Antisense inhibitors of MIR17HG pre-RNA as therapeutic agents in cancer

JP2024543952A5Pending Publication Date: 2025-12-09DANA FARBER CANCER INSTITUTE INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024532316
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-11-30
Filing Date
2022-11-29
Publication Date
2025-12-09

AI Technical Summary

Technical Problem

Current therapies are inadequate for effectively targeting the aberrant expression and function of MIR17HG pre-RNA, which plays a crucial role in the progression of diseases such as multiple myeloma and other cancers, due to the lack of specific and effective therapeutic agents.

Method used

Development of antisense oligonucleotides (ASOs) that specifically bind to MIR17HG pre-RNA, modulating its expression and function, thereby inhibiting its oncogenic activity.

Benefits of technology

The ASOs effectively reduce tumor growth in multiple myeloma and other cancers by targeting MIR17HG pre-RNA, demonstrating reduced toxicity and efficacy in vivo without relying on microRNA or DROSHA, providing a novel therapeutic approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Antisense oligonucleotide inhibitors against MIR-17-92a-1 cluster host gene (MIR17HG) preRNA are disclosed for treating or ameliorating diseases in which MIR17HG preRNA plays a role.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Related Applications This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 284,527, filed November 30, 2021, which is incorporated by reference herein in its entirety.

[0002] Sequence Listing This application has been submitted electronically in XML format and contains a Sequence Listing, which is hereby incorporated by reference in its entirety. Said XML copy, created on November 28, 2022, is named 52095_753001WO_SL.xml and is 71 KB in size. [Background technology]

[0003] In the human genome, loci with long noncoding RNAs (lncRNAs) outnumber protein-coding genes and are susceptible to the same oncogenic pathogenic events (Hon et al., Nature 543:199-204 (2017);Wang et al., Cancer Cell 33:706-720 (2018)). These RNA molecules are defined as having a length greater than 200 nucleotides (nt) and lack of protein-coding potential, hence resulting in a wide variety of functional entities (Ulitsky et al., Cell 154:26-46 (2013)). LncRNAs are often classified into four distinct subgroups based on their location relative to protein-coding genes: exonic, intronic, overlapping, intergenic, sense and antisense lncRNAs; alternatively, they can be functionally classified into cis- and trans-acting lncRNAs. Ulitsky et al., Cell 154:26-46 (2013). Trans-acting lncRNAs are of special interest due to their diverse mechanisms of action, such as through their role as precursor molecules for the biogenesis of mature microRNAs (miRNAs) (Lu et al., Nat. Med. 23:1331-1341 (2017)) or through their direct interactions with proteins and nucleic acids that modulate protein function and / or stability (Tseng et al., Nature 512:82-6 (2014)). Aberrant expression and function of lncRNAs has been implicated in the progressive enhancement of malignant phenotypes by tumor cells (Gutschner and Diederichs, RNA. Biol. 9:703-19 (2012)). Summary of the Invention

[0004] A first aspect of the present disclosure is directed to an antisense oligonucleotide (ASO) that binds to MIR-17-92a-1 cluster host gene (MIR17HG) preRNA under physiological conditions, wherein the ASO is 15 to about 30 nucleotides in length, and the MIR-17-92a-1 cluster host gene (MIR17HG) preRNA has the nucleic acid sequence of SEQ ID NO:1.

[0005] Another aspect of the present disclosure is a pharmaceutical composition containing a therapeutically effective amount of an antisense oligonucleotide and a pharma- ceutically acceptable carrier.

[0006] Yet another aspect of the present disclosure is a method of treating a disease in which aberrant expression and function of MIR17HG pre-RNA plays a role. The method involves administering to a subject a pharmaceutical composition.

[0007] Yet another embodiment of the present disclosure is a kit containing a therapeutically effective amount of an ASO that binds to MIR17HG preRNA, and printed instructions for using a first active agent in the treatment of a disease in which abnormal expression and function of MIR17HG preRNA plays a role in a subject.

[0008] Actual examples described herein demonstrate that ASOs that bind to MIR17HG preRNA result in reduced multiple myeloma tumor growth in vivo in a microRNA- and DROSHA-independent manner and without toxicity. [Brief description of the drawings]

[0009] [Figure 1-1]FIG. 1A is a diagram and a set of point and line plots illustrating a genome-wide CRISPRi viability screen that identified MIR17HG as a major dependency in multiple myeloma (MM). FIG. 1A illustrates the viability screen diagrammatically. FIG. 1B is a set of line plots showing RRA-based ranking analysis for lncRNA dependencies in secondary screens. FIG. 1C is a set of line plots showing CCK-8 proliferation assays for MM cell lines. FIG. 1D is a set of line plots showing CCK-8 proliferation assays for MM cell lines transfected with ASOs targeting MIR17HG pre-RNA or non-targeting ASOs (NC). [Figure 1-2] (As stated above.) [Figure 1-3] (As stated above.) [Figure 1-4] (As stated above.) [Figure 2-1]A set of diagrams, lines, bars, and survival plots showing how lncRNA lnc-17-92TV1, also referred to herein as regulator of adipogenesis (RROL), mediates dependency in a microRNA-independent manner. Figure 2A illustrates a schematic overview of the MIR17HG locus, including both lncRNA (RROL) and miRNA (miR-17-92) derived transcripts. Figure 2B is a set of line plots showing the prognostic significance (PFS and OS) of high RROL expression (top quartile) in three large cohorts of MM patients. Figure 2C is a set of bar plots illustrating CCK-8 proliferation assays in AMO1 and H929 cells transduced with pri-mir-17-92 (pri-miR) or GFP control. Figure 2D is a set of bar plots and images illustrating CCK-8 proliferation assays for Drosha WT or KO AMO1 and H929 cells exposed to ASO1. Figure 2E is a line plot illustrating the effect of RROL depletion in Matrigel-based AMO1DR-KO xenografts in NOD SCID mice. Figure 2F is a survival plot illustrating survival analysis of tumor-injected mice. Figure 2G is a set of bar plots showing CCK-8 proliferation assays in HCT-116 and DLD-1 colorectal cancer cell lines expressing either WT or mutated (- / -) Dicer. [Figure 2-2] (As stated above.) [Figure 2-3] (As stated above.) [Figure 2-4] (As stated above.) [Figure 2-5] (As stated above.) [Figure 3-1]A set of charts, images, bars, and dot plots showing the interaction of RROL with chromatin to regulate gene expression. Figure 3A shows transcriptome analysis after RROL depletion in MM cell lines that are either Drosha WT (AMO1, H929) or KO (AMO1DR-KO), and is a chart showing commonly downregulated genes (adjusted p<0.05; lfc<-1). Figure 3B is a bar plot illustrating qRT-PCR analysis for RROL targets in CD138+ cells from three MM patients exposed to ASO1 for 24 hours. Figure 3C is a set of dot plots and correlation plots showing the correlation between RROL targets (mRNA) and RROL in CD138+ MM patient cells, together and alone, for each RROL target. Figure 3D is a bar plot illustrating a GLuc / SEAP dual reporter assay showing reduced activity of ACC1, ANO6, CCDC91, EPT1, EXT1, FER, and KIAA1109 promoter activity after RROL knockdown using ASO1. Figure 3E is a set of line plots illustrating a CCK-8 proliferation assay in five MM cell lines after transfection with siRNA against RROL targets. Figure 3F is a bar plot illustrating a ChIRP-qPCR analysis showing effective amplification of the ACC1 promoter in chromatin purified using two RROL antisense probe sets (ps1 and ps2) compared to chromatin purified using a LacZ antisense probe (negative control). FIG. 3G is a set of images and dot plots illustrating (left) snapshots acquired by dual RNA-FISH analysis for ACC1 pre-mRNA (green) and RROL (purple) in a representative AMO1 cell; (right) box plots showing the distance (nm) of ACC1 pre-RNA spots to the nearest RROL spot or to the nearest random spot. [Figure 3-2] (As stated above.) [Figure 3-3] (As stated above.) [Diagram 3-4] (As stated above.) [Figure 3-5](As stated above.) [Figure 4-1] A set of bars and images illustrating the promotion of RROL of MYC occupancy in the ACC1 promoter. Figure 4A is a bar plot showing upstream regulator analysis of transcriptional changes after 3 days of gymnotic exposure to ASO1 in H929 and AMO1 cells. Figure 4B is a set of bar plots and images illustrating ChIP-qPCR analysis of MYC occupancy in the ACC1 promoter in AMO1, H929, and U266MYC+ exposed to ASO1 or NC (vehicle) for 24 hours. Figure 4C is a bar plot and images illustrating qRT-PCR analysis of ACC1 mRNA in P493-6 cells exposed to either doxycycline or DMSO for 2 days to knock down MYC, and exposed to either ASO1 or vehicle (NC) for another 2 days to deplete RROL. Figure 4D is a set of images illustrating Co-IF / FISH analysis for ACC1 preRNA (red), MYC protein (green), and RROL (purple). Figure 4E illustrates qRT-PCR analysis (detecting isoform 2) for RROL in RIP material precipitated using an anti-MYC antibody (α-MYC) or an IgG control. Figure 4F illustrates Western blot analysis for MYC in RPPD material precipitated with control RNA or RROL transcripts-1 and -2. Figure 4G illustrates RNA Y3H using MYC as hybrid protein 2 and either negative control RNA (-) or RROL transcripts-1 and -2 as hybrid RNA. [Figure 4-2] (As stated above.) [Figure 4-3] (As stated above.) [Figure 5-1]A set of diagrams, images, and bar plots illustrating that RROL mediates the association of the MYC-WDR82 transcription complex, leading to the transcriptional and epigenetic activation of ACC1. Figure 5A shows a schematic of an integrated BioID and Co-IP / MS assay to investigate the MYC-protein interaction network in the presence or absence of RROL depletion. Figure 5B is an image illustrating a Western blot analysis for WDR82 in RPPD material precipitated with RROL-1 and RROL-2 or with control RNA. Figure 5C is an image illustrating RNA Y3H with WDR82 as hybrid protein 2 and either negative control RNA (-) or RROL transcripts-1 and -2 as hybrid RNA. Figure 5D is a bar plot and image illustrating ChIP-qPCR analysis for H3K4me3 occupancy at the ACC1 promoter in AMO1 after silencing of WDR82. Figure 5E is a bar plot and image illustrating the ChIP-qPCR analysis of MYC occupancy in the ACC1 promoter in AMO1 after silencing WDR82. Figure 5F is a bar plot and image illustrating the qRT-PCR analysis of ACC1 mRNA after transfection of siRNA (siWDR82-1 or -2) targeting WDR82 in AMO1. Figure 5G is a bar plot and image illustrating the ChIP-qPCR analysis of WDR82-GFP occupancy in the ACC1 promoter in AMO1 exposed to gymnotic ASO1 for 24 hours. Figure 5H is a bar plot and image illustrating the ChIP-qPCR analysis of H3K4me3 occupancy in the ACC1 promoter in AMO1 and H929 exposed to gymnotic ASO1 for 24 hours. Figure 5I is a set of images of Western blots showing H3K4me3 levels at the ACC1 promoter site. [Figure 5-2] (As stated above.) [Figure 5-3] (As stated above.) [Figure 5-4] (As stated above.) [Figure 5-5](As stated above.) [Figure 6-1] 6A is a set of bar plots, flow cytometry plots, and diagrams showing that the RROL / MYC-ACC1 axis regulates de novo lipogenesis. FIG. 6A illustrates the incorporation of 14C-glucose into lipids after either RROL, MYC, or ACC1 depletion / inhibition in MM cell lines or CD138+ MM patient cells. FIG. 6B is a set of bar plots showing liquid chromatography-mass spectrometry (LC-MS)-based lipid profiling after RROL inhibition in MM cells. FIG. 6C is a bar plot showing the effect of palmitic acid on the anti-proliferative effect of RROL depletion in MM cells. FIG. 6D is a set of flow cytometry plots showing the effect of palmitic acid on the anti-proliferative effect of RROL depletion in MM cells. FIG. 6E illustrates the RROL pathway as it affects MM cell growth. [Figure 6-2] (As stated above.) [Figure 6-3] (As stated above.) [Figure 6-4] (As stated above.) [Figure 6-5] (As stated above.) [Figure 7-1]7A is a set of dots, bars, and survival plots and images depicting therapeutic inhibitors of RROL that exert strong antitumor activity in vitro and in vivo in animal models of human MM. FIG. 7A is a schematic illustrating a multi-step screen for developing RROL therapeutic ASOs. FIG. 7B is a set of bar plots illustrating CCK-8 proliferation assays in a panel of 11 MM cell lines. FIG. 7C is a dot plot illustrating subcutaneous in vivo tumor growth of AMO1 cells in NOD SCID mice. FIG. 7D-7E are bar plots illustrating qRT-PCR analysis for RROL (FIG. 7D) and RROL targets (FIG. 7E) in AMO1 xenografts. FIG. 7F is a bar plot illustrating lipid profiling analysis showing modulation of tripalmitin in tumors. FIG. 7G is a dot plot and images illustrating BLI-based measurements of in vivo tumor growth of MOLP8-luc+ in NSG mice. Figure 7H is a survival plot from the experiment in Figure 7E, with black arrows indicating treatment. Figure 7I is a line plot showing human kappa light chain ELISA-based measurements of in vivo tumor growth of MM patient cells in NSG mice (PDX-NSG). Figure 7J is a bar plot showing qRT-PCR analysis for BCL2L11 in tumors removed from animals treated with G2-15b*-TO (G) or SB9-19-TO (SB) or vehicle (NC) as a control. [Figure 7-2] (As stated above.) [Figure 7-3] (As stated above.) [Figure 7-4] (As stated above.) [Figure 7-5] (As stated above.) [Figure 8]8A is a set of bar plots illustrating the screening data and MIR17HG knockdown with or without antisense oligonucleotides. FIG. 8A is a bar plot showing the analysis of the screening data, and the upset plot shows the identification of cell type-specific and shared lncRNA dependencies in MM cells. FIG. 8B is a bar plot showing the knockdown of MIR17HG obtained in AMO1 engineered to express dCas9-KRAB fusion protein and anti-MIR17HG gRNA under the control of a conditional promoter. FIG. 8C is a bar plot showing the knockdown of MIR17HG obtained in AMO1 transfected with two gapmeRs. [Figure 9-1]FIG. 9A is a set of box and bar plots illustrating RROL expression and its correlation with miR-17-92 microRNA. FIG. 9A is a box plot showing RROL expression in newly diagnosed (ND) vs. relapsed (R) MM patients. FIG. 9B is a box plot showing RROL expression in ND vs. R MM patients from GSE66293. FIG. 9C is a Spearman correlation showing the correlation between RROL and miR-17-92 in CD138+ cells from 140 MM patients analyzed by RNA-seq and miRNA profiling. FIG. 9D is a set of bar plots illustrating qRT-PCR analysis for miR-17-92 microRNA in AMO1 and H929 cells. FIG. 9E is a set of bar plots illustrating qRT-PCR analysis for miR-17-92 microRNA in AMO1 and H929, either WT or KO to Drosha. Figure 9F is a set of bar plots illustrating knockdown of MIR17HG using three different ASOs or a scrambled control (NC) in AMO1DR-KO and H929DR-KO. Figure 9G is an RNA-seq coverage plot and junction analysis for RROL in four MM samples. Figure 9H is a bar plot showing qRT-PCR analysis for RROL transcript variants 1 and 2 in AMO1. Primers amplify the regions shown in Figure 9G. Figure 9I is a box plot showing RNA-seq analysis for RROL expression (TPM) in the MMRF / CoMMpass dataset (n=720) and 60 MM cell lines. Figure 9J is a line plot showing the effect of RROL depletion in Matrigel-based AMO1DR-KO xenografts in NOD SCID mice. FIG. 9K is a bar plot showing CCK-8 proliferation assay in HCC-116 cells transfected with ASOs targeting the 5′ end of MIR17HG preRNA or scrambled control (NC) (5′-ASO).Figure 9L is a bar plot showing that ectopic expression of pri-mir-17-92, lnc-17-92TV1, and lnc-17-92TV2 was confirmed by qRT-PCR showing i) upregulation of miR-17 following ectopic expression of pri-mir-17-92, ii) upregulation of lnc-17-92TV1 following its ectopic expression, and iii) upregulation of lnc-17-92TV2 following its ectopic expression. [Figure 9-2] (As stated above.) [Figure 9-3] (As stated above.) [Figure 9-4] (As stated above.) [Figure 9-5] (As stated above.) [Figure 9-6] (As stated above.) [Figure 9-7] (As stated above.) [Figure 9-8] (As stated above.) [Figure 9-9] (As stated above.) [Figure 10-1]10A is a set of images, heat maps, and bar plots illustrating RROL and miR-17-92 miRNA expression and localization in vitro. FIG. 10A is a bar plot showing intracellular qRT-PCR analysis for RROL in AMO1 and H929. FIG. 10B is a set of images showing RNA-FISH analysis for intracellular localization of RROL in AMO1. FIG. 10C is a heat map showing qRT-PCR analysis for RROL and miR-17-92 miRNA in AMO1 gymnotic exposed to ASO1 or ASO-1-NC. FIG. 10D is a bar plot showing qRT-PCR analysis for RROL transcriptional targets in Daudi and Raji cells gymnotic exposed to ASO1 for 24 hours. FIG. 10E is a bar plot showing qRT-PCR analysis for murine rrol, acc1, and fer in 5TGM1 murine MM cells transfected with three different ASOs targeting murine mir17hg nascent RNA. Figures 10F-G are bar plots showing qRT-PCR analysis of miR-17-92 miRNA (black bars) and RROL transcriptional targets (white bars) in AMO1 transfected with pooled miR-17-92 miRNA inhibitors (Figure 10F) or mimics (Figure 10G). Figures 10H-I are bar plots showing ChIRP-qPCR analysis showing % positive reactions (amplification) (Figure 10H) or C values ​​(Figure 10I) of GAPDH exon 2 in purified chromatin using two RROL antisense probe sets (ps1 and ps2) or using a LacZ antisense probe (negative control). [Figure 10-2] (As stated above.) [Figure 10-3] (As stated above.) [Figure 10-4] (As stated above.) [Figure 11-1]A set of photographs and a bar plot showing that RROL promotes MYC occupancy in the ACC1 promoter. Figure 11A is a Western blot for MYC in U266 cells infected with WT or vectors with FLAG or MYC-FLAG expression. Figure 11B is a schematic diagram of the isoforms of RROL. Figure 11C is qRT-PCR for RROL isoform-2 after immunoprecipitation with anti-MYC antibody (α-MYC) or IgG control. Figure 11D is a bar plot showing qRT-PCR analysis for ACC1 mRNA after treatment with MYC inhibitor 10058-F4 in MM cell lines AMO1 and H929. Figure 11E is a bar plot showing the incorporation of C14-glucose into lipids after treatment with MYC inhibitor 10058-F4 in MM cell lines AMO1 and H929. Figure 11F is a bar plot showing CCK-8 proliferation assay in U266MYC- and U266MYC+ after transfection with ACC1-targeting siRNA or scrambled siRNA (NC). Cell viability was measured 48 hours after transfection and is expressed as % relative to NC-transfected cells. Figure 11G is a photograph of a Western blot analysis for MYC in RPPD material precipitated with control RNA or a truncated version of lnc-17-92TV1; 5% input is used as a reference. [Figure 11-2] (As stated above.) [Figure 11-3] (As stated above.) [Figure 12-1]A set of images showing MYC and GFP expression after RROL knockdown or WDR82-GFP fusion protein expression. Figure 12A is an image illustrating the Western blot analysis for MYC in FBA-MYC cells with or without doxycycline to induce FBA-MYC fusion protein, and transfected with either NC or ASO1 to knockdown RROL. Figure 12B is an image illustrating the Western blot analysis for GFP in AMO1 cells infected with WT, or vectors with GFP or WDR82-GFP expression. Figure 12C is an image showing the Western blot analysis for WDR82 in RPPD material precipitated with control RNA or a truncated version of lnc-17-92TV1. Figure 12D is a set of images and bar plots showing Western blot analysis for WDR82, H3, H3H3K4me1, H3H3K4me2, and H3H3K4me3 after silencing WDR82 with siRNA pools (n=4) in H929 (48 hours). Lamin A / C was used as a protein loading control (nuclear lysate), and ii is quantification of densitometric analysis. [Figure 12-2] (As stated above.) [Figure 13] A set of bar plots and photographs showing the effect of glucose uptake (update) and expression of RROL target after exposure to ASO that binds RROL. Figure 13A is a bar plot showing the incorporation of C14-glucose into lipid after transfection of AMO1 with miR-17-92 anti-miR. Figure 13B is a bar plot showing GEP analysis of miR-17-92 canonical target BCL2L11 (BIM) and PTEN in AMO1 and H929 exposed to ASO1 for 36 hours. Figure 13C is a photograph of the Western blot analysis of miR-17-92 canonical target BIM in AMO1 exposed to ASO1 for 36 hours. [Figure 14-1]14A is a set of bar plots depicting a multi-step screen to develop therapeutic ASOs targeting RROL. FIG. 14A is a bar plot showing the results of step 1, which identifies ASO-accessible extensions on RROL, 16 sequences (>20-mer) in either the "G" or "SB" configuration. FIG. 14B is a bar plot showing the results of step 2, which optimizes the G2 and SB9 designs selected from step 1. FIG. 14C is a bar plot showing the results of step 3, which tested step 2 molecules conjugated with palmitic acid (P), cholesterol (C), or tocopherol (T). [Figure 14-2] (As stated above.) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter herein belongs. As used in this specification and the appended claims, unless specified to the contrary, the following terms have the meanings indicated to facilitate understanding of this disclosure.

