for integration into a safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0520] The engineered recombinant cells have applications in immuno-oncology. For example, priming receptors and CARs can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells include blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0521] Provided herein are modified cells, wherein the cells have been modified to have reduced expression of a FAS gene and / or reduced function of a product of the FAS gene relative to a corresponding unmodified cell, and optionally the modified cells are hematopoietic cells. In some embodiments, the modified cells are further modified to have reduced expression of at least one second gene and / or reduced function of a product of at least one second gene relative to a corresponding unmodified cell.

[0522] Also provided herein are modified and engineered cells, wherein the engineered cells have been modified to have reduced expression of a FAS gene and / or reduced function of a product of the FAS gene relative to a corresponding unmodified engineered cell, and optionally the modified and engineered cells have been engineered to express a heterologous immune receptor. In some embodiments, the modified and engineered cells are further modified to have reduced expression of at least one second gene and / or reduced function of a product of at least one second gene relative to a corresponding unmodified engineered cell.

[0523] Also provided herein are modified cells, wherein the cells have been modified to have (a) reduced expression of a FAS gene and / or reduced function of a product of the FAS gene, and (b) reduced expression of at least one second gene and / or reduced function of a product of at least one second gene, wherein the reduced expression of each gene is relative to a corresponding unmodified cell, and optionally the modified cells are hematopoietic cells.

[0524] In some embodiments, the modification to reduce expression comprises genetically engineering the genome of the cell to disrupt the FAS gene and optionally at least one second gene. In some embodiments, the genetic engineering comprises nuclease-mediated editing, and optionally, the nuclease-mediated editing comprises CRISPR / Cas9-mediated editing.

[0525] In some embodiments, the modification to reduce expression comprises RNAi-mediated targeting of the FAS gene and optionally at least one second gene, and optionally the RNAi-mediated targeting comprises short hairpin RNA (shRNA)-mediated knockdown. In some embodiments, the RNAi-mediated targeting comprises engineering the cell to express an RNA polynucleotide capable of mediating the knockdown of the FAS gene and optionally at least one second gene.

[0526] In some embodiments, the modified cells comprise hematopoietic cells. In some embodiments, the hematopoietic cells comprise hematopoietic stem cells. In some embodiments, the hematopoietic cells comprise immune cells. In some embodiments, the immune cells comprise adaptive immune cells, innate immune cells, T cells, NK cells, macrophages.

[0527] In some embodiments, the modified cells comprise engineered cells. In some embodiments, the engineered cells are engineered to express a heterologous receptor. In some embodiments, the heterologous receptor comprises an immune receptor. In some embodiments, the heterologous immune receptor comprises a chimeric antigen receptor (CAR), a T cell receptor, or an NK cell receptor. In some embodiments, the engineered cells comprise T cells or cells capable of differentiating into T cells, and the heterologous receptor is inserted into an endogenous TCR locus, optionally the T cell receptor alpha (TRAC) locus. In some embodiments, the heterologous receptor comprises one or more antigen-binding domains, optionally capable of binding to a tumor antigen or an antigen associated with cancer.

[0528] In some embodiments, the reduced expression and / or function of the FAS gene or its expression product improves at least one property of the modified cell relative to a corresponding unmodified cell.

[0529] In some embodiments, when the modified cell is further modified to have reduced expression and / or function of at least one second gene, the reduced expression and / or function of the FAS gene or its expression product, and the reduced expression and / or function of the at least one second gene or its expression product, improves at least one property of the modified cell relative to a corresponding cell modified to reduce only the expression and / or function of the FAS gene.

[0530] In some embodiments, when the modified cell is further modified to have reduced expression and / or function of at least one second gene, the reduced expression and / or function of the FAS gene or its expression product, and the reduced expression and / or function of the at least one second gene or its expression product, improves at least one property of the modified cell relative to a corresponding cell modified to reduce only the expression and / or function of the at least one second gene.

