Methods and compositions for treating MYBPC3-associated hypertrophic cardiomyopathy with viral vectors
Patent Information
- Application Number
- JP2024534656
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-12-10
- Filing Date
- 2022-12-09
- Publication Date
- 2025-12-17
AI Technical Summary
Current treatments for cardiomyopathy, particularly hypertrophic cardiomyopathy, are limited, and there is a need for effective gene transfer strategies to address calcium cycling abnormalities and improve cardiac function.
Recombinant adeno-associated virus (rAAV) vectors are used to deliver transgenes to the heart, incorporating specific promoters and regulatory elements to achieve physiologically relevant expression levels and tissue specificity, with compositions administered via intravenous injection to enhance cardiac function.
The rAAV vectors result in improved cardiac function, increasing left ventricular ejection fraction and reducing left ventricular wall thickness, with sustained expression lasting over two years, effectively treating hypertrophic cardiomyopathy.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 288519, filed December 10, 2021, the entire contents of which are incorporated by reference herein.
[0002] INCORPORATION BY REFERENCE IN THE SEQUENCE LISTING This application incorporates material provided in the attached XML file, entitled U120270087WO00-SEQ-PRW.xml (created on December 8, 2022, size 67,554 bytes). [Background technology]
[0003] background Cardiomyopathy represents a collection of diverse conditions of the heart muscle and is the second most common cause of heart disease in subjects, with medical management of secondary symptoms being the only treatment option. These diseases have many causes, symptoms, and treatments and can affect people of all ages and races. When cardiomyopathy occurs, the normal muscle in the heart can become enlarged, hardened, thin, or filled with substances that the body produces but that do not belong in the heart muscle. As a result, the ability of the heart muscle to pump blood is reduced, which can cause irregular heartbeats, blood backing up into the lungs or the rest of the body, and heart failure. Cardiomyopathy can be acquired or hereditary. The cause is not always known, but the genetic underpinnings of the genetic form of the disease are increasingly being understood.
[0004] Gene transfer strategies have been shown to ameliorate heart disease. Summary of the Invention
[0005] overview Cardiomyopathy is a class of heart muscle diseases that adversely affect the heart's ability to circulate blood through the cardiovascular system. There are various types of cardiomyopathy, including dilated cardiomyopathy, hypertrophic cardiomyopathy, and restrictive cardiomyopathy. Cardiomyopathy in the human population is a major medical burden, and although it is particularly desirable to treat cardiomyopathy in the human population, there is currently an unmet need for treatment.
[0006] Dilated cardiomyopathy (DCM) is one of the most common types of cardiomyopathy, occurring primarily in adults aged 20-60 years. DCM affects the ventricles and atria, the lower and upper chambers of the heart, respectively. Most forms of DCM are acquired from a number of causes, including coronary heart disease, heart attacks, high blood pressure, diabetes, thyroid disease, viral hepatitis and viral infections that inflame the heart muscle. Alcoholism and certain drugs, such as cocaine and amphetamines, as well as at least two drugs used to treat cancer (doxorubicin and daunorubicin), can also lead to DCM. In addition, there are numerous genetic forms of DCM, including, but not limited to, DCM associated with Duchenne and Becker muscular dystrophy. In some forms of Becker muscular dystrophy, as well as in most cases of Duchenne muscular dystrophy, cardiomyopathy can eventually limit the patient's survival.
[0007] Hypertrophic cardiomyopathy (HCM) occurs when the walls of the heart muscle become abnormally thickened. The increased wall thickness may block or obstruct the flow of blood within the heart, as well as increase cardiac complications. Hypertrophic cardiomyopathy presents with otherwise unexplained left ventricular hypertrophy, which can lead to arrhythmias, heart failure, and in certain cases, sudden cardiac death (SCD). HCM is also the leading cause of sudden cardiac death in adolescents, with a risk of 0.5-2% per year. Of note, MYBPC3 mutations are commonly associated with HCM, contributing to approximately 40% of cases where the gene has been identified, with a penetrance of 50-75%.
[0008] Restrictive cardiomyopathy (RCM) is a condition in which the heart's chambers stiffen over time. While the heart's ability to contract remains largely unaffected, the heart muscle does not fully relax between heart beats. This limits the ability of the ventricles to fill with blood and causes blood to flow backwards through the circulatory system.
[0009] Cardiac function is critically dependent on calcium-dependent signaling. During cardiac disease, the dysfunction of calcium channels in cardiomyocytes promotes calcium circulation abnormalities, further impairing cardiac function. Genetic transfer strategies to reduce calcium circulation abnormalities have been reported to improve cardiac disease in small and large animal models and in human clinical trials.
[0010] Disclosed herein is a gene delivery approach for the treatment of a human subject having one or more types of cardiomyopathy or symptoms thereof.
[0011] Accordingly, some aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) vector for delivering a transgene to the heart of a subject. Such a rAAV vector may include, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to one or more transgenes, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector includes, in addition to the promoter, a regulatory element that alters expression, for example, in a manner that provides a physiologically relevant expression level and / or restricts expression to a specific cell type or tissue. In some embodiments, the regulatory element includes one or more of an enhancer, a 5' untranslated region (UTR), and a 3' UTR. In some embodiments, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of the transgene). In some embodiments, the two transgenes are operably linked to the same single promoter. In some embodiments, each transgene is operably linked to a separate promoter. In some embodiments in which multiple transgenes are provided, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of two transgenes expressed from a single promoter, or 3' of one or both transgenes expressed from different promoters). Aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) nucleic acid vector for delivering two or more transgenes to the heart of a subject, wherein the vector includes, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, two or more transgenes and a promoter operably linked to the two or more transgenes, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0012] In some embodiments, the therapeutic transgene is encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence set forth in sequence as SEQ ID NO: 9, 29, or 43. In some embodiments, one or more of the transgenes of the present disclosure are naturally occurring sequences. In some embodiments, one or more transgenes are engineered to be species-specific. In some embodiments, one or more transgenes are codon-optimized for expression in a species of interest, such as human. For example, in some embodiments, the therapeutic transgene (e.g., MYBPC transgene) is codon-optimized.
[0013] Further provided herein is a rAAV particle that contains the rAAV vector disclosed herein, encapsidated in AAV capsid.Other aspects of the present disclosure include compositions that contain the rAAV particles described herein.In some embodiments, such compositions can be administered to a subject for gene therapy for cardiomyopathy.In additional embodiments, such compositions can be administered to a subject for gene therapy for heart disease.In some embodiments, the heart disease causes heart failure in a subject.
[0014] The composition of the present disclosure may be administered to a subject via different routes. In some embodiments, the composition is administered via intravenous injection to the subject. In some embodiments, administration of the composition results in expression of the transgene (or expression of two or more transgenes if multiple transgenes are used) in the subject's heart. In various embodiments, administering the composition results in improved cardiac function in the subject, such as improved cardiac function for more than 10 months in the subject. In some embodiments, administration results in improved cardiac function for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, the improved cardiac function is represented by an increase in left ventricular ejection fraction (LVEF). In some embodiments, the LVEF (compared to pre-treatment measurements) is increased by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between those listed). In some embodiments, the LVEF is measured by echocardiography. In some embodiments, administration results in improvement of cardiac physiology (e.g., structural features) for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, improvement of cardiac physiology is represented by a decrease in the thickness of the left ventricular wall. In some embodiments, the thickness of the left ventricular wall is decreased by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between the listed amounts). In some embodiments, the thickness of the left ventricular wall is measured by cardiac magnetic resonance imaging (MRI) or transthoracic echocardiography (TTE).
[0015] In some embodiments, described herein are compositions comprising AAV vectors, virions, viral particles, and pharmaceutical preparations thereof, which are useful in methods for delivering genetic material that codes for one or more beneficial or therapeutic product(s) to mammalian cells and tissues.The rAAV vectors, rAAV particles, or compositions comprising rAAV particles of the present disclosure may be used for gene therapy for cardiac disease, such as one or more types of cardiomyopathies, in subjects who require gene therapy.
[0016] Additionally, provided herein are compositions, including one or more of the disclosed AAV compositions, formulated with one or more additional ingredients or prepared with one or more instructions for their use, as well as therapeutic and / or diagnostic kits.
[0017] In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human MYBPC3 coding sequence, and optionally an enhancer element (such as an alpha MHC enhancer) operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human MYBPC3 coding sequence, an enhancer element (such as an alpha MHC enhancer) operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native to the human MYBPC3 coding sequence and / or non-native to the promoter. In some embodiments, the Kozak sequence is a synthetic sequence. In some embodiments, the human MYBPC3 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac-specific promoter. In some embodiments, the promoter is one or more of CMV, mini CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, and combinations thereof. In some embodiments, the cardiac specific enhancer or regulatory element comprises an alpha MHC enhancer. In some embodiments, the promoter is CBA (chicken beta-actin). In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 particle. In some embodiments, the rAAV particle is a rh10 particle. In some embodiments, a composition is provided that includes a plurality of rAAV particles. In some embodiments, the plurality of rAAV particles may further include a pharma- ceutically acceptable carrier.In some embodiments, the rh74 particles comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of SEQ ID NO:18, or SEQ ID NO:29 (e.g., SEQ ID NO:29 encodes the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the nucleotide sequence of SEQ ID NO:18). In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO: 16, or a portion of SEQ ID NO: 16 (e.g., SEQ ID NO: 16 is the amino acid sequence of the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the amino acid sequence of SEQ ID NO: 16). In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO: 7.
