Netrin-1 production promoter

A Netrin-1 production promoter using white fungus and imidazole dipeptide addresses the challenge of maintaining Netrin-1 levels by enhancing production in cells and human saliva, demonstrating superior efficacy in promoting Netrin-1.

JP2026057176APending Publication Date: 2026-04-02NIPPON MENARD COSMETIC CO
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-20
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

There is a need for a safe and sustainable method to promote Netrin-1 production, as its levels decrease with age and regular exercise is difficult to maintain, and existing factors like IL-10 and Ginkgolide B are impractical for long-term administration.

Method used

A Netrin-1 production promoter containing white fungus and imidazole dipeptide, which can be incorporated into foods, quasi-drugs, or pharmaceuticals, enhancing Netrin-1 production through their combination.

Benefits of technology

The promoter effectively increases Netrin-1 production in nerve and skeletal muscle cells, and human consumption shows significant increases in salivary Netrin-1 levels, with the combination of white fungus and imidazole dipeptide exhibiting superior effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026057176000001
    Figure 2026057176000001
  • Figure 2026057176000002
    Figure 2026057176000002
  • Figure 2026057176000003
    Figure 2026057176000003
Patent Text Reader

Abstract

The objective of this invention is to provide a highly safe, long-term-use, and excellent food-derived Netrin-1 production promoter. [Solution] White fungus exhibits excellent Netrin-1 production-promoting activity, and the combination of white fungus and imidazole dipeptide showed a particularly remarkable Netrin-1 production-promoting activity compared to white fungus and imidazole dipeptide alone. Therefore, white fungus, white fungus, and imidazole dipeptide can be used as foods, quasi-drugs, and pharmaceuticals with excellent Netrin-1 production-promoting activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a Netrin-1 production promoter characterized by containing white jellyfish. Furthermore, it relates to a Netrin-1 production promoter characterized by containing white jellyfish and imidazole dipeptide.

Background Art

[0002] Netrin-1 is one of the axon guidance molecules that is widely produced in various tissues in vivo, including the nervous system, and determines the elongation direction of axons in neurons (Non-Patent Document 1). By this factor, the axons of neurons are induced to extend in the correct direction, and a complex neural network in the brain is formed (Non-Patent Document 2). In recent years, it has been clarified that Netrin-1 is very useful for improving the functions of the nervous system, such as alleviating the symptoms of depressive disorder group and improving the cognitive function decline due to Alzheimer's dementia (Non-Patent Documents 3 and 4).

[0003] In addition to its functions in the nervous system, Netrin-1 is known to have the effects of promoting the healing of injuries in the corneal epithelium and brain (Non-Patent Documents 5 and 6), improving fatty liver (Non-Patent Document 7), and the like. Thus, Netrin-1 is recognized as an important factor widely involved in maintaining the homeostasis of the living body due to its various functions in various tissues.

[0004] Netrin-1 is known to be produced in various tissues besides the nervous system, including the heart, digestive tract, and skeletal muscle, but a decrease in its blood concentration with age has been confirmed (Non-Patent Documents 8, 9). Since aerobic exercise has been suggested to be effective in increasing blood Netrin-1 levels (Non-Patent Document 10), it is desirable to adopt a regular exercise habit. However, in modern society, where lifestyles tend to be irregular, it is not easy to continue exercising. Furthermore, in many cases, physical function declines with age, or the effects of illness or injury make exercise itself difficult. In addition, although factors such as Interleukin-10 (IL-10) and Ginkgolide B are known to promote Netrin-1 production (Non-Patent Documents 11, 12), it is practically difficult to administer these factors over a long period of time. For this reason, there is a need for the development of a food-derived Netrin-1 production promoter that is highly safe and can be taken for a long period of time.

[0005] Here, the white fungus used in the present invention is a mushroom of the family Tremellaceae in the phylum Basidiomycota, and is known to exhibit collagen production promoting activity (Patent Document 1), angiogenesis inhibitory activity (Patent Document 2), anti-inflammatory activity (Patent Document 3), etc., but its netrin-1 production promoting activity is completely unknown.

