Compositions for modulating sodium voltage-dependent channel alpha subunit 1 expression and uses thereof

JP2024545923A5Pending Publication Date: 2026-01-20REGEL THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024540038
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-30
Filing Date
2022-12-28
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

There is no effective treatment for Dravet syndrome, a drug-resistant infantile epilepsy caused by heterozygous loss-of-function mutations in the sodium voltage-gated channel alpha subunit 1 (SCN1A) gene, leading to severe seizures and cognitive impairment, with existing treatments failing to address the underlying cause.

Method used

Development of vectors containing a sequence-specific DNA targeting module (DTM) fused to a transactivator, specifically targeting SCN1A-expressing cells, particularly parvalbumin-expressing GABAergic interneurons, to increase SCN1A expression using nuclease-deficient CRISPR-associated proteins and promoters, delivered via viral vectors like adeno-associated virus (AAV), to normalize brain function and reduce seizures.

Benefits of technology

The approach effectively increases SCN1A expression in affected neurons, reducing seizure frequency and severity, and potentially preventing sudden death in epilepsy (SUDEP), offering a therapeutic solution for Dravet syndrome.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein are compositions and methods for increasing expression of the sodium voltage-dependent channel alpha subunit 1 (SCN1A) gene in SCN1A-expressing cells. Further provided herein are uses of such compositions for treating disorders associated with deficiencies in SCN1A expression, such as Dravet syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 294,967, filed December 30, 2021, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (REGT_001_01WO_SeqList_ST26.xml, size: 366,590 bytes, created on: December 22, 2022) are incorporated by reference in their entirety herein.

[0003] Technical Field The present disclosure relates to gene expression regulation and methods of using same. [Background technology]

[0004] background Dravet syndrome (DS) is a drug-resistant infantile epilepsy that causes cognitive impairment and death in approximately 20% of patients by age 25 years. Approximately 85% of DS cases are caused by heterozygous loss-of-function mutations in the sodium voltage-gated channel alpha subunit 1 (SCN1A) gene, which encodes the alpha subunit of the sodium channel Nav1.1. Mouse models of DS reveal that parvalbumin-expressing GABAergic interneurons are the primary cell type affected by SCN1A haploinsufficiency and underlie the severe and frequent seizures. No treatment exists to eliminate seizures in DS patients, nor to treat the underlying cause of the disease. Summary of the Invention

[0005] overview Provided herein is a vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA targeting module (DTM) fused to a transactivator; (b) an enhancer polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-dependent channel alpha subunit 1 (SCN1A)-expressing cells in the brain; and (c) a promoter polynucleotide sequence. In some embodiments, the SCN1A-expressing cells are GABAergic interneuron cells. In some embodiments, the SCN1A-expressing cells are parvalbumin (PV)-expressing interneurons.

[0006] In some embodiments of the vectors provided herein, the DTM comprises a nuclease-deficient CRISPR-associated protein. In some embodiments, the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA). In some embodiments, the gRNA targets the SCN1A gene. In some embodiments, the gRNA specifically hybridizes to the regulatory region of the SCN1A gene. In some embodiments, the regulatory region of the SCN1A gene is a promoter or enhancer. In some embodiments, the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 160, or 161. In some embodiments, the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 11, 19, 21, or 27. In some embodiments, the gRNA is operably linked to a promoter recognized by RNA polymerase III. In some embodiments, the gRNA is operably linked to a human U6 promoter. In some embodiments, the vector further comprises a polynucleotide sequence encoding a second gRNA that targets the SCN1A gene.

[0007] In some embodiments of the vectors provided herein, the nuclease-deficient CRISPR-associated protein is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cs cl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog. In some embodiments, the nuclease-deficient CRISPR-associated protein is dCas9. In some embodiments, the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9, or Campylobacter jejuni dCas9, or a dCas9 from an orthologous bacterial species. In some embodiments, dCas9 comprises the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159. In some embodiments, dCas9 comprises an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159. In some embodiments, dCas9 is encoded by a nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106. In some embodiments, dCas9 is encoded by a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106. In some embodiments, dCas9 comprises a fragment of the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159, which is a protein capable of forming a complex with a gRNA and targeting the SCN1A gene.

[0008] In some embodiments of the vector provided herein, the promoter is a minimal promoter.In some embodiments, the promoter is recognized by RNA polymerase II.In some embodiments, the promoter is a human U6 promoter, a mouse U6 promoter, or a human H1 promoter.

[0009] In some embodiments of the vectors provided herein, the enhancer polynucleotide sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 33-102. In some embodiments, the enhancer polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 69 or 34.

[0010] In some embodiments of the vectors provided herein, the transactivator is VP16, VP32, VP48, VP64, VPR, the MS2-SAM system, p65, Rta, the CITE-D domain of p300, or SunTag. In some embodiments, the transactivator is encoded by a nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113.

[0011] In some embodiments of the vectors provided herein, the vector comprises, in 5'-3' order, (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, and (c) a transgene polynucleotide sequence. In some embodiments of the vectors provided herein, the vector comprises, in 5'-3' order, (a) an enhancer polynucleotide sequence, (b) a promoter polynucleotide sequence, and (c) a transgene polynucleotide sequence.

[0012] Provided herein is a vector wherein (a) the transgene polynucleotide sequence encodes an amino acid sequence of SEQ ID NO:114, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO:114, or (b) the transgene polynucleotide sequence comprises or consists of a nucleotide sequence of SEQ ID NO:115, 116, or 117, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO:115, 116, or 117.

[0013] In some embodiments of the vectors provided herein, the vector further comprises an artificial intron.

[0014] In some embodiments of the vectors provided herein, the vector further comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element (HBVPRE), an RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element.

[0015] In some embodiments of the vectors provided herein, the vector further comprises a polyadenylation signal sequence. In some embodiments, the polyadenylation signal sequence is an SV40 polyadenylation signal sequence.

[0016] In some embodiments of the vector provided herein, the vector is a viral vector.In some embodiments, the viral vector is an adeno-associated virus (AAV) vector.In some embodiments, the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of a promoter polynucleotide sequence and a second AAV ITR located downstream of a transgene polynucleotide sequence.In some embodiments, the first AAV ITR is an AAV2 ITR, and the second AAV ITR is an AAV2 ITR.

[0017] Provided herein is a vector that includes, in 5'-3' order, (a) a 5' ITR, (b) an RNA polymerase III promoter, (c) a polynucleotide sequence encoding a gRNA, (d) an enhancer polynucleotide sequence, (e) a minimal promoter, (f) an artificial intron, (g) a transgene polynucleotide sequence, (h) a WPRE, (i) a polyadenylation signal sequence, and (j) a 3' ITR.

[0018] Provided herein is a vector that includes, in 5'-3' order, (a) a 5' ITR, (b) an RNA polymerase III promoter, (c) a polynucleotide sequence encoding a gRNA, (d) a minimal promoter, (e) an enhancer polynucleotide sequence, (f) an artificial intron, (g) a transgene polynucleotide sequence, (h) a WPRE, (i) a polyadenylation signal sequence, and (j) a 3' ITR.

[0019] Provided herein are vectors comprising the nucleotide sequence of SEQ ID NO:137, 141, 145, 149, or 153, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO:137, 141, 145, 149, or 153.

[0020] In some embodiments of the vectors provided herein, the vector is suitable for delivery via a non-viral delivery system, hi some embodiments, the non-viral delivery system is a lipid nanoparticle or an exosome.

[0021] Provided herein is a viral particle that comprises the vector disclosed herein.In some embodiments, the viral particle is a recombinant AAV (rAAV) particle.In some embodiments, the rAAV particle is an AAV9, AAV-PHP.eB, AAV-DJ or AAV2 serotype particle.

[0022] Provided herein is a population of viral particles comprising a plurality of the viral particles disclosed herein.

[0023] Provided herein is a pharmaceutical composition comprising a vector, a viral particle or a population of viral particles disclosed herein, and a pharma- ceutically acceptable carrier, vehicle, or diluent.

[0024] Provided herein is a cell comprising the vector or viral particle disclosed herein. In some embodiments, the cell is a mammalian cell or an insect cell.

[0025] Provided herein are methods of producing rAAV particles, comprising (i) culturing the cells disclosed herein under conditions that allow packaging of the rAAV particles, and (ii) harvesting the cultured host cells or culture medium for harvesting the rAAV particles. In some embodiments, the rAAV particles comprise AAV9, AAV-PHP.eB, AAV-DJ, or AAV2 capsid proteins.

[0026] Provided herein are methods for treating Dravet Syndrome (DS) in a subject having or suspected of having DS, the methods comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles, or a pharmaceutical composition.

[0027] Provided herein is a method for treating or reducing the risk, severity, frequency, or length of epilepsy and / or seizures in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), comprising administering to the subject a therapeutically effective amount of a vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein.

[0028] Provided herein is a method for preventing or reducing the risk of sudden death in epilepsy (SUDEP) in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), comprising administering to the subject a therapeutically effective amount of a vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein.

[0029] In some embodiments of the methods disclosed herein, the subject is between about 2 years of age and about 18 years of age. In some embodiments, the subject is over 18 years of age.

[0030] In some embodiments of the methods disclosed herein, the vector, viral particle, population, or pharmaceutical composition is administered to the subject via intraventricular, intrathecal, intracarotid, or intraparenchymal injection.

[0031] In some embodiments of the methods disclosed herein, the vector, viral particle, population, or pharmaceutical composition is administered to a subject in a single dose, in some embodiments, the single dose comprises about 10E+9 to about 10E+14 viral particles.

[0032] Provided herein is a method for increasing the level of SCN1A expression in SCN1A-expressing cells in the brain, comprising contacting the cells with a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein.In some embodiments, the SCN1A-expressing cells comprise a loss-of-function mutation in one copy of the SCN1A gene.In some embodiments, the SCN1A-expressing cells are GABAergic interneuron cells.In some embodiments, the GABAergic interneuron cells express parvalbumin (PV).

