Methods and agents for increasing RBM3 expression
Patent Information
- Application Number
- JP2024536408
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-10-24
- Filing Date
- 2022-12-19
- Publication Date
- 2025-12-05
AI Technical Summary
Current methods for increasing RBM3 expression, such as therapeutic hypothermia, are risky and not fully understood mechanistically, and there is a lack of effective agents to induce RBM3 expression without inducing hypothermia.
Identification of a previously uncharacterized exon in the RBM3 mRNA isoform that causes nonsense-mediated degradation at warm temperatures, and use of agents like antisense oligonucleotides to prevent the inclusion of this exon, thereby increasing RBM3 expression.
Achieves a 3-4 fold increase in RBM3 expression without the need for hypothermia, providing neuroprotection against diseases like Alzheimer's and neurodegenerative disorders.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] This application claims priority from UK Patent No. 2118495.7, filed December 20, 2021, and UK Patent No. 2215713.5, filed October 24, 2022, the contents and elements of which are incorporated herein by reference for all purposes.
[0002] FIELD OF THEINVENTION The present invention relates generally to methods and substances that increase the expression of RNA-binding motif protein 3 (RBM3), and agents for that purpose that are used, for example, in the therapy and prevention of disease. [Background technology]
[0003] background In hibernation and hypothermia, global protein synthesis and cellular metabolism are downregulated, but low temperature also induces the expression of a small subset of proteins known as cold shock proteins (Peretti, D. et al. Nature 518, 236-239 (2015)). Among these, RNA-binding motif protein 3 (RBM3) and cold-inducible RNA-binding protein (CIRP, also known as CIRBP) are cold shock proteins expressed at high levels in the brain. 1,2,30,31 RBM3 and CIRPB (and other RNA-binding proteins, RBPs) regulate mRNA splicing, stability and transport and are key regulators of gene expression (GE).
[0004] Evolutionary conservation of RBM3 and CIRPB 3 and extreme temperature sensitivity 4 Nevertheless, the mechanistic basis of cold-induced transcript expression has long remained enigmatic. Global analyses of gene expression have demonstrated temperature-regulated alternative splicing (AS) coupled with nonsense-mediated mRNA decay (NMD) as a global mechanism for the control of temperature-dependent gene expression. 5 .
[0005] Alternative splicing of pre-mRNA leads to different mRNA isoforms. The NMD pathway recognizes mRNA isoforms that code for premature termination codons (PTCs) and targets these mRNAs for degradation, thus allowing splicing-controlled regulation of gene expression levels. 6 NMD-inducing isoforms are frequently found in RNA-binding proteins. 5 , Heat-induced PTC-containing isoforms of CIRBP explain cold-induced CIRBP expression. 7 In a global analysis, temperature-regulated NMD isoforms of various RNA-binding proteins (RBPs) were identified along with a heat-induced NMD isoform of RBM3 (Neumann A., “Leveraging RNA-sequencing data to obtain insights about mRNA splicing: from daily rhythms to secretory adaptations and cryptic splice sites” thesis, Appendix I publication 6, 2019). Neumann et al. 5 reported over 60 RBPs with temperature-regulated NMD exons. Preussner et al. ("Rhythmic gene expression is controlled by alternative splicing triggering nonsense mediated decay", Abstract submitted at the 24th th Annual meeting of the RNA Society, 2019) considers the goal of establishing methods to alter the expression levels of RBM3 and CIRBP by interfering with NMD-induced splicing isoforms.
[0006] CIRBP has diverse functions ranging from circadian rhythm and sleep homeostasis to inflammation and cancer. 8-11, RBM3 is strongly associated with the neuroprotective effects of hypothermia 12 The neuroprotective function of RBM3 in hypoxic-ischemic brain injury 13 , exposure to neurotoxins 14 and neurodegenerative diseases (e.g., prion infection and Alzheimer's disease in mice). 15 More specifically, RBM3 overexpression, achieved by inducing hypothermia or by lentiviral delivery, results in synaptic protection in mouse models of Alzheimer's disease and throughout the course of prion disease in mice, while preventing behavioral defects and neuronal loss and significantly increasing survival time. 15 .
[0007] Therapeutic hypothermia is used extensively in clinical practice for neuroprotection, from neonatal hypoxic-ischemic encephalopathy to head trauma, stroke, and during cardiac surgery in adults.
[0008] The mechanisms of hypothermia-induced neuroprotection in humans are not fully understood. Moreover, induced cooling in humans is not without risks, with high morbidity (blood clots, pneumonia, etc.) and the need for an intensive care set-up.
[0009] The present invention has been devised in light of the above considerations. Summary of the Invention [Means for solving the problem]
[0010] Summary of the Invention The present invention relates to increasing the levels of RBM3 without the need for induction of hypothermia. The inventors have identified a previously experimentally uncharacterized exon contained in the isoform of RBM3 mRNA at warm temperatures and confirmed that this exon is responsible for nonsense-mediated decay of RBM3, thus causing a decrease in RBM3 expression at warm temperatures.
[0011] Agents that target this exon or its splice sites increase expression of RBM3 without the need for cooling. A variety of such agents are described herein.
[0012] Peretti et al. 15 described the use of lentiviral vectors to induce expression of RBM3 in mouse models of Alzheimer's disease and prion disease, but this article did not address the mechanism responsible for cold induction of RBM3, and alternative splicing isoforms of RBM3 were not identified.
[0013] Neumann ("Leveraging RNA-sequencing data to obtain insights about mRNA splicing: from daily rhythms to secretory adaptations and cryptic splice sites", Appendix I publication 6, 2019) characterized NMD isoforms at different temperatures and identified NMD variants in various unannotated RNA-binding proteins, such as RBM3. The NMD variant of RBM3 contains an NMD exon that is only illustrated in a schematic diagram showing it located between exons 3 and 4 (Figure S2A). The inclusion of the NMD exon was not identified as a significant splicing event because its inclusion frequency (percent spliced, PSI) at cold relative to warm temperatures was very low (dPSI < 15%, see legend to Figure S2). Moreover, the inclusion level of the RBM3 NMD exon was only about 3% PSI at 38° C. (fig. S2B), the lowest level reported in a global analysis, whereas other RBP heat-induced NMD exons had PSIs of more than 20% or even 60% at 38° C. (hnRNP DL and CIRBP in Fig. 2D). Neumann does not disclose the effect of preventing inclusion of this exon on the relative expression of RBM3, nor does he disclose the specific sequence or location of this exon.
[0014] Neumann et al. 5did not identify any exons between exon 3 and exon 4 of RBM3. Neumann et al. 5 The alternative splicing events for RBM3 identified in are alternative terminal exons, but these were not identified as temperature dependent (marked “undirected”, see Table EV1, Sheet 3).