[0006] Imidazole dipeptides are a general term for amino acids containing an imidazole group, and are known to be abundant in muscles. Anserine and carnosine, in particular, are well-known for their antioxidant and anti-aging effects (Non-Patent Literature 13, 14). However, their effect on promoting Netrin-1 production is completely unknown.

[0007] In light of these circumstances, the inventors conducted diligent research and discovered that white fungus has an excellent Netrin-1 production-promoting effect. Furthermore, by combining white fungus with imidazole dipeptide, they found an even better Netrin-1 production-promoting effect than either of them alone, thus completing the present invention. [Prior art documents] [License]

[0008] [License 1] Special Announcement No. 2006-131558 [License 2] Special Announcement No. 2004-307453 [License 3] Special Announcement No. 63-183537 [Non-licensed literature]

[0009] [Non-licensed Document 1] Int. J. Mol. Sci. Vol.18 491(2017) [Non-licensed Document 2] Front. Mol. Neuroscis. Vol.17 1307755(2024) [Non-licensed Document 3] Mol. Med. Rep. Vol.17 4611-4618(2018) [Non-licensed Document 4] J. Alzheimers Dis. Vol.52 223-242(2016) [Non-licensed Document 5] Int. J. Ophthalmol. Vol.13(2) 206-212(2020) [Non-licensed Document 6] Transl. Stroke Res. Vol.15(1) 219-237(2024) [Non-licensed Document 7] Life Sci. Vol. 311(Pt B) 121149(2022) [Non-licensed Document 8] Int. J. Mol. Sci. Vol.22 4499(2021) [Non-licensed Document 9] Biol. Sci. Med. Sci. Vol.79 glad194(2024) [Non-licensed Document 10] ProS One. Vol.14(2) e0199802(2019) [Non-Patent Document 11] Sci. Rep. Vol.6 30459(2016) [Non-Patent Document 12] Int. J. Dev. Neurosci. Vol.83(8) 740-752(2023) [Non-Patent Document 12] ProS One. Vol.14(2) e0199802(2019) [Non-Patent Document 13] Rejuvenation Res. Vol.13(2-3) 156-158(2010) [Non-Patent Document 14] Proc. Natl. Acad. Sci. USA Vol.85(9) 3175-3179(1988) [Overview of the project] [Problems that the invention aims to solve]

[0010] The present invention relates to a Netrin-1 production promoter characterized by containing white fungus. Furthermore, the present invention relates to a Netrin-1 production promoter characterized by containing white fungus and imidazole dipeptide. [Means for solving the problem]

[0011] As a result of diligent research, the inventors of this invention have discovered that white fungus has an excellent Netrin-1 production-promoting effect, and further, they have found that the combination of white fungus and imidazole dipeptide has an extremely excellent Netrin-1 production-promoting effect.

[0012] For the white jelly fungus of the present invention, the white jelly fungus (scientific name: Tremella fuciformis) belonging to the family Tremellaceae of the phylum Basidiomycota can be used. The white jelly fungus is also called Tremella fuciformis Berk. in Chinese and is considered to be native to China. Currently, it is mainly cultivated in regions with temperate to tropical climates such as Okinawa, China, India, and Indonesia, and the white jelly fungus cultivated in any region can be used. The part of the white jelly fungus used in the present invention is not particularly limited, and examples include the fruiting body and mycelium, and it is particularly desirable to use the fruiting body.

[0013] The white jelly fungus used in the present invention can be used as it is, or if necessary, those subjected to treatments such as juicing, drying, pulverization, and mincing can also be used. Further, an extract obtained by extracting the white jelly fungus as it is or after the above treatments can also be used. Examples of the solvent for extraction include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, petroleum ether, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used alone or in combination of two or more. The white jelly fungus used in the present invention is preferably extracted with a polar solvent such as water or a lower alcohol, and water extraction is particularly preferred.

[0014] The above extract may be used as the extracted liquid as it is, or if necessary, it may be used after being subjected to treatments such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, and fermentation. Further, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, and freeze drying, and used as a dried product.