[0033] Provided herein is a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein for use as a medicament. [Brief description of the drawings]

[0034] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "sa-dCas9" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0035] [Diagram 2] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v2-del234-444" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0036] [Diagram 3]1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-vp64-v4-del479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0037] [Figure 4] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v5-del234-444,479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0038] [Diagram 5] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "sa-dCas9" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0039] [Figure 6]1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v2-del234-444" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0040] [Figure 7] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-vp64-v4-del479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0041] [Figure 8] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v5-del234-444,479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0042] [Figure 9]1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "sa-dCas9" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0043] [Figure 10] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v2-del234-444" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0044] [Figure 11] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-vp64-v4-del479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0045] [Figure 12]1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v5-del234-444,479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0046] [Figure 13] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "sa-dCas9" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0047] [Figure 14] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v2-del234-444" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs. [Figure 15] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-vp64-v4-del479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0048] [Figure 16] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. The vector encodes a fusion protein comprising dCas9 and the VP64 transactivator. "minisadcas9-v5-del234-444,479-649" refers to the polynucleotide sequence encoding dCas9. "S5_Scn1a_E2" refers to the enhancer polynucleotide sequence. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs. [Figure 17] 1 shows a plasmid map of the vector provided herein incorporated into an AAV expression cassette. This vector encodes a fusion protein containing dCas9 and the VP64 transactivator. "sa-dCas9" refers to the polynucleotide sequence encoding dCas9. "NLS" refers to the nuclear localization signal. "bp" refers to base pairs.

[0049] [Figure 18A-B]18A and 18B show the results of an experiment testing the effect of vectors provided herein on regulating SCN1A expression in vitro in human (FIG. 18A) and mouse (FIG. 18B) cell lines. The vector contained a dCas9-VP64 transgene driven by an E2 enhancer. All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). The human gRNAs used in FIG. 18A were hG-pA11 (SEQ ID NO: 11), hG-pB6 (SEQ ID NO: 19), hG-E1 (SEQ ID NO: 21), and hG-E7 (SEQ ID NO: 27). "C" refers to the non-targeting gRNA control. The results of an experiment testing the effect of vectors provided herein on regulating SCN1A expression in vitro in human (FIG. 18A) and mouse (FIG. 18B) cell lines. The vector contained a dCas9-VP64 transgene driven by an E2 enhancer. All RNA level values ​​were normalized to the levels of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). The human gRNAs used in Figure 18A were hG-pA11 (SEQ ID NO: 11), hG-pB6 (SEQ ID NO: 19), hG-E1 (SEQ ID NO: 21), and hG-E7 (SEQ ID NO: 27). "C" refers to non-targeting gRNA control.

[0050] [Fig. 18C-D]18 shows the results of an experiment testing the effect of the vectors provided herein in vivo in wild-type and Dravet model mice. The vectors were administered via recombinant AAV. The vectors contained a dCas9-VP64 transgene driven by an E2 enhancer. Modulation of SCNA1 expression was measured after vector administration in wild-type mice (FIG. 18C) and Dravet mice (FIG. 18D). All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). The effect of vector administration on seizure latency (FIG. 18E), time to first seizure (FIG. 18F), and survival rate (FIG. 18G) in Dravet model mice is shown. "C" refers to non-targeting gRNA control. "WT" refers to wild-type mice for SCN1A. "HET" refers to mice heterozygous for SCN1A. "PV IN" refers to interneurons expressing parvalbumin. "EEG" refers to electroencephalogram. "d" refers to days. Figure 18 shows the results of an experiment testing the effect of the vectors provided herein in vivo in wild-type and Dravet model mice. The vectors were administered via recombinant AAV. The vectors contained a dCas9-VP64 transgene driven by an E2 enhancer. Modulation of SCNA1 expression was measured after vector administration in wild-type mice (Figure 18C) and Dravet mice (Figure 18D). All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). Figure 18 shows the effect of vector administration on seizure latency (Figure 18E), time to first seizure (Figure 18F), and survival rate (Figure 18G) in Dravet model mice. "C" refers to non-targeting gRNA control. "WT" refers to wild-type mice for SCN1A. "HET" refers to mice heterozygous for SCN1A. "PV IN" refers to interneurons expressing parvalbumin. "EEG" stands for electroencephalogram. "d" stands for day.

[0051] [Fig. 18E-F]18 shows the results of an experiment testing the effect of the vectors provided herein in vivo in wild-type and Dravet model mice. The vectors were administered via recombinant AAV. The vectors contained a dCas9-VP64 transgene driven by an E2 enhancer. Modulation of SCNA1 expression was measured after vector administration in wild-type mice (FIG. 18C) and Dravet mice (FIG. 18D). All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). The effect of vector administration on seizure latency (FIG. 18E), time to first seizure (FIG. 18F), and survival rate (FIG. 18G) in Dravet model mice is shown. "C" refers to non-targeting gRNA control. "WT" refers to wild-type mice for SCN1A. "HET" refers to mice heterozygous for SCN1A. "PV IN" refers to interneurons expressing parvalbumin. "EEG" refers to electroencephalogram. "d" refers to days. Figure 18 shows the results of an experiment testing the effect of the vectors provided herein in vivo in wild-type and Dravet model mice. The vectors were administered via recombinant AAV. The vectors contained a dCas9-VP64 transgene driven by an E2 enhancer. Modulation of SCNA1 expression was measured after vector administration in wild-type mice (Figure 18C) and Dravet mice (Figure 18D). All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). Figure 18 shows the effect of vector administration on seizure latency (Figure 18E), time to first seizure (Figure 18F), and survival rate (Figure 18G) in Dravet model mice. "C" refers to non-targeting gRNA control. "WT" refers to wild-type mice for SCN1A. "HET" refers to mice heterozygous for SCN1A. "PV IN" refers to interneurons expressing parvalbumin. "EEG" stands for electroencephalogram. "d" stands for day.

[0052] [Figure 18G]18 shows the results of an experiment testing the effect of the vectors provided herein in vivo in wild-type and Dravet model mice. The vectors were administered via recombinant AAV. The vectors contained a dCas9-VP64 transgene driven by an E2 enhancer. Modulation of SCNA1 expression was measured after vector administration in wild-type mice (FIG. 18C) and Dravet mice (FIG. 18D). All RNA level values ​​were normalized to the level of SCN1A RNA obtained in control conditions (i.e., non-targeting control gRNA). The effect of vector administration on seizure latency (FIG. 18E), time to first seizure (FIG. 18F), and survival rate (FIG. 18G) in Dravet model mice is shown. "C" refers to non-targeting gRNA control. "WT" refers to wild-type mice for SCN1A. "HET" refers to mice heterozygous for SCN1A. "PV IN" refers to interneurons expressing parvalbumin. "EEG" refers to electroencephalogram. "d" refers to the day. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0053] Detailed Description The present disclosure provides compositions and methods for increasing expression of the sodium voltage-dependent channel alpha subunit 1 (SCN1A) gene specifically in SCN1A-expressing cells (e.g., SCN1A-expressing cells in the brain). Such cells include parvalbumin (PV)-expressing interneurons. Heterozygous loss-of-function mutations in the SCN1A gene, which encodes the alpha subunit of the sodium channel Nav1.1, result in haploinsufficiency leading to abnormal function of parvalbumin (PV)-expressing GABAergic interneurons. SCN1A mutations have been linked to Dravet syndrome (DS), a drug-resistant infantile epilepsy associated with seizures, developmental disabilities, and increased mortality. The present disclosure provides vectors that include elements that restrict expression of a transgene encoding a fusion protein to a specific subtype of neurons affected by DS. The fusion protein specifically targets the SCN1A gene and modulates expression of the gene, thereby increasing SCN1A expression in these neurons. The compositions and methods provided herein are useful for normalizing brain function and reducing symptoms associated with DS, including seizures. The therapeutic effect is achieved by selectively restoring normal cellular activity in the brain.

[0054] vector Provided herein is a vector comprising a regulatory element and a transgene element that increases SCN1A expression in SCN1A-expressing cells. The present disclosure provides a vector comprising (a) a transgene polynucleotide sequence encoding a sequence-specific DNA targeting module (DTM) fused to a transactivator, (b) an enhancer polynucleotide sequence that specifically restricts expression of the transgene to SCN1A-expressing cells in the brain, and (c) a promoter polynucleotide sequence. The transgene sequence encodes a fusion protein comprising the SCN1A sequence-specific DTM fused to the transactivator.

[0055] In some embodiments, the SCN1A-expressing cell is a GABAergic interneuron cell. In some embodiments, the SCN1A-expressing cell is a PV-expressing interneuron cell.

[0056] The vectors provided herein comprise a transgene polynucleotide sequence encoding a programmable DTM that targets a genomic sequence or sequences that regulate the SCN1A gene. In some embodiments, the transgene polynucleotide sequence is codon-optimized (e.g., optimized for expression in human cells).

[0057] An exemplary amino acid sequence of the alpha subunit of human Nav1.1 (UniProtKB Identifier No. P35498) is provided as SEQ ID NO: 154. An exemplary nucleotide sequence of the human SCN1A gene is provided as SEQ ID NO: 155.

[0058] In some embodiments, the DTM comprises components derived from or derived from a CRISPR / Cas system. In some embodiments, the DTM comprises a nuclease-deficient CRISPR-associated protein. In some embodiments (e.g., when the DTM comprises a nuclease-deficient CRISPR-associated protein), the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA). In some embodiments, the gRNA targets the SCN1A gene or a sequence that regulates the SCN1A gene. In some embodiments, the gRNA specifically hybridizes to a regulatory region of the SCNA1 gene (e.g., specifically hybridizes under conditions present in the nucleus of the cell). In some embodiments, the gRNA specifically hybridizes to a control region, promoter, enhancer, intron, exon, transcription start site, coding region, or non-coding region of the SCNA1 gene. In some embodiments, the gRNA specifically hybridizes to promoter 1a, promoter 1b, or promoter 1c of the SCNA1 gene. In some embodiments, the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of any of the sequences in Table 1. In some embodiments, the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 160, or 161. In some embodiments, the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 11, 19, 21, or 27. In some embodiments, the polynucleotide sequence encoding the gRNA is operably linked to a promoter (e.g., an RNA polymerase III promoter). In such embodiments, the vector comprises two promoters: (1) a promoter that regulates expression of a transgene polynucleotide sequence, and (2) a promoter that regulates expression of a polynucleotide sequence encoding a gRNA.In some embodiments, the promoter that regulates the expression of the polynucleotide sequence encoding the gRNA is recognized by RNA polymerase III. In some embodiments, the promoter that regulates the expression of the polynucleotide sequence encoding the gRNA is a human U6 promoter.