[0015] Llorian et al. 32 have studied alternative splicing of RBM3 among other genes in differentiating aortic smooth muscle. They describe introns 3 and 4 of RBM3 as flanking poison exons and show increased retention of the intron in differentiated cells. The authors did not examine the effect of alternative splicing on the levels of RBM3 mRNA, did not examine the role of temperature on alternative splicing, and did not confirm or investigate exon inclusion.
[0016] The present inventors have unexpectedly identified that an NMD-inducible exon between exons 3 and 4 governs the temperature-regulated expression of RBM3, despite its low inclusion level at high temperatures. A dramatic increase (3-4 fold) in RBM3 expression is achieved by agents capable of affecting alternative splicing of RBM3 pre-mRNA, such as antisense oligonucleotides, preventing the inclusion of this exon as described herein and demonstrated in the Examples.
[0017] In one aspect, the present invention provides a method of inhibiting nonsense-mediated decay of RBM3-encoding mature mRNA in a cell, comprising exposing the cell to an agent capable of hybridizing with a region of RBM3 pre-mRNA to alter splicing of the pre-mRNA, such that exon 3a is not incorporated in the resulting mature mRNA. The method may be an in vitro or ex vivo method. In some embodiments, the method is an in vivo method. The cell may be a mammalian cell, e.g., a primate cell, and optionally the cell may be a mouse cell or a human cell. The cell is preferably a neuron, an astrocyte, an oligodendrocyte, a microglia, an ependymal cell, or a brain stem cell.
[0018] The term "expose" as used herein means exposing a cell to an agent (e.g., ASO) or delivering an agent to a cell in such a manner or under such conditions that the agent enters the cell. See, for example, Juliano et al., Bioconjug Chem. 2012 Feb. 15; 23(2):147-57, which is incorporated herein in its entirety. The agent (e.g., ASO) is delivered to the interior of the cell and enters the cell nucleus. The agent is exogenous to the cell. In one embodiment, the cell is contacted with a vector (e.g., a viral genome, a plasmid, an artificial chromosome) that enters the cell. In the cell, the vector causes expression of the ASO in the cell, for example from the cell genome or from an exogenous nucleic acid. The ASO can be introduced into the cell in vivo or exogenously.
[0019] "Capable of hybridizing" - Hybridization assays are known in the art and generally involve the use of complementary nucleic acid probes (e.g., in situ hybridization, Northern blotting and related techniques, using labeled probes). In some embodiments, the hybridization assay is an in situ hybridization assay, using a labeled probe, such as a fluorescently labeled probe.
[0020] Selective hybridization conditions suitable for oligonucleotides of 17 to 30 bases include overnight hybridization in 6×SSC at 42° C., followed by washing in 6×SSC at increasing temperatures from 42° C. to 65° C. The general formula for calculating the stringent conditions necessary to achieve hybridization between nucleic acid molecules of specified sequence homology is (Sambrook et al., 1989): Tm=81.5° C.+16.6 Log[Na + ]+0.41 (% G+C)-0.63 (% formamide)-600 / ♯ base pairs (bp) in the duplex.
[0021] In another aspect, the present invention provides a method for treating or preventing a disease affected by RMB3 expression in a subject, comprising administering to the subject an agent capable of hybridizing with a region of RBM3 pre-mRNA to alter splicing of the pre-mRNA such that exon 3a is not incorporated in the resulting mature mRNA. In one aspect, the present invention provides a method for increasing neuroprotection in a subject, comprising administering to the subject an agent capable of hybridizing with a region of RBM3 pre-mRNA to alter splicing of the pre-mRNA such that exon 3a is not incorporated in the resulting mature mRNA.
[0022] Agents of the invention may be capable of preventing the inclusion of all or part of exon 3a.
[0023] As used herein, "expression" may be gene expression or protein expression, and thus may be measured by quantifying the levels of RBM3 transcripts or the protein levels of RBM3. Exemplary methods for measuring RBM3 expression are set forth in the "Methods" section below.
[0024] The methods and agents of the invention may be used to treat or prevent diseases such as neurological disorders, and / or the diseases are neonatal hypoxic-ischemic encephalopathy, head trauma, or stroke; anxiety or depression; a neurodegenerative disease optionally selected from Alzheimer's disease, Parkinson's disease, prion diseases, frontotemporal dementia, tauopathy, amyotrophic lateral sclerosis (ALS), and vascular dementia; or neurological damage, optionally occurring during cardiac surgery, or induced coma (induced coma).
[0025] In some embodiments, the region of the pre-mRNA of RBM3 is selected from: a region within exon 3a, a region spanning the splice site of exon 3a, a region located within 250 nucleotides upstream of exon 3a, and a region located within 250 nucleotides downstream of exon 3a. In some embodiments, the region is located within 200 nucleotides upstream of exon 3a or within 200 nucleotides downstream of exon 3a. The region can be within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides upstream of exon 3a. The region can be within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides downstream of exon 3a. The region can be within 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides upstream of exon 3a. The region can be within 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides downstream of exon 3a. The region can be within 210, 220, 230, 240, or 250 nucleotides upstream of exon 3a. The region can be within 210, 220, 230, 240, or 250 nucleotides downstream of exon 3a. The region can be upstream or downstream of exon 3a and corresponds to annotated intron 3 of the RBM3 gene.
[0026] In some embodiments, the region comprises a splice enhancer element. For example, in some embodiments, the region corresponds to SEQ ID NO: 27, preferably SEQ ID NO: 29. In other embodiments, the region corresponds to SEQ ID NO: 15, 16, 17, 19, 21, 23, or 25.
[0027] In some embodiments, the region spans the 5' splice site of exon 3a. In certain embodiments, the region comprises nucleotides at positions 257-269, 258-269, 259-269, 260-269, 261-269, 262-269, 263-269, 264-269, 265-269, 266-269, or 267-269 of SEQ ID NO:6, and / or nucleotides at positions 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 of SEQ ID NO:33. In some embodiments, the region includes nucleotides 259-271, 260-271, 261-271, 262-271, 263-271, 264-271, 265-271, 266-271, 267-271, 268-271, or 269-271 of SEQ ID NO:5.
[0028] In some embodiments, the region spans the 3' splice site of exon 3a. In some embodiments, the region comprises nucleotides at positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:6 and / or nucleotides at positions 136-147, 137-147, 138-147, 139-147, 140-147, 141-147, 142-147, 143-147, 144-147, or 145-147 of SEQ ID NO:32. In certain embodiments, the region comprises nucleotides at positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:5.