[0015] The intake amount of white jellyfish used in the present invention can be appropriately adjusted according to the administration form, purpose of use, age, body weight, etc. The intake amount of white jellyfish per day for adults can be orally ingested once to several times a day in the range of 0.05 to 500 mg, preferably 0.5 to 200 mg, as an extract of white jellyfish. In some cases, an amount less than the above intake range may be sufficient, and in other cases, it may be necessary to ingest more than the range. Also, regarding the method of adding the active ingredient in formulation, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.

[0016] The imidazole dipeptide in the present invention may be a synthesized one or one obtained from meat such as chicken, and any of them can be used, and those commercially available can be used. The intake amount of imidazole dipeptide can be appropriately increased or decreased according to age and symptoms, with 0.1 to 1000 mg per day as a guide, but in the present invention, it can also be used at a lower dose by combining it with white jellyfish.

[0017] The Netrin-1 production promoter characterized by containing white jellyfish, and the Netrin-1 production promoter containing white jellyfish and imidazole dipeptide of the present invention can be used as foods, quasi-drugs, and pharmaceuticals. As foods, they can be used as tablets, soft capsules, hard capsules, granules, tablets, gummies, beverages, jellies, etc. Also, in quasi-drugs and pharmaceuticals, they can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, solutions, emulsions, etc., and parenteral injections, suppositories, etc. In order to achieve the object of the present invention, oral ingestion is preferred.

[0018] The Netrin-1 production promoter of the present invention can also contain components such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives, fragrances, etc. that are usually used in foods, quasi-drugs or pharmaceuticals, as long as the effects are not impaired. Furthermore, it can also contain components such as plant materials, polyphenols, vitamins, saccharides, proteins, fats and oils, etc. [Effects of the Invention]

[0019] The Netrin-1 production promoter of the present invention, characterized by containing white fungus, has excellent Netrin-1 production promoting activity. Furthermore, the Netrin-1 production promoter, characterized by containing white fungus and imidazole dipeptide, has extremely excellent Netrin-1 production promoting activity. [Modes for carrying out the invention]

[0020] The following examples are illustrative and the claims of the present invention are not limited in any way to these examples. The percentages of content shown in the examples are in weight percentages. [Examples]

[0021] Production example 1 White wood ear hot water extract 50 g of dried white fungus fruiting bodies were added to 1 kg of purified water and heated to extract the substance. The extract was then concentrated and dried to obtain 5.4 g of solid material.

[0022] Manufacturing Example 2: White Fungus 50% Ethanol Extract 100 g of dried white fungus fruiting bodies was mixed with 900 g of 50% ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 2.0 g of solid material.

[0023] Manufacturing Example 3: White Jelly Mushroom Ethanol Extract 100 g of dried white fungus fruiting bodies was mixed with 900 g of ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 1.0 g of solid material.

[0024] Next, we will give an example of a formulation using white fungus, but the present invention is not limited to this. [Examples]

[0025] Prescription Example 1: Soft Capsules <Prescription> Component Content (%) 1. White fungus hot water extract (manufacturing example 1) 0.5 2. Add flaxseed oil until the total amount is 100. 3. Beeswax 5.0 4. Glycerin fatty acid ester 5.0 5. Vitamin E 3.0 <Manufacturing method> Components 1-5 were mixed, and 250 mg of the mixture was filled into a coating composed of starch, carrageenan, reduced starch syrup, and glycerin. After drying, soft capsules were obtained. <Usage> Take 3 tablets per day.

[0026] Prescription Example 2: Soft Capsules <Prescription> Component Content (%) 1. White fungus hot water extract (manufacturing example 1) 0.5 2. Imidazole dipeptide 10.0 3. Add flaxseed oil until the total volume is 100. 4. Beeswax 5.0 5. Glycerin fatty acid ester 5.0 6. Vitamin E 3.0 <Manufacturing method> Components 1-6 were mixed, and 250 mg of the mixture was filled into a coating composed of starch, carrageenan, reduced starch syrup, and glycerin. After drying, soft capsules were obtained. <Usage> Take 3 tablets per day.