[0059] In some embodiments, the vector comprises a first polynucleotide sequence encoding a first gRNA and a second polynucleotide sequence encoding a second gRNA. In such embodiments, both the first gRNA and the second gRNA target the SCN1A gene or a sequence that regulates the SCN1A gene.

[0060] In some embodiments, the DTM comprises a nuclease-deficient CRISPR-associated protein (also known as a catalytically inactive CRISPR nuclease). Such modified proteins may be referred to as "dead Cas" or "dCas" proteins. For example, the Cas9 protein can be rendered catalytically inactive by introducing point mutations into each of its two nucleolytic domains. Examples of such mutations include D10A and H840A. These mutations block the nucleolytic activity of Cas9 but do not affect its binding to its target. Thus, dCas proteins can be used to deliver cargo to specific genomic locations even though they lack the ability to cleave or nick target nucleic acid sequences.

[0061] In some embodiments, the DTM is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Csm7, Csm8, Csm9, Csm10, Csm11, Csm12, Csm13, Csm13, Csm14, Csm15, Csm16, Csm17, Csm18, Csm19, Csm20, Csm21, Csm22, Csm23, Csm24, Csm25, Csm26, Csm In some embodiments, the DTM comprises a nuclease-deficient CRISPR-associated protein that is sm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog. In some embodiments, the DTM comprises dCas9. In some embodiments, the dCas9 is Staphylococcus aureus (Sa) dCas9, Streptococcus pyogenes dCas9, or Campylobacter jejuni dCas9. In some embodiments, the dCas9 is derived from an orthologous bacterial species.

[0062] In some embodiments, dCas9 comprises any of the amino acid sequences in Table 9. In some embodiments, dCas9 comprises the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159. In some embodiments, dCas9 comprises an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159. In some embodiments, dCas9 comprises a fragment of the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159, which fragment is a protein that can form a complex with a gRNA and target the SCN1A gene.

[0063] In some embodiments, dCas9 is encoded by a codon-optimized nucleotide sequence (e.g., optimized for expression in human cells). In some embodiments, dCas9 is encoded by any of the nucleotide sequences in Table 4. In some embodiments, dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106. In some embodiments, dCas9 is encoded by a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106. In some embodiments, dCas9 is encoded by a fragment of the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106, which fragment encodes a protein that can form a complex with a gRNA and target the SCN1A gene.

[0064] In some embodiments, the DTM comprises a zinc finger transcription factor or a portion of a zinc finger transcription factor. The zinc finger transcription factor comprises a DNA binding domain that comprises a zinc finger motif. In some embodiments, the DTM comprises a DNA binding domain of a zinc finger transcription factor. In some embodiments, the zinc finger transcription factor is a C2H2 zinc finger transcription factor. The C2H2 zinc finger transcription factor comprises a Cys2His2 zinc finger motif. In some embodiments, the C2H2 zinc finger transcription factor comprises a DNA binding domain of a Zif268 zinc finger transcription factor, or a sequence derived from said DNA binding domain. In some embodiments, the C2H2 zinc finger transcription factor comprises a DNA binding domain of a humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA binding domain. In some embodiments, the zinc finger transcription factor is derived from a vertebrate that is less immunogenic. In some embodiments, the DTM comprises a DNA binding domain of a zinc finger transcription factor (e.g., Zif268), which targets the SCN1A gene. In some embodiments, the DNA binding domain of the zinc finger transcription factor is engineered to target the SCN1A gene. In some embodiments, the DNA binding domain of the zinc finger transcription factor is engineered to target the coordinates of the SCN1A gene provided in Table 2 or Table 3. Examples of zinc finger transcription factors and their use for modulating gene expression are provided in US9,234,016 and US2016 / 0039893.

[0065] In some embodiments, the DTM comprises a Transcription Activator-Like Protein Effector (TALE) protein or a portion of a TALE protein. A TALE protein comprises a central domain that contributes to DNA binding, a nuclear localization signal, and a domain that activates target gene transcription. In some embodiments, the DTM comprises a DNA binding domain of a TALE protein. In some embodiments, the DTM comprises a DNA binding domain of a TALE protein that targets the SCN1A gene. In some embodiments, the DNA binding domain of a TALE protein is engineered to target the SCN1A gene. In some embodiments, the DNA binding domain of a TALE protein is engineered to target the coordinates of the SCN1A gene provided in Table 2 or Table 3. Examples of TALE proteins and their uses for regulating gene expression are provided in US8,586,526, US9,394,545, and US9,522,936.

[0066] The vectors provided herein encode fusion proteins in which the DTMs described above are functionally fused to a transactivator. In some embodiments, the transactivator is VP16, VP32, VP48, VP64, VPR, MS2-SAM system, p65, Rta, CITE-D domain of p300, or SunTag. Exemplary SunTag constructs are provided in US2017 / 0219596. In some embodiments, the transactivator is encoded by any of the nucleotide sequences in Table 5. In some embodiments, the transactivator domain is encoded by the nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113. In some embodiments, the transactivator is encoded by a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO:107, 108, 109, 110, 111, 112, or 113.

[0067] In some embodiments, the vectors provided herein encode a nuclear localization signal (NLS) adjacent to the DTM in the fusion protein. In some embodiments, the NLS is a simian virus 40 (SV40) NLS. In some embodiments, the NLS is a nucleoplasmin NLS. In some embodiments, the vector encodes an SV40 NLS and a nucleoplasmin NLS adjacent to the DTM in a coding frame with the fusion protein.

[0068] The vectors provided herein comprise a promoter sequence that regulates the expression of a transgene. In some embodiments, the promoter is a minimal promoter. In some embodiments, the promoter is recognized by RNA polymerase II. In some embodiments, the promoter is a human U6 (hU6) promoter, a mouse U6 promoter, or a human H1 promoter. In some embodiments, the promoter is an E2 promoter.

[0069] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the promoter is a chicken beta actin (CBA) promoter, a GUSB240 promoter, a GUSB379 promoter, a HSVTK promoter, a CMV promoter, an SV40 early promoter, an SV40 late promoter, a metallothionein promoter, a mouse mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, an EF-1 alpha promoter, a dihydrofolate reductase (DHFR) promoter, or a phosphoglycerol kinase (PGK) promoter.

[0070] The vectors provided herein comprise an enhancer polynucleotide sequence that specifically restricts expression of a transgene to SCN1A-expressing cells in the brain (e.g., PV-expressing interneuron cells). In some embodiments, the enhancer polynucleotide sequence comprises any of the nucleotide sequences in Table 2 or Table 3. In some embodiments, the enhancer polynucleotide sequence comprises any one of SEQ ID NOs: 33-102. In some embodiments, the enhancer polynucleotide sequence comprises a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to any one of SEQ ID NOs: 33-102. In some embodiments, the enhancer polynucleotide sequence comprises a nucleotide sequence of SEQ ID NO: 69 or 34. In some embodiments, the enhancer polynucleotide sequence comprises a nucleotide sequence that is at least about 90%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 69 or 34. Exemplary enhancer sequences that restrict expression of a transgene to SCN1A-expressing cells are disclosed in WO2020 / 163102, the contents of which are incorporated by reference in their entirety for all purposes, including the enhancer sequences disclosed therein.

[0071] In some embodiments, the vectors provided herein comprise, in 5'-3' order, (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, and (c) a transgene polynucleotide sequence. In some embodiments, the vectors provided herein comprise, in 5'-3' order, (a) an enhancer polynucleotide sequence, (b) a promoter polynucleotide sequence, and (c) a transgene polynucleotide sequence. The position and orientation of the enhancer polynucleotide sequence can be varied.

[0072] Provided herein are vectors encoding one of the transgenes in Table 6 (NLS-SadCas9-NLS-VP64, NLS-miniSadCas9v2-NLS-VP64, NLS-miniSadCas9v4-NLS-VP64, or NLS-miniSadCas9v5-NLS-VP64).

[0073] Provided herein is a vector comprising a transgene polynucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 114. Further provided herein is a vector comprising a transgene polynucleotide sequence that encodes an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 114.

[0074] Provided herein are vectors comprising a transgene polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 114, 118, 122, or 126. Further provided herein are vectors comprising a transgene polynucleotide sequence encoding an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 114, 118, 122, or 126.

[0075] Provided herein is a vector comprising a transgene polynucleotide sequence that comprises or consists of the nucleotide sequence of SEQ ID NO: 115, 116, or 117. Further provided herein is a vector comprising a transgene polynucleotide sequence that comprises or consists of a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 115, 116, or 117.

[0076] Provided herein is a vector comprising a transgene polynucleotide sequence that comprises or consists of the nucleotide sequence of SEQ ID NO: 115, 116, 117, 119, 120, 121, 123, 124, 125, 127, 128, or 129. Further provided herein is a vector comprising a transgene polynucleotide sequence that comprises or consists of a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 115, 116, 117, 119, 120, 121, 123, 124, 125, 127, 128, or 129.

[0077] In some embodiments, the vectors provided herein further comprise an artificial intron. In some embodiments, the vectors provided herein further comprise a chimeric intron.

[0078] In some embodiments, the vectors provided herein further comprise or encode a woodchuck hepatitis virus post-transcriptional element (WPRE). See, e.g., Wang and Verma, Proc. Natl. Acad. Sci., USA, 96:3906-3910 (1999). In some embodiments, the vectors comprise or encode a Hepatitis B virus post-transcriptional regulatory element (HBVPRE) and / or an RNA transport element (RTE). In some embodiments, the WPRE or HBVPRE sequence is any of the WPRE or HBVPRE sequences disclosed in US 6,136,597 or US 6,287,814. In some embodiments, the vectors provided herein further comprise or encode a WPRE3 or wsl3 regulatory element. In some embodiments, the WPRE3 is GATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTT (SEQ ID NO: 135).