[0029] In certain embodiments, the agent is an antisense oligonucleotide (ASO). In this case, the method of inhibiting nonsense-mediated decay of RBM3-encoded mature mRNA in a cell, increasing neuroprotection and / or treating or preventing a disease according to the present invention may further comprise expressing the ASO from a transgene encoding the ASO that is introduced or administered to the cell or subject. Preferably, the viral vector is a recombinant AAV vector.
[0030] In another aspect, the invention provides an ASO as described herein. Also provided is an expression construct encoding the ASO according to the invention. Preferably, the expression construct is a vector or a viral vector. Also provided is a host cell comprising the expression construct.
[0031] "Antisense Oligonucleotide" - As used herein, the terms "antisense oligonucleotide", "ASO" and "antisense oligomer" are used interchangeably and refer to a polynucleotide comprising nucleotides that hybridize to a target nucleic acid (e.g., pre-mRNA) sequence by Watson-Crick base pairing or wobble base pairing (GU).
[0032] Preferably, the ASO is complementary or essentially complementary to all or part of a region of the RBM3 pre-mRNA described herein.
[0033] The ASO can be of any length suitable for hybridizing with the pre-mRNA and effective for altering splicing. In some embodiments, the ASO is 10-30 nucleotides in length. Preferably, the ASO is 25 nucleotides in length, or the ASO is 15, 16, 17, 18, or 19 nucleotides in length. In certain embodiments, the ASO is 19 nucleotides in length. In certain embodiments, the ASO is 8-300, preferably 18-30, nucleotides in length, more preferably 20, 21, 22, 23, 24, or 25 nucleotides in length. In specific embodiments, the ASO is 30-40, 41-50, or 51-300 nucleotides in length.
[0034] Where a DNA sequence is specified herein, for example with reference to a drawing or SEQ ID NO:, unless otherwise required by context, it will be understood that the "RNA equivalent," in which T is substituted with U where present, is disclosed mutatis mutandis.
[0035] For the purposes of this invention, "complementary to", "complementary sequence of the nucleotide sequence represented in SEQ ID NO:X" is a nucleotide sequence that can be derived from the represented nucleotide sequence by replacing a nucleotide by its complementary nucleotide according to Chargaff's rules (A⇔T or U; G⇔C) and reading the sequence in the 5' to 3' direction, i.e. in the opposite direction to the represented nucleotide sequence.
[0036] Polynucleotides (e.g., oligonucleotides, ASOs, mRNA, gRNA, etc.) are "complementary" to one another, and hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides.
[0037] "Essentially complementary to" - The ASO can have exact sequence complementarity or close complementarity to the target sequence (e.g., essentially complementary and having sufficient complementarity to bind to the target sequence and alter the splicing of the RBM3 pre-mRNA).
[0038] ASOs are designed such that they bind (hybridize) to a target nucleic acid (e.g., a pre-mRNA transcript) and remain hybridized under physiological conditions; where the ASOs can either block or inhibit binding of the spliceosomal complex or a spliceosomal component or transactivation to a pre-mRNA.
[0039] Typically, when ASOs hybridize to sites other than the desired (target) nucleic acid sequence, they hybridize to a limited number of sequences that are not the target nucleic acid (to a small number of sites other than the target nucleic acid). The design of the ASO takes into account the occurrence of sufficiently similar nucleic acid sequences at the target nucleic acid sequence or elsewhere in the genome or cellular RNA / transcriptome, so that the likelihood of the ASO binding to other sites and causing "off-target" effects is limited.
[0040] An agent (e.g., ASO) does not need to hybridize with all nucleobases in a target sequence, and the nucleobases it hybridizes with can be adjacent or non-adjacent bases. The ASO can hybridize across one or more segments of the target nucleic acid, such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop or hairpin structures can form). In certain embodiments, the ASO hybridizes with non-adjacent nucleobases in the target nucleic acid. For example, the ASO can hybridize with nucleobases in the target nucleic acid that are separated by one or more nucleobases to which the ASO does not hybridize.
[0041] Thus, an agent (e.g., an ASO) can comprise a complementary sequence that is complementary to at least 8, at least 9, or at least 10 contiguous nucleotides (nt) of a sequence in the region between exons 3 and 4. In some embodiments, the complementary sequence is complementary to at least 8, at least 9, or at least 10 contiguous nucleotides of a sequence in exon 3a. In some embodiments, the complementary sequence is complementary to at least 8, at least 9, or at least 10 contiguous nucleotides spanning the exon 3a splice site. In some embodiments, the complementary sequence is complementary to at least 8, at least 9, or at least 10 contiguous nucleotides of a splice enhancer element.
[0042] "Complementarity" (the degree to which one polynucleotide is complementary to another) can be quantified in terms of the proportion (e.g., percentage) of bases on opposite strands that are predicted to form hydrogen bonds with each other according to commonly accepted base-pairing rules. The sequence of an oligomeric compound, e.g., an ASO or gRNA, need not be 100% complementary to the sequence of its target nucleic acid to which it hybridizes. In certain embodiments, "essentially complementary" ASOs may comprise at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted.
[0043] For example, an ASO in which 18 of the 20 nucleobases of an oligomeric compound are complementary to a target region and will therefore hybridize specifically corresponds to 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be clustered together with complementary nucleobases or interspersed with complementary nucleobases, and do not have to be adjacent to each other or to complementary nucleobases. An ASO that is 18 nucleobases long, with four non-complementary nucleobases flanked by two regions of perfect complementarity with the target nucleic acid, would have an overall complementarity of 77.8% with the target nucleic acid and would therefore be within this range.
[0044] When considering ASOs that can hybridize to the sense strand of a target region, it will be appreciated that the longer the overall length of the sense or antisense regions, the less stringent the requirements for complementarity or sequence identity between these regions and their corresponding target regions (their complementary sequences).
[0045] However, it is preferred that the nucleic acid of interest has 100% sequence identity with the corresponding portion of the target nucleic acid and comprises a sequence of about 19 contiguous nucleotides, particularly about 25 nucleotides.
[0046] "Corresponding to" - A nucleotide or nucleotide sequence or region at a position in one sequence corresponds to the position of a nucleotide or nucleotide sequence or region in a similar specific nucleotide sequence when they are optimally aligned. Usually, corresponding regions share a high degree of sequence identity.
[0047] "Optimal alignment" - The optimal alignment of two sequences is found by aligning the two sequences over their entire length according to the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, J Mol Biol 48(3):443-53) in The European Molecular Biology Open Software Suite (EMBOSS, Rice et al., 2000, Trends in Genetics 16(6): 276-277; see, for example, the World Wide Web at https: / / www.ebi.ac.uk / Tools / emboss / ) using default settings (gap opening penalty = 10 (for nucleotides) / 10 (for proteins) and gap extension penalty = 0.5 (for nucleotides) / 0.5 (for proteins)). For nucleotides, the default scoring matrix used is EDNAFULL, and for proteins, the default scoring matrix is EBLOSUM62.
