Treatment of age-related white matter loss by competitive replacement of glial cells
Patent Information
- Application Number
- JP2024523828
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-20
- Filing Date
- 2022-10-19
- Publication Date
- 2025-10-10
AI Technical Summary
Age-related loss of white matter, oligodendrocytes, or astrocytes leads to cognitive impairment, dementia, and other neurological disorders, with limited therapeutic options available.
Administration of a therapeutically effective amount of isolated glial progenitor cells to replace or rejuvenate oligodendrocytes and astrocytes, using methods such as intraparenchymal implantation, and suppression of transcriptional repressors like E2F6, ZNF274, MAX, and IKZF3 to enhance glial progenitor cell function.
The method effectively replaces aged or diseased glial cells with healthy ones, potentially reversing neurological deficits and improving cognitive function.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 257,767, filed October 20, 2021, the contents of which are incorporated herein by reference in their entirety.
[0002] The present application relates to the treatment of oligodendrocyte loss, astrocyte loss, or white matter loss, including age-related oligodendrocyte loss, age-related astrocyte loss, or age-related white matter loss. [Background technology]
[0003] Age-related loss of white matter, oligodendrocytes, or astrocytes commonly occurs in older adults and can lead to poor outcomes, including cognitive impairment, dementia, urinary incontinence, gait disturbance, depression, and increased risk of stroke and death. This loss is accompanied by partial loss of myelin, axons, and oligodendrocytes, mild reactive astrogliosis, sparsely distributed macrophages, and stenosis due to hyaline fibrosis of small arteries and smaller vessels. Age-related white matter loss is generally considered a form of incomplete ischemia, mainly associated with cerebral small vessel arteriosclerosis. Such small vessel changes can lead to damage of the blood-brain barrier and chronic leakage of fluid and macromolecules in the white matter. Indeed, increased concentrations of cerebrospinal fluid albumin and IgG levels have been found in patients with age-related white matter loss. Although age-related white matter loss has been a significant clinical problem, relatively few studies have been conducted to evaluate treatments for this condition.
[0004] Epidemiology of Vascular Aging MRI studies have shown a positive linear relationship between blood pressure and the severity of age-related white matter loss. Statins have long been used to reduce cardiovascular events and ischemic stroke in coronary artery patients. However, it is unclear whether statins are useful in treating age-related white matter loss. Acetylcholinesterase inhibitors (donepezil, galantamine, and rivastigmine) and N-methyl-D-aspartate (NMDA) receptor antagonists (memantine) have been approved for the treatment of Alzheimer's disease. There is also evidence that hyperhomocysteinemia is associated with age-related white matter loss. However, it is unclear whether homocysteine-lowering therapy is useful in slowing such white matter loss.
[0005] A need exists for therapies and methods for treating disorders and conditions mediated or characterized by loss of white matter, oligodendrocytes, or astrocytes. The present disclosure is directed to overcoming these and other deficiencies in the art. Summary of the Invention
[0006] The present disclosure addresses the above needs in several aspects.
[0007] In some aspects, the present disclosure provides a method of treating a condition mediated by age-related oligodendrocyte loss in a subject, comprising administering a therapeutically effective amount of an isolated population of glial progenitor cells to a subject in need of such treatment. The condition may be vascular leukoencephalopathy, an adult-onset autoimmune demyelinating condition, a chronic post-radiation induced demyelinating condition, an adult-onset lysosomal storage disease, an adult-onset leukodystrophy, or cerebral palsy.
[0008] In another aspect, the present disclosure provides a method of treating a condition mediated by age-related astrocyte loss in a subject, the method comprising administering a therapeutically effective amount of an isolated population of glial progenitor cells to a subject in need of such treatment. The condition may be amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, Huntington's disease, Alexander's disease, or vanishing white matter disease.
[0009] In yet another aspect, the present disclosure provides a method for treating a condition mediated by age-related white matter loss in a subject, comprising administering a therapeutically effective amount of an isolated population of glial progenitor cells to a subject in need of such treatment. Examples of such conditions include vascular leukoencephalopathy, adult-onset autoimmune demyelinating conditions, chronic post-radiation induced demyelinating conditions, adult-onset lysosomal storage diseases, adult-onset leukodystrophies, cerebral palsy, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, Huntington's disease, Alexander's disease, and vanishing white matter diseases.
[0010] In each of the above methods, the condition may be Huntington's disease or subcortical dementia. Examples of vascular leukoencephalopathy include subcortical stroke, diabetic leukoencephalopathy, and hypertensive leukoencephalopathy. Examples of adult-onset autoimmune demyelinating conditions include relapsing-remitting multiple sclerosis, chronic or progressive multiple sclerosis, neuromyelitis optica, transverse myelitis, and optic neuritis.
[0011] In some embodiments of each of the above methods, the isolated population of glial progenitor cells is younger than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject. In some embodiments, the isolated population of glial progenitor cells or their progeny replaces at least some of the glial progenitor cells, oligodendrocytes, or astrocytes in the subject. In some embodiments, the isolated population of glial progenitor cells or their progeny grows or proliferates or divides faster than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject. In some embodiments, the isolated population of glial progenitor cells or their progeny has a higher level of MYC and YAP1 pathway activity than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject.
[0012] In some embodiments, the subject is a mammal, such as a human. The isolated population of glial progenitor cells can be derived from pluripotent stem cells. Examples of pluripotent stem cells include embryonic stem cells and induced pluripotent stem cells. In some embodiments, the glial progenitor cells can be rejuvenated from glial cells (such as glial progenitor cells, astrocytes, or oligodendrocytes) disclosed herein.
[0013] For each of the above methods, administering can be performed by intraparenchymal, intracallosal, intracerebroventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. In some examples, the isolated population of glial progenitor cells or progeny can be administered to the forebrain, striatum, and / or cerebellum. The isolated glial progenitor cells or progeny can be heterologous, xenogenic, allogeneic, allogeneic, or autologous to the subject.
[0014] In some other aspects, the present disclosure provides a method for rejuvenating or enhancing the developmental potential of glial precursor cells or their progeny. The method comprises suppressing a transcriptional repressor selected from the group consisting of E2F6, ZNF274, MAX, and IKZF3 in the glial precursor cells or progeny. The glial precursor cells can be senescent glial precursor cells. The progeny can be oligodendrocytes or astrocytes. The suppressing step can comprise expressing or introducing a suppressor of the transcriptional repressor in the glial precursor cells or progeny.
[0015] In another aspect, the present disclosure provides a cell or its progeny prepared according to the above-mentioned method. The present disclosure also provides an isolated glial progenitor cell or its progeny comprising a suppressor of a transcriptional repressor selected from the group consisting of E2F6, ZNF274, MAX, and IKZF3. In some embodiments, the isolated glial progenitor cell or its progeny comprises an exogenous suppressor. That is, the suppressor is exogenous to the cell or its progeny.
[0016] In a further aspect, the disclosure provides a method for treating a condition mediated by white matter loss, oligodendrocyte loss, or astrocyte loss, comprising administering to a subject in need of such treatment (i) a therapeutically effective amount of a suppressor of a transcriptional repressor selected from the group consisting of E2F6, ZNF274, MAX, and IKZF3, and / or (ii) a therapeutically effective amount of a cell or progeny thereof prepared according to the above-mentioned method, and / or (iii) a therapeutically effective amount of a suppressor-containing glial precursor cell or progeny thereof. In some embodiments, the white matter loss, oligodendrocyte loss, or astrocyte loss is age-related.
[0017] The subject can be a mammal, such as a human.
[0018] In some embodiments, the suppressor comprises a small molecule compound, an oligonucleotide, a nucleic acid, a peptide, a polypeptide, a CRISPR / Cas system, or an antibody or antigen-binding portion thereof. In some examples, the suppressor can be an miRNA or siRNA molecule, or a CRISPR / Cas system, or an antisense nucleic acid.
[0019] In some embodiments, the nucleic acid comprises or encodes a miRNA or siRNA molecule. In some examples, the miRNA or siRNA molecule comprises a sequence that is at least 70% (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) identical to a sequence selected from the group consisting of miR-125b-5p, miR-106a-5p, miR-17-5p, miR-130a-3p, miR-130b-3p, miR-379-5p, miR-93-3p, miR-1260b, miR-767-5p, miR-30b-5p, miR-9-3p, miR-9-5p, and miR-485-5p. Preferably, the miRNA or siRNA molecule comprises a sequence that is at least 70% (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) identical to a sequence selected from the group consisting of miR-125b-5p, miR-106a-5p, miR-17-5p, miR-130a-3p, miR-130b-3p, miR-379-5p, and miR-485-5p.
[0020] In some embodiments, the suppressor comprises a CRISPR-Cas system.
[0021] In the above-described methods, the suppressor can be administered intraparenchymally, intracallosally, intracerebroventricularly, intrathecally, intracerebrally, intracisternally, or intravenously to a subject having a condition, such as a lysosomal storage disease, an autoimmune demyelinating condition (e.g., multiple sclerosis, neuromyelitis optica, transverse myelitis, and optic neuritis), a vascular leukoencephalopathy (e.g., subcortical stroke, diabetic leukoencephalopathy, hypertensive leukoencephalopathy, age-related white matter disease, and spinal cord injury), a radiation-induced demyelinating condition, a leukodystrophy (e.g., Pelizaeus-Merzbacher disease, Tay-Sach disease, Sandhoffs gangliosidosis, Krabbe disease, metachromatic leukodystrophy, mucopolysaccharidoses, Niemann-Pick disease, Adrenol Kidd dystrophy, Canavan disease, vanishing white matter disease, and Alexander disease), or peripheral leukomalacia or cerebral palsy. In some embodiments, the condition is Huntington's disease or subcortical dementia.
[0022] Administering can be performed by intraparenchymal, intracallosal, intraventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. In some embodiments, the cells or isolated glial progenitor cells or progeny thereof can be administered to the forebrain, striatum, and / or cerebellum. The cells or isolated glial progenitor cells or progeny thereof can be heterologous, xenogenic, allogeneic, allogeneic, or autologous to the subject.
[0023] The details of one or more embodiments of the disclosure are set forth in the description below. Other features, objects, and advantages of the disclosure will become apparent from the description and the claims. [Brief description of the drawings]
[0024] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0025] [Figure 1A]Representative images of WT-mCherry expression are shown. CRISPR-mediated integration of a transgenic reporter cassette into the AAVS1 safe harbor locus results in color-tagged WT expressing mCherry. E1-3, exons 1-3; LHA, left homology arm; SA, splice acceptor site; T2A, 2A self-cleaving peptide; Puro, puromycin resistance gene; pA, polyadenylation sequence; CAG, CAG promoter; RHA, right homology arm. Scale: 500 μm. [Figure 1B] Representative images of HD-EGFP expression are shown. CRISPR-mediated integration of a transgenic reporter cassette into the AAVS1 safe harbor locus results in color-tagged HD hESCs expressing EGFP. [Figure 1C] The HTT CAG length and respective transgenic insertions of engineered WT and HD hESC lines are shown. [Figure 1D] Figure 1 shows the PCR screening strategy to assess transgene cassette integration and zygosity using primers dna803, dna804, and dna1835 (SEQ ID NOs: 1-3). PCR screening shows that WT-EGFP, WT-mCherry, and HD-EGFP integrated the transgenic cassette at the correct site, WT-mCherry and WT-EGFP harbor homozygous integration, and HD-EGFP harbors heterozygous integration. E1-3, exons 1-3; LHA, left homology arm; RHA, right homology arm. [Figure 1E] Representative images of WT-mCherry and HD-EGFP expression in the brain are shown. Immunostaining for OCT4 indicates that pluripotency is maintained following transgene insertion. [Figure 2A] Representative karyotypes from WT-mCherry and HD-EGFP are shown to assess acquired copy number variants (CNVs) and loss of heterozygosity (LOH). Karyotype analysis indicates that no chromosomal abnormalities were acquired during the transgene integration process. [Figure 2B]An example of aCGH profiling of human chromosome 20 carrying an amplification commonly found in hESCs (inside dashed line) known to confer a selective growth advantage to hESCs is shown. No such mutation was detected in WT-EGFP, WT-mCherry, or HD-EGFP hESCs. [Figure 2C] Comparative aCGH profiles were shown and multiple mutations were detected in the engineered strains, both within and outside the normal range, none of which are expected to affect the experimental results. [Figure 3A] Illustrates the generation of HD chimeric mice, the differentiation process, and phenotypic characterization prior to experimental engraftment. [Figure 3B] Phase contrast images of WT-mCherry and HD-EGFP glial cultures, both highly enriched in bipolar hGPCs at 150 DIV. Scale: 50 μm. [Figure 3C] Flow cytometry of 150 DIV cell preparations (WT-mCherry, n=10; HD-EGFP, n=6) revealed a high enrichment of CD140a(PDGFRα)+ / CD44+ hGPCs, with the remainder consisting of less mature A2B5+ hGPCs and PDGFRα- / CD44+ astrocytes. Expression of the fluorescent reporter was consistent throughout glial differentiation. Unpaired two-tailed t-test; data are presented as mean ± SEM. [Figure 3D] Immunocytochemistry confirms enrichment of PDGFRα+ hGPCs in cultures generated from both WT-mCherry and HD-EGFP hESCs. Only a small proportion of these hGPCs differentiate into GFAP+ astrocytes. Scale: 100 μm. [Figure 3E-3G] The percentages of cells expressing (A) reporter, (B) PDGFRα+, and (C) GFAP in HD chimeric mice are shown. [Figure 4A]Representative images demonstrating that human wild-type glia outcompete and migrate past previously integrated HD glia. Engraftment of WT glia (mCherry+, red) into the striatum of HD chimeras led to the progressive replacement of HD glia (EGFP+, green) creating extensive exclusive domains in their advance. Dashed contours (white) delimit the outline of the striatum where human cells were mapped and quantified. STR-striatum (caudate-putamen); LV-lateral ventricle; CTX-cortex. Dashed rectangles (orange) represent the inset at week 72. Left scale bar: 500 μm, right scale bar: 100 μm. [Figure 4B-4C] Representative images demonstrating that human wild-type glia outcompete and displace previously integrated HD glia. Figure 4B demonstrates that these exclusive domains form as WT GPCs (Olig2+, white) out-displace their HD counterparts. Scale bar: 50 μm. Figure 4C shows that within areas dominated by WT glia, GPC replacement precedes astrocyte replacement, as HD astrocytes (hGFAP+, white) can be seen. Scale bar: 10 μm. [Fig. 4D-4E] We show human wild-type glia outcompeting and displacing previously integrated HD glia. Figure 4D is a sketch showing the strategy used to quantify the distribution of human glia in the striatum over time. Human glia were mapped on 15 equidistant sections (5 shown as an example) of the mouse striatum and reconstructed in 3D for analysis. Their distribution was measured radially as a function of distance to the injection site. Figure 4E shows that WT glia increase their spatial dominance over time; WT vs. HD (HD vs. WT group) - 54 n=8 at 54 weeks, n=7 at 72 weeks. Their advance was accompanied by a progressive eradication of HD glia compared to HD chimeric controls; HD (HD vs. WT group). [Figure 4F]Figure 1 shows that human wild-type glia outcompete and displace previously integrated HD glia. Volumetric quantification shows that WT glia increase their spatial dominance over time; WT vs. HD (HD vs. WT group) - n=8 at 54 weeks, n=7 at 72 weeks. Their advance was accompanied by a progressive eradication of HD glia compared to HD chimeric controls; HD (HD vs. WT group) - n=8 at 54 weeks, n=7 at 72 weeks vs. HD controls - n=4 at both time points; two-way ANOVA with Sidak's multiple comparison test; main effects are shown as numerical P values and post-hoc comparisons are indicated as follows: ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05; data are presented as mean ± sem. [Diagram 5] The experimental design of HD versus WT and HD control mice is illustrated. [Figure 6A-6C] We show that human wild-type glia outcompete previously integrated human HD glia. [Figure 6A] We provide stereological estimates and demonstrate that as WT glia expand within the humanized striatum, the total number of HD glia is progressively reduced compared to HD chimeric controls; two-way ANOVA with Sidak's multiple comparison test. [Figure 6B-6C] Figure 6B shows that the proportion of GPCs (Olig2+, FIG. 6B) and astrocytes (GFAP+, FIG. 6C) in both populations was maintained as they competed for striatal dominance; HD control-n=4 at both time points; WT control-n=4 (54 weeks), n=3 (72 weeks); HD vs. WT-n=5 (54 weeks), n=3 (72 weeks); orange arrows point to co-labeled cells. Data are shown as mean ± sem with individual data points. [Figure 6D-6E] Representative images of HD glia ( Fig. 6D ) and WT glia ( Fig. 6E ) are shown, in which Olig2+ (white) GPCs expanded as they displaced their HD counterparts, and within the regions where they became dominant, they further differentiated into hGFAP+ (white) astrocytes. [Figure 7A] The experimental design and analysis time points of the WT control group are illustrated. [Figure 7B]Representative images of engraftment of WT glia (mCherry+, red) into the adult striatum of Rag1(- / -) mice are shown, resulting in substantial humanization of the mouse striatum over time. [Figure 7C-7D] Volumetric quantification shows that WT glia infiltrate and disperse throughout the mouse striatum over time, more extensively than those grafted into HD chimeras. WT (HD vs. WT group) - n=8 for 54 weeks, n=7 for 72 weeks vs. WT control - n=7 for 54 weeks, n=5 for 72 weeks; two-way ANOVA with Sidak's multiple comparison test; main effects shown as numerical P values; data shown as mean ± sem. Figure 7C shows WT control. Figure 7D shows cells / mm3. [Figure 8] Illustrated is the experimental design for mice receiving a 1:1 mixture of mCherry-tagged (WT-mCherry) and untagged (WT-untagged) WT glia. [Figure 9A-9D] We show that co-engrafted syngeneic clones of wild-type glia thrive and intermix while migrating HD glia. [Figure 9A] Immunolabeling for human nuclear antigen (hN) shows that both WT-mCherry (mCherry+hN+, red, white) and WT untagged (mCherry-EGFP-hN+, white) glia expand within the previously humanized striatum, progressively outgrowing HD glia (EGFP+hN+, green, white). Scale bar: 500 μm. [Figure 9B] Extensive homotypic domains were formed as intermixed WT glia expanded and displaced resident HD glia. Scale bar: 100 μm. [Figure 9C] Shown is a mixture of isogenic WT-mCherry and WT-untagged. Scale bar: 100 μm. [Figure 9D] Figure 2 shows that within domains dominated by WT glia, typically within white matter tracts, only more complex astrocyte-like HD glia can be seen. Scale bar: 10 μm. [Figure 10]Quantification of the percentage of WT-mCherry and WT-untagged glia in the striatum showed no significant differences between the two populations at any of the quantified time points (n=6 for each time point); two-way ANOVA with Sidak's multiple comparison test; mean ± sem. [Figure 11] Illustrated is the experimental design for co-engraftment of WT and HT glia in neonatal mice. [Figures 12A-12C] Representative images of the proportion of WT and HD glia in the striatum in mice co-engrafted with WT and HT glia are shown. The images show no significant growth advantage for either cell population; n=5; paired two-tailed t-test. [Figure 13A-13B] We demonstrate that equal growth of neonatally engrafted WT and HD glia is sustained by an equally proliferating Ki67+ (white) glial pool; HD control-n=3; WT control-n=4; HD vs. WT-n=5; One-way ANOVA with Tukey's multiple comparison test. Figure 13A shows striatal occupancy. Figure 13B shows relative abundance of Ki67+ cells. [Figure 14A] We present the experimental design to demonstrate that differences in cellular age are sufficient to drive human glial repopulation. [Figure 14B] We show that differences in cellular age are sufficient to drive human glial repopulation. [Figure 15A-15D] We show that mouse chimeras with a striatum substantially humanized by HD glia were generated to provide an in vivo model for evaluating the replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHtt-expressing hESCs engineered to express EGFP were transplanted into the neostriatum of immunodeficient Rag1(- / -) mice and their expansion was monitored histologically. [Figure 15A] The experimental design and analytical endpoints are shown. [Figure 15B] Neonatal engrafted HD glia (EGFP+, green) expand within the mouse striatum, resulting in substantial humanization of the tissue over time. Dashed line demarcates the border of the striatum where human cells were mapped and quantified. Scale: 500 μm. STR, neostriatum. [Figure 15C] Their expansion is accompanied by an increase in the number of HD glia present in the mouse striatum over time. Data are presented as mean ± sem with individual data points (n = 4). One-way ANOVA with Tukey's multiple comparison test; 12 weeks (n = 3), 24 weeks (n = 3), 36 weeks (n = 4). [Figure 15D] We show that their expansion is accompanied by a time-dependent increase in the number of HD glia harbored in the mouse striatum, at the expense of their Ki67+ proliferative cell pool. [Fig. 15E-15J] We show that mouse chimeras with a striatum substantially humanized by HD glia were generated to provide an in vivo model for evaluating the replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHtt-expressing hESCs engineered to express EGFP were transplanted into the neostriatum of immunodeficient Rag1(- / -) mice and their expansion was monitored histologically. [Figure 15E] Figure 1 shows the strategy used to assess the degree of striatal humanization 36 weeks after neonatal transplantation of HD GPCs. HD cell distribution was mapped on 15 equidistant sagittal sections (e.g., 5 shown) and reconstructed in 3D for analysis. [Figure 15F] 13 shows a rendered example of a mapped and reconstructed striatum for volumetric analysis. [Figure 15G] Volumetric quantification is shown, showing that by 36 weeks, HD glia had expanded throughout the entire striatum, assuming a uniform distribution; data are presented as mean (lines) and individual data points (n=4). Data are presented as mean±sem, with individual data points (n=4). [Fig. 15H-J]As they colonized the mouse striatum, HD glia either expanded and persisted as Olig2+ GPCs (arrows point to Olig2+ / EGFP+ (red / green) cells) or differentiated into hGFAP+ (red) astrocytes. Proliferating (Ki67+, red) HD glia can still be seen after 36 weeks of expansion, albeit in reduced numbers (D). Scale: 10 μm. Data are presented as mean ± sem with individual data points (n=4). [Figures 16A-16C] We show that a proliferative advantage drives WT glia to progress through the humanized HD striatum. [Fig. 17A-17I] We show that differences in cellular age are sufficient to drive competitive glial repopulation. [Figure 17A] The experimental design and analytical endpoints are shown. [Figure 17B] Figure 1 shows that engraftment of younger WT glia (EGFP+, green) into the striatum of WT chimeras resulted in the selective replacement of their aged counterparts (mCherry+, red). Dashed lines demarcate the striatal regions where human cells were mapped and quantified. STR, striatum (caudate-putamen); LV, lateral ventricle; CTX, cortex. Scale: 500 μm. [Figure 17C] Shown is a WT chimeric control, engrafted only at birth. Scale: 100 μm. [Figure 17D] A rendered example of the mapped striatum is shown. Volumetric quantification shows that younger WT glia replace older allogeneic counterparts as they expand from the injection site. [Figure 17E] Aged vs. young (isograft) results shown, n=3. Their progression tracked the progressive elimination of aged WT glia from the tissue compared to control WT chimeras (aged control). Scale: 100 μm. [Figure 17F]Aged (isograft) vs. aged (control) results are shown; n=3 each; two-way ANOVA with Sidak's multiple comparison test; interactions or main effects are shown as numerical P values and post-hoc comparisons are indicated as follows: ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05, data are presented as mean±SEM. [Figure 17G] Figure 17 shows that at the interface between young and aged WT glia, a higher incidence of Ki67+ (white) cells is found within the younger population. The dashed square represents the inset color division (Figure 17H). Scale: 50 μm. [Figure 17I] Quantification of Ki67+ cells is shown, demonstrating that younger WT glia are significantly more proliferative than their aged counterparts; n=3 for all experimental groups; One-way ANOVA with Sidak's multiple comparison test; Data are presented as mean ± SEM with individual data points. [Figure 18A] Gating strategy flow cytometry analysis of WT-mCherry hESC lines is shown. [Figure 18B] Gating strategy flow cytometry analysis of HD-EGFP hESC lines. From dissociated glial cultures, live cells were identified by their lack of DAPI incorporation. Of these, cells stained for PDGFRα, CD44, PDGFRα / CD44, and A2B5 were identified based on antibody-specific fluorescence intensity compared to their respective unstained gating controls. Essentially all cells retained their respective reporter expression throughout in vitro glial differentiation. [Figure 19A] At the border between WT and HD glia, a high incidence of Ki67+ (white) cells is found only within the WT glial population. I', High magnification of two WT daughter cells at the edge of the competing border. [Figure 19B]Quantification of Ki67+ glia within each population as a function of time shows a significant proliferative advantage of WT glia that persists throughout the experiment. HD control: 54 weeks (n=4), 72 weeks (n=4); WT control: 54 weeks (n=5), 72 weeks: n=3; WT vs HD allograft: 54 weeks (n=5), 72 weeks (n=3). Comparisons by two-way ANOVA with Sidak's multiple comparison test; mean ± SEM. [Fig. 20A-20I] We show that WT glia acquire a dominant competitor transcriptional profile in the face of resident HD glia. [Figure 20A] The experimental design is shown. [Figure 20B] We show uniform manifold approximation projection (UMAP) visualization of integrated scRNA-seq data, identifying six major cell populations. [Figure 20C] UMAP visualization of the partitioning of scRNA-seq data of the group, identifying six major cell populations. [Figure 20D] Stacked bar plots of percentages of cell types in each group are shown. [Figure 20E] Cell cycle analysis notch box plots of circulating GPCs and GPCs in G2 / M phase. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with the median at the center of the notches, and error bars represent minimum and maximum non-outliers. Comparisons between groups utilized the Kruskal-Wallis test followed by Dunn's test with multiple comparisons adjusted via the Benjamini-Hochberg method. Adjusted p values of *=<0.05, **<0.01, ***=<0.001, ****=<0.0001. [Figure 20F] Venn diagrams of pairwise differentially expressed GPC genes are shown (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 20G] Curated ingenuity pathway analysis of differentially expressed genes between GPC groups. Circle size represents p-value and shaded area indicates activation Z-score, with red being more active in top groups and green being more active in bottom groups. [Figure 20H]A heatmap of curated pairwise differentially expressed GPC genes is shown. [Figure 20I] Violin plots of pairwise differentially expressed GPC ribosomal genes log2 fold changes are shown. [Figures 21A-21I] We show that WT glia acquire a dominant transcriptional profile when confronted with their aged counterparts. [Figure 21A] The experimental design is shown. [Figure 21B] A UMAP visualization of integrated scRNA-seq data is shown, identifying six major cell populations. [Figure 21C] UMAP visualization of the partitioning of scRNA-seq data of the group, identifying six major cell populations. [Figure 21D] Stacked bar plots of percentages of cell types in each group are shown. [Figure 21E] Cell cycle analysis notch box plots of circulating GPCs and GPCs in G2 / M phase. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with the median at the center of the notches, and error bars represent minimum and maximum non-outliers. Comparisons between groups utilized the Kruskal-Wallis test followed by Dunn's test with multiple comparisons adjusted via the Benjamini-Hochberg method. Adjusted p values of *=<0.05, **<0.01, ***=<0.001, ****=<0.0001. [Figure 21F] Venn diagrams of pairwise differentially expressed GPC genes are shown (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 21G] Curated Ingenuity Pathway analysis of differentially expressed genes between GPC groups. Circle size represents p-value and shaded area indicates activation Z-score, with red being more active in top groups and green being more active in bottom groups. [Fig. 21H] A heatmap of curated pairwise differentially expressed GPC genes is shown. [Figure 21I]Violin plots of pairwise differentially expressed GPC ribosomal genes log2 fold change are shown. [Fig. 22A-22F] 1 shows a transcriptional signature of competitive advantage. [Figure 22A] Schematic diagram of the identification of candidate transcription factors. [Figure 22B] Eigengene violin plots of identified WGCNA modules per condition are shown. Significant modules (black, green, blue, brown, red, cyan) are represented whose members are enriched for downstream targets of five transcription factors in (Figure 22E). [Figure 22C] Relative importance analysis to estimate the differential contribution of each biological factor (age vs. genotype) to the eigengene of each module is shown. [Figure 22D] Gene set enrichment analysis (GSEA) showed that these prioritized transcription factors highlighted their regulons, which were enriched for upregulated genes in dominant young WT cells. [Figure 22E] We present the key transcription factors predicted via SCENIC for establishing competitive advantage and their relative activities among groups. [Figure 22F] Figure 22 shows the regulatory network with downstream targets and their functional signaling pathways represented. The targets belong to coordinated modules in Figure 22B and their expression is controlled by at least one other important transcription factor in Figure 22E. NES: Network enrichment score. [Figures 23A-23C] We show that aged human glia are eliminated by their younger counterparts by inducible apoptosis. [Figure 23A] At the border between young (EGFP+, green) and senescent WT glia (mCherry+, red), a higher incidence of apoptotic TUNEL+ (white) cells is evident in the senescent population. Scale: 100 μm. [Figure 23B] Higher magnification of the competition interface between these different populations illustrates that resident glia selectively undergo apoptosis. Scale: 50 μm. [Figure 23C] Quantification of TUNEL+ cells shows a significantly higher incidence of TUNEL+ cells among aged resident WT glia compared to their younger syngeneic counterparts and to aged WT chimeric controls not challenged with younger cells. Quantification was performed on pooled samples from 60 and 80 weeks (n=5 for all experimental groups). One-way ANOVA with Sidak's multiple comparison test; data are presented as mean ± SEM with individual data points. [Fig. 24A-24B] 1 shows the isolation of engrafted human cells from the chimeric host. [Figure 24A] FIG. 1 is a schematic diagram showing the experimental workflow involved in the isolation of human cells from the striatum of a chimeric host. [Figure 24B] An example of the gating strategy used for FACS enrichment of human cells extracted from dissociated chimeric striatum is shown. Live cells were identified by the lack of DAPI incorporation. Of these, human cells were sorted based on their expression of their respective fluorescent reporters (EGFP+ or mCherry+) and harvested for single cell sequencing and downstream analysis. [Fig. 25A-25F] Bulk RNA-Seq characterization of human fetal GPCs. [Figure 25A] FIG. 1 shows the workflow of bulk and scRNA-sequencing of selected second trimester human fetal brain isolates: CD140a+, CD140a-, and A2B5+ / PSA-NCAM. [Figure 25B] Principal component analysis of all samples across two batches is shown. [Figure 25C] Venn diagrams of CD140a+ vs. CD140a- and CD140+ vs. A2B5+ / PSA-NCAM- differentially expressed gene sets (p<0.01 and absolute log2 fold change>1) are shown. [Figure 25D] Significant Ingenuity Pathway Analysis terms for both gene sets are shown. Size represents -log10p value and color represents activation Z-score (blue, CD140a+; red, A2B5+ or CD140a-). [Figure 25E] The log2 fold change of significant genes in both gene sets is shown. Missing bars are not significant. [Figure 25F] 1E shows a heatmap of transformed transcripts per million (TPM) of selected genes in 1E. [Fig. 26A-26H] FIG. 1 shows single cell RNA sequencing of CD140a and A2B5 selected human fetal GPCs. [Figure 26A] 1 shows UMAP plots of primary cell types identified during scRNA-Seq analysis of FACS-isolated hGPCs derived from 20-week-old human fetal VZ / SVZ. [Figure 26B] UMAP of only PSA-NCAM- / A2B5+ human fetal cells is shown. [Figure 26C] UMAP of only CD140a+ human fetal cells is shown. [Figure 26D] Violin plots of cell type-selective marker genes are shown. [Figure 26E] A volcano plot of the GPC vs. pre-GPC populations is shown. [Figure 26F] 4 shows signature plots of selected differentially expressed genes between GPC and pre-GPC. [Figure 26F] IPA terms of selected significantly enriched GPCs and pre-GPCs are shown, along with their −log10 p values and activation Z scores. [Fig. 26H] Selected feature plots of transcription factors predicted to be significantly activated in fetal hGPCs are shown. Relative transcription factor regulon activation is displayed as calculated using the SCENIC package. [Fig. 27A-27F] We show that adult human GPC is transcriptionally and functionally distinct from fetal GPC. [Figure 27A] Figure 1 shows the workflow for bulk RNA-Seq analysis of human adult and fetal GPCs. [Figure 27B] Principal component analysis of all samples across the three batches is shown. [Figure 27C]A Venn diagram of both adult versus fetal differentially expressed gene sets is shown. [Figure 27B] IPA networks of curated terms and genes are shown. Node size is proportional to the degree of the node. Label color corresponds to enrichment in either adult (red) or fetal (blue) populations. [Figure 27E] A bar plot of significant IPA terms per module is shown. Z-scores indicate predicted activation in fetal (blue) or adult (red) hGPCs. [Figure 27F] Bar plots of log2 fold change and heatmap of TPM of network genes are shown. [Fig. 28A-28G] Inference of transcription factor activity implicates a series of transcriptional repressors in establishing adult hGPC identity. [Figure 28A] Normalized enrichment score plots of significantly enriched transcription factors predicted to be active in fetal and adult GPCs. Each dot is a motif whose size indicates the number of genes in which the motif is predicted to be active, and the color represents the window around the promoter in which the motif was found to be enriched. [Figure 28B] A heatmap of enriched TF TPMs is shown. [Figure 28C] Log fold change from adult GPC is shown for both fetal hGPC isolates. [Fig. 28D-G] Shown are predicted direct transcription factor activities of curated genes separated into: (Fig. 28D) fetal activators, (Fig. 28E) fetal repressors, (Fig. 28F) adult activators, and (Fig. 28G) adult repressors. Color indicates differential expression in either adult (red) or fetal (blue) hGPCs, and shape determines the type of node (octagon, repressors; rectangle, activators; oval, other target genes). Boxed and circled genes indicate functionally related genes that contribute to either glial progenitor / oligodendrocyte identity, aging / proliferation targets, or upstream or downstream TFs that were also considered activated. [Figures 29A-29D]1 shows induction of the senescent GPC transcriptome via adult hGPC-enriched repressors. [Figure 29A] A schematic diagram outlining the construction of four different doxycycline (DOX)-inducible EGFP lentiviral expression vectors, each encoding one of the following transcriptional repressors: E2F6, IKZF3, MAX, or ZNF274. [Figure 29B] Induced pluripotent stem cell (iPSC)-derived hGPC cultures (line C27) were transduced with a single lentivirus or vehicle for one day and then treated with Dox for the remainder of the experiment. Three, seven, and ten days after the initiation of Dox-induced transgene expression, hGPCs were isolated via FACS for qPCR. [Figure 29C] qPCR of Dox-treated cells showing expression of each transcription factor compared to matched time point controls is shown. [Figure 29D] qPCR fold change heatmaps of selected senescence-associated genes are shown. Within time points, comparisons to control were calculated via regression of cell batch effect followed by post hoc least squares means testing of linear models. FDR adjusted p-values: *<0.05, **<0.01, ***<0.001. [Fig. 30A-30E] We show that miRNAs drive adult GPC transcriptional divergence in parallel with transcription factor activity. [Figure 30A] Principal component analysis of miRNA microarray samples from human A2B5+ adult and CD140a+ fetal GPCs. [Figure 30B] Log2 fold change bar plots and heat maps of differentially expressed miRNAs are shown. [Figure 30C] Characterization bubble plots of miRNA enrichment compared to the mean log2FC of predicted gene targets are shown. [Figure 30D] 1 shows the curated signaling network of fetal enriched miRNAs and their predicted targets. [Figure 30E] A curated signaling network of adult-enriched miRNAs and their predicted targets is shown. [Fig. 31A-31E] 1 shows enrichment of human fetal GPCs by CD140a+ or A2B5+ / PSA-NCAM-selection. [Figure 31A] Principal component analysis of CD140a+ and A2B5+ fetal GPCs is shown. [Figure 31B] Volcano plots showing significant A2B5 (green) and CD140a (blue) enriched genes are shown. [Figure 31C] Principal component analysis of CD140a+ and CD140a- fetal cells is shown. [Figure 31D] Volcano plots showing significant CD140a- (magenta) and CD140a (blue) enriched genes are shown. [Figure 31E] Perturbation plots of significantly up- and down-regulated genes in both gene sets are shown. [Fig. 32A-32D] Single-cell RNA-Seq quality filtering is shown. [Figure 32A] Violin plot of unfiltered A2B5+ / PSA-NCAM-capture is shown. [Figure 32B] A violin plot of unfiltered CD140a scRNA-seq capture is shown. [Figure 32C] Violin plots following quality filtration of A2B5+ / PSA-NCAM-capture (<15% percent mitochondrial gene expression and >500 unique genes) are shown. [Fig. 32D] Shown is a violin plot after quality filtered (<15% percent mitochondrial gene expression and >500 unique genes) CD140a+ capture. [Fig. 33A-33C]Figure 33 shows single-cell RNA sequencing of A2B5+ / PSA-NCAM- vs. CD140a+ fetal hGPC. Figure 33A shows UMAP plots of A2B5+ and CD140a+ fetal hGPC. Figure 33B shows the frequency of cell types in each sorting paradigm isolate. Figure 33C shows a scatter plot of differentially expressed bulk RNA-Seq log2 fold change versus pseudo bulk log2 fold change between CD140a+ and A2B5+ fetal hGPC isolates. [Diagram 34] Figure 1 shows shared motifs of active transcription factors in fetal or adult hGPCs. Matrix of all predicted active transcription factors in fetal and adult GPCs. Size and color indicate the degree of motif sharing between transcription factors. [Diagram 35] Adult repressor isoform expression. Bar plot of transcripts per million (TPM) of all proteins encoding adult repressor isoforms in each GPC group. [Diagram 36] Bulk RNA-Seq of iPSC-derived hGPCs shows concordant abundance of aging-associated genes. iPSC-derived hGPCs (C27) were isolated via CD140a+ FACS and assayed via bulk RNA sequencing. The abundance of relevant glial aging-associated genes, including those within the active transcription factor cohort, is displayed with fetal and adult hGPC data. [Fig. 37A-37B] This shows that transcription factor regulation of miRNA provides post-transcriptional regulation of glial aging gene expression. Figure 37A shows the log2FC violin plot of the key adult vs. fetal GPC transcription factors that are predicted to be upstream of differentially expressed adult vs. fetal GPC miRNAs. Figure 37B shows the network of identified transcription factors from Figure 26 and their predicted regulation of differentially expressed adult vs. fetal hGPC miRNAs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0026] The present disclosure relates to compositions and methods for treating conditions mediated by oligodendrocyte loss, astrocyte loss, or white matter loss, including age-related oligodendrocyte loss, age-related astrocyte loss, or age-related white matter loss. The present disclosure also relates to (a) rejuvenating glial progenitor cells or their progeny, or (b) enhancing the developmental potential of glial progenitor cells or their progeny.