[0079] In some embodiments, the vectors provided herein further comprise or encode a polyadenylation (polyA) signal sequence. As used herein, "polyadenylation signal sequence" refers to a DNA sequence that, when transcribed, regulates the addition of a polyA tail to an mRNA transcript. In some embodiments, the polyA signal sequence is an SV40, human, bovine, or rabbit polyA signal sequence. In some embodiments, the polyA signal sequence is an SV40 polyA signal sequence. In some embodiments, the polyA signal sequence is a β-globulin polyA signal sequence. In some embodiments, the polyA signal sequence is a human growth hormone polyA signal sequence or a bovine growth hormone polyA signal sequence. In some embodiments, the SV40 polyA signal sequence is AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC (SEQ ID NO: 136).

[0080] In some embodiments, the vectors provided herein further comprise or encode a Kozak sequence (e.g., a DNA sequence that is transcribed into an RNA Kozak sequence). In some embodiments, the vector comprises a Kozak sequence upstream of the transgene. In some embodiments, the Kozak sequence is encoded by GCCACC (SEQ ID NO: 130). In some embodiments, the Kozak sequence (e.g., an RNA Kozak sequence) comprises or consists of ACCAUGG (SEQ ID NO: 131), GCCGCCACCAUGG (SEQ ID NO: 132), CCACCAUG (SEQ ID NO: 133), or CCACCAUGG (SEQ ID NO: 134).

[0081] In some embodiments, the vectors provided herein further comprise a TATA transcriptional regulatory activation site (see, e.g., Francois et al., (2005) J. Virol. 79(17):11082-11094).

[0082] In some embodiments, the vectors provided herein include (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, (c) a transgene polynucleotide sequence, (d) an artificial intron, and (e) a WPRE. In some embodiments, the vectors provided herein include (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, (c) a transgene polynucleotide sequence, (d) a WPRE, and (e) a polyA signal sequence. In some embodiments, the vectors provided herein include (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, (c) a transgene polynucleotide sequence, (d) an artificial intron, and (e) a polyA signal sequence. In some embodiments, the vectors provided herein include (a) a promoter polynucleotide sequence, (b) an enhancer polynucleotide sequence, (c) a transgene polynucleotide sequence, (d) an artificial intron, and (e) a WPRE, and (f) a polyA signal sequence.

[0083] In some embodiments, the vectors provided herein are plasmids or viral expression cassettes that contain additional nucleic acid sequences. In some embodiments, the vectors provided herein can be used to generate recombinant viral particles to function as viral vectors for gene delivery. In some embodiments, the vectors provided herein are formulated for use via non-viral delivery systems. Further provided herein are plasmids that contain any of the vector nucleic acid sequences disclosed herein.

[0084] In some embodiments, the vectors provided herein do not integrate, hi some embodiments, the vectors provided herein do not replicate.

[0085] In some embodiments, the vector provided herein is a viral vector. In some embodiments, the viral vector is an adeno-associated viral (AAV) vector. In some embodiments, the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of a promoter polynucleotide sequence and a second AAV ITR located downstream of a transgene polynucleotide sequence. The ITRs are sequences that mediate AAV provirus integration and packaging of AAV DNA into virions. In some embodiments, the AAV vector comprises a first AAV ITR and a second AAV ITR that flank a polynucleotide sequence that is packaged into a recombinant AAV (rAAV) particle. In some embodiments, the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR. Maps of exemplary AAV expression cassettes comprising vectors provided herein that are incorporated into plasmids are shown in Figures 1-17. The AAV expression cassettes and associated plasmids provided herein can be used to produce rAAV particles.

[0086] In some embodiments, the AAV vectors provided herein are self-complementary. In some embodiments, the AAV vectors provided herein are single-stranded.

[0087] In some embodiments, the vectors provided herein comprise, in the order of 5'-3', (a) a 5'ITR, (b) an RNA polymerase III promoter, (c) a polynucleotide sequence encoding a gRNA, (d) an enhancer polynucleotide sequence, (e) a minimal promoter, (f) an artificial intron, (g) a transgene polynucleotide sequence, (h) a WPRE, (i) a polyadenylation signal sequence, and (j) a 3'ITR. In some embodiments, the vectors provided herein comprise, in the order of 5'-3', (a) a 5'ITR, (b) an RNA polymerase III promoter, (c) a polynucleotide sequence encoding a gRNA, (d) a minimal promoter, (e) an enhancer polynucleotide sequence, (f) an artificial intron, (g) a transgene polynucleotide sequence, (h) a WPRE, (i) a polyadenylation signal sequence, and (j) a 3'ITR. The position and orientation of the enhancer polynucleotide sequence can be varied.

[0088] Examples of vectors that are AAV expression cassettes and their sequences are provided in Table 7. In some embodiments, these sequences include, in 5'-3' order, (a) a 5'AAV2 ITR, (b) an hU6 promoter, (c) a polynucleotide sequence encoding a gRNA, (d) an enhancer polynucleotide sequence, (e) a beta globin promoter, (f) a transgene polynucleotide sequence, and (h) a 3'AAV2 ITR. In some embodiments, these sequences further include any combination of (1) an artificial intron, (2) a WPRE, and (3) a polyadenylation signal sequence (e.g., an SV40 polyadenylation signal sequence). In some embodiments, these sequences include, in 5'-3' order: (a) the 5' AAV2 ITR; (b) the hU6 promoter; (c) a polynucleotide sequence encoding a gRNA; (d) an enhancer polynucleotide sequence; (e) a beta globin promoter; (f) an artificial intron; (g) an introduced polynucleotide sequence; (h) a WPRE (WPRE3); (i) an SV40 polyadenylation signal sequence; and (j) a 3' AAV2 ITR.

[0089] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153. In some embodiments, the vector comprises a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153.

[0090] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153. In some embodiments, the vector comprises a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153.

[0091] Further provided herein is a viral particle (also referred to as virion) that comprises any of the vectors, expression cassettes, or nucleic acid molecules provided herein.In some embodiments, the viral particle is a rAAV particle.In some embodiments, the rAAV particle is an AAV9 serotype particle.In some embodiments, the rAAV particle is an AAV-PHP.eB, AAV-DJ, or AAV2 serotype particle. In some embodiments, the rAAV is selected from the group consisting of AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, porcine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particles.

[0092] Provided herein is a population of viral particles comprising a plurality of the viral particles disclosed herein. Provided herein is a population of rAAV particles comprising a plurality of the rAAV particles disclosed herein.

[0093] In some embodiments, the vectors provided herein are suitable for delivery via a non-viral delivery system. In some embodiments, the vectors provided herein are formulated for delivery via a non-viral delivery system. In some embodiments, the non-viral delivery system is a lipid nanoparticle or an exosome. In some embodiments, the non-viral system for gene delivery may be lipid-based, polymer-based, or other nanomaterial-based. Cationic lipids or cationic polymers can be complexed with nucleic acid molecules to produce synthetic vehicles for gene delivery.

[0094] Provided herein is a cell comprising any of the vectors or viral particles disclosed herein. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a HEK293 cell. In some embodiments, the cell is an insect cell. In some embodiments, the insect cell is a Spodoptera frugiperda cell (e.g., Sf9 or ExpiSf9™ cell line). The Sf9 insect cell line (Thermo Fisher Scientific, Waltham, MA) is a clonal isolate derived from the parent S. frugiperda cell line IPLB-Sf-21-AE. ExpiSf9™ cells (Thermo Fisher Scientific, Waltham, MA) are non-engineered derivatives of Sf9 insect cells adapted to high density suspension growth.

[0095] Pharmaceutical Compositions Provided herein is a pharmaceutical composition comprising any of the vectors, viral particles, nucleic acid molecules, and populations of viral particles disclosed herein and a pharmaceutically acceptable carrier, vehicle, or diluent. "Pharmaceutically acceptable" refers to a substance that is not toxic or otherwise undesirable, i.e., the substance can be administered to a subject without causing any undesirable biological effects. Generally, a pharmaceutically acceptable substance has one or more advantages that outweigh any undesirable biological effects that the substance may have. Undesirable biological effects may include, for example, excessive toxicity, irritation, allergic response, and other problems and complications.

[0096] For injections, the carrier is typically a liquid. For other methods of administration, the carrier can be either solid or liquid.

[0097] In some embodiments, pharmaceutical compositions may include other medicinal agents, pharmaceutical agents, stabilizers, buffers, adjuvants, and / or diluents.

[0098] In some embodiments, the pharmaceutical composition comprises at least one pharma- ceutically acceptable carrier, excipient, and / or vehicle, such as a solvent, buffer, solution, dispersion medium, coating, antibacterial agent, antifungal agent, isotonicity agent, and absorption delaying agent. In some embodiments, the pharma- ceutically acceptable carrier, excipient, and / or vehicle comprises saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, or a combination thereof. In some embodiments, the pharma- ceutically acceptable carrier, excipient, and / or vehicle comprises phosphate buffered saline, sterile saline, lactose, sucrose, calcium phosphate, dextran, agar, pectin, peanut oil, sesame oil, pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), or a suitable mixture thereof. In some embodiments, the compositions disclosed herein further comprise an emulsifying agent or wetting agent, or a pH buffering agent. Such species may be present in small amounts (eg, less than 10% by weight of the composition, such as less than 5% by weight of the composition, 2% by weight of the composition, 1% by weight of the composition, or even less).

[0099] In some embodiments, the pharmaceutical composition further comprises one or more other pharmaceutical ingredients, such as one or more preservatives or chemical stabilizers. Examples of preservatives and chemical stabilizers include, but are not limited to, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, parachlorophenol, and albumin. In some embodiments, the compositions disclosed herein further comprise antibacterial and / or antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal; isotonic agents, such as sugars and sodium chloride; and / or agents that delay absorption, such as aluminum monostearate and gelatin.