[0048] "Sequence identity" - for the purposes of the present invention, the sequence identity of two related nucleotide or amino acid sequences, expressed as a percentage, means the number of positions in two optimally aligned sequences with identical residues (x100) divided by the number of positions compared. A position in an alignment containing a gap, i.e., a residue present in one sequence but absent in the other, is considered a position with non-identical residues.
[0049] In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, optionally with one, two, or three substitutions. In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 51, 52, 53, 54, 55, 56, and 57, optionally with one, two, or three substitutions. In certain embodiments, the ASO comprises or consists of one of SEQ ID NOs: 34, 35, 36, 37, 38, 39, 69, and 70, optionally with one, two, or three substitutions.
[0050] In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, 83, 84, 85, 86 and 87, optionally with 1, 2 or 3 substitutions.
[0051] In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 83, 84, 85 and 87, optionally with 1, 2, or 3 substitutions.
[0052] In certain embodiments, the ASO comprises or consists of one of SEQ ID NOs: 44, 46, 47, 48, 83, 84, 85, 86 and 87, optionally with one, two or three substitutions.
[0053] The ASOs described herein may comprise LNA, RNA or DNA nucleotides. In some embodiments, the ASOs comprise alternating LNA and RNA nucleotides. In other embodiments, the ASOs comprise alternating LNA and DNA nucleotides. In specific embodiments, the ASOs comprise alternating RNA and DNA nucleotides.
[0054] In some embodiments, the ASO comprises a backbone modification that is optionally a phosphorothioate linkage. In some embodiments, the ASO comprises a sugar moiety modification that is optionally a 2'-O-methoxyethyl (MOE) modification. Preferably, the ASO comprises 2'-O-methoxyethyl (MOE) modifications and phosphorothioate linkages. In a specific embodiment, the ASO is fully 2'-O-methoxyethyl modified and fully phosphorothioate modified. In some embodiments, the ASO comprises 2'-O-methyl modifications. In some embodiments, the ASO is fully 2'-O-methyl and fully phosphorothioate modified.
[0055] In certain embodiments, the ASO is or comprises a phosphorodiamidate morpholino oligonucleotide.
[0056] In another aspect, the invention provides a method for inhibiting nonsense-mediated decay of RBM3-encoding mature mRNA in a cell, the method comprising exposing the cell to an agent, wherein the agent is an ASO described herein.
[0057] In another aspect, a method of treating or preventing a disease affected by RMB3 expression in a subject is provided, comprising administering to the subject an agent, wherein the agent is an ASO described herein. Also provided is a method of increasing neuroprotection in a subject, comprising administering to the subject an agent, wherein the agent is an ASO described herein.
[0058] The invention further provides an agent for use in a method for inhibiting nonsense-mediated decay (NMD) of RBM3-encoding mature mRNA, for use in a method for treating or preventing a disease affected by RMB3 expression, or for use in a method for increasing neuroprotection in a subject as described herein. In some embodiments, the agent is an ASO.
[0059] In another aspect, there is provided the use of an agent in the manufacture of a medicament for use in a method of inhibiting sense-mediated decay (NMD) of RBM3-encoding mature mRNA, the use of an agent in the manufacture of a medicament for use in a method of treating or preventing a disease affected by RMB3 expression, or the use of an agent in the manufacture of a medicament for increasing neuroprotection in a subject as described herein.
[0060] In a further aspect, a method for identifying an antisense oligonucleotide (ASO) capable of increasing the expression of RBM3 in a cell is provided, comprising the steps of: i) identifying an ASO targeting a region of pre-mRNA of RBM3 gene, the region being selected from a region within exon 3a, a region spanning the splice site of exon 3a, a region located within 250 nucleotides upstream of exon 3a, and a region located within 250 nucleotides downstream of exon 3a; ii) delivering the ASO identified in step i) to the cell; and iii) measuring the expression level of RBM3 in the cell of step ii). In a particular embodiment, the method further comprises: iv) comparing the level of expression measured in step iii) with the level of expression of RBM3 in a cell treated with a control, which is optionally an ASO or DMSO. Preferably, the level of expression is measured by RT-qPCR or Western blotting.
[0061] In another aspect, the present invention provides a CRISPR / Cas-based system as described herein, including at least one gRNA capable of hybridizing to a region in the gene for RBM3 so as to remove exon 3a therefrom.
[0062] In another aspect, the invention provides a CRISPR / Cas-based base editing system as described herein, including at least one gRNA capable of hybridizing to a region in the RBM3 gene to edit one or more of the splice sites described herein.
[0063] In another aspect, a guide RNA pair is provided for removing exon 3a from the gene of RBM3, wherein the first guide RNA can hybridize to a genomic sequence upstream of exon 3a and the second guide RNA can hybridize to a genomic sequence downstream of exon 3a. In some embodiments, the first guide RNA comprises SEQ ID NO: 11 or SEQ ID NO: 12 and the second guide RNA comprises SEQ ID NO: 13.
[0064] In some embodiments, the gRNA is complementary or essentially complementary to all or part of the region defined above. In certain embodiments, the gRNA is 80%, 85%, 90%, 95% or 100% complementary to said region. In certain embodiments, the gRNA is 100% complementary to said region.
[0065] Also provided is an expression construct or combination of constructs that encodes the CRISPR / Ca system. Preferably, the expression construct is a vector or a viral vector.
[0066] In another aspect, the present invention provides a method for treating or preventing a disease affected by RMB3 expression in a subject or providing neuroprotective therapy to a subject, the method comprising administering to a subject a CRISPR / Cas-based base editing system described herein, or an expression construct encoding the system.
[0067] The present invention includes combinations of the described embodiments and preferred features except where such combinations are clearly unacceptable or specifically avoided.
[0068] Detailed Description of the Invention RBM3 RNA-binding motif protein 3 (RBM3), also known as IS1-RNPL and RNPL, is a cold shock protein that is upregulated in response to reduced temperature 1 RBM3 is an evolutionarily highly conserved RNA-binding protein.
[0069] The human RBM3 gene (NCBI gene ID: 5935) is located on chromosome X48574484-48581162, GRCh38.p13 primary assembly, and encodes the 157 amino acid long RBM3 protein (NCBI reference sequence: NP_006734.1). The mouse RBM3 gene has NCBI gene ID: 19652.