[0531] In some embodiments, the at least one property comprises improved proliferation capacity. In some embodiments, the at least one property comprises improved protection from FAS-mediated apoptosis. In some embodiments, the modified cells comprise immune cells, and the at least one property comprises improved immune effector cell function. In some embodiments, the improved immune effector cell function comprises increased relative effector molecule expression, production, and / or secretion. In some embodiments, the immune cells comprise T cells, and the effector molecule comprises one or more molecules selected from the group consisting of IFNγ, TNFα, granzyme B, and FASL.

[0532] In some embodiments, the modified cells are engineered to express a heterologous surface antigen, and optionally, the heterologous surface antigen is capable of mediating targeted depletion of the engineered and modified cells relative to corresponding modified cells that have not been engineered to express the heterologous surface antigen.

[0533] Also provided herein is a method for stimulating an immune response in a subject, comprising administering to the subject any one of the modified cells disclosed herein. Also provided herein is a method for treating cancer in a subject, comprising administering to the subject any one of the modified cells disclosed herein. In some embodiments, the modified cells are autologous to the subject. In some embodiments, the modified cells are allogeneic to the subject.

[0534] Also provided herein is a recombinant immune cell comprising one or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode a first chimeric polypeptide comprising a priming receptor, a second chimeric polypeptide comprising a CAR, and a nucleic acid sequence at least 15 nucleotides in length, wherein the nucleic acid sequence is selected from the group consisting of a nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39, a nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40, and a nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41.

[0535] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40. In some embodiments, the nucleic acid sequence is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41.

[0536] Also provided herein is a recombinant immune cell comprising one or more recombinant nucleic acid(s) non-virally inserted into a target region of the genome of the cell, wherein the one or more recombinant nucleic acid(s) encode a priming receptor described herein, a CAR, a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or complementary to an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41. Also provided herein is a recombinant immune cell comprising a priming receptor that specifically binds to placental / germline alkaline phosphatase (ALPG / P), a chimeric antigen receptor that specifically binds to MSLN, a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or complementary to an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41.

[0537] Cells containing DNA template inserts at target loci or safe harbor sites, as described in this disclosure, may be referred to as engineered cells. In some embodiments, the immune cells are any cells capable of giving rise to pluripotent immune cells. In some embodiments, the immune cells are primary immune cells. In some embodiments, the immune cells may be induced pluripotent stem cells (iPSCs) or human pluripotent stem cells (HSPCs). In some embodiments, the immune cells comprise primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells, or T cell precursors. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD8+ cells. + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0538] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, hematopoietic stem cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. Non-limiting examples of immune cells contemplated by the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated by the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other stem cells, including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tenocytes, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.

[0539] Also provided herein is a population of cells comprising a plurality of immune cells, in some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise a priming receptor, a CAR, and a first and second nucleic acid described herein.

[0540] How to Treat Cancer In another aspect, the invention provides a method of treating an immune-related condition (e.g., cancer) in an individual, the method comprising administering to the individual an effective amount of a composition, the composition comprising: a priming receptor that specifically binds ALPG / P; a chimeric antigen receptor that specifically binds MSLN; a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0541] In another aspect, the invention provides a method for enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition, the composition comprising: a priming receptor that specifically binds ALPG / P; a chimeric antigen receptor that specifically binds MSLN; a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence at least 15 nucleotides in length, the second nucleic acid sequence being complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0542] In some embodiments, the recombinant nucleic acid is an shRNA molecule. In some embodiments, the shRNA is selected from the group consisting of a FAS shRNA molecule, a PTPN2 shRNA molecule, and a TOX shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule. In some embodiments, a cell comprises at least a PTPN2 shRNA molecule. In some embodiments, a cell comprises at least a TOX shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule and a PTPN2 shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule and a TOX shRNA molecule. In some embodiments, a cell comprises at least a PTPN2 shRNA molecule and a TOX shRNA molecule. In another aspect, the invention provides a method of enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising cells comprising at least one shRNA molecule, wherein the shRNA molecule is selected from the group consisting of a FAS shRNA molecule, a PTPN2 shRNA molecule, and a TOX shRNA molecule.

[0543] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0544] In some embodiments, the methods provided herein (e.g., methods of enhancing an immune response) are useful for treating cancer, and thus, an individual receiving a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immunoevasive. In some embodiments, the cancer is immunoresponsive. In certain embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer. In some embodiments, the cancer is ovarian cancer.