[0018] In some embodiments, a method of treating hypertrophic cardiomyopathy is described, the method comprising administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human MYBPC3 coding sequence and an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in expression of a therapeutically effective amount of human MYBPC3, thereby treating hypertrophic cardiomyopathy. In some embodiments, the rAAV is administered via intravenous injection. In some embodiments, about 0.5 to about 5 rAAV vector genomes are administered per cell. In some embodiments, about 0.5 to about 2 rAAV vector genomes are administered per cell. In some embodiments, about 1×10 per kilogram. 13 ~Approx. 3×10 14 (vgs / kg) of vector genomes are administered.
[0019] Also described herein is a method for inducing increased expression of human MYBPC3 in a target cell, comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a human MYBPC3 coding sequence and an enhancer element (such as an alpha MHC enhancer) operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting results in increased expression of human MYBPC3 in the target cell compared to before the contacting, thereby increasing the expression of human MYBPC3. In some embodiments, the contacting is in vivo. In some embodiments, the method is used for the treatment of hypertrophic cardiomyopathy. In some embodiments, the nucleic acid, rAAV particle, composition, or method for producing thereof described herein can be used for the treatment of hypertrophic cardiomyopathy. [Brief description of the drawings]
[0020] [Figure 1]FIG. 1 shows a gene construct map for a non-limiting example of a construct encompassing sequences for MYBPC3.
[0021] [Diagram 2] FIG. 2 shows a gene construct map for a non-limiting example of a construct encompassing sequences for MYBPC3.
[0022] [Diagram 3] FIG. 3 shows a gel assessing RT-mediated detection of MYBPC3 RNA.
[0023] [Figure 4A-4B] Figures 4A-4D show multiple qPCR plots showing hMYBPC3 expression for non-limiting examples of constructs described herein. Figure 4A shows GAPDH expression in cardiac tissue. Figure 4B shows MYBPC3 expression in cardiac tissue. [Fig. 4C-4D] Figure 4C shows MYBPC3 expression in heart tissue normalized to GAPDH, and Figure 4D shows MYBPC3 expression based on each AAV9 sample.
[0024] [Diagram 5] FIG. 5 shows a gel assessing detection of MYBPC3 DNA.
[0025] [Figure 6A-6B] Figure 6A shows multiple qPCR plots showing hMYBPC3 expression for non-limiting examples of constructs described herein. Figure 6A shows GAPDH expression in cardiac tissue. Figure 6B shows MYBPC3 expression in cardiac tissue. [Figure 6C-6D] Figure 6C shows expression of MYBPC3 in heart tissue normalized to GAPDH, and Figure 6D shows MYBPC3 expression based on each AAV9 sample. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0026] Detailed Description Reference is made to specific features and / or non-limiting embodiments of the invention. It should be understood that the disclosure of the invention herein encompasses all possible combinations of such specific features. For example, if a specific feature is disclosed in the context of a particular aspect or embodiment of the invention, or in the context of a particular claim, that feature can also be used in combination with and / or in the context of other specific aspects and embodiments of the invention, and in the invention in general, to the extent possible.
[0027] definition
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.Unless otherwise stated, all patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety.If there are multiple definitions for a term in this specification, those in this section shall prevail unless otherwise stated.
[0029] "Subject" refers to a mammal that is the subject of treatment using a method or composition as provided herein. "Mammal" includes, without limitation, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates such as monkeys, chimpanzees, apes, and humans. In some embodiments, the subject is a human.
[0030] The terms "treating," "treatment," "therapeutic," or "treatment" do not necessarily mean a complete cure or elimination of a disease or condition. Any alleviation of undesirable signs or symptoms of a disease or condition, regardless of the degree, can be considered treatment and / or therapy. "Treating" a disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0031] As used herein, the term "effective amount" refers to an amount that can treat or ameliorate a disease or condition, or an amount that can produce the intended therapeutic effect, such as reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0032] A "nucleic acid" sequence refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence. The term captures sequences that include any of the known base analogs of DNA and RNA, including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxy-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methyl Guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0033] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including DNA, RNA, or their analogs. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. Modifications to nucleotide structure, if present, may be added before or after the assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.
[0034] The term "isolated" when referring to a nucleotide sequence means that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. Thus, an "isolated nucleic acid molecule encoding a particular polypeptide" refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode the polypeptide of interest; however, the molecule may include some additional bases or moieties that do not materially affect the essential characteristics of the composition.
[0035] The term "identity" refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity." The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences, divided by the length of the shorter sequence, multiplied by 100.
[0036] Throughout this application, for purposes of describing the relative positions of nucleotide sequences in particular nucleic acid molecules, for example, when a particular nucleotide sequence is described as being located "upstream," "downstream," "3'," or "5'" relative to another sequence, it is to be understood as referring to the position of that sequence on the "sense" or "coding" strand of the DNA molecule being referenced, as is conventional in the art.
[0037] Sequence identity can be determined by aligning sequences using algorithms such as BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package Release 7.0 (Genetics Computer Group, 575 Science Dr., Madison, Wis.) with default gap parameters or by inspection, and by optimal alignment (i.e., the one that results in the highest percentage of sequence similarity over the entire comparison window). The percentage of sequence identity is calculated by comparing two optimally aligned sequences over the entire comparison window, determining the number of positions where identical residues occur in both sequences to calculate the number of matching positions, dividing the number of matching positions by the total number of matching and mismatching positions in the comparison window, not counting gaps (i.e., the size of the window), and multiplying the result by 100 to calculate the percentage of sequence identity. Unless otherwise indicated, the comparison window between two sequences is defined by the total length of the shorter of the two sequences.
[0038] The term "recombinant" when applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps and other procedures that result in constructs that are distinguishable from polynucleotides found in nature and / or combinations of polynucleotides and viral proteins not found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The terms encompass copies of the original polynucleotide construct and progeny of the original viral construct, respectively.
[0039] The term "gene" refers to a polynucleotide that contains at least one open reading frame that can code for a particular gene product. Any of the polynucleotide sequences described herein may be used to identify larger fragments or full-length coding sequences of the genes with which they are associated. Methods for isolating larger fragment sequences are known to those skilled in the art.
[0040] The term "transgene" as used herein refers to a nucleic acid sequence to be placed in a viral vector, which encodes a polypeptide, protein, or other product of interest.In some embodiments, one rAAV vector can contain sequences that code for one or more transgenes (which can be the same gene or different genes, as desired).For example, one rAAV vector can contain coding sequences for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 transgenes.The transgenes of the present disclosure, as provided herein, relate to the improvement of one or more cardiac conditions, such as cardiomyopathies.
[0041] The term "gene transfer" or "gene delivery" refers to a method or system for inserting DNA, such as a transgene, into a host cell, such as that of a subject suffering from cardiomyopathy. In some embodiments, gene transfer results in the transient expression of unintegrated introduced DNA, extrachromosomal replication, and expression of introduced replicons (e.g., episomes). In additional embodiments, gene transfer results in the integration of introduced genetic material into the genomic DNA of the host cell.
[0042] The term "regulatory element" or "regulatory sequence", or variations thereof, refers to a nucleotide sequence involved in the functional regulation of a polynucleotide, including the replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. Regulatory elements can be enhancing or inhibitory in nature, depending on the embodiment. Non-limiting examples of regulatory elements include transcriptional regulatory sequences, such as promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like. Collectively, these elements provide for the replication, transcription, and translation of the coding sequence in the recipient cell, although not all of these sequences need always be present. It should be understood that the structural components of the rAAV vectors as provided herein may be listed in separate paragraphs and may be combined and used together for clarity only. For example, any regulatory element or other component may be used in combination with any transgene (or transgenes) provided herein.
[0043] A "promoter" is a polynucleotide that interacts with RNA polymerase to initiate transcription of a coding region (eg, a transgene) that is usually located downstream (in the 3' direction) from the promoter.
[0044] The term "operably linked" refers to an arrangement of elements configured so that the components perform a function. For example, a regulatory sequence operably linked to a coding sequence effects expression of the coding sequence. Depending on the embodiment, the regulatory sequence need not be contiguous with the coding sequence. Thus, for example, one or more untranslated but transcribed sequences can be present between the promoter sequence and the coding sequence, and the two sequences are still considered to be "operably linked."
[0045] The term "vector" refers to any molecular vehicle, such as a plasmid, phage, transposon, cosmid, chromosome, virus, viral particle, virion, etc., that can transfer genetic sequences (e.g., a transgene) to or between cells of interest.
[0046] An "expression vector" is a vector that contains a region of nucleic acid (e.g., a transgene) that encodes a gene product (e.g., a polypeptide or protein) of interest. As disclosed herein, the vector is used to achieve expression, e.g., stable expression, of the protein in the intended target cell. The expression vector may also contain a control element operably linked to the transgene to facilitate expression of the encoded protein in the target cell. The combination of one or more regulatory elements and the gene(s) to which they are operably linked for expression may be referred to herein as an "expression cassette."