[0011] As used in this description and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a composition" includes mixtures of two or more such compositions, reference to "an inhibitor" includes mixtures of two or more such inhibitors, etc.

[0012] Unless otherwise stated, the term "about" is understood to be within the bounds of normal acceptance in the art, e.g., within two standard deviations of the mean. "About" may be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value.

[0013] The term "approximately" as used herein refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise stated or otherwise clear from the context (except where such number would exceed 100% of possible values). Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about".

[0014] The transitional term "comprising," which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. In contrast, the transitional phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. The transitional phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps, "and those that do not materially affect the basic and novel characteristics of the claimed disclosure."

[0015] Antisense oligonucleotides In one embodiment, the present disclosure provides an antisense oligonucleotide (ASO) that binds to MiR-17-92a-1 cluster host gene (MIR17HG) pre-RNA under physiological conditions.

[0016] The MIR17HG gene is involved in the expression of two lncRNAs, lnc-17-92 TV1 and lnc-17-92 TV2 , and six miRNAs: miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a. TV1 (RNA regulator of lipogenesis (RROL), lnc-17-92 TV1 , and MIR17HGmiR-17-92 The nucleic acid sequence of the transcript (also known as Lnc-17-92) is provided in NCBI Accession No. NR_027350, version NR_027350.1. TV1 lnc-17-92 is shown herein to provide a chromatin scaffold that mediates transcription factor complexes that drive oncogenic gene translation. TV2 The nucleic acid sequence of the transcript is provided in NCBI accession number NR_027349, version NR_027349.1.

[0017] The nucleic acid sequence of MIR17HG pre-RNA is provided in Ensembl Accession No. ENSG00000215417 and is set forth below (SEQ ID NO:1):

[0018] [ka]

[0019] [ka]

[0020] [ka]

[0021] As used herein, the term "antisense oligonucleotide" (abbreviated as ASO) refers to a non-naturally occurring polymer of nucleotides (oligomer) capable of binding to a target RNA molecule.

[0022] The term "nucleotide" includes nucleosides having a ribose sugar (i.e., ribonucleotides forming ribonucleic acid, RNA) or 2'-deoxyribose sugar (i.e., deoxyribonucleotides forming deoxyribonucleic acid, DNA), and phosphate, unless specifically sated or clear from the context. Nucleotides serve as monomeric units of nucleic acid polymers or polynucleotides. The four nucleobases in DNA are guanine (G), adenine (A), cytosine (C), and thymine (T). The four nucleobases in RNA are guanine (G), adenine (A), cytosine (C), and uracil (U). In this context, ASOs are understood to be exogenous to the cells into which they may be introduced.

[0023] ASO can be made of ribonucleotides, deoxyribonucleotides, modified ribonucleotides, modified deoxyribonucleotides, or combinations thereof.ASO modulates target RNA by hybridization through at least partial complementary regions.ASO modulation mechanisms include transcription arrest, RNA synthesis interference (e.g., at various stages, including capping, splicing, and / or transport from nucleus to cytoplasm), ribosome attachment, RNAse H recruitment, mRNA degradation (e.g., gapmer-type ASO), translation arrest (e.g., ASO binds to target RNA to block translation), or steric blockage of target RNA by ASO hybridization.

[0024] The terms "gapmer" and "gapmeR" are used herein to refer to short DNA ASO structures with RNA-like wing segments on both sides or in the main region of the gap. These linear DNA molecules are designed to hybridize to targets to degrade the RNA by inducing RNase H cleavage. The binding of gapmers to target RNA has higher affinity due to the modified RNA-like flanking regions, as well as resistance to ASO degradation by nucleases. The gapmer gap contains at least one modification that is different from that of the modifications in one or both wings. Such modifications include nucleobases, monomer linkages, and sugar modifications.

[0025] In some embodiments, the ASO binds to the 5'-terminal region of MIR17HG preRNA. The term "terminal region" when used in the context of MIR17HG preRNA refers to the first 20% of the 5'-terminal nucleotides. In some embodiments, the ASO binds within the first 10%, first 15%, or first 20% of the 5'-terminal nucleotides of MIR17HG preRNA. In some embodiments, the ASO binds within the 3'-terminal region of MIR17HG preRNA.

[0026] In some embodiments, ASO targets the intron region closest to the 5' end of MIR17HG preRNA.The term "intron region" as used herein refers to the region of an RNA molecule that is removed from preRNA during the process of transcription.In some embodiments, ASO targets the region of MIR17HG preRNA where miRNA primary transcript (pri-miRNA) is spliced ​​(e.g., pri-mir-17-92).Pre-miRNA is the longer sequence from which mature miRNA is derived.

[0027] The ASOs disclosed herein bind to MIR17HG pre-RNA under physiological conditions. As used herein, the term "physiological conditions" refers to conditions typically encountered in mammalian in vivo conditions, such as an isotonic solution (about 0.9% saline) at body temperature (about 37° C.) at physiological pH (within the range of about 7.3 to about 7.5).

[0028] The minimum percent complementarity of an ASO to be effective can be determined according to standard procedures. Generally, the ASO has about 85% to about 100% complementarity with the MIR17HG preRNA. In some embodiments, the ASO has 100% complementarity with the MIR17HG preRNA sequence that it targets. In some embodiments, the ASO is at least 99% complementary, at least 98% complementary, at least 97% complementary, at least 96% complementary, at least 95% complementary, at last 90% complementary, at least 85% complementary to the MIR17HG preRNA.

[0029] The ASO has a length ranging from 15 to 30 nucleotides. In some embodiments, the ASO is 30 nucleotides or less in length. In some embodiments, the ASO is 25 nucleotides or less in length. In some embodiments, the ASO is 24 nucleotides or less in length. In some embodiments, the ASO is 23 nucleotides or less in length. In some embodiments, the ASO is 20 nucleotides or less in length. In some embodiments, the ASO is 18 nucleotides or less in length. In some embodiments, the ASO is 15 nucleotides to 24 nucleotides in length. In some embodiments, the ASO is 18 nucleotides to 23 nucleotides in length. In some embodiments, the ASO is 18 nucleotides in length (referred to herein as an 18-mer). In some embodiments, the ASO is a 20-mer. In some embodiments, the ASO is a 21-mer. In some embodiments, the ASO is a 22-mer. In some embodiments, the ASO is a 23-mer. The term "mer" as used herein in the context of ASO refers to a length of nucleotides. For example, the terms "16-mer" and "16mer" refer to a stretch of 16 nucleotides.

[0030] In some embodiments, the ASO is a single-stranded RNA that is a single-stranded RNA (sgRNA) for use with the CRISPR cas9 gene editing system. The nucleic acid sequence of a representative anti-MIR17HG pre-RNA sgRNA is set forth below:

[0031] MIR17HG preRNA sgRNA #1: AGTGGCGCGAAGGCGCAGGT (SEQ ID NO:2); MIR17HG preRNA sgRNA #2: GTGGCGCGAAGGCGCAGGTC (SEQ ID NO:3); MIR17HG pre-RNA sgRNA #3: CCTCGCCCGAGGGCGCGAAG (SEQ ID NO: 4); and MIR17HG pre-RNA sgRNA #4: GAGGGCGCGAAGTGGCGCGA (SEQ ID NO: 5)

[0032] In some embodiments, the ASO is a single-stranded DNA (ssDNA) molecule. The nucleic acid sequences of representative ssDNA anti-MIR17HG pre-RNA ASOs are set forth in Table 1.

[0033] [Table 1]

[0034] ASOs can be further modified with the addition of chemical moieties or chemical modifications to their nucleobases, nucleotides, or internucleoside linkages. ASO modifications enhance in vivo stability, improve specificity, and reduce toxic side effects. Exemplary modifications include modification of nucleotides with 2'-O-methoxyethyl ribose (MOE) groups.

[0035] MIR17HG pre-RNA binding ASO can be prepared in G configuration, in which the ASO contains 5'-terminal nucleotide modified with 2'-MOE, unmodified DNA ("DNA gap"), and 3'-terminal nucleotide modified with 2'-MOE. Alternatively, MIR17HG pre-RNA binding ASO can be prepared in SB configuration, in which all of the nucleotides in the ASO are modified with 2'MOE. The nucleic acid sequences of representative ASOs are specified in Table 2.

[0036] Gapmer ASO contains modified nucleotides at the ends of DNA gap.In some embodiments, DNA gap is 5, 6, 7, 8, 9, 10, 11, 12 or 15 nucleotides in length.In some embodiments, ASO is 5-8-5 gapmer, in which DNA gap is flanked on the 5' side by 5mer 2'-MOE chemically modified nucleotides and on the 3' side by 5mer 2'-MOE chemically modified nucleotides.

[0037] [Table 2]

[0038] Representative ASOs in Table 2 can be modified, for example ASO2 can be selected as a G-configuration ASO for further modification, and ASO9 can be selected as a SB-configuration ASO for further modification. These ASOs can be further modified as illustrated in Table 3. In one embodiment, G2-tweaked 15 can be selected as a G-configuration ASO (G2-15) as specified in Table 3, and SB-tweaked 19 can be selected as a SB-configuration ASO (SB2-19) as specified in Table 4.

[0039] [Table 3]

[0040] [Table 4]

[0041] In some embodiments, ASO can be further modified. In some embodiments, the modification comprises the conjugation of an additional moiety (e.g., lipid) to one or more ASO nucleotides. In addition, ASO can also comprise one or more chemical modifications of one or more nucleobases, nucleotides, or internucleoside linkages.

[0042] ASO conjugation and modification Additional moieties (e.g., lipid moieties) may be conjugated to any one or more nucleotides within the ASO to increase delivery efficiency, specific cell or tissue targeting, cellular uptake, and / or prolonged circulation time. In some embodiments, one or more nucleotides within the ASO are conjugated to a lipophilic moiety. In some embodiments, a chemical moiety is conjugated to one or more of the nucleotides at the 5' or 3' end of the ASO (i.e., either the 5' and / or 3' of the DNA gap in a gapmer). In some embodiments, every nucleotide of the ASO is conjugated to a chemical moiety (i.e., full 2'MOE configuration). In some embodiments, the first 5' terminal nucleotide is conjugated to a chemical moiety. In some embodiments, the last 3' terminal nucleotide is conjugated to a chemical moiety. Representative lipophilic moieties include palmitic acid, sterols (e.g., tocopherol, cholesterol), carbohydrates (e.g., N-acetylgalactosamine; GalNAc), oleyl residues, retinyl residues, cholesteryl residues, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, and phenoxazine.

[0043] Representative tocopherols include α-tocopherol, β-tocopherol, γ-tocopherol, and δ-tocopherol. Analogs of tocopherol include various unsaturated analogs of α-tocotrienol, β-tocotrienol, γ-tocotrienol, and δ-tocotrienol.