[0545] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing cancer volume compared to the cancer volume before administration of the antibody. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing cancer growth rate compared to the cancer growth rate before administration of the antibody. In some embodiments, the treatment is effective in eliminating the cancer.

[0546] In some embodiments, MSLN and ALPG or ALPP are expressed at higher levels in cancer compared to non-cancer cells. The levels of MSLN, ALPG and ALPP can be assessed by any technique known in the art, including, but not limited to, protein or nuclear assays, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology, and FISH, and combinations thereof.

[0547] Immunomodulatory methods A method of administering cells containing the system described herein, comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40 or complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41, can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0548] In one aspect, administration of cells comprising the system described herein, which comprises a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN, can result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. Generally, the induced pro-inflammatory molecules are present at levels greater than those achieved with isotype controls. Such pro-inflammatory molecules then lead to the activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN can induce multiple anti-tumor immune mechanisms that result in tumor destruction.

[0549] In another aspect, provided herein is a method of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells, the cells comprising a system comprising a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject cells comprising a system comprising a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN.

[0550] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0551] In any of the embodiments described herein that increase an immune response, the increase, decrease, or alteration of any aspect of characteristic(s) or function(s) is compared to cells that do not contain a composition comprising a system comprising a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN.

[0552] Increasing an immune response can be both enhancing an immune response or inducing an immune response. For example, increasing an immune response encompasses both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of cells comprising a system comprising a priming receptor that specifically binds ALPG / P and a chimeric antigen receptor that specifically binds MSLN. In some embodiments, the immune response is enhanced by administration of cells comprising a system comprising a priming receptor that specifically binds to ALPG / P and a chimeric antigen receptor that specifically binds to MSLN.

[0553] In another aspect, the present application provides a method for gene editing a cell with a system, the system comprising: a priming receptor that specifically binds ALPG / P; a chimeric antigen receptor that specifically binds MSLN; a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 39; and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 40 or complementary to an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO: 41, wherein the gene editing results in modulation of immune function of the cell. The modulation can be an increase in immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in expression of an MSLN CAR. In some embodiments, the modulation of function results in activation of the cell comprising the system.

[0554] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0555] In some embodiments, modulation of the function of cells comprising a priming receptor and a CAR system described herein results in an increase in the ability of the cells to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by cells expressing the priming receptor and a CAR system. In some embodiments, modulation of function enhances or increases the ability of the cells to produce cytokines, chemokines, CARs, or costimulatory or activating receptors. In some embodiments, modulation increases the T cell stimulatory function of cells expressing the priming receptor and a CAR system, where T cell stimulatory function includes, for example, the ability of the cells to induce T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0556] In some embodiments, the increased immune response is cytokine and chemokine secretion. In some embodiments, the priming receptor and CAR system induces increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells. In some embodiments, the at least one cytokine or chemokine is selected from the group consisting of IL-2 and IFNγ. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNγ. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2 and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNγ and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0557] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0558] In some embodiments, cells expressing the priming receptor and CAR system induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0559] Methods for reducing gene expression Another aspect of the present invention provides a method for attenuating expression of a target gene in a mammalian cell, comprising introducing into the mammalian cell a recombinant nucleic acid complementary to the target gene mRNA, such as a single-stranded hairpin ribonucleic acid (shRNA), siRNA, dsRNA, or antisense oligonucleotide. In some embodiments, the recombinant nucleic acid complementary to the target gene mRNA is an shRNA. In some embodiments, the shRNA comprises a self-complementary sequence of 19 to 100 nucleotides that forms a duplex region, and this self-complementary sequence hybridizes to the target gene mRNA transcript under intracellular conditions. In some embodiments, the shRNA comprises a 22-nt self-complementary sequence. In some embodiments, the shRNA (i) is a substrate for cleavage by RNase III enzyme to produce a double-stranded RNA product, (ii) does not result in general sequence-independent killing of mammalian cells, and (iii) reduces expression of the target gene in a manner dependent on the sequence of the complementary region. In some embodiments, the target gene is FAS. In some embodiments, the target gene is human FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is human PTPN2. In some embodiments, the target gene is TOX. In some embodiments, the target gene is human TOX.