[0047] The term "AAV" is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or its derivatives. The term covers all subtypes, and both naturally occurring and recombinant forms, unless otherwise indicated. The abbreviation "rAAV" refers to recombinant adeno-associated virus, which is also referred to as recombinant AAV vector (or "rAAV vector"), which refers to AAV that contains a polynucleotide sequence (e.g., a transgene) that is not of AAV origin. The term "AAV" encompasses AAV serotype 1 (AAV-1), AAV serotype 2 (AAV-2), AAV serotype 3 (AAV-3), AAV serotype 4 (AAV-4), AAV serotype 5 (AAV-5), AAV serotype 6 (AAV-6), AAV serotype 7 (AAV-7), AAV serotype 8 (AAV-8), AAV serotype 9 (AAV-9), serotype rh10 AAV, serotype rh74 AAV, or pseudotyped rAAV (e.g., AAV2 / 9, which refers to an AAV vector having the genome of AAV2 (e.g., ITRs of AAV2) and the capsid of AAV9). In some embodiments, the preferred serotype for delivery to a human patient suffering from cardiomyopathy is one of AAV-9, serotype rh74, serotype rh10, or AAV-8. In some embodiments, the rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine, or other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference herein in its entirety.
[0048] The term "AAV virus" or "AAV viral particle" or "rAAV vector particle" refers to a viral particle that is composed of at least AAV capsid proteins and an encapsidated polynucleotide.
[0049] The term "heterologous" refers to a genotypically distinct origin. For example, a heterologous polynucleotide is one that originates from a different species compared to the reference species (e.g., a human gene inserted into a viral plasmid is a heterologous gene). A promoter that has been removed from its native coding sequence and operably linked to a coding sequence that is not found in nature to which it is linked is a heterologous promoter.
[0050] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present disclosure.
[0051] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle that is administered with the rAAV particle or preparation and / or rAAV vector. Such pharmaceutical carriers can be sterile liquids such as water and oils (including those of petroleum such as mineral oil, vegetable oils such as peanut oil, soybean oil, and sesame oil, animal oils, or synthetic origin). Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers.
[0052] In some embodiments, the sequences described herein are CpG-depleted and cDNA codon-optimized. In some embodiments, the sequences encoding MYBPC3 are optionally CpG-depleted.
[0053] Terms and phrases used in this application, and variations thereof, particularly in the appended claims, should be construed as open ended, as opposed to limiting, unless expressly stated otherwise. By way of example of the foregoing, the term "including" should be construed to mean "including, without limitation," "including but not limited to," and the like; the term "comprising," as used herein, is synonymous with "including," "containing," or "characterized by," and is inclusive or open ended, not excluding additional, unrecited elements or method steps; the term "having" means "having at least The term "including" should be interpreted as "including but not limited to"; the term "examples" is used to provide illustrative examples of the items under discussion, not an exhaustive or limiting list thereof; and the use of terms such as "preferably," "preferred," "desired," or "desirable," and words of similar import, should not be understood as implying that a particular feature is essential, mandatory, or even critical to structure or function, but instead is intended merely to highlight alternative or additional features that may or may not be utilized in a particular embodiment. Additionally, the term "comprising" should be interpreted synonymously with the phrases "having at least" or "comprising at least." When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps.When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components. Similarly, a group of items joined with the conjunction "and" should not be read as requiring each and every item to be present in the group, but rather as "and / or" unless expressly stated otherwise. Similarly, a group of items joined with the conjunction "or" should not be read as requiring mutual exclusivity within the group, but rather as "and / or" unless expressly stated otherwise.
[0054] With respect to the use of substantially all plural and / or singular terms in this specification, those skilled in the art can translate from plural to singular and / or from singular to plural, where appropriate for the context and / or application. For clarity, various singular / plural permutations may be explicitly stated in this specification. The indefinite article "a" or "an" does not exclude plurals. A single processor or other unit may fulfill the functions of several items recited in the claims. The mere fact that certain means are recited in mutually different dependent claims does not indicate that a combination of these means cannot be used to advantage. Any reference signs in the claims should not be interpreted as limiting the scope.
[0055] Ranges disclosed herein also encompass any and all overlaps, subranges, and combinations thereof. Words such as "up to," "at least," "greater than," "less than," "between" and the like include the recited numbers. Numbers preceded by terms such as "about" or "approximately" include the recited numbers. For example, "about 90%" includes "90%." In some embodiments, at least 95% homologous or identical includes 96%, 97%, 98%, 99%, and 100% homologous or identical to a reference sequence. In addition, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference also encompasses that the sequence "comprises," "consists of," or "consists essentially of" the recited sequence, unless otherwise indicated.
[0056] Sequence Listing [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]
[0057] aMHC-mCMV-MYBPC3 construct [ka] [ka] [ka] [ka]
[0058] [ka] [ka]
[0059] Kozak sequence [ka]
[0060] Transgene Transgenes may be used to correct, reduce, eliminate, or otherwise ameliorate genetic defects, which may include defects in which a normal gene is expressed at lower than normal levels, defects with a gene product that is expressed at normal or near-normal levels but has abnormal activity, or defects in which no functional gene product is expressed. In some embodiments, the transgene sequence encodes a therapeutic protein or polypeptide to be expressed in the host cell. Aspects of the present disclosure also include using multiple transgenes.
[0061] The MYBPC3 gene provides instructions for making cardiac myosin binding protein C (cardiac MyBP-C). Cardiac MyBP-C is found in cardiac myocytes, where it plays a role in sarcomere contraction. Muscle contraction is highly dependent on the activity of sarcomeres present in muscle cells. Mutations in MYBPC3 are a common cause of familial hypertrophic cardiomyopathy, accounting for up to 30% of all cases. While some individuals have no obvious health effects, all affected individuals have an increased risk of heart failure and sudden death. MYBPC3 mutations generally present a phenotype of a shorter or otherwise altered MyBP-C protein. The reduction of MyBPC in sarcomeres disrupts the conformation of myosin, which may contribute to various cardiac disease conditions.
[0062] Regulatory elements In some embodiments, the rAAV vector includes one or more regions that include sequences that facilitate expression of a heterologous nucleic acid, e.g., expression regulatory sequences operably linked to the heterologous nucleic acid. A promoter drives transcription of the nucleic acid sequence that it regulates, and thus it is typically located at or near the transcription start site of the gene. A promoter can have a length of, e.g., 100 to 1000 nucleotides. In some embodiments, a promoter is operably linked to a nucleic acid, or a sequence of a nucleic acid (a nucleotide sequence). A promoter is considered to be "operably linked" to a sequence of a nucleic acid that it regulates when the promoter is present in the correct functional location and orientation with respect to that sequence such that the promoter regulates the sequence, e.g., controls ("drives") the transcription initiation and / or expression of the sequence. Many such sequences are known in the art.
[0063] The promoters that can be used according to the present disclosure may include any promoter that can drive the expression of a transgene in the heart of a subject. In some embodiments, the promoter may be a tissue-specific promoter. "Tissue-specific promoter" as used herein refers to a promoter that can only function in a specific type of tissue, such as the heart. Thus, a "tissue-specific promoter" cannot drive the expression of a transgene in other types of tissue. In some embodiments, the promoters that can be used according to the present disclosure are promoters that are restricted to the heart. Non-limiting examples of tissue-specific promoters and / or regulatory elements that may be used include (1) desmin, creatine kinase, myogenin, alpha myosin heavy chain, and natriuretic peptide, which are specific to muscle cells, and (2) albumin, alpha-1-antitrypsin, hepatitis B virus core protein promoters, which are specific to liver cells. Non-limiting examples of promoters that are restricted to the heart are selected from cardiac troponin C, cardiac troponin I, and cardiac troponin T (cTnT). As provided herein, in treating cardiomyopathy, the promoter limited to the heart is advantageous due to at least the reduced possibility of off-target expression of transgene, thereby effectively increasing the dose delivered to the heart and enhancing treatment.Non-limiting examples of expression regulatory sequence include promoter, insulator, silencer, response element, intron, enhancer, start site, termination signal, and poly (A) tail.Any combination of such regulatory sequence is contemplated herein (e.g., promoter and enhancer).
[0064] Alternatively, the promoter may be a promoter from one of the following genes, without limitation: α-myosin heavy chain gene, 6-myosin heavy chain gene, myosin light chain 2v (MLC-2v) gene, myosin light chain 2a gene, CARP gene, cardiac α-actin gene, cardiac m2 muscarinic acetylcholine gene, atrial natriuretic factor gene (ANF), cardiac sarcoplasmic reticulum Ca-ATPase gene, skeletal α-actin gene; or the artificial heart promoter derived from the MLC-2v gene.
[0065] Any of a number of promoters suitable for use in a selected host cell may be used to achieve an appropriate expression level of the nucleic acid, protein, or polypeptide of interest. The promoter may be, for example, a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a synthetic promoter. For example, constitutive promoters of various strengths may be used. The rAAV vectors described herein may include one or more constitutive promoters, such as viral promoters or promoters from mammalian genes that are generally active in driving transcription. Non-limiting examples of constitutive viral promoters include promoters of herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), simian virus 40 (SV40), mouse mammary tumor virus (MMTV), Ad E1A, and cytomegalovirus (CMV). Non-limiting examples of non-viral constitutive promoters include various housekeeping gene promoters, as exemplified by the β-actin promoter, including chicken β-actin promoter (CBA).