[0044] In some embodiments, one or more nucleotides in the ASO are conjugated with lipids, such as palmitic acid, tocopherol, or cholesterol. The lipids can be connected to the 5' or 3' end of the ASO using PS(*) or PO() linkages. In some embodiments, one or more nucleotides in the ASO are conjugated with lipids. In embodiments in which two or more nucleotides are so modified, the lipids can be the same or different. For example, in embodiments in which three nucleotides are conjugated to lipids, each of the lipids can be different, such as palmitic acid, tocopherol, and cholesterol. Additional lipophilic moieties suitable for conjugation to nucleic acids are known in the art. See, e.g., U.S. Patent Nos. 8,106,022, 8,404,862, 10,077,443, 10,358,643, 10,441,653, 11,116,843, and 11,260,134, as well as U.S. Patent Application Publication Nos. 2014 / 0045919, 2016 / 0289677, 2021 / 0163934, and 2022 / 0175817.

[0045] In some embodiments, the ASO comprises chemical modifications to one or more nucleobases, sugar moieties, internucleoside linkages (ie, backbone), or combinations thereof.

[0046] Nucleobase modifications include any modification or substitution that is structurally distinct but functionally compatible with nucleobases, including 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and 0-6 substituted purines. Exemplary modified nucleobases include pseudouridine, 2'-thiouridine (s2u), N6'-methyladenosine, 5'methylcytidine, N-ethylpiperdine 7'-EAA triazole modified adenine, N-ethylpiperidine 6'-triazole modified adenine, 6'-phenylpyrrolo-cytosine, 2',4'-difluorotoluyl ribonucleoside, 2-aminopropyl arsenic acid, 2',4'-difluorotoluyl ribonucleoside, 2',4'-diaminopropyl arsenic acid ... adenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-propynyl (C=C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil sil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-amino ... -deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, tricyclic pyrimidines, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Representative tricyclic pyrimidines include 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases may also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.

[0047] Additional nucleobase modification is known in the art.See, for example, U.S. Patent Nos. 3,687,808, 5,130,302, 5,811,534, 5,830,653 and 6,005,096, U.S. Patent Application Publication Nos. 20030158403 and 2003 / 0175906, and Kroschwitz et al., eds., The Concise Encyclopedia of Polymer Science and Engineering, 1st ed., John Wiley & Sons, 1990.

[0048] Sugar moiety modifications include bicyclic, tricyclic, and non-bicyclic sugar moieties or sugar surrogates, including furanosyl sugar moieties (e.g., 2-deoxyfuranosyl sugar moiety modifications). Exemplary modified furanosyl sugar moieties include acyclic modifications, for example, at the 2', 4', and 5' positions. In some embodiments, the acyclic modifications are branched. Representative modifications at the 2' position of the sugar moiety include 2'-deoxy-2'-fluoro (2'-F), 2'-arabino-fluoro (2'-Ara-F), 2'-O-benzyl, 2'-O-methyl-4-pyridine (2'-O-CH2Py(4)), 2'-O-methyl (2'-OCH3) (2'-OMe or Me), 2'-O-methoxyethyl (2'-O(CH2)2OCH3) (2-O-MOE or MOE), halo, allyl, amino, azido, unlocked nucleic acid (UNA), glycol nucleic acid (GNA), SH, CN, OCN, CF3, OCF3, O-C1-C1-C2-C3 ... 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m)-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), and OCH2C(=O)-N(R m )(R n ), where each R m and R n are independently H, an amino protecting group, or C1-C 10 Alky (unmodified or modified).

[0049] In some embodiments, the sugar moiety modification comprises a fluorine modification (2'-fluoro or 2'-F) at the 2' position. The 2'-F modification provides high RNA binding affinity and resistance to nuclease degradation. Methods for preparing 2'-F-containing sugar moiety modifications are known in the art. See, for example, U.S. Patent Nos. 5,459,255 and 6,262,241, U.S. Patent Application Publication Nos. 20060036087 and 20110269814, and Ludwig, acta Biochim. Biophys. Acad. Sci. Hung. 16(3-4):131-3 (1981) and Ludwig and Eckstein J. Org. Chem. 54:631-635 (1989).

[0050] Bicyclic sugar moiety modifications include bridged sugar modifications that form a second ring. In some embodiments, the second ring includes a bridge between the 4' and 2' positions on the furanose ring. In some embodiments, the sugar moiety is ribose. Exemplary 4' to 2' bridged sugar moiety modifications include (S)-cEt-BNA, tricyclo-DNA (tcDNA), PMO, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (also known as locked nucleic acid or "LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' (also known as ethylene bridged nucleic acid or "ENA"), 4'-CH(CH3)-O-2' (S configuration). in the case of 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE"), 4'-C(CH3)(CH3)-O-2', 4'-CH2-N(OCH3)-2, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2', 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a , and R b are independently H, a protecting group, or C1-C 12Alkyl (unmodified or modified). Additional sugar moiety modifications and analogs thereof are known in the art. See, e.g., U.S. Pat. Nos. 5,859,221, 6,005,087, 6,531,584, 7,399,845, 7,569,686, 7,741,457, 8,022,193, 8,278,283, 8,278,425, 8,278,426, 9,102,938, and 10,119,136, U.S. Patent Application Publication No. 20100190837, and Zhou et al., J. Org. Chem. 74(1):118-34 (2009).

[0051] Internucleoside linkage (i.e., backbone) modifications include any altered 3' to 5' phosphodiester linkage, including alkylphosphonates (e.g., methoxypropylphosphonate (MOP)) and phosphorothioates (e.g., phosphorothioate (PS)). ASOs containing multiple modified internucleoside linkages with chiral centers can be stereopure (containing only one stereoisomer), stereorandom (no regularity in stereoisomers), or can have a pattern in stereoisomers. Representative internucleoside linkage modifications include phosphodiester bond (P=O) (unmodified, naturally occurring), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate (PS) (P=S) (including Pr and Sp isomers), and phosphorodithioate (PS2) (HS-P=S), 5'-(E)-vinylphosphonate (5'-(E)-VP), 5'-M methyl phosphonate (5'-MP), (S)-5'-C-methyl with phosphate, and 5'-phosphorothioate (5'-PS). Non-phosphorus containing internucleoside linkages include methylenemethylimino (-CH2-N(CH3)-O-CH2), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), peptide nucleic acid (PNA), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-).Neutral charge internucleoside linkages include phosphotriester, methylphosphonate (MP), MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are known in the art. See, for example, US Patent Publication No. 20220049248 and Hu et al., Signal Transduct. Target. Ther. 5(1):101-25 (2020).

[0052] The 2'-deoxyfuranosyl sugar moiety involves the addition of a 5-membered carbon furanosyl ring sugar moiety bearing two hydrogens at the 2' position and may be unmodified or further modified at positions other than the 2' position. The 2'-O-methoxyethyl sugar moiety involves the replacement of the 2'-OH group of the ribosyl ring with 2'-O(CH2)2-OCH3).

[0053] Pharmaceutical Compositions The pharmaceutical composition of the present disclosure comprises a therapeutically effective amount of ASO and a pharma- ceutical acceptable carrier. As used herein, the term "therapeutically effective amount of ASO" refers to a sufficient amount of ASO to provide a desired therapeutic effect.

[0054] The effective amount of ASO for a given patient will vary depending on one or more factors, which may include age, weight, type, location, and severity of cancer, and the general health of the subject. Ultimately, the attending physician will determine the appropriate dose and dosage regimen. Typically, the ASO will be given in a series of doses, typically a single weekly dose for several weeks. In some embodiments, the effective amount of ASO is about 0.03 mg to about 3 kg per dose. In some embodiments, the effective amount of ASO is about 0.3 mg to about 300 mg per dose. In some embodiments, the effective dose of ASO is about 30 mg per dose. In some embodiments, the effective amount of ASO is about 10 mg / kg to about 50 mg / kg of subject body weight per dose. In some embodiments, the ASO is administered once a week for about 30 weeks to about 60 weeks. In some embodiments, the ASO is administered once a week for about 40 weeks. In some embodiments, the ASO is administered once a week, twice a week, or every other weekday (e.g., 3 days a week) for about 4 weeks.

[0055] The composition may be provided as a sterile liquid preparation, such as an isotonic aqueous solution, a suspension, an emulsion, a dispersion, or a viscous composition, which may be buffered to a selected pH. Liquid pharma- ceutically acceptable carriers include aqueous or non-aqueous carriers as well. The phrase "pharma-ceutically acceptable carrier" is recognized in the art and includes any pharma-ceutically acceptable material, composition, or vehicle suitable for administering the ASO of the present disclosure to a mammal. Carriers include liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials that are involved in carrying or transporting the subject agent from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient. Some examples of materials which may serve as pharma- ceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical preparations.

[0056] Representative examples of liquid carriers include water, saline, phosphate buffered saline, and suitable mixtures thereof. The compositions are typically isotonic, i.e., they have the same osmotic pressure as blood. Sodium chloride, potassium chloride, sodium bicarbonate, sodium carbonate, sodium dihydrogen phosphate monohydrate, disodium hydrogen phosphate anhydrous, potassium dihydrogen phosphate, sodium hydrogen phosphate heptahydrate, and isotonic electrolyte solutions (e.g., Plasma-Lyte®) may be used to achieve the desired isotonicity. Hydrochloric acid and / or sodium hydroxide may be used to adjust the pH of the composition. In some embodiments, the pH may be within the range of about 7.5 to about 8.5. Depending on the carrier and ASO, other excipients may be added, such as wetting agents, dispersing agents, or emulsifying agents, gelling agents, and viscosity enhancing agents, preservatives, etc., as known in the art.

[0057] In some embodiments, the composition comprises a pharma- ceutically acceptable carrier. The carrier can be liquid-based, such as fatty acid, lipid nanoparticle (LNP), liposome, lipid vesicle, or lipoplex. In some embodiments, the ASO is emulsified in a fatty acid carrier. Representative fatty acids include ethyl eicosapentaenoate (EPA-E), ethyl octadecatetraenoate (ODTA-E), ethyl nonadecapentaenoate (NDPA-E), ethyl arachidonate (AA-E), ethyl eicosatetraenoate (ETA-E), and ethyl heneicosapentaenoate (HPA-E).

[0058] In some embodiments, the carrier is LNP.In certain embodiments, LNP comprises two or more concentric bilayers separated by aqueous compartments.The lipid bilayers can be functionalized and / or cross-linked with each other.The lipid bilayers can comprise one or more ligands, proteins, or channels.

[0059] Lipid carriers, such as LNPs, may include one or more cationic / ionic lipids, one or more polymer-conjugated lipids, one or more structured lipids, and / or one or more phospholipids. "Cationic lipid" refers to a lipid that is positively charged or can retain a positive charge. Cationic lipids include one or more amine groups that are positively charged depending on the pH. "Polymer-conjugated lipid" refers to a lipid that has a conjugated polymer moiety. Polymer-conjugated lipids include PEGylated lipids, which are lipids conjugated to polyethylene glycol. "Structured lipid" refers to a non-cationic lipid that has no net charge at physiological pH. Exemplary structured lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, etc. "Phospholipid" refers to a lipid that has a triester of glycerol with two fatty acids and a phosphate ion. The phospholipids in LNPs assemble the lipids into one or more lipid bilayers. LNPs, their methods of preparation, formulation, and delivery are disclosed, for example, in U.S. Patent Application Publication Nos. 2004 / 0142025, 2007 / 0042031, and 2020 / 0237679, as well as U.S. Patent Nos. 9,364,435, 9,518,272, 10,022,435, and 11,191,849.

[0060] Lipoplexes, liposomes, and lipid nanoparticles may contain combinations of lipid molecules, such as cationic lipids, neutral lipids, anionic lipids, polypeptide-lipid conjugates, and other stabilizing components. Representative stabilizing components include antioxidants, surfactants, and salts. The composition and preparation of lipoplexes, liposomes, and lipid nanoparticles are known in the art. See, e.g., U.S. Pat. Nos. 8,058,069, 8,969,353, 9,682,139, 10,238,754, U.S. Patent Application Publication Nos. 2005 / 0064026 and 2018 / 0291086, as well as Lasic, Trends Biotechnol. 16(7):307-21 (1998), Lasic et al., FEBS Lett. 312(2-3):255-8 (1992), and Drummond et al., Pharmacol. Rev. 51(4):691-743 (1999).

[0061] Medicine Kit In one embodiment, the present disclosure is directed to a pharmaceutical kit or system that contains one or more ASOs.The kit or system includes a package such as a box, carton, tube, etc., that has one or more containers, such as a vial, tube, ampoule, or bottle, that contain ASO or its pharmaceutical composition, in a closed state therein.The kit or system can also include a printed instruction manual for using ASO and its pharmaceutical composition.

[0062] In some embodiments, the kit contains a therapeutically effective amount of an anti-MIR17HG pre-RNA ASO and printed instructions for its use in treating a disease caused by MIR17HG pre-RNA in a subject. In some embodiments, the kit also contains a MYC proto-oncogene, a bHLH transcription factor (MYC) inhibitor, and printed instructions for use of the MYC inhibitor, and the MIR17HG pre-RNA ASO and the MYC inhibitor in the same or different dosage forms are in the same or different containers.

[0063] How to use In one embodiment, the present disclosure is directed to treating a subject having a disease in which aberrant expression and function of MIR17HG preRNA plays a role. The method involves administering to a subject in need thereof a pharmaceutical composition containing a therapeutically effective amount of ASO.

[0064] The term "disease in which aberrant expression and function of MIR17HG preRNA plays a role" refers to a disease that may be ameliorated by therapeutic targeting of MIR17HG preRNA transcripts.

[0065] The term "treatment" as used herein refers to an approach for obtaining beneficial or desired results, including clinical results. Such results may include one or more of the following: alleviation or amelioration of one or more symptoms of the disease in which MIR17HG preRNA plays a role, whether detectable or undetectable, reduction in the extent of the disease, stabilization of the disease state, delay or slowing of the disease, improvement or palliation of the disease, and remission of the disease (whether partial or total).

[0066] The term "subject" (or "patient") as used herein includes all members of the animal kingdom susceptible to or afflicted with a disease in which aberrant expression and function of MIR17HG preRNA plays a role. In some embodiments, the subject is a human. Thus, a subject who "has a disease," "has a neoplasm," or "is in need of" treatment according to the present disclosure broadly encompasses subjects who have been positively diagnosed, including subjects with active disease who may have been previously treated with one or more rounds of therapy, as well as subjects who are not currently being treated (e.g., in remission) but may still be at risk of relapse, and subjects who have not been positively diagnosed but who are susceptible to a disease in which aberrant expression and function of MIR17HG preRNA plays a role (e.g., those who, because of personal and / or family medical history, or who otherwise present one or more risk factors such that a medical professional may reasonably suspect that the subject has a disease in which aberrant expression and function of MIR17HG preRNA plays a role).

[0067] Diseases in which MIR17HG pre-RNA plays a role include, for example, neoplasms (cancer), and non-cancerous diseases such as liver diseases.

[0068] The term "neoplasm" as used herein means a disease characterized by excessive proliferation or decreased apoptosis. Exemplary neoplasms for which the present disclosure may be used include pancreatic cancer, leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (Hodgkin's disease, non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial tumor, lymphangiosarcoma, lymphangioendothelial tumor, synovium, mesothelioma, Ewing's tumor, hepatocellular carcinoma ... Solid tumors, including, but not limited to, leiomyosarcoma, rhabdomyosarcoma, colon cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, glioblastoma multiforme, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma).

[0069] In some embodiments, the disease in which the abnormal expression and function of MIR17HG preRNA plays a role is multiple myeloma, lymphoma, or colorectal cancer. Representative lymphomas include chronic lymphocytic leukemia, cutaneous b-cell lymphoma, cutaneous t-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, and Waldenstrom's macroglobulinemia. Representative colorectal cancers include gastrointestinal adenocarcinoma, rectal adenocarcinoma, and colon adenocarcinoma. Multiple myeloma (MM) is a genetically complex malignant tumor of plasma cells that accounts for approximately 10% of blood cancers, and despite recent advances, MM remains largely incurable (Gulla and Anderson, Haematologica 105:2358-2367 (2020)).