[0560] Immune cells comprising the recombinant nucleic acid can have reduced or diminished expression of a target gene selected from the group consisting of FAS, PTPN2, and TOX. In some embodiments, the immune cells have FAS, PTPN2, and / or TOX expression reduced by about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, or 50-55% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the immune cells have FAS expression in the immune cells that is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the immune cells have PTPN2 expression in the immune cells that is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s). In some embodiments, the immune cells have TOX expression in the immune cells that is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s).

[0561] In some embodiments, expression of FAS in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid. In some embodiments, the second nucleic acid is capable of reducing expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid. In some embodiments, expression of PTPN2 in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0562] In some embodiments, the second nucleic acid is capable of reducing TOX expression in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid, hi some embodiments, TOX expression in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0563] In some embodiments, the expression of FAS, PTPN2, and / or TOX is determined by a nucleic acid assay or a protein assay, in some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0564] How to edit cells The terms "genetic engineering," "gene editing," or "genome editing," as used herein, refer to a type of genetic manipulation in which DNA is inserted, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effects of sequence-specific genes or proteins or for modifying cellular behavior (e.g., for therapeutic purposes).

[0565] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0566] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

[0567] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.

[0568] Provided herein is a method for inserting a nucleotide sequence of more than about 5 kilobases in length into the genome of a cell in the absence of a viral vector. In some embodiments, a nucleotide sequence of more than about 5 bases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0569] The integration of large nucleic acids, e.g., nucleic acids greater than 5 kilobases in size, into cells can be limited by low integration efficiency, off-target effects, and / or loss of cell viability. Methods and compositions for achieving integration of nucleotide sequences, e.g., nucleotide sequences greater than about 5 bases in size, into the genome of a cell are described herein. Some methods improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.

[0570] The plasmid can be introduced into immune cells using a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced into a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cleaves the genomic DNA at this specific site. The specific site can be a portion of the genome that encodes an endogenous immune cell receptor. Therefore, by cleaving the genome at this site, the immune cell no longer expresses the endogenous immune cell receptor.

[0571] The plasmid may contain 5' and 3' homology-directed repair arms complementary to sequences at specific sites on the genome of the immune cell. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site on the genome of the immune cell. Once the plasmid is integrated, the cell expresses the priming receptor. However, as described, the design of the transgene cassette ensures that the non-viral delivery system receptor does not express the CAR until the priming receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0572] First, T cells are activated. The T cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells such as T cells are harvested from a patient. Then, a plasmid encoding a CAR and a priming receptor is introduced into the T cells. Advantageously, the plasmid of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. The T cells are then expanded and co-cultured to generate a sufficient amount of engineered immune cells for use as a therapeutic treatment.

[0573] A method for editing the genome of a cell can include: a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) an RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the DNA template is greater than about 200 nucleotides in size, the 5' and 3' ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and the molar ratio of RNP to DNA template in the complex is between about 3:1 and about 100:1; and b) introducing the RNP-DNA template complex into the cell.

[0574] In some embodiments, the methods described herein provide an efficiency of delivery of RNP-DNA template complexes of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP-DNA template into cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or nonviable) into which the RNP-DNA template is introduced.

[0575] As another example, the efficiency of delivery can be determined by quantifying the number of genome-edited cells in a cell population (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing are available. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.

[0576] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these. In some embodiments, the off-target effects of integration are reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these.

[0577] In some cases, the methods described herein provide high cell viability of cells into which the RNP-DNA template has been introduced, in some cases, the viability of cells into which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0578] In the methods provided herein, the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 5:1 to about 10:1, from about 5:1 to about 15:1, from 5:1 to about 20:1, from 5:1 to about 25:1, from about 8:1 to about 12:1, from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.

[0579] In some embodiments, the DNA template has a concentration of about 2.5 pM to about 25 pM. For example, the DNA template concentration can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration therebetween.