[0027] Conditions mediated by white matter / oligodendrocyte / astrocyte loss and associated disorders Certain aspects of the present disclosure relate to compositions and methods for treating conditions or disorders mediated by oligodendrocyte loss, astrocyte loss, or white matter loss. Such conditions are often associated with a lack of myelin in the central nervous system ("CNS"). Examples of such conditions or disorders include any disease or condition associated with demyelination, insufficient myelination and remyelination, or hypomyelination in a subject. Such conditions or disorders may be genetic, acquired, or an aging process, i.e., age-related. In some embodiments, the condition is an age-related white matter disease condition defined or characterized as oligodendrocyte loss, astrocyte loss, or white matter atrophy in the context of normal, otherwise healthy aging.
[0028] In humans, aging represents the accumulation of human changes over time and can encompass physical, psychological, and social changes. Aging increases the risk of human diseases such as cancer, diabetes, cardiovascular disease, and stroke, including demyelination in the CNS, which is often seen in various neurodegenerative diseases. Thus, in some embodiments of the present disclosure, the condition or disorder is mediated by age-related oligodendrocyte loss, age-related astrocyte loss, or age-related white matter loss.
[0029] Demyelination in the CNS can occur in response to genetic mutations (leukodystrophies), autoimmune diseases (e.g., multiple sclerosis), or trauma (e.g., traumatic brain injury, spinal cord injury, or ischemic stroke). Disruption of myelin function can play an important role in neurological and psychiatric disorders such as autism spectrum disorder (ASD), Alzheimer's disease, Huntington's disease, multiple system atrophy, Parkinson's disease, fragile X syndrome, schizophrenia, and various leukodystrophies.
[0030] Leukodystrophies are a group of rare, mostly inherited neurological disorders that result from abnormal production, processing, or development of myelin and are the result of genetic defects (mutations). Some forms are present at birth, while others may not cause symptoms until the child is older. Some primarily affect adults. Leukodystrophies include Canavan disease, Pelizaeus-Merzbacher disease, hypomyelination with atrophy of the basal ganglia and cerebellum, Krabbe disease (globoid cell leukodystrophy), X-linked adrenoleukodystrophy, metachromatic leukodystrophy, Pelizaeus-Merzbacher-like disease (or hypomyelinating leukodystrophy 2), Niemann-Pick disease type C (NPC), autosomal dominant leukodystrophy with autonomic neuropathy (ADLD), 4H leukodystrophy (Pol These include peripheral demyelinating leukodystrophy III-related leukodystrophy), Zellweger spectrum disorder (ZSD), childhood ataxia with central nervous system hypomyelination or CACH (also called vanishing white matter disease or VWMD), celebretendin xanthomatosis (CTX), Alexander disease (AXD), SOX10-associated peripheral demyelinating neuropathy, central demyelinating leukodystrophy, Waardenburg syndrome, Hirschung's disease (PCWH), adult polyglucosan body disease (APBD), hereditary diffuse leukoencephalopathy with axonal spheroid formation (HDLS), Aicardi-Goutières syndrome (AGS), and adult Refsum disease.
[0031] Subjects suitable for treatment with the methods described herein include any human subject having a condition mediated by a deficiency in myelin, which may be manifested by age-related oligodendrocyte loss, age-related astrocyte loss, or age-related white matter loss.
[0032] In another embodiment, the condition mediated by a deficiency of myelin is selected from the group consisting of childhood leukodystrophies, lysosomal storage diseases, congenital demyelination, cerebral palsy, inflammatory demyelination, post-infectious and post-vaccination leukoencephalitis, radiation or chemotherapy induced demyelination, and vascular demyelination.
[0033] In further embodiments, the condition mediated by myelin deficiency requires myelination. In another embodiment, the condition mediated by myelin deficiency requires remyelination. In some embodiments, the condition requiring remyelination is selected from the group consisting of multiple sclerosis, neuromyelitis optica, transverse myelitis, optic neuritis, subcortical stroke, diabetic leukoencephalopathy, hypertensive leukoencephalopathy, age-related white matter disease, leukodementia, Binswanger's disease, spinal cord injury, demyelination due to radiation therapy or chemotherapy, post-infectious and post-vaccination leukoencephalitis, periventricular leukomalacia, and cerebral palsy.
[0034] In further embodiments, the condition mediated by myelin deficiency is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is Huntington's disease. Huntington's disease is an autosomal dominant neurodegenerative disease characterized by relentless progressive motor disability accompanied by devastating psychiatric and cognitive deterioration. Huntington's disease is associated with consistent and severe neostriatal atrophy associated with a profound loss of GABAergic medium spiny neurons, the main output neurons of the striatum. Huntington's disease is characterized by an abnormally long CAG repeat expansion in the first exon of the huntingtin gene. The encoded polyglutamine expansion of mutant huntingtin protein disrupts its normal function and protein-protein interactions, ultimately resulting in widespread neuropathology that is most rapidly manifested by neofibrosis.
[0035] Other neurodegenerative diseases treatable in accordance with the present application include frontotemporal dementia, Alzheimer's disease, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis.
[0036] In one embodiment, the condition mediated by myelin deficiency is a neuropsychiatric disorder. In some embodiments, the neuropsychiatric disorder is schizophrenia. Schizophrenia is a serious mental illness that affects a person's thoughts, emotions, and behavior. Symptoms of schizophrenia are generally classified into three categories: (1) psychotic symptoms, including changes in perception; (2) negative symptoms, including loss of motivation, apathy, and lack of enjoyment; and (3) cognitive symptoms, including problems with attention, concentration, and memory. Other neuropsychiatric disorders treatable according to the present application include autism spectrum disorder and bipolar disorder.
[0037] The above myelin-related disorders are hereditary or acquired or age-related, affect millions of people, and impose a heavy burden on affected individuals and their families. The pathological processes underlying many of these disorders remain poorly understood, and few disease-modifying therapies exist. There is an unmet need for therapeutics to treat these disorders. The present disclosure addresses these needs in several ways, including competitive replacement of aged or older glial progenitor cells in the brain, and rejuvenation of glial progenitor cells or their progeny.
[0038] Competitive replacement of glial precursor cells in the adult brain Some aspects of the present disclosure relate to competitive replacement of glial progenitor cells. Competition between cell populations in development and tumorigenesis is well established, but competition between cells in the adult brain has been little studied. In particular, it is unclear whether allografted human glia can outcompete diseased cells to achieve therapeutic replacement in the adult human brain.
[0039] As disclosed herein, we engrafted healthy fluorophore-tagged wild-type (WT) hGPCs produced from human embryonic stem cells (hESCs) into the striatum of adult mice neonatally chimerized with spectrally distinct mutant HTT-expressing hGPCs produced from Huntington's disease (HD)-derived hESCs. WT hGPCs outcompeted and ultimately eliminated their human HD counterparts, repopulating the host striatum with healthy glia. Single-cell RNA-Seq revealed that WT donor hGPCs acquired a YAP1 / MYC-defined dominant competitor phenotype upon interaction with resident HD-derived glia. Competitive success was primarily dependent on the age difference between competitor populations, in that adult-engrafted WT hGPCs outcompeted resident syngeneic WT cells that had been neonatally engrafted and were therefore older. These data indicate that aged and diseased human glia can be widely replaced in the adult brain by younger, healthy hGPCs, suggesting that transplantation of newly generated glial progenitor cells could be used as a broad therapeutic platform for the replacement of aged as well as diseased human glia.
[0040] Glial dysfunction is a causative factor in a wide range of neurological conditions. Astrocytic and oligodendrocyte pathology has been associated with the development and progression of several both neurodegenerative and neuropsychiatric disorders, including amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD), as well as conditions as diverse as schizophrenia and bipolar disease. In such conditions, replacement of diseased glia by healthy glial progenitor cells (hGPCs) may provide real therapeutic benefit, given their ability to give rise to new astrocytes and oligodendrocytes while dispersing and colonizing their host. However, although human GPCs can outcompete and replace their murine counterparts in various experimental therapeutic models, it is unclear whether allografted human GPCs can replace other human cells, diseased or not.
[0041] As disclosed in the Examples below, human glial chimeric mice were used to model competition between healthy and diseased human glia in vivo by engrafting healthy hGPCs into the striatum of adult mice neonatally chimerized with hGPCs derived from subjects with HD, a prototypic monophenotypic neurodegenerative disease resulting from expression of a mutant CAG repeat-expanded huntingtin (mHTT) gene.
[0042] Glial pathology is causally involved in synaptic dysfunction in HD. Replacement of mHTT-expressing mouse glia with transplanted healthy hGPCs was sufficient to rescue aspects of the HD phenotype in a transgenic mouse model. As disclosed herein, we used genetically tagged wild-type (WT) and mHTT-expressing hGPCs derived from sibling lines of human embryonic stem cells (hESCs) to ask whether healthy WT hGPCs could replace diseased HD hGPCs in vivo. When healthy hGPCs were delivered to the striatum of adult mice chimerized with HD hGPCs, the healthy hGPCs were found to outcompete and displace already resident HD hGPCs. However, because WT donor cells were effectively younger than the resident host glia they were replacing, we asked whether differences in cell age might also contribute to the competitive outcome. This was found to be the case, in that healthy young hGPCs transplanted into adult mice neonatally engrafted with differentially tagged glia derived from the same healthy strain relentlessly replaced their older syngeneic counterparts. Single-cell RNA-sequencing (scRNA-seq) of younger winning and older losing hGPC populations revealed a set of differentially expressed pathways that overlapped with those of winning WT hGPCs and losing HD hGPCs, suggesting a common transcriptional signature of competitively dominant GPCs. These data indicate that dynamic competition between clonally distinct glial populations may occur in the mature adult brain, whereby replacement of both existing and diseased glia may be achieved by the introduction of young healthy hGPCs.
[0043] In light of the contribution of glial pathology to a wide variety of neurodegenerative and neuropsychiatric disorders, we here sought to establish the relative suitability of wild-type and diseased human GPCs in vivo to assess the potential of allogeneic glial replacement as a therapeutic strategy. Some parts of this disclosure focused on Huntington's disease, given the well-described role of glial pathology in HD. When WT hGPCs were introduced into brains already chimerized with HD hGPCs, we found that WT cells competitively dominated and eventually replaced already resident HD glial progenitor cells. The selective expansion of healthy cells was associated with an active elimination of resident HD glia from the tissue and was supported by a sustained proliferative advantage of healthy donor cells compared to their already resident diseased counterparts.
[0044] Single-cell RNA-seq analysis revealed that dominance of healthy WT hGPCs encountering HD glia in vivo was associated with the expression of typical signatures of successful cell-cell competition. Surprisingly, however, when controlling for the relative age of already resident (older) and newly introduced (younger) donor hGPCs, we found that WT hGPCs transplanted into neonatally chimerized adult neostriatum, together with differentially tagged but otherwise syngeneic WT hGPCs, similarly dominated and displaced already resident hGPCs. This observation suggested that cell youth is a key determinant of competitive success and the ability of the donor hGPC population to displace the host hGPC population. Thus, transplanted young WT hGPCs acquired a gene expression signature of a dominant competitor phenotype in vivo, regardless of whether they were challenged by resident older HD or allogeneic syngeneic WT hGPCs; indeed, the analyses described here suggested that cell youth is an even stronger determinant of competitive fitness than disease genotype.
[0045] These observations suggest that this process was driven by the recapitulation of developmental cell competition, an evolutionarily conserved selection process in which less fit clones are sensed and excluded from tissues by their more fit neighbors, but which here dynamically manifests in the adult brain. This process has been shown in a variety of systems to involve the active elimination of relatively slower growing cells by faster growing and more competitively fit neighbors. In the adult brain, WT hGPCs were typically observed to have expanded from their transplantation site in ongoing waves of proliferation. These younger hGPCs largely excluded their previously stably resident, and therefore older, counterparts, regardless of whether the latter were mHTT-expressing HD cells or allogeneic syngeneic WT cells transplanted several months earlier. In both cases, the younger cells eventually recolonized the host brain with healthy new hGPCs (Figures 4 and 17), and in both cases, the younger donor cells differentially expressed a set of genes associated with competitive dominance (Figures 20-22). Notably, competitive dominance of younger, adult transplanted hGPCs was associated with increased levels of predicted MYC and YAP1 pathway activity. These data provide a striking parallel to cell-cell competition in mouse embryos, where defective cells are eliminated by their neighbors following the acquisition of differential MYC expression during competitive challenge, and YAP and MYC interact to determine competitive outcomes during cell-cell competition. Indeed, the simultaneous enrichment of YAP1 pathway members in “winning” WT hGPCs, including both upstream and downstream transcripts of YAP1, suggests that the Hippo pathway may be a particularly promising target for the regulation of glial replacement in the adult human brain. Indeed, these observations parallel the results of liver repopulation studies, where mouse fetal liver precursors were found to drive faster and more extensive replacement when allografted into older than younger hosts, and MYC and YAP1 activity were major determinants of competitive success. Thus, identifying YAP1 and MYC as key regulators of competition between hGPCs may enable strategies to further enhance the competitive advantage, rate, and extent of donor cell colony formation following delivery of these cells to the brain.
[0046] The observed competitive replacement of resident glia by younger hGPCs resembles that of mouse glia by transplanted human GPCs, as their expansion in the mouse brain is also maintained by a relative proliferative advantage and proceeds by excluding their mouse counterparts upon contact. Similar to the xenotransplantation setting, the winning population of young WT hGPCs appears to induce apoptotic death and localized elimination of the resident losing population, whether composed of older syngeneic WT or sibling HD cells. The relative localization of apoptotic host cells to the advancing wavefront of younger WT cells suggests that the latter induces the death of already resident hGPCs via contact-dependent means. Potential mechanisms for such contact-dependent expression of relative cytocompatibility have been described in various models and include selective expression of Fwr isoforms, potentially transduced by Piezo1-dependent regulation of YAP, as well as mechanical signals. In addition, the selective elimination of both HD and syngeneic hGPCs when confronted with younger hGPCs was consistent with the loss of ribosomal transcripts by the "loser" cells during cell competition and paralleled their depletion of ribosomal-encoding transcripts, highlighting the contribution of ribosomal protein transcription to the regulation of cell fitness. Together, these data suggest that transcriptional control of the translation machinery is as important in cell-cell competition in the adult brain as it is during development.
[0047] These observations suggest that the brain is a much more dynamic structural environment than previously appreciated, and that intercellular competition between glial progenitors, and potentially the astrocytes from which they are derived, plays a key role in maintaining the adult brain as well as during development. Indeed, this competitive advantage of young resident cells over older resident cells that we noticed seems to largely mimic development, where successive waves of GPCs compete with each other, with the oldest being largely eradicated from the brain by birth and replaced by their younger successors. One can similarly envision that in adulthood, somatic mutations among dividing glial progenitors may result in selective clonal advantage for one daughter lineage or the other, leading to the relentless competitive replacement of the population by the descendants of the dominant daughters. This scenario is typical of the onset of carcinogenesis and potentially glioma formation, but may also be involved in tumor suppression, via competitive exclusion of tumor cells by their more fit non-tumorous neighbors. It is particularly interesting to consider whether such a process of dynamic competition between differentially matched hGPCs could similarly be involved in the development of non-neoplastic adult-onset brain disorders involving glia, such as some schizophrenias, and HD itself. Indeed, such mechanisms could contribute to the acceleration at later stages of disease progression that is often noted among those neurodegenerative and neuropsychiatric disorders involving glial pathology. In a broader sense, these data suggest that resident and therefore older diseased human glia could be replaced after the introduction of younger and healthier hGPCs. Indeed, such glial replacement could provide a viable strategy towards cell-based therapy of those diseases of the human brain in which glial cells are causally involved.
[0048] Rejuvenation of glial precursor cells or their progeny Some aspects of the present disclosure relate to rejuvenation of glial progenitor cells or their progeny. Human glial progenitor cells emerge during the second trimester of pregnancy and colonize the brain, where they remain in a parenchymal pool throughout adulthood. Fetal hGPCs are highly migratory and proliferative, but their expansion capacity decreases with age and following demyelination-related transformation.
[0049] As disclosed herein, we compared the transcriptional programs of fetal and adult hGPCs using bulk and single-cell RNA sequencing to determine the basis of their reduced recruitment capacity. To that end, we identified age-related changes in gene expression suggestive of loss of proliferation capacity, as well as transcriptional programs associated with the onset of differentiation and aging. More specifically, adult hGPCs have developed a repressive transcription factor network centered around MYC and regulated by ZNF274, MAX, IKZF3, and E2F6. Some exemplary nucleic acid and amino acid sequences of these repressors are shown below. E2F6 cDNA (SEQ ID NO:4): TIFF2024540971000002.tif58170 Amino acid (SEQ ID NO:5): TIFF2024540971000003.tif23170IKZF3 cDNA (SEQ ID NO:6): TIFF2024540971000004.tif52170 Amino acid (SEQ ID NO:7): TIFF2024540971000005.tif20170MAX cDNA (SEQ ID NO:8): TIFF2024540971000006.tif23170 Amino acid (SEQ ID NO:9): TIFF2024540971000007.tif11170ZNF274 cDNA (SEQ ID NO: 10): TIFF2024540971000008.tif112170 Amino acid (SEQ ID NO:11): TIFF2024540971000009.tif40170
[0050] Individual overexpression of each of these factors in human iPSC-derived GPCs resulted in loss of proliferative gene expression and induction of markers of senescence, replicating the transcriptional changes that occur during glial aging. Parallel miRNA profiling identified adult-selective miRNA expression signatures, whose targets may further constrain the expansion capacity of aged GPCs. These observations indicate that hGPCs senesce by acquiring a MYC-repressive environment and suggest that suppression of these repressors of glial expansion and transformation may allow effective rejuvenation of aged hGPCs.
[0051] Glial progenitor cells (GPCs, also called oligodendrocyte precursor cells and NG2 cells) colonize the human brain during development and remain abundant throughout adulthood. During development, human GPCs (hGPCs) are highly proliferative bipotential cells that generate new oligodendrocytes and astrocytes (Ffrench-Constant and Raff, 1986; Raff et al., 1983). In rodents, this capacity declines during normal aging, with proliferation, migration, and differentiation capacities all reduced in aged GPCs (Chari et al., 2003; Gao and Raff, 1997; Moyon et al., 2021; Segel et al., 2019; Tang et al., 2000; Temple and Raff, 1986; Wolswijk and Noble, 1989; Wren et al., 1992). Similarly, adult human GPCs are less proliferative, less mobile, and more readily differentiated than their fetal counterparts when transplanted into congenital hypomyelinated mouse hosts (Windrem et al., 2004). However, despite the apparently distinct capabilities of fetal and adult hGPCs, and the wealth of data on GPC transcription in rodent aging models, little data is available that addresses changes in GPC gene expression during human aging (Perlman et al., 2020; Sim et al., 2006) or provides a clear head-to-head comparison of transcription by fetal and adult human GPCs. Thus, certain portions of the present disclosure compare the transcriptional patterns of fetal and adult hGPCs and use the data to identify regulatory pathways causally related to the maturation and aging of these cells.
[0052] To this end, we first utilized bulk and single-cell RNA sequencing (scRNA-Seq) of A2B5+ and CD140a / PDGFRa+ hGPCs isolated from human fetal forebrains to define their transcriptional signatures and heterogeneity. We then compared these data with gene expression in isolated adult hGPCs, finding that the latter exhibited transcriptional patterns suggestive of loss of proliferative capacity, onset of an early phenotypic differentiation profile, and induction of senescence. Transcription factor motif enrichment analysis of the promoters of differentially expressed genes then implicated the adult-inducible transcriptional repressors E2F6, ZNF274, MAX, and IKZF3 as key drivers of the human glial aging program. Network analysis strongly suggested that, as a group, these genes functioned through inhibition of MYC and its proximal targets, which were relatively overexpressed in fetal hGPCs. Importantly, it was then found that overexpression of these adult repressors in newly generated human iPSC-derived GPCs resulted in the induction of a transcriptional signature that resembled fetal hGPCs in their expression signature, and in fact substantially recapitulated that of adult GPCs. We then identified a cohort of miRNAs selectively expressed by adult hGPCs that were predicted to post-transcriptionally inhibit fetal GPC gene expression, particularly in concert with an adult-acquired repressor network. Taken together, these data suggest that during aging of adult human GPCs, a cohort of repressors emerges whose activity centers around MYC and MYC-dependent transcription. Thus, these repressors may comprise viable therapeutic targets, the modulation of which may restore hallmarks of mitotic and differentiation capacity of aged or otherwise mitotically exhausted GPCs.
[0053] Suppressor / Rejuvenation Therapy In one aspect, the disclosure provides a method of therapy by suppressing a transcriptional repressor selected from the group consisting of E2F6, ZNF274, MAX, and IKZF3. In some examples, the suppression of a transcriptional repressor can be achieved by administering one or more suppressors or inhibitors of the transcriptional repressors to a subject in need of the suppression or to a target cell in need of the suppression. Such suppressors or inhibitors include or can be small molecule compounds, oligonucleotides, nucleic acids, peptides, polypeptides, CRISPR / Cas systems, or antibodies or antigen-binding portions thereof. Examples of suppressors / inhibitors include activators, agonists, or enhancers of related YAP or MYC pathway signaling pathways (e.g., Hippo signaling pathways). Various activators for this signaling pathway are known in the art. In some embodiments, the suppressor is an inhibitory or interfering nucleic acid, such as an siRNA, shRNA, miRNA, antisense oligonucleotide (ASO), and / or a nucleic acid comprising one or more modified nucleic acid residues.
[0054] inhibitory nucleic acid Certain aspects of the present disclosure provide one or more inhibitory nucleic acids (e.g., inhibitory RNA molecules), polynucleotides encoding such inhibitory nucleic acids, and transgenes engineered to express such inhibitory nucleic acids. One or more inhibitory nucleic acids may target the same gene (e.g., hybridize or specifically bind to the same mRNA sequence or different mRNA sequences of the same gene) or different genes (e.g., hybridize or specifically bind to the mRNAs of different genes). Thus, the methods described herein may include reducing expression of E2F6, ZNF274, MAX, or IKZF3 genes using inhibitory nucleic acids that target E2F6, ZNF274, MAX, or IKZF3 genes or mRNAs.
[0055] Inhibitory nucleic acid refers to a nucleic acid that can bind to a target nucleic acid (e.g., target RNA) in a cell and reduce or inhibit the level or function of the target nucleic acid in the cell. Examples of inhibitory nucleic acids include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, small interfering (si)RNA compounds, single-stranded or double-stranded RNA interference compounds, modified bases / locked nucleic acids (LNA), antagomir, peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that specifically hybridize to at least a portion of a target nucleic acid (e.g., E2F6, ZNF274, MAX, or IKZF3 mRNA) and regulate its level or function.
[0056] In some embodiments, the inhibitory nucleic acid can be an antisense RNA, an antisense DNA, a chimeric antisense oligonucleotide, an antisense oligonucleotide containing a modified linkage, an interfering RNA (iRNA), a short or small interfering RNA (siRNA), a microRNA or a microinterfering RNA (miRNA), a small temporal RNA (stRNA), a short hairpin RNA (shRNA), a small RNA-induced gene activator (RNAa), a small activating RNA (saRNA), or a combination thereof. The inhibitory nucleic acid can be modified, for example, to include modified nucleotides (e.g., locked nucleic acids) or backbones (e.g., backbones that do not contain phosphorus atoms therein), or modified by mixmers or gapmers, see, for example, WO2013 / 006619, which is incorporated herein by reference for teachings related to modification of oligonucleotides.
[0057] In some instances, the inhibitory nucleic acid is an inhibitory RNA molecule that mediates RNA interference (RNAi), a process by which cells regulate gene expression. Double-stranded RNA (dsRNA) in the cytoplasm triggers the RNAi pathway in which double-stranded RNA is processed by the RNAse III-like enzyme DICER into small double-stranded fragments approximately 21-23 nucleotides long. These double-stranded fragments are integrated into a multisubunit protein called the RNA-induced silencing complex (RISC). RISC contains Argonaute proteins that rewind the double-stranded fragment into a passenger strand that is removed from the complex and a guide strand that is complementary to a target sequence within a specific mRNA and directs the RISC complex to cleave or suppress translation of a specific target mRNA molecule (Kotowska-Zimmer et al., 2021). In this way, the gene encoding the mRNA molecule is essentially inactive or "silenced."
[0058] RNAi technology may use several tools, including synthetic siRNA, vector-based shRNA, and artificial miRNA (amiRNA). Synthetic siRNA is an exogenous double-stranded RNA that must be delivered into cells and overcome stability and pharmacokinetic challenges. shRNA is an artificial RNA molecule with a tight hairpin loop structure that is delivered to cells using a plasmid or viral expression vector. shRNA is typically transcribed from a strong pol III promoter (e.g., U6 or H1) and enters the RNAi pathway as a hairpin. However, transcription driven by a strong pol III promoter can produce supraphysiological levels of shRNA that saturate the endogenous miRNA biogenesis machinery, resulting in toxicity. amiRNA embeds target-specific shRNA inserts in a scaffold based on a natural primary miRNA (pri-miRNA). This ensures proper processing and transport similar to endogenous miRNA, resulting in reduced toxicity (Kotowska-Zimmer et al., 2021).