[0066] Inducible promoters and / or regulatory elements may also be contemplated to achieve the appropriate expression level of the protein or polypeptide of interest.Non-limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes such as estrogen gene promoters.Another example of an inducible promoter is the tetVP16 promoter, which is responsive to tetracycline.
[0067] Synthetic promoters are also contemplated herein. Synthetic promoters may contain, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.
[0068] Enhancer elements can function in combination with other regulatory elements to increase expression of a transgene. In some embodiments, the enhancer element is upstream (located 5') of the transgene. Non-limiting embodiments of enhancer elements include nucleotide sequences including, for example, a 100 base pair element from simian virus 40 (SV40 late 2XUSE), a 35 base pair element from human immunodeficiency virus 1 (HIV-1 USE), a 39 base pair element from ground squirrel hepatitis virus (GHV USE), a 21 base pair element from adenovirus (adenovirus L3 USE), a 21 base pair element from human prothrombin (hTHGB USE), a 53 base pair element from human C2 complement gene (hC2 USE), truncations of any of the foregoing, and combinations of the foregoing. In some embodiments, the enhancer is derived from an α-myosin heavy chain (αMHC) gene. In some embodiments, the αMHC enhancer comprises SEQ ID NO:3.
[0069] Non-limiting polyadenylation signals include nucleotide sequences including, for example, the 624 base pair polyadenylation signal from human growth hormone (hGH), the 135 base pair polyadenylation signal from simian virus 40 (sV40 late), the 49 base pair synthetic polyadenylation signal from rabbit beta-globin (SPA), the 250 base pair polyadenylation signal from bovine growth hormone (bGH), truncations of any of the foregoing, and combinations of the foregoing.
[0070] In some embodiments of the disclosed rAAV vectors, the two or more transgenes are operably controlled by a single promoter. In some embodiments, each of the two or more transgenes is operably controlled by a separate promoter.
[0071] In some embodiments, the rAAV vector of the present disclosure further comprises an internal ribosome entry site (IRES). IRES is a nucleotide sequence that allows translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. In most eukaryotes, translation can only be initiated at the 5' end of an mRNA molecule, since 5' cap recognition is required for the assembly of the initiation complex. In some embodiments, the IRES is located between transgenes.
[0072] In such embodiments, the proteins encoded by the different transgenes are translated individually (ie, as opposed to being translated as a fusion protein).
[0073] In some embodiments, an rAAV vector of the disclosure includes at least, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a first transgene, an IRES operably linked to a second transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0074] In some embodiments, the rAAV vector of the disclosure further comprises a polyadenylation (pA) signal.
[0075] Expression cassette The expression cassette is composed of a transgene and its regulatory sequences at a minimum. If the cassette is designed to be expressed from rAAV, the expression cassette further comprises 5' and 3' AAV ITRs. These ITRs may be full length or one or both of the ITRs may be truncated. In one embodiment, the rAAV is pseudotyped, i.e., the AAV capsid is from a different source of AAV than the AAV that provides the ITRs. In one embodiment, the ITRs of AAV serotype 2 are used. In an additional embodiment, the ITRs of AAV serotype 1 are used. However, ITRs from other suitable sources may be selected.
[0076] Figure 1 represents a non-limiting embodiment of the construct described herein. At the 5' end, the AAV ITR and alpha MHC enhancer are located upstream from the promoter. Following the promoter, a MYBPC3 transgene consisting of multiple exons is represented. The construct further comprises a polyadenylation site following the MYBPC3 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or change the expression of MYBPC3.
[0077] Figure 2 represents a non-limiting embodiment of the construct described herein. At the 5' end, the AAV ITR and alpha MHC enhancer are located upstream from the CMV promoter. Following the promoter, the MYBPC3 transgene is represented. The construct further comprises a bGH polyadenylation site following the MYBPC3 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or change the expression of MYBPC3.
[0078] vector Further provided herein is a rAAV viral particle or a rAAV preparation containing such a particle. In some embodiments, the rAAV particle comprises a viral capsid and one or more transgenes encapsidated by the viral capsid as described herein. Methods for producing rAAV particles are known in the art and commercially available (see, for example, Zolotukhin el al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Application Publication Nos. US2007 / 0015238 and US2012 / 0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing a rAAV vector can be combined with one or more helper plasmids, such as those containing the rep genes (encoding, for example, Rep78, Rep68, Rep52 and Rep40) and the cap genes (encoding VP1, VP2, and VP3, including the modified VP3 regions described herein), and transfected into a production strain such that the rAAV particles can be packaged and subsequently purified.
[0079] The particles in the rAAV particles or rAAV preparations disclosed herein may be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, 2 / 9, 3 / 1, 3 / 5, 3 / 8, or 3 / 9). As used herein, the serotype of the rAAV rAAV particle refers to the serotype of the capsid protein of the recombinant virus. In some embodiments, the rAAV particle is rAAV6 or rAAV9. In some embodiments, the rAAV particle is AAVrh.74. In a preferred embodiment, the rAAV particle is AAVrh74. In an additional preferred embodiment, the rAAV is AAV9. In some embodiments, rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine, or other mutations as described in PCT Publication WO2019 / 1784412, which is incorporated by reference in its entirety. Non-limiting examples of derivatives, pseudotypes, and / or other vector types include AAVrh.10, AAVrh.74, AAV2 / 1, AAV2 / 5, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2-AAV3 hybrid, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AA Examples of such vectors include, but are not limited to, V2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.
[0080] Such AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A1, Schaffer DV, Samulski RJ.). In certain embodiments, the capsid of any of the rAAV particles disclosed herein is of the AAVrh.10 serotype. In some embodiments, the capsid is of the AAV2 / 6 serotype. In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a rAAV vector that includes ITRs from one serotype (e.g., AAV2, AAV3) and (b) a capsid composed of capsid proteins from another serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al, J. Virol., 75:7662-7671, 2001; Halbert et al, J. Virol., 74:1524-1532, 2000; Zolotukhin et al, Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).
[0081] rAAV Gene Therapy for Heart Disease In some embodiments, the rAAV vectors of the disclosure further comprise a polyadenylation (pA) signal. For example, in preferred embodiments, the pA signal comprises one or more of the following sequences: sequential, 12, or 11-13, or sequential 12-13, or 32, or 46.
[0082] In some embodiments, the rAAV vector of the disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0083] In some embodiments, the rAAV vector genome is circular. In some embodiments, the rAAV vector genome is linear. In some embodiments, the rAAV vector genome is single-stranded. In some embodiments, the rAAV vector genome is double-stranded. In some embodiments, the rAAV vector genome is a self-complementary rAAV vector.
[0084] Described herein are non-limiting examples of rAAV vectors. The vectors described below include linear plasmid sequences set forth as SEQ ID NOs: 1-14, or 20-34, or 35-48. The vectors of the present disclosure may include nucleotide sequences having at least 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the sequences set forth as SEQ ID NOs: 1-14, or 20-34, or 35-48. In some embodiments, the rAAV includes one or more nucleotide sequences having 100% identity to one or more of the sequences set forth as SEQ ID NOs: 1-14, or 20-34, or 35-48.
[0085] In some embodiments, any of the disclosed rAAV nucleic acid vector sequences comprises a truncation at the 5' or 3' end compared to any one of SEQ ID NOs: 1-14, or 20-34, or 35-48. In some embodiments, any of the rAAV vectors comprises a nucleotide sequence that differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more than 18 nucleotides from any one of SEQ ID NOs: 1-14, or 20-34, or 35-48.
[0086] Recombinant adeno-associated viral vectors and therapeutic uses thereof Many serotypes of AAV have been cloned and sequenced. Serotypes 1 and 6 share >99% amino acid homology in their capsid proteins. Of the first six AAV serotypes, serotype 2 has been extensively characterized and is therefore often used in gene transfer studies, but other AAV serotypes, such as AAV9, AAV20, AAVrh74, AAVrh10, etc., are also used according to embodiments disclosed herein. In some embodiments, repeated administration of a given serotype that is expected to induce a humoral immune response is performed in conjunction with an immune management regimen. In some embodiments, the immune management regimen includes administration of one or more agents that function as B cell depletors, alone or in combination with one or more agents that inhibit one or more aspects of the mTOR pathway. In one embodiment, an anti-CD20 antibody is administered and rapamycin is administered. In some embodiments, this allows repeated administration of rAAV of a given serotype, where the immune response to subsequent administrations of the rAAV is reduced, limited, or absent. Further information regarding immune management can be found in US patent application Ser. No. 15 / 306,139, the entire contents of which are incorporated herein by reference.
[0087] The therapeutic rAAV vectors, particles, or compositions comprising therapeutic rAAV particles of the present disclosure may be used in a human subject in need thereof for gene therapy for cardiac disease, such as cardiomyopathies, as provided herein. Examples of cardiac disease that may be treated using the methods and compositions of the present disclosure include, but are not limited to, cardiomyopathies and acute ischemia. In some embodiments, the cardiomyopathies are hypertrophic or dilated cardiomyopathy. In some embodiments, the cardiomyopathies are hypertrophic cardiomyopathy, which are caused by or associated with reduced or absent expression and / or function of MYBPC3. The therapeutic rAAV vectors, particles, and compositions comprising therapeutic rAAV particles may be used for the treatment of such heart failure (e.g., heart failure secondary to cardiomyopathy) when administered to a subject in need thereof, e.g., via vascular delivery to the coronary arteries and / or direct injection into the heart. In some embodiments, administration is via systemic delivery to a subject in need thereof. The therapeutic rAAV vectors, particles, and compositions comprising rAAV particles drive co-expression of MYBPC3 in the subject's cardiomyocytes.