[0070] RBM3 is expressed in tissues such as bone marrow and brain tissue (https: / / www.ncbi.nlm.nih.gov / gene?Db=gene&Cmd=ShowDetailView&TermToSearch=5935#gene-expression). Multiple alternatively spliced transcript variants predicted to encode distinct isoforms have been characterized.
[0071] As used herein, "RBM3" refers to RBM3 from any species and includes isoforms, fragments, variants, or homologs of RBM3 from any species. In certain embodiments, the species is human (Homo sapiens). In some embodiments, the species is mouse (Mus musculus).
[0072] A "variant or homolog" of RBM3 or its encoding nucleic acid refers to a naturally occurring RBM3 in a related species that functionally corresponds to the human sequence and shares a high degree of sequence similarity or identity such that the two can be optimally aligned, and the corresponding regions identified herein.
[0073] Alternative splicing of pre-mRNA Most unspliced eukaryotic pre-mRNAs consist of protein-coding exons and intervening non-coding introns. During pre-mRNA splicing, introns are cleaved from the pre-mRNA and exons are joined to form the mature mRNA, which is then translated into protein. The boundaries of introns and exons are marked by splice sites (ss) at the intron-exon junctions.
[0074] More than 95% of human multi-exon genes can be spliced to form multiple alternative mature mRNAs (Pan, Q. et al. (2008), Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing., Nature genetics, 40(12), pp. 1413-5. doi: 10.1038 / ng.259.; Barbosa-Morais, NL et al. (2012) The evolutionary landscape of alternative splicing in vertebrate species., Science 338(6114), pp. 1587-93. doi:10.1126 / science.1230612; Merkin, J. et al. (2012) Evolutionary dynamics of gene and isoform regulation in Mammalian tissues., Science. 338(6114), pp. 1593-9. doi:10.1126 / science.1228186. In contrast to constitutive splicing, when only one mRNA isoform is produced from a gene, this process is called alternative splicing (AS). AS is classified into five main categories: exon truncation by using alternative 5' or 3' splice sites (A5ss / A3ss), cassette exon skipping (SE), skipping of either one of two consecutive exons and simultaneous inclusion of the other (mutually exclusive exons, MXE), or intron retention (RI).
[0075] Alternative splicing factors can regulate AS by interacting with components of the spliceosome, promoting or suppressing the use of specific splice sites. These trans-acting protein factors bind to pre-mRNA at cis-regulatory elements within its sequence. Cis-regulatory elements are divided into four categories based on their location and type of regulation: intronic splicing enhancers (ISEs), exonic splicing enhancers (ESEs, both of which promote ss usage), intronic splicing silencers (ISSs), and exonic splicing silencers (ESSs, both of which suppress ss usage) (Black, DL (2003) Mechanisms of Alternative Pre-Messenger RNA Splicing, Annual Review of Biochemistry. pp. 291-336. doi: 10.1146 / annurev.biochem.72.121801.161720.).
[0076] One example of an alternative splicing event that controls mRNA levels, and therefore protein levels, is a highly conserved exon in an RNA-binding protein. 5 When included in a transcript, these exons direct the degradation of the mRNA via the nonsense-mediated decay (NMD) pathway. Therefore, by preventing the inclusion of these exons, nonsense-mediated decay (NMD) of the mRNA can be inhibited, and the mRNA and protein levels of the RNA-binding protein can be increased.
[0077] In all embodiments herein, reference to "mRNA," "RNA," or "transcript" refers to a messenger RNA molecule, which may be the primary transcript (pre-mRNA), or the product of processing and splicing of the pre-mRNA, called mature mRNA. Pre-mRNA is unspliced and therefore contains introns.
[0078] Nonsense-Mediated Decay (NMD) Nonsense-mediated mRNA decay (NMD) is a eukaryotic RNA degradation pathway through which a set of NMD factors recognizes and degrades mRNA isoforms that contain abnormally positioned translation termination codons. These codons are called premature termination codons (PTCs). PTC-containing mRNA isoforms are often referred to as poison isoforms.
[0079] Poison isoforms are frequently found in RNA-binding proteins, and alternative splicing leads to the inclusion of a PTC-containing exon, the poison exon, in the transcript. 5 The heat-inducible poison exon of CIRBP provides an explanation for cold-induced CIRBP expression 5 .
[0080] PTC recognition occurs during translation of the mRNA and requires several proteins to ultimately degrade the mRNA. These proteins include UPF1, UPF2, and UPF3, and NMD factors such as SMG6 and SMG5-SMG7. 6 The process of NMD is described in more detail in Lykke-Andersen, S. & Jensen, TH Nature Reviews Molecular Cell Biology 16, 665 (2015), which is incorporated herein by reference in its entirety.
[0081] Using an inhibitor of translation, poison mRNA isoforms can be stabilized before degradation occurs, thus allowing accumulation and detection of poison mRNA isoforms.An exemplary inhibitor of translation is cycloheximide (CHX).Alternatively, NMD can be inhibited by knocking down UPF1 and / or other proteins that play a role in NMD, such as MG6 and SMG7.
[0082] RBM3 exon 3a The mature mRNA of human RBM3, which encodes the RBM3 polypeptide (NP_006734.1), is defined in GenBank accession number NM_006743.5 and consists of seven annotated exons: exon 3 (SEQ ID NO:1) spans nucleotides 207-313 of NM_006743.5, and exon 4 (SEQ ID NO:2) spans nucleotides 314-419 of NM_006743.5.
[0083] The mature mRNA of mouse RBM3, encoding RBM3 polypeptide isoform 1 (NP_001159881.1), is defined by GenBank accession number NM_001166409.2 and consists of seven annotated exons: exon 3 (SEQ ID NO:3) spans nucleotides 362-468 of NM_001166409.2, and exon 4 (SEQ ID NO:4) spans nucleotides 469-568 of NM_001166409.2.
[0084] The inventors have identified an alternative splicing event that leads to the inclusion of a previously unannotated exon, herein referred to as exon 3a, into the RBM3 transcript. Exon 3a contains a PTC, inducing nonsense-mediated decay (NMD) of the transcript, thus reducing RBM3 mRNA and protein levels. The inventors further identified that the inclusion of exon 3a is induced by warm temperatures.
[0085] Exon 3a is located within annotated intron 3 of RBM3, between annotated exons 3 and 4. Table 1 demonstrates the sequence of exon 3a mapped onto the mouse and human genomes. The two sequences share high (91%) sequence identity.