[0059] In some embodiments of the present disclosure, the inhibitory RNA molecule can be an siRNA, miRNA (including amiRNA), or shRNA. siRNA is known in the art as a double-stranded RNA molecule of approximately 19-25 (e.g., 19-23) base pairs in length that induces RNAi in cells. In some embodiments, the siRNA sequence can also be inserted into an artificial miRNA scaffold ("shmiRNA"). shRNA is known in the art as an RNA molecule that includes approximately 19-25 (e.g., 19-23) base pairs of double-stranded RNA linked by a short loop (e.g., about 4-11 nucleotides) that induces RNAi in cells. miRNA is known in the art as an RNA molecule that includes a short (e.g., 19-25 base pairs) sequence of double-stranded RNA linked by a loop and contains one or more additional sequences of double-stranded RNA that include one or more bulges (e.g., mismatched or unpaired base pairs) that induce RNAi in cells.
[0060] As used herein, the term "miRNA" encompasses endogenous miRNAs as well as exogenous or heterologous miRNAs. In some embodiments, "miRNA" can refer to pri-miRNA or pre-miRNA. During miRNA processing, a pri-miRNA transcript is produced. The pri-miRNA is processed by Drosha-DGCR8 to produce a pre-miRNA by excising one or more sequences to leave a 5' flanking region, a guide strand, a loop region, a non-guide strand, and a 3' flanking region, or a pre-miRNA by leaving a 5' flanking region, a non-guide strand, a loop region, a guide strand, and a 3' flanking region. The pre-miRNA is then exported to the cytoplasm and processed by Dicer to obtain an siRNA with a guide strand and a non-guide (or passenger) strand. The guide strand is then used by the RISC complex to catalyze gene silencing, for example, by recognizing a target RNA sequence complementary to the guide strand. Further description of miRNAs can be found, for example, in WO2008 / 150897. Recognition of target sequences by miRNAs is determined primarily by pairing between the target and the miRNA seed sequence, e.g., nucleotides 1-8 (5'-3') of the guide strand (see, e.g., Boudreau, RR et al. (2013) Nucleic Acids Res. 41:e9).
[0061] Shown below are some exemplary suppressor miRNAs that target and suppress one or more of E2F6, ZNF274, MAX, and IKZF3. Table. Sequences of suppressor miRNAs TIFF2024540971000010.tif67170
[0062] In some embodiments of the present disclosure, the inhibitory RNA molecule forms a hairpin structure. In general, hairpin-forming RNAs are arranged in a self-complementary "stem-loop" structure that includes a single nucleic acid encoding a stem portion having a double strand including a sense strand (e.g., passenger strand) connected to an antisense strand (e.g., guide strand) by a loop sequence. The passenger strand and guide strand share complementarity. In some embodiments, the passenger strand and guide strand share 100% complementarity. In some embodiments, the passenger strand and guide strand share at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% complementarity. The passenger strand and guide strand may lack complementarity due to base pair mismatches. In some embodiments, the passenger strand and guide strand of the hairpin-forming RNA may have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 mismatches. Generally, the first 2-8 nucleotides of the stem (relative to the loop) are referred to as "seed" residues and play an important role in target recognition and binding. The first residue of the stem (relative to the loop) is referred to as the "anchor" residue. In some embodiments, the hairpin-forming RNA has a mismatch at the anchor residue.
[0063] In some embodiments, the inhibitory RNA molecule is processed in a cell (or subject) to form a "mature miRNA." Mature miRNAs are the result of a multi-step pathway that begins through transcription of the primary miRNA from its miRNA gene or intron by RNA polymerase II or III, which generates the first precursor molecule in the biological pathway that results in the miRNA. Once transcribed, the pri-miRNA (often more than 1000 nucleotides long with a hairpin structure) is processed by the Drosha enzyme, which cleaves the pri-miRNA near the junction between the hairpin structure and the ssRNA, resulting in the precursor miRNA (pre-miRNA). The pre-miRNA is exported to the cytoplasm and further reduced by the Dicer enzyme at the pre-miRNA loop, resulting in a doubled miRNA strand.
[0064] Of the two strands of the miRNA duplex, one arm, the guide strand (miR), is typically found in higher concentrations and binds and associates with Argonaute proteins that are ultimately loaded into the RNA-induced silencing complex. The guide strand miRNA-RISC complex helps regulate gene expression by binding to its complementary sequence in the mRNA, often in the 3'UTR of the mRNA. The non-guide strand of the miRNA duplex, known as the passenger strand, is often degraded but may persist and act either intact or after partial degradation to have a functional role in gene expression.
[0065] In some embodiments, the transgene is engineered to express an inhibitory nucleic acid (e.g., miRNA) with a guide strand that targets a human gene. "Targeting" refers to the hybridization or specific binding of an inhibitory nucleic acid to its cognate (e.g., complementary) sequence on a target gene (e.g., an mRNA transcript of the target gene). In some embodiments, an inhibitory nucleic acid that targets a gene transcript shares a region of complementarity with the target gene that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the region of complementarity is 30 or more nucleotides in length.
[0066] Typically, the guide strand may target a human gene transcript associated with a myelin disease or disorder. Examples include the guide strand for ZNF274, MAX, IKZF3, or E2F6. In some embodiments, the guide strand targeting any of these gene transcripts is encoded by an isolated nucleic acid comprising a suitable segment of the above-mentioned sequence.
[0067] Thus, inhibitory nucleic acids can be used to mediate gene silencing, specifically one or more of ZNF274, MAX, IKZF3, and E2F6, through interactions with RNA transcripts or alternatively by interactions with specific gene sequences, which result in gene silencing at either the transcriptional or post-transcriptional level, for example, but not limited to, RNAi, or by cellular processes that modulate the chromatin structure or methylation pattern of the target using the target nucleotide sequence to prevent transcription of the target gene, thereby mediating silencing.
[0068] These inhibitory nucleic acids may comprise short double-stranded regions of RNA. The double-stranded RNA molecules may be symmetric or asymmetric and may comprise two distinct separate strands that may be complementary, i.e., two single-stranded RNA molecules, or may comprise one single-stranded molecule in which the two complementary portions, e.g., the sense and antisense regions, are base-paired and covalently linked by one or more single-stranded "hairpin" regions (i.e., loops), resulting in, for example, a single-stranded short hairpin polynucleotide or a circular single-stranded polynucleotide.
[0069] The linker can be a polynucleotide linker or a non-nucleotide linker. In some embodiments, the linker is a non-nucleotide linker. In some embodiments, the hairpin or circular inhibitory nucleic acid molecule contains one or more loop motifs, and at least one of the loop portions of the molecule is biodegradable. For example, a single-stranded hairpin molecule can be designed such that the degradation of the loop portion of the molecule in vivo can produce a double-stranded siRNA molecule with a 3'-end overhang, such as a 3'-end nucleotide overhang that comprises 1, 2, 3, or 4 nucleotides. Or alternatively, a circular inhibitory nucleic acid molecule can be designed such that the degradation of the loop portion of the molecule in vivo can produce a double-stranded siRNA molecule with a 3'-end overhang, such as a 3'-end overhang that comprises about 2 nucleotides.
[0070] In a symmetric inhibitory nucleic acid molecule, each strand, the sense (passenger) strand, and the antisense (guide) strand, can independently be about 15 to about 40 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides in length.
[0071] In asymmetric inhibitory nucleic acid molecules, the antisense region or strand of the molecule can be about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides in length and the sense region is about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
[0072] In yet other embodiments, the inhibitory nucleic acid molecules described herein can comprise single-stranded hairpin siRNA molecules, which can be about 25 to about 70 (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length.
[0073] In yet other embodiments, the molecule may comprise a single stranded circular siRNA molecule, the molecule being about 38 to about 70 (eg, about 38, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length.
[0074] In various symmetric embodiments, the inhibitory nucleic acid duplexes described herein can independently comprise from about 15 to about 40 base pairs (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40).
[0075] In yet other embodiments in which the inhibitory nucleic acid molecules described herein are asymmetric, the molecules can contain between about 3 and 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) base pairs.
[0076] In yet other embodiments in which the inhibitory nucleic acid molecule is a hairpin or circular structure, the molecule can contain from about 3 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) base pairs.
[0077] The sense strand and antisense strand, or the sense region and the antisense region of the inhibitory nucleic acid molecule, can be complementary. Also, the antisense strand or the antisense region can be complementary to the nucleotide sequence or a portion thereof of the target RNA (e.g., the nucleotide sequence or a portion thereof of ZNF274, MAX, IKZF3, and E2F6). The sense strand or the sense region of the inhibitory nucleic acid can include the nucleotide sequence or a portion thereof of the target gene.
[0078] In some embodiments, the inhibitory nucleic acid can be optimized (based on sequence) or chemically modified to minimize degradation prior to and / or during delivery to the tissue of interest. Commercial sources of these interfering nucleic acids include, but are not limited to, Thermo-Fisher Scientific / Ambion, Origene, Qiagen, Dharmacon, and Santa Cruz Biotechnology. In some embodiments, such optimization and / or modification can be performed to ensure that a sufficient payload of inhibitory nucleic acid is delivered to the tissue of interest. Other embodiments include the use of small molecules, aptamers, or oligonucleotides designed to reduce expression of E2F6, ZNF274, MAX, or IKZF3 genes, either by binding to the DNA of the gene and restricting expression, e.g., antisense oligonucleotides, or by imposing post-transcriptional gene silencing (PTGS) through mechanisms including, but not limited to, binding directly to the target transcript or gene product or one or more other proteins in such a way that expression of the gene is reduced, or the use of other small molecule decoys to reduce expression of a particular gene.
[0079] Any of the inhibitory nucleic acid molecules or constructs described herein may contain one or more chemical modifications. Modifications can be used to improve in vivo or in vivo characteristics such as stability, activity, toxicity, immune response (e.g., to prevent stimulation of an interferon response, an inflammatory or proinflammatory cytokine response, or a Toll-like receptor (TIF) response), and / or bioavailability.
[0080] Chemically modified molecules exhibit improved RNAi activity compared to corresponding unmodified or minimally modified molecules. The chemically modified motifs disclosed herein provide nuclease resistance and pharmacokinetic properties suitable for use in therapeutic applications, while at the same time providing the ability to maintain substantially similar RNAi activity to unmodified or minimally modified active siRNA.
[0081] In various embodiments, the inhibitory nucleic acid molecules described herein may include modifications in which any (e.g., one or more or all) nucleotides present in the sense and / or antisense strand are modified nucleotides. In some embodiments, the molecules may be partially modified by chemical modification (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75, 80 nucleotides are modified). In other embodiments, the molecules may be fully modified by chemical modification (e.g., 100% modified).
[0082] Chemical modifications within a single molecule can be the same or different. In some embodiments, at least one strand has at least one chemical modification. In other embodiments, each strand has at least one chemical modification, which can be the same or different, such as a sugar, base, or backbone (i.e., internucleotide linkage) modification. In other embodiments, the molecule can contain at least 2, 3, 4, 5, or more different chemical modifications.
[0083] Non-limiting examples of suitable chemical modifications include those disclosed in, for example, US Pat. No. 8,202,979 and US2005 / 0266422, including sugar, base, and phosphate, non-nucleotide modifications, and / or any combination thereof.
[0084] In various embodiments, the majority of pyrimidine nucleotides present in the double-stranded inhibitory nucleic acid molecule comprise a sugar modification. In yet other embodiments, the majority of purine nucleotides present in the double-stranded molecule comprise a sugar modification. In certain instances, the purines and pyrimidines are differentially modified at the 2' sugar position (i.e., at least one purine has a different modification at the 2' sugar position than at least one pyrimidine in the same or different strand).
[0085] In certain embodiments, at least one modified nucleotide is a 2'-deoxy-2-fluoro nucleotide, a 2'-deoxy nucleotide, or a 2'-O-alkyl (e.g., 2'-O-methyl) nucleotide. In yet other embodiments, at least one nucleotide has a ribo-like, Northern, or A-type helix configuration (see, e.g., Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984). Non-limiting examples of nucleotides having a Northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2'-O,4'-C-methylene-(D-ribofuranosyl) nucleotides); 2'-methoxyethoxy (MOE) nucleotides; 2'-methyl-thio-ethyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides, 2'-azido nucleotides, 2'-O-trifluoromethyl nucleotides, 2'-O-ethyl-trifluoromethoxy nucleotides, 2'-O-difluoromethoxy-ethoxy nucleotides, 4'-thio nucleotides, and 2'-O-methyl nucleotides.
[0086] The inhibitory nucleic acid described herein can be obtained using several techniques known to those skilled in the art.For example, the inhibitory nucleic acid can be chemically synthesized or can be encoded by plasmid (e.g., transcribed as a sequence that automatically folds into double strands with hairpin loop).siRNA can also be produced by cleavage of longer dsRNA.
[0087] In some embodiments, the inhibitory nucleic acid is chemically synthesized. Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides that lack ribonucleotides) can be synthesized using protocols known in the art, for example, as described in Caruthers et al., 1992, Methods in Enzymology 211, 3-19; Thompson et al., International Patent Application No. 99 / 54459; Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684; Wincott et al., 1997, Methods Mol. Bio., 74, 59; Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Patent No. 6,001,311. Synthesis of oligonucleotides utilizes common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5' end and phosphoramidite at the 3' end.
[0088] Alternatively, the inhibitory nucleic acids can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992, Science 256, 9923; Draper et al., International Patent Application No. 93 / 23569; Shabarova et al., 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. 8, 204) or by hybridization after synthesis and / or deprotection.
[0089] In some embodiments, the inhibitory nucleic acid can be expressed and delivered from a transcription unit inserted into a recombinant DNA or RNA vector. The recombinant vector can be a DNA plasmid or a viral vector. The viral vector can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
[0090] CRISPR / Cas system In one aspect, the suppression or knockdown of one or more of the genes described herein can be achieved through CRISPR-Cas-induced nucleases using the CRISPR / Cas system and related methods known in the art.See, for example, US11225659B2, WO2021 / 168799A1, WO2022 / 188039A1, WO2022 / 188797A1, WO2022 / 068912A1, and WO2022 / 047624A1. See also Gimenez et al., "CRISPR-on System for the Activation of the Endogenous human INS gene," Gene Therapy 23:543-547 (2016); Wiedenheft et al., "RNA-Guided Genetic Silencing Systems in Bacteria and Archaea," Nature 482:331-338 (2012); Zhang et al., "Multiplex Genome Engineering Using CRISPR / Cas Systems," Science 339(6121):819-23 (2013); and Gaj et al., "ZFN, TALEN, and CRISPR / Cas-based Methods for Genome Engineering," Cell 31(7):397-405 (2013), which are incorporated by reference in their entireties.
[0091] The CRISPR-Cas system is a genetic technology that allows sequence-specific control of gene expression in prokaryotic and eukaryotic cells by inducible nuclease double-stranded DNA breaks. It is based on the CRISPR (clustered regularly interspaced palindromic repeats) pathway derived from the bacterial immune system.
[0092] In another aspect, the present application provides a complex comprising: (i) a protein composition comprising a Cas protein, or an orthologue, homologue, derivative, conjugate, functional fragment, conjugate, or fusion thereof, and (ii) a polynucleotide composition comprising a CRISPR RNA and a programmable spacer sequence or guide sequence complementary to at least a portion of a target RNA or DNA. The programmable guide RNA, CRISPR RNA, and Cas protein together form a CRISPR / Cas-based module for sequence targeting and recognition.
[0093] The target RNA can be any RNA molecule of interest, including naturally occurring and engineered RNA molecules. The target RNA can be an mRNA, tRNA, ribosomal RNA (rRNA), microRNA (miRNA), interfering RNA (siRNA), ribozyme, riboswitch, satellite RNA, microswitch, microzyme, or viral RNA.
[0094] In some embodiments, the target nucleic acids are associated with conditions or diseases, such as conditions or disorders mediated by white matter / oligodendrocyte / astrocyte loss and related disorders described herein, and thus, in some embodiments, the systems described herein can be used to treat such conditions or diseases by targeting these nucleic acids.
[0095] For example, the target nucleic acid associated with a condition or disease can be an RNA molecule that is overexpressed in diseased cells, old or older cells, or senescent cells.The target nucleic acid can also be a toxic RNA and / or a mutant RNA (e.g., an mRNA molecule with splicing defects or mutations).The target nucleic acid can also be an miRNA.
[0096] For example, the target nucleic acid can be of a gene whose increased activity is linked to aging, such as STAT, and a transcriptional repressor (e.g., E2F6, ZNF274, MAX, or IKZF3), as illustrated in Figures 28, 30, and 37. The target nucleic acid can be of a miRNA that promotes aging in adult GPCs, such as miR-584-5p, miR-330-3p, miR-23b-3p, and miR-140-3p, as illustrated in Figures 28, 30, and 37.
[0097] A variety of Cas proteins can be used in the present invention. Cas protein, CRISPR-associated protein, or CRISPR protein, used interchangeably, refers to CRISPR-Cas class 1 or class 2 proteins or proteins derived therefrom, including type I, II, III, IV, V, or VI systems with RNA-guided DNA binding. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas13, Cas13e, Cas13f, CasF, CasG, CasH, Csy1, Csy2, Csy3, Csel (or CasA), Csel2 (or Csel3), Csel4 (or Csel5), Csel6 (or Csel7), Csel8 (or Csel9), Csel10 (or Csel11), Csel12 (or Csel13), Csel14 (or Csel15), Csel16 (or Csel17), Csel18 (or Csel19), Csel20 (or Csel21), Csel21 (or Csel22), Csel23 (or Csel24), Csel25 (or Csel26), Csel27 (or Csel28), Csel29 (or Csel29), Csel30 (or Csel31), Csel32 (or Csel32), Csel33 (or Csel33), Csel34 (or Csel34), Csel35 (or Csel35), Csel36 (or Csel36), Csel37 (or Csel37), Csel38 (or Csel38), Csel39 (or Csel39), Csel39 ( asB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966. See, e.g., US11225659B2, WO2021 / 168799A1, WO2022 / 188039A1, WO2022 / 188797A1, WO2022 / 068912A1, WO2022 / 047624A1, WO2014 / 144761, WO2014 / 144592, WO2013 / 176772, US2014 / 0273226, and US2014 / 0273233, the contents of which are incorporated by reference in their entireties.
[0098] Expression cassettes and expression vectors The present disclosure also provides an expression cassette comprising or consisting of a recombinant nucleic acid encoding the inhibitory nucleic acid or CRISPR / Cas system described above. If such a recombinant nucleic acid does not already comprise a promoter, the expression cassette may further comprise a promoter. Thus, an expression cassette according to the present invention comprises, in the 5' to 3' direction, a promoter, a coding sequence, and optionally a terminator or other elements. The expression cassette allows for easy transfer of the nucleic acid sequence of interest into an organism, preferably a cell, preferably a diseased cell.
[0099] The expression cassette of the present disclosure is preferably contained in a vector. Thus, the vector of the present disclosure allows for the transformation of cells with a nucleic acid sequence of interest. Correspondingly, the present disclosure provides a host cell comprising an expression cassette according to the present disclosure or a recombinant nucleic acid according to the present disclosure. The recombinant nucleic acid may also comprise a promoter or enhancer that allows for the expression of the nucleic acid sequence of interest.
[0100] Exogenous genetic material (e.g., a nucleic acid, an expression cassette, or an expression vector encoding one or more therapeutic or inhibitory RNAs) can be introduced into a target cell of interest in vivo by gene transfer methods such as transfection or transduction to provide a genetically modified cell. A variety of expression vectors (i.e., vehicles for facilitating the delivery of exogenous genetic material to a target cell) are known to those skilled in the art. As used herein, "exogenous genetic material" refers to either natural or synthetic nucleic acids or oligonucleotides that are not naturally found in a cell, or, if it is naturally found in a cell, it is not transcribed or expressed at a biologically significant level by the cell. Thus, "exogenous genetic material" includes, for example, non-naturally occurring nucleic acids that can be transcribed into RNA.
[0101] As used herein, "transfection of a cell" refers to the acquisition of new genetic material by a cell through the incorporation of added nucleic acid (DNA, RNA, or hybrids thereof) without the use of a viral delivery vehicle. Thus, transfection refers to the introduction of nucleic acid into a cell using physical or chemical methods. Several transfection techniques are known to those skilled in the art, including calcium phosphate nucleic acid co-precipitation, strontium phosphate nucleic acid co-precipitation, DEAE-dextran, electroporation, cationic liposome-mediated transfection, and tungsten particle-facilitated microparticle bombardment. In contrast, "transduction of a cell" refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus. RNA viruses (e.g., retroviruses) for transferring nucleic acid into a cell are referred to herein as transducing chimeric viruses. Exogenous genetic material contained within the virus can be integrated into the genome of the transduced cell. A cell transduced with a chimeric DNA virus (e.g., an adenovirus carrying DNA encoding a therapeutic agent) may not have the exogenous genetic material integrated into its genome, but may be capable of expressing exogenous genetic material carried extrachromosomally within the cell.
[0102] Typically, the exogenous genetic material may include a heterologous gene (encoding a therapeutic RNA or protein) along with a promoter that controls the transcription of the new gene. A promoter characteristically has a specific nucleotide sequence required to initiate transcription. Optionally, the exogenous genetic material further includes additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity. The exogenous genetic material may be introduced into the cell genome immediately downstream of the promoter such that the promoter and the coding sequence are operably linked to allow transcription of the coding sequence. Retroviral expression vectors may include an exogenous promoter element to control the transcription of the inserted exogenous gene. Such exogenous promoters include both constitutive and inducible promoters.
[0103] Naturally occurring constitutive promoters control the expression of essential cellular functions. As a result, genes under the control of a constitutive promoter are expressed under all conditions of cell growth. Exemplary constitutive promoters include the promoters of the following genes that code for certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyltransferase, dihydrofolate reductase, adenosine deaminase, phosphoglycerol kinase, pyruvate kinase, phosphoglycerol mutase, actin promoter, ubiquitin, elongation factor-1, and other constitutive promoters known to those skilled in the art. In addition, many viral promoters function constitutively in eukaryotic cells. These include, among others, the early and late promoters of SV40, the long terminal repeats (LTRs) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Thus, any of the tactic constitutive promoters can be used to control the transcription of a heterologous gene insert.
[0104] Genes under the control of inducible promoters are expressed only in the presence of, or are largely regulated by, an inducing agent (e.g., transcription under the control of the metallothionein promoter is greatly increased in the presence of certain metal ions). Inducible promoters contain a response element (RE) that stimulates transcription when their inducer is bound. Examples include REs for serum factors, steroid hormones, retinoic acid, and cyclic AMP. Promoters containing specific REs can be selected to obtain an inducible response, and in some cases the RE itself can be attached to different promoters, thereby conferring inducibility to the recombinant gene. Thus, by selecting the appropriate promoter (constitutive vs. inducible, strong vs. weak), it is possible to control both the presence and the level of expression of the therapeutic agent in the recombinant cell. When a gene encoding a therapeutic agent is under the control of an inducible promoter, delivery of the therapeutic agent in situ is triggered by exposing the recombinant cell in situ to conditions to allow transcription of the therapeutic agent, for example, by injecting a specific inducer of the inducible promoter that controls transcription of the agent. For example, in situ expression by genetically modified cells of a therapeutic agent encoded by a gene under the control of a metallothionein promoter is enhanced by contacting the genetically modified cells in situ with a solution containing the appropriate (i.e., inducing) metal ion.
[0105] Thus, the amount of therapeutic agent delivered in situ is regulated by controlling factors such as: (1) the nature of the promoter used to direct transcription of the inserted gene (i.e., whether the promoter is constitutive or inducible, strong or weak), (2) the number of copies of the exogenous gene inserted into the cells, (3) the number of transduced / transfected cells administered (e.g., implanted) to the patient, (4) the size of the implant (e.g., graft or encapsulated expression system), (5) the number of implants, (6) the length of time the transduced / transfected cells or implants are left in place, and (7) the rate of production of the therapeutic agent by the genetically engineered cells. Selection and optimization of these factors for delivery of a therapeutically effective dose of a particular therapeutic agent is deemed to be within the scope of one of ordinary skill in the art without undue experimentation, taking into account the factors disclosed above and the clinical profile of the patient.
[0106] In addition to at least one promoter and at least one heterologous nucleic acid encoding a therapeutic agent, the expression vector may contain a selection gene, such as a neomycin resistance gene or a fluorescent protein gene, to facilitate the selection of cells transfected or transduced with the expression vector. Alternatively, the cells are transfected with two or more expression vectors, at least one vector containing gene(s) encoding the therapeutic agent(s) and the other vector containing a selection gene. Selection of a suitable promoter, enhancer, selection gene, and / or signal sequence is deemed to be within the scope of one of ordinary skill in the art without undue experimentation.
[0107] The coding sequence of the present disclosure can be inserted into any type of target cell or host cell. In the context of an expression vector, the vector can be easily introduced into a host cell, such as a mammalian, bacterial, yeast, or insect cell, by any method in the art. For example, the expression vector can be transferred into the host cell by physical, chemical, or biological means.
[0108] Polynucleotide Carriers / Delivery As disclosed herein, the above-mentioned polynucleotides or nucleic acid molecules can be used to treat disorders in a subject. Accordingly, the present disclosure provides systems and methods for delivering polynucleotides to a target cell or subject.
[0109] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, e.g., Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
[0110] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.
[0111] Chemical means for introducing polynucleotides into host cells include macromolecule complexes, nanocapsules, microspheres, beads, and colloidal dispersion systems such as lipid systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0112] The polynucleotides or nucleic acids described herein (e.g., inhibitory nucleic acids, those encoding CRISPR-Cas systems, expression cassettes, and expression vectors) can be directly added, or complexed with cationic lipids, packaged into liposomes, or as recombinant plasmids or viral vectors, or otherwise delivered to target cells or tissues. Methods for delivering nucleic acid molecules are known in the art. See, e.g., U.S. Patent No. 6,395,713, WO 94 / 02595, Akhtar et al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140, Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192, and Lee et al., 2000, ACS Symp. Ser., 752, 184-192. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not limited to, encapsulation within liposomes, by iontophoresis, or by incorporation into other vehicles such as biodegradable polymers, hydrogels, cyclodextrins (see, e.g., Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074, WO03 / 47518 and WO03 / 46185), poly(lactic-co-glycolic) acid (PLGA) and PLCA microspheres (see, e.g., U.S. Pat. No. 6,447,796 and US2002 / 130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (see, e.g., WO00 / 53722).
[0113] In one aspect, the present application provides a carrier system containing a nucleic acid molecule as described herein. In some embodiments, the carrier system is a lipid-based carrier system, a cationic lipid, or a liposome-nucleic acid complex, a liposome, a micelle, a virosome, a lipid nanoparticle, or a mixture thereof. In other embodiments, the carrier system is a polymer-based carrier system, such as a cationic polymer-nucleic acid complex. In additional embodiments, the carrier system is a cyclodextrin-based carrier system, such as a cyclodextrin polymer-nucleic acid complex. In further embodiments, the carrier system is a protein-based carrier system, such as a cationic peptide-nucleic acid complex. Preferably, the carrier system is a lipid nanoparticle formulation. The lipid nanoparticle ("LNP") formulation described herein can be applied to any nucleic acid molecule (e.g., an RNA molecule) or combination of nucleic acid molecules as described herein.
[0114] In certain embodiments, the nucleic acid molecules described herein are formulated as lipid nanoparticle compositions as described in U.S. Patent Nos. 7,514,099 and 7,404,969. In some embodiments, the present application features compositions that include nucleic acid molecules formulated as any of the formulations described in US 2012 / 0029054, such as LNP-051, LNP-053, LNP-054, LNP-069, LNP-073, LNP-077, LNP-080, LNP-082, LNP-083, LNP-060, LNP-061, LNP-086, LNP-097, LNP-098, LNP-099, LNP-100, LNP-101, LNP-102, LNP-103, or LNP-104.
[0115] In other embodiments, the present disclosure features conjugates and / or complexes of the nucleic acid molecules described herein. Such conjugates and / or complexes can be used to facilitate the delivery of nucleic acid molecules to biological systems such as cells. The conjugates and complexes provided herein can impart therapeutic activity by translocating therapeutic compounds across cell membranes, altering pharmacokinetics, and / or modulating the localization of the nucleic acid molecules of the present invention. Non-limiting examples of such conjugates are described, for example, in U.S. Patent Nos. 7,833,992, 6,528,631, 6,335,434, 6,235,886, 6,153,737, 5,214,136, and 5,138,045.
[0116] In various embodiments, polyethylene glycol (PEG) can be covalently attached to the nucleic acid molecules described herein. The attached PEG can be of any molecular weight, preferably from about 100 to about 50,000 Daltons (Da). Thus, the present disclosure features compositions or formulations that include poly(ethylene glycol) lipids (PEG-modified or long-circulating liposomes or stealth liposomes) and surface-modified liposomes that contain a nucleic acid molecule described herein. See, e.g., WO96 / 10391, WO96 / 10390, and WO96 / 10392).
[0117] In some embodiments, the nucleic acid molecules may also be formulated or complexed with polyethyleneimine and its derivatives, such as polyethyleneimine-polyethylene glycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethylene glycol-tri-N-acetylgalactosamine (PEI-PEG-tri-gal) derivatives. In one embodiment, the nucleic acid molecules may be formulated as described in US2003 / 0077829.
[0118] In other embodiments, the nucleic acid molecules described herein may be complexed with membrane disruptive agents, such as those described in US 2001 / 0007666. In yet other embodiments, the membrane disruptive agents and molecules may be complexed with cationic lipids or helper lipid molecules, such as those described in U.S. Patent No. 6,235,310.
[0119] In certain embodiments, the nucleic acid molecules described herein can be complexed with delivery systems such as those described in U.S. Patent Application Publication Nos. 2003 / 077829, 2005 / 0287551, 2005 / 0164220, 2005 / 0191627, 2005 / 0118594, 2005 / 0153919, 2005 / 00854886, and 2003 / 0158133, as well as IWO00 / 03683 and WO02 / 087541.
[0120] In some embodiments, the liposomal formulations described herein are prepared using the methods described in U.S. Pat. Nos. 6,858,224, 6,534,484, 6,287,591, 6,835,395, 6,586,410, 6,858,225, 6,815,432, 6,586,001, 6,120,798, 6,977,223, 6,998,115, 5,981,501, 5,976,567, 5,705,385, and U.S. Patent Application Publication Nos. 2006 / 0019912, 2006 / 0019923, 2006 / 0019930, 2006 / 001916, and 2006 / 001918. 258, 2006 / 0008909, 2005 / 0255153, 2005 / 0079212, 2005 / 0008689, 2003 / 0077829, 2005 / 0064595, 2005 / 0175682, 2005 / 0118253, 2004 / 0071654, 2005 / 0244504, 2005 / 0265961, and 2003 / 0077829.
[0121] As disclosed herein, the above-mentioned nucleic acid molecules can be used to treat disorders in subjects. The above-mentioned vectors (such as recombinant plasmids and viral vectors) can be used to deliver therapeutic agents such as inhibitory nucleic acids or CRISPR-Cas systems described herein. Delivery of the vector can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells explanted from the subject and then reintroduced into the subject, or by any other means that would allow for introduction into the desired target cells. Such recombinant vectors can also be administered directly or in conjunction with suitable delivery reagents, including, for example, Mirus Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine), or liposome lipid-based carrier systems, cationic lipids, or liposome-nucleic acid complexes, micelles, virosomes, lipid nanoparticles.
[0122] Viral Vectors In some embodiments, the polynucleotide encoding the RNA molecule may be inserted into or encoded by a vector, such as a plasmid or viral vector. Preferably, the polynucleotide is inserted into or encoded by a viral vector. The viral vector may be a herpes virus (HSV) vector, a retroviral vector, an adenoviral vector, an AAV vector, a lentiviral vector, or the like. In some specific embodiments, the viral vector is an AAV vector. In some embodiments, the RNA may be encoded by a retroviral vector (see, e.g., U.S. Pat. Nos. 5,399,346, 5,124,263, 4,650,764, and 4,980,289, the contents of each of which are incorporated herein by reference in their entirety).