[0070] In some embodiments, the disease in which MIR17HG preRNA plays a role is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), liver fibrosis, viral hepatitis, or alcoholic liver disease (ALD).In these diseases, MYC, a highly multifaceted transcription factor that regulates hepatocyte function, has been identified as dysregulated.Overexpression of MYC alters a wide variety of roles, including cell proliferation, growth, metabolism, DNA replication, cell cycle progression, cell adhesion, and differentiation.Overexpressed MYC is often found in patients with liver fibrosis, as described in detail by Zheng et al., Genes (Basel) 8:123-20 (2017).

[0071] In some embodiments, the disease is characterized by the transcription product of MIR17HG pre-RNA further interacting with MYC proto-oncogene, bHLH transcription factor (MYC), or MYC binding partner, or by dysregulated MYC or dysregulated MYC binding partner. Representative diseases in which MYC plays a role include multiple myeloma, B-cell lymphoma (e.g., diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, and Burkitt's lymphoma), triple-negative breast cancer, pancreatic cancer, liver cancer, and gastric cancer.

[0072] Combination therapy The disclosed therapy can be used in combination with at least one other active agent in treating diseases and disorders. The term "in combination" in this context means that the agents are co-administered, which includes substantially simultaneous administration by the same or separate dosage form, or sequentially, for example, as part of the same treatment regimen or by continuous treatment regimen. Thus, when given sequentially, at the beginning of administration of the second therapy, the first of the two therapies is still detectable at effective concentrations at the site of treatment in some cases. The sequence and time interval can be determined so that they can act together (e.g., synergistically to provide increased benefit than if they were administered separately). For example, therapeutic agents can be administered sequentially in any order at the same time or at different times; however, if not administered simultaneously, they can be administered close enough in time to provide the desired therapeutic effect, which can be in a synergistic manner. Thus, the term is not limited to administration of active agents at exactly the same time.

[0073] The dosage of the additional therapeutic agent may be the same as or even lower than the known or recommended dose. See Hardman et al., eds., Goodman & Gilman's The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill, New York, 2001;Physician's Desk Reference 60th ed., 2006. Anti-cancer agents that can be used in combination with the therapy of the present invention are known in the art. See, for example, U.S. Pat. No. 9,101,622 (section 5.2 thereof). An "anti-cancer" agent can negatively affect cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing blood supply to tumors or cancer cells, promoting an immune response against cancer cells or tumors, preventing or inhibiting the progression of cancer, or prolonging the lifespan of patients with cancer. More generally, these additional active agents will be provided in a combined amount effective to kill or inhibit the proliferation of diseased or cancerous cells. This process may involve contacting cells with recipient cells and agents or multiple factors simultaneously. This can be accomplished by contacting cells with a single composition or pharmacological formulation that contains both agents, or by contacting cells with two separate compositions or formulations, one of which contains ASO and the other of which contains a second agent.

[0074] In some embodiments, the therapies of the present disclosure are used in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic intervention, targeted therapy, apoptosis-inducing therapy, or cell cycle modulating therapy.

[0075] In some embodiments, the therapy of the present disclosure may precede or follow the additional agent (e.g., anti-cancer) treatment by intervals ranging from minutes to weeks. In embodiments in which the additional agent and the therapy of the present disclosure are applied separately to the subject, it will generally be ensured that no significant period of time has elapsed between the time of each delivery, so that the agent and the therapy of the present disclosure may still exert a beneficial combined effect against the disease of the subject. In such cases, it is contemplated that both modalities may be administered to the subject within about 12-24 hours of each other, more preferably within about 6-12 hours of each other. In some circumstances, it may be desirable to significantly extend the period of treatment, however, with several days (2, 3, 4, 5, 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8) elapsed between the respective administrations. In some embodiments, the therapy of the present disclosure and the additional agent may be administered within the same patient visit; in other embodiments, the two agents are administered during different patient visits.

[0076] In some embodiments, the therapy of the present disclosure and the additional agent are administered in a cyclical manner. Cycle therapy involves the administration of one therapeutic agent for a period of time, followed by the administration of a second therapeutic agent for a period of time, and repeating this sequential administration, i.e., cycle, to reduce the development of resistance to one or both of the additional therapeutic agents, to avoid or reduce the side effects of one or both of the additional therapeutic agents, and / or to improve the efficacy of the therapy. In one example, cycle therapy involves the administration of a first additional therapeutic agent for a period of time, followed by the administration of a second additional therapeutic agent for a period of time, optionally followed by the administration of a third additional therapeutic agent for a period of time, etc., and repeating this sequential administration, i.e., cycle. It is expected that the treatment cycle will be repeated as necessary. It is also contemplated that various standard therapies as well as surgical interventions can be applied in combination with the cells of the present disclosure.

[0077] Representative types of additional therapeutic agents are described below. In some embodiments, the additional therapeutic agent is a MYC inhibitor. Representative MYC inhibitors include cisplatin, gemcitabine, axitinib, nadroparin, and benzamidine.

[0078] In some embodiments, the additional therapeutic agent is an acetyl-CoA carboxylase-alpha (ACC1) inhibitor. In some embodiments, the AAC1 inhibitor is 5-tetradecyl-oxy-2-furoic acid (TOFA).

[0079] In some embodiments, the additional therapeutic agent is an immunomodulatory imide drug (IMiD). Exemplary IMiDs include thalidomide, lenalidomide, pomalidomide, and iveldimide. In some embodiments, the additional therapeutic agent is a proteasome inhibitor. Exemplary proteasome inhibitors include bortezomib, carfilzomib (Kyprolis®), delanzomib, ixazomib, marizomib, and oprozomib.

[0080] Multiple myeloma therapeutics that may be suitable for combination with the therapies of the invention described herein include belantamab mafodotin-blmf (Blenrep®), bortezomib (Velcade®), carfilzomib (Kyprolis®), carmustine (BiCNU®), siltacabtagene autolucel (Carvykti®), cyclophosphamide, daratumumab (Darzalex®), daratumumab and hyaluronidase-fihj (Darzalex®). Faspro®), doxorubicin hydrochloride liposomal (Doxil®), elotuzumab (Empliciti®), idecabutagen bicelucel (Abecma®), isatuximab-irfc (Sarclisa®), ixazomib citrate (Ninlaro®), lenalidomide (Revlimid), melphalan and melphalan hydrochloride (Alkeran® tablets, Alkeran® for injection, E vomela®), pamidronate disodium (Aredia®), plerixafor (Mozobil®), pomalidomide (Pomalyst®), selinexor (Xpovio®), thalidomide (Thalomid®), zoledronic acid (Zometa®), as well as the PAD combination of bortezomib (PS-341), doxorubicin hydrochloride (Adriamycin®), and dexamethasone.

[0081] immunotherapy Immunotherapy, including immune checkpoint inhibitors, may be employed to treat diagnosed cancer. Immune checkpoint molecules include, for example, PD1, CTLA4, KIR, TIGIT, TIM-3, LAG-3, BTLA, VISTA, CD47, and NKG2A. Clinically available examples of immune checkpoint inhibitors include durvalumab (Imfinzi®), atezolizumab (Tecentriq®), and avelumab (Bavencio®). Clinically available examples of PD1 inhibitors include nivolumab (Opdivo®), pembrolizumab (Keytruda®), and cemiplimab (Libtayo®).

[0082] chemotherapy Anti-cancer therapy also includes a variety of combination therapies with both chemical and radiation-based treatments. Combination chemotherapy includes, for example, Abraxane®, altretamine, docetaxel, Herceptin®, methotrexate, Novantrone®, Zoladex®, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, bromocriptidine ... omycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, Taxol®, gemcitabien, Navelbine®, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine, and methotrexate, or any analog or derivative variant of the foregoing, and also combinations thereof.

[0083] Radiation therapy Anticancer therapy also includes radiation-based DNA-damaging therapy.Combined radiation therapy includes what is commonly known as gamma rays, X-rays, and / or the directional delivery of radioisotopes to tumor cells, which cause extensive damage to DNA, to DNA replication and repair, and to chromosome assembly and maintenance.The dosage range of radioisotopes varies widely and depends on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by neoplastic cells, and will be determined by the attending physician.

[0084] Radiation therapy can include external or internal radiation therapy. External radiation therapy involves a radiation source that is outside the subject's body and delivers radiation to the area of ​​the cancer inside the body. Internal radiation therapy uses radioactive material sealed in needles, seeds, wires, or catheters that are placed directly into or near the cancer.

[0085] These and other aspects of the present disclosure will be further understood in light of the following working examples, which are intended to illustrate certain embodiments of the present disclosure, but are not intended to limit its scope, as defined by the claims. EXAMPLES

[0086] [Example 1] material and method Cell lines: Cell lines (CL) were grown at 37°C and 5% CO2. a) MM-CL: AMO1, NCI-H929, SK-MM-1, U266, JJN3, and KMS-12-BM were purchased from DSMZ (Braunschweig, Germany). MM.1S, MM.1R, and RPMI-8226 were purchased from ATCC (Manassas, VA, USA). ABZB CL is AMO1 bortezomib-resistant and ACFZ CL is AMO1 carfilzomib-resistant (Morelli et al., Blood 132:1050-1063 (2018)). LR7 CL is U266 melphalan-resistant (Morelli et al., Blood 132:1050-1063 (2018)). These cells were cultured in RPMI-1640 medium (Gibco® Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Lonza Group Ltd., Basel, Switzerland) and 1% penicillin / streptomycin (Gibco®, Life Technologies). b) B-cell lymphoma cell lines (BCL0CL): Maver-1, Jeko-1 (mantle cell lymphoma), Sultan, P3HR1, Daudi and Raji (Burkitt's lymphoma) (purchased from ATCC) were cultured in RPMI-1640 medium (Gibco® Life Technologies) supplemented with 10% fetal bovine serum (Lonza Group Ltd.) and 1% penicillin / streptomycin (Gibco®, Life Technologies).c) Non-malignant cell lines: HK-2 (human kidney cells, cortical / proximal tubule) were purchased from ATCC and cultured in K-SFM (keratinocyte serum-free medium) (Thermo Fisher Scientific, Waltham, MA, USA) supplemented according to ATCC guidelines; THLE-2 (human liver cells) were purchased from ATCC and cultured in BEGM (bronchial epithelial cell growth medium) (Lonza Group Ltd.) supplemented according to ATCC guidelines; d) Lenti-X™ 293T (human fetal kidney, purchased from Takara Bio Inc. (cat. no. 632180)) and Flp-In T-REx cells were cultured in DMEM (Dulbecco's modified Eagle's medium) (Gibco®, Life Technologies) supplemented with 10% fetal bovine serum (Lonza Group Ltd.) and 1% penicillin / streptomycin (Gibco®, Life Technologies). e) P493-6 were cultured in RPMI-1640 medium (Gibco® Life Technologies) supplemented with 10% fetal bovine serum (Lonza Group Ltd.) and 1% penicillin / streptomycin (Gibco®, Life Technologies). f) 5TGM1 murine MM cells were cultured in IMDM (Iscove's Modified Dulbecco's Medium) (Gibco®, Life Technologies) supplemented with 10% fetal bovine serum (Lonza Group Ltd.) and 1% penicillin / streptomycin (Gibco®, Life Technologies). g) Colorectal cancer cell lines HCT116 and DLD-1, parental, and dicer mutants were purchased from Horizon Discovery and cultured in ATCC formulated McCoy's 5a Medium Modified (cat. no. 30-2007) supplemented with 10% fetal bovine serum (Lonza Group Ltd.) and 1% penicillin / streptomycin (Gibco®, Life Technologies). Cells were periodically tested to exclude mycoplasma contamination. Cells were checked for STRs (short tandem repeats).

[0087] Primary patient cells: After informed consent was approved by the Dana-Farber Cancer Institute Institutional Review Board, CD138+ cells were isolated from BM aspirates of MM patients by Ficoll-Hypaque (Lonza Group, Basel, Switzerland) density gradient sedimentation; followed by antibody-mediated positive selection using anti-CD138 magnetic-activated cell separation microbeads (Miltenyi Biotech, Gladbach, Germany). The purity of immunoselected cells was assessed by flow cytometric analysis using phycoerythrin-conjugated CD138 monoclonal antibody by standard procedures. For long-term culture (6 days), CD138+ cells were physically separated from HS-5 cells and cultured using Falcon cell culture inserts (Corning, New York, NY, USA) according to the manufacturer's instructions, as previously described (Morelli et al., Blood 132:1050-1063 (2018)).

[0088] Peripheral blood mononuclear cells: After informed consent was approved by the Dana-Farber Cancer Institute Institutional Review Board, CD138+ cells were isolated from BM aspirates of MM patients by Ficoll-Hypaque (Lonza Group, Basel, Switzerland) density gradient sedimentation; followed by antibody-mediated positive selection using anti-CD138 magnetic activated cell separation microbeads (Miltenyi Biotech, Gladbach, Germany). Purity of immunoselected cells was assessed by flow cytometric analysis using phycoerythrin-conjugated CD138 monoclonal antibody by standard procedures. For long-term culture (6 days), CD138+ cells were physically separated from HS-5 cells and cultured using Falcon cell culture inserts (Corning, New York, NY, USA) according to the manufacturer's instructions, as previously described (Morelli et al., Blood 132:1050-1063 (2018)).

[0089] RNA-seq, microarray-based gene expression analysis, and microRNA profiling in MM patients. RNA-seq: As the primary dataset, we used previously published RNAseq data from CD138+ MM cells from 360 MM patients from the IFM / DFCI 20019 clinical trial (NCT01191060) (Samur et al., Leukemia 32:2626-2635 (2018)). We used this dataset to assess lncRNA expression in newly diagnosed MM patients. Unstranded paired-end RNA sequencing was quantified using pseudo-mapping with Salmon. Reference transcripts for GRCh38 transcripts were downloaded from Gencode v24. After QC controls, TPM values ​​for genes were generated from isoform-level TPMs using tximport. All figures were created using R and ggpubr. De novo assembly for the RNAseq data for the IFM cohort was performed using TopHat. Using the Gencode v24 GTF file as a reference, new isoforms annotated by TopHat were identified from the output file. Newly diagnosed (ND) and recurrent (R) samples from the DFCI / IFM continuation study were used to compare ND-MM and R-MM. Similar to the diagnosis-only samples, these samples were sequenced using paired end sequencing and expression was quantified using the same pipeline described above. As a secondary dataset, MMRF CoMMpass data filtered at the TPM level was downloaded from the MMRF research portal. Only samples retrieved from CD138+ selected BM samples at diagnosis were used for analysis.

[0090] Microarray-Based Gene Expression Analysis: RROL expression levels were assessed in a publicly available dataset (GSE66293) (Lionetti et al., Oncotarget 6:24205-17 (2015)), including 129 newly diagnosed and 12 recurrent MM cases profiled by GeneChip Human Gene 1.0 ST arrays (Affymetrix, Santa Clara, CA, USA) (Todoerti et al., Clin. Cancer. Res. 19:3247-58 (2013)). Normalized and re-annotated expression levels were obtained using the Chip Definition File from the BrainArray library version 20.0.0 (Dai et al., Nucleic Acids Res. 33:e175-9 (2005)) as described (Todoerti et al., Clin. Cancer. Res. 19:3247-58 (2013)). Differential expression between the two groups was assessed by Wilcoxon's runk sum test with continuity correction in the R environment (version 4.0.4).

[0091] miRNA Profiling: miRNA expression data for the IFM cohort was generated using the Affymetrix GeneChip® miRNA Array 4.0 platform. The miRNA expression data was normalized using the oligo package from Affy and Bioconductor.

[0092] Correlation analysis: Spearman correlation was used to evaluate the correlations between lncRNAs, mRNAs, and miRNAs.

[0093] Survival analysis: Survival analysis was performed using the survival package in R, and groups were compared using the log-rank test.

[0094] Generation of dCAS9-KRAB cell lines. Cell lines expressing dCas9-KRAB fusion proteins were generated as previously described (Morelli et al., Methods Mol. Biol. 2348:189-204 (2021)). Briefly, cells were infected with lentivirus expressing the dCas9-BFP-KRAB transgene (Addgene, plasmid #46911) and selected for clones stably expressing high BFP. Infection was performed at a low MOI (<0.4). Validation of transcriptional repression in MM cell lines expressing dCas9-KRAB fusion proteins was assessed by infecting cells with lentivirus expressing an sgRNA against ENO1 (gRNA_ENO1: CCGGCGAGATCTCCGTGCTC (SEQ ID NO: 66) or a non-targeting negative control (gRNA_NC: GATGTGGTCATTCGTCATGA (SEQ ID NO: 67)). sgRNAs were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (plasmid #60955). The procedure followed the protocol established by the Weissman lab and available online at weissmanlab.ucsf.edu / CRISPR / CRISPR.html. Downregulation of ENO1 was assessed by reverse transcription (RT) and quantitative real-time amplification (qRT-PCR) analysis, following the procedure described below for qRT-PCR.