[0100] In some embodiments, the pharmaceutical composition is in the form of an injectable solution or dispersion, for example, an aqueous solution or dispersion. In some embodiments, the pharmaceutical composition is a sterile powder for extemporaneous preparation of a sterile injectable solution or dispersion. Dispersions may be prepared in water, glycerol, liquid polyethylene glycol, oil, or any combination thereof. Delivery vehicles, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., may be used for the introduction of the pharmaceutical composition provided herein.

[0101] In some embodiments, the pharmaceutical compositions are suitable for or formulated for intraventricular, intrathecal, intracarotid, or intraparenchymal injection.

[0102] Methods for producing rAAV particles Provided herein are methods for producing rAAV particles using any of the vectors, AAV expression cassettes, nucleic acid molecules, and cells disclosed herein.

[0103] Provided herein are methods for producing rAAV particles, comprising: (i) culturing cells containing a vector or AAV expression cassette disclosed herein under conditions that allow packaging of the rAAV particles; and (ii) harvesting the cultured host cells or culture medium for harvesting the rAAV particles.

[0104] In some embodiments, a method for producing rAAV particles includes providing a cell with (a) a vector (i.e., a nucleic acid template comprising an AAV expression cassette) that includes two AAV ITRs located 5' and 3' of a polynucleotide sequence desired to be packaged into an rAAV particle, and (b) sufficient AAV sequences for replication and encapsidation of the nucleic acid template into an AAV protein capsid (e.g., AAV rep sequences, also referred to as "helper functions," and AAV cap sequences that encode the AAV capsid subunits). Typically, the AAV rep and cap sequences are not adjacent to the AAV ITRs to prevent rescue and / or packaging of these sequences.

[0105] The vector (nucleic acid template), rep sequence, cap sequence, and any other helper functions necessary to produce the rAAV particles disclosed herein may be delivered to the packaging host cell using any suitable genetic element. Further details regarding methods for preparing rAAV particles are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY; Fisher et al., J. Virol., 70:520-532 (1993); and US 5,478,745.

[0106] The nucleic acid template and AAV rep and cap sequences are provided under conditions such that a viral vector comprising the nucleic acid template packaged within an AAV protein capsid is produced within the cell. The method may further comprise a step of harvesting the viral vector from the cell. The viral vector may be harvested from the culture medium and / or by lysing the cell.

[0107] The cell can be a cell that is permissive for AAV virus replication. Any suitable cell known in the art can be used. In some embodiments, the cell is a mammalian cell (e.g., HEK293 cell). In some embodiments, the cell can be a trans-complementing packaging cell line that provides a replication-deficient helper virus, such as a function that is missing from HEK293 cell or other E1a trans-complementing cell. The helper sequence can be embedded in the chromosome or maintained as a stable extrachromosomal element.

[0108] In some embodiments, rAAV particles are produced using a triple transfection method as described in US 6,001,650. In some embodiments, rAAV is produced by transfecting host cells with AAV vectors (i.e., AAV expression cassettes) packaged into rAAV particles, AAV helper function vectors, and accessory function vectors. AAV helper function vectors encode "AAV helper function" sequences (i.e., rep and cap) that function in trans for productive AAV replication and encapsidation. Non-limiting examples of AAV helper function vectors include pHLP19 and pRep6cap6 vectors, which are described in US 6,001,650 and US 6,156,303, respectively. Accessory function vectors encode nucleotide sequences for non-AAV derived viral and / or cellular functions (i.e., "accessory functions") on which AAV depends for replication. Accessory functions include functions required for AAV replication, including, but not limited to, those involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of the cap expression product, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (e.g., other than herpes simplex virus type 1), and vaccinia virus.

[0109] In some embodiments, rAAV is produced using a recombinant baculovirus vector. Production of rAAV using a baculovirus vector is described, for example, in Urabe et al. (2002) Hum Gene Ther 13(16):1935-1943, Smith et al. (2009) Mol Ther 17(11):1888-1896, US8,945,918, US9,879,282, and US2018 / 0371495. In some embodiments, the baculovirus vector genome is derived from Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV), Bombyx mori nuclear polyhedrosis virus (BmNPV), Helicoverpa armigera (HearNPV), or Spodoptera exigua MNPV. Baculovirus vectors are used to produce recombinant AAV in insect cells (e.g., Spodoptera frugiperda cells). In some embodiments, Sf9 or ExpiSf9™ Spodoptera frugiperda cell lines are used to produce rAAV. In some embodiments, the methods of the disclosure include co-infecting insect cells with a population of recombinant baculoviruses (rBVs) to produce the rAAVs disclosed herein. At least two populations of rBVs may be used in the methods of the disclosure. Methods for generating recombinant baculoviruses are known in the art (see, e.g., Bac-to-Bac® Baculovirus Expression System (Thermo Fisher Scientific, Waltham, Mass.)).

[0110] In some embodiments, the rAAV particles produced by the methods provided herein comprise AAV9 capsid proteins. In some embodiments, the rAAV particles produced by the methods provided herein comprise AAV-PHP.eB, AAV-DJ, or AAV2 capsid proteins. In some embodiments, the rAAV particles produced by the methods provided herein are selected from the group consisting of AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, porcine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN capsid protein.

[0111] How to use vectors Provided herein is a method for increasing the expression of wild type (or normal functioning) SCN1A in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein.The subject has a heterozygous loss-of-function mutation in SCN1A gene.The loss-of-function mutation can be a nonsense or missense mutation, or a deletion.

[0112] Provided herein is a method for increasing the level of SCN1A expression in SCN1A-expressing cells in the brain, comprising contacting the cells with a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein.In some embodiments, the SCN1A-expressing cells comprise a loss-of-function mutation in one copy of the SCN1A gene.In some embodiments, the SCN1A-expressing cells are GABAergic interneuron cells.In some embodiments, the GABAergic interneuron cells express parvalbumin (PV).

[0113] In some embodiments, the vectors provided herein increase SCN1A mRNA expression. The level of mRNA expression may be measured by Northern blot, nuclease protection assay (NPA), in situ hybridization, or reverse transcription polymerase chain reaction (RT-PCR).

[0114] In some embodiments, the vectors provided herein increase SCN1A protein expression (i.e., expression of the alpha subunit of the sodium channel Nav1.1). The level of protein expression may be measured by Western blot or immunohistochemistry.

[0115] Provided herein is a method for treating Dravet Syndrome (DS) in a subject having or suspected of having DS, the method comprising administering to the subject a therapeutically effective amount of a vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein.

[0116] Provided herein are methods for treating or reducing the risk, severity, frequency, or length of DS in a subject having or at risk of having DS, comprising administering to the subject a therapeutically effective amount of a vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein.

[0117] Provided herein is a method for treating or reducing the risk, severity, frequency, or duration of epilepsy and / or seizures in a subject having or at risk of having epilepsy, seizures, or DS, comprising administering to the subject a therapeutically effective amount of a vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein.

[0118] Provided herein is a method for preventing or reducing the risk of sudden death in epilepsy (SUDEP) in a subject having or at risk of having epilepsy, seizures, or DS, comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein. SUDEP can be defined as the death of an epilepsy patient that is not due to trauma, drowning, status epilepticus, or other known cause, but often has evidence of associated seizures.

[0119] In any of the methods provided herein, the vector may be an rAAV particle comprising the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153.

[0120] In any of the methods provided herein, the vector may be an rAAV particle that comprises the nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153.

[0121] In some embodiments, the rAAV comprises an AAV9 capsid protein. In some embodiments, the rAAV particle comprises an AAV-PHP.eB, AAV-DJ, or AAV2 capsid protein. In some embodiments, the rAAV particle comprises an AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, porcine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN capsid protein.

[0122] In some embodiments, the subject is a human. In some embodiments, the subject is under 2 years of age. In some embodiments, the subject is between about 2 years of age and about 18 years of age. In some embodiments, the subject is over 18 years of age.

[0123] In some embodiments, the vector, viral particle, population of viral particles, or pharmaceutical composition is administered to a subject via intraventricular, intrathecal, intracarotid, or intraparenchymal injection.

[0124] In some embodiments, the vector, viral particle, population of viral particles, or pharmaceutical composition is administered to a subject in a single dose, hi some embodiments, the single dose comprises about 10E+9 to about 10E+14 viral particles.

[0125] Further provided herein is a vector, a viral particle, a population of viral particles, or a pharmaceutical composition disclosed herein for use as a medicament.

[0126] In some embodiments, the efficacy of the vector, viral particle, population of viral particles, or pharmaceutical composition disclosed herein may be tested in an animal model (e.g., a mouse model) of DS. In some embodiments, the mouse model is Scn1a-KO:129S-Scn1atm1Kea / Mmjax, Scn1a-R1407X:Scn1aKIdneo; Scn1a-R613X:129S1 / SvImJ-Scn1aem1Dsf / J; or Scn1a-A1783V:B6(Cg)-Scn1atm1.1Dsf / J.

[0127] The vectors, viral particles, populations of viral particles, or pharmaceutical compositions disclosed herein may be tested in the following experiments: - in vitro demonstration of the level of expression of DTM at the RNA and protein level; - In vitro demonstration of upregulation of the SCN1A gene for specific gRNA sequences at the RNA and protein levels; - in vivo demonstration of the specificity of transgene expression in targeted cell populations in wild-type mouse brain using immunofluorescence; - In vivo demonstration of upregulation of SCN1A in wild-type mouse brain at the RNA and protein levels; -In vivo demonstration of upregulation of SCN1A in Dravet mouse brain at the RNA and protein levels; - demonstrating increased survival of treated Dravet mice versus untreated Dravet mice; and - Demonstration of reduced seizures in treated versus untreated Dravet mice.

[0128] definition Unless otherwise stated, the terms used herein have the definitions as commonly used in the art. Some terms are defined below, and additional definitions can be found in the remainder of the detailed description.

[0129] The term "a" or "an" refers to one or more of that entity, i.e., it can refer to multiple referents. Thus, the terms "a," "an," "one or more," and "at least one" are used interchangeably herein. In addition, reference to an "element" by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that only one of the element is present.