[0580] In some embodiments, the size or length of the DNA template is about 4.5kb, 5.0kb, 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb, 6.0kb, 6.1kb, 6.2kb, 6.3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.1kb, 7.2kb, 7.3kb, 7.4kb, 7.5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, 10.0kb, 10.1kb, 10.2kb, 10.3kb, 10.4kb, 10.5kb, 10.6kb, 10.7kb, 10.8kb, 10.9kb, 11.0kb, 11.1kb, 11.2kb, 11.4kb, 11.5kb, 11.6kb, 11.7kb, 11. The DNA template may be 5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, or greater than 10kb, or any size in between these sizes. For example, the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about 6 kb to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.

[0581] In some embodiments, the amount of DNA template is about 1 μg to about 10 μg. For example, the amount of DNA template can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0582] In some cases, the size of the DNA template is large enough and sufficient in quantity to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes.

[0583] In some embodiments, the DNA template comprises regulatory sequences, such as promoter and / or enhancer sequences, for regulating expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0584] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of other strands or opposite strands of DNA. "Substantially devoid" means that the pure single-stranded DNA is devoid of one DNA strand at least 100 times more than another DNA strand.

[0585] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about 1 minute to about 30 minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, or any amount of time therebetween. In another example, the RNP can be incubated with the DNA template at a temperature of about 20° C. to about 25° C. for about less than 1 minute to about 1 minute, about less than 1 minute to about 5 minutes, about less than 1 minute to about 10 minutes, about 5 to 10 minutes, about 5 to 15 minutes, about 10 to about 15 minutes, about 10 to about 20 minutes, or about 10 to about 30 minutes. In some embodiments, the RNP-DNA template complex and cells are mixed before introducing the RNP-DNA template complex into the cells.

[0586] In some embodiments, introducing the RNP-DNA template complex comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L. Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.

[0587] In some embodiments, the Cas9 protein can be in an active endonuclease form so that when it binds to a target nucleic acid as part of a complex with a guide RNA or a DNA template, a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or by HDR to introduce specific mutations. Various Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be used. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).

[0588] In some cases, Cas9 protein is a nickase, so that when it binds to target nucleic acid as part of a complex with guide RNA, it introduces single-strand breaks or nicks into target nucleic acid.A pair of Cas9 nickases, each of which is bound to structurally different guide RNAs, can target two adjacent sites in the target genome region, and thus introduce a pair of adjacent single-strand breaks into the target genome region.Nickase pairs can increase specificity because off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0589] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.

[0590] In some cases, multiple RNP-DNA templates containing structurally distinct ribonucleoprotein complexes are introduced into cells. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the DNA templates at multiple structurally distinct target genomic regions.

[0591] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. Progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - The modified cells are T cells. Also provided are any populations of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0592] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to the patient. In other cases, any of the constructs described herein are delivered to the patient in vivo. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both incorporated herein by reference).

[0593] In some embodiments, the RNP-DNA template complex is about 1×10 5 ~about 2×10 6 For example, the RNP-DNA template complex is introduced into cells at approximately 1 × 10 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~about 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells, or approximately 1 x 10 6 ~about 2×10 6 can be introduced into

[0594] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).

[0595] Genetic manipulations (e.g., genome editing, nuclease-mediated editing, CRISPR / Cas9-mediated editing, etc.) to manipulate the expression of heterologous receptors (e.g., CAR and / or TCR) and RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) are described in International Publication Nos. 2018232356A1, 2019084552A1, 2019226998A1, 2020014235A1, 2020123871A1, and 2020186219A1, each of which is incorporated by reference herein for all purposes.

[0596] Insertion site Methods for editing the genome of a T cell specifically include methods for editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human T cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the TCR-α transmembrane domain.

[0597] Methods for editing the genome of a T cell also include methods for editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0598] Methods for editing the genome of T cells specifically include methods for editing the genome of human T cells comprising inserting a nucleic acid sequence or construct into a targeted region of a genomic safe harbor (GSH) site.

[0599] Methods for editing the genome of a T cell also include methods of editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into the GS94 target region (locus chr11:128340000-128350000).

[0600] In some embodiments, the target region is the GS94 locus.