[0095] CRISPRi viability screening. Library design: gRNAs targeting lncRNA TSSs were designed using the Broad Institute web portal (now called CRISPick: portals.broadinstitute.org / gppx / crispick / public). For the primary screening, target lncRNAs were selected based on median TPM>0.5 in the IFM / DFCI cohort. For the secondary screening, target lncRNAs were selected based on primary screening results (i.e., targeted by significantly depleted or enriched gRNAs, FDR<0.25); in addition, additional lncRNAs were identified by de novo assembly of RNA-seq data and manually selected lncRNAs were selected based on their impact on clinical outcomes of MM patients enrolled in IFM / DFCI clinical studies.

[0096] gRNA Pool Library Production: A primary CRISPRi library consisting of 7,500 gRNAs or a secondary CRISPRi library consisting of 3,750 gRNAs was co-transfected with packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) into HEK293T cells using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific) according to the manufacturer's protocol. Library DNA (4 μg), psPAX2 DNA (4 μg), and VSV-G DNA (2 μg) were mixed and transfected into HEK293T cells in T75 flasks (×10). Six hours after transfection, the medium was removed and replaced with 10 ml of virus production medium (DMEM medium supplemented with 10% FBS). 48 hours after transfection, the lentiviral medium was collected, concentrated using Lenti-X™ Concentration Reagent (Takara Bio Inc., Cat. No. 631232), and stored at -80°C.

[0097] Virus titer determination: 1×10 6Single cells (each cell line) were seeded per well of a 6-well plate. Cells were infected overnight with various amounts of lentivirus in the presence of 8 μg / ml polybrene. Titration of lentiviral particles was performed by flow cytometry according to the protocol from Cellecta, sections 5.3 and 5.4.

[0098] Primary screening: 4 × 10 expressing dCAS-KRAB fusion protein 7 MM cells were infected with library lentiviral particles at MOIs ranging from 0.1 to 0.3 using spinoculation. Infections were performed in triplicate. Virus-containing medium was removed 1 h after spinoculation, and cells were washed 2× with PBS and cultured in complete medium. After 4 days, cells were selected with puromycin for an additional 3 days. On day 7, cell debris was removed by Ficoll-Hypaque (Lonza Group, Basel, Switzerland) density gradient sedimentation. Cells were cultured for an additional 2 weeks to ensure 1000× representation of the library. Genomic DNA was isolated using the Blood&Cell Culture DNA Maxi / Midi kit (Qiagen #13362, 13343) according to the manufacturer's protocol. PCR amplification of gRNA cassettes for Illumina sequencing of gRNA representation was performed by Cellecta (Mountain View, CA). Protocols for PCR and Illumina sequencing are available online.

[0099] Screening data analysis: For candidate gene discovery, the normalized gRNA count table was loaded into MaGeCK (Model-Based Analysis of Genome-Wide CRISPR-Cas9 Knockouts) by comparing the experimental and control (plasmid library) conditions. Top genes were determined based on the average log2 fold change (LFC) and false discovery rate (FDR) for all gRNAs.

[0100] In vitro validation of MIR17HG: Top scoring (n=4, MIR17HG sgRNA#1-4, SEQ ID NO:2-5) sgRNAs targeting MIR17HG were cloned into pRSGT16-u6Tet-sg-CMV-TetRep-2A-TagRFP-2A-Puro (Cellecta, Cat#SVCRU6T16-L) vector and verified by sequencing. gRNA constructs were co-transfected into HEK293T cells with packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific) according to the manufacturer's protocol. Viruses were harvested 48 hours later, concentrated, and stored at -80°C. MM cell lines stably expressing dCas9-KRAB fusion proteins were infected with lentiviruses driving expression of individual sgRNAs. Infected cells were selected using puromycin. Expression of sgRNAs was achieved by doxycycline (0.5 μg / mL, every other day).

[0101] Antisense oligonucleotides, synthetic miRNA mimics and inhibitors, siRNA. Long non-coding LNA gapmerR, SEQ ID NO:2-14, were custom designed and purchased from Exiqon (Vedbaek, Denmark). Synthetic mimetics and inhibitors for miR-17a, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a1 were purchased from Ambion (Applied Biosystems, CA, US). Silencer Select siRNA was purchased from Ambion (Applied Biosystems, CA, US). The design of t-ASO is described in Tables 2-4.

[0102] Gymnosis. Gymnotic experiments were performed as previously described (Taiana et al., Methods Mol. Biol. 2348:157-166 (2021)). Briefly: cells were seeded at a seeding density that reached confluence on the last day of the experiment. Cell numbers at seeding ranged from 0.5 to 2.5 × 10 in 96-well plates. 3 2.5–10 × 10 in a 12-well plate 4 1–3 × 10 in a 6-well plate 5 For ChIP and Co-IP experiments, cell numbers at seeding ranged from 1 × 10 in a T75 flask (10 mL final volume). 6 There were 100 pieces.

[0103] Transient transfection of cells. Cells from adherent cell lines were transfected with 25 nM LNA gapmeR (Exiqon) by Lipofectamine 2000 according to the manufacturer's instructions. Cells from suspension cell lines (i.e., non-adherent) were transfected (electroporated) by the Neon transfection system (Invitrogen, CA, US) (1150, 2 pulses at 30 ms). LNA gapmeR, miRNA inhibitors / mimics, and siRNA were used at 25 nM. Transfection efficiency, assessed by flow cytometry analysis, reached 85%–90% compared to FAM dye-labeled anti-miR negative controls.

[0104] Stable expression using lentiviral plasmids. To generate cells stably overexpressing the miR-17-92 cluster, AMO1 was transduced with the PMIRH17-92PA-1 lentivector (System Biosciences, Palo Alto, CA, USA). To generate cells stably expressing c-MYC, U266 was transduced with a Myc-DDK-tagged human v-myc myelocytomatosis viral oncogene homolog (avian) (MYC) lenti-ORF clone (RC201611L3) (Origene Technologies, Rockville, Maryland, MD). To generate cells stably expressing WDR82, AMO1 was transduced with an mGFP-tagged human WD repeat domain 82 (WDR82) lenti-ORF clone (RC216325L4) (Origene Technologies, Rockville, Maryland, MD). To generate cells stably expressing Cas9, AMO1 and H929 were transduced with pLX_311-Cas9 (Addgene #96924). Cells expressing the transgene were selected by antibiotic selection for 3-5 days.

[0105] CRISPR / CAS9 gene knockout. To generate Drosha KO cells, AMO1 and H929 stably expressing Cas9 were transduced with transEDIT CRISPR single-stranded gRNA lentiviral expression vector targeting Drosha (CMV promoter, ZsGreen, TEVH-1203933) (transOMIC technologies Inc., Huntsville, AL, USA). Five days after infection, ZsGreen+ cells were sorted (BD FACSARIA III; BD Biosciences, Qume Drive San Jose, CA, USA) and cultured.

[0106] Cell viability assay. Cell viability was assessed by Cell Counting Kit-8 (CCK-8) assay (Dojindo Molecular Technologies) and 7-AminoactinoMYCin (7-AAD) flow cytometry assay (BD biosciences) according to the manufacturer's instructions. Flow cytometry analysis was performed by FACS CANTO II (BD biosciences) or Attune NxT flow cytometer (Thermo Fisher Scientific).

[0107] Detection of apoptosis. Apoptosis was examined by Annexin V / 7-AAD flow cytometry assay (BD biosciences) and by electron microscopy. Flow cytometry analysis was performed by FACS CANTO II (BD biosciences) or by Attune NxT flow cytometer (Thermo Fisher Scientific).

[0108] Reverse transcription (RT) and quantitative real-time amplification (qRT-PCR). RNA extraction, reverse transcription (RT), and quantitative real-time amplification (qRT-PCR) were performed as previously described (Morelli et al., Blood 132:1050-1063 (2018)). Briefly, total RNA was extracted from cells using TRIzol® Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Nuclear and cytoplasmic intracellular RNA purification was performed using an RNA intracellular isolation kit (catalog number 25501) (Active Motif, Carlsbad, CA) according to the manufacturer's instructions. Total RNA integrity was verified by nanodrop (Celbio Nanodrop Spectrophotometer nd-1000). For RROL (MIR17HG) and mRNA dosage studies, cDNA with oligo-dT primers was obtained by High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and then used as a template to quantify:

[0109] a) Human RROL (Hs03295901), ACACA or ACC1 (Hs01046047_m1), ANO6 (Hs03805835_m1), EXT1 (Hs00609156_m1), FER (Hs00245497_m1), MALAT1 (Hs00273907_s1), and PVT1 (Hs00413039_m1). Normalization was performed using human GAPDH (Hs03929097_g1) or ACTB (Hs03023943_g1) or 18S (Hs03003631_g1).

[0110] b) Muridae rrol (Mm01230322_s1), acaca (Mm01304258_m1), and fer (Mm00484303_m1).

[0111] Single-tube TaqMan miRNA assays (Thermo Fisher Scientific) were used to detect and quantitate miR-17 (002308), miR-18a (002422), miR-19a (000395), miR-20a (000580), miR-19b (000396), and miR-92a-1 (000431) using a ViiA7 RT reader (Thermo Fisher Scientific) according to the manufacturer's instructions. Mature miRNA expression was normalized to RNU44 (Thermo Fisher Scientific, Assay Id: Hs03929097_g1). RROL isoforms were also detected by SYBR Green qRT-PCR using the following primers: RROL-1 (Fw, 5'-CCTGCAACTTCCTGGAGAAC (SEQ ID NO: 68); Rev, 5'-GTCTCAAGTGGGCATGATGA (SEQ ID NO: 69)), RROL-2 (Fw, 5'-GACCCTCTTTTAAGTTGGGTG (SEQ ID NO: 70; Rev, 5'-TGGCAAAACATTTTCCTCCT (SEQ ID NO: 71)). Comparative real-time polymerase chain reaction (RT-PCR) was performed in triplicate, including no template controls. Relative expression was calculated using the comparative cross threshold (Ct) method.

[0112] Western blot analysis. Protein extraction and western blot analysis were performed as previously described. Briefly, cells were lysed in 1× RIPA buffer (Cell Signaling Technology) supplemented with Halt protease inhibitor single-use cocktail (100×, Thermo Scientific). Total cell lysates (approximately 20 μg per lane) were separated using 4-12% Novex Bis-Tris SDS-acrylamide gels (Invitrogen) and electrophoretically transferred to nitrocellulose membranes (Bio-Rad). Nuclear protein extraction was performed using NE-PER™ Nuclear and Cytoplasmic Extraction Reagent (Thermo Fisher, #78833) according to the manufacturer's instructions. After electrophoresis, the nitrocellulose membranes were blocked and probed with primary antibodies overnight at 4°C, then the membranes were washed three times in PBS-Tween and then incubated with horseradish peroxidase-conjugated secondary antibodies for 2 h at room temperature. Chemiluminescence was detected using Western blotting luminol reagent (sc-2048, Santa Cruz, Dallas, TX, USA).

[0113] Primary antibodies: Anti-MYC [D84C1] (#5605), anti-WDR82 [D2I3B] (#99715), anti-H3K4me3 [C42D8] (#9751), and anti-Lamin A / C (#2032) antibodies were purchased from Cell Signaling Biotechnology (Danvers, MA). Anti-Drosha antibody [EPR12794] (ab183732) was purchased from Abcam (Cambridge, UK). Anti-MYC [9E10] (sc-40), GAPDH (sc-25778), and β-actin (ab96682) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Monoclonal anti-FLAG® M2 antibody (F3165) was purchased from Millipore Sigma (Bedford, MA). Secondary antibodies: anti-rabbit IgG, HRP-linked antibody (#7074) and anti-mouse IgG, HRP-linked antibody (#7076) were purchased from Cell Signaling Biotechnology (Danvers, Mass.).

[0114] RNA FISH. RNA-FISH experiments were performed according to established protocols (Raj et al., Nat. Methods 5:877-9 (2008); Shaffer et al., PLoS One 8:e75120-9 (2013)). Cells were seeded on poly-L-lysine coated coverslips and allowed to attach for at least 1 h. The medium was then removed and cells were washed once with 1×PBS, then fixed and permeabilized in ice-cold 95% methanol / 5% acetic acid at 4° C. for 10 min. After removing the fixative, cells were washed with Wash Buffer A (20% Stellaris RNA FISH Wash Buffer A, Biosearch Technologies, Inc., SMF-WA1-60; 10% deionized formamide, EMD Millipore, S4117; in RNAse-free water, Life Technologies, AM9932) for 5 min at room temperature. The cells were then incubated with RNA FISH probe (Stellaris) at a working concentration of 125 nM in hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer, Biosearch Technologies, SMF-HB1-10; 10% deionized formamide) overnight at 37° C. in a humidified chamber in the dark. The next day, the cells were washed three times for 30 min each at 37° C. in the dark with Wash Buffer A. The cells were then incubated with Wash Buffer A+1:1000 Hoescht 33342 (Invitrogen, stock 10 mg / mL) for 15 min at 37° C., followed by a 5 min wash at room temperature with Wash Buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were mounted on the slides with Vectashield (VWR 101098-042) and the coverslips were sealed with clear nail polish. Z-axis images were acquired on an LSM 880 with Airyscan using an oil immersion 63x objective and 2-3x zoom (WMKeck Microscopy Facility, MIT), and Airyscan processing was performed using the "auto" intensity attribute. Representative images were generated using ImageJ.

[0115] Co-immunofluorescence with RNA FISH (Co-IF / FISH). Co-IF / FISH experiments were performed in a similar format to the dual RNA-FISH experiments with the following modifications. After cells were allowed to adhere to the coverslip, cells were fixed with 4% PFA (VWR, BT140770) in RNase-free PBS for 10 min at room temperature. After cells were washed 3x with PBS for 5 min, cells were permeabilized with ice-cold 95% methanol / 5% acetic acid for 10 min at 4°C. Cells were then blocked with 4% IgG-free bovine serum albumin (VWR, 102643-516) in PBS for 30 min, and then primary antibody mixture (1:500 rabbit anti-c-MYC D84C12 in PBS) was added to the cells and incubated overnight at room temperature in a humidified chamber. The next day, cells were washed 3x with PBS for 5 min at room temperature, and secondary antibody mixture (Alexa Fluor 488 goat anti-rabbit IgG, ThermoFisher A11008, 1:500 in PBS) was added and incubated for 1 h at room temperature in the dark. Cells were washed 3x with PBS for 5 min, and prior to RNA FISH, cells with antibody staining were re-fixed with 4% PFA in PBS for 10 min at room temperature, followed by 3x washing with PBS. After antibody staining and fixation, the RNA FISH protocol was performed as described above, starting with washing with Wash Buffer A.

[0116] Microarray-based gene expression profiling after RROL depletion. Microarray-based analysis of gene expression changes after treatment with ASO1 was performed as previously described (Morelli et al., Blood 132:1050-1063 (2018)).

[0117] AMO1 after RROL depletion DR-KORNA-seq analysis of RROL. Total RNA was extracted as described above and submitted to NovaSeq RNAseq analysis, followed by the VIPER NGS analysis pipeline (Cornwell et al., BMC Bioinformatics 19:135-14 (2018)). The list of differentially expressed genes (DEGs) was applied to GSEA or IPA software to reveal biological pathways modulated by RROL.

[0118] Luciferase reporter assay. Promoter reporter clones for human ACC1 (NM_198834), ANO6 (NM_001025356), CCDC91 (NM_018318), EPT1 (NM_033505), EXT1 (NM_000127), FER (NM_001308028), and ZYG11A (NM_001004339) were cloned into the GLuc-ON™ promoter reporter vector (GeneCopoeia, Rockville, MD). Luciferase reporter assays were performed according to the manufacturer's instructions.