[0123] Lentiviral Vectors Lentiviruses, such as HIV, are "slow viruses". Vectors derived from lentiviruses can be expressed in host cells for long periods of time after several administrations to patients, for example, via ex vivo transduced stem or progenitor cells. For most diseases and disorders, including genetic diseases, cancer, and neurological diseases, long-term expression is essential for successful treatment. With regard to the safety of lentiviral vectors, several strategies are currently known in the art to eliminate the replication capacity of lentiviral vectors. See, for example, US2021 / 0401868 and US2021 / 0403517, each of which is incorporated herein by reference in its entirety. For example, deletion of promoter and enhancer elements from the U3 region of the long terminal repeat (LTR) would result in no LTR-directed transcription. The resulting vector is called "self-inactivating" (SIN).
[0124] Lentiviral vectors are particularly suitable for achieving long-term gene transfer, since they allow long-term, stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have the additional advantage over vectors derived from oncoretroviruses, such as murine leukemia viruses, in that they can transduce non-proliferating cells, such as CNS cells. They also have the additional advantage of being less immunogenic. In general, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction nuclease sites, and one or more selection markers (e.g., WO01 / 96584 and WO01 / 29058, and U.S. Patent No. 6,326,193). Several vector promoter sequences are available for the expression of transgenes. One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence, capable of driving high levels of expression of any polynucleotide sequence operably linked to it. Another example of a suitable promoter is EF1a. However, other constitutive promoter sequences can also be used, including, but not limited to, Simian Virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Inducible promoters include, but are not limited to, metallothionein promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter.
[0125] The present disclosure provides recombinant lentiviruses capable of infecting dividing and non-dividing cells, such as oligodendrocytes, astrocytes, or glial precursor cells. The viruses are useful for in vivo and ex vivo transfer and expression of nucleic acid sequences. The lentiviral vectors of the present disclosure can be lentiviral transfer plasmids or infectious lentiviral particles. Constructions of lentiviral vectors, helper constructs, envelope constructs, etc. for use in lentiviral transfer systems are described, for example, in US2021 / 0401868 and US2021 / 0403517, each of which is incorporated herein by reference in its entirety.
[0126] Adenovirus Adenovirus is a eukaryotic DNA virus that can be modified to efficiently deliver nucleic acid to various cell types in vivo, and is widely used in gene therapy protocols, including targeting genes to neuronal and glial cells.Various replication-defective adenoviruses and minimal adenovirus vectors have been described for nucleic acid therapeutic agents (see, for example, PCT Patent Publication Nos. 1994 / 26914, 1995 / 02697, 1994 / 28152, 1994 / 12649, 1995 / 02697, and 1996 / 22378, the contents of each of which are incorporated by reference in their entirety).Such adenovirus vectors can also be used to deliver therapeutic molecules of the present disclosure to cells.
[0127] Adeno-associated virus Adeno-associated viruses are widely used gene therapy vectors due to their clinical safety record, non-pathogenicity, ability to infect non-dividing cells (such as neurons), and ability to provide long-term gene expression after a single administration. Currently, many human and non-human primate AAV serotypes have been identified. AAV vectors have demonstrated safety in hundreds of clinical trials worldwide, and clinical efficacy has been shown in trials for hemophilia B, spinal muscular atrophy, alpha-1 antitrypsin, and Leber's congenital anmyelopathy.
[0128] Due to their safety, non-pathogenicity, and ability to infect neurons, AAVs such as AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, and AAV9 are commonly used gene therapy vectors for CNS applications. However, after direct CNS injection, these serotypes exhibit predominantly neuronal tropism, especially when gene expression is driven by a constitutive promoter, with low expression in oligodendrocytes, limiting their potential use in the treatment of white matter diseases. AAV1 / 2, AAV2, and AAV8 have been shown to transduce oligodendrocytes. The reliance on cell-specific promoters for expression specificity allows for the possibility of non-selective cellular uptake and leaky transgene expression via cryptic promoter activity in non-oligodendrocyte lineage cells.
[0129] The approach described herein to alleviate these problems involves using AAV serotypes with high tropism for oligodendrocytes or astrocytes or glial progenitor cells. Recently, using DNA shuffling and directed evolution methods, a chimeric AAV capsid, AAV / Olig001, with strong selectivity for oligodendrocytes has been described (Powell et al., 2016, Gene Ther 23:807-814). AAV / Olig001 was subsequently shown to transduce neonatal oligodendrocytes in a mouse model of Canavan disease (Francis et al., 2021. Mol Ther Methods Clin Dev 20:520-534). Other approaches such as random mutagenesis and peptide library insertion can be used to generate capsid libraries that can be screened for tropism and selectivity for oligodendrocytes or astrocytes or glial progenitor cells.
[0130] As mentioned above, the term "adeno-associated virus" and / or "AAV" refers to parvoviruses and variants thereof that have a linear, single-stranded DNA genome. The term encompasses all subtypes and both naturally occurring and recombinant forms, unless otherwise required. Parvoviruses, including AAV, are useful as gene therapy vectors because they can enter cells and introduce nucleic acids (e.g., transgenes) into the nucleus. In some embodiments, the introduced nucleic acid (e.g., rAAV vector genome) forms circular concatemers that persist as episomes in the nucleus of transduced cells. In some embodiments, the transgene is inserted into a specific site of the host cell genome. Site-specific integration is believed to be more likely to result in a predictable long-term expression profile, as opposed to random integration. The insertion site of AAV into the human genome is referred to as AAVS1. Once introduced into a cell, the RNA or polypeptide encoded by the nucleic acid can be expressed by the cell. Because AAV is not associated with any pathogenic disease in humans, nucleic acids delivered by AAV can be used to express therapeutic RNAs or polypeptides for the treatment of diseases, disorders, and / or conditions in human subjects.
[0131] Multiple serotypes of AAV exist in nature, and at least 15 wild-type serotypes have been identified in humans to date (i.e., AAV1-AAV15). Naturally occurring and variant serotypes are distinguished from other AAV serotypes by possessing serologically distinct protein capsids. Examples include AAV1, AAV2, AAV, AAV3 (including AAV3A and AAV3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV12, AAVrhlO, AAVrh74 (see WO2016 / 210170), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, and recombinantly produced variants (e.g., capsid variants having insertions, deletions, substitutions, etc.), such as the variants designated AAV2i8, NP4, NP22, NP66, DJ, DJ / 8, DJ / 9, LK3, RHM4-1, among others. For example, "primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, and "bovine AAV" refers to AAV that infects bovine mammals.
[0132] Serotype uniqueness is determined based on the lack of cross-reactivity between antibodies against one AAV compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequences and antigenic determinants (e.g., due to differences in VP1, VP2, and / or VP3 sequences of AAV serotypes). However, some naturally occurring AAV or artificial AAV variants (e.g., recombinant AAV) may not show serological differences with any of the currently known serotypes. These viruses can then be considered as subgroups of the corresponding type, or more simply, as variant AAV. Thus, as used herein, the term "serotype" refers to both serologically distinct viruses, as well as viruses that are not serologically distinct but may be within a subgroup or variant of a given serotype.
[0133] A comprehensive list and alignment of the amino acid sequences of the capsids of known AAV serotypes is provided by Marsic et al. (2014) Molecular Therapy 22(11):1900-1909. The genomic sequences of various serotypes of AAV, as well as the sequences of the native ITRs, rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Nos. NC_002077 (AAV1), AF063497 (AAV1), NC_001401 (AAV2), AF043303 (AAV2), NC_001729 (AAV3), NC_001863 (AAV3B), NC_001829 (AAV4), U89790 (AAV4), NC_006152 (AAV5), NC_001862 (AAV6), AF513851 (AAV7), AF513852 (AAV8), and NC_006261 (AAV8), the disclosures of which are incorporated herein by reference. For example, Srivistava et al. (1983) J. Virology 45:555, Chiorini et al. (1998) J. Virology 71:6823, Chiorini et al. (1999) J. Virology 73:1309, Bantel-Schaal et al. (1999) J. Virology 73:939, Xiao et al. al. (1999) J. Virology 73:3994, Muramatsu et al. (1996) Virology 221:208, Shade et al. (1986) J. Virol. 58:921, Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99:11854, Morris et al. (2004) Virology 33:375-383, International Patent Publication Nos. 00 / 28061, 99 / 61601, 98 / 11244, 2013 / 063379, 2014 / 194132, 2015 / 121501, and U.S. Patent Nos. 6,156,303 and 7,906,111.
[0134] As mentioned above, "recombinant adeno-associated virus" or "rAAV" is distinguished from wild-type AAV by replacing all or part of the endogenous viral genome with non-native sequences. The incorporation of non-native sequences into the virus defines the viral vector as a "recombinant" vector, and thus an "rAAV vector." The rAAV vector may contain a heterologous polynucleotide encoding a desired RNA or protein or polypeptide (e.g., an RNA molecule disclosed herein). The recombinant vector sequence may be encapsidated or packaged into an AAV capsid and is referred to as a "rAAV vector," "rAAV vector particle," "rAAV viral particle," or simply "rAAV."
[0135] The present disclosure provides rAAV vectors that include polynucleotide sequences that are not of AAV origin (e.g., polynucleotides that are heterologous to AAV). The heterologous polynucleotide may be flanked by at least one, and possibly two, AAV terminal repeat sequences (e.g., inverted terminal repeats). The heterologous polynucleotide flanked by the ITRs, also referred to herein as the "vector genome", typically encodes an RNA or polypeptide of interest, or a gene of interest, e.g., a target for therapeutic treatment. Delivery or administration of the rAAV vector to a subject (e.g., a patient) provides the encoded RNA / protein / peptide to the subject. Thus, the rAAV vector can be used to transcribe / deliver heterologous polynucleotides for expression, e.g., to treat various diseases, disorders, and conditions.
[0136] rAAV vector genomes generally carry 145 bases of ITRs in cis with the heterologous nucleic acid sequences replacing the viral rep and cap genes. Such ITRs are useful for producing recombinant AAV vectors, however modified AAV ITRs and non-AAV terminal repeats containing partially or completely synthetic sequences can also serve this purpose. The ITRs form hairpin structures and function as primers for host cell-mediated synthesis of complementary DNA strands after infection, for example. The ITRs also play a role in viral packaging, integration, etc. The ITRs are the only AAV viral elements required in cis for AAV genome replication and packaging into rAAV vectors. The rAAV vector genomes contain two ITRs, which are typically present at the 5' and 3' ends of the vector genome, which optionally contain heterologous sequences (e.g., transgenes encoding genes of interest, or nucleic acid sequences of interest, including but not limited to antisense and siRNA, and CRISPR molecules, among many others). The 5' and 3' ITRs may both contain the same sequence, or each may contain a different sequence. The AAV ITRs can be derived from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, or any other AAV.
[0137] The rAAV vectors of the present disclosure may comprise ITRs from an AAV serotype (e.g., wild-type AAV2, a fragment or a variant thereof) that is different from the serotype of the capsid (e.g., AAV8, Olig001). Such rAAV vectors that comprise at least one ITR from one serotype but a capsid from a different serotype may be referred to as hybrid viral vectors (see U.S. Patent No. 7,172,893). The AAV ITRs may comprise the entire wild-type ITR sequence or may be a variant, fragment, or modification thereof, but retain functionality.
[0138] In some embodiments, the rAAV vector genome is linear, single-stranded, and flanked by AAV ITRs. Prior to transcription and translation of the heterologous gene, the free 3'-OH of one of the self-priming ITRs must be used by a DNA polymerase (e.g., a DNA polymerase in the transduced cell) to convert the approximately 4700 nucleotide single-stranded DNA genome into a double-stranded form to initiate second strand synthesis. In some embodiments, the full-length single-stranded vector genome (i.e., sense and antisense) anneals to generate a full-length double-stranded vector genome. This can occur when multiple rAAV vectors carrying genomes of opposite polarity (i.e., sense or antisense) transduce the same cell at the same time. Regardless of how they are produced, once the double-stranded vector genome is formed, the cell can transcribe and translate the double-stranded DNA and express the heterologous gene.
[0139] The efficiency of transgene expression from rAAV vectors can be hindered by the need to convert single-stranded rAAV genomes (ssAAV) to double-stranded DNA prior to expression. This step can be avoided by using self-complementary AAV genomes (scAAV) that can package inverted repeat genomes that can fold into double-stranded DNA without the need for DNA synthesis or base pairing between multiple vector genomes. See, for example, U.S. Patent No. 8,784,799; McCarty, (2008) Molec. Therapy 16(10):1648-1656, and McCarty et al., (2001) Gene Therapy 8:1248-1254, McCarty et al., (2003) Gene Therapy 10:2112-2118).
[0140] The viral capsid of the rAAV vector may be a wild-type AAV or a mutant AAV, such as AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAVrh74 (see WO2016 / 210170), AAV12, AAV2i8, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9.45, RHM4-1 (WO2015 / 013313), RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, RHM15-6, AAV The AAV vector may be from hu.26, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9,45, AAV2i8, AAV29G, AAV2,8G9, AVV-LK03, AAV2-TT, AAV2-TT-S312N, AAV3B-S312N, AAV avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, snake AAV, caprine AAV, shrimp AAV, ovine AAV, and variants thereof (see, e.g., Fields et al., VIROLOGY, volume 2, chapter 69(4 th ed., Lippincott-Raven Publishers). The capsid may be derived from several AAV serotypes as disclosed in U.S. Pat. No. 7,906,111, Gao et al. (2004) J. Virol. 78:6381, Morris et al. (2004) Virol. 33:375, WO2013 / 063379, WO2014 / 194132, and may include the true AAV (AAV-TT) mutant as disclosed in WO2015 / 121501, and RHM4-1, RHM15-1 through RHM15-6, and mutants thereof as disclosed in WO2015 / 013313. The full complement of AAV cap proteins includes VP1, VP2, and VP3. An ORF comprising a nucleotide sequence encoding an AAV VP capsid protein may contain less than the full complement AAV Cap protein, or the full complement of AAV cap proteins may be provided.
[0141] In some embodiments, an rAAV vector that comprises capsid proteins encoded by nucleotide sequences from two or more AAV serotypes (e.g., wildtype AAV serotypes, mutant AAV serotypes) is referred to as a "chimeric vector" or "chimeric capsid" (see U.S. Pat. No. 6,491,907, the disclosure of which is incorporated herein by reference in its entirety). In some embodiments, the chimeric capsid protein is encoded by nucleic acid sequences from 2, 3, 4, 5, 6, 7, 8, 9, 10 or more AAV serotypes. In some embodiments, the recombinant AAV vector comprises a capsid sequence derived from, for example, AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh74, AAVrh10, AAV2i8, or variants thereof, resulting in a chimeric capsid protein comprising a combination of amino acids from any of the aforementioned AAV serotypes (see Rabinowitz et al. (2002) J. Virology 76(2):791-801). Alternatively, the chimeric capsid may comprise a VP1 from one serotype, a VP2 from a different serotype, a VP3 from yet a different serotype, and a mixture of combinations thereof. For example, the chimeric viral capsid may comprise an AAV1 cap protein or subunit and at least one AAV2 cap protein or subunit. The chimeric capsid can include, for example, an AAV capsid having one or more B19 cap subunits, e.g., an AAV cap protein or subunit can be replaced by a B19 cap protein or subunit. For example, in one embodiment, the VP3 subunit of the AAV capsid can be replaced by the VP2 subunit of B19. In some embodiments, the chimeric capsid is an Olig001 capsid described in WO2021 / 221995 and WO2014 / 052789, which are incorporated herein by reference.
[0142] In some embodiments, the chimeric vector is engineered to exhibit altered tropism or tropism for a particular tissue or cell type. The term "tropism" refers to preferential entry of the virus into a particular cell (e.g., oligodendrocyte) or tissue type, and / or preferential interaction with the cell surface that facilitates entry into a particular cell or tissue type. AAV tropism is generally determined by specific interactions between different viral capsid proteins and their cognate cellular receptors (Lykken et al. (2018) J. Neurodev. Disord. 10:16). Preferably, once the virus or viral vector enters the cell, sequences (e.g., heterologous sequences such as transgenes) carried by the vector genome (e.g., rAAV vector genome) are expressed.
[0143] "Tropical profile" refers to a pattern of transduction of one or more target cells in various tissues and / or organs. For example, a chimeric AAV capsid may have a tropism profile characterized by efficient transduction of oligodendrocytes, astrocytes, or oligodendrocyte precursor cells with only low transduction of neurons and other CNS cells. See WO2014 / 052789, incorporated herein by reference. Such chimeric capsids may be considered specific for oligodendrocytes or astrocytes or glial precursor cells, exhibiting tropism for oligodendrocytes or astrocytes or glial precursor cells, referred to herein as "glialtropism," and preferentially transduce oligodendrocytes or astrocytes or oligodendrocyte precursor cells over neurons and other CNS cell types when administered directly to the CNS. In some embodiments, at least about 80% of the cells transduced with the oligodendrocyte or oligodendrocyte precursor cell specific capsid are oligodendrocytes or oligodendrocyte precursor cells, e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the transduced cells are oligodendrocytes or oligodendrocyte precursor cells.
[0144] Cell Replacement Therapy One aspect of the present application relates to a method for reducing the adverse effects of age-related oligodendrocyte loss, astrocyte loss, or white matter loss in the CNS (e.g., brain) of an adult subject. The method includes identifying a subject, e.g., an adult subject, that suffers from the adverse effects of age-related oligodendrocyte loss, astrocyte loss, or white matter loss in the CNS (e.g., brain) and providing a population of isolated glial progenitor cells. The isolated population of glial progenitor cells is then introduced into the CNS (such as the brain and / or brainstem) of the selected subject to at least partially replace cells in the subject's brain in locations that suffer from the adverse effects of age-related white matter loss.
[0145] As used herein, the term "glial cells" refers to a population of non-neuronal cells that provide support and nutrition, maintain homeostasis, and either form myelin or promote myelination, and participate in signal transduction in the nervous system. As used herein, "glial cells" encompass fully differentiated cells of the glial lineage, e.g., oligodendrocytes or astrocytes, as well as glial precursor cells. Glial precursor cells are cells that have the potential to differentiate into cells of the glial lineage, such as oligodendrocytes and astrocytes.
[0146] The glial progenitor cells described herein may be derived from any suitable source of pluripotent stem cells, such as, but not limited to, human induced pluripotent stem cells (iPSCs) and embryonic stem cells, as described in more detail below. In one example, the glial progenitor cells may be rejuvenated cells from the glial progenitor cells described herein or their progeny.
[0147] In some embodiments, to effect treatment in a subject in need thereof, the glial progenitor cells or rejuvenated cells are young glial or glial progenitor cells or are younger than their counterparts in the subject to be treated.
[0148] As used herein, the term "young" glial or glial progenitor cells refers to cells that are induced to begin differentiation into glial progenitor cells in an in vitro environment (approximately 105 days from cell isolation from fetal donor tissue). In some embodiments, the term "young glial cells" refers to differentiated glial progenitor cells that are ready for transplantation into an animal (approximately 160 days from cell isolation from fetal donor tissue). In some embodiments, the term "young glial cells" refers to glial progenitor cells or their progeny within 1-20 weeks of transplantation. The term "older glial cells" is used in comparison to "young glial cells". In comparison to older glial cells, young glial cells may have one or more of the following characteristics: (i) they grow or proliferate or divide faster, (ii) they have lower than older ones' levels of old age-associated transcripts encoding CDKN1A (p21Cip1) and CDKN2 / p16 (INK4) and p14 (ARF), and (iii) they have longer telomeres or higher telomerase activity or both.
[0149] In some embodiments, the older glial cells are glial cells derived from glial progenitor cells transplanted into the host for 5, 10, 20, 30, or 40 weeks. In some embodiments, the older glial cells are glial cells cultured from differentiated glial progenitor cells for an additional 5, 10, 20, 30, or 40 weeks (e.g., about 160 days from initial tissue harvest). In some embodiments, the older glial cells are glial cells cultured from induction of differentiation for an additional 5, 10, 20, 30, or 40 weeks (e.g., about 105 days from initial tissue harvest).
[0150] iPSCs are pluripotent cells derived from non-pluripotent cells, such as somatic cells. For example, but not limited to, iPSCs can be derived from tissues, peripheral blood, umbilical cord blood, and bone marrow (see, e.g., Cai et al., J. Biol. Chem. 285(15):112227-11234(2110); Giorgetti et al., Nat. Protocol. 5(4):811-820(2010); Streckfuss-Bomeke et al., Eur. Heart J. doi:10.1093 / eurheartj / ehs203(July 12, 2012); Hu et al., Blood doi:10.1182 / blood-2010-07-298331(Feb. 4, 2011); Sommer et al., J. Vis. Exp. 68:e4327 doi:10.3791 / 4327 (2012), which are incorporated herein by reference in their entirety). Somatic cells can be reprogrammed to an embryonic stem cell-like state using genetic manipulation. Exemplary somatic cells suitable for forming iPSCs include fibroblasts (see, e.g., Streckfuss-Bomeke et al., Eur. Heart J. doi:10.1093 / eurheartj / ehs203 (2012), which are incorporated herein by reference in their entirety), such as dermal fibroblasts obtained by skin samples or biopsies, synoviocytes from synovial tissue, keratinocytes, mature B cells, mature T cells, pancreatic beta cells, melanocytes, hepatocytes, foreskin cells, cheek cells, or lung fibroblasts.
[0151] Methods for producing induced pluripotent stem cells are known in the art and typically involve expressing a combination of reprogramming factors in somatic cells. Suitable reprogramming factors that promote and induce the generation of iPSCs include one or more of Oct4, Klf4, Sox2, c-Myc, Nanog, C / EBPα, Esrrb, Lin28, and Nr5a2. In certain embodiments, at least two reprogramming factors are expressed in somatic cells to reprogram somatic cells normally. In other embodiments, at least three reprogramming factors are expressed in somatic cells to reprogram somatic cells normally.
[0152] iPSCs can be derived by methods known in the art, including using integrative viral vectors (e.g., lentiviral vectors, inducible lentiviral vectors, and retroviral vectors), excisable vectors (e.g., transposon and floxed lentiviral vectors), and non-integrative vectors (e.g., adenoviral and plasmid vectors) that deliver genes that promote cell reprogramming (e.g., Takahashi and Yamanaka, Cell 126:663-676 (2006); Okita. et al., Nature 448:313-317 (2007); Nakagawa et al., Nat. Biotechnol. 26:101-106 (2007); Takahashi et al. Cell 131:1-12 (2007); Meissner et al. Nat. Biotech. 25:1177-1181 (2007); Yu et al. Science 318:1917-1920 (2007), Park et al. Nature 451:141-146 (2008), and U.S. Patent Application Publication No. 2008 / 0233610, which are incorporated by reference in their entireties.Other methods for generating iPS cells include those described in WO2007 / 069666, WO2009 / 006930, WO2009 / 006997, WO2009 / 007852, WO2008 / 118820, U.S. Patent Application Publication Nos. 2011 / 0200568 to Ikeda et al., 2010 / 0156778 to Egusa et al., 2012 / 0276070 to Musick, and 2012 / 0276636 to Nakagawa, Shi et al., Cell Stem Cell 3(5):568-574 (2008), Kim et al., Nature 454:646-650 (2008), Kim ... Cell Stem Cell 3(5):568-574 (2008), Kim et al., Cell Stem Cell 3(5):568-574 (2008), Kim et al., Cell Ste 136(3):411-419(2009), Huangfu et al., Nat. Biotechnol. 26:1269-1275(2008), Zhao et al., Cell Stem Cell 3:475-479(2008), Feng et al., Nat. Cell Biol. 11:197-203(2009), and Hanna et al. Cell 133(2):250-264(2008), which are incorporated by reference in their entireties.
[0153] The above-mentioned method of iPSC generation can be modified to include small molecules that enhance reprogramming efficiency or even replace reprogramming factors. These small molecules include, but are not limited to, epigenetic modulators such as DNA methyltransferase inhibitor 5'-azacytidine, histone deacetylase inhibitor VPA, and G9a histone methyltransferase inhibitor BIX-01294 together with BayK8644, and L-type calcium channel agonists. Other small molecule reprogramming factors include those that target signal transduction pathways, such as TGF-β inhibitors and kinase inhibitors (e.g., Kenpaullone) (see review by Sommer and Mostoslavsky, Stem Cell Res.Ther.1:26 doi:10.1186 / scrt26 (August 10, 2010), which is incorporated herein by reference in its entirety).
[0154] For methods of obtaining highly enriched preparations of glial progenitor cells from iPSCs suitable for generating the non-human mammalian models described herein, see WO2014 / 124087 to Goldman and Wang, and Wang et al., Cell Stem Cell 12(2):252-264 (2013), which are incorporated by reference in their entireties.
[0155] In another embodiment of the present application, the glial precursor cells are derived from embryonic stem cells. Embryonic stem cells are derived from totipotent cells of early mammalian embryos and are capable of unlimited undifferentiated proliferation in vitro. As used herein, the term "embryonic stem cells" refers to cells isolated from an embryo, placenta, or umbilical cord, or immortalized versions of such cells, i.e., embryonic stem cell lines. Suitable embryonic stem cell lines include, but are not limited to, lines WA-01 (H1), WA-07, WA-09 (H9), WA-13, and WA-14 (H14) (see Thomson et al., Science 282(5391):1145-47 (1998) and U.S. Patent No. 7,029,913 to Thomson et al., which are incorporated herein by reference in their entireties). Other suitable embryonic stem cell lines include the HAD-C100 cell line (Tannenbaum et al., PLoS One 7(6):e35325 (2012), which is incorporated by reference in its entirety), the WIBR4, WIBR5, WIBR6 cell lines (Lengner et al., Cell 141(5):872-83 (2010), which is incorporated by reference in its entirety), and the human embryonic stem cell lines (HUES) lines 1-17 (see Cowan et al., N. Engl. J. Med. 350:1353-56 (2004), which is incorporated by reference in its entirety).
[0156] Human embryonic stem cells provide a virtually unlimited source of cloned / genetically modified cells potentially useful for tissue replacement therapy. Methods for obtaining highly enriched preparations of glial progenitor cells from embryonic cells suitable for generating the non-human mammalian models of the present disclosure are described herein as disclosed in Wang et al., Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety.
[0157] Briefly, glial progenitor cells are derived from a pluripotent cell population, i.e., iPSCs or embryonic stem cells, using a protocol that directs the pluripotent cells through successive stages of neural and glial progenitor differentiation. Each stage of lineage restriction is characterized and identified by the expression of certain cellular proteins. Stage 1 of this process involves culturing the pluripotent cell population under conditions effective to induce embryoid body formation. As described herein, the pluripotent cell population can be maintained in co-culture with other cells, such as embryonic fibroblasts, in embryonic stem cell (ESC) medium (e.g., DMEM / F12 containing a suitable serum replacement and bFGF). The pluripotent cells are passaged before reaching 100% confluence, e.g., 80% confluence, when colonies are approximately 250-300 μm in diameter. The pluripotent state of the cells is easily assessed using markers for SSEA4, TRA-1-60, OCT-4, NANOG, and / or SOX2.
[0158] To generate embryoid bodies (EBs), which are complex three-dimensional cellular aggregates of pluripotent stem cells (step 2), pluripotent cell cultures are dissociated once they achieve approximately 80% confluence with colony diameters of 250-300 μm, or approximately 250-300 μm. EBs are first cultured in suspension in ESC medium without bFGF, then switched to neural induction medium supplemented with bFGF and heparin. To induce neuroepithelial differentiation (step 3), EBs are plated and cultured in neural induction medium supplemented with bFGF, heparin, laminin, then switched to neural induction medium supplemented with retinoic acid. Neuroepithelial differentiation is assessed by co-expression of PAX6 and SOX1, which characterize central neural stem and progenitor cells.
[0159] To induce differentiation of pre-oligodendrocyte precursor cells ("pre-OPC"), neuroepithelial cell colonies can be cultured in the presence of additional factors including retinoic acid, B27 supplement, and sonic hedgehog (shh) agonists (e.g., palmofamine). The emergence of pre-OPC colonies is assessed by the presence of OLIG2 and / or NKX2.2 expression. Although both OLIG2 and NKX2.2 are expressed by central oligodendrocyte precursor cells, NKX2.2 is a more specific indicator of oligodendrocyte differentiation. Thus, the early pre-oligodendrocyte precursor cell stage is characterized by the presence of OLIG2 and / or NKX2.2 expression. + / NKX2.2 - Characterized by cell colonies. + / NKX2.2 - Early pre-OPCs are transformed into later OLIGs by replacing retinoic acid with bFGF. + / NKX2.2 + At the end of stage 5, a significant proportion of cells express OLIG2 + / NKX2.2 + As shown by the expression profile, they are pre-OPCs.
[0160] Pre-OPCs can be further differentiated into bipotential glial progenitor cells by culturing in glial induction medium supplemented with growth factors such as triiodothyronine (T3), neurotrophin 3 (NT3), insulin growth factor (IGF-1), and platelet-derived growth factor-AA (PDGF-AA) (stage 6). These culture conditions can be extended for 3-4 months or more, if desired, to maximize the production of myelinogenic glial progenitor cells. Cell preparations suitable for transplantation into appropriate subjects express PDGFRα + It is identified as containing glial precursor cells.
[0161] The population of glial progenitor cells used in practicing the methods of the present application may comprise at least about 80% glial progenitor cells, including, for example, about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% glial cells. The selected preparation of glial progenitor cells may be relatively devoid of other cell types, such as neurons and neuronal progenitor cells (e.g., containing less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1%). Optionally, the cell population may be a substantially pure population of glial progenitor cells.
[0162] The subject treated according to the method of the present application may be an adult suffering from age-related white matter / oligodendrocyte / astrocyte loss in the brain. The method reduces the deleterious effects of this condition that may occur as part of the normal aging process.
[0163] As used herein, "treating" or "treatment" refers to any indicator of success in ameliorating an injury, pathology, or condition, including any objective or subjective parameter, such as relief; remission; a decrease in symptoms or making the injury, pathology, or condition more tolerable to the patient; a slowing or reduction in the rate of degeneration; making the end point of degeneration less debilitating; or improving the physical or mental health of the subject. Treatment or amelioration of symptoms may be based on objective or subjective parameters, including the results of a physical exam, a neurological exam, and / or a psychiatric evaluation.
[0164] "Treating" may include administration of glial progenitor cells and / or other agent(s) to prevent or delay, reduce, or arrest or inhibit the onset of symptoms or conditions associated with a disease, condition, or disorder. A "therapeutic effect" refers to the reduction, elimination, or prevention of a disease, a symptom of a disease, or a side effect of a disease, condition, or disorder in a subject. Treatment may be prophylactic (to prevent or delay the onset or worsening of a disease, condition, or disorder, or to prevent the manifestation of clinical or subclinical symptoms thereof), or therapeutic suppression or reduction of symptoms after manifestation of a disease, condition, or disorder.
[0165] As used herein, the term "white matter" relates to components of the central nervous system in the brain and superficial spinal cord, which are composed largely of glial cells and myelinated axons that transmit signals from one area of the cerebrum to another, and between the cerebrum and lower brain centers.
[0166] One condition resulting from age-related white matter loss, oligodendrocyte loss, or astrocyte loss in the brain that can be treated by the methods of the present application is subcortical dementia.
[0167] Colloid progenitor cells can be introduced into a subject in need of relief from adverse effects by a variety of known techniques, including but not limited to injection, deposition, and grafting, as described herein.