[0088] The amino acid sequence of the therapeutic MyBP-C encoded by the MYBPC3 transgene has at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:15.
[0089] In some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and / or contained in the attached sequence listing) are provided, accounting for the degeneracy of the nucleic acid code. Additionally, sequences (whether nucleic acid or amino acid) that differ from those explicitly disclosed herein (and / or contained in the attached sequence listing) but have functional similarity or equivalence are also contemplated within the scope of this disclosure. The foregoing includes mutations, truncations, substitutions, or other types of modifications.
[0090] According to some embodiments described herein, any of the sequences may be used, or truncated or mutated forms of any of the sequences disclosed herein (and / or contained in the accompanying sequence listing) may be used in any combination.
[0091] The promoter driving the expression of therapeutic nucleic acid can be, but is not limited to, a constitutive promoter, an inducible promoter, a tissue-specific promoter, a neuron-specific promoter, a muscle-specific promoter, or a synthetic promoter. In some embodiments, the promoter is a neuron-specific promoter or a muscle-specific promoter. The constitutive promoter can be, but is not limited to, a herpes simplex virus (HSV) promoter, a thymidine kinase (TK) promoter, a Rous sarcoma virus (RSV) promoter, a simian virus 40 (SV40) promoter, a mouse mammary tumor virus (MMTV) promoter, an adenovirus E1A promoter, a cytomegalovirus (CMV) promoter, a mammalian housekeeping gene promoter, or a β-actin promoter. The inducible promoter can be, but is not limited to, a cytochrome P450 gene promoter, a heat shock protein gene promoter, a metallothionein gene promoter, a hormone-inducible gene promoter, an estrogen gene promoter, or a tetVP16 promoter that is responsive to tetracycline. The muscle-specific promoter can be, but is not limited to, a desmin promoter, a creatine kinase promoter, a myogenin promoter, an alpha myosin heavy chain promoter, or a natriuretic peptide promoter.
[0092] In some embodiments, the therapeutic rAAV promoter comprises a neuron- or myocardial-specific promoter.
[0093] The therapeutic rAAV can be serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype rh10, or serotype rh74. The therapeutic rAAV can also be pseudotyped rAAV.
[0094] In some embodiments, the therapeutic rAAV has a sequence that, when assembled sequentially, shares at least 85% sequence identity with SEQ ID NOs: 1-14, or 20-34, or 35-48.
[0095] In some embodiments, the therapeutic rAAV has a sequence that, when assembled sequentially, shares at least 95% sequence identity with SEQ ID NOs: 1-14, or 20-34, or 35-48.
[0096] Pharmaceutical Formulation and Administration The compositions described herein may further comprise pharmaceutical excipients, buffers, or diluents, and may be formulated for administration to host cells ex vivo or to animals, particularly humans, in situ. Such compositions may further comprise, optionally, liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to cells, tissues, organs, or the body of a subject in need thereof. Such compositions may be formulated for use in a variety of therapies, such as in the amelioration, prevention, and / or treatment of conditions such as peptide deficiency, polypeptide deficiency, peptide overexpression, polypeptide overexpression, and the like, including conditions that result in diseases or disorders as described herein.
[0097] Formulations containing pharma- ceutically acceptable excipient and / or carrier solutions are well known to those of skill in the art, as is the development of appropriate dosing and treatment regimens for use with the specific compositions described herein in a variety of treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administration and formulations.
[0098] Typically, these formulations may contain at least about 0.1% or more of a therapeutic agent (e.g., therapeutic rAAV particles or preparations), although the percentage of active ingredient(s) may of course vary and may conveniently be between about 1 or 2% and about 70% or 80% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent(s) in each therapeutically useful composition may be prepared in such a way that a suitable dosage will be obtained for any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be taken into account by those skilled in the art when preparing such pharmaceutical formulations. In addition, various dosages and treatment regimes may be desirable.
[0099] In some situations, it may be desirable to deliver the therapeutic rAAV particles or preparations in a suitably formulated pharmaceutical composition disclosed herein subcutaneously, intravascularly, intracardially, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells (e.g., cardiac myocytes and / or other cardiac cells), tissues, or organs. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are delivered systemically via intravenous injection, particularly for treating humans. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are injected directly into the heart of a subject. Direct injection into the heart may include, for example, injection into one or more of cardiac muscle tissue, the lining of the heart, or the skeletal muscle surrounding the heart, using a needle catheter. In some embodiments, direct injection into the human heart is preferred, for example, when delivery is performed in conjunction with a surgical procedure that improves access to the heart.
[0100] Pharmaceutical preparations of compositions suitable for injectable use include sterile aqueous solutions or dispersions. In some embodiments, the preparations are sterile and fluid to the extent that easy syringability exists. In some embodiments, the form is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier is, for example, a solvent or dispersion medium containing water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, vegetable oils, or other pharma- ceutically acceptable carriers generally recognized as safe (GRAS) by the U.S. Food and Drug Administration. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. There is virtually no limit to the other components that can be included, so long as the additional agent does not cause significant adverse effects when in contact with target cells or host tissues. The therapeutic rAAV particles or preparations may thus be delivered together with a variety of other pharma- ceutically acceptable agents, as appropriate in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0101] The amount of therapeutic rAAV particles or preparations and / or therapeutic rAAV vector compositions, as well as the time of administration of such compositions, will be within the knowledge of a person skilled in the art who has the benefit of the teachings of the present invention.However, administration of a therapeutically effective amount of the compositions of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.In some situations, it may be desirable to provide multiple or continuous administrations of rAAV particles or preparations and / or rAAV vector compositions, either over a relatively short period of time or over a relatively long period of time, which may be determined by the physician supervising the administration of such compositions.
[0102] The toxicity and efficacy of the compositions utilized in the methods of the present disclosure were evaluated using LD 50 The dose that is lethal to 50% of the population may be determined by standard pharmaceutical procedures using either cultured cells or experimental animals. The dose ratio between toxicity and efficacy is the therapeutic index, and it is the ratio LD 50 / ED 50 Compositions that exhibit large therapeutic indices are preferred. Compositions that exhibit toxic side effects may be used, while care should be taken to design a delivery system that minimizes the potential damage of such side effects. Dosages of compositions as described herein are generally at or near the ED with little or no toxicity. 50 The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
[0103] Other aspects of the present disclosure relate to methods and preparations for use with subjects, such as human or non-human subjects, host cells in situ in a subject, or host cells derived from a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is a companion animal. "Companion animal" as used herein refers to pets and other domestic animals. Non-limiting examples of companion animals include dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters. In some embodiments, the subject is a human subject.
[0104] In some embodiments, one or more pharma- ceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition that includes a therapeutic agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, such as a human.
[0105] A pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of a therapeutic agent and optionally one or more pharma- ceutically acceptable excipients. A pharma-ceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product) that is intentionally included in a drug delivery system. The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. The excipient may act to a) aid in the processing of the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other attribute of the overall safety, efficacy, delivery of the API during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.
[0106] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.
[0107] The pharmaceutical composition may contain other additional components that are typically included in pharmaceutical compositions. Such additional components may include, but are not limited to, antipruritic agents, astringents, local anesthetics, anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).
[0108] The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof, but is not limited thereto. The carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. The carrier may also contain isotonic agents such as sugars, polyalcohols, sodium chloride, etc. in the composition.
[0109] Pharmaceutically acceptable refers to properties and / or substances that are acceptable to subjects from a pharmacological / toxicological point of view.The phrase "pharmacologically acceptable" refers to molecular entities, compositions, and properties that can be physiologically tolerated and do not typically cause allergic or other adverse or toxic reactions when administered to subjects.In some embodiments, pharmaceutically acceptable compounds are approved by federal or state government regulatory agencies or listed in the United States Pharmacopeia or other commonly recognized pharmacopoeias for use in animals and more specifically in humans.
[0110] The rAAV or pharmaceutical composition as described herein may be formulated for administration to a host cell ex vivo or in situ in an animal, particularly a human. The rAAV or pharmaceutical composition may be administered by various routes. Routes of administration include, but are not limited to, intravenous, intraarterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and / or localized delivery to a target tissue. In some embodiments, multiple injections, or other types of administration, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more injections, are provided. Routes of administration may be combined, if desired. Depending on the embodiment, the first and second rAAV do not have to be administered the same number of times (e.g., the first rAAV may be administered once and the second vector may be administered three times). In some embodiments, administration is intramuscular administration.
[0111] In some embodiments, the number of rAAV particles administered to a subject is about 10 6~about 10 14 particles / mL or approximately 10 3 ~about 10 13 An order of magnitude range of particles / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the number of rAAV particles administered to a subject may be about 10 6 ~about 10 14 Vector genomes (vgs) / mL or 10 3 ~10 15 An order of magnitude range of vgs / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, about 0.5 to about 5 rAAV vector genomes are administered per cell. In some embodiments, about 0.5 to about 2 rAAV vector genomes are administered per cell. In some embodiments, about 1 x 10 per kilogram. 13 ~Approx. 3×10 14 (vgs / kg) of vector genomes are administered. In some embodiments, the dosage is based on the subject's myocardial mass. In some embodiments, the dosage is based on body weight. In some embodiments, the dosage is based on body surface area. The rAAV particles can be administered as a single dose, or can be divided into two or more administrations as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, a dose ranging from about 0.0001 mL to about 10 mL is delivered to the subject.