[0601] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional carcinogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges, such as low knock-in efficiency, risk of insertional carcinogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by identifying and using safe harbor loci or safe harbor sites (SHSs), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0602] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in an increasing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, whose disruption confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, similar to the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are located near many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.)

[0603] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55, 625, 241 to 55, 629, 351. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference. Exemplary AAVS1-targeting gRNAs and target sequences are provided below. ● AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 212) AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 213)

[0604] CCR5, located on chromosome 3 at position 3p21.31, encodes the primary co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus for CCR5 is chr3:46, 414, 443 to 46, 414, 942. See Pellenz et al., "New Human Chromosomal Sites with Safe Harbor Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference).

[0605] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12(2007):1477-1482, the relevant disclosure of which is incorporated herein by reference, identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. See Pellenz et al. “New Human Chromosomal Sites with Safe Harbor Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7(2019):814-828, the relevant disclosure of which is incorporated herein by reference.

[0606] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Additional examples of integration sites are provided in Table D.

[0607] In some embodiments, safe harbor sites allow for high transgene expression (sufficient to enable transgene functionality or treatment of a disease of interest) and stable expression of the transgene over days, weeks, or months. In some embodiments, knockout of the gene at the safe harbor locus confers a benefit to cellular function, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.

[0608] When used, "neighboring genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).

[0609] In some embodiments, the present disclosure contemplates inserts containing one or more transgenes. The transgenes can encode therapeutic proteins, antibodies, peptides, or any other gene of interest. Transgene integration can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. Therapeutic properties of immune cells can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells can also be manifested by expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the tumor microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity through reduction, and resistance to treatments such as chemotherapy.

[0610] As used herein, "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into a target locus or safe harbor site. In some embodiments, the insert size comprises at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size comprises about 5,000 or more nucleotide base pairs. In some embodiments, the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilobase pairs), or any size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp, or any size therebetween. In some embodiments, the insert size is in the range of 4.5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.8-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.5-20 kbp, or any number within that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, or 9-10 kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp.In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp. In some embodiments, the insert size is 4.5 to 17, 6 to 17, 7 to 17, 8 to 17, 9 to 17, 10 to 17, 11 to 17, 12 to 17, 13 to 17, or 14 to 17, 15 to 17, or 16 to 17 kbp. In some embodiments, the insert size is 4.5 to 18, 6 to 18, 7 to 18, 8 to 18, 9 to 18, 10 to 18, 11 to 18, 12 to 18, 13 to 18, 14 to 18, 15 to 18, 16 to 18, or 17 to 18 kbp. In some embodiments, the insert size is 4.5 to 19, 6 to 19, 7 to 19, 8 to 19, 9 to 19, 10 to 19, 11 to 19, 12 to 19, 13 to 19, 14 to 19, 15 to 19, 16 to 19, 17 to 19, or 18 to 19 kbp. In some embodiments, the insert size is 4.5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, or 19 to 20 kbp.

[0611] An insert, as used herein, refers to a nucleic acid molecule or polynucleotide inserted into a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. Nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.

[0612] An insert can have coding and / or non-coding regions. An insert can include non-coding sequences (e.g., regulatory elements, e.g., promoter sequences). In some embodiments, an insert encodes a transcription factor. In some embodiments, an insert encodes an antigen-binding receptor, e.g., a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, an insert is a human sequence. In some embodiments, an insert is chimeric. In some embodiments, an insert is a multigene / multimodule therapeutic cassette. A multigene / multimodule therapeutic cassette refers to an insert or cassette having one or more receptors (e.g., synthetic receptors), other exogenous protein-coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0613] In some embodiments, the nucleic acid sequence is inserted into the genome of T cells via non-viral delivery.In non-viral delivery methods, the nucleic acid can be naked DNA or can be in a non-viral plasmid or vector.The non-viral delivery technique can be a site-specific integration technique described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulat...

Claims

1. A recombinant nucleic acid comprising one or more of the following nucleic acid sequences: a. a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of the mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; b. a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 518-559 of the mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and / or c. A nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of the mRNA encoding human thymocyte selection-associated high mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:

41.