[0027] Prescription example 3: Tablets <Prescription> Component Content (%) 1. White fungus ethanol extract (production example 3) 1.0 2. Add maltitol so that the total amount becomes 100. 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed, 10% water was added as a binder, and the mixture was granulated in a fluid bed. Component 4 was added to the formed granules and mixed, and then compressed into tablets to obtain 300 mg tablets. <Usage> Take 3 tablets per day.

[0028] Prescription Example 4: Hard Capsules <Prescription> Component Content (%) 1. White fungus 50% ethanol extract (Production example 2) 5.0 2. Add cornstarch until the total amount is 100. 3. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed and filled into No. 2 hard capsules with 250 mg each to obtain hard capsules. <Usage> Take two tablets per day.

[0029] Comparative Example 1: Conventional soft capsule In the soft capsule of Formula Example 1, the white fungus hot water extract (Manufacturing Example 1) was replaced with flaxseed oil to create the conventional soft capsule.

[0030] Comparative Example 2: Conventional soft capsules containing imidazole dipeptide In the soft capsule of Formulation Example 2, replacing the white fungus hot water extract (Manufacturing Example 1) with flaxseed oil resulted in a conventional soft capsule containing imidazole dipeptide. [Examples]

[0031] Test Example 1: Promoting Netrin-1 production in nerve cells by white fungus. Rat pheochromocytoma-derived nerve cells were cultured in DMEM containing 10% fetal bovine serum and 10% fetal equine serum. Nerve growth factor (NGF) was then added to a final concentration of 50 ng / mL, and the cells were cultured for 24-48 hours to differentiate into mature nerve cells. To these cells, white fungus hot water extract (Production Example 1), white fungus 50% ethanol extract (Production Example 2), or white fungus ethanol extract (Production Example 3) were added to final concentrations of 50 μg / mL, 100 μg / mL, and 200 μg / mL, respectively. Imidazole dipeptide was also added to a final concentration of 100 μg / mL. As positive controls, Ginkgolide B and IL-10, known to promote Netrin-1 production, were added to final concentrations of 200 μM and 100 U / mL, respectively. After adding each sample to the nerve cells, they were cultured for 24 hours, harvested, and gene expression analysis was performed. Gene expression was evaluated by real-time PCR to assess changes in Netrin-1 gene expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal standard. Gene expression in the sample-free environment was set to 1, and the gene expression ratio was calculated.

[0032] Primer set for rat Netrin-1 CACTGCCACTACTGCAAGGA(array 1) GCTACAGGAATCTTAATGCAAG (Sequence 2) Primer set for rat GAPDH CAAGTTCAACGGCACAGTCAA (Sequence 3) GGATCTCGCTCCTGGAAGATG (sequence 4)

[0033] Table 1 shows the results of Test Example 1. Netrin-1 gene expression in nerve cells was promoted in a concentration-dependent manner by white fungus hot water extract (Production Example 1), white fungus 50% ethanol extract (Production Example 2), and white fungus ethanol extract (Production Example 3), and the effect was superior to that of Ginkgolide B and IL-10, which were used as positive controls. Furthermore, it was found that combining each solvent extract of white fungus with imidazole dipeptide resulted in an effect that exceeded the sum of the effects of each extract individually. From these results, it was revealed that white fungus exhibits excellent Netrin-1 production promoting activity in nerve cells, and that combining it with imidazole dipeptide further enhances its Netrin-1 production promoting activity.