[0112] For administration of injectable aqueous solutions, for example, the solution may be suitably buffered, and if necessary, the liquid diluent is first made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this context, the sterile aqueous media that may be used will be known to those skilled in the art in view of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of subcutaneous infusion or injected at the proposed site of injection (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035-1038 and 1570-1580). In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, monobasic buffer (e.g., monobasic sodium phosphate buffer), dibasic salt (e.g., dibasic sodium phosphate), sodium-based tonicity agent (e.g., sodium chloride tonicity agent), non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent), surfactant (e.g., poloxamer 188 surfactant), and water. In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, sodium phosphate monobasic buffer, dibasic sodium phosphate, sodium chloride tonicity agent, magnesium chloride hexahydrate tonicity agent, poloxamer 188 surfactant, and water. In some embodiments, the active rAAV components are present in the formulation according to the amount of vector genome provided herein. In some embodiments, the monobasic buffer (e.g., sodium phosphate monobasic buffer) is present in the formulation at a concentration of about 0.2 mg / mL to about 0.5 mg / mL. In some embodiments, the dibasic salt (e.g., sodium phosphate dibasic) is present in the formulation at a concentration of about 1.5 mg / mL to about 4 mg / mL. In some embodiments, the sodium-based tonicity agent (e.g., sodium chloride tonicity agent) is present in the formulation at a concentration of about 8 mg / mL to about 12 mg / mL.In some embodiments, the non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent) is present in the formulation at a concentration of about 0.1 mg / mL to about 0.35 mg / mL. In some embodiments, the surfactant (e.g., poloxamer 188 surfactant) is present in the formulation at a concentration of about 0.05 mg / mL to about 0.8 mg / mL. In some embodiments, water is present to bring the volume of the formulation (e.g., dosage unit) to 1 mL.
[0113] Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will in any event determine the appropriate dose for each individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards, for example, as required by FDA Office of Biologics standards.
[0114] Sterile injectable solution is prepared by incorporating rAAV particles or formulations in the required amount in a suitable solvent with some of the other ingredients listed above as necessary, and then filter sterilization.Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other ingredients from those listed above.In the case of sterile powders for preparing sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying techniques, which produce powders of active ingredients plus any additional desired ingredients from their previously sterile-filtered solutions.
[0115] The amount of rAAV particles or preparations and the time of administration of such particles or preparations will be within the knowledge of a person skilled in the art who has the benefit of the teachings of the present invention.However, it is possible that administration of a therapeutically effective amount of the AAV particles or preparations of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.Alternatively, in some situations, it may be desirable to provide multiple or successive administrations of rAAV particles or preparations, either over a relatively short period of time or over a relatively long period of time, as can be determined by the physician supervising the administration of such compositions.
[0116] If desired, the rAAV particles can be administered in combination with other agents, such as proteins or polypeptides or various pharmacologic active agents, including administration of one or more therapeutic polypeptides, biologically active fragments or variants thereof. There is virtually no limit to the other components that can be included, as long as the additional agent does not cause significant adverse effects when contacting target cells or host tissues. The rAAV particles or preparations can thus be delivered together with various other pharmacologic acceptable agents, as required in a particular case. Such compositions can be purified from host cells or other biological sources, or alternatively, can be chemically synthesized as described herein.
[0117] In some embodiments, treatment of a subject with rAAV particles as described herein achieves one, two, three, four or more of the following effects, including, for example: (i) reduction or amelioration of the severity of a disease or a symptom associated therewith, (ii) reduction in the duration of a symptom associated with a disease, (iii) protection against progression of a disease or a symptom associated therewith, (iv) regression of a disease or a symptom associated therewith, (v) protection against the development or onset of a symptom associated with a disease, (vi) protection against recurrence of a symptom associated with a disease, (vii) reduction in hospitalization of the subject, (viii) reduction in length of hospitalization, (ix) increase in survival rate of a subject with a disease, (x) reduction in the number of symptoms associated with a disease, or (xi) enhancing, improving, supplementing, complementing, or augmenting the prophylactic or therapeutic effect(s) of another treatment.
[0118] In view of the teachings herein, it will be clear to those skilled in the art that the effective amount of viral vector to be added can be empirically determined. Administration can be administered in a single dose, multiple doses, continuously or intermittently throughout the course of treatment. Methods for determining the most effective administration means and dosages are well known to those skilled in the art and will vary depending on the viral vector, the composition of the treatment, the target cells, and the subject being treated. Single and multiple administrations can be administered, with the level and pattern of administration being selected by the treating physician.
[0119] kit Described herein is a composition comprising one or more of the disclosed rAAV vectors, which is included in a kit for diagnosing, preventing, treating or ameliorating one or more symptoms of heart disease or condition, such as cardiomyopathy.Such kits may be useful in diagnosing, preventing, and / or treating human disease, and may be particularly useful in treating, preventing, and / or ameliorating one or more symptoms of heart disease, such as cardiomyopathy.In some embodiments, the heart disease is caused by cardiomyopathy.In some embodiments, the heart disease is caused by hypertrophic cardiomyopathy or dilated cardiomyopathy.In some embodiments, the heart disease is hypertrophic cardiomyopathy.
[0120] Also provided in some embodiments are kits comprising one or more of the disclosed rAAV vectors (as well as one or more virions, viral particles, transformed host cells, or pharmaceutical compositions comprising such vectors); and instructions for using such kits in one or more therapeutic, diagnostic, and / or prophylactic clinical embodiments. Such kits may include one or more reagents, restriction enzymes, peptides, therapeutic agents, pharmaceutical compounds, or a means for delivery of the composition(s) to a host cell or to an animal (e.g., a syringe, injection, etc.). Depending on the embodiment, the kits may include those for treating, preventing, or ameliorating symptoms of a disease, deficiency, dysfunction, and / or injury, or may include components for large-scale production of the viral vectors themselves.
[0121] In some embodiments, the kit includes one or more containers or receptacles containing one or more doses of any of the described therapeutic agents. Such kits may be therapeutic in nature. In some embodiments, the kit contains a unit dosage, which means, for example, a predetermined amount of a composition including a described therapeutic agent, with or without one or more additional agents.
[0122] One or more components of the kit can be provided in one or more liquid or frozen solvents. The solvent can be aqueous or non-aqueous. The formulations in the kit can also be provided as dry powder(s) or in lyophilized form that can be reconstituted by adding a suitable solvent.
[0123] In some embodiments, the kit includes a label, marker, package insert, bar code, and / or reader indicating directions for proper use of the contents of the kit. In some embodiments, the kit may include a label, marker, package insert, bar code, and / or reader indicating that the contents of the kit can be administered according to a particular dosage or dosing regimen to treat a subject.
[0124] In addition, the kit may also include various reagents, including, but not limited to, washing reagents, elution reagents, and concentration reagents. Such reagents may be readily selected from among those described herein and from among conventional concentration reagents.
[0125] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present invention.
[0126] Combination therapy Aspects of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is encompassed within the scope of the present disclosure.
[0127] The compositions of the present disclosure may include rAAV particles or preparations and / or rAAV vectors, either alone or in combination with one or more additional active ingredients, which may be obtained from natural or recombinant sources or chemically synthesized. In some embodiments, the rAAV particles or preparations are administered in combination with a proteasome inhibitor, such as bortezomib, or hydroxyurea, in the same composition or as part of the same treatment regimen.
[0128] If desired, rAAV particles and rAAV vectors may be administered in combination with other agents, such as proteins or polypeptides or various pharmacoactive agents. In some embodiments, this may reflect, for example, one or more administrations of therapeutic polypeptides (e.g., recombinant forms of functional peptides or proteins that serve to replace or supplement the rAAV-based production of transgene-encoded proteins), biologically active fragments or variants thereof. rAAV particles or preparations may thus be delivered together with a variety of other pharmacologic acceptable agents, as required in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0129] In some embodiments, the additional therapeutic agent comprises an anti-inflammatory agent. The anti-inflammatory agent may be, but is not limited to, a corticosteroid, cortisone, hydrocortisone, hydrocortisone-21-monoesters (e.g., hydrocortisone-21-acetate, hydrocortisone-21-butyrate, hydrocortisone-21-propionate, hydrocortisone-21-parate, etc.), hydrocortisone-17,21-diesters (e.g., hydrocortisone-17,21-di ...butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-2 betamethasone (typically as betamethasone benzoate or betamethasone dipropionate); fluocinonide; prednisolone; and triamcinolone (typically as triamcinolone acetonide). In some embodiments, the anti-inflammatory agent includes, but is not limited to, cromolyn (5,5'-(2-hydroxypropane-1,3-diyl)bis(oxy)bis(4-oxo-4H-chromene-2-carboxylic acid) (also known as cromoglycate), and 2-carboxylatochromone-5'-yl-2-hydroxypropane derivatives such as bis(acetoxymethyl), cromoglycate disodium, nedocromil (9-ethyl-4,6-dioxo-10-propyl-6,9-dihydro-4H-pyrano[3,2-g]quinoline-2,8-dicarboxylic acid), and tranilast (2-{[(2E)-3-(3,4-dimethoxyphenyl)propane] and mast cell degranulation inhibitors such as, for example, 2-[2-chloro-5-cyano-3-(oxaloamino)anilino]-2-oxoacetic acid, and lodoxamide (2-[2-chloro-5-cyano-3-(oxaloamino)anilino]-2-oxoacetic acid). In some embodiments, the anti-inflammatory agent is a nonsteroidal anti-inflammatory drug (NSAID) such as, without limitation, aspirin compounds (acetylsalicylate), non-aspirin salicylates, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamic acid, naproxen, naproxen sodium, phenylbutazone, sulindac, and tometin.