[0168] In one embodiment, the cells may be bilaterally grafted into multiple sites in a subject as described in U.S. Patent No. 7,524,491 to Goldman, Windrem et al., Cell Stem Cell 2:553-565 (2008), Han et al., Cell Stem Cell 12:342-353 (2013), and Wang et al., Cell Stem Cell 12:252-264 (2013), which are incorporated by reference in their entireties. Methods for grafting neural tissue and cells into a host brain are described by Bjorklund and Stenevi (eds), Neural Grafting in the Mammalian CNS, Ch. 3-8, Elsevier, Amsterdam (1985), U.S. Patent No. 5,082,670 to Gage et al., and U.S. Patent No. 6,497,872 to Weiss et al., which are incorporated by reference in their entireties. Typical procedures include intraparenchymal, intracallosal, intraventricular, intrathecal, and intravenous implantation.
[0169] Intraparenchymal transplantation can be achieved by injection or deposition of tissue in the host brain so that it opposes the brain parenchyma at the time of transplantation. The two main procedures of intraparenchymal transplantation are as follows: (1) injecting donor cells into the host brain parenchyma, or (2) preparing a cavity by surgical means to expose the host brain parenchyma, and then depositing the graft into the cavity (Bjorklund and Stenevi (eds), Neural Grafting in the Mammalian CNS, Ch. 3, Elsevier, Amsterdam (1985), incorporated herein by reference in its entirety). Both methods provide substantial attachment between donor cells and host brain tissue at the time of transplantation, and both promote anatomical integration between the graft and the host brain tissue. This is important if donor cells are required to become an integral part of the host brain and survive for the host's lifetime.
[0170] Glial progenitor cells can also be delivered into the corpus callosum, as described in US Patent Application Publication No. 2003 / 0223972 to Goldman, which is incorporated herein by reference in its entirety.Glial progenitor cells can also be delivered directly to the forebrain subcortex, specifically to the anterior and posterior anlage of the corpus callosum.Glial progenitor cells can also be delivered to the cerebellar peduncle white matter to gain access to the main cerebellum and brainstem.Glial progenitor cells can also be delivered to the spinal cord.
[0171] Alternatively, the cells may be placed in a ventricle, such as the cerebral ventricle. Grafting cells within the ventricle may be accomplished by injecting donor cells or by growing the cells in a matrix such as 30% collagen to form a plug of solid tissue that may later be implanted within the ventricle to prevent dislocation of the grafted cells. In the case of subdural grafts, the cells may be injected around the surface of the brain after making a slit in the dura.
[0172] Suitable techniques for cell delivery are described above. In one embodiment, the preparation of glial progenitor cells is administered to the striatum, forebrain, brainstem, and / or cerebellum of a subject.
[0173] Delivery of cells to a subject may involve either a single step or multiple step injections directly into the nervous system. For focal disorders such as demyelination of the optic nerve, a single injection can be used. Adult and fetal oligodendrocyte precursor cells are widely distributed in the brain of the transplant recipient, but for widespread disorders, multiple injection sites can be performed to optimize treatment. Injections are optionally directed to regions of the central nervous system, such as white matter tracts such as the corpus callosum (e.g., anterior and posterior anlage), dorsal columns, cerebellar peduncle, cerebral peduncle, etc. Such injections can be performed unilaterally or bilaterally, using precise localization methods such as stereotaxic surgery, optionally with accompanying imaging methods (e.g., high resolution MRI imaging). Those skilled in the art will recognize that brain regions vary by species, however, those skilled in the art will also recognize equivalent brain regions across mammalian species.
[0174] The cell transplant can be optionally injected as dissociated cells, but can also be provided by local placement of non-dissociated cells. In either case, the cell transplant optionally includes an acceptable solution. Such acceptable solutions include solutions that avoid undesirable biological activity and contamination. Suitable solutions include an appropriate amount of pharma- ceutically acceptable salts to make the formulation isotonic. Examples of pharma- ceutically acceptable solutions include, but are not limited to, saline, Ringer's solution, dextrose solution, and culture medium. The pH of the solution is preferably about 5 to about 8, more preferably about 7 to about 7.5.
[0175] The injection of the dissociated cell transplant can be a streaming injection across the inlet, outlet, or both inlet and outlet pathways of an injection device (e.g., a cannula, needle, or tube). Automation can be used to provide uniform inlet and outlet rates as well as injection rates and volumes.
[0176] The number of glial progenitor cells administered to a subject may range from approximately 10 to approximately 10 cells per administration (e.g., injection site), depending on the size and species of the recipient and the volume of tissue requiring cell replacement. 2 ~10 8 Single administration (e.g., injection) doses can range from 10 to 20 mg / kg for transplant recipient patients. 3 ~10 5 , 10 4 ~10 7 , and 10 5 ~10 8 The amount of each cell may range from 1 to 2,000 cells, or any amount in total.
[0177] Since the CNS is an immunologically privileged site, the administered cells, including xenogeneic ones, can survive, and optionally, immunosuppressants or typical regimens of immunosuppressants are not used in the treatment method. However, optionally, immunosuppressants may also be administered to the subject. Immunosuppressants and their administration regimens are known to those skilled in the art and include drugs such as azathioprine, azathioprine sodium, cyclosporine, daltroban, gusperimus trihydrochloride, sirolimus, and tacrolimus. The dose range and duration of the regimen may vary depending on the disorder being treated, the degree of rejection, the activity of the specific immunosuppressant used, the age, weight, general health, sex, and diet of the subject, the time of administration, the route of administration, the excretion rate of the specific immunosuppressant used, the duration and frequency of treatment, and the concomitant drugs. Those skilled in the art can determine the acceptable dose and duration for immunosuppression. The administration regimen can be adjusted by the individual physician in the event of contraindications or changes in the subject's condition.
[0178] In one embodiment, one or more immunosuppressants can be administered to the subject starting 10 weeks prior to administration of the cells. In one embodiment, one or more immunosuppressants are administered to the subject starting 9 weeks, 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, 1 week, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 1 day, or less than 24 hours prior to administration of the cells. In one embodiment, one or more immunosuppressants are administered to the subject starting on the day of administration of the cells and continuing for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months after administration. In one embodiment, one or more immunosuppressants are administered to the subject for more than one year after administration.
[0179] Suitable subjects for treatment with the methods described herein include any mammalian subject suffering from age-related white matter loss. Exemplary mammalian subjects include humans, mice, rats, guinea pigs and other small rodents, dogs, cats, sheep, goats, and monkeys. In one embodiment, the subject is a human.
[0180] The suppressor / rejuvenation therapy can be combined with cell therapy. For example, the inhibitory molecules, CRISPR / Cas systems, expression cassettes, or expression vectors described above can be used as therapeutic reagents in ex vivo applications. For that purpose, the reagents can be introduced into tissues or cells that are transplanted into a subject for therapeutic effect. The cells and / or tissues can be derived from the organism or subject that subsequently receives the explant (e.g., syngeneic or autologous), or from another organism or subject (e.g., relative, sibling, or HLA-matched donor) before transplantation (e.g., heterologous, xenogenic, allogeneic, or allogeneic). The reagents can be used to regulate the expression of one or more genes in the cells or tissues so that the cells or tissues can obtain a desired phenotype or function when transplanted in vivo. In one embodiment, certain target cells from the patient are extracted or isolated. These isolated cells are contacted with a reagent that targets a specific nucleotide sequence within the cells under conditions suitable for uptake of the reagent by the cells (e.g., using a delivery reagent such as a cationic lipid, liposome, or using a technique such as electroporation to facilitate delivery of the reagent to the cells), and the cells are then reintroduced into the same or another patient.
[0181] For therapeutic use, a pharma- tically effective dose of the therapeutic reagent or pharmaceutical composition can be administered to a subject. A pharma- tically effective dose is that dose necessary to prevent, inhibit, or treat (alleviate some symptoms, preferably all symptoms) the onset of a disease state. One of skill in the art can readily determine the therapeutically effective dose of the reagent to be administered to a given subject by considering factors such as the size and weight of the subject, the extent of disease progression or penetration, the age, health, and sex of the subject, the route of administration, and whether administration is local or systemic. In general, an amount of 0.1 mg / kg to 100 mg / kg body weight / day of the active ingredient is administered depending on the potency of the negatively charged polymer. The therapeutic reagent or pharmaceutical composition can be administered in a single dose or multiple doses.
[0182] Pharmaceutical Compositions The present disclosure provides pharmaceutical compositions or medicaments for preventing or treating genetic or acquired disorders of myelin. In some embodiments, the pharmaceutical compositions include one or more of the above protein molecules, polynucleotides, expression cassettes, expression vectors (e.g., viral vector genomes, expression vectors, rAAV vectors), systems (e.g., CRISPR / Cas systems, or nucleic acid(s) encoding components of the systems), and host cells.
[0183] The pharmaceutical composition further comprises a pharma- ceutically acceptable carrier, adjuvant, diluent, excipient, and / or other pharmaceutical agent. A pharma- ceutically acceptable carrier, adjuvant, diluent, excipient, or other agent is not biologically or otherwise undesirable, e.g., the material can be administered to a subject without causing undesirable biological effects that outweigh the beneficial biological effects of the material. Any suitable pharma- cetically acceptable carrier or excipient can be used in the preparation of a pharmaceutical composition according to the present invention (see, e.g., Remington The Science and Practice of Pharmacy, Adeboye Adejare (Editor) Academic Press, November 2020).
[0184] Pharmaceutical compositions are typically sterile, pyrogen-free, and stable under the conditions of manufacture and storage. Pharmaceutical compositions may be formulated as a solution (e.g., water, saline, dextrose solution, buffer solution, or other pharma- ceutical sterile fluid), microemulsion, liposome, or other ordered structure suitable for high product (e.g., viral vector particles, microparticles, or nanoparticles) concentration.
[0185] In some embodiments, pharmaceutical compositions comprising the above-mentioned proteins, polynucleotides, expression cassettes, expression vectors, vector genomes, or rAAV vectors of the present disclosure are formulated in water or buffered saline. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. In some embodiments, it may be preferable to include isotonicity agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged adsorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin. In some embodiments, the nucleic acids, vectors, and / or host cells of the present disclosure may be administered in a controlled release formulation, for example, in a composition comprising a slow release polymer or other carrier that protects the product against rapid release, including implants and microencapsulated delivery systems.
[0186] In some embodiments, the pharmaceutical compositions of the present disclosure are parenteral pharmaceutical compositions, including compositions suitable for intravenous, intraarterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intraarticular, intraparenchymal (IP), intrathecal (IT), intracerebroventricular (ICV) and / or intracisternal (ICM) administration. In some embodiments, the pharmaceutical compositions of the present disclosure are formulated for administration by ICV injection. In some embodiments, the vector (e.g., a viral vector such as AAV) may be formulated in 350 mM NaCl and 5% D-sorbitol in PBS.
[0187] Method of administration The above molecules, or polynucleotides, or vectors (e.g., vector genomes, rAAV vectors), or systems (e.g., CRISPR / Cas systems, or nucleic acid(s) encoding components of the systems), or cells may be administered to a subject (e.g., a patient) or target cells to treat the subject. Administration of the vector to a human subject or animal in need of treatment can be by any means known in the art for administering vectors. Examples of target cells include cells of the CNS, preferably oligodendrocytes, astrocytes, or their precursor cells.
[0188] The vectors can be administered in addition to and as an adjunct to standard care treatments. That is, the vectors can be co-administered with another agent, compound, drug, treatment or treatment regimen at the same time, contemporaneously, or at a predetermined dosage interval, as determined by one of skill in the art using routine methods. The uses disclosed herein include administration of the rAAV vectors of the present disclosure in addition to and / or in accordance with a dosing schedule in addition to and / or in conjunction with standard care for a disease known in the art.
[0189] In some embodiments, the combination composition comprises one or more immunosuppressants. In some embodiments, the combination composition comprises a rAAV vector comprising a transgene (e.g., a polynucleotide encoding an RNA molecule disclosed herein) and one or more immunosuppressants. In some embodiments, the method comprises administering or delivering a rAAV vector comprising a transgene to a subject, and administering an immunosuppressant to the subject prophylactically prior to administration of the vector or after administration of the vector (i.e., before or after the vector and / or protein are provided and thereby symptoms of a response thereto become evident).
[0190] In one embodiment, the vectors (e.g., rAAV vectors) of the present disclosure are administered systemically. Exemplary methods of systemic administration include, but are not limited to, intravenous (e.g., portal vein), intraarterial (e.g., femoral artery, hepatic artery), intravascular, subcutaneous, intradermal, intraperitoneal, transmucosal, intrapulmonary, intralymphatic, and intramuscular administration, etc., as well as direct tissue or organ injection. Those skilled in the art will appreciate that systemic administration can deliver nucleic acids to all tissues. In some embodiments, direct tissue or organ administration includes administration to areas directly affected by oligodendrocyte deficiency (e.g., the brain and / or central nervous system). In some embodiments, the vectors and pharmaceutical compositions of the present disclosure are administered to the brain parenchyma (i.e., by intraparenchymal administration), to the spinal canal or subarachnoid space to reach the cerebrospinal fluid (CSF) (i.e., by intrathecal administration), to the ventricles of the brain (i.e., by intraventricular administration), and / or to the cisterna magna of the brain (i.e., by intracisternal administration).
[0191] Thus, in some embodiments, vectors of the present disclosure are administered by direct injection into the brain (e.g., into the parenchyma, ventricle, cisterna magna, etc.) and / or into the CSF (e.g., into the spinal canal or subarachnoid space) to treat myelin disorders. Target cells of vectors of the present disclosure include cells located in the cortex, subcortical white matter of the corpus callosum, striatum, and / or cerebellum. In some embodiments, target cells of vectors of the present disclosure are oligodendrocytes or their precursor cells. Additional routes of administration may also include local application of vectors under direct visualization, e.g., superficial cortical application, or other stereotaxic application.
[0192] In some embodiments, the vector of the present disclosure is administered by at least two routes. For example, the vector is administered systemically and also directly to the brain. When administered via at least two routes, the administration of the vector can be, but need not be, simultaneous or contemporaneous. Instead, administration via different routes can be performed separately with a time interval between each administration.
[0193] The above-mentioned proteins, or polynucleotides encoding the proteins, or vector genomes, or vectors comprising the polynucleotides (e.g., rAAV vectors) can be used for ex vivo transduction of cells or for direct administration to a subject (e.g., direct administration to the CNS of a patient with a disease). In some embodiments, the transduced cells (e.g., host cells) are administered to a subject to treat or prevent a disease, disorder, or condition (e.g., cell therapy for a disease). For example, rAAV vectors comprising therapeutic nucleic acids (e.g., encoding proteins) can be administered in a biologically effective amount, preferably to oligodendrocytes, astrocytes, or their precursor cells.
[0194] Dosage of the rAAV vector depends, for example, on the mode of administration, the disease or condition being treated, the stage and / or aggressiveness of the disease, the condition of the individual subject (age, sex, weight, etc.), the particular viral vector, the stability of the expressed protein, the host immune response to the vector, and / or the gene being delivered. Generally, the dose is at least 1×10 per kg of subject body weight to achieve a therapeutic effect. 8 or more, e.g., 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 15 or more in the range of vector genomes (vg).
[0195] In some embodiments, a polynucleotide encoding a protein described herein may be administered as a component of a DNA molecule (e.g., a recombinant nucleic acid) having appropriate regulatory elements (e.g., a promoter) for expression in a target cell (e.g., an oligodendrocyte, astrocyte, or a precursor cell thereof). The polynucleotide may be administered as a component of a plasmid or viral vector, e.g., an rAAV vector. The rAAV vector may be administered in vivo by delivering the vector directly (e.g., directly to the CNS) to a patient in need of treatment. The rAAV vector may also be administered ex vivo to a patient by in vitro administration of the vector to cells from a donor patient in need of treatment, followed by reintroduction of the transduced cells into the donor (e.g., cell therapy).
[0196] kit The present disclosure provides a kit that includes packaging material and one or more components described therein. The kit typically includes a label or package insert that includes a description of the components or an in vitro, in vivo, or ex vivo use of the components therein. The kit may include a collection of such components, such as the above-mentioned polynucleotides, nucleic acids, expression cassettes, expression vectors (e.g., viral vector genomes, expression vectors, rAAV vectors), and host cells, and optionally a second active agent, such as a compound, therapeutic agent, drug, or composition.
[0197] A kit refers to a physical structure that contains one or more components of the kit. The packaging material can maintain the components sterile and can be made of materials commonly used for such purposes (e.g., paper, glass, plastic, foil, ampoules, vials, tubes, etc.).
[0198] The label or insert may include the identity of one or more components therein, the dose, the mechanism of action, the clinical pharmacology of the active ingredient(s), including pharmacokinetics and pharmacodynamics. The label or insert may include information identifying manufacture, lot number, place and date of manufacture, expiration date. The label or insert may include information regarding the disease for which the kit components may be used (e.g., inherited or acquired or age-related disorders of myelin, such as HD). The label or insert may include instructions for the clinician or subject for using one or more of the kit components in a method, use, or treatment protocol or regimen. The instructions may include dosage, frequency of duration, and instructions for practicing any of the methods, uses, treatment protocols, or prophylactic or therapeutic regimens described herein.
[0199] The label or package insert may include information regarding potential side effects, complications or reactions, for example, warnings to the subject or clinician regarding situations in which it is not appropriate to use a particular composition.
[0200] definition Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which this invention belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention. When used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well unless the context clearly dictates otherwise. The following terms have the following meanings:
[0201] As used herein, the term "about" or "approximately" refers to a measurable value, such as the amount of biological activity, homology or length of a polynucleotide or polypeptide sequence, dosage, time, temperature, and is intended to encompass a variation of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or even 0.1% in either direction of the specified amount (greater or less than), unless otherwise specified, apparent from the context, or unless such number exceeds 100% of the possible value.
[0202] The term "transgene" refers to a heterologous polynucleotide that can be introduced into a cell, transcribed into RNA, and optionally translated and / or expressed under appropriate conditions. In an embodiment, it confers a desired property to the cell into which it is introduced, or otherwise produces a desired therapeutic or diagnostic result. In another embodiment, it can be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.
[0203] As used herein, the term "homologous" or "homology" refers to two or more reference entities (e.g., nucleic acid or polypeptide sequences) that share at least partial identity over a given region or portion. For example, if an amino acid position in two peptides is occupied by the same amino acid, the peptides are homologous at that position. In particular, a homologous peptide retains an activity or function associated with the unmodified or reference peptide, and a modified peptide generally has an amino acid sequence that is "substantially homologous" to the amino acid sequence of the unmodified sequence. When referring to a polypeptide, nucleic acid, or fragment thereof, "substantial homology" or "substantial similarity" means that there is sequence identity in at least about 70%-99% of the sequence when optimally aligned with another polypeptide, nucleic acid (or its complementary strand) or fragment thereof, with appropriate insertions or deletions. The degree of homology (identity) between two sequences can be ascertained using computer programs or mathematical algorithms known in the art. Such algorithms that calculate percent sequence homology (or identity) generally account for sequence gaps and mismatches over the comparison region or area.
[0204] A nucleic acid or polynucleotide refers to a DNA molecule (e.g., cDNA or genomic DNA), an RNA molecule (e.g., mRNA), or a DNA or RNA analog. A DNA or RNA analog can be synthesized from nucleotide analogs. A nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA.
[0205] An isolated or recombinant nucleic acid refers to a nucleic acid whose structure is not identical to that of any naturally occurring nucleic acid or to that of any fragment of naturally occurring genomic nucleic acid. Thus, the term encompasses, for example, (a) a DNA having the sequence of a portion of a naturally occurring genomic DNA molecule, but not flanked by both sequences that flank that portion of the molecule in the genome of the naturally occurring organism, (b) a nucleic acid that is incorporated into a vector or into the genomic DNA of a prokaryotic or eukaryotic organism in such a manner that the resulting molecule is not identical to any naturally occurring vector or genomic DNA, (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment, and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene that encodes a fusion protein. The nucleic acids described above can be used to express the proteins of the present disclosure. For this purpose, the nucleic acid can be operably linked to a suitable regulatory sequence to generate an expression vector.
[0206] A "recombinant nucleic acid" is a combination of nucleic acid sequences that are joined together using recombinant techniques and procedures used to join nucleic acid sequences together.
[0207] The terms "heterologous" DNA molecule and "heterologous" nucleic acid, as used herein, refer to a molecule that is derived from a source foreign to a particular host cell, or that, if derived from the same source, is modified from its original form, respectively. Thus, a heterologous gene in a host cell includes a gene that is endogenous to a particular host cell, but that has been modified, for example, by the use of shuffling or recombination. When used to describe two nucleic acid segments, these terms mean that the two nucleic acid segments are not from the same gene, or that, if they form the same gene, one or both of them have been modified from their original form. These terms also include non-naturally occurring multiple copies of a naturally occurring DNA molecule. Thus, these terms refer to a nucleic acid segment that is foreign or heterologous to the cell, or that is homologous to the cell, but is in a location within the host cell nucleic acid where that element is not normally found. The exogenous DNA segment is expressed to produce an exogenous RNA or polypeptide. A "homologous DNA molecule" is a DNA molecule that is naturally associated with the host cell into which it is introduced.
[0208] "Regulatory sequences" include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include sequences that direct constitutive expression of nucleotide sequences, as well as tissue-specific regulatory sequences and / or inducible sequences. The design of an expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression of the desired protein or RNA, and the like. The expression vector can be introduced into a host cell to produce the RNA or polypeptide of interest. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one that initiates RNA at high frequency.
[0209] A "promoter" is a nucleotide sequence that initiates and regulates transcription of a polynucleotide. Promoters can include inducible promoters (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. The term "promoter" or "control element" is intended to include full-length promoter regions and functional (e.g., transcription or translation controlling) segments of these regions.
[0210] "Operably linked" refers to an arrangement of elements such that the components so described are configured to perform their normal functions. Thus, a given promoter operably linked to a nucleic acid sequence can affect the expression of that sequence if the appropriate enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct its expression. Thus, for example, intervening untranslated but transcribed sequences can be present between the promoter sequence and the nucleic acid sequence, and the promoter sequence can still be considered "operably linked" to the coding sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation of the promoter element and DNA sequence of interest that allows initiation of transcription of the DNA sequence of interest upon recognition of the promoter element by the transcription complex.
[0211] As used herein, the term "gene construct" or "nucleic acid construct" refers to a non-naturally occurring nucleic acid molecule resulting from the use of recombinant DNA technology (e.g., recombinant nucleic acid). A gene or nucleic acid construct is a nucleic acid molecule, either single-stranded or double-stranded, that has been modified to contain segments of nucleic acid sequences that are combined and arranged in a manner not found in nature. A nucleic acid construct may be a "cassette" or "vector" (e.g., a plasmid, a rAAV vector genome, an expression vector, etc.), i.e., a nucleic acid molecule designed to deliver exogenously created DNA into a host cell.
[0212] As used herein, "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in a suitable host cell, which may include a promoter operably linked to a nucleotide sequence of interest, which may be operably linked to a termination signal. It may also include sequences necessary for proper translation of the nucleotide sequence. The coding region usually encodes an RNA or protein of interest. The expression cassette containing the nucleotide sequence of interest may be chimeric. The expression cassette may also be naturally occurring but obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or a regulatable promoter that initiates transcription only when the host cell is exposed to some particular stimulus. In the case of a multicellular organism, the promoter may also be specific to a particular tissue or organ, or to a developmental stage.
[0213] A vector refers to a nucleic acid molecule, capable of transporting another nucleic acid to which it is linked. A vector may or may not be capable of autonomous replication, or may or may not be capable of integrating into a host DNA. Examples include plasmids, viruses (e.g., rAAV), cosmids, or other vehicles that can be engineered by insertion or incorporation of a nucleic acid (e.g., a recombinant nucleic acid). Vectors can be used for a variety of purposes, including, for example, genetic engineering (e.g., cloning vectors), to introduce / transfect a nucleic acid into a cell and transcribe or translate the inserted nucleic acid in the cell. In some embodiments, the vector nucleic acid sequence contains at least an origin of replication for propagation in a cell. In some embodiments, the vector nucleic acid includes a heterologous nucleic acid sequence, an expression control element(s) (e.g., promoter, enhancer), a selectable marker (e.g., antibiotic resistance), a polyadenosine (polyA) sequence, and / or an ITR. In some embodiments, the nucleic acid sequence is propagated when delivered to a host cell. In some embodiments, when delivered to a host cell, either in vitro or in vivo, the cell expresses a polypeptide encoded by the heterologous nucleic acid sequence. In some embodiments, when delivered to a host cell, the nucleic acid sequence or a portion of the nucleic acid sequence is packaged into a capsid. The host cell may be an isolated cell or a cell within a host organism. In addition to the nucleic acid sequence (e.g., a transgene) that encodes an RNA or a polypeptide or protein, additional sequences (e.g., regulatory sequences) may be present within the same vector (i.e., in cis with respect to the gene) and adjacent to the gene. In some embodiments, the regulatory sequences may be present on a separate (e.g., second) vector that acts in trans to regulate expression of the gene. A plasmid vector may be referred to herein as an "expression vector."
[0214] As used herein, the term "vector genome" refers to a recombinant nucleic acid sequence that is packaged or encapsidated to form a rAAV vector. Typically, a vector genome includes heterologous polynucleotide sequences, such as transgenes, regulatory elements, ITRs that are not naturally present in the capsid. When a recombinant plasmid is used to construct or produce a recombinant vector (e.g., a rAAV vector), the vector genome does not include the entire plasmid, but rather includes only the sequences intended for delivery by the viral vector. This non-vector genome portion of the recombinant plasmid is typically referred to as the "plasmid backbone", which is important for the cloning, selection and amplification of the plasmid, which are processes required for the propagation of recombinant viral vector production, but is not itself packaged or encapsidated into the rAAV vector.
[0215] As used herein, the term "viral vector" generally refers to viral particles that function as nucleic acid delivery vehicles and contain a vector genome (e.g., containing a transgene in place of nucleic acids encoding AAV rep and cap) packaged within the viral particle (i.e., capsid), including, for example, lentiviruses and parvoviruses, including AAV serotypes and variants (e.g., rAAV vectors). Recombinant viral vectors do not contain a vector genome that contains the rep and / or cap genes.
[0216] As used herein, the terms "overexpressing," "overexpress," "overexpressed," or "overexpression," when referring to the production of a nucleic acid or protein in a host cell, means that the nucleic acid or protein is produced in an amount that is greater than the amount that is produced in its naturally occurring environment. The term is intended to encompass the overexpression of endogenous, as well as exogenous or heterologous nucleic acids and proteins. Thus, the term and the like are intended to encompass increasing the expression of a nucleic acid or protein in a cell to a level that is greater than the level that the cell naturally contains. In certain embodiments, the expression level or amount of a nucleic acid or protein in a cell is increased by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% compared to the level or amount naturally contained in the cell.
[0217] Terms such as "overexpressing," "overexpress," "overexpressed," and "overexpression," in the context of mutant or diseased cells, are intended to encompass increasing expression of a nucleic acid or protein to a level greater than that contained in a mutant, diseased, wild-type, or non-diseased cell. In certain embodiments, the expression level or amount of a nucleic acid or protein in a mutant or diseased cell is increased by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% compared to the level or amount contained in a mutant, diseased, wild-type, or undiseased cell.
[0218] "Antisense" refers to a nucleic acid sequence that is complementary to the coding strand or mRNA of a nucleic acid sequence, regardless of length.Antisense RNA can be introduced into individual cells, tissues, or organoids.Antisense nucleic acid can contain modified backbones, such as phosphorothioates, phosphorodithioates, or other modified backbones known in the art, or can contain non-natural internucleoside linkages.
[0219] As referred to herein, a "complementary nucleic acid sequence" is a nucleic acid sequence that can hybridize with another nucleic acid sequence that consists of complementary nucleotide base pairs. "Hybridize" refers to pairing that forms a double-stranded molecule between complementary nucleotide bases under suitable stringent conditions (e.g., in DNA, adenine (A) forms base pairs with thymine (T) and guanine (G) forms base pairs with cytosine (C)). (See, e.g., Wahl, GM and SL Berger (1987) Methods Enzymol. 152:399; Kimmel, AR (1987) Methods Enzymol. 152:507).
[0220] A "suppressor" or "inhibitor" refers to an agent that causes a decrease in the expression or activity of a target gene or protein, respectively.
[0221] The terms "inhibit," "downregulate," or "reduce" refer to a reduction in the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits, below the expression or level observed in the absence of an inhibitor, suppressor, or repressor, such as an inhibitory nucleic acid molecule (e.g., siRNA) described herein. Downregulation can be associated with post-transcriptional silencing, e.g., RNAi-mediated cleavage, or changes in DNA methylation patterns or DNA chromatin structure.
[0222] As used herein, an "inhibitory nucleic acid" is a double-stranded RNA, RNA interference, miRNA, siRNA, shRNA, or antisense RNA, or a portion thereof, or a mimetic thereof, that when administered to a mammalian cell results in a reduction in expression of a target gene. Typically, a nucleic acid inhibitor comprises at least a portion of a target nucleic acid molecule or its orthologue, or comprises at least a portion of the complementary strand of a target nucleic acid molecule. Typically, expression of the target gene is reduced by 10%, 25%, 50%, 75%, or even 90-100%.
[0223] As used herein, the term "siRNA" refers to a double-stranded RNA molecule that interferes with the expression of a particular gene or genes after transcription. In some embodiments, siRNA functions to interfere with or inhibit gene expression using the RNA interference pathway. Similar interference or inhibition effects can be achieved with one or more of short hairpin RNA (shRNA), microRNA (mRNA), and / or nucleic acids (such as siRNA, shRNA, or miRNA) that contain one or more modified nucleic acid residues, such as peptide nucleic acid (PNA), locked nucleic acid (LNA), unlocked nucleic acid (UNA), or triazole-linked DNA. Optimally, siRNAs are 18, 19, 20, 21, 22, 23, or 24 nucleotides in length and have a two-base overhang at their 3' end. These dsRNAs can be introduced into individual cells or culture systems. Such siRNAs are used to down-regulate mRNA levels or promoter activity.
[0224] As used herein, the terms "treat," "treating," or "treatment" refer to the administration of therapy to partially or completely relieve, ameliorate, alleviate, inhibit, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms, characteristics, and / or causes of a particular disease, disorder, and / or condition.
[0225] As used herein, the term "amelioration" refers to a detectable or measurable improvement in a subject's disease, disorder or condition, or a symptom thereof, or an underlying cellular response. Detectable or measurable improvement includes a subjective or objective decrease, reduction, inhibition, suppression, limitation or control of the occurrence, frequency, severity, progression or duration of the disease, disorder or condition, the cause of complications due thereto or associated therewith, an improvement in the symptoms thereof, or a reversal thereof.
[0226] As used herein, the term "associated with" refers to being associated with one another when the presence, level and / or form of one correlates with the presence, level and / or form of the other. For example, a particular entity (e.g., a polypeptide, gene signature, metabolite, microorganism, etc.) is considered to be associated with a particular disease, disorder, or condition if its presence, level and / or form correlates with the incidence and / or susceptibility of the disease, disorder, or condition (e.g., across a relevant population).
[0227] As used herein, the term "prevent" or "prevention" refers to a delay in the onset and / or a reduction in the frequency and / or severity of one or more signs or symptoms of a particular disease, disorder, or condition (e.g., a myelin disease). In some embodiments, prevention is assessed on a population basis such that an agent is considered to "prevent" a particular disease, disorder, or condition if a statistically significant reduction in the onset, frequency, and / or intensity of one or more signs or symptoms of the disease, disorder, or condition is observed in a population susceptible to the disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed for a predetermined period of time.
[0228] As used herein, the term "therapeutically effective amount" refers to an amount that produces the desired therapeutic effect for which it is administered. In some embodiments, the term refers to an amount sufficient to treat a disease, disorder, or condition when administered according to a therapeutic dosing regimen to a population suffering from or susceptible to the disease, disorder, or condition. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity and / or delays the onset of one or more symptoms of a disease, disorder, and / or condition. Those skilled in the art will appreciate that the term "therapeutically effective amount" does not actually require that successful treatment be achieved in a particular individual. Rather, a therapeutically effective amount may be an amount that, when administered to a patient in need of such treatment, provides a specific desired pharmacological response in a significant number of subjects.