[0119] ChIRP. RROL and LacZ antisense DNA probes were designed using the online probe designer at singlemoleculefish.com. Oligonucleotides were biotinylated at the 3' end with an 18-carbon spacer arm. AMO1 cells were harvested and subjected to ChIRP using the EZ-Magna ChIRP RNA Interactome Kit (Millipore Sigma, Bedford, MA) according to the manufacturer's instructions and established protocols (Chu et al., J. Vis. Exp. 61:3912-6 (2012)).

[0120] De novo lipogenesis assay. Cells were plated at 5 × 10 per well in a 6-well plate. 5 The cells were seeded at 100-fold and incubated for 3 days in the presence of treatment (ASO1 / 10058-F4 / IPTG or respective control). 24 hours before the end of treatment, 1 μCi of14 C-labeled glucose (ARC-0122D) was added to each well. Cells were harvested, washed with cold PBS, and collected in glass tubes. Purified lipid extracts were obtained by chloroform-methanol-based extraction (Bligh and Dyer, Can. J. Biochem. Physiol. 37:911-7 (1959)). Glucose incorporation into cellular lipids was quantified by photon emission by scintillation counting and normalized to total protein content.

[0121] Lipid profiling. Lipids were extracted from MM cells, dried, and stored under argon until analysis. Lipid species were analyzed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI / MS / MS) on a Nexera X2 UHPLC system (Shimadzu) coupled with a hybrid triple quadrupole / linear ion trap mass spectrometer (6500+ QTRAP system; AB SCIEX) by Lipometrix, KU Leuven, Belgium.

[0122] Lipid extraction: Lipid extraction was performed using 1N HCl:CH3OH 1:8 (v / v), 900 μl CHCl3, and 200 μg / ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma Aldrich). A mixture of deuterium-labeled lipids, SPLASH® LIPIDOMIX® Mass Spec Standard (#330707, Avanti Polar Lipids), was spiked into the extract mix. The organic fraction was evaporated at room temperature using a Savant Speedvac spd111v (Thermo Fisher Scientific), and the remaining lipid pellet was stored under argon at -20°C.

[0123] Mass spectrometry. The lipid pellet was reconstituted in 100% ethanol immediately prior to mass spectrometry analysis. Lipid species were analyzed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI / MS / MS) on a Nexera X2 UHPLC system (Shimadzu) interfaced with a hybrid triple quadrupole / linear ion trap mass spectrometer (6500+ QTRAP system; AB SCIEX). Chromatographic separation was performed on an XBridge amide column (150 mm × 4.6 mm, 3.5 μm; Waters) maintained at 35 °C using mobile phase A [1 mM ammonium acetate in water-acetonitrile 5:95 (v / v)] and mobile phase B [1 mM ammonium acetate in water-acetonitrile 50:50 (v / v)] with the following gradient: (0–6 min: 0% B > 6% B; 6–10 min: 6% B > 25% B; 10–11 min: 25% B > 98% B; 11–13 min: 98% B > 100% B; 13–19 min: 100% B; 19–24 min: 0% B) at a flow rate of 0.7 mL / min increasing to 1.5 mL / min after 13 min. Sphingomyelin, ceramide, dihydroceramide, hexosylceramide, and lactosylceramide were measured in positive ion mode using precursor scans at 184.1, 264.4, 266.4, 264.4, and 264.4, respectively. Triacylglycerides and diacylglycerides were measured in positive ion mode using neutral loss scans for one of the fatty acyl moieties. Phosphatidylcholine, lysophosphatidylcholine, phosphatidylethanolamine, lysophosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, and phosphatidylserine were measured in negative ion mode by fatty acyl fragment ions. Lipid quantification was performed by scheduled multiple reaction monitoring (MRM), and transitions were based on neutral loss or typical product ions as described above.The instrument parameters were as follows: curtain gas = 35 psi; collision gas = 8 a.u. (medium); ion spray voltage = 5500 V and -4,500 V; temperature = 550 °C; ion source gas 1 = 50 psi; ion source gas 2 = 60 psi; declustering potential = 60 V and -80 V; entrance potential = 10 V and -10 V; collision cell exit potential = 15 V and -15 V. For lipidomic analysis, the following fatty acyl moieties were taken into account: 14:0, 14:1, 16:0, 16:1, 16:2, 18:0, 18:1, 18:2, 18:3, 20:0, 20:1, 20:2, 20:3, 20:4, 20:5, 22:0, 22:1, 22:2, 22:4, 22:5, and 22:6, except for TG, which was considered to be 16:0, 16:1, 18:0, 18:1, 18:2, 18:3, 20:0, 20:1, 20:2, 20:3, 20:4, 20:5, 22:0, 22:1, 22:2, 22:4, 22:5, and 22:6.

[0124] Data analysis. Peak integration was performed using MultiQuantTM software version 3.0.3. Lipid species signals were corrected for isotope contributions (calculated using Python Molmass 2019.1.1) and quantified based on internal standard signals, adhering to the Lipodomics Standards Initiative (LSI) guidelines (Level 2 type quantification as defined by LSI).

[0125] ChIP-qPCR. ChIP-qPCR was performed as previously described (Fulciniti et al., Cell Rep. 25:3693-3705 (2018)). Briefly, 1 × 10 7 Cells (AMO1, H929, and U266 with corresponding treatments) MYC+) was crosslinked with 1% formaldehyde for 10 min at 37°C. Crosslinked chromatin was then extracted, diluted in lysis buffer, and sheared by sonication. Chromatin was divided into equal samples for immunoprecipitation with specific antibodies. Immunoprecipitates were pelleted by centrifugation and incubated at 68°C to release protein-DNA crosslinks. DNA was extracted from the eluate with a Qiaquick PCR purification kit (QIAGEN). Antibodies used were: endogenous MYC (Cell Signaling Technology, #13987), MYC-DDK (Santa Cruz Biotechnology, 9E10-x), GFP (Abcam, #ab290), H3K4me3 (#ab8580), normal rabbit IgG (Cell Signaling Technology, #2729), normal mouse IgG (Santa Cruz Biotechnology, sc-2025). Parallel samples of input DNA from the same cells were used as controls. ChIP and input DNA were analyzed using SYBR Green real-time PCR analysis (Applied Biosystems). Primers for ChIP-qPCR: ACC1 Fw: TTTCTCTCTTGCAGAGTGAGGTGTGG (SEQ ID NO: 72) and ACC1 Rv: TACAAAGGCACGGAGAGAGCAAGT (SEQ ID NO: 73).

[0126] RNA-protein pull-down. RROL transcripts were cloned into pBlueScript vector and sequence verified. In vitro transcription and biotinylation were performed using the AmpliScribe™ T7-Flash™ Biotin-RNA Transcription Kit (Lucigen, Cat# ASB71110) according to the manufacturer's instructions. Cell nuclear lysates (1 × 10 7AMO1 cells) were incubated with biotinylated RNA and streptavidin beads for RNA pull-down incubation using the Pierce™ Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, Cat#20164) according to the manufacturer's instructions. Proteins associated with the RNA were eluted and analyzed by Western blotting.

[0127] RNA Yeast 3 Hybrid. Saccharomyces cerevisiae strain YLW3 was transformed with the RNA plasmids using standard protocols. They were tested for viability by spotting on SC plates depleted of uracil (SC-U). Protein plasmids were transformed into yeast strain Y8800 and grown on SC plates depleted of tryptophan (SC-W). Yeast strain YLW3 containing the tested RNA plasmid was mated with the Y8800 yeast strain containing the protein plasmid. Mating was performed in YPD medium according to the manufacturer's protocol. Diploids carrying both plasmids were selected on SC medium depleted of tryptophan and uracil (SD-WU) and dimerization was tested by growth on medium also depleted of histidine (SC-WUH). The next day, the diploids in SC-WUH medium were transferred to solid agar plates containing various levels of 3AT, a competitive inhibitor of the HIS3 gene product, to increase the stringency of selection. Only diploids with significant interactions should be able to produce enough histidine for survival. After 1-3 days, the growth of different colonies in different conditions was examined to find the diploids with the strongest interactions.

[0128] RIP-qPCR. RNA immunoprecipitation (RIP) experiments were performed using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore Sigma, Cat. No. 17-701) according to the manufacturer's instructions. The anti-MYC antibody [Y69] used for RIP was purchased from Abcam (ab32072). Normal rabbit IgG was purchased from Cell Signaling Technology (Cat. No. #2729). The primers used to detect RROL are listed above.

[0129] Co-immunoprecipitation (Co-IP). Protein lysates were diluted with 1 × 10 7 Cells (AMO1, H929, and U266 with corresponding treatments) MYC+ ). Co-immunoprecipitation was performed using the Pierce™ Co-immunoprecipitation Kit (Thermo Fisher Scientific, Cat. No. 26149) according to the manufacturer's instructions. The IP antibodies used were as follows: anti-MYC antibody [Y69] was purchased from Abcam (ab32072), anti-FLAG® M2 antibody was purchased from Millipore Sigma (F3165), and normal rabbit IgG was purchased from Cell Signaling Technology (2729).

[0130] Proximity-dependent biotin identification (BioID). BioID was performed as described by Kalkat et al., Mol. Cell 72:836-848 (2018). Briefly, FBA-MYC cells were grown to 60% confluence in T75 flasks prior to transfection with ASO1 (50 nM, using Lipofectamine 2000 as described above) and treatment with 1 mg / mL doxycycline (Millipore Sigma), 1 μM MG132 (Millipore Sigma), and 50 mM biotin (Bio Basic) for 24 hours. Experiments with FBA-MYC cells exposed to doxycycline included 16 biological replicates (8 with RROL depletion and 8 without RROL depletion). Negative controls used for analysis included 6 biological replicates of FBA-MYC cells not exposed to doxycycline. Cells were harvested by detachment and washed three times with 50 mL PBS before flash freezing. Cell pellets were lysed in 1 mL modified RIPA buffer (1% NP-40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1% SDS, 1:100 proteasome inhibitor cocktail (Thermo Fisher Scientific), 0.5% sodium deoxycholate) with 250 U benzonase (Millipore). Lysates were rotated for 1 h at 4°C, sonicated 3x30 s, and then centrifuged at 27000g for 30 min at 4°C. Biotinylated proteins were isolated by affinity purification using 30 mg washed streptavidin-Sepharose beads (GE) with 2 h rotation at 4°C. Beads were then washed 7x1 mL 50 mM ammonium bicarbonate (pH 8.0) before trypsin digestion.

[0131] Mass spectrometry. Mass spectrometry analysis of Co-IP and BioID samples was performed at the Taplin Mass Spectrometry Facility (Harvard Medical School, Boston, MA) following established protocols.

[0132] Animal studies. Six-week-old female immunodeficient NOD.CB17-Prkdcscid / NCrCrl (NOD / SCID) mice (Charles River) or NSG mice (Jackson Laboratory) were housed in our animal facility at Dana-Farber Cancer Institute (DFCI). All experiments were performed after approval by the DFCI Animal Ethics Committee and conducted using institutional guidelines.

[0133] AMO1 DR-KO Xenograft model: AMO was administered prior to subcutaneous injection into SCID NOD mice. DR-KO were gymnotic exposed to ASO1 (2.5uM) or ASO-NC (2.5uM) for 2 days. On the day of injection (day 0), cell viability was assessed by Annexin V / 7-AAD flow cytometry assay, confirming undetectable apoptosis-inducing activity of ASO-1 at this time point (not shown). For tumor cell injection, cells were resuspended in PBS 1x supplemented with ASO1 (5uM) or ASO-NC (5uM); then mixed with an equivalent volume of Matrigel (Corning, #354230) to reach a final oligo concentration of 2.5uM. 5x10 per mouse 6 Single cells were injected subcutaneously (5 mice per group). Tumor size was measured by electronic caliper.

[0134] AMO1 xenograft model: 5 × 10 6 AMO1 cells were injected subcutaneously into NOD SCID mice. When tumors became palpable (approximately 50 mm), G2-15b * Mice were randomized (3 groups, 5 mice / group) to receive SB9-19-TO or SB9-19-TO or vehicle (-) as a control. Treatment was administered at 10 mg / kg by IP injection every other day for 2 weeks. Tumor size was measured by electronic caliper. In the independent experiment used for RROL and ACC1 qRT-PCR analysis, mice were enrolled to receive treatment after tumors reached a volume of approximately 200 mm and were treated on days 1-3-5. Tumors were then harvested on day 6.

[0135] MOLP8-luc+ xenograft model: 1×10 6 MOLP8-luc+ cells were injected into 28 NSG mice via the tail vein. Three mice (marked by x) were then excluded due to failed injection. The next day, 11 mice were placed in the control group and 8 mice were placed in the G2-19b group. * 10 mice were assigned to treatment with SB9-19-TO and 6 mice to treatment with SB9-19-TO. Treatment was administered at 10 mg / kg by IP injection every other day for 2 weeks. At the end of the treatment cycle (day 15), BLI was measured as an index of tumor growth.

[0136] Tumor growth inhibition (%TGI) was determined as previously described (Buck et al., Cancer Res. 68:8322-32 (2008)) by the formula: %TGI=(1-[Tt / T0 / Ct / C0]1-[C0 / Ct])×100, where Tt=median tumor volume treated at time t, T0=median tumor volume treated at time 0, Ct=median tumor volume of controls at time t, and C0=median tumor volume of controls at time 0.

[0137] Statistical analysis. All in vitro experiments were repeated at least three times and performed in triplicate; a representative experiment is shown in the figures. Statistical significance of differences was determined using the Student's t-test (unless otherwise specified), with the minimum level of significance designated as p<0.05. Kaplan-Meier survival curves were compared by the log-rank test. Statistical analysis was determined using GraphPad software. Graphs were acquired using GraphPad software (unless otherwise specified).

[0138] [Example 2] Genome-wide CRISPRi viability screen identifies MIR17HG as a key dependency in MM. We analyzed RNA-seq data from 360 newly diagnosed MM patients and identified 913 lncRNA transcripts as expressed in primary MM cells and in a panel of 70 MM cell lines, exemplified in Figure 1A, left panel, labeled I. To systematically examine the role of these lncRNAs in MM cell growth, three MM cell lines (H929, KMS-11, and KMS-12-BM) were engineered to express dCAS9-KRAB fusion proteins and transduced with a pooled library of seven sgRNAs against each of the 913 transcription start sites (TSSs) and 576 negative control sgRNAs (see Figure 1A, middle panel, labeled II). The relative abundance of sgRNAs was assessed after 3 weeks by deep sequencing and analyzed using the Model-Based Analysis of Genome-Wide CRISPR-Cas9 Knockout (MAGeCK) Robust Rank Aggregation (RRA) algorithm (Li et al., Genome Biol. 15:554-12 (2014)). As illustrated in the right panel of FIG. 1A labeled III, the most enriched or depleted sgRNAs were further tested in a secondary screen using a pooled library targeting 224 lncRNA TSSs, known protein-coding cancer genes (MYC, IRF4) (Chesi et al., Cancer Cell 13:167-80 (2008); Shaffer et al., Nature 454:226-31 (2008)) or tumor suppressor (TP53) (Jovanovic et al., Front. Oncol. 8:665-7 (2019)) as positive controls, and the TSSs of 2245 non-targeting sgRNAs as negative controls. In the secondary screen, four MM cell lines (H929, KMS11, KMS12BM, and AMO1) were used to detect and rank significantly depleted or enriched sgRNAs.As expected, sgRNAs targeting IRF4 and MYC were significantly depleted in three (MYC) or all (IRF4) cell lines, while sgRNAs targeting TP53 were significantly enriched in both TP53 wild-type cell lines (AMO1 and H929) (Tessoulin et al., J. Hematol. Oncol. 11:137 (2018)). Figure 1B highlights the top lncRNA dependency MIR17HG, along with protein-coding genes IRF4 and MYC, which were used as positive controls. Figure 1C illustrates CCK-8 proliferation assays for MM cell lines AMO1, H929, KMS11, and KMS12BM stably expressing KRAB-dCAS9 fusion protein and transduced with a lentivector conditionally expressing anti-MIR17HG sgRNA. CCK-8 assays were performed at the indicated time points after exposure to doxycycline (0.5 μg / mL). Cell proliferation was calculated relative to parental cells infected with an empty sgRNA vector and exposed to doxycycline under several conditions. Focusing on depleted sgRNAs, we identified lncRNA dependencies in MM cells that were cell type specific (54%) or shared by more than one cell line (46%) (see Figure 8A). Ranking analysis of sgRNA depletion identified MIR17HG as the major lncRNA dependency in the screen, with RRA scores equal to or better than those obtained by targeting MYC or IRF4 in all cell lines tested (Figure 8B). To further validate this data, MM cell lines expressing dCAS9-KRAB fusion proteins were transduced with the top four sgRNAs targeting MIR17HG under the control of a tetracycline-inducible promoter, and reduced cell growth was observed after continuous exposure to doxycycline compared to cells infected with non-targeting sgRNAs, as illustrated in Figure 1C and Figure 8B. MIR17HG expression was examined by qRT-PCR 5 days after induction of gRNA with doxycycline. Results shown in Figure 8B are the average RNA expression levels after normalization with ACTB and ΔΔCt calculation.