[0130] Unless otherwise stated or clear from the context, the term "about" means within 10% above or below the reported numerical value (except when such number is greater than 100% or less than 0% of possible values). Unless otherwise indicated, when used in conjunction with a range or series of values, the term "about" applies to the endpoints of the range or each of the values ​​recited in the series. As used in this application, the terms "about" and "approximately" are used as equivalents.

[0131] As used herein, the term "gRNA molecule" or "gRNA" refers to a guide RNA that can target a CRISPR nuclease or a nuclease-deficient CRISPR-associated protein to a target nucleic acid. Depending on the context, the term "gRNA molecule" refers to a guide ribonucleic acid or a nucleic acid that encodes a gRNA.

[0132] As used herein, the term "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are invariant over a window of alignment of residues, e.g., nucleotides or amino acids. The "fractional identity" of an aligned segment of a test sequence and a reference sequence is the number of identical residues shared by the two aligned sequences divided by the total number of residues in the reference sequence segment, i.e., the entire reference sequence or a smaller defined portion of the reference sequence. The "percent identity" is the fractional identity multiplied by 100. Percent identity can be calculated using the alignment program Clustal Omega, available at ebi.ac.uk / Tools / msa / clustalo, using default parameters. See Sievers et al., "Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega" (2011 October 11) Molecular Systems Biology 7:539. For the purpose of calculating identity to sequences, extensions such as tags are not included.

[0133] As used herein, a regulatory sequence (e.g., a promoter) is considered to be "operably linked" when it is in a functional position and orientation with respect to the nucleic acid sequence it regulates to control transcription initiation and / or expression of that sequence.

[0134] As used herein, the term "self-complementary" when referring to an AAV vector refers to an AAV vector that contains nucleic acid (i.e., DNA) that forms dimeric inverted repeat molecules that spontaneously anneal, resulting in faster and more robust transgene expression compared to conventional single-stranded (ss) AAV genomes. See, e.g., McCarty, Molecular Therapy 16(10):1648-1656 (2008). Unlike conventional ssAAV, self-complementary AAV (scAAV) can bypass second strand synthesis, the rate-limiting step of gene expression. In addition, double-stranded scAAV is less susceptible to DNA degradation after viral transduction, thereby increasing the copy number of stable episomes.

[0135] As used herein, the terms "treat," "treating," or "treatment of" (and grammatical variations thereof) mean that the severity of a subject's condition is reduced, at least partially ameliorated, or stabilized, and / or some relief, alleviation, reduction, or stabilization of at least one clinical symptom is achieved, and / or the progression of a disease or disorder is slowed.

[0136] As used herein, the terms "prevent", "preventing", and "prevention" (and grammatical variations thereof) refer to the prevention and / or delay of onset of disease, disorder, and / or clinical symptom(s) in a subject, and / or the reduction in the severity of onset of disease, disorder, and / or clinical symptom(s) compared to that which would occur in the absence of the compositions and / or methods described herein. Prevention may be complete, e.g., the complete absence of disease, disorder, and / or clinical symptom(s). Prevention may also be partial, such that the onset of disease, disorder, and / or clinical symptom(s) in a subject, and / or the severity of onset is less than that which would occur in the absence of the compositions and / or methods described herein.

[0137] In some embodiments, the nucleic acid sequences provided herein are nucleic acid sense strands (e.g., 5' to 3' strands) or plus (+) strands in the context of a viral sequence. In some embodiments, the nucleic acid sequences are nucleic acid antisense strands (e.g., 3' to 5' strands) or minus (-) strands in the context of a viral sequence.

[0138] As used herein, a "therapeutically effective amount" is an amount of a vector, viral particle, population of viral particles, or pharmaceutical composition provided herein that is effective to treat a disease or disorder or ameliorate a sign or symptom thereof in a subject. A "therapeutically effective amount" may vary depending on, for example, the disease and / or symptoms of the disease, the severity of the disease and / or symptoms of the disease or disorder, the age, weight, and / or health of the patient being treated, and the judgment of the prescribing physician.

[0139] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes. However, the mention of any reference, article, publication, patent, patent publication, or patent application cited herein is not, and should not be considered as, an admission or any suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world. [Table 1] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

Table 4-6

Table 4-7

Table 5-1

Table 5-2

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

Table 6-6

Table 6-7

Table 6-8

Table 6-9

Table 6-10

Table 6-11

Table 6-12

Table 6-13

Table 6-14

Table 6-15

Table 6-16

Table 6-17

Table 6-18

Table 7-1

Table 7-2

Table 7-3

Table 7-4

Table 7-5

Table 7-6

Table 7-7

Table 7-8

Table 7-9

Table 7-10

Table 7-11

Table 7-12

Table 7-13

Table 7-14

Table 7-15

Table 7-16

Table 7-17

Table 7-18

Table 7-19

Table 7-20

Table 7-21

Table 7-22

Table 7-23

Table 7-24

Table 7-25

Table 7-26

Table 7-27

Table 7-28

Table 7-29

Table 7-30

Table 7-31

Table 7-32

Table 7-33

Table 7-34

Table 8-1

Table 8-2

Table 8-3

Table 8-4

Table 8-5

Table 8-6

Table 9-1

Table 9-2

Table 9-3

[0140] The present disclosure will be further clarified by the following examples, which are intended to be purely illustrative of the disclosure and not limiting in any way.

[0141] example Example 1. In vitro regulation of SCNA1 expression in cell lines The vectors provided herein were tested for their ability to normalize SCN1A expression levels in relevant cells in vitro.

[0142] Kelly cells (human neuroblastoma cell line) were lipotransfected with a plasmid containing the indicated gRNA and dCas9-VP64 transgene (encoding SEQ ID NO:114) driven by an E2 enhancer (SEQ ID NO:34). After 48 hours of incubation, RNA extraction and cDNA synthesis were performed, followed by qPCR using SCN1A-specific primers. Values ​​were normalized to the levels of SCN1A obtained in control conditions (i.e., non-targeting control gRNA). Error bars represent standard deviation derived from at least four biological replicates.

[0143] As shown in Figure 18A, the top four best human gRNAs used in vectors containing E2 driving dCas9-VP64 upregulated SCN1A expression in Kelly cells in vitro. Non-targeting gRNAs were used as controls. The human gRNAs used were hG-pA11 (SEQ ID NO: 11), hG-pB6 (SEQ ID NO: 19), hG-E1 (SEQ ID NO: 21), and hG-E7 (SEQ ID NO: 27).

[0144] Mouse Neuro2A (N2A) was lipotransfected with a plasmid containing the indicated gRNA and dCas9-VP64 transgene driven by an E2 enhancer (SEQ ID NO: 34). After 48 h of incubation, RNA extraction and cDNA synthesis were performed, followed by qPCR using SCN1A-specific primers. Values ​​were normalized to the levels of SCN1A obtained in control conditions (i.e., non-targeting control gRNA). Error bars represent standard deviation derived from at least two biological replicates.

[0145] As shown in Figure 18B, the top two best gRNAs (G1 (SEQ ID NO: 160) and G2 (SEQ ID NO: 161)) used in vectors containing E2 driving dCas9-VP64 upregulated SCN1A expression in N2A cells in vitro. A non-targeting gRNA was used as a control (C).

[0146] Example 2. In vivo regulation of SCNA1 expression in wild-type and Dravet mice Wild-type (WT) mouse pups were treated via intracerebroventricular (ICV) injection with AAV9 (containing an AAV expression cassette of SEQ ID NO: 141) driving expression of the dCas9-VP64 transgene under the control of the E2 enhancer in addition to the indicated guide RNA. After 4 weeks of incubation, RNA extraction and cDNA synthesis were performed from cortical tissue, followed by qPCR using SCN1A-specific primers. Values ​​were normalized to the levels of SCN1A obtained in control conditions (i.e., non-targeting control gRNA). Error bars represent standard deviation derived from at least two biological replicates.

[0147] As shown in Figure 18C, the top two best performing gRNAs (G1 (SEQ ID NO: 160) and G2 (SEQ ID NO: 161)) used in vectors containing E2 driving dCas9-VP64 upregulated the expression levels of SCN1A in the cortex of WT mice above WT levels. A non-targeting gRNA was used as a control (C).

[0148] Dravet mouse pups (Scn1atm1Kea Dravet mouse model (Miller et al., (2014) Genes, Brain and Behavior, 13:163-172) was treated via ICV injection with AAV (containing AAV expression cassette of SEQ ID NO: 141) driving expression of dCas9-VP64 transgene under the control of E2 enhancer in addition to the indicated guide RNA. Animals were genotyped (WT: wild type for SCN1A, or HET: heterozygous for SCN1A) by PCR. After 4 weeks of incubation, mouse cortices were extracted and subjected to mononuclear isolation (a total of about 8,000 cells, including about 200 parvalbumin-expressing interneurons), library synthesis, and sequencing. SCN1A in a subset of parvalbumin-expressing cells was extracted across conditions, and expression level values ​​were normalized to the control condition (i.e., using a non-targeting control gRNA).

[0149] As shown in FIG. 18D, the top two best performing gRNAs (G1 (SEQ ID NO: 160) and G2 (SEQ ID NO: 161)) used in vectors containing E2 driving dCas9-VP64 normalized the levels of SCN1A in parvalbumin-expressing cells of Dravet mice above baseline levels of heterozygous expression to near WT levels. A non-targeting gRNA was used as a control (C). Thus, administration of the vector resulted in normalization of SCN1A gene expression in a mouse model of Dravet syndrome.

[0150] Example 3. Effects on seizure and survival phenotypes in the Dravet model mouse Dravet mouse pups (Scn1at m1KeaDravet mouse model) was treated via ICV injection with AAV9 (containing the AAV expression cassette of SEQ ID NO: 141) driving expression of the dCas9-VP64 transgene under the control of the E2 enhancer, in addition to the indicated guide RNA (G2, SEQ ID NO: 161). The genotype of the animals (WT: wild type for SCN1A, or HET: heterozygous for SCN1A) was defined by PCR. Animal survival was monitored during the experimental period and after 4 weeks of incubation. Electroencephalogram (EEG) activity was continuously monitored for a period of 10 days. Each experimental group included at least 3 animals.