[0130] In some embodiments, the anti-inflammatory agent comprises an antihistamine. The antihistamine may be, but is not limited to, clemastine, clemastine fumarate (2(R)-[2-[1-(4-chlorophenyl)-1-phenylethoxy]ethyl-1-methylpyrrolidine), dexmedetomidine, doxylamine, loratidine, desloratidine and promethazine, and diphenhydramine, or a pharmaceutically acceptable salt, solvate or ester thereof. In some embodiments, the antihistamine includes, but is not limited to, azatadine, azelastine, bruflorine, cetirizine, cyproheptadine, doxantrozole, etodroxydine, forskolin, hydroxyzine, ketotifen, oxatomide, pizotifen, proxicromil, N,N'-substituted piperazine or terfenadine. In some embodiments, the antihistamine is an H1 antagonist, such as, but not limited to, cetirizine, chlorpheniramine, dimenhydrinate, diphenhydramine, fexofenadine, hydroxyzine, orphenadrine, pheniramine, and doxylamine.In some embodiments, the antihistamine is an H2 antagonist, such as, but not limited to, cimetidine, famotidine, lafutidine, nizatidine, ranitidine, and roxatidine.
[0131] In some embodiments, the additional therapeutic agent comprises an antiviral agent, including an antiretroviral agent. Suitable antiviral agents include, but are not limited to, remdesivir, acyclovir, famciclovir, ganciclovir, foscarnet, idoxuridine, sorivudine, trifluorothymidine, valacyclovir, vidarabine, didanosine, dideoxyinosine, stavudine, zalcitabine, zidovudine, amantadine, interferon alpha, ribavirin, and rimantadine.
[0132] In some embodiments, the additional therapeutic agent comprises an antibiotic.Non-limiting examples of suitable antibiotics include beta-lactams such as penicillins, aminopenicillins (e.g., amoxicillin, ampicillin, hetacillin, etc.), penicillinase-resistant antibiotics (e.g., cloxacillin, dicloxacillin, methicillin, nafcillin, oxacillin, etc.), broad-spectrum antibiotics (e.g., axocillin, carbenicillin, mezlocillin, piperacillin, ticarcillin, etc.); cephalosporins (e.g., cefadroxil, cefazolin, cephalixin, cephalothin, cephapirin, cephradine, cefaclor, cefaclor, cefaclovir ... cefacmandole, cefmetazole, cefonicid, ceforanide, cefotetan, cefoxitin, cefprozil, cefuroxime, loracarbef, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftiofur, ceftizoxime, ceftriaxone, moxalactam, etc.; monobactams such as aztreonam; carbapenems such as imipenem and elopenem; quinolones (e.g., ciprofloxacin, enrofloxacin, difloxacin, orbifloxacin, marbofloxacin, etc.) ;Chloramphenicol (e.g., chloramphenicol, thiamphenicol, florfenicol, etc.);Tetracyclines (e.g., chlortetracycline, tetracycline, oxytetracycline, doxycycline, minocycline, etc.);Macrolides (e.g., erythromycin, tylosin, trimycosin, clarithromycin, azithromycin, etc.);Lincosamides (e.g., lincomycin, clindamycin, etc.);Aminoglycosides (e.g., gentamicin, amikacin, kanamycin, apramycin, tobramycin, etc.) sulfonamides (e.g., sulfadomethoxine, sulfamethazine, sulfaquinoxaline, sulfamerazine, sulfathiazole, sulfasalazine, sulfadiazine, sulfabromomethazine, sulfurethoxypyridazine, etc.); glycopeptides (e.g., vancomycin, teicoplanin, ramoplanin, and decaplanin; and other antibiotics (e.g., rifampin, nitrofuran, virginiamycin, polymyxin, tobramycin, etc.).
[0133] In some embodiments, the additional therapeutic agent includes, but is not limited to, antifungal agents, such as itraconazole, ketoconazole, fluoconazole, and amphotericin B. In some embodiments, the therapeutic agent is an antiparasitic agent, such as, but not limited to, the broad-spectrum antiparasitic agent nitazoxanide; antimalarials and other antiprotozoal agents (e.g., artemisin, mefloquine, lumefantrine, tinidazole, and miltefosine); anthelmintics, such as mebendazole, thiabendazole, and ivermectin; and antiamoebic agents, such as rifampin and amphotericin B.
[0134] In some embodiments, the additional therapeutic agents include analgesics, including, without limitation, opioid analgesics such as alfentanil, buprenorphine, butorphanol, codeine, dihydrocodeine (drocode), fentanyl, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, sufentanil, and tramadol; and non-opioid analgesics such as apazone, etodolac, difenpyramide, indomethacin, meclofenamate, mefenamic acid, oxaprozin, phenylbutazone, piroxicam, and tolmetin.
[0135] Any particular feature, aspect, method, property, characteristic, quality, attribute, element, etc. disclosed herein in relation to one embodiment can be used in all other embodiments described herein. Consequently, it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another to form various modes of the disclosed invention. Thus, it is intended that the scope of the invention disclosed herein should not be limited by the particular disclosed embodiments described above. Moreover, the invention is susceptible to various modifications and alternative forms, specific examples of which are shown in the drawings and described in detail herein. However, the invention is not limited to the particular forms or methods disclosed, but on the contrary, it should be understood that the invention covers all modifications, equivalents, and alternatives falling within the spirit and scope of the various described embodiments and the appended claims. Any method disclosed herein need not be performed in the order described. The methods disclosed herein include specific actions performed by the practitioner; however, they may also include, either explicitly or implicitly, the direction of those actions by a third party. Furthermore, when features or aspects of the disclosure are described in terms of a Markush group, those skilled in the art will recognize that the disclosure also can be described in terms of any individual members or subgroups of members of that Markush group.
[0136] Any headings or sub-headings used herein are for organizational purposes only and should not be used to limit the scope of the aspects disclosed herein.
[0137] example The following examples are illustrative only and are not intended to limit the scope of the invention.
[0138] material and method Construct Design MYBPC3 cDNA was codon-optimized for expression in human tissues and subcloned into a suitable plasmid backbone for production of AAV. A construct containing a single-stranded AAV genome was engineered to contain elements as provided in Table 1 below, with other designs and alternative configurations also described. A schematic of the construct is provided in Figure 1. Table 1 [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]
[0139] In silico derivation of consensus Kozak sequences for enhanced expression in cardiac tissue
[0140] To design new synthetic Kozak sequences for enhancing transgene expression in the heart, an analysis of genes highly expressed in human heart tissue was performed. Genes were selected from the Human Protein Atlas, as shown in Table 2 below, and the Kozak sequence for each was identified in NCBI. Consensus sequences were derived using Weblogo (https: / / weblogo.berkeley.edu / logo.cgi). The consensus sequence (AGCCCCAAC (SEQ ID NO: 28)) was then utilized in the design of the transgene constructs provided herein. Table 2. [Table 2]
[0141] Alternative constructs were designed using different promoters and in silico derived sequences, as shown in Table 3 below. Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]
[0142] Additional constructs were designed containing the following alternative promoters: TNNC1 GATCACTGGGACCAGAGGAGGGGCTGGAGGATACTACACGCAGGGGTGGGCTGGGCTGGGCTGGGCTGGGCCAGGAATGCAGCGGGGCAGGGCTATTTAAGTCAAGGGCCGGCTGGCAACCCCAGCAAGCTGTCCTGTGAG (SEQ ID NO: 63) MHC CAAGGCTTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCAT ACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTC (SEQ ID NO: 64)
[0143] AAV production. Recombinant AAV (rAAV) particles containing each of the constructs are made by suspension transfection of Expi293F cells with the MYBPC3 constructs and other plasmids required for rAAV production (e.g., containing rep and cap expression cassettes), generating three groups of rAAVs including: (1) AAV9 capsid protein, (2) rh74 capsid protein, and (3) rh74 variant capsid protein containing a tryptophan to arginine mutation at amino acid 505 of the rh74 VP1 capsid protein. Vectors are isolated using a capture column followed by an anion exchange column and purified to a titer of 2-5E+13 vg / ml using a cesium chloride gradient.
[0144] Example 1. In vitro expression studies Three groups of rAAVs containing MYBPC3 constructs will be generated as described above and delivered into HEK293, C2C12, or human induced pluripotent stem cell-derived cardiomyocytes. Whole cell lysates will be generated and probed for MYBPC3 expression by ELISA and / or immunoblotting.
[0145] Example 2. In vivo expression studies Three groups of rAAV containing MYBPC3 constructs are generated as described above and administered to neonatal C57BL / 6 mice (n=6-10 / group) at 5E+13vg / kg via the facial vein. Two to four weeks after rAAV administration, heart, diaphragm, and skeletal muscle tissues are harvested and whole cell lysates are analyzed for MYBPC3 expression using ELISA and / or immunoblotting.