[0139] Furthermore, two different locked nucleic acid (LNA) gapmeR ASOs targeting MIR17HG nascent RNA (pre-RNA) for RNase H-mediated degradation (Lai et al., Mol. Cell 77:1032-1043 (2020); Lee and Mendell, 2020) were used to transfect 11 MM cell lines, including those resistant to traditional anti-MM drugs (AMO1-ABZB, resistant to bortezomib; AMO1-ACFZ, resistant to carfilzomib; MM.1R, resistant to dexamethasone); and confirmed significant effects on MM cell viability independent of genetic and molecular background, as illustrated in Figure 1D and Figure 8C. ASOs were used at a concentration of 25 nM. Cell viability was measured 2 and 4 days after electroporation and is expressed as % of viability compared to cells transfected with NC-ASO. Data from one of three independent experiments are shown in Figures 1D and 1E. Data are presented as mean ± sd in Figures 1D and 1E. *p<0.05 by Student's t-test. Figure 8C shows MIR17HG expression by qRT-PCR 24 hours after transfection. Results shown are mean RNA expression levels after normalization with ACTB and ΔΔCt calculation. One of three independent experiments is shown.

[0140] These data demonstrate a widespread dependency on lncRNAs in MM cells. The molecular and functional roles of MIR17HG will be further explored in the MM setting.

[0141] [Example 3] MIR17HG RROL (RROL) mediates dependency in a microRNA-independent manner. As illustrated in Figure 2A, the microRNA cluster miR-17-92 (MIR17HG miR-17-92 In addition to providing precursors for the lncRNAs miR-17 / -18a / -19a / -20a / -19b / -92a1), MIR17HG also encodes the so far poorly characterized lncRNA transcript lnc-17-92TV1 (MIR17HG RROL RROL also produces RROL-dependent RROL-associated leukemia (also known as RROL-associated leukemia) (He et al., Nature 435:828-33 (2005); Ota et al., Cancer Res. 64:3087-95 (2004)). In two independent data sets from MM patients enrolled in the IFM / DFCI clinical trial (NCT01191060) analyzed at the time of diagnosis and / or relapse, it was observed that RROL expression was higher during disease progression (see Figures 9A-B); and that higher expression of RROL was associated with shorter event-free survival (EFS) and overall survival (OS) in three large cohorts of newly diagnosed MM patients (Figure 2B). RROL expression did not significantly correlate with miR-17-92 in CD138+ MM cells from 140 patients (average Spearman r = 0.16), suggesting that RROL and miR-17-92 may be subject to independent regulatory control and function in distinct molecular pathways (Figure 9C).

[0142] In support of the miRNA-independent function of RROL, firstly, we observed intact anti-proliferative activity of anti-MIR17HG ASO in the presence or absence of ectopic expression of pri-mir-17-92 in two MM cell lines (Figure 2C and Figure 9D). AMO1 and H929 cells were stably transduced with either a lentivector carrying pri-mir-17-92 (pri-miR) or a lentiviral vector carrying GFP as a control; two different ASOs targeting the 5' end of MIR17HG pre-RNA (5'-ASO), or a scrambled control (NC). The effect on cell proliferation was assessed 48 hours after transfection. Figure 9D shows cells infected with a lentiviral vector containing pri-mir-17-92 (lenti-pri-mir) or a lentiviral vector containing GFP. Results shown are the average miRNA expression levels after normalization with RNU44 and ΔΔCt calculation. To deplete RROL alone, ASOs were designed to target MIR17HG at the 5' end (5'-ASO), a sequence not included in ectopic pri-mir-17-92. Second, we used two Drosha knockout (DR-KO) MM cell lines (AMO1) that are unable to produce miR-17-92. DR-KO and H929 DR-KO) was established (Figure 9E). Results shown are the average miRNA expression levels after normalization with RNU44 and ΔΔCt calculation (Bartel et al., Cell 116:281-97 (2004)). ASO-mediated targeting of MIR17HG preRNA affects only RROL in these cells. Potent anti-proliferative activity in both DR-WT and DR-KO cell systems was observed, as assessed after gymnotic treatment with ASO1 (1 μM for AMO1 and 2.5 μM for H929) for 6 days and detected by Western blot analysis for Drosha expression in WT and KO cells (Figure 2D), or after transfection with three different ASOs (-1 / -2 / -3) (Figure 9F), without significant rescue in DR-KO cells. Vinculin was used as a protein loading control. The percentage of live cells was compared to NC and analyzed 48 hours after transfection by CCK-8 assay. RROL expression was analyzed 48 hours after transfection by qRT-PCR. One of three independent experiments is shown. * indicates p<0.05 after Student's t-test calculation. In MM cells, both RNA-seq (Figure 2G) and qRT-PCR (Figure 2H) showed preferential expression of RROL TV1, the isoform that was further investigated and hereafter referred to as RROL (also known as lnc-17-92). RNA-seq was used to confirm its expression in CD138+ cells from an additional large cohort of MM patients (MMRF / CoMMpass, n=720) and in MM cell lines (n=60) (Figure 9I).

[0143] Importantly, AMO1 with (ASO-1) or without (NC) RROL depletion DR-KO Exposure to ASO1 inhibited AMO1-dependent markers in establishing tumors in NOD SCID mice, as detected by tumor growth (Figure 2E) and prolonged animal survival (Figure 2F). DR-KO hindered the ability of MIR17HG 34Using the easy-to-transfect colorectal cancer cell line HCT-116, which is driven by lnc-17-92 TV1 We found that ectopic expression of lnc-17-92TV1 significantly rescued the antiproliferative activity of ASOs targeting MIR17HG preRNA more effectively than ectopic lnc-17-92TV2 or pri-mir-17-92 (Figure ​(Figure9K and L). 9L), suggesting that ectopic expression of lnc-17-92TV1, ... TV2 , or GFP (empty). The effect on cell proliferation was assessed 2 days after transfection with 5'-ASO and 3 days after transfection with plasmids. NC and empty vector transfected cells were used as references. The effect on cell proliferation was assessed 48 hours after transfection. Ectopic expression of pri-mir-17-92, lnc-17-92TV1, and lnc-17-92TV2 was confirmed by qRT-PCR showing i) upregulation of miR-17 after ectopic expression of pri-mir-17-92; ii) upregulation of lnc-17-92TV1 after its ectopic expression; iii) upregulation of lnc-17-92TV2 after its ectopic expression. As illustrated in FIG. 2G, anti-proliferative activity of anti-MIR17HG ASOs in colorectal cancer cell lines HCT-116 and DLD-1 was also observed, despite these cell lines having (- / -) or not (wt) mutant Dicer conferring a hypomorphic phenotype (Cummins et al., Proc. Natl. Acad. Sci. USA 103:3687-92 (2006)). Cells were transfected with either a scrambled control (NC) or two different ASOs (-1 and -2) to obtain RROL depletion. The % of live cells compared to NC was analyzed 48 hours after transfection. * indicates p<0.05 after Student's t-test, and ns indicates p>0.05. These results indicate that RROL is a major mediator of MIR17HG cancer dependency, independent of miR-17-92.

[0144] [Example 4] RROL interacts with chromatin to regulate gene expression. The functional role of lncRNAs depends on their subcellular localization. Ulitsky et al., Cell 154:26-46 (2013). qRT-PCR analysis of nuclear and cytoplasmic compartments using MALAT1 and GAPDH mRNA as positive controls showed nuclear enrichment of RROL (Figure 10A). MALAT1 and GAPDH were used as internal controls for nuclear and cytoplasmic enriched RNA, respectively. Results are the mean fold enrichment of nuclear vs. cytoplasmic fractions after 2-ΔCt calculation. This finding was confirmed by RNA FISH, as illustrated in Figure 10B. Based on this, we next explored the transcriptional network regulated by RROL in MM. Towards this goal, an ASO-based loss-of-function (LOF) study was performed, followed by the analysis of DR-WT (AMO1 and H929) and DR-KO (AMO1 DR-KO ) followed by integrated gene expression analysis in both MM cell lines. Kinetic analysis of differentially expressed genes (DEGs) performed after early exposure to gymnotic ASO1 (Figure 10C) or transfection with ASO2 (Figure 9K), which avoids modulation of miR-17-92 in Drosha WT cells, identified a set of genes that were rapidly downregulated after RROL depletion in all cell lines tested. Heatmaps shown in Figure 10C show the average RROL or miRNA expression levels after normalization and ΔΔCt calculation with GAPDH or RNU44, respectively. Early exposure to gymnotic ASO1 was used to deplete RROL in DR-WT (AMO1 and H929) and DR-KO (AMO1DR-KO) MM cell lines, which also avoids modulation of canonical targets of RROL in Drosha WT cells (Figures 13B and 13C).

[0145] These findings were verified in CD138+ cells from three MM patients treated ex vivo with ASO1 (Figure 3B). Results shown in Figure 3B are the average mRNA expression levels after normalization with GAPDH and ΔΔCt calculation. RNA levels in cells exposed to NC (vehicle) were set as internal reference. RROL depletion findings were also verified in other cell models, including lymphoma cell lines Raji and Daudi (Figure 10D), and murine MM cell line 5TGM1 depleted of human or murine RROL (Figure 10E). Results shown in Figure 10D are the average mRNA expression levels after normalization with GAPDH and ΔΔCt calculation. Results shown in Figure 10E are the average mRNA expression levels after normalization with murine gapdh and ΔΔCt calculation. Conversely, expression of these genes was not affected by modulation of individual members of miR-17-92 by synthetic mimics or inhibitors (Figures 10F-G). Results shown are the mean miRNA or mRNA expression levels after normalization and ΔΔCt calculation with RNU44 or GAPDH, respectively. Moreover, as illustrated in Figure 3C, a significant positive correlation (Spearman r>0.3; p<0.001) between RROL and its target genes in at least one of the two large RNA-seq MM patient datasets (IFM / DFCI and MMRF / CoMMpass) was observed; supporting the clinical relevance of these regulatory axes. Figure 3C illustrates the correlation analysis between RROL targets (mRNAs) and RROL in CD138+ MM patient cells from two large RNA-seq cohorts (DFCI / IFM, n=360; MMRF / CoMMpass, n=720). Spearman r obtained in DFCI / IFM (x-axis) and MMRF / CoMMpass (y-axis) datasets is reported. The red dotted line indicates r=0.3.

[0146] 293T in the presence or absence of RROL depletion DR-KOLuciferase reporter assays performed in cells demonstrate the regulatory control of RROL on these genes, except for ANO6, where the regulatory control occurs at the promoter level (Figure 3D). The reporter vector was co-transfected with either ASO1 or control ASO into 293T cells. 48 hours after transfection, cells were harvested for luciferase activity assays. Results are shown as % of normalized Gluc activity in ASO1-transfected cells compared to control. RNAi-based LOF screening in five MM cell lines identified ACC1 (acetyl-CoA carboxylase alpha) as the RROL target gene with the most significant effect on MM cell proliferation and survival (Figure 3E). These results provided the rationale to further explore the role of the RROL-ACC1 axis in MM pathobiology. As shown in Figure 3E, two siRNAs were used for each target plus a scrambled siRNA (NC) as a control. Cell viability was measured at the indicated time points. It is expressed as % for NC-transfected cells. Consistently, RROL interaction in the promoter region of the top target ACC1 was confirmed by chromatin isolation by RNA precipitation (ChIRP) assay followed by qRT-PCR analysis (Figure 3F and Figures S10H-S10I). Furthermore, frequent proximal localization of RROL in the ACC1 locus was demonstrated by single-molecule dual RNA FISH analysis of RROL and ACC1 pre-mRNA (<300 nm to the nearest RROL spot in about 50% of the analyzed ACC1 pre-RNA spots) (n=60) (Figure 3G).

[0147] Taken together, without being bound by theory, these data indicate RROL as a chromatin-interacting lncRNA with transcriptional regulatory function.

[0148] [Example 5] RROL promotes MYC occupancy at the ACC1 promoter. A strong inhibition of the MYC-associated network upon RROL depletion in both tested cell lines was observed by upstream regulatory analysis of RROL-associated gene expression changes (Figure 4A). Based on this analysis, we assessed whether MYC and RROL cooperate to promote ACC1 expression in MM cells. RROL depletion in MM cells indeed prevented MYC occupancy at the ACC1 promoter, while its expression was unaffected (Figure 4B and Figure 11A). MYC occupancy at the ACC1 promoter was calculated as a % relative to input chromatin. Western blot analysis for MYC from paired samples is shown below each histogram plot. GAPDH or α-tubulin was used as protein loading control. Expression of ACC1 in the conditional MYC Tet-Off cell line P493-6 (Schuhmacher et al., Curr. Biol. 9:1255-8 (1999)) was reduced only in the presence of high MYC levels (Figure 4C). ACC1 expression level in cells exposed to NC was set as internal reference.Furthermore, as illustrated in Fig. 4D, RNA FISH analysis for RROL and ACC1 preRNA was coupled with immunofluorescence analysis for MYC protein (FISH / IF) to find co-localization of RROL and MYC at ACC1 locus.RROL was detected using two different probes (RROL-ps1 and RROL-ps2), and representative images are shown with each RROL probe in Fig. 4D.

[0149] To assess the presence of RROL-MYC complexes, RNA immunoprecipitation (RIP) assays were performed with MYC antibodies, which showed specific enrichment of RROL isoform 2 (RROL-2) in MYC-bound RNA, as illustrated in FIG. 4E and FIG. 11B-C. LncRNA PVT1 was used as a positive control due to its known role as a MYC interactor (FIG. 4E). RNA-protein pull-down (RPPD) experiments confirmed MYC forming a complex with RROL-2 (FIG. 4F and FIG. 11D). Furthermore, an RNA yeast-3-hybrid (Y3H) assay was adapted to confirm RROL-MYC interaction in an in vivo cell model (Hook et al., RNA 11:227-33 (2005)). In this assay, direct RROL-MYC interaction activates a reporter gene that allows yeast colony growth; as shown in FIG. 4G, we detected yeast colony growth in the presence of RROL-2 as a hybrid RNA.

[0150] These data appear to demonstrate that RROL forms an RNA-protein complex with the transcription factor MYC to promote its chromatin occupancy and transcriptional activity at the ACC1 promoter.

[0151] [Example 6] RROL mediates the assembly of the MYC-WDR82 transcriptional complex, leading to the transcriptional and epigenetic activation of ACC1. Targeting MIR17HG primarily kills c-MYC positive (MYC+) tumor cells, including in MM. Interestingly, MYC is known to reactivate ACC1 (also known as ACACA) expression and de novo lipogenesis in tumor cells, and MYC+ tumor cells become dependent on this metabolic pathway, which is verified here in MM cells (Figure 11D-Figure 11F). Figure 11D shows ACC1 mRNA after treatment with MYC inhibitor 10058-F4 in MM cell lines AMO1 and H929. Raw Ct values ​​were normalized to GAPDH mRNA and expressed as ΔΔCt values ​​calculated using the comparative threshold crossing method. ACC1 expression levels in cells treated with DMSO (NC) were set as the internal reference. Therefore, the functional interrelationship between MYC and MIR17HG was investigated.