[0151] Injection of AAV vectors into Dravet mice, followed by EEG monitoring of cortical activity, resulted in an improvement in the seizure phenotype as measured by seizure latency (FIG. 18E) and time to first seizure (FIG. 18F). Treated mice also showed increased survival (78% compared to a baseline survival rate of 55% in untreated control animals in this cohort (FIG. 18G)). Thus, administration of the vector resulted in an improvement in the seizure and survival phenotype in a mouse model of Dravet syndrome.

[0152] Numbered embodiments Without limiting the scope of the appended claims, the present disclosure describes the following numbered embodiments.

[0153] Embodiment 1. A vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA targeting module (DTM) fused to a transactivator; (b) an enhancer polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-dependent channel alpha subunit 1 (SCN1A)-expressing cells in the brain; and (c) a promoter polynucleotide sequence.

[0154] Embodiment 2. The vector of embodiment 1, wherein the SCN1A-expressing cell is a GABAergic interneuron cell.

[0155] Embodiment 3. The vector of embodiment 1, wherein the SCN1A-expressing cell is a parvalbumin (PV)-expressing interneuron.

[0156] Embodiment 4. The vector of any one of embodiments 1 to 3, wherein the DTM comprises a nuclease-deficient CRISPR-associated protein.

[0157] Embodiment 5. The vector of embodiment 4, wherein the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA).

[0158] Embodiment 6. The vector of embodiment 5, wherein the gRNA targets the SCN1A gene.

[0159] Embodiment 7. The vector of embodiment 5 or 6, wherein the gRNA specifically hybridizes to the regulatory region of the SCN1A gene.

[0160] Embodiment 8. The vector of embodiment 7, wherein the regulatory region of the SCN1A gene is a promoter or enhancer.

[0161] Embodiment 9. The vector of any one of embodiments 5 to 8, wherein the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 160, or 161.

[0162] Embodiment 10. The vector of any one of embodiments 5 to 9, wherein the gRNA is operably linked to a promoter recognized by RNA polymerase III.

[0163] Embodiment 11. The vector of any one of embodiments 5 to 9, wherein the gRNA is operably linked to a human U6 promoter.

[0164] Embodiment 12. A vector described in any one of embodiments 5 to 11, wherein the vector further comprises a polynucleotide sequence encoding a second gRNA targeting the SCN1A gene.

[0165] 13. The nuclease-deficient CRISPR-associated protein is selected from the group consisting of nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm 2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog.

[0166] Embodiment 14. The vector of any one of embodiments 5 to 12, wherein the nuclease-deficient CRISPR-associated protein is dCas9.

[0167] Embodiment 15. The vector of embodiment 14, wherein the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9, or Campylobacter jejuni dCas9, or a dCas9 from an orthologous bacterial species.

[0168] Embodiment 16. The vector of embodiment 14, wherein the dCas9 comprises the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159.

[0169] Embodiment 17. The vector of embodiment 14, wherein the dCas9 comprises an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159.

[0170] Embodiment 18. The vector of embodiment 14, wherein the dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106.

[0171] Embodiment 19. The vector of embodiment 14, wherein the dCas9 is encoded by a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106.

[0172] Embodiment 20. The vector of embodiment 14, wherein the dCas9 comprises a fragment of the amino acid sequence of SEQ ID NO: 156, 157, 158, or 159, and the fragment is a protein capable of forming a complex with the gRNA and targeting the SCN1A gene.

[0173] Embodiment 21. The DTM comprises: (a) a zinc finger transcription factor or a portion of a zinc finger transcription factor, or (b) a DNA-binding domain of a zinc finger transcription factor;

[0174] Embodiment 22 The vector of embodiment 21, wherein the zinc finger transcription factor is a C2H2 zinc finger transcription factor.

[0175] Embodiment 23 The vector of embodiment 21, wherein the C2H2 zinc finger transcription factor comprises the DNA-binding domain of Zif268 zinc finger transcription factor or another humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA-binding domain.

[0176] Embodiment 24 The vector of embodiment 23, wherein the DNA-binding domain of the Zif268 zinc finger transcription factor targets the SCN1A gene.

[0177] Embodiment 25. The DTM comprises: (a) a transcription activator-like protein effector (TALE) protein or a portion of a TALE protein, or (b) A vector described in any one of embodiments 1 to 3, comprising a DNA binding domain of a TALE protein.

[0178] Embodiment 26. The vector described in embodiment 25, wherein the DNA binding domain of the TALE protein targets the SCN1A gene.

[0179] Embodiment 27. A vector described in any one of embodiments 1 to 26, wherein the promoter is a minimal promoter.

[0180] Embodiment 28. A vector according to any one of embodiments 1 to 26, wherein the promoter is recognized by RNA polymerase II.

[0181] Embodiment 29. A vector according to any one of embodiments 1 to 26, wherein the promoter is a human U6 promoter, a mouse U6 promoter, or a human H1 promoter.

[0182] Embodiment 30. A vector described in any one of claims 1 to 29, wherein the enhancer polynucleotide sequence comprises a nucleotide sequence of any one of SEQ ID NOs: 33 to 102.

[0183] Embodiment 31. A vector described in any one of embodiments 1 to 29, wherein the enhancer polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 69 or 34.

[0184] Embodiment 32. A vector according to any one of embodiments 1 to 31, wherein the transactivator is VP16, VP32, VP48, VP64, VPR, the MS2-SAM system, p65, Rta, the CITE-D domain of p300, or SunTag.

[0185] Embodiment 33. The vector of any one of embodiments 1 to 31, wherein the transactivator is encoded by a nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113.

[0186] In the order of embodiment 34.5'-3', (a) the promoter polynucleotide sequence; and (b) the enhancer polynucleotide sequence; and (c) the transgene polynucleotide sequence.

[0187] In the order of embodiment 35.5'-3', (a) the enhancer polynucleotide sequence; and (b) the promoter polynucleotide sequence; and (c) the transgene polynucleotide sequence.

[0188] EMBODIMENT 36. (a) the transgene polynucleotide sequence encodes an amino acid sequence of SEQ ID NO: 114, 118, 122, or 126, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 114, 118, 122, or 126; or (b) the vector of any one of embodiments 1 to 35, wherein the transgene polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 115, 116, 117, 119, 120, 121, 123, 124, 125, 127, 128, or 129, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 115, 116, 117, 119, 120, 121, 123, 124, 125, 127, 128, or 129.

[0189] Embodiment 37. A vector according to any one of embodiments 1 to 36, further comprising an artificial intron.

[0190] Embodiment 38. The vector of any one of embodiments 1 to 37, further comprising a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element (HBVPRE), an RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element.

[0191] Embodiment 39. A vector according to any one of embodiments 1 to 38, further comprising a polyadenylation signal sequence.

[0192] Embodiment 40. The vector of embodiment 39, wherein the polyadenylation signal sequence is an SV40 polyadenylation signal sequence.

[0193] Embodiment 41. The vector according to any one of embodiments 1 to 40, wherein the vector is a viral vector.

[0194] Embodiment 42. The vector of embodiment 41, wherein the viral vector is an adeno-associated viral (AAV) vector.

[0195] Embodiment 43. The vector of embodiment 42, wherein the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence.

[0196] Embodiment 44 The vector of embodiment 43, wherein the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR.

[0197] In the embodiment 45.5'-3' order, (a) a 5'ITR; (b) an RNA polymerase III promoter; and (c) a polynucleotide sequence encoding a gRNA; and (d) the enhancer polynucleotide sequence; and (e) a minimal promoter; (f) an artificial intron; (g) the transgene polynucleotide sequence; and (h) the WPRE; (i) a polyadenylation signal sequence; (j) 3'ITR.

[0198] In the order of embodiment 46.5'-3', (a) a 5'ITR; (b) an RNA polymerase III promoter; and (c) a polynucleotide sequence encoding a gRNA; and (d) a minimal promoter; (e) the enhancer polynucleotide sequence; and (f) an artificial intron; (g) the transgene polynucleotide sequence; and (h) the WPRE; (i) a polyadenylation signal sequence; (j) 3'ITR.

[0199] Embodiment 47. The vector of embodiment 44, wherein the vector comprises a nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, or 153.

[0200] Embodiment 48. A vector described in any one of embodiments 1 to 40, wherein the vector is suitable for delivery via a non-viral delivery system.

[0201] Embodiment 49. The vector of embodiment 48, wherein the non-viral delivery system is a lipid nanoparticle or an exosome.

[0202] Embodiment 50. A viral particle comprising a vector according to any one of embodiments 41 to 47.

[0203] Embodiment 51. The viral particle of embodiment 50, wherein the viral particle is a recombinant AAV (rAAV) particle.

[0204] Embodiment 52. The viral particle of embodiment 51, wherein the rAAV particle is an AAV9, AAV-PHP.eB, AAV-DJ, or AAV2 serotype particle.

[0205] Embodiment 53. A population of viral particles comprising a plurality of viral particles according to any one of embodiments 50 to 52.

[0206] Embodiment 54. A pharmaceutical composition comprising a vector according to any one of embodiments 1 to 49, a viral particle according to any one of embodiments 50 to 52 or a population according to embodiment 53, and a pharma- ceutical acceptable carrier, vehicle or diluent.

[0207] Embodiment 55. A cell comprising a vector according to any one of embodiments 1 to 49 or a viral particle according to any one of embodiments 50 to 52.

[0208] Embodiment 56 The cell of embodiment 55, wherein the cell is a mammalian cell or an insect cell.

[0209] Embodiment 57. A method for producing rAAV particles, comprising: (i) culturing the cells of embodiment 55 or 56 under conditions that allow packaging of the rAAV particles; (ii) harvesting the cultured host cells or culture medium for collection of the rAAV particles.

[0210] Embodiment 58. The method of embodiment 57, wherein the rAAV particles comprise AAV9, AAV-PHP.eB, AAV-DJ, or AAV2 capsid proteins.