[0229] A "population" of cells refers to any number of cells greater than one, but at least 1×10 3 cells, at least 1 x 10 4 cells, at least 1 x 10 5 cells, at least 1 x 10 6 cells, at least 1 x 10 7 cells, at least 1 x 10 8 cells, at least 1 x 10 9 cells, or at least 1 x 10 10 Each cell is a single cell.
[0230] As used herein, the term "stem cell" refers to a cell that has the ability to both replace itself and differentiate into more specialized cells. Their self-renewal ability generally persists for the life of an organism. Pluripotent stem cells can give rise to all of the various cell types of the body. Multipotent stem cells can give rise to a limited subset of cell types. For example, hematopoietic stem cells can give rise to the various types of cells found in the blood, but cannot give rise to other types of cells. Multipotent stem cells can also be referred to as somatic stem cells, tissue stem cells, lineage-specific stem cells, and adult stem cells. The non-stem cell progeny of multipotent stem cells are progenitor cells (also referred to as restricted progenitor cells). Progenitor cells give rise to fully differentiated cells, but give rise to a more restricted set of cell types than stem cells. Progenitor cells also have a relatively limited ability to self-renew, and as they divide and differentiate, they eventually wear out and are replaced by new progenitor cells derived from their upstream multipotent stem cells.
[0231] "Induced pluripotent stem cells", commonly abbreviated as iPS cells or iPSCs, refer to a type of pluripotent stem cell artificially prepared from non-pluripotent cells, typically adult somatic cells, or terminally differentiated cells such as fibroblasts, hematopoietic cells, muscle cells, neurons, epithelial cells, etc., by introducing certain factors called reprogramming factors.
[0232] "Pluripotent" refers to a stem cell that has the potential to differentiate into all cells that make up one or more tissues or organs, particularly any of the three germ layers: endoderm (stomach lining, gastrointestinal tract, lungs), mesoderm (muscle, bone, blood, urogenital tract), or ectoderm (epidermal tissue and nervous system). As used herein, "pluripotent stem cell" refers to a cell that can differentiate into a cell derived from any of the three germ layers, e.g., a direct descendant of a totipotent cell or an induced pluripotent cell.
[0233] As used herein, "therapeutic cells" refers to a cell population that ameliorates a patient's condition, disease, and / or injury. Therapeutic cells can be autologous (i.e., derived from the patient), allogeneic (i.e., derived from an individual of the same species but different from the patient), or xenogeneic (i.e., derived from a species but different from the patient). Therapeutic cells can be homogeneous (i.e., composed of a single cell type) or heterogeneous (i.e., composed of multiple cell types). The term "therapeutic cells" includes both therapeutic active cells and progenitor cells that can differentiate into therapeutic active cells.
[0234] The term "autologous" refers to any material derived from the same subject or individual to which it is later reintroduced. For example, the methods of autologous cell therapy described herein involve the collection of glial cells or their progenitor cells from a donor, e.g., a patient, which are then engineered, e.g., to express a transgene, and then re-administered to the same donor, e.g., patient.
[0235] The term "heterologous" refers to any material (e.g., a cell or tissue scaffold) that is derived from a different subject or individual. As used herein, "heterologous" or "non-endogenous" or "exogenous" also refers to any material (e.g., a gene, protein, compound, molecule, cell, or tissue or tissue component) or activity that is not native to the host cell or host subject, or any gene, protein, compound, molecule, cell, tissue, or tissue component that is native to the host or host cell but has been altered or mutated such that the structure, activity, or both differ between the native version and the mutated version.
[0236] The term "allogeneic" refers to any material (e.g., cells or tissue) derived from one individual that is then introduced into another individual of the same species, e.g., allogeneic cell transplantation. For example, cells may be obtained from a first subject, modified ex vivo according to the methods described herein, and then administered to a second subject to treat a disease. In such embodiments, the cells administered to the subject are allogeneic and heterologous cells.
[0237] The term "xenogenic" refers to any material (eg, cells or tissues) that is derived from an individual of a different species.
[0238] The term "syngeneic" refers to any material (eg, cells or tissues) that are characterized by essentially the same genes.
[0239] As used herein, the term "subject" refers to an organism, e.g., a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, an experimental animal, a mouse, a rat, a hamster, a gerbil, a cat, a dog). In some embodiments, the subject is a non-human disease model. In some embodiments, the human subject is an adult, an adolescent, or a pediatric subject. In some embodiments, the subject is suffering from a disease, disorder, or condition, e.g., a disease, disorder, or condition that can be treated as provided herein. In some embodiments, the subject is suffering from a disease, disorder, or condition associated with a deficiency or dysfunction of aspartoacylase activity. In some embodiments, the subject is susceptible to a disease, disorder, or condition. In some embodiments, a susceptible subject is prone to and / or exhibits an increased risk (compared to the average risk observed in a reference subject or population) of developing a disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, the subject does not exhibit a particular symptom (e.g., a clinical symptom of a disease) or characteristic of a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject is a human patient. In some embodiments, the subject is an individual to whom and / or to whom a diagnosis and / or therapy is administered.
[0240] As used herein, the term "therapeutically effective amount" refers to an amount that produces the desired therapeutic effect for which it is administered. In some embodiments, the term refers to an amount sufficient to treat a disease, disorder, or condition when administered according to a therapeutic dosing regimen to a population suffering from or susceptible to the disease, disorder, or condition. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity and / or delays the onset of one or more symptoms of a disease, disorder, and / or condition. Those skilled in the art will appreciate that the term "therapeutically effective amount" does not actually require that successful treatment be achieved in a particular individual. Rather, a therapeutically effective amount may be an amount that, when administered to a patient in need of such treatment, provides a specific desired pharmacological response in a significant number of subjects.
[0241] The following examples are intended to illustrate the practice of embodiments of the present disclosure, but are in no way intended to limit its scope. Example Part A relates to competitive replacement of glial cells. Example Part B relates to rejuvenation of glial progenitor cells. EXAMPLES
[0242] Example Part A: Competitive replacement of glial progenitor cells in the adult brain Materials and Methods Human embryonic stem cell lines and culture conditions Sibling human embryonic stem cell (hESC) lines GENEA019 (WT: 18; 15CAG) and GENEA020 (HD: 48; 17CAG). hESCs were cultured at 0.55ug / cm in mTeSR1 medium (STEMCELL Technologies, Cat. No. 85850). 2hESCs were cultured regularly in a feeder-free manner on cell culture flasks coated with 100% human recombinant laminin 521 (BIOLAMINA, Cat. No. LN521). Daily medium changes were performed. hESCs were passaged regularly at 80% confluency into freshly coated flasks. Passaging was performed using ReLeSR (STEMCELL TECHNOLOGIES, Cat. No. 05872). All hESC and differentiation cultures were maintained in a 37°C 5% CO2 incubator and regularly checked for contamination and mycoplasma-free status.
[0243] Generation of fluorescent reporter hESCs For universal differential fluorescent labeling of WT and HD cells (Figure 1), reporter constructs driving expression of either mCherry or EGFP were inserted into the AAVS1 safe harbor locus of WT GENEA019 and HD GENEA020 hESCs, respectively, using a modified version of the CRISPR-Cas9-mediated strategy previously described in Oceguera-Yanez, F., et al., Methods 101, 43--55, which is incorporated herein by reference in its entirety. To prepare hESCs for plasmid delivery by electroporation, hESCs were harvested as single-cell suspensions after dissociation with Accutase (StemCell Technologies, Cat. No. 07920), washed in medium, and counted in an automated cell counter NucleoCounter NC-200 (ChemoMetec). A total of 1.5 × 10 6Cells were mixed with 5 μg of AAVS1 targeting CRISPR-Cas9 plasmid (pXAT2) and 5 μg of reporter donor plasmid (pAAVS1-P-CAG-mCh or pAAVS1-P-CAG-GFP). pXAT2 (Addgene plasmid no. 80494), pAAVS1-P-CAG-mCh (Addgene plasmid no. 80491), and pAAVS1-P-CAG-GFP (Addgene plasmid no. 80492) were gifts from Knut Woltjen. Electroporation was performed using an Amaxa 4D-Nucleofector (Lonza) with a P3 Primary Cell Kit (Lonza, catalog no. V4XP-3024) according to the manufacturer's guidelines. After nucleic acid excision, the electroporated hESC suspension was transferred to a 10 cm cell culture dish and cultured in mTeSR1 supplemented with 10 μM Y-27632 (Tocris, Cat. No. 1254) for the first 24 h. Electroporated hESCs were grown for 48–72 h and then treated with 0.5 μg / μL puromycin (ThermoFisher, Cat. No. A1113803). Electroporated hESC cultures were kept under puromycin until individual colonies were large enough to be picked manually. Colonies were assessed by fluorescence microscopy and transferred to 96-well plates based on the uniformity of fluorescent protein expression. After their expansion, each clone was split for further expansion and genotyping. For genotyping, DNA was extracted using the prepGEM Tissue DNA extraction kit (Zygem). Precisely targeted transgenic integration at the AAVS1 locus was detected by PCR using the following primers: dna803: TCGACTTCCCCTCTTCCGATG (SEQ ID NO: 1), and dna804: CTCAGGTTCTGGGAGAGGGTAG (SEQ ID NO: 2), while zygosity of integration was determined by the presence or absence of the WT allele using the following additional primers: (dna803 and dna183: GAGCCTAGGGCCGGGATTCTC (SEQ ID NO: 3)).hESC clones harboring correctly targeted insertions were cryopreserved in Pro-Freeze CDM medium (Lonza, catalog no. BEBP12-769E) and expanded for karyotyping and array comparative genomic hybridization (aCGH) characterization prior to experimental application.
[0244] Karyotyping and aCGH The nuclear phase diagrams of the generated reporter hESC lines were analyzed on interphase spreads by the G-banding method (Institut fur Medizinishche Genetik und Angewandte Genomik, Universitatsklinikum Tubingen). All hESC lines used in this study possess normal karyotypes. Furthermore, the acquired copy number variants (CNVs) and regions of loss of heterozygosity (LOH) were assessed by aCGH (Cell Line Genetics). We identified various CNVs and LOH within and outside the normal range (Figure 2), but none were expected to affect the outcome of competitive interactions between the clones.
[0245] Induction of hGPCs from reporter WT and HD hESCs Human GPCs were derived from both reporter WT and HD hESCs using Applicants' established protocol (Wang et al., Cell Stem Cell 12, 252-264, incorporated herein by reference in its entirety) with minor modifications to the embryoid body (EB) generation step (see Wang et al. Cell Stem Cell 12, 252-264). Details of the EB generation step are included in the Supplementary Information. Cells were harvested for xenografting between 150-200 DIV, at which point cultures derived from both WT-mCherry and HD-EGFP hESCs expressed PDGFRα + / CD44 + Bipotential glial progenitor cells were enriched. Detailed characterization of the generated cultures by flow cytometry and immunocytochemistry can be seen in Figure 3 and Figures 18A and 18B.
[0246] Cell preparation for xenotransplantation To prepare cells for xenografting, glial cultures were cultured with Ca 2+ / Mg 2+ Free Hank's Balanced Salt Solution (HBSS (- / -) The cells were collected in a 200 µL centrifuge tube (ThermoFisher, Cat. No. 14170112), mechanically dissociated into small clusters by gentle pipetting, and counted in a hemocytometer. The cell suspension was then spun and diluted with 10 5 Cold HBSS at a final concentration of 10 cells / µL (- / -) and kept on ice until transplantation.
[0247] Host and xenograft paradigms In vivo modeling of human glial striatal repopulation: To generate human mouse chimeras carrying mHtt-expressing human glia (HD chimeras), neonatal immunodeficient Rag1(- / -) pups (Mombaerts, P. et al, Cell 68,869--877.10.1016 / 0092-8674(92)90030-g, incorporated herein by reference in its entirety) were cryo-anesthetized, immobilized in a custom baked clay platform, and injected bilaterally into the presumptive striatum within 48 hours of birth with 100,000 HD-EGFP glia (50,000 per brain hemisphere). Cells were delivered using a 10 μL syringe with a pulled glass pipette (HAMILTON, catalog no. 7653-01) at a depth of 1.2-1.4 mm. Pups were then returned to their mothers until weaning. To model human glial striatal repopulation, 36-week-old HD chimeras were anesthetized with ketamine / xylazine and fixed in a stereotaxic frame. 200,000 WT glia were delivered bilaterally into the humanized striatum (AP: +0.8 mm; ML: ±1.8 mm; DV: -2.5 to -2.8 mm) using a 10 μL syringe and metal needle. To minimize damage, cells were injected at a controlled rate of 175 nL / min using a controlled micropump system (World Precision Instruments). Backflow was prevented by leaving the needle in place for an additional 5 min. Experimental animals were divided into HD chimeric littermates that did not receive WT glia, and non-chimeric Rag1 littermates that received WT glia at 36 weeks of age following this exact procedure. (- / -) compared with mice.
[0248] Neonatal striatal engraftment To model the cell-intrinsic effects of mHtt expression on the outcome of competition between human glia, we used neonatal Rag1 (- / -) Mice were injected according to the same neonatal striatal xenograft protocol described above, but instead delivered a total of 200,000 human glia (100,000 per hemisphere) consisting of a 1:1 mixture of WT-mCherry and HD-EGFP hESC-derived glia. Control littermates received injections consisting of either WT-mCherry or HD-EGFP human glia.
[0249] Aseptic technique was used for all xenotransplants. All mice were housed in a pathogen-free environment with free access to food and water, and all procedures were performed in accordance with protocols approved by the University of Rochester Committee on Animal Resources.
[0250] Tissue processing The experimental animals were incubated in HBSS ( - / -) , followed by perfusion with 4% PFA. Brains were removed, post-fixed in 4% PFA for 2 h, and rinsed three times with PBS. They were then incubated in 30% sucrose solution (SIGMA-ALDRICH, Cat. No. S9378) until equilibrated, at which point they were embedded in OCT in the sagittal orientation (Sakura, Cat. No. 4583), frozen in 2-methylbutane (Fisher Scientific, Cat. No. 11914421) at temperatures of -60 to -70 °C, and transferred to a -80 °C freezer. The resulting blocks were then cut into 20 μm sections on a CM1950 cryostat (Leica), serially collected onto adhesive slides, and stored at -20 °C until further use.
[0251] immunostaining Phenotyping of human cells was achieved by immunostaining for their respective fluorescent reporters along with the following specific phenotypic markers: Olig2 (oligodendrocyte transcription factor, marks GPCs) and GFAP (glial fibrillary acidic protein, marks astrocytes). Fluorescent reporters were used as markers for human cells because their expression remained ubiquitous throughout the life of the animals (Figure 4). In animals that received a 1:1 mixture of WT-mCherry and WT-untagged human glia, the latter were identified by their expression of human nuclear antigen and lack of fluorescent reporter expression. For immunolabeling, sections were rehydrated in PBS and then permeabilized and blocked for 2 hours using permeabilization / blocking buffer (PBS + 0.1% Triton-X (SIGMA-ALDRICH, Cat. No. T8787) + 10% Normal Goat Serum (THERMOFISHER, Cat. No. 16210072)). Sections were then incubated overnight at 4°C with a primary antibody targeting a phenotypic marker. The following day, the primary antibody was thoroughly washed from the sections with PBS and a secondary antibody was applied to the sections for 1 hour. After thoroughly rinsing the secondary antibody with PBS, a second primary antibody, this time against a fluorescent reporter, was applied to the sections overnight at 4°C. These were rinsed the following day with PBS and the sections were incubated in the secondary antibody for 1 hour. Slides were again thoroughly washed with PBS and mounted with VECTASHIELD VIBRANCE (Vector Labs, Cat. No. H-1800).
[0252] Xenograft mapping and 3D reconstruction To map human cell distribution within the mouse striatum, a whole-brain montage of 15 equally spaced 160 μm sagittal sections spanning the entire striatum was acquired using a NIKON NI-E ECLIPSE microscope equipped with a DS-Fi1 camera at 10x magnification and processed with NIS-Elements imaging software (NIKON). The striatum within each section was outlined and immunolabeled human cells were identified and mapped within the outlined striatum using Stereo Investigator software (MICROBRIGHTFIELD Bioscience). Where applicable, injection sites of WT glia were mapped as reference points for further volumetric quantification of human cell distribution. The mapped sections were then aligned using the lateral ventricle as a reference to generate a 3D reconstructed model of the humanized mouse striatum. After 3D reconstruction, Cartesian coordinates of each human cell marker, injection site, and striatal contour were exported for further analysis.
[0253] To assess the distribution and proportion of proliferative cells in each human cell population within the striatum, immunolabeled human cells expressing Ki67 were mapped on every third of 15 sections when performing 3D reconstructions.
[0254] volume determination To quantify the spatial distribution of HD glia in HD chimeras, the volume of each quantified striatal cross-section was calculated by multiplying the section thickness (20 μm) by the area of the section. The cell density of each cross-section was then calculated by dividing the number of marked cells in each cross-section by its respective volume.
[0255] To quantify the spatiotemporal dynamics of competing WT and HD glia, we developed a program to calculate the volumetric distribution of each cell population as a function of distance to the WT glial delivery site in the 3D reconstructed dataset (Figure 4). For that purpose, each quantified cross-section was delimited by representing the outline of the striatum as two identical polygons separated from each other by the thickness of the cross-section (20 µm), with upper and lower boundaries z u , z lThen, because the depthwise location of each cell marker in each individual cross section is unknown, the marked cells in each cross section were represented as a uniform point probability function with a constant probability across the cross section, i.e., z l From z u Each cell marker in the cross section up to has a probability function: TIFF2024540971000011.tif21170
[0256] The spatial distribution of each cell population was then measured by counting the number of marked cells within concentric spherical shells radiating from the WT glial delivery site at radial increments of 125 μm (for control HD chimeras, the average of the coordinates of the WT glial delivery site was used). Marked cells were counted if each representative line segment was completely inside, completely outside, or intersecting the spherical shell at either the upper or lower limit. Each cell population p a,b (where a, b represent the minimum and maximum radius of the spherical shell) was calculated by dividing the number of marked cells in the spherical shell by the combined cross-sectional volume within the shell, TIFF2024540971000012.tif14170, N a,b is the sum of the integrated point probability functions over each cross section for each point, and V a,b is the combined cross-sectional volume within the spherical shell. Subsequent analysis was restricted to a spherical radius of 2 mm. The code was implemented in Python 3.8 and package Shapely 1.7 to represent polygons and calculate circle intersections of polygons.
[0257] Stereological estimation and phenotyping Estimation of the total amount of human cells and their respective phenotyping were performed stereologically in five equidistant 480 μm-separated sections spanning the entire striatum using optical fractionation techniques (West, MJ (1999). Trends in Neurosciences 22, 51-61, incorporated herein by reference in its entirety). First, whole-striatal z-stack montages were acquired using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi1 camera at 20x magnification and processed with NIS-Elements imaging software (Nikon). Each z-stack tile was acquired using a step size of 0.9 μm. The montages were then loaded into StereoInvestigator and the striatum was outlined. A series of 200×200 μm counting frames were systematically randomly placed by the software within a 400×400 μm grid covering the outlined striatum in each section. Counting was performed over the entire section height (no guard zones) and cells were counted based on their immunolabeling in the optical section in which they were initially focused.
[0258] Statistical analysis and reproducibility Samples exhibiting artifacts related to mistarget injection, obvious surgical injury, or technical problems from the experimental procedure, such as injection into gliotic lesions, were excluded from this study. Statistical tests were performed using GraphPad Prism 9. For comparisons between two or more groups, one-way analysis of variance (Tukey's multiple comparison test) was applied. For comparisons between two groups with two or more factors, two-way analysis of variance (Sidak's multiple comparison test) was applied. When comparing between two matched groups, a paired two-tailed t-test was applied for normally distributed data sets, whereas an unpaired two-tailed t-test was applied for unmatched groups. Significance was defined as P<0.05. Whenever possible, the respective P values are stated in the figures, otherwise ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05. The number of replicates is indicated in the figure legends, and n indicates the number of independent experiments. Data are expressed as mean ± standard error (sem).
[0259] Apoptosis assay Identification of apoptotic cells within human cell populations was achieved by terminal deoxynucleotidyl transferase-dUTP nick-end labeling (TUNEL) and immunostaining for their respective fluorescent reporters. TUNEL was performed using the Click-iT TUNEL Alexa Fluor 647 Imaging Assay (Invitrogen, Cat. No. C10247) according to the manufacturer's instructions, except that samples were incubated in proteinase K solution for 20 min at room temperature. To confirm efficient TUNEL staining in fixed frozen brain cryosections, positive control sections were treated with DNase I according to the manufacturer's instructions. Following TUNEL, sections were immunolabeled for fluorescent reporters according to the immunostaining protocol previously described.
[0260] TUNEL + Human cell quantification To assess the distribution and proportion of apoptotic cells within each human cell pool, whole-striatal montages of five equally spaced 480 μm apart sagittal sections spanning the entire striatum were acquired using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi3 camera at 10x magnification and stitched together with NIS-Elements imaging software. The striatum was outlined within each section, and immunolabeled human cells were identified and mapped based on their TUNEL labeling within the outlined striatum using Stereo Investigator.
[0261] Representative images showing the entire humanized striatum were generated from the previously acquired whole-brain montage using the "crop" function in NIS-Elements imaging software and adjusting the "min / max" levels. Representative images of the human glial competition interface were then acquired as large-field z-stack montages using a Nikon Ti-E C2+ confocal microscope equipped with 488 nm, 561 nm, and 640 nm laser lines and a standard PMT detector. Images were acquired at 40x or 60x magnification with an oil immersion objective and stitched together in NIS-Elements. Maximum intensity projections were then generated and the "min / max" levels were adjusted in NIS-Elements. Similarly, representative images of human cell phenotypes were acquired, imaged, and processed as z-stacks using a Nikon Ti-E C2+ confocal and the same laser lines.
[0262] Fluorescence-activated cell sorting (FACS) of human glia from chimeric mice To isolate human cells for scRNA-seq, experimental chimeras were perfused intracardially with HBSS, their striatum dissected, and tissue dissociated as previously described (Mariani, JN, Zou, L. & Goldman, SA in Oligodendrocytes. Methods in Molecular Biology Vol. 1936 (eds David Lyons & Linde Kegel) 311--331 (Humana Press, 2019) and illustrated in Figure 24A. Single cell suspensions were isolated based on expression of mCherry, EGFP, or their absence using a BD FACSAria Fusion (BD Biosciences). 4',6-diamidino-2-phenylindole (DAPI; ThermoFisher, Cat. No. D1306) was added at 1 μg / ml to exclude dead cells. The gating strategy is shown in Figure 24B.
[0263] Single-cell RNA sequencing analysis Primary Data Acquisition Isolated cells were acquired for scRNA-seq on a 10X Genomics Chromium Controller (v3.1 chemistry). Libraries were generated according to the manufacturer's instructions and sequenced on an Illumina NovaSeq 6000 at the University of Rochester Genomics Center. scRNA-seq libraries were aligned with STARsolo using a custom two-pass strategy. First, annotated chimeric GRCh38 and GRCm38 references were generated using human and mouse annotations from Ensembl 102 with the addition of mCherry and EGFP. STARsolo was then run with the following parameters: twopassMode=basic, limitSjdbInsertNsj=3000000, and soloUMIfiltering=MultiGeneUMI. BAM files were then split by species and cross-species multi-mapping reads were assigned to both human or mouse BAM. FASTQ files were regenerated from either mouse or human BAM files and realigned to a single species reference.
[0264] Differential Expression Analysis Human data was imported into R using Seurat. Cells were filtered (unique genes >250 and mitochondrial gene rate <15). Cells were then further filtered for expression of mCherry or EGFP. Counts were imported into Python for integration using scvi where the 4,000 most variable features were used. Models were trained for integration using mouse samples and cell lines in addition to the number of unique genes and mitochondrial gene expression rates. Latent representations were then used for dimensionality reduction via UMAP and Louvain community detection. Smaller populations of cells were classified into six main types of glia based on marker expression. Data was then re-imported into Seurat and differential expression was performed using MAST. A gene was considered differentially expressed if its expression was detected in at least 3% of all GPCs. Model design for differential expression utilized the number of unique genes in the cells and the experimental group (cell line / age of cells, and whether the cells were in the presence of opposing clones or not). The significance of differential expression was P<0.05 and the log2 fold change was at least 0.15. For functional analysis of each differentially expressed gene list, Ingenuity Pathway Analysis (QIAGEN) was used.
[0265] Cell cycle analysis The G2M scores of each experimental group were calculated using the CellCycleScoring function in Seurat. Statistical comparisons between the experimental groups of each model were then calculated using Dunn's test with Benjamini-Hochberg multiple comparison adjustment.
[0266] Identification of transcription factor-associated regulons Genes were first filtered to retain only those expressing at least 3 counts in at least 1% of cells. All 9,579 cells were used in this analysis. The filtered raw matrix was then used as input for the standard pipeline in pySCENIC to identify each transcription factor and its putative downstream targets in the dataset. These gene sets were referred to as regulons and assigned an "area under the curve" (AUC) value to represent their activity in each cell, with higher values indicating stronger enrichment of such regulons. The resulting AUC matrix was then used to look for significant transcription factors. Within the GPC subpopulations in both isograft and allograft models, cells from young WT samples were assigned a 1 and cells from aged WT or aged HD samples were assigned a 0. A logistic regression was then performed using glmnet with the AUC of all TFs as predictors for a given 0 / 1 outcome. Lambda for the logistic regression was automatically defined in cv.glmnet.
[0267] We isolated TFs with positive coefficients and further filtered them based on their average activity per group, such that the TF average activity in young WT should be higher than that of their aged counterparts. The final step was to perform gene set enrichment analysis (GSEA) on the previously identified regulons to determine whether they were enriched for differentially upregulated genes in young WT cells compared to aged HD and WT cells (adjusted P<10). -2 , NES>0).
[0268] Identification of co-expressed gene sets with competitive advantage We filtered to exclude genes with less than 1 count across all cells and used the resulting matrix to denoise the data with DCA. Weighted gene co-expression network analysis (WGCNA) was performed on the denoised data of the GPC subset. Signature network adjacencies were calculated with a soft thresholding power of 9. Modules were detected after hierarchical clustering of genes on differences based on the topological overlap matrix and dynamic tree cutting. We then used GeneOverlap (adjusted P<10 -2 ) was used to identify modules whose gene members displayed significant overlap with the key TF targets identified above. The relative contributions of linear independent covariates, age (young, aged) and genotype (HD, WT) to the additive explanation for each module eigengene (e.g., ME ~ age + genotype) were calculated by the lmg method, implemented in the relaimpo package.
[0269] Network Representation: Functional annotation of gene targets of transcription factors was performed using IPA. To generate a representative network, we focused on the MYC regulon and its shared targets with other important TFs. The network was constructed using Cytoscape.
[0270] Generation of embryoid bodies (EBs) To generate uniform EBs, hESCs were dissociated into small clusters using ReLeSR, harvested, and counted in an automated cell counter NucleoCounter NC-200. A total of 3 × 10 cells were counted per well of an AGGREWELL-800 plate (StemCell Technologies, Cat. No. 34815). 6hESCs were added and centrifuged to aggregate the hESCs in individual microwells. The aggregated hESCs were cultured overnight in mTeSR 1 supplemented with 10 μm Y-27632 to allow for the formation of EBs. After 24 hours of aggregation, EBs were released from each microwell by gently pipetting the medium in each well using a P1000 pipette with a cut tip and transferred to ultra-low attachment tissue culture flasks (Corning, Cat. No. 3815) for further indicated differentiation. Prior to aggregation, AGGREWELL-800 plates were prepared according to the manufacturer's guidelines.
[0271] Flow cytometry of hESC-derived glial cultures Glial cultures were dissociated in Accutase for 5 min, then harvested as single cell suspensions, counted in a hemocytometer, and diluted at 10 6 Cells were resuspended at 100 cells / ml in MILTENYI wash buffer (MWB; PBS + 0.5% BSA fraction V (ThermoFisher, Cat. No. 15260037) + 2 μM EDTA (ThermoFisher, Cat. No. 15575020)). Each cell suspension was then incubated in MWB for 15 min at 4° C. to block non-specific antibody binding and divided into 100 μL fractions for immunolabeling. Each fraction was then incubated with fluorophore-conjugated antibodies for 15 min at 4° C., except for the unstained gating control. Antibody sources and concentrations are listed in the table below. TIFF2024540971000013.tif119170
[0272] The cells were then washed with MWB, spun at 200×g for 10 min, resuspended in MWB, and filtered into a 5 ml polystyrene tube with a 35 μm cell strainer cap (Corning, Cat. No. 352235). 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, Cat. No. D1306) was added at 1 μg / mL to exclude dead cells. Flow cytometric analysis of glial cultures was then performed on a CYTOFLEX S platform (Beckman Coulter) and data were analyzed using CYTEXPERT (Beckman Coulter) and FLOWJO (BD Biosciences) software. The gating strategy and data analysis are illustrated in FIG. 18.
[0273] Immunocytochemistry of hESC and glial cultures Cultures were fixed with 4% paraformaldehyde (PFA) for 7 minutes, washed with phosphate-buffered saline (PBS), then permeabilized and blocked with permeabilization / blocking buffer (PBS+0.1% Triton-X (Sigma-Aldrich, Cat. No. T8787)+1% BSA Fraction V) for 1 hour. Cultures were then incubated with primary antibodies overnight at 4° C., washed with PBS, and then incubated with secondary antibodies for 2 hours at room temperature. Antibody sources and concentrations are listed in the table above. Nuclear counterstaining was then performed by incubation with 1 μg / mL DAPI for 5 minutes at room temperature, followed by three additional PBS washes before imaging.
[0274] Representative images of hESCs were acquired on a Nikon Eclipse Ti microscope equipped with a DS-Fi3 camera at 10x magnification, while representative images of glial cultures were acquired with a DS-Qi2 camera at 20x magnification, with both adjusted “min / max” levels in NIS-Elements imaging software (Nikon).
[0275] Mapped cell count and cross-sectional volume estimation (volumetric quantification) As mentioned in the methods section above, mapped cells are counted as 1 if their respective representative line segments are completely inside, 0 if they are completely outside and partially if they intersect with the radial spherical shell. To that end, we calculate the points on the surface of the radial spherical shell that correspond to the projection of the mapped cells onto the spherical shell. Here we only consider the calculation of points above the injection site, since points below the injection site are treated similarly. The corresponding points on the spherical shell are given by, TIFF2024540971000014.tif14170 where r is either a or b depending on whether the shell intersects with an exterior or interior point. l >z d In case (b), the point is not counted because it is outside the shell, and z u <z d In case (a), the shell passes beyond the point and is not counted. d (a) <z u and z d (b)>z l If z then the line segment is entirely inside the spherical shell, which counts as 1. Furthermore, we may have two limit cases where the spherical shell intersects the line segment. Since these two cases are similar, we will only deal with the case where the line segment intersects the upper surface of the spherical shell. That is, d (a)>z u and z u <z d (b) <z l In this case, the part of the line inside the spherical shell has length z u -z d (b), and the mapped cells are counted by integrating their point probability function as TIFF2024540971000015.tif12170In the formula, w is the width of the cross section.
[0276] To calculate the corresponding cross-sectional volume in which mapped cells were counted, we first triangulate each polygon representing the anatomical boundary of each cross-section. We then form prisms from the triangles with a height that matches the thickness of the cross-section. We represent each prism as three tetrahedrons and measure the cumulative volume within the sphere as the total overlap volume between a sphere of radius r and each tetrahedron.