[0152] MYC activity has been shown to be modulated through interactions with transcriptional and epigenetic coregulators (Gouw et al., Cell Metab. 30:556-572 (2019)). To determine whether RROL affects these protein-protein interactions, we performed proximity-dependent biotin identification (BioID) analysis of MYC in three MM cell lines (AMO1, H929, and U266) in the presence and absence of RROL depletion. MYC+ ) and co-immunoprecipitation assays followed by mass spectrometry analysis (Co-IP / MS). This integrated analysis highlighted WDR82 as a highly reliable RROL-dependent MYC interactor (Figure 5A and Figure 12A, and Tables 5-8); direct RNA-protein interaction between RROL and WDR82 was further confirmed by both RPPD (Figure 5B) and RNA Y3H (Figure 5C) assays. Black arrows in Figure 5C indicate yeast colony growth. Analysis using a truncated version of lnc-17-92TV1 further demonstrated the miR-17-92-free 3'-end region to be specifically associated with interaction with MYC in MM cells (Figure 11G). All 172 MYC interactors in vivo are listed in Table 5. All 18 RROL-dependent in vivo MYC interactors identified from the BioID assay are listed in Table 6.

[0153] All 176 MYC interactors in MM cells (identified in more than two cell lines) are listed in Table 7. All 8 RROL-dependent MYC interactors in MM cells (identified in more than two cell lines) are listed in Table 8.

[0154] [Table 5-1]

[0155] [Table 5-2]

[0156] [Table 5-3]

[0157] [Table 6]

[0158] [Table 7]

[0159] [Table 8]

[0160] WDR82 is a regulatory component of the SET1 methyltransferase complex that catalyzes histone H3 "Lys-4" trimethylation (H3K4me3) at the transcription start site of active loci, a prerequisite for MYC binding to chromatin and transactivation (Amente et al., Am. J. Cancer Res. 1:413-418 (2011)). Consistent with this, depletion of WDR82 resulted in a global reduction in H3K4me3 (Figure 5D and Figure 12D) and a reduction in MYC occupancy at the ACC1 promoter (Figure 5E), resulting in reduced ACC1 expression in MM cells (Figure 5F). Figure 5D shows Western blot analysis for WDR82 and H3K4me3 (expressed as % of input chromatin). Lamin A / C was used as a protein loading control (nuclear lysate). Figure 5E shows Western blot analysis for WDR82 and MYC from paired samples (expressed as % of input chromatin). α-Tubulin was used as a protein loading control. Data in Figure 5F are shown as raw Ct values ​​normalized to GAPDH mRNA and expressed as ΔΔCt values ​​calculated using the comparative threshold crossing method. ACC1 expression levels in NC-transfected cells (ell) were set as an internal reference.

[0161] Figure 5G illustrates ChIP-qPCR analysis for WDR82-GFP occupancy at the ACC1 promoter in AMO1 exposed to gymnotic ASO1 for 24 h, as well as Western blot analysis for WDR82-GFP from paired samples (expressed as % of input chromatin). α-Tubulin was used as a protein loading control. Furthermore, using MM cells expressing ectopic WDR82-GFP fusion protein (Figure 12B), it was demonstrated that RROL expression is essential for WDR82 occupancy at the ACC1 promoter (Figure 5H), without globally affecting the H3K4 methylation status (Figure 5I). Figure 5H illustrates ChIP-qPCR analysis for H3K4me3 occupancy at the ACC1 promoter in AMO1 and H929 exposed to gymnotic ASO1 for 24 h, as well as Western blot analysis for H3K4me3 from paired samples (expressed as % of input chromatin). Lamin A / C was used as a protein loading control (nuclear lysates). *p<0.05, Student's t-test. Additionally, RROL depletion led to reduced levels of H3K4me3 at the ACC1 promoter site without a detectable effect on global H3K4me3 (Figure 5I).

[0162] We demonstrate a role for RROL as a chromatin scaffold mediating the assembly of the MYC-WDR82 multiprotein transcription complex, which controls ACC1 expression.

[0163] [Example 7] The RROL / MYC-ACC1 axis regulates de novo adipogenesis. ACC1 catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, a rate-limiting step during de novo lipogenesis (DNL) (Beloribi-Djefaflia et al., Oncogenesis 5:e189-10 (2016)), a metabolic pathway that is aberrantly activated in cancer cells (Rohrig and Schulze., Nat. Rev. Cancer 16:732-749 (2016)). Here, RROL depletion, as well as inhibition of either MYC or ACC1, point to reduced DNL in both MM cell lines and CD138+ MM patient cells (Zadra et al., Proc. Natl. Acad. Sci. USA 116:631-640 (2019)), increasing the contribution of ACC1 to lipid pools. 14 -significantly reduced the incorporation of radiolabeled glucose (Figure 6A). ASO1 was used to deplete RROL, the small molecule 10058-F4 was used to inhibit MYC, and IPTG-inducible shRNA was used to deplete ACC1. Results are expressed as percentages relative to negative controls (NC ASO, DMSO, and non-induced, respectively). This inhibition was not observed after transfection of MM cells with a synthetic inhibitor of miR-17-92 (Figure 13A), which indicates that the incorporation of C into lipids was significantly reduced 48 hours after transfection of AMO1 with miR-17-92 anti-miR (25 nM each). 14-Glucose incorporation is shown. Results are expressed as percentages relative to non-induced cells. NS indicates p>0.05 after Student's t-test. Liquid chromatography-mass spectrometry (LC-MS)-based lipid profiling after RROL inhibition in MM cells confirmed the depletion of several saturated (SFA) and monounsaturated (MUFA) phospholipid species produced via DNL (Figure 6B). Lipid profiling analysis showing modulation of the main membrane phospholipid classes [phosphatidylglycerol (PG), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidylcholine (PC), and phosphatidylinositol (PI)] with saturated (SFA) or monounsaturated (MUFA) acyl chains after treatment of AMO1 and H929 with ASO1 is shown in Figure 6B. (Rysman et al., Cancer Res. 70:8117-26 (2010); Zaidi et al., Prog. Lipid Res. 52:585-9 (2013)). Furthermore, addition of palmitic acid (PA), the main downstream product of ACC1 activity, significantly rescued the anti-proliferative (Figure 6C, CCK-8 proliferation assay) and apoptosis-inducing (Figure 6D) effects of RROL depletion in MM cells, supporting the role of DNL in tumors, promoting the activity of RROL in MM and justifying the name of RNA regulator of adipogenesis, as illustrated in the proposed model in Figure 6E. Figure 6D shows Annexin V / 7-AAD flow cytometry assay in ASO1 exposed for 6 days to the indicated concentrations of ASO1 with supplementation of either BSA (control) or BSA-PA (20 μM).

[0164] [Example 8] Therapeutic inhibitors of RROL exert potent antitumor activity in vitro and in vivo in animal models of human MM. To investigate the therapeutic potential of RROL and to develop inhibitors, we screened over 80 fully phosphorothioated (PS), 2'-O-methoxyethyl (2'-MOE) modified, lipid-conjugated ASOs for their potential to induce RNase H-mediated degradation of RROL (gapmeR) or exert function via an RNase H-independent mechanism (steric blockers) (Puttaraju et al., Nat. Med. 27:526-535 (2021)) (Figure 7A and Figures 14A-C). This procedure identified the 18-mer tocopherol (T) conjugate gapmeR G2-15b-T ("G") and the 18-mer tocopherol (T) conjugate steric blocker SB9-19-T ("SB") as lead compounds, both of which conferred potent anti-proliferative activity (cell growth inhibition, CGI>50%) in a large panel of MM cell lines as well as CD138+ primary MM cells; whereas they showed no such anti-proliferative activity (CGI<50%) against non-malignant cell lines (THLE-2, HK-2, HS-5, and 293T) and PBMCs from three healthy donors (Figure 7B). Figure 7B shows MM cell lines AMO1, ABZB, ACFZ, H929, MM.1S, MM1.R, U266, LR7, R8226, KMS-11, KMS-12-BM, and CD138+ cells from two MM patients (MM-Pt), four non-malignant cell lines (THLE-2, HK-2, HS-5, and 293T), and PMBCs from three healthy donors. * Cell proliferation was measured 48 hours (or 24 hours for MM-pt) after transfection with either SB9-19-TO (G) or SB9-19-TO (SB) or vehicle (-) as a control. Cell proliferation is calculated by comparing with vehicle transfected cells.

[0165] The results of the multi-step screening test to develop therapeutic ASOs targeting RROL are shown in Figure 14A-14C. The results of step 1, which identified ASO-accessible extensions on RROL, are shown in Figure 14A, and 16 sequences (>20-mer) in "G" or "SB" configurations for a total of 32 ASOs were tested; sequences G2 (21-mer) and SB9 (22-mer) were selected for further study based on KD activity in AMO1 cells assessed by qRT-PCR. The results of step 2, which optimized the G2 and SB9 designs, are shown in Figure 14B, and these sequences were fine-tuned to obtain 20-mer (n=8) and 18-mer (n=5) derivative ASOs for G2, and 22-mer (7), 20-mer (n=8), and 18-mer (n=5) derivative ASOs for SB9; based on KD activity in AMO1 cells assessed by qRT-PCR. The 18-mer derivative sequences G2-15 and SB9-19 were selected for further investigation. Step 3 results are shown in FIG. 14C, which shows the testing of two selected step 2 molecules conjugated with palmitic acid (P) or cholesterol (C) or tocopherol (T). Based on the KD activity in AMO1 cells assessed by qRT-PCR. The TO-conjugated molecule was selected as the leading compound. The G2-15-T ASO was further optimized by replacing the 10-mer "core" DNA gap with an 8-mer "core" DNA gap (G2-15b-T).

[0166] The in vivo antitumor activity of both compounds was assessed using a subcutaneous AMO1 xenograft model in immune-deficient NOD SCID mice, where G2-15b *A significant reduction in tumor growth was observed 21 days after treatment cycles with either SB9-19-TO (G; n=5; tumor growth inhibition, TGI=76%) or SB9-19-TO (SB; n=5; TGI=69%) or vehicle (NK; n=5). Analysis of tumors removed from mice after this treatment confirmed the reduced expression of RROL (Figure 7D) and its target (Figure 7E), the target BIM (also known as BCL2L11) (Figure 7J), as well as reduced levels of tripalmitin (Falchook et al., EClinicalMedicine 34:100797-11 (2021)), a surrogate for the DNL product palmitic acid (Figure 7F); demonstrating efficient uptake of G2-15b-T and SB9-19-T by tumor cells in vivo. Furthermore, no noticeable toxicity was observed in mice. The data in Figures 7D and 7E show that G2-15b * Samples taken from animals treated with SB9-19-TO (G; n=1) or SB9-19-TO (SB; n=1) or vehicle (NC; n=1) as a control are shown. Raw Ct values ​​were normalized to ACTB mRNA, and ΔΔCt values ​​calculated using the comparative threshold crossing method were expressed as ΔΔCt values. Expression levels in NC were set as the internal reference.

[0167] Significant anti-MM activity of G2-15b-T and SB9-19-T was confirmed in an aggressive model of diffuse myeloma, where tumor growth of MOLP8-luc+ MM cells was assessed by bioluminescence imaging (BLI). In this model, tumor growth was significantly greater than that of G2-15b * G2-15b was significantly antagonized after cycles of treatment with either SB9-19-TO (G; n=8; TGI=84%) or SB9-19-TO (SB; n=6; TGI=52%) or vehicle (NC; n=11). *Treatment with -TO led to tumor clearance in 2 of 8 mice (25%) (Figure 7G). The scatter plot on the left of Figure 7G shows the analysis of bioluminescence intensity. The black bar indicates the median value. Bioluminescence was measured at the end of the treatment cycle (day 15). On the right of Figure 7G, image acquisition is shown. Mice that were removed from the study due to failure of IV injection of tumor cells are covered by black rectangles. Importantly, both inhibitors significantly prolonged animal survival (Figure 7H).

[0168] Finally, we used a clinically relevant PDX-NSG mouse model (PDX-NSG) by tail vein injection of CD138+ MM cells obtained from advanced stage patients. In this model, tumor growth was monitored in serum samples using human kappa light chain as a surrogate. Remarkably, regression of tumor growth after treatment cycles with G2-15b-T (G; n=2) was observed (Figure 7I), an effect comparable to bortezomib (BZT; n=2, positive control), vehicle control is represented as NC (n=3). Black arrows indicate treatment.

[0169] The above real-life example 8 demonstrates that lncRNA RROL is a major dependency in MM. The RROL host gene, MIR17HG, is often amplified and / or overexpressed in human cancers, with the role of a driver. Without intending to be bound by theory of operation, RROL is a regulator of gene expression through chromatin occupancy and interaction with transcription factors and epigenetic modulators such as MYC and WDR82.

[0170] The data also show that the RROL-MYC-WDR82 complex affects tumor cell metabolism by activating the DNL pathway through the rate-limiting enzyme ACC1. This anabolic pathway is largely restricted to liver and adipose tissue in normal adults, but is reactivated in cancer cells through mechanisms that are not yet fully described (Beloribi-Djefaflia et al., Oncogenesis 5:e189-10 (2016);Rohrig and Schulze., Nat Rev Cancer 16:732-749 (2016)). MYC is involved in reprogramming tumor cell metabolism by activating DNL through ACC1 and other genes (Stine et al., Cancer Discov 5:1024-39 (2015)). In turn, DNL has emerged as an essential pathway for the development and progression of MYC-driven cancers that is amenable to pharmacological inhibition of ACC1 (Gouw et al., Cell Metab 30:556-572 (2019)). The role of ACC1 and DNL in tumor development appears to be particularly relevant in MM, where tumor cells must adapt their metabolic pathways to meet the high bioenergetic and biosynthetic demands imposed by malignant cell growth coupled with the constant production of monoclonal immunoglobulins (El Arfani et al., Int J Mol Sci 19:1200-19 (2018);Masarwi et al., JBMR Plus 3:e10173-10 (2019)).

[0171] The in vivo real-world examples utilized two of the ASOs of the present invention that target RROL via different mechanisms of action (i.e., RNase H-dependent or independent). With recent advances in RNA medicines (Crooke et al., Cell Metab 27:714-739 (2018);Damase et al., Front Bioeng Biotechnol 9:628137-24 (2021);Sullenger and Nair., Science 352:1417-20 (2016)), the use of ASOs to therapeutically antagonize disease-driving genes is becoming increasingly feasible (Dhuri et al., J Clin Med 9:2004-24 (2020);Puttaraju ... Nat Med 27:526-535 (2021)).

[0172] In conclusion, this real-life example validates RROL as a lncRNA that promotes MYC-WDR82 protein complex formation and its chromatin binding, affecting lipid metabolism and ultimately tumor cell growth.

[0173] All patent and non-patent publications are indicative of the level of skill in the art to which this disclosure pertains. All such publications, including any specific portions thereof referred to, are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0174] Although the disclosure herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the disclosure. It is therefore to be understood that numerous modifications may be made to the exemplary embodiments and other arrangements may be devised without departing from the spirit and scope of the disclosure as defined by the appended claims.

Claims

1. An antisense oligonucleotide (ASO) that binds to MIR-17-92a-1 cluster host gene (MIR17HG) pre-RNA under physiological conditions, said ASO being 15 to about 30 nucleotides in length, and said pre-RNA comprising the nucleic acid sequence of SEQ ID NO:

1.

2. lnc-17-92 TV1 The ASO of claim 1, which binds to an exon region of the pre-RNA encoding a portion of the ASO.

3. AGTGGCGCGAAGGCGCAGGT (SEQ ID NO: 2), GTGGCGCGAAGGCGCAGGTC (SEQ ID NO: 3), CCTCGCCCGAGGGCGCGAAG (SEQ ID NO: 4), GAGGGCGCGAAGTGGCGCGA (SEQ ID NO: 5), TACTTGCTTGGCTT (SEQ ID NO: 6), CACCGTCCAAATCTAT (SEQ ID NO: 7), AGCACTCAA The ASO of claim 1, comprising any one of the nucleic acid sequences CATCAGC (SEQ ID NO: 8), CACCGTCCAAATCTAT (SEQ ID NO: 9), GTATGACTGGAATAGG (SEQ ID NO: 10), TACAGTGGAAATCGGC (SEQ ID NO: 11), GCGAGCAAACACGAAA (SEQ ID NO: 12), and ACTTGGATTGGATGAG (SEQ ID NO: 13).

4. An ASO described in any one of claims 1 to 3, which is used to treat a disease in which abnormal expression and function of MIR17HG pre-RNA plays a role.

5. A pharmaceutical composition comprising a therapeutically effective amount of the ASO of any one of claims 1 to 3 and a pharmaceutically acceptable carrier.

6. The pharmaceutical composition of claim 5, which is used to treat a disease in which abnormal expression and function of MIR17HG pre-RNA plays a role.