[0086] The present invention provides a method for modulating splicing and thereby avoiding incorporation of exon 3a (or at least its associated PTC) into mature RBM3 mRNA. Avoidance of incorporation of exon 3a means that all or part of exon 3a is not incorporated into mature RBM3 mRNA. As described in Example 3, there is an alternative internal 3'ss at position 107 of the sequence of exon 3a (e.g., SEQ ID NO: 6 and SEQ ID NO: 5), and thus the agents and methods of the present invention can lead to mature mRNAs in which nucleotides 108-271 of SEQ ID NO: 5 or nucleotides 108-269 of SEQ ID NO: 6 are not incorporated (they are skipped). Thus, the agents of the present invention can cause skipping of all of exon 3a or part of exon 3a, for example nucleotides 108-269 of SEQ ID NO: 6.
[0087] [Table 1]
[0088] In a specific embodiment, the species is Homo sapiens, and therefore "exon 3a" refers to SEQ ID NO:6.
[0089] In some embodiments, the species is mouse (Mus musculus), and thus "exon 3a" refers to SEQ ID NO:5.
[0090] RBM3 is highly conserved across species (ZhouR et al. Oncotarget. 2017; 8(13): 22235-22250). Given the high evolutionary conservation of RBM3, exon 3a can be mapped onto the genomes of other species using known alignment techniques.
[0091] Thus, "exon 3a" as used herein may include the sequence of exon 3a of the human RBM3 gene (SEQ ID NO: 6) or the sequence of exon 3a of the mouse RBM3 gene (SEQ ID NO: 5), or may include a sequence that is a homologue or other variant of SEQ ID NO: 6 or SEQ ID NO: 5. In the context of the claimed invention, RBM3 exon 3a is typically native to the relevant cell or subject.
[0092] Exon 3a detection The presence of exon 3a in the RBM3 mRNA can be detected by using PCR primers complementary to sequences upstream and downstream of exon 3a, e.g., binding to exons 3 and 4 or 5, or intronic sequences upstream and downstream of exon 3a. As discussed above, inhibition of translation can be used to stabilize exon 3a-containing mRNA isoforms before NMD-mediated degradation occurs.
[0093] Thus, in another aspect, a PCR primer pair is provided. In some embodiments, the PCR primers are a forward primer (5'-TCATCACCTTCACCAACCCA (SEQ ID NO: 7)) and a reverse primer (5'-TCTAGAGTAGCTGCGACCAC (SEQ ID NO: 8)). In some embodiments, the PCR primers are a forward primer (5'-TCATCACCTTCACAAACCCA (SEQ ID NO: 9)) and a reverse primer (5'-GTGGTCGCAGTTACTCTAGA (SEQ ID NO: 10)) designed for the mouse RBM3 gene.
[0094] Genome editing Genome editing can be used to create cell lines lacking RBM3 exon 3a, or as a therapy to prevent or treat diseases described herein. Various genome editing techniques, such as CRISPR / Cas9, can be used to remove exon 3a from the gene of RBM3. Exon 3a can be removed using a guide RNA pair. Engineered cells lacking exon 3a can show higher expression of RBM3 even at low temperatures, for example, as shown in the specific embodiment of Example 5.
[0095] In another aspect, a genetically engineered cell is provided that is missing exon 3a.In certain embodiments, the expression of RBM3 in the genetically engineered cell is higher than that in wild-type (or other control) cells.In some embodiments, the expression of RBM3 at 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, or 41°C is higher in the genetically engineered cell than that in wild-type (or other control) cells.
[0096] In one aspect, a guide RNA pair is provided for removing exon 3a from the gene RBM3, where optionally the first guide RNA can hybridize to the gene upstream of exon 3a and the second guide RNA can hybridize to the gene downstream of exon 3a. In some embodiments, the first guide RNA comprises SEQ ID NO: 11 or SEQ ID NO: 12 and the second guide RNA comprises SEQ ID NO: 13.
[0097] BasesEdit Using CRISPR-mediated base editing, the splice site of RBM3 exon 3a can be altered, resulting in permanent exon exclusion (de-inclusion).
[0098] The Cas protein forms a complex with the 3' end of the gRNA. The specificity of the CRISPR-based system depends on two factors: the targeting sequence and the protospacer adjacent motif (PAM). The targeting or recognition sequence is located at the 5' end of the gRNA and is designed to base-pair on the host DNA (target nucleic acid or target DNA) at a precise DNA sequence known as the protospacer. By simply exchanging the recognition sequence of the gRNA, the Cas protein can be directed to a new genomic target. The PAM sequence is located on the DNA to be modified and is recognized by the Cas protein. The PAM recognition sequence of the Cas protein can be species-specific.
[0099] As is well known in the art (see, for example, Kluesner, Mitchell G., et al. "CRISPR-Cas9 cytidine and adenosine base editing of splice-sites mediates highly-efficient disruption of proteins in primary and immortalized cells." Nature communications 12.1 (2021): 1-12), base editors are a class of gene editing enzymes consisting of a Cas protein fused to a base editing domain, e.g., Cas9 nickase fused to a nucleotide deaminase domain. In principle, base editors localize to the target region in the genome guided by the gRNA. Once bound, the Cas9 complex displaces the unbound strand and forms a ssDNA R-loop. The R-loop becomes accessible to the tethered deaminase domains, whereby a cytidine deaminase base editor (CBE, C:G→T:A) deaminates C→U, base-pairing like a T, and an adenosine deaminase base editor (ABE, A:T→G:C) deaminates A→I, base-pairing like a G. Simultaneous nicking of the unedited strand by the core Cas9 nickase then stimulates DNA repair, and the newly deaminated base is used as a template for DNA polymerization, thereby preventing editing on both strands of DNA.
[0100] Examples of therapeutic base editing are disclosed, for example, in WO2022081612A1.
[0101] In some embodiments, the base editing domain comprises an adenosine deaminase base editor (ABE). Adenine base editors include, for example, ecTadA, including wild-type and mutant forms thereof. Adenosine deaminase base editors are described in Gaudelli et al. (Nature 2017, 551, 464-471), Koblan et al. (Nature Biotech.2018, 36, 843-846), Richter et al. (Nature Biotech.2020, 38, 883-891), and Gaudelli et al. (Nature Biotech.2020, 38, 892-900), each of which is incorporated herein by reference.
[0102] In some embodiments, the base editing domain comprises a cytidine deaminase domain. The cytidine deaminase domain can convert the DNA base cytosine to uracil. In some embodiments, the cytidine deaminase domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) family deaminase. In some embodiments, the cytidine deaminase domain comprises an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, or a combination thereof. In some embodiments, the cytidine deaminase domain comprises an APOBEC1 deaminase. In some embodiments, the cytidine deaminase domain comprises a rat APOBEC1 deaminase. In some embodiments, a cytidine deaminase enzyme (e.g., rAPOBEC1) can be fused to the N-terminus of dCas to produce a base editing enzyme called BE1.