[0277] depth coordinate z l For a cross section of , each triangle has coordinates (x 1 ,y 1 ,z l ), (x 2 ,y 2 ,z l ), and (x 3 ,y 3 ,z l ) three points v 1 , v 2 , v 3 These triangles together create a 2D representation of the domain. To obtain a 3D representation of each cross section, we use a known thickness dz (here 20 nm) and divide the triangles into 3D regions with coordinates (x 1 ,y 1 ,z u ), (x 2 ,y 2 ,z u ), and (x 3 ,y 3 ,z u ) on the boundary above the cross section, three new points w are translated perpendicular to the cross section by dz. 1 , w 2 , w 3 We thicken the prism shape with,. Calculating the exact overlap volume of a 3D polygon with a sphere is not straightforward, but we can calculate the overlap volume of a sphere with a tetrahedron. To that end, we define each prism domain as a set of coordinates, <v 1 ,v 2 ,v 3 ,w 1 >, <v 2 ,v 3 ,w 1 ,w 2 > and <v 3 ,w1 ,w 2 ,w 3 > Given a sphere of radius r, the volume of intersection of each cross section with the sphere is given by the sum of the volumes of the intersections of each tetrahedron T with a sphere S of radius r. TIFF2024540971000016.tif15170
[0278] Example A1 - Generation of distinct, color-tagged human glia from WT and HD hESCs To assess the ability of healthy glia to replace diseased counterparts in vivo, we first generated fluorescently tagged reporter lines of WT and HD human embryonic stem cells (hESCs) to allow the production of spectrally distinct GPCs of each genotype whose growth in vivo could then be independently monitored. We first used a CRISPR-Cas9-mediated knock-in strategy (Oceguera-Yanez, F. et al. Methods 101, 43-55 (2016)) to integrate EGFP and mCherry reporter cassettes into the AAVS1 locus of matched female sibling wild-type (WT, GENEA019) and mHtt-expressing (HD, GENEA020) hESCs (Dumevska, B. et al. Stem Cell Research 16, 430-433 (2016) and Dumovska, B. et al. Stem Cell Research 16, 397--400 (2016)) (Figure 1). We then verified that the reporter cassette was stably integrated into each of these clones (Figure 1D) and that the editing did not affect the self-renewal, pluripotency, or karyotypic stability of the tagged hESCs (Figures 1E and 2A). From these tagged, spectrally distinct lines, we used a previously described differentiation protocol (Benraiss, A. et al. Nature Communications 7, 11758 (2016)) to generate color-coded human glial progenitor cells (hGPCs) from each line whose in vivo behavior can be compared, alone or in competition. We verified the ability of each line to maintain EGFP or mCherry expression after maturation as astrocytes or oligomutated cells, as well as the absence of any significant differentially expressed oncogenic mutations or copy number variants (CNVs) that may bias growth (Figures 2B and 2C), and we also verified that both WT and mHTT-expressing hGPCs colonized the mouse host brain when injected alone (Figures 15 and 6).
[0279] We then differentiated both WT-mCherry and HD-EGFP hESCs using an established protocol for generating hGPCs (Wang, S. et al. Cell Stem Cell 12, 252-264 (2013)) and assessed both their ability to differentiate into glia and the stability of their reporter expression upon acquisition of a glial fate (Figure 3). By 150 days in vitro (DIV), glial cultures derived from both WT-mCherry and HD-EGFP expressed PDGFRα, comprising approximately half of the cells in the culture. + / CD44 + were equally enriched for dual potential GPC (P = 0.78), with the remainder being immature A2B5 + GPC and PDGFRα - / CD44 + astrocytes, and their progenitors (Figures 3 and 18). Importantly, virtually all immunophenotypic cells derived from WT-mCherry and HD-EGFP hESCs, including mature astrocytes and GPCs, continued to express the respective fluorescent reporters, indicating that transgene expression remained stable upon acquisition of peripheral glial identity (Figure 3D).
[0280] Example A2 - Establishment of human HD glial chimeric mice Mouse chimeras with striatum substantially humanized by HD glia (HD chimeras, FIG. 15) were generated to provide an in vivo model to evaluate replacement of diseased human glia with their healthy counterparts. hGPCs derived from mHtt-expressing hESCs engineered to express EGFP (FIGS. 1, 2, and 3, hereafter referred to as HD) were transfected into immunodeficient Rag1 (- / -) We transplanted them into the neostriatum of mice and monitored their expansion histologically (Figure 15A).
[0281] After transplantation, HD glia rapidly infiltrated the mouse striatum, migrating and expanding initially within the striatal white matter tracts (Figure 15B). Gradually, these cells expanded outward, progressively displacing their mouse counterparts from the striatal neuropil, such that by 36 weeks, the mouse striatum was substantially humanized by HD glia (Figures 15B, 15F, and 15G). HD glia progression was driven by their mitotic expansion, and their total number doubled between 12 and 36 weeks (Figure 15C, P = 0.0032). Conversely, as they expanded and matured within the newly established domain, their proliferative cell pool (Ki67 + ) were progressively depleted (Fig. 15D and I, P = 0.0036) and slowed their rate of expansion over time.
[0282] The majority of HD glia express Olig2 + GPCs (72.7±1.9%), which persisted as a new resident pool after replacing their mouse counterparts. A small fraction of these (4.8±0.9%) further expanded into GFAP + The affected astrocytes were differentiated into astrocytes (Figures 15I and 15J). Astrocyte differentiation was observed mainly within the striatal white matter tracts. These diseased astrocytes lacked the structural complexity typically observed in their healthy counterparts and showed abnormal fiber organization, as previously reported (Figure 15J; Osipovitch, M. et al., "Human ESC-Derived Chimeric Mouse Models of Huntington's Disease Reveal Cell-Intrinsic Defects in Glial Progenitor Cell Differentiation," Cell Stem Cell 24:107-122 (2019)), which is incorporated herein by reference in its entirety.
[0283] Example A3 - Healthy WT hGPCs infiltrate and outcompete resident glia in HD chimeric adult striatum Using established chimeras in which striatal glia are predominantly mHTT-expressing and human, we determined how resident HD human glia respond to the introduction of healthy hGPCs and whether the resident glial population could be displaced to some degree. hGPCs derived from WT hESCs engineered to express mCherry (Figures 1, 2, and 3, hereafter referred to as WT) were engrafted into the striatum of 36-week-old HD chimeras and their expansion was monitored using histology as they competed for striatal dominance (Figure 5).
[0284] After engraftment, WT glia infiltrated the previously humanized striatum and gradually displaced their HD counterparts as they expanded from their transplantation sites (Figure 4). This process was slow but sustained, resulting in substantial regrowth of the HD striatum over time (Figure 4, 54 weeks, p<0.0001; 72 weeks, p<0.0001). Notably, the expansion of WT glia (as opposed to their spatial relocation) was paralleled by a simultaneous elimination of HD glia from the tissue (Figure 4, 54 weeks - P<0.0001; 72 weeks - P<0.0001), typically characterized by a discrete advancing front behind which few HD glia were found (Figure 4).
[0285] Mutually exclusive domains are Olig2 + These formed immediately following competition between GPCs (Figure 4). These constituted the majority of the WT glial population (80.1 ± 4.7% at 72 weeks), which persisted as a new resident GPC pool even after replacing their HD counterparts. Their potential to generate astrocytes was not confirmed by the fact that only a small proportion of these (4.0 ± 1.5% at 72 weeks) expressed GFAP receptors within their newly established domains. + Curiously, within the regions dominated by WT glia, HD astrocytes (GFAP + ) remained (Fig. 4). Nevertheless, Olig2 + and GFAP +The overall ratio between glia and GPCs remained stable throughout the experiment in both populations (Figure 6), indicating that GPC replacement precedes astrocyte replacement, but proportional phenotypic repopulation is achieved over time.
[0286] Interestingly, adult Rag1 cells were not used in the experiment. (- / -) WT hGPCs transplanted into mice were neonatally chimerized with adult Rag1 (- / -) Human-human glial replacement developed at a slower rate than human-mouse glial replacement, expanding more extensively throughout the host striatum than those grafted into mice (Figure 7, 54 weeks: P = 0.14, 72 weeks: P = 0.0009). These results indicate that competitive glial replacement develops with distinct species-specific kinetics between xenogeneic and allogeneic grafts.
[0287] These results are not an artifact of off-target effects derived from gene editing or fluorescent reporter expression toxicity, since co-engrafted hGPCs derived from WT-mCherry and their unmodified counterparts (WT-untagged) (Figure 8) expanded equally in the striatum of HD chimeras, resulting in similar glial regrowth (Figures 9 and 10, 54 weeks - P = 0.5227, 72 weeks - P = 0.1251). Therefore, the analyses performed in (Figure 4) and (Figures 6 and 7) report samples from both experimental paradigms. Of note, while WT and HD glia are strongly separated from each other, the two syngeneic clones of WT glia are seen to be intermixed (Figure 9), suggesting that active recognition precedes competitive exclusion of HD glia from the tissue.
[0288] Example A4 - Human WT glia enjoy a proliferative advantage compared to resident HD glia Striatal repopulation by HD glia proceeded with a gradual depletion of their proliferative cell pool as they expanded and matured within the tissue (Figure S15D). Therefore, we tested whether the selective expansion of young WT glia within the HD striatum was sustained by differences in the proliferative capacity between the two populations. The temporal expression of Ki67 in both WT and HD glial populations was assessed as competitive striatal repopulation unfolded.
[0289] At both 54 and 72 weeks of age, the mitotic fraction of transplanted WT glia was significantly greater than that of resident HD glia (Figure 16A-C, 54 weeks - P<0.0001, 72 weeks - P=0.0120). These data indicate that HD striatal repopulation by WT glia was driven by a relatively enriched proliferative cell pool. As cells aged, this proliferative advantage became less pronounced, but it is important to note that it was maintained throughout the experiment. With this in mind, the sustained proliferative advantage of transplanted WT glia over their HD counterparts should provide the impetus for continuous striatal repopulation beyond the observed experimental time points (Figure 16A-C).
[0290] Considerations for Examples A1 to A4: The striatum of human glial chimeric mice with HD-derived glia is repopulated by their healthy counterparts after transplantation of WT human GPCs (Figure 4). The data presented above suggest that this process was driven by the recurrent occurrence of developmental cell-cell competition (Amoyel, M. & Bach, EA, Development 141:988-1000 (2014) and Baker, NE, Nat Rev Genet 21, 683-697 (2020)), which is dynamically affected in the adult brain. Such cell-cell competition has traditionally been defined by the active purging of relatively slow growing cells from tissues in response to interactions with faster growing neighbors (Morata, G. & Ripoll, P., Dev Biol 42:211-221 (1975); Simpson, P., Dev Biol 69:182-193 (1979); and Simpson, P. & Morata, G., Dev Biol 85, 299-308 (1981), which are incorporated herein by reference in their entireties). Thus, WT human GPCs typically expanded from their transplantation sites in a forward wave that repelled and displaced their previously stably resident HD-derived counterparts upon contact (Figure 4). The expansion of WT hGPCs in this HD glial environment was driven by a sustained proliferative advantage over a portion of these young healthy GPCs, which over time led to extensive colonization of the host brain.
[0291] The enrichment of MYC targets in the transcriptional signature, one of the best described regulators of cell competition (Cova, C. de la, et al. Cell 117:107-116 (2004); Moreno, E. & Basler, K. Cell 117:117-129 (2004); and Villa del Campo, C., et al., Cell Reports 8:1741-1751 (2014), all of which are incorporated by reference in their entireties), further demonstrated the conservation of this mechanism in the elimination of HD hGPCs. Notably, their loss is paralleled by a depletion of ribosomal transcripts and is consistent with the transcriptional profiles of putative "loser" cells during cell competition in the developing mouse embryo (Lima, A. et al. Nat Metabolism 1-18 (2021), incorporated herein by reference in its entirety) and skin (Ellis, SJ et al. Nature 569:497-502 (2019), incorporated herein by reference in its entirety). This observation suggests that regulation of translation and protein synthesis is a determinant of cell competition not only during development but also in the adult brain.
[0292] Interestingly, this process cannot be entirely explained by the deleterious effects of mHtt expression, since when co-engrafted, both clones contributed to humanization of the mouse striatum at the time points evaluated (Figure 11, Figure 12, Figure 13). Repopulation of HD chimeras was rather driven by the age difference between the freshly transplanted, more proliferative WT GPCs and the more mature, relatively quiescent resident HD glia. This notion parallels observations from liver repopulation studies in which allogeneic engraftment of mouse fetal liver precursors into older, but otherwise healthy, hosts was associated with faster and more extensive tissue replacement than engraftment into younger hosts (Menthena, A. et al. Gastroenterology 140:1009-1020.e8 (2011), incorporated herein by reference in its entirety).
[0293] Because both severity and age of onset of HD are tightly correlated with CAG repeat length, using cell lines harboring mHtt with more CAG repeats may better model its effects within the short life span of these chimeras. Nevertheless, the competitive advantage afforded by the difference in age, and therefore mitotic capacity, between resident and newly transplanted GPCs is likely to contribute significantly to the replacement of the resident pool.
[0294] The competitive replacement described here resembles that of mouse glial replacement by transplanted hGPCs, as their expansion in the mouse brain is also maintained by a relative proliferative advantage and proceeds with the elimination of their mouse counterparts upon contact. Moreover, this competitive behavior appears to largely mimic the development of successive waves of GPCs competing with each other, with the oldest being almost completely eradicated from the brain by birth and replaced by their younger successors. These commonalities suggest that cell-cell competition may reveal an essential developmental program that can be resumed in the adult brain environment after the introduction of new, young GPCs.
[0295] Broadly speaking, our observations suggest that the brain may be a much more dynamic structural environment than previously recognized, and that cell-cell competition between glial precursor cells and the astrocytes from which they originate is as important in maintaining the adult brain as it is during development. One can easily imagine how somatic mutations between glia and their precursors could result in selective clonal advantage in one daughter lineage or the other, leading to the relentless replacement of the population by the descendants of the dominant daughter. Such a mechanism could contribute to the accelerated disease progression of disorders in which genomic instability and somatic mutations may result in cells with different competitive advantages, which in turn may have a competitive advantage over their sibling clones. This scenario is typical of the development of a wide range of carcinogenesis in the brain and of glioma formation, but may equally be involved in the development of non-neoplastic adult-onset disorders in which glial cells are causally involved, such as some childhood-onset schizophrenia and HD itself.
[0296] This study lays the foundation for the development, as well as the study, of mechanisms underlying in vivo cell-cell competitive interactions between human glia in various contexts. Practically, the present data suggest that diseased human glia could potentially be replaced after the introduction of younger, healthier hGPCs. Indeed, such glial replacement could provide a viable strategy towards cell-based treatment of various neurological diseases. This study demonstrates that human glia affected by a prototypic neurodegenerative disease could be replaced by their healthy counterparts in vivo after transplantation of healthy human GPCs. A new humanization platform has been established that allows predicting the likely efficiency of human glial replacement in various disease contexts while simultaneously interrogating the mechanisms by which the replacement occurs. The mechanistic insights gained in this study may enable strategies to further enhance the rate and extent of human glial replacement after hGPC delivery. Taken together, these data highlight the potential of hGPCs as a cellular vector for the treatment of those diseases of the human CNS in which glial cells are causally involved.
[0297] Example A5 - Human WT glia assume a dominant competitor profile when encountering HD glia Having established that transplanted WT hGPCs effectively colonize HD glial chimeric striatum at the expense of resident mHTT-expressing glia, we next sought to define the molecular signals underlying their competitive advantage. To that end, we analyzed the transcriptional profiles of WT and HD human glia isolated from the striatum of chimeras in which the two cell populations were co-resident and in competition, as well as from their respective controls in which one or the other was transplanted without the other, using single-cell RNA sequencing (scRNA-seq, 10X Genomics, v3.1 chemistry) (Figure 20A). After integration of all captures and alignment against human sequences, Louvain community detection revealed six major populations of human glia, including hGPCs, circulating hGPCs, immature oligodendrocytes (iOLs), neural progenitor cells (NPCs), astrocytes, and their intermediate progenitors (astrocyte progenitor cells, APCs) (Figure 20B-D). Within these populations, cell cycle analysis predicted a higher proportion of actively proliferating G2 / M phase cells in competing WT cells compared to their HD counterparts (Figure 20E), consistent with histological observations (Figure 19). To proceed, we focused on hGPC as the primary competing population in our model. Pairwise differential expression revealed distinct sets of differentially expressed genes across groups (Figure 20F), and subsequent functional analysis using Ingenuity pathway analysis (IPA) within the hGPC population revealed a number of prominent terms related to their competition (Figure 20G).
[0298] During competition, WT GPCs were found to activate pathways driving protein synthesis, whereas HD GPCs were predicted to downregulate them. Predicted upstream transcription factor activation identified YAP1, MYC, and MYCN - conserved master regulators of cell growth and proliferation - as significantly modulated across experimental groups. Importantly, we found that YAP1 and MYC targets were selectively downregulated in competing HD GPCs compared to their controls (Figure 20G). Notably, this downregulation was accompanied by a marked repression of ribosome-encoding genes (Figure 20I). Conversely, competing WT hGPCs showed upregulation of expression of both YAP1 and MYC targets, as well as ribosome-encoding genes, compared to controls (Figure 20G-H). Thus, these data suggest that transplanted WT hGPCs, upon contact with their HD counterparts, actively assumed a competitively dominant phenotype to promote their own expansion and colonization while driving the local elimination of the latter.
[0299] Example A6 - Age differences drive competitive human glial regrowth Because WT cells transplanted into adult hosts were fundamentally younger than the resident host cells they displaced, we next asked whether differences in cell age, in addition to disease state, might have contributed to the competitive success of late donor cells. To that end, we engrafted the striatum of 40-week-old adult glial chimeras with hGPCs newly generated from WT hESCs engineered to express EGFP, which had been engrafted perinatally with hGPCs derived from mCherry-tagged or otherwise allogeneic WT hESCs (Figure 17A). We then histologically monitored the expansion of transplanted cells to map the relative fitness and competitive performance of these pools of allogeneic, but otherwise clearly aged, hGPCs.
[0300] We noted that the expansion of transplanted WT glia in the striatum of WT chimeras was strikingly similar to their expansion in the striatum of HD chimeras (Figure 4). After engraftment, younger WT glia rapidly infiltrated the previously humanized striatum, progressively displacing their senescent counterparts as they expanded from the transplantation site, eventually resulting in substantial recolonization of the tissue (Figures 17B-D and E, P<0.0001). Their expansion was paralleled by a localized elimination of senescent WT glia (Figures 17B-D and F, P<0.0001), which was also characterized by a distinct advancing front behind which few already resident WT glia were found (Figure 17C). Accordingly, we also noted that the mitotic rate of transplanted WT glia was significantly greater than that of their resident senescent counterparts (Figures 17G-I, P=0.018). Taken together, these data indicated that repopulation of the human WT glial chimeric striatum with younger syngeneic hGPCs was accompanied by replacement of older cells by their younger counterparts and was driven in part by the relative expansion of younger, more mitotically active cell populations.
[0301] Example A7 --Young cells replace their older counterparts through the induction of apoptosis Since younger glia appeared to exert a clear competitive advantage over their older counterparts, we next asked whether the elimination of older glia by younger cells occurred passively as a result of the higher proliferation rate of younger cells, leading to a relative attrition of older resident counterparts during normal turnover, or whether the replacement was actively driven by the induction of programmed cell death in older cells by more fit younger cells. To address this question, we used the TUNEL assay to compare the rates of apoptosis in aged and young WT glial populations as they competed at their respective baselines in the host striatum, as well as in single transplant controls. As competitive repopulation unfolded, aged WT glia were found to have undergone apoptosis at a significantly higher rate than their young counterparts (Figure 23A-C, P<0.0001). Importantly, the increased apoptosis of older resident glia appears to be driven by interactions with younger cells, as we found a significantly higher proportion of senescent glia to be apoptotic in chimeras transplanted with younger cells as adults than in controls that did not receive later adult injections (Figure 23A-C, P=0.0013). These data suggest that senescent resident glia confronted with their younger counterparts are actively eliminated, at least in part, via apoptosis induced by encounter with younger hGPCs, and that the higher relative fitness of hGPCs allowed them to repopulate the chimeric host striatum.
[0302] Example A8 - Young hGPCs acquire a dominant signature when challenged with older syngeneic cells To determine whether the molecular signals underlying the competitive advantage of younger WT glia over aged WT glia are similar to those underlying their advantage over HD glia, we used scRNA-seq to analyze the transcriptional signatures of competing young and aged WT glia and their respective controls (Figure 21A). Within the sequenced populations (Figures 21B-D), we found that the proportion of competing aged WT cells in the G2 / M phase of the cell cycle was significantly lower than their younger counterparts (Figure 21E), consistent with the histological data (Figure 17I). Differential expression analysis revealed distinct sets of genes differentially expressed between competing young and aged WT GPCs (Figures 21F and H), and subsequent IPA analysis of those gene sets revealed a similar signature to that observed between donor (young) WT and already resident (aged) HD GPCs in the competing allograft model (Figure 21G). Notably, genes functionally associated with protein synthesis, including ribosomal genes, as well as upstream YAP1, MYC, and MYCN signaling, were all activated in competing young WT GPCs compared to their aged counterparts (Figure 21G). However, despite these similarities, in other respects, aged WT GPCs responded differently to freshly transplanted WT GPCs than HD GPCs. In contrast to HD GPCs, aged WT cells faced with younger isogeneic competitors upregulated both YAP1 and MYC targets, with a concomitant upregulation of ribosomal genes (Figure 21I), compared to their uncompeted controls (Figure 21G). This difference in their profiles may represent an intrinsic ability to respond competitively when challenged, which HD hGPCs expressing mHTT lack. Nevertheless, this upregulation was insufficient to match the greater fitness of their younger counterparts, which also revealed (but to a greater extent) selective upregulation of YAP1 and MYC targets as well as ribosomal genes compared to their uncompetitive controls (Figure S21G-H).Taken together, these data indicate that determinants of relative cytofitness can be conserved across different challenge scenarios, and that the resulting competitive outcome is greatly influenced by the relative age of the competing populations.
[0303] Example A9 - Competitive advantage is linked to distinct sets of transcription factors Next, we asked what gene signature defines the competitive advantage of newly transplanted human GPCs over resident cells. To that end, we applied a multi-step analysis using lasso-regulated logistic regression (Figure 22A) that identified five TFs (CEBPZ, MYBL2, MYC, NFYB, TFDP1) whose activity can significantly explain the advantage of young WT GPCs over both aged HD and aged WT GPCs. These five TFs and their putative targets were identified as gene sets (regulons) upregulated in young WT cells (normalized enrichment score [NES]>0, adjusted p<10) in both allograft and isograft models. -2 ) (Figure 22D). We also noticed that although their activities varied in the absence of competition (aged HD, aged WT, young WT alone), their average activities were higher in the dominant young WT cells in both allograft (vs. HD) and isograft (vs. older syngeneic autologous) paradigms, especially in MYC (Figure 22E).
[0304] Next, we set out to identify a cohort of genes with defined expression patterns as well as significant overlap with the five prioritized regulons mentioned above. We first used weighted gene co-expression network analysis (WGCNA) to detect a total of 19 modules in the GPC dataset (Figure 22A). Six modules harbored genes with significant overlap with targets of CEBPZ, MYBL2, MYC, NFYB, and TFDP1 (Figure 22B). We then asked whether the expression patterns of prioritized modules could be explained by the age of the cells (young vs. old), their genotype (HD vs. WT), or both. WGCNA defined a module eigengene as the first principal component of the gene cohort, thereby representing the general expression pattern of all genes in that module. Therefore, we constructed a linear model in which the module eigengene was a response described by both age and genotype. It was observed that the brown, red, and cyan modules were primarily affected by age, whereas the black, blue, and green modules were affected by both age and genotype (Figure 22C).
[0305] MYC (Figures 20 and 21), whose regulated pathway activation was already speculated to confer a competitive advantage, was also one of the five prioritized TFs. Therefore, we further characterized the MYC regulon and its downstream targets, noting how these downstream targets were also regulated by other prioritized TFs (Figure 22F). Interestingly, although MYC localized to the brown module, the majority of its targets belonged to the blue module. Although the blue module genes were similarly expressed in the non-competitive control paradigm, their expression levels were higher in young WT compared to aged HD in the WT vs. HD allograft paradigm (Figure 22B), a pattern suggesting that the blue signature was not activated unless the cells were in a competitive environment. Furthermore, we noted lower expression of these genes in aged HD compared to aged WT hGPCs (Figure 22E-F), which may highlight the inherently greater competitive capacity of WT cells and is consistent with previous observations that aged WT hGPCs respond differently than HD hGPCs when challenged with newly engrafted WT hGPCs. Importantly, the blue module eigengenes could be described by both genotype and age, demonstrating that the competitive advantage associated with MYC signaling was driven by both of these variations. Thus, targets within this network were enriched for pathways regulating cell proliferation (TP53, RICTOR, YAP), gene transcription (MYCN, MLXIPL), and protein synthesis (LARP1), each of which have been previously mentioned as differentially expressed in each competition scenario (Figure 20 and Figure 21). Thus, the output of this competition-induced regulatory network appeared to confer a competitive advantage to young WT hGPCs when introduced into the adult brain, regardless of whether they were faced with older HD-derived or allogeneic syngeneic hGPCs.
[0306] Example - Part B Rejuvenation of glial precursor cells or their progeny Experimental model and subject details Human subjects Details of fetal and adult brain samples are detailed in the Methods section "Adult and fetal brain processing for cell isolation." Gender of fetal samples was not provided during tissue acquisition.
[0307] cell line The human iPSC line C27 was used to generate hGPCs in which the predicted transcripts of interest were verified. The C27 line is male and was obtained from Lorenz Studer. Cells were differentiated into GPCs as detailed in the Methods section (see Generation of GPCs from human iPSCs) (Chambers et al., 2009).
[0308] Learn how Adult and fetal brain processing for cell isolation Human brain samples were obtained from consenting patients at the University of Rochester Strong Memorial Hospital under approved Institutional Review Board protocols. Brain tissue was obtained from normal GW18-24 cortical and / or VZ / SVZ dissections or adult white matter / cortical epilepsy resections (18F, 19M, and 27F for mRNA, and 8M, 20F, 43M, and 54F for miRNA). + / PSA-NCAM - Fetal GPC acquisition, dissociation, and immunomagnetic sorting of cells were as described (Windrem et al., 2004). GPCs were isolated from dissociated tissues using a dual immunomagnetic sorting strategy as described (Windrem et al., 2004; Windrem et al., 2008) and immunolabeled with mouse anti-PSA-NCAM using rat anti-mouse IgM tagged with microbeads (Miltenyi Biotech). + (Millipore, DSHB) cells were depleted and then A2B5 + (clone 105, ATCC, Manassas, VA) cells were treated with PSA-NCAM -Pool selection was performed. After sorting, cells were maintained in DMEM-F12 / N1 containing 10 ng / ml bFGF and 20 ng / ml PDGF-AA for 1-14 days. Alternatively, CD140a / PDGFαR-defined GPCs were isolated and sorted using MACS as described (Sim et al., 2011b) and identified as CD140 + An enriched population of glial progenitor cells was obtained.
[0309] Bulk RNA sequencing RNA was purified from the isolates via Qiagen RNeasy kit and bulk RNA sequencing libraries were constructed. Samples were deep sequenced on an Illumina HiSeq 2500 at the University of Rochester Genomics Research Center. Raw FASTQ files were trimmed and adapters removed using fastp (Chen et al., 2018), aligned to GRCh38 via STAR in two-pass mode across all samples using Ensembl 95 gene annotations (Dobin et al., 2013) and quantified with RSEM version (Li and Dewey, 2011). Subsequent analyses were performed in R (R Core Team, 2017) with RSEM gene-level results imported via tximport (Soneson et al., 2015). DE analysis was performed with DESeq2 (Love et al., 2014), and paired analyses (fetal A2B5+ vs. CD140a+, fetal CD140a+ vs. CD140a-) added paired information to the model. For adult vs. fetal DE analysis, age was concatenated with sorting markers (CD140a- samples were not included) to define group variation, where sequencing batch was also added to the model to account for technical variability. Genes with an adjusted p-value of less than 0.01 and absolute log2 fold change >1 were considered significant. These data were then further filtered by meaningful abundance, defined as a median TPM (calculated via RSEM) of 1 in at least one group (20,663 genes met this criterion prior to DE).
[0310] scRNA-Seq analysis Single cells express CD140a + or PSA-NCAM - / A2B5 +Fetal brain samples processed as above for bulk rna-seq until sorted via FACS for either surface expression. Single cells were then acquired on a 10X genomics chrome controller utilizing V2 chemistry and libraries generated according to manufacturer's instructions. Samples were sequenced on an Illumina HISEQ 2500 system. Demultiplexed samples were then aligned and quantified using Cell Ranger against indices generated from GRCh38 and Ensembl95 gene annotations using only protein-coding, lncRNA, or miRNA biotypes. Analysis of scRNA-Seq samples was performed via Seurat (Butler et al., 2018) within R. Both samples were merged and low quality cells were removed, as defined by having mitochondrial gene expression above 15% or having less than 500 unique genes. Samples were then normalized utilizing SCTRANSFORM, which took care to regress contributions from the total number of UMIs, mitochondrial gene content, or differences in S-phase and G2M-phase scores for each cell. We then calculated PCA and performed UMAP using the first 30 dimensions with n.neighbors=60 and repulsion.strength=0.8. We then ran FindNeighbors followed by FindClusters with resolution set to 0.35. Based on the expression profile of each cluster, several similar clusters were merged into broader cell type clusters. Static differential expression of clusters was calculated using MAST test (Finak et al., 2015), and adjusted p-values less than 0.01 and absolute log2 fold changes greater than 0.5 were considered significant. Prediction of active transcription factor regulons was performed with the SCENIC package in R (Aibar et al., 2017) using the hg38 database found at resources.aertslab.org / cistarget / . Genes were included in the co-expression analysis if they were expressed in at least 1% of cells.
[0311] Ingenuity Pathway Analysis and Network Construction Differentially expressed genes were fed into Ingenuity Pathway Analysis (Qiagen) to determine significant canonical, functional, and upstream signaling terms. For construction of the IPA network, terms were filtered for adjusted p-values less than 0.001. Irrelevant IPA terms were removed along with highly redundant functional terms assessed via jaccard similarity index using the iGraph package (Csardi, 2006). Modularity was established within Gephi (Bastian et al., 2009) and the final network was visualized using Cytoscape (Shannon, 2003). Genes and terms of interest were retained for visualization purposes. Modules were partitioned from each other and organized using yFiles organic layout.
[0312] Inference of transcription factor activity Adult and fetal enriched gene lists were fed separately into RcisTarget (Aibar et al., 2017) to identify over-representation of motifs in windows (500bp up / 100bp down and 10kb up and 10kb down) around the promoters of genes. Transcription factors associated with significantly enriched motifs (NES>3) were then filtered by their significant differential expression in the input gene list. Within each window and gene list, only relevant TF-gene interactions (repressors that downregulate the gene and activators that upregulate the gene) were retained. The scan windows were then merged to generate a TF-gene edge list of predicted fetal / adult repressors / activators. We finally narrowed down the TFs of interest to those that have been primarily reported in the literature as sole activators or repressors.
[0313] miRNA microarray analysis A2B5 + Adult (n=3) and CD140a +Fetal (n=4) cell suspensions were isolated via MACS as described above and their miRNAs were isolated using the miRNeasy kit according to the manufacturer's instructions (QIAGEN). Purified miRNAs were then prepared and profiled on Affymetrix GeneChip miRNA3.0 arrays as directed by their standard protocol. Raw CEL files were then read into R via the oligo (Carvalho and Irizarry, 2010) package and samples were normalized via robust multi-array averaging (RMA). Probes were then filtered for human miRNAs only according to Affymetrix annotations and differential expression was performed with limma (Ritchie et al., 2015) where significance was established at an adjusted p-value of less than 0.01. Finally, differentially expressed miRNAs were surveyed across five independent miRNA prediction databases using MIRNATAP (Pajak M, 2020) with min_src set to 2 and method set to "geom". Transcription factor regulation of miRNAs was performed via querying the TrasmiR V2.0 database ( Tong et al., 2019 ).