[0211] Embodiment 59. A method for treating Dravet Syndrome (DS) in a subject having or suspected of having DS, comprising administering to the subject a therapeutically effective amount of a vector described in any one of embodiments 1 to 49, a viral particle described in any one of embodiments 50 to 52, a population described in embodiment 53, or a pharmaceutical composition described in embodiment 54.

[0212] Embodiment 60. A method for treating or reducing the risk, severity, frequency or duration of epilepsy and / or seizures in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), comprising administering to the subject a therapeutically effective amount of a vector according to any one of embodiments 1 to 49, a viral particle according to any one of embodiments 50 to 52, a population according to embodiment 53, or a pharmaceutical composition according to embodiment 54.

[0213] Embodiment 61. A method for preventing or reducing the risk of sudden death in epilepsy (SUDEP) in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), comprising administering to the subject a therapeutically effective amount of a vector according to any one of embodiments 1 to 49, a viral particle according to any one of embodiments 50 to 52, a population according to embodiment 53, or a pharmaceutical composition according to embodiment 54.

[0214] Embodiment 62. The method of any one of embodiments 59-61, wherein the subject is about 2 years old to about 18 years old.

[0215] Embodiment 63. The method of any one of embodiments 59-61, wherein the subject is over 18 years of age.

[0216] Embodiment 64. The method of any one of embodiments 59 to 63, wherein the vector, viral particle, population, or pharmaceutical composition is administered to the subject via intraventricular, intrathecal, intracarotid, or intraparenchymal injection.

[0217] Embodiment 65. The method of any one of embodiments 59 to 64, wherein the vector, viral particle, population, or pharmaceutical composition is administered to the subject in a single dose.

[0218] Embodiment 66. The method of embodiment 65, wherein the single dose comprises about 10E+9 to about 10E+14 viral particles.

[0219] Embodiment 67. A method for increasing the level of SCN1A expression in SCN1A-expressing cells in the brain, comprising contacting the cells with a vector described in any one of embodiments 1 to 49, a viral particle described in any one of embodiments 50 to 52, a population described in embodiment 53, or a pharmaceutical composition described in embodiment 54.

[0220] Embodiment 68. The method of embodiment 67, wherein the SCN1A-expressing cells contain a loss-of-function mutation in one copy of the SCN1A gene.

[0221] Embodiment 69. The method of embodiment 67 or 68, wherein the SCN1A-expressing cell is a GABAergic interneuron cell.

[0222] Embodiment 70. The method of embodiment 69, wherein the GABAergic interneuron cells express parvalbumin (PV).

[0223] Embodiment 71. A vector according to any one of embodiments 1 to 49, a viral particle according to any one of embodiments 50 to 52, a population according to embodiment 53, or a pharmaceutical composition according to embodiment 54, for use as a medicament.

Claims

1. A vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA targeting module (DTM) fused to a transactivator, wherein the DTM comprises a nuclease-deficient CRISPR-associated protein; (b) an enhancer polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-dependent channel alpha subunit 1 (SCN1A)-expressing cells in the brain; and (c) a promoter polynucleotide sequence; and (d) a polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 160, or 161.

2. The vector of claim 1, wherein the SCN1A-expressing cell is a GABAergic interneuron cell or a parvalbumin (PV)-expressing interneuron.

3. 2. The vector of claim 1 , wherein the gRNA is encoded by or specifically hybridizes to the nucleotide sequence of SEQ ID NO: 11, 19, 21, or 27.

4. 2. The vector of claim 1, wherein the gRNA is operably linked to a promoter recognized by RNA polymerase III, optionally, the gRNA is operably linked to a human U6 promoter.

5. 2. The vector of claim 1, wherein the vector further comprises a polynucleotide sequence encoding a second gRNA that targets the SCN1A gene.

6. The nuclease-deficient CRISPR-associated protein is selected from the group consisting of nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cm rl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas orthologue; optionally, the nuclease-deficient CRISPR-associated protein is dCas9; optionally, the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9, or Campylobacter jejuni dCas9. dCas9, or a dCas9 from an orthologous bacterial species; optionally, the dCas9 comprises the amino acid sequence of SEQ ID NO: 156, or an amino acid sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 156; optionally, the dCas9 comprises a fragment of the amino acid sequence of SEQ ID NO: 156, wherein the fragment forms a complex with the gRNA and encodes the SCN1A gene.

2. The vector of claim 1, wherein the dCas9 is a protein capable of targeting a gene, or optionally, the dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106, or is encoded by a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 103, 104, 105, or 106.

7. 2. The vector of claim 1, wherein the promoter is a minimal promoter, the promoter is recognized by RNA polymerase II, or the promoter is a human U6 promoter, a mouse U6 promoter, or a human H1 promoter.

8. The vector of claim 1, wherein the enhancer polynucleotide sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 33 to 102, or the enhancer polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 69 or 34.

9. 2. The vector of claim 1, wherein the transactivator is VP16, VP32, VP48, VP64, VPR, the MS2-SAM system, p65, Rta, the CITE-D domain of p300, or SunTag, or wherein the transactivator is encoded by the nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 107, 108, 109, 110, 111, 112, or 113.

10. the enhancer polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO:69, and (i) the DTM is Staphylococcus aureus dCas9 and the transactivator is VP64, or (ii) The vector of claim 1, wherein the transgene polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO:

115.

11. In the order 5'-3', (i)(a) the promoter polynucleotide sequence; (b) the enhancer polynucleotide sequence; and (c) the transgene polynucleotide sequence; or (ii)(a) the enhancer polynucleotide sequence; (b) the promoter polynucleotide sequence; and (c) a transgene polynucleotide sequence.

12. (a) the transgene polynucleotide sequence encodes the amino acid sequence of SEQ ID NO:114, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO:114; or (b) the vector of claim 1, wherein the transgene polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 115, 116, or 117, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 115, 116, or 117.

13. Artificial introns; a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element (HBVPRE), an RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element; and / or 2. The vector of claim 1, further comprising a polyadenylation signal sequence, optionally wherein the polyadenylation signal sequence is an SV40 polyadenylation signal sequence.

14. 2. The vector of claim 1, wherein the vector is a viral vector, optionally wherein the viral vector is an adeno-associated viral (AAV) vector, optionally wherein the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence, optionally wherein the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR.

15. In the order 5'-3', (i) (a) a 5' ITR; (b) an RNA polymerase III promoter; and (c) a polynucleotide sequence encoding a gRNA; and (d) the enhancer polynucleotide sequence; and (e) a minimal promoter; (f) an artificial intron; (g) the transgene polynucleotide sequence; and (h) WPRE; and (i) a polyadenylation signal sequence; and (j) a 3' ITR; or (ii) (a) a 5′ ITR; (b) an RNA polymerase III promoter; and (c) a polynucleotide sequence encoding a gRNA; and (d) a minimal promoter; (e) the enhancer polynucleotide sequence; and (f) an artificial intron; (g) the transgene polynucleotide sequence; and (h) WPRE; and (i) a polyadenylation signal sequence; and (j) a 3' ITR.

16. 15. The vector of claim 14, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153, or a nucleotide sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the nucleotide sequence of SEQ ID NO: 137, 141, 145, 149, or 153.

17. 2. The vector of claim 1, wherein the vector is suitable for delivery via a non-viral delivery system, optionally wherein the non-viral delivery system is a lipid nanoparticle or an exosome.

18. A viral particle comprising the vector of claim 14, Optionally, the viral particle is a recombinant AAV (rAAV) particle. The rAAV particle is an AAV9, AAV-PHP.eB, AAV-DJ, or AAV2 serotype particle.

19. A population of virus particles comprising a plurality of virus particles according to claim 18.

20. A pharmaceutical composition comprising a vector according to any one of claims 1 to 17, a viral particle according to claim 18 or a population according to claim 19, and a pharmaceutically acceptable carrier, vehicle or diluent.

21. A cell comprising the vector according to any one of claims 1 to 17 or the viral particle according to claim 18, Optionally, the cell is a mammalian cell or an insect cell.

22. 1. A method for producing rAAV particles, comprising: (i) culturing the cells of claim 21 under conditions that allow packaging of the rAAV particles; (ii) harvesting the cultured host cells or culture medium to collect the rAAV particles, optionally wherein the rAAV particles comprise AAV9, AAV-PHP.eB, AAV-DJ, or AAV2 capsid proteins.

23. 20. The vector of any one of claims 1 to 17, the viral particle of claim 18, or the population of claim 19 for use in (i) a method for treating Dravet Syndrome (DS) in a subject having or suspected of having DS, (ii) a method for treating or reducing the risk, severity, frequency, or duration of epilepsy and / or seizures in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), or (iii) a method for preventing or reducing the risk of sudden death in epilepsy (SUDEP) in a subject having or at risk of having epilepsy, seizures, or Dravet Syndrome (DS), The method comprises administering to the subject a therapeutically effective amount of a vector according to any one of claims 1 to 17, a viral particle according to claim 18, or a population according to claim 19; Optionally, the subject is between about 2 years old and about 18 years old, or the subject is over 18 years old; optionally, the vector, viral particle, or population is administered to the subject via intraventricular, intrathecal, intracarotid, or intraparenchymal injection; optionally, the vector, viral particle, or population is administered to the subject in a single dose; optionally, the single dose comprises between about 10E+9 and about 10E+14 viral particles of the vector, viral particle, or population.

24. 20. The vector of any one of claims 1 to 17, the viral particle of claim 18, or the population of claim 19, for use in a method for increasing the level of SCN1A expression in SCN1A-expressing cells in the brain, the method comprising contacting the cells with the vector of any one of claims 1 to 17, the viral particle of claim 18, or the population of claim 19, optionally wherein the SCN1A-expressing cells comprise a loss-of-function mutation in one copy of the SCN1A gene, optionally wherein the SCN1A-expressing cells are GABAergic interneuron cells, optionally wherein the GABAergic interneuron cells express parvalbumin (PV).

25. A vector according to any one of claims 1 to 17, a viral particle according to claim 18 or a population according to claim 19 for use as a medicament.