2. The recombinant nucleic acid described in claim 1, wherein the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

3. The recombinant nucleic acid of claim 1, wherein the nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

4. The recombinant nucleic acid described in claim 3, wherein the nucleic acid sequence is a short hairpin RNA (shRNA).

5. The recombinant nucleic acid described in claim 1, wherein the nucleic acid sequence comprises a sequence selected from the group consisting of sequences set forth in SEQ ID NOs: 49, 64, 51, 66, 42-48, 50, 52-63, 65, or 67-71.

6. A recombinant nucleic acid described in claim 5, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

49.

7. A recombinant nucleic acid described in claim 5, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

64.

8. A recombinant nucleic acid described in claim 5, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

51.

9. A recombinant nucleic acid described in claim 5, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

66.

10. The recombinant nucleic acid of claim 1, wherein the nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells not containing the nucleic acid.

11. The recombinant nucleic acid described in claim 1, wherein the nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 82, 95, 72, 85, 73-81, 83, 84, 86-94, 96, or 97.

12. A recombinant nucleic acid described in claim 11, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

82.

13. A recombinant nucleic acid described in claim 11, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

95.

14. A recombinant nucleic acid described in claim 11, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

72.

15. A recombinant nucleic acid described in claim 11, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

85.

16. The recombinant nucleic acid of claim 1, wherein the nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells not containing the nucleic acid.

17. The recombinant nucleic acid of claim 1, wherein the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 49, 64, 51, 66, 42-48, 50, 52-63, 65, or 67-71, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 82, 95, 72, 85, 73-81, 83, 84, 86-94, 96, or 97.

18. A recombinant nucleic acid as described in claim 1, wherein the first nucleic acid sequence comprises the sequence set forth in SEQ ID NO:49 and the second nucleic acid sequence comprises the sequence set forth in SEQ ID NO:

82.

19. A recombinant nucleic acid described in claim 1, comprising the sequence described in SEQ ID NO: 157 or 162.

20. The recombinant nucleic acid described in claim 1, wherein the nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98 to 125.

21. The recombinant nucleic acid(s) of claim 1, wherein the nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells not containing the nucleic acid.

22. The recombinant nucleic acid of claim 1, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

23. The recombinant nucleic acid described in claim 22, wherein the insertion site is located in the genomic safe harbor (GSH) locus or the T-cell receptor alpha constant (TRAC) locus.

24. The recombinant nucleic acid of claim 23, wherein the GHS locus is the GS94 locus at chr11:128340000-128350000.

25. One or more recombinant nucleic acids comprising: a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

26. The recombinant nucleic acid of claim 25, wherein the first nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 49, 64, 51, 66, 42-48, 50, 52-63, 65, or 67-71, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 82, 95, 72, 85, 73-81, 83, 84, 86-94, 96, or 97.

27. One or more recombinant nucleic acids comprising: a first nucleic acid at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and a second nucleic acid at least 15 nucleotides in length that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:

41.

28. An expression vector comprising the recombinant nucleic acid described in claim 1.

29. a. at least one recombinant nucleic acid(s) according to claim 1, and / or b. An expression vector comprising the recombinant nucleic acid of claim 1. including immune cells.

30. The immune cell described in claim 29, which is a primary human immune cell.

31. 30. A pharmaceutical composition comprising the immune cells of claim 29 and a pharmaceutically acceptable excipient.

32. A pharmaceutical composition comprising the recombinant nucleic acid of claim 1 or an expression vector containing said recombinant nucleic acid, and a pharmaceutically acceptable excipient.

33. 1. A method for editing immune cells, comprising: a. providing a ribonucleoprotein (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises the recombinant nucleic acid of claim 1, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; b. non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell in vitro, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell and the nuclease domain cleaves the target region to create the insertion site within the genome of the immune cell; c. editing the immune cell via insertion of the recombinant nucleic acid of claim 1 into the insertion site in the genome of the immune cell; The method comprising:

34. 33. The pharmaceutical composition of claim 31 or 32 for treating a disease in a subject.

35. 1. A method for modulating immune cell activity, comprising: i. a recombinant nucleic acid according to claim 1, and / or ii. The vector of claim 28. contacting immune cells in vitro, The method comprising:

Images