[0146] Three groups of rAAV containing MYBPC3 constructs are generated as described above and administered via the jugular vein to 5-7 week old C57BL / 6 mice (n=6-10 / group) at three different doses: 1E+13vg / kg, 5E+13vg / kg, or 1+E14vg / kg. One month after rAAV administration, heart, diaphragm, and skeletal muscle tissues are harvested and whole cell lysates are analyzed for MYBPC3 expression using ELISA and / or immunoblotting.
[0147] Example 3. Restoration of MYBPC3 expression in vivo Constitutive homozygous MYBPC3 knockout mice (Mybpc3 tm1Rmos ;MGI:3526881) rapidly develop a severe, early-onset hypertrophic cardiomyopathy-related phenotype that is relatively stable over time and survives well into adulthood (>1 year) (Harris et al., 2002).
[0148] Mybpc3-loxP-introduced (Mybpc3-floxed:Mybpc3 fl / fl) mice (Mybpc3 tm2.1Rmos ;MGI:5523781) to generate tissue-specific MYBPC3-deficient animals (Chen et al., 2012). To generate cardiomyocyte-specific knockout (CKO) mice of MYBPC3, Mybpc3 fl / fl mice are crossed with α-myosin heavy chain transgenic (αMHC-Cre) mice.
[0149] rAAV containing MYBPC3 construct is produced as described above, and delivered to pre-symptomatic and / or symptomatic MYBPC3 mutant mice with various doses via single IV injection.Endpoints include survival rate and cardiac function monitored by echocardiography.At autopsy, cardiac tissue is harvested, and total tissue lysate is analyzed for AAV biodistribution by ddPCR, and for human MYBPC3 expression by ELISA and / or immunoblot.In addition, tissue sections are analyzed for histopathology.The therapeutic effect of rAAV is evaluated through measured endpoints and / or histopathological evaluation.
[0150] Example 4. Detection of MYBPC3 DNA and mRNA from treated mice According to Table 4, two groups of rAAV, including (1) AAV9 capsid protein and (2) rh74 capsid protein, were administered via intraperitoneal injection to a neonatal mouse model. After at least 25 days (necropsy on average at day 28), the cardiac tissues of the treated mice were isolated from the treated mice, and the harvested hearts were separated into three separate sections: upper heart tissue, middle heart tissue, and lower heart tissue. The upper heart tissue was fixed in formalin for paraffin-embedded (FFPE) tissue processing, while the middle and lower heart tissues were immediately frozen at -80°C. The frozen cardiac tissue was processed and homogenized via bead crushing, and the resulting homogenized lysate was divided into two fractions: the first fraction for RNA extraction, and the second fraction for DNA extraction. Table 4 [Table 4]
[0151] RNA extraction RNA was extracted using Promega extraction reagents, and purified RNA was analyzed for quantity and quality via Tapestation and nanodrop. RT-PCR was performed to detect codon-optimized hMYBPC3 mRNA. Figure 3 shows the detection of mRNA signal for hMYBPC3 mRNA from isolated tissue lysates. As can be seen, RT positive samples show mRNA hMYBPC3 signal for AAV9 and RH74-mediated vectors at the expected size of 260bp. Figure 4 shows RT-qPCR plots comparing A: GAPDH control, B: MYBPC3, C: hMYBPC3 RNA normalized to GAPDH, and D: hMYBPC3 RNA normalized to AAV9 samples. Samples 2-2 and 3-5 displayed high relative fold change for hMYBPC3. The results confirm the detection of hMYBPC3 RNA expression in mouse heart samples treated with AAV9 and RH74-mediated vectors.
[0152] DNA extraction and assay for hMYBPC3 Similar to the RNA extraction method, DNA was extracted from homogenized tissue lysates and analyzed for quantity and quality via Tapestation and nanodrop. Total DNA was used as template in PCF reactions with primers designed to specifically recognize codon-optimized human MYBPC3 DNA. Figure 5 shows rAAV9 replicates A-D, and RH74 replicates E-H, as well as an untreated mock control. The presence of the expected 260 bp band indicates that hMYBPC3 DNA was detectable in mice treated with both rAAV9 and RH74 based constructs. Figure 6 shows qPCR plots comparing A: GAPDH control, B: MYBPC3, C: hMYBPC3 DNA normalized to GAPDH, and D: hMYBPC3 DNA normalized to AAV9 samples. As can be seen, samples 2-2 and 3-5 expressed 4-6 fold increased hMYBPC3 DNA over the levels detected in tissue samples. The results confirm the detection of co-hMYBPC3 DNA in cardiac samples from mice treated with AAV9 and RH74-mediated vectors.
Claims
1. 1. A nucleic acid comprising an expression construct comprising a human MYBPC3 coding sequence operably linked to a cardiac-specific enhancer or regulatory element and a promoter, wherein: The expression construct is flanked on both sides by inverted terminal repeats, The human MYBPC3 coding sequence is codon-optimized for expression in human cells. The nucleic acid.
2. 2. The nucleic acid of claim 1, wherein the human MYBPC3 coding sequence has at least about 85% sequence identity to the sequence of SEQ ID NO: 9, 29 or 43.
3. the promoter comprises a cardiac-specific promoter; Optionally, wherein the promoter is selected from the group consisting of CMV, mini-CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, and combinations thereof, and wherein the cardiac-specific enhancer or regulatory element comprises an alpha MHC enhancer; Further optionally herein, the promoter has at least about 85% sequence identity to the sequence of SEQ ID NO: 5, 24 or 39. The nucleic acid of claim 1.
4. 2. The nucleic acid of claim 1, wherein the expression construct, when assembled sequentially, has at least about 85% sequence identity to the sequence of SEQ ID NOs: 1-14, or 20-34, or 35-48.
5. 2. The nucleic acid of claim 1, wherein the expression construct comprises the sequence of SEQ ID NO: 1-14, or 20-34, or 35-48 when assembled sequentially.
6. 10. The nucleic acid of claim 1, comprising a recombinant adeno-associated virus (rAAV) vector or a single-stranded or self-complementary rAAV nucleic acid vector.
7. A recombinant adeno-associated virus (rAAV) particle comprising the nucleic acid of any one of claims 1 to 6.
8. The rAAV particle of claim 7, which is an rh74 particle.
9. 8. The rAAV particle of claim 7, which is an AAV9 particle, an rhlO particle, or a combination thereof.
10. 8. The rAAV particle of claim 7 for use in treating hypertrophic cardiomyopathy.
11. 10. A composition comprising a plurality of the rAAV particles of claim 7, optionally further comprising a pharmaceutically acceptable carrier.
12. 1. An rAAV for use in a method for treating hypertrophic cardiomyopathy, comprising: wherein the rAAV comprises a nucleic acid expression construct comprising the nucleic acid of any one of claims 1 to 6; The method includes administering a therapeutically effective amount of the rAAV, wherein said administration results in expression of a therapeutically effective amount of human MyBP-C, thereby treating hypertrophic cardiomyopathy. The rAAV.
13. (i) the rAAV is administered via intravenous injection; and / or (ii) about 0.5 to about 5 rAAV vector genomes are administered per cell, optionally wherein about 0.5 to about 2 rAAV vector genomes are administered per cell; rAAV for use according to claim 12.
14. A method for inducing expression of human MyBP-C in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles of claim 9.
15. The method of claim 14 for use in an in vivo method for increasing expression of MYBPC3 in a target cell.
16. below: a human MYBPC3 coding sequence that is codon-optimized for expression in human cells; a cardiac enhancer element operably linked to the promoter; and Kozak sequence A nucleic acid comprising an expression construct comprising: wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the Kozak sequences are non-native with respect to the human MYBPC3 coding sequence, cardiac enhancer elements, and / or promoter. The nucleic acid.
17. 17. The nucleic acid of claim 16, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO:
28.
18. 17. The nucleic acid of claim 16, wherein the human MYBPC coding sequence has at least about 85% sequence identity to the sequence of SEQ ID NO: 9, 29 or 43.
19. the promoter comprises a cardiac-specific promoter; Optionally, wherein the promoter is selected from the group consisting of CMV, mini-CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, and combinations thereof, and wherein the cardiac-specific enhancer or regulatory element comprises an alpha MHC enhancer; Further optionally herein, the promoter has at least about 85% sequence identity to the sequence of SEQ ID NO: 5, 24 or 39. The nucleic acid of claim 16.
20. 17. The nucleic acid of claim 16, wherein the expression construct has at least about 85% sequence identity to the sequences of SEQ ID NOS: 1-14, or 20-34, or 35-48, arranged in order, optionally wherein the expression construct comprises the sequences of SEQ ID NOS: 1-14, or 20-34, or 35-48, arranged in order.
21. 17. The nucleic acid of claim 16, comprising a recombinant adeno-associated virus (rAAV) vector or a single-stranded or self-complementary rAAV nucleic acid vector.
22. 22. A recombinant adeno-associated virus (rAAV) particle comprising the nucleic acid of any one of claims 16 to 21, optionally wherein the rAAV particle is an AAV9 particle, a rh74 particle, a rh10 particle, or a combination thereof.
23. 23. A composition comprising a plurality of the rAAV particles of claim 22, optionally further comprising a pharmaceutically acceptable carrier.