[0314] Exploratory Analysis and Visualization PCA of bulk RNA-Seq or microarray samples was calculated via prcomp using the default settings of variance stabilization values in the DESeq2 object. PCA was plotted via autoplot in the ggfortify package. Volcano plots were generated using EnhancedVolcano. Graphs were further edited or newly generated using ggplot2 and aligned using patchwork.
[0315] Generation of human iPSC-derived GPCs Human induced pluripotent stem cells (C27 (Chambers et al., 2009)) were differentiated into GPCs using previously described protocols (Osipovitch et al., 2019; Wang et al., 2013; Windrem et al., 2017). Briefly, cells were differentiated first into neuroepithelial cells, then into pre-GPCs, and finally into GPCs. GPCs were maintained in glial medium supplemented with T3, NT3, IGF1, and PDGF-AA.
[0316] Lentiviral overexpression For overexpression of E2F6, ZNF274, IKZF3, or MAX, we first identified the most abundant protein-encoding transcripts of each of these genes from the adult hGPC dataset. The cDNA of each transcript was cloned downstream of the tetracycline response element promoter in the pTANK-TRE-EGFP-CAG-rtTA3G-WPRE vector. Viral particles pseudotyped with vesicular stomatitis virus G glycoprotein were produced by transient transfection of HEK293FT cells, concentrated by ultracentrifugation, and titrated by QPCR (qPCR Lentivirus Titer Kit, ABM-Applied Biological Materials Inc). iPSC(C27)-derived GPC cultures (160–180 days in vitro) were infected in glial medium at 1.0 MOI for 24 h. Cells were washed with HBSS and maintained in glial medium supplemented with 1 μg / ml doxycycline (Millipore-Sigma St. Louis, MO) for the remainder of the experiment. Transduced hGPCs were visualized with DAPI at 3, 7, and 10 days after the initial addition of doxycycline. - / EGFP + Doxycycline control cells were isolated via FACS on expression. - Selected alone.
[0317] quantitative PCR RNA from overexpression experiments was extracted using RNeasy micro kit (Qiagen, Germany). First-strand cDNA was synthesized using TaqMan Reverse Transcription Reagents (Applied Biosystems, USA). qPCR reactions were performed in triplicate by loading 1 ng of RNA mixed with FASTSTART UNIVERSAL SYBRGREEN MASTERMIX (Roche Diagnostics, Germany) and analyzed on a real-time PCR instrument (CFX Connect Real-Time System thermocycler, Bio-Rad). Results were normalized to the expression of 18S from each sample.
[0318] Quantification and statistical analysis For qPCR experiments, significant differences in delta CT for each gene were analyzed in a linear model constructed by the interaction of overexpression condition and time point with the addition of cell batch covariate. Post-hoc pairwise comparisons were tested via least squares means tests against Dox control within time points using the lsmeans package (Lenth, 2016). P values were adjusted for multiple comparisons using the false discovery rate method, whereby a p value of less than 0.05 was considered significant.
[0319] Additional Resources Bulk and scRNA sequencing data from this paper and related previous publications can be explored in our Shiny app at GlialExplorer.org or ctngoldmanlab.genialis.com.
[0320] Example B1 - CD140a selection enriches more efficiently for human fetal glial progenitor cells than A2B5 To identify concomitants to GPC senescence, we first used bulk and single-cell RNA-Seq to characterize hGPCs derived from second-trimester fetal human tissues, whether isolated by targeting the CD140a epitope of PDGFRα or the glial ganglioside recognized by monoclonal antibody A2B5. To that end, two sample-matching experiments were performed, whereby the ventricular / subventricular zones (VZ / SVZ) of fetal brains at 18–22 weeks gestational age (ga) were dissociated and sorted via fluorescence-activated cell sorting (FACS) for either CD140a+ and A2B5+ / PSA-NCAM- (A2B5+) GPCs, or CD140a+ GPCs and CD140a-depleted remnants (n=5, Figure 25A) isolated from the same fetal brains (n=3).
[0321] Bulk RNA-Seq libraries were then generated and deep sequenced for both experiments. Principal component analysis (PCA) showed separation of CD140a+ and A2B5+ cells, as well as further separation of both from CD140a-depleted samples (Figure 25B, Figure 31A-B). Differential expression (p<0.01, absolute log2 fold change>1) in both paired cohorts identified 723 genes as differentially expressed between CD140a+ and A2B5+ GPCs (435 in CD140a and 288 in A2B5). In contrast, 2,629 genes distinguished CD140a+ GPCs from CD140a- cells (Figure 25C and Figure 31C-D). The direction of differential gene expression was highly consistent when comparing CD140+ with either A2B5+ or CD140- cells, with all but four genes being consistent (Figure 31E).
[0322] Pathway enrichment analysis using Ingenuity Pathway Analysis (IPA) of both of these gene sets identified similar pathways as relatively active in CD140+ GPCs, including cell motility, oligodendrocyte differentiation, lipid synthesis, and downstream PDGF, SOX10, and TCF7L2 signaling (Figure 25). As expected, stronger activation Z-scores were typically observed when comparing CD140a+ GPCs to CD140a- cells but not A2B5+ GPCs. Interestingly, CD140a+ cells also differentially expressed several pathways related to the immune system, likely due to a small amount of microglial contamination as a result of re-expression of the PDGFaR epitope on the microglial surface. A2B5+ samples further showed upregulated ST8SIA1, an enzyme involved in A2B5 synthesis, as well as proneural pathways.
[0323] Among the genes differentially upregulated in CD140a+ isolates were PDGFRA itself, as well as several early oligodendrocyte genes, including OLIG1, OLIG2, NKX2-2, SOX10, and GPR17 (Figure 25E-F). Furthermore, the CD140a+ fraction also exhibited increased expression of genes associated with late myelogenesis, including MBP, GAL3ST1, and UGT8. Beyond the enrichment for oligodendrocyte lineage, many genes typically associated with microglia were also enriched in CD140a isolates, including CD68, C2, C3, C4, and TREM2. In contrast, A2B5+ isolates exhibited enrichment for astroglial (AQ4, CLU) and early neuronal (NEUROD1, NEUROD2, GABRG1, GABRA4, EOMES, HTR2A) genes, suggesting expression of A2B5 by immature astrocytes and neurons as well as GPC and oligodendrocyte lineage cells. Overall, then, oligodendrocyte enrichment was significantly greater in CD140a+ GPCs than A2B5-defined GPCs when comparing each to the depleted fraction, suggesting that CD140a isolates were more enriched in hGPCs and thus CD140a is the more appropriate phenotype for direct comparison with adult hGPCs.
[0324] Example B2 - Single-cell RNA sequencing reveals cellular heterogeneity within human fetal GPC isolates To further delineate the composition of fetal hGPC isolates at single cell resolution, we isolated both CD140a+ and A2B5+ hGPCs from 20-week ga fetal VZ / SVZ via FACS and then assayed the transcriptome of each by single cell RNA-Seq (Figure 25A, 10X Genomics V2). We attempted to obtain over 1,000 cells of each, and after filtering low quality cells (<500 unique genes, >15% mitochondrial gene percentage), we were left with 1,053 PSA-NCAM- / A2B5+ and 957 CD140a+ high quality cells (median 6,845 unique molecular identifiers and 2,336 unique genes per cell, Figure 32). Dimensionality reduction by uniform manifold approximation and projection (UMAP), followed by shared nearest neighbor modularity-based clustering of all cells using Seurat (Butler et al., 2018), revealed 11 clusters with eight primary cell types, as defined by differential enrichment of marker genes. These primary cell types include GPCs, pre-GPCs, neural progenitor cells (NPCs), immature neurons, neurons, microglia, and a cluster consisting of endothelial cells and pericytes. CD140a+ FACS isolates were found to be more enriched for GPC and pre-GPC populations than fetal A2B5+ / PSA-NCAM- cells (Figure 26A-D, Figure 33A-C). Furthermore, whereas CD140a-sorted cells were primarily restricted to GPCs and pre-GPCs with only scattered microglial contamination, A2B5+ / PSA-NCAM- isolates also contained astrocytes and neuronal lineage cells despite prior depletion of neuronal PSA-NCAM (Figure 33A-C). These data supported the more selective and phenotypically restricted nature of CD140a rather than A2B5-based GPC isolation.
[0325] Based on that, we next explored the gene expression profiles of the dominant cell populations in CD140a+ fetal isolates, GPCs, and pre-GPCs (Figure 33B). Differential expression between these two pools resulted in 269 (143 upregulated, 126 downregulated, p<0.01, log2 fold change>0.5, Figure 26E). During the transition from pre-GPCs to GPCs, early oligodendrocyte lineage genes were rapidly upregulated (OLIG2, SOX10, NKX2-2, PLLP, APOD), whereas those expressed in pre-GPCs were effectively lost (VIM, HOPX, TAGLN2, TNC). Interestingly, genes involved in the human leukocyte antigen system, including HLA-A, HLA-B, HLA-C, and B2M, were all downregulated as cells transitioned to the GPC stage (Figure 26F). IPA analysis showed that pre-GPCs were relatively enriched for terms related to migration, proliferation, and astrocyte identity (BMP4, AGT, and VEGF signaling), whereas GPCs showed enrichment for terms related to acquisition of oligodendrocyte identity (PDGF-AA, FGFR2, CCND1) in addition to activation of the MYC and MYCN pathways (Figure 26G). Using single-cell co-expression data along with promoter motif enrichment using the SCENIC package (Aibar et al., 2017), we then identified 262 transcription factors predicted to be relatively activated in GPCs versus pre-GPCs (Wilcoxon rank sum test, p<0.01). These included SATB1, as well as early GPC specification factors OLIG2, SOX10, and NKX2-2 (Figure 26H).
[0326] Example B3 - Human adult GPC and fetal GPC are transcriptionally distinct Next, we asked how adult hGPCs might differ transcriptionally from fetal hGPCs. To this end, we isolated A2B5+ hGPCs from surgically resected adult human temporal neocortex (ages 19–21, n=3) and assessed their bulk RNA expression, along with four additional fetal CD140a+ samples. It was previously noted that A2B5 selection is sufficient to isolate GPCs from adult human brain and is more sensitive in that respect than CD140a, given the maturation-associated downregulation of PDGFRA expression in adult hGPCs (Sim et al., 2006; Windrem et al., 2004). Confirming that prior observation, here we found that PDGFRA in A2B5+ adult GPCs was expressed at a median TPM of 0.55, compared with a median TPM of 47.56 in fetal A2B5+ cells. By pairing sequencing and analysis with fetal CD140a-selected cells, we were able to regress sequencing batch effects while simultaneously increasing power (Figure 27A). Depletion of PSA-NCAM+ cells was not necessary for adult hGPC samples because expression of PSA-NCAM ceases in adult cortex and white matter (Seki and Arai, 1993). As a result, PCA of human adult and fetal GPCs showed tight clustering of adult GPCs that was sharply separated from both sorted fetal hGPC pools (Figure 27B). Differential expression of adult GPCs compared to either A2B5+ or CD140a+ fetal GPC populations yielded 3,142 and 5,282 significant genes, respectively (p<0.01, absolute log2 fold change>1) (Figure 27C). To refine the definition of differential expression, downstream analysis was performed on the intersecting 2,720 genes (Figure 27D, 1,060 up-regulated and 1,660 down-regulated in adult GPCs compared to fetal hGPCs). Surprisingly, 100% of the genes were directionally consistent within these two sets of differentially expressed genes.
[0327] To better understand the differences between adult and fetal GPCs, we next constructed a gene ontology network of non-redundant significant IPA terms and their contributing differentially expressed genes (Figure 27D-E). Spin-glass crowd detection of this network revealed three modules (modules M1-M3) of highly connected functional terms (Figure 27E) and genes (Figure 27F). M1 contained terms and genes related to glial development, proliferation, and motility. Notably, several genes related to GPC ontogeny were downregulated in adult GPCs, including CSPG4 / NG2, PCDH15, CHRDL1, LMNB1, PTPRZ1, and ST8SIA1. In contrast, numerous genes whose appearance precedes and follows oligodendrocyte differentiation and myelination were upregulated in adult GPCs, including MAG, MOG, MYRF, PLP1, CD9, CLDN11, CNP, ERBB4, GJB1, PMP22, and SEMA4D.
[0328] Module 2 harbored a large number of terms related to cellular senescence and the regulation of proliferation and senescence. Cell cycle progression and mitosis were predicted to be activated in fetal GPCs, with a strong enrichment of growth factors including MKI67, TOP2A, CENPF, CENPH, CHEK1, EZH2, and a number of cyclins including CDK1 and CDK4. Furthermore, proliferation-inducing pathways were also presumed to be activated, including MYC, CCND1, and YAP1 signaling, of which both YAP1 and MYC transcripts were upregulated as well. In this regard, transient overexpression of MYC in aged rodent GPCs has recently been shown to restore their capacity for both proliferation and differentiation. Conversely, adult GPCs exhibited upregulation of transcripts associated with senescence, including E2F6, MAP3K7, DMTF1 / DMP1, OGT, AHR, RUNX1, and RUNX2. Concomitantly, adult hGPCs exhibited downregulation of fetal transcripts including LMNB1, PATZ1, BCL11A, HDAC2, FN1, EZH2, and YAP1, as well as its cofactor TEAD1. As a result, functional terms predicted to be active in adult hGPCs include aging, the onset of rapid aging observed in Hutchinson-Gilford Progeria Syndrome, and cyclin-dependent kinase inhibitory pathways downstream of CDKN1A / p21 and CDKN2A / p16. Furthermore, AHR and its signaling pathway, which are involved in driving aging via inhibition of MYC, were similarly upregulated in adult GPCs.
[0329] Module 3 consisted primarily of development- and disease-linked signaling pathways that are also associated with aging. This included predicted activation of ASCL1 and BDNF signaling in fetal hGPCs, and MAPT / Tau, APP, and REST signaling in adult GPCs. Overall, transcriptional and functional profiling of adult GPCs revealed a reduction in transcripts associated with proliferative capacity and a shift towards an aged and more mature phenotype.
[0330] Example B4 - Inference of transcription factor activity implicates adult GPC transcriptional repressors Given the striking transcriptional disparity between adult and fetal GPCs, we next asked whether we could infer which transcription factors direct their identity. To accomplish this, we first scanned two promoter windows (500bp up / 100bp down, 10kb up / 10kb down) of the adult or fetal enriched GPC gene sets to infer significantly enriched TF motifs. This identified 48 TFs that were also differentially expressed in the scanned intersection dataset (Figure 34). Among these, we focused on TFs whose primary means of DNA interaction was either exclusively repressive or stimulatory, while also considering the enrichment of their known cofactors. This analysis resulted in 12 potential upstream regulators to explore (Figure 28A-C), including four adult repressors, E2F6, ZNF274, MAX, and IKZF3; one adult activator, STAT3; three fetal repressors, BCL11A HDAC2, and EZH2; and four fetal activators, MYC, HMGA2, NFIB, and TEAD2. Interestingly, among these predicted TFs, three groups shared high motif similarity matches within their target promoters, suggesting that they may cooperate or compete for DNA binding at shared loci (Figure 28A and Figure 34).
[0331] We then constructed four potential signaling pathways based on the curated transcriptional interactions to predict those genes targeted by sets of TFs (Figure 28D-G). Among the activators enriched in fetal GPCs (Figure 28D), the growth factor MYC, NFIB, a key determinant of gliogenesis, TEAD2, a YAP / TAZ effector, and another growth factor, HMGA2, were each predicted to activate a cohort of progenitor genes, including both mitosis-related transcripts and those demonstrated to inhibit the onset of senescence. Direct positive regulation was also predicted among these four fetal activators, with NFIB driven by HMGA2 and TEAD2, MYC driven by TEAD2 and NFIB, HMGA2 driven by MYC and TEAD2, and TEAD2 reciprocally driven by MYC (Figure 28D). In contrast to these fetal activators, fetal repressors including the C2H2-type zinc finger BCL11A, the polycomb repressive complex subunit EZH2, and the histone deacetylase HDAC2 were each predicted to repress more mature oligodendrocyte gene expression at this stage (Figure 28E). Moreover, all three of these TFs were predicted to inhibit targets involved in aging. Thus, these factors appear to directly regulate downstream transcriptional events that lead to the maintenance of the cycling progenitor state.
[0332] Next, we assessed these predicted adult GPC signaling networks for potential mechanisms involved in their age-related gene expression changes. STAT3 was predicted to shift GPC identity to glial maturity via upregulation of a large cohort of oligodendrocyte genes associated with early differentiation and myelination (Figure 28F). In addition, STAT3 was also predicted to activate a series of aging-related genes, including BIN1, RUNX1, RUNX2, DMTF1, CD47, MAP3K7, CTNNA1, and OGT. Concurrently, repression in adult GPCs was predicted to be influenced by the Ikaros family zinc finger IKZF3 / Aiolos, the KRAB (kruppel associated box) zinc finger ZNF274, the MYC-associated factor MAX, and the cell cycle regulator E2F6 (Figure 28G). Targeting with this set of transcription factors predicted the repression of these gene sets that contribute to the fetal GPC signature, which was indeed observed with the downregulation of the early progenitor genes PDGFRA and CSPG4, and the cell cycle genes CDK1, CDK4, and MKI67. Repression of YAP1, LMNB1, and TEAD1 was also predicted, whose expression delays or prevents the onset of aging. Interestingly, this set of four adult repressors predicted downregulated expression of each of the fetal enriched activators NFIB, MYC, TEAD2, and HMGA2, in addition to the fetal enriched repressors BCL11A, EZH2, and HDAC2.
[0333] Example B5 - Expression of adult-enriched repressors induces age-related transcriptional changes in GPCs We next asked whether the four adult-enriched transcriptional repressors we identified in Figure 28G, E2F6, IKZF3, MAX, and ZNF274, were sufficient to induce aspects of age-related changes in gene expression by otherwise young GPCs. To accomplish this, we engineered doxycycline (Dox)-inducible overexpression lentiviruses for each transcription factor (Figure 29A).
[0334] Briefly, we first identified which protein-coding isoforms of each repressor were most abundant in adult GPCs to best mimic endogenous age-related upregulation, and these candidates were E2F6-202, IKZF3-217, MAX-201, and ZNF274-201 (Figure 35). These cDNAs were cloned downstream of a tetracycline response element promoter and upstream of a T2A self-cleaving EGFP reporter (Figure 29A). Human induced pluripotent stem cell (iPSC)-derived hGPC cultures prepared from the C27 line were then infected for 24 hours as previously described in Wang et al., 2013, Cell Stem Cell 12, 252-264, and then treated with Dox to induce overexpression of the transgene. C27 iPSC-derived GPCs were selected because their transcriptome resembles that of fetal GPCs (Figure 36), and they are similarly able to engraft and myelinate dysmyelinating mice upon transplantation. Overexpressing cells were selected via FACS for EGFP expression 3, 7, and 10 days after Dox addition (Figure 29B, n=3-5). Uninfected cultures treated with Dox were used as controls.
[0335] RNA was extracted and the age-related genes of interest were analyzed by qPCR. Significant induction of each adult-enriched repressor was observed at each time point after Dox supplementation (Figure 29C). MKI67 and CDK1, genes whose upregulation is associated with active cell division, were significantly repressed at two or more time points in each overexpression paradigm (Figure 29D). This was consistent with their decreased expression in adult GPCs (Figure 27F), suggesting their direct repression by E2F6, MAX, and ZNF274 (MKI67), or all four (CDK1). The GPC stage marker PDGFRA, the cognate receptor for PDGF-AA, was also significantly repressed at two time points in IKZF3-transduced GPCs, as well as in E2F6-transduced GPCs at day 3, consistent with its repression in normal adult GPCs. Interestingly, the senescence-associated cyclin-dependent kinase inhibitor CDKN1A / p21 was upregulated at all time points in response to each of the repressors tested, whereas CDKN2A / p16 was similarly upregulated at all time points in ZNF274-transduced hGPCs as well as in day 7 E2F6-overexpressing GPCs (Figure 29D). In addition, both MBP and IL1A were strongly upregulated in adult hGPCs compared to fetal, and both showed a sharp trend toward upregulated expression in response to repressor transduction, although time point-related variability prevented their increases from achieving statistical significance. Taken together, these data supported the prediction that forced early expression of adult-enriched GPC repressors, E2F6, IKZF3, MAX, and ZNF274, is sufficient to induce multiple features of the senescent GPC transcriptome in young iPSC-derived GPCs.
[0336] Example B6 -- miRNA expression patterns of fetal hGPCs predict their suppression of aging To identify potential post-transcriptional regulators of gene expression, we utilized Affymetrix GeneChip miRNA 3.0 arrays to assess differences in miRNA expression between adult and fetal GPCs (n=4). PCA showed separation of both GPC populations as defined by their miRNA expression profiles (Figure 30A). Differential expression (adjusted p-value <0.01) between both ages resulted in 56 genes (23 enriched in adult GPCs, 33 enriched in fetal GPCs, Figure 30B-C). Notably, among these differentially expressed miRNAs were the fetal precursor miRNAs, miR-9-3p, miR-9-5p ( Lau et al., 2008 ), and miR-17-5p ( Budde et al., 2010 ), as well as the adult oligodendrocyte regulators, miR-219a-3p and miR-338-5p ( Dugas et al., 2010 ; Wang et al., 2017 ).
[0337] We then utilized this cohort of miRNAs to predict genes expected to be repressed through miRNA upregulation, analyzing both adult and fetal GPC pools separately. To accomplish this, we used miRNAtap to query five miRNA gene target databases: DIANA (Maragkakis et al., 2011), Miranda (Enright et al., 2003), PicTar (Lall et al., 2006), TargetScan (Friedman et al., 2009), and miRDB (Wong and Wang, 2015). To maximize accuracy, genes were considered targets only if they appeared in at least two databases. In fetal-enriched miRs, this approach predicted an average of 36.3 (SD = 24.5) repressed genes per miRNA. In contrast, adult hGPC-enriched miRNAs predicted an average of 46.4 (SD=37.8) genes as targets per miRNA (Figure 30C). Overall, this identified potential repression of 48.8% of adult GPC-enriched genes via fetal miRNAs and repression of 39.9% of fetal GPC-enriched genes by adult miRNAs.
[0338] To assess the functional significance of these miRNA-dependent post-transcriptional regulatory mechanisms, we curated fetal and adult networks according to miRNA targeting of functionally relevant differentially expressed genes (Figure 30D-E). The proposed upstream adult transcriptional regulators STAT3, E2F6, and MAX were predicted to be inhibited via seven miRNAs in fetal GPCs (Figure 30D), including previously validated repression of STAT3 in other cell types by miR-126b-5p, miR-106a-5p, miR-17-5p, miR-130a-3p, and miR-130b-3p (Du et al., 2014a; Jiang et al., 2020; Zhang et al., 2020; Zhang et al., 2013; Zhao et al., 2013). In parallel, several early and mature oligodendrocyte genes were simultaneously targeted for inhibition, all consistent with maintenance of a progenitor state, including MBP, UGT8, CD9, PLP1, MYRF, and PMP22 (Goldman and Kuypers, 2015). Importantly, a cohort of genes linked to either induction of senescence or inhibition of proliferation, or both, were also predicted to be actively repressed in fetal GPCs. These include RUNX1, RUNX2, BIN1, DMTF1 / DMP1, CTNNA1, SERPINE1, CDKN1C, PAK1, IFI16, EFEMP1, MAP3K7, AHR, OGT, CBX7, and CYLD (Eckers et al., 2016, Elliott et al., 1999, Ferrand et al., 2015, Hu et al. al.,2019, Inoue and Sherr,1998, Jiang et al.,2017, Kilbey et al.,2007, Lee and Zhang,2016, Li et al.,2015, Mademtzoglou et al.,2018, Mikawa et al.,2014, Ni et al.,2017, Wotton et al.,2004, Xin et al. al., 2004, Zhang and Guo, 2018).Inhibition of senescence or activation of proliferation has also been observed by several miRNAs identified here, including miR-17-5p, miR-93-3p, miR-1260b, miR-106a-5p, miR-767-5p, miR-130a-3p, miR-9-3p, miR-9-5p, and miR-130b-3p (Borgdorff et al., 2010; Gao et al., 2019; Meng et al., 2017; O'Loghlen et al., 2015; Shen et al., 2015; Su et al., 2018; Tai et al., 2020; Wang et al., 2020a; Xia et al., 2019; Zhang and Guo, 2018). Taken together, these data provide complementary mechanisms by which fetal hGPCs may maintain their characteristic progenitor transcriptional state and signature.
[0339] Example B7 - Adult miRNA signaling can suppress the proliferative progenitor state and predict aging Next, we investigated a potential miRNA regulatory network within adult hGPCs (Figure 30E). This involved five miRNAs that control five identified active fetal transcriptional regulators, including HDAC2, NFIB, BCLL1A, TEAD2, and HMGA2, whose miR-4651-mediated silencing has previously been shown to inhibit proliferation (Han et al., 2020). This miRNA cohort was predicted to function in parallel with adult transcriptional repressors in inhibiting the expression of genes involved in maintaining the GPC precursor state, including PDGFRA, PTPRZ1, ZBTB18, SOX6, EGFR, and NRXN1. Furthermore, the adult miRNA environment is predicted to repress a number of genes known to induce a proliferative state or delay aging, including LMNB1 (Freund et al., 2012), PATZ1 (Cho et al., 2012), GADD45A (Hollander et al., 1999), YAP1 and TEAD1 (Xie et al., 2013), CDK1 (Diril et al., 2012), TPX2 (Rohrberg et al., 2020), S1PR1 (Liu et al., 2019), RRM2 (Aird et al., 2013), CCND2 (Bunt et al., 2010), SGO1 (Murakami-Tonami et al., 2016), MCM4 and MCM6 (Mason et al., 2004), ZNF423 (Hernandez-Segura et al., 2013), and GADD45A (Hollander et al., 1999). These include miR-584-5p (Li et al., 2017), miR-193a-5p (Chen et al., 2016), miR-548ac (Song et al., 2020), miR-23b-3p (Campos-Viguri et al., 2020), miR-140-3p (Wang et al., 2020b), and miR-330-3p (Wang et al., 2020b).Taken together, these data implicate these miRs as active participants in the maintenance of the progenitor state in fetal hGPCs and their regulation as a possible mechanism by which adult hGPCs assume their signature gene expression profile.
[0340] Example B8 - Transcription factor regulation of miRNAs establishes and reinforces GPC identity Next, we sought to predict the upstream regulation of differentially expressed miRNAs in fetal and adult GPCs by querying the TransmiR transcription factor miRNA regulation database (Tong et al., 2019). This approach predicted the regulation of 54 of the 56 age-specific GPC miRNAs through 66 transcription factors that were similarly determined to be significantly differentially expressed between fetal and adult GPCs (Figure 37A). Interestingly, the top four predicted miRNA-regulating TFs were all MYC-associated factors, including MAX, MYC itself, E2F6, and the fetal-enriched MYC-associated zinc finger protein MAZ, which targets 36, 33, 30, and 28 unique differentially expressed miRNAs, respectively.
[0341] Examination of the proposed relationships in the context of the 12 TF candidates (Figure 28) showed numerous fetal hGPC-enriched miRNAs predicted to be targeted by both fetal activators and adult repressors, but those miRNAs enriched in adult GPCs were more uniquely targeted (Figure 37B). MYC was predicted to drive expression of numerous miRNAs in fetal GPCs, many of which were predicted to be repressed in adulthood via E2F6, MAX, or both. Notably, miR-130a-3p was predicted to be targeted by MYC, MAX, and E2F6 in addition to activation via TEAD2. Notably, among validated TF-miRNA interactions in other cell types, upregulation of the rejuvenating miR-17-5p by MYC and its...
Claims
1. 1. A population of isolated glial progenitor cells for use in a method of treating a condition mediated by age-related oligodendrocyte loss in a subject, said method comprising administering a therapeutically effective amount of the isolated population of glial progenitor cells to said subject in need of such treatment; (i) the isolated glial progenitor cells are younger than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (ii) the isolated glial progenitor cells or their progeny grow or proliferate or divide faster than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (iii) the isolated glial progenitor cells or progeny thereof have a higher level of MYC and YAP1 pathway activity than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; and the administering is performed by intraparenchymal, intracallosal, intraventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. Isolated glial progenitor cell populations for use.
2. 2. The isolated population of glial progenitor cells for use according to claim 1, wherein the condition is vascular leukoencephalopathy, an adult-onset autoimmune demyelinating condition, a chronic post-radiation induced demyelinating condition, an adult-onset lysosomal storage disease, an adult-onset leukodystrophy, or cerebral palsy.
3. 1. A population of isolated glial progenitor cells for use in a method of treating a condition mediated by age-related astrocyte loss in a subject, said method comprising administering a therapeutically effective amount of the isolated population of glial progenitor cells to said subject in need of such treatment; (i) the isolated glial progenitor cells are younger than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (ii) the isolated glial progenitor cells or their progeny grow or proliferate or divide faster than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (iii) the isolated glial progenitor cells or progeny thereof have a higher level of MYC and YAP1 pathway activity than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; and the administering is performed by intraparenchymal, intracallosal, intraventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. Isolated glial progenitor cell populations for use.
4. 4. The isolated population of glial progenitor cells for use according to claim 3, wherein the condition is amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, Huntington's disease, Alexander's disease, or vanishing white matter disease.
5. 1. A population of isolated glial progenitor cells for use in a method of treating a condition mediated by age-related white matter loss in a subject, said method comprising administering a therapeutically effective amount of the isolated population of glial progenitor cells to said subject in need of such treatment; (i) the isolated glial progenitor cells are younger than the glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (ii) the isolated glial progenitor cells or their progeny grow or proliferate or divide faster than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; or (iii) the isolated glial progenitor cells or progeny thereof have a higher level of MYC and YAP1 pathway activity than glial progenitor cells, oligodendrocytes, or astrocytes in the subject; and the administering is performed by intraparenchymal, intracallosal, intraventricular, intrathecal, intracerebral, intracisternal, or intravenous implantation. Isolated glial progenitor cell populations for use.
6. The state is 6. The isolated population of glial progenitor cells for use according to claim 5, wherein the disease is vascular leukoencephalopathy, adult-onset autoimmune demyelinating condition, chronic post-radiation induced demyelinating condition, adult-onset lysosomal storage disease, adult-onset leukodystrophy, cerebral palsy, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, Huntington's disease, Alexander disease, or vanishing white matter disease.
7. 6. The isolated population of glial progenitor cells for use according to any one of claims 1, 3 and 5, wherein the condition is Huntington's disease or subcortical dementia.
8. 10. The isolated population of glial progenitor cells for use according to claim 2 or 6, wherein the vascular leukoencephalopathy is subcortical stroke, diabetic leukoencephalopathy, or hypertensive leukoencephalopathy.
9. 10. The isolated population of glial progenitor cells for use according to claim 2 or 6, wherein the adult-onset autoimmune demyelinating condition is relapsing-remitting multiple sclerosis, chronic or progressive multiple sclerosis, neuromyelitis optica, transverse myelitis, or optic neuritis.
10. 7. The isolated population of glial progenitor cells for use according to any one of claims 1 to 6, wherein the isolated population of glial progenitor cells or their progeny replaces at least some of the glial progenitor cells, oligodendrocytes, or astrocytes in the subject.
11. The isolated population of glial precursor cells for use according to any one of claims 1 to 6, wherein the subject is a human.
12. 7. The isolated population of glial progenitor cells for use according to any one of claims 1 to 6, wherein said population of isolated glial progenitor cells is derived from pluripotent stem cells.
13. 13. The isolated population of glial progenitor cells for use according to claim 12, wherein the pluripotent stem cells are embryonic stem cells or induced pluripotent stem cells.
14. 7. The isolated population of glial progenitor cells for use according to any one of claims 1 to 6, wherein said population of isolated glial progenitor cells is administered to the forebrain, striatum, and / or cerebellum.
15. 7. The isolated population of glial progenitor cells for use according to any one of claims 1 to 6, wherein the isolated glial progenitor cells are heterologous, xenogenic, allogeneic, syngeneic, or autologous to the subject.