[0103] In some embodiments, the CRISPR / Cas-based base editing system comprises a Cas9 protein, such as dCas9 without catalytic activity. The Cas9 protein is an endonuclease that cleaves nucleic acids and is encoded by the CRISPR locus and participates in the type II CRISPR system. The Cas9 molecule can interact with one or more gRNAs and with the gRNA molecule to localize to a site that includes a target domain, in certain embodiments, a site that includes a PAM sequence. For example, a transformation assay can be used to determine the ability of the Cas9 molecule to recognize the PAM sequence. In some embodiments, the Cas9 protein is derived from Streptococcus pyogenes. In some embodiments, the Cas9 protein is derived from Staphylococcus aureus.
[0104] In some embodiments, the Cas9 protein may be mutated to reduce or inactivate nuclease activity.
[0105] Wild-type Cas9 has two active sites for cleaving DNA (RuvC and HNH nuclease domains), one for each strand of the double helix. However, nickase variants of Cas9 (e.g., Addgene, plasmid no. (#)48873) that can cleave only one strand of DNA due to catalytic inactivation of the RuvC or HNH nuclease domains are readily available. Thus, in certain embodiments, the Cas protein comprises a Cas9 nickase. In a preferred embodiment, the Cas protein comprises a S. aureus Cas9 D10A nickase. In another embodiment, the Cas protein comprises a S. aureus Cas9 H840A nickase.
[0106] Inactivated Cas9 protein without endonuclease activity (also called "iCas9" or "dCas9") can be targeted by gRNA to genes in bacteria, yeast, and human cells to silence gene expression through steric hindrance. Exemplary mutations for the S. pyogenes Cas9 sequence that reduce or inactivate nuclease activity include: D10A, E762A, H840A, N854A, N863A, and / or D986A. Exemplary mutations for the S. aureus Cas9 sequence that inactivate nuclease activity include D10A and N580A.
[0107] The Cas9 protein or mutant Cas9 protein may be derived from a bacterial or archaeal species, such as Streptococcus pyogenes, Staphylococcus aureus, Streptococcus thermophilus, or Neisseria meningitidis. In some embodiments, the Cas protein or mutated Cas9 protein is selected from the group consisting of Streptococcus, Staphylococcus, Brevibacillus, Corynebacter, Sutterella, Legionella, Francisella, Treponema, Filifacto, Eubacterium, Lactobacillus, Bacteroides, Flavibacterium, Lactobacillus, Bacteroides ... The Cas9 protein is derived from the bacterial genus Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, or Campylobacter.In some embodiments, the Cas9 protein or mutated Cas9 protein is selected from the group consisting of Streptococcus pyogenes, Francisella novicida, Staphylococcus aureus, Neisseria meningitidis, Streptococcus thermophilus, Treponema denticola, Brevibacillus laterosporus, Campylobacter jejuni, Corynebacterium diphtheria, Eubacterium ventrilosum, and the like. ventriosum, Streptococcus pasteurianus, Lactobacillus farciminis, Sphaerochaeta globus, Azospirillum, Gluconacetobacter diazotrophicus, Neisseria cinerea, Roseburia intestinalis, Parvibaculum lavamentivorans, Nitratifractor salsuginis and Campylobacter lari.
[0108] Vectors and Nucleic Acids In some embodiments, the CRISPR / Cas fusion protein may be provided by a nucleic acid (e.g., vector, construct) encoding the fusion protein and optionally a gRNA. Vectors encoding CRISPR / Cas-based base editing systems are commercially available, for example, from Addgene (see, for example, pCMV-ABE7.10, https: / / www.addgene.org / 102919 / ). Examples of vectors that include a cloning site for gRNA expression include modified ABE7.10 versions containing a gRNA expression cassette (e.g., those referred to as ABE7.10_4.1 and ABE7.10_3.1, as described in Escobar, Helena, et al. “Base editing repairs an SGCA mutation in human primary muscle stem cells.” JCI insight 6.10 (2021)).
[0109] The area to be edited In one embodiment, a CRISPR / Cas-based base editing system is provided for modifying an RNA splice site encoded in a target genomic DNA. The CRISPR / Cas-based base editing system includes a fusion protein and at least one gRNA, the fusion protein includes a Cas protein and a base editing domain, and the at least one gRNA can hybridize with a region (i.e., a target region) in the RBM3 gene.
[0110] In some embodiments, the region is the region spanning the 3' splice site of exon 3a of RBM3.
[0111] In other embodiments, the region is the region spanning the 5' splice site of exon 3a of RBM3.
[0112] In yet other embodiments, the region spans the internal alternative splice site in exon 3a of RBM3 at nucleotide 107 of exon 3a.
[0113] In some embodiments, the CRISPR / Cas-based base editing system comprises one gRNA targeting a region spanning the 3' splice site, a gRNA targeting a region spanning the 5' splice site, and / or a gRNA targeting an internal alternative splice site in exon 3a.
[0114] The splice sites that can be base edited using the systems described herein are shown in bold in the following sequences: [ka] [ka] is the splice acceptor immediately preceding the 3' splice site of exon 3a. [ka] is an internal splice site in exon 3a (nucleotides 106-107). [ka] is the splice donor immediately following the 5' splice site of exon 3a.
[0115] gRNA As described above, the CRISPR / Cas-based base editing system includes at least one gRNA. The gRNA targets the RBM3 gene. The gRNA can bind and target regions of the RBM3 gene described herein. The gRNA can target RNA splice sites in the RBM3 gene. The gRNA provides targeting for the CRISPR / Cas-based base editing system. The gRNA can be a fusion of two non-coding RNAs: crRNA and tracrRNA. The gRNA can target a DNA sequence of interest through complementary base pairing with the DNA target of interest, usually over a region of 20 nucleotides. The tracrRNA serves as a binding scaffold for the Cas nuclease.
[0116] It will be understood by those skilled in the art that even if a splice site is selected for editing, many different specific target regions and specific gRNAs can be used to effect the change. This will depend on the PAM site (e.g., "NGG") utilized by the selected CRISPR / Cas-based base editing system and the "distance of the editing window" from that site, as well as the editing that is decided to be performed. Taking into account the disclosures herein and general knowledge, those skilled in the art will be able to select the appropriate gRNA and system.
[0117] "Target region" refers to the region of the target gene that the CRISPR / Cas-based gene editing system targets and binds to. The portion of the gRNA that targets (hybridizes with) the target sequence in the genome may be referred to as the "targeting sequence" or "targeting portion" or "targeting domain." "Protospacer" or "gRNA spacer" may refer to the region of the target gene that the CRISPR / Cas9-based gene editing system targets and binds to; "protospacer" or "gRNA spacer" may also refer to the portion of the gRNA that is complementary to the targeted sequence in the genome. The gRNA may include a gRNA scaffold. The gRNA scaffold may facilitate binding of as9 to the gRNA and facilitate endonuclease activity. The gRNA scaffold is a polynucleotide sequence that follows the portion of the gRNA that corresponds to the sequence that the gRNA targets. Taken together, the gRNA targeting portion and the gRNA scaffold form one polynucleotide.