[0034] [Table 1]

[0035] Test Example 2: Promoting Netrin-1 production in skeletal muscle cells by white fungus. Human skeletal muscle-derived muscle satellite cells were cultured in DMEM containing 10% fetal bovine serum. They were then cultured for 3 days in DMEM containing 2% horse serum to differentiate into myotubes. To these myotubes, white fungus hot water extract (Production Example 1), white fungus 50% ethanol extract (Production Example 2), or white fungus ethanol extract (Production Example 3) were added to final concentrations of 50 μg / mL, 100 μg / mL, and 200 μg / mL. Imidazole dipeptide was also added to a final concentration of 100 μg / mL. As positive controls, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR) and Insulin-like Growth Factor-1 (IGF-1), known to activate muscle cells, were added to final concentrations of 1 mM and 100 ng / mL, respectively. After adding each sample to the myotubes, the cells were cultured for 24 hours, harvested, and gene expression analysis was performed. Gene expression was evaluated by real-time PCR to assess Netrin-1 gene expression changes. 18S ribosomal RNA was used as the internal standard. Gene expression in the sample-free state was set to 1, and the gene expression ratio was calculated.

[0036] Primer set for human Netrin-1 CACTGCCATTACTGCAAGGA (Sequence 5) GCTACAGGGATCTTTATGCAGG (sequence 6) Primer set for human 18S ribosomal RNA CCGAGCCGCCTGGATAC (sequence 7) CAGTTCCGAAAACCAACAAAATAGA (sequence 8)

[0037] Table 2 shows the results of Test Example 2. Netrin-1 gene expression in myotubes was promoted in a concentration-dependent manner by white fungus hot water extract (Production Example 1), white fungus 50% ethanol extract (Production Example 2), and white fungus ethanol extract (Production Example 3), and the effect was superior to that of AICAR and IGF-1, which were used as positive controls. Furthermore, it was found that combining each solvent extract of white fungus with imidazole dipeptide resulted in an effect that exceeded the sum of the effects of each extract individually. From these results, it was revealed that white fungus exhibits excellent Netrin-1 production promoting activity in skeletal muscle, and that when combined with imidazole dipeptide, it exhibits even better Netrin-1 production promoting activity.

[0038] [Table 2]

[0039] Test Example 3: Investigation of the effect of human ingestion on the amount of Netrin-1 in saliva. Forty middle-aged and elderly men and women (ages 40-64) whose Netrin-1 levels are expected to decrease with age were divided into four groups of 10 each, with age and weight being roughly equal. Specifically, Test Group 1 received conventional soft capsules (Comparative Example 1), Test Group 2 received soft capsules containing white fungus hot water extract (Manufacturing Example 1) (Formulation Example 1), Test Group 3 received conventional soft capsules containing imidazole dipeptide (Comparative Example 2), and Test Group 4 received soft capsules containing white fungus hot water extract (Manufacturing Example 1) and imidazole dipeptide (Formulation Example 2). All test groups took three capsules per day, and the amount of Netrin-1 in saliva was measured using an ELISA kit before consumption and three months after consumption. The change in salivary Netrin-1 was calculated by subtracting the pre-consumption measurement from the measurement taken three months after consumption.

[0040] Table 3 shows the results of Test Example 3. In Test Group 2, which ingested soft capsules containing white fungus hot water extract, a superior increase in salivary Netrin-1 levels was observed compared to Test Group 1, which ingested conventional soft capsules. Furthermore, in Test Group 4, which ingested soft capsules containing both white fungus hot water extract and imidazole dipeptide, an even superior increase in salivary Netrin-1 levels was observed. From these results, it was confirmed that white fungus is effective in promoting Netrin-1 production in human consumption, and that combining white fungus with imidazole dipeptide is even more effective.

[0041] [Table 3] [Industrial applicability]

[0042] The present invention can be used as a Netrin-1 production promoter containing white fungus, or as a Netrin-1 production promoter containing white fungus and imidazole dipeptide. It can also be used in foods, quasi-drugs, and pharmaceuticals containing these.

Claims

1. A Netrin-1 production promoter characterized by containing white fungus.

2. A Netrin-1 production promoter characterized by containing white fungus and imidazole dipeptide.

3. A food composition for promoting Netrin-1 production, characterized by containing a Netrin-1 production promoter according to any one of claims 1 to 2.

Citation Information

Patent Citations

  • Anti-inflammatory agent

    JP1988183537A

  • Vascularization inhibitor and use thereof

    JP2004307453A

  • Collagen formation enhancer

    JP2006131558A