[0118] The gRNA may include a targeting domain at its 5' end that is sufficiently complementary to the target region to be able to hybridize, for example, with about 10 to about 20 nucleotides of the target region of the target gene when followed by an appropriate protospacer adjacent motif (PAM) in the genome, where the target region or protospacer is followed by a PAM sequence at the 3' end of the protospacer.
[0119] The targeting domain of the gRNA does not need to be completely complementary to the target region of the target DNA. In some embodiments, the targeting domain of the gRNA is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% complementary to the target region (or has 1, 2, or 3 mismatches compared to the target region) over a length of, such as, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.
[0120] Typically, the targeting domain or portion of the crRNA or gRNA that hybridizes to the target DNA region is 16, 17, 18, 19, 20, or 21 nucleotides in length, more preferably 17-20 nucleotides in length, and optionally 20 nucleotides in length.
[0121] Examples of CRISPR / Cas-based base editing systems and related materials and methods In one embodiment, a CRISPR / Cas-based base editing system for altering an RNA splice site encoded in genomic DNA of a subject is provided, The CRISPR / Cas-based base editing system comprises a fusion protein and at least one guide RNA (gRNA), The fusion protein comprises a Cas protein and a base editing domain, the at least one gRNA is capable of hybridizing to a region in the RBM3 gene; The areas are: (i) nucleotides 136-147, 137-147, 138-147, 139-147, 140-147, 141-147, 142-147, 143-147, 144-147, 145-147, or 146-147 of SEQ ID NO:32, or a complementary sequence thereof, such that the splice site located at nucleotides 146-147 of SEQ ID NO:32 is altered; (ii) SEQ ID NO: 6 or a complementary sequence thereof, such that the splice site located at nucleotides 106 to 107 of SEQ ID NO: 6 is altered; or (iii) nucleotides at positions 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 of SEQ ID NO:33, or a complementary sequence thereof, such that a splice site located in the first two nucleotides of SEQ ID NO:33 is altered; Including, Optionally, the gRNA, or the targeting domain of the gRNA that hybridizes to the target region, is 16, 17, 18, 19, 20, or 21 nucleotides in length.
[0122] In one embodiment, the region comprises nucleotides at positions 136-147, 137-147, 138-147, 139-147, 140-147, 141-147, 142-147, 143-147, 144-147, or 145-147 of SEQ ID NO: 32, or a complementary sequence thereof, such that a splice site located at at least two nucleotides of SEQ ID NO: 32 is altered, and the region further comprises nucleotides at positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, or 1-15 of SEQ ID NO: 6, or a complementary sequence thereof.
[0123] In one embodiment, the region comprises nucleotides 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 of SEQ ID NO:33, or a complementary sequence thereof, such that a splice site located in the first two nucleotides of SEQ ID NO:33 is altered, and the region further comprises nucleotides 254-269, 255-269, 256-269, 257-269, 258-269, 259-269, 260-269, 261-269, 262-269, 263-269, 264-269, 265-269, 266-269, or 267-269 of SEQ ID NO:6.
[0124] In one embodiment, the region spans nucleotides 106-17 of SEQ ID NO:6 and includes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides such that the splice site located at nucleotides 106-107 of SEQ ID NO:6 is altered.
[0125] Thus, in some embodiments, the CRISPR / Cas-based base editing system disclosed herein is a system for altering a splice site by converting "AG" (splice acceptor) to "AA" or "GG", which facilitates the skipping of exon 3a. In other embodiments, the CRISPR / Cas-based base editing system allows for alteration of a splice site by converting "GT" (splice donor) to "GC" or "AT", which facilitates the skipping of exon 3a.
[0126] Adenosine or cytidine base editing on the coding or non-coding DNA strand can be used to alter the 3' splice site of Rbm3 exon 3a (the last two nucleotides of SEQ ID NO: 32 in humans or SEQ ID NO: 30 in mice), the 5' splice site of Rbm3 exon 3a (the first two nucleotides of SEQ ID NO: 33 in humans or SEQ ID NO: 31 in mice) and / or the internal 3' splice site at positions 106-107 in SEQ ID NO: 6 (human) or SEQ ID NO: 5 (mouse).
[0127] In some embodiments, the base editing domain comprises an adenosine deaminase base editor that converts "AG" at positions 146-147 of SEQ ID NO:32 to "GG."
[0128] In some embodiments, the gRNA hybridizes to a region spanning the 3' splice site of exon 3a. In a specific embodiment, the gRNA comprises the sequence TTCTaGGGGGTGGAGGGCAG (SEQ ID NO: 90) or a complementary sequence thereof, optionally with one, two or three nucleotide substitutions.
[0129] In some embodiments, SEQ ID NO:90 is used in conjunction with an adenosine deaminase base editor that converts the "AG" at positions 146-147 of SEQ ID NO:32 to "GG."
[0130] In some embodiments, the base editing domain comprises an adenosine deaminase base editor that converts the "AG" at the internal splice site of exon 3a (nucleotides 106-107).
[0131] In some embodiments, the gRNA hybridizes to a region spanning the 3' splice site of exon 3a. In a specific embodiment, the gRNA comprises the sequence CTACTACCTAAGCCCAAGGC (SEQ ID NO: 91) or a complementary sequence thereof, optionally with one, two or three nucleotide substitutions. Such a gRNA sequence can bind to the reverse DNA strand and target "C", which is complementary to AG.
[0132] In some embodiments, the base editing domain is located immediately following the 5' splice site of exon 3a. [ka] Contains an adenosine deaminase base editor that converts splice donors.
[0133] In some embodiments, the gRNA hybridizes to a region spanning this splice site. In a specific embodiment, the gRNA comprises the sequence CTTACATCTTGACTGAACTC (SEQ ID NO: 92) or a complementary sequence thereof, optionally with one, two or three nucleotide substitutions. Such gRNA sequences can bind to the opposite DNA strand and target "C" or "A", which are complementary to GT, using ABE or CBE.
[0134] Thus, in one embodiment, the target region is selected from SEQ ID NOs: 90, 91, and 92, and at least one gRNA comprises or consists of a sequence that is the RNA equivalent of SEQ ID NOs: 90, 91, and 92, or a complementary sequence thereof.
[0135] In one embodiment, the RNA splice sites encoded in the genomic DNA are altered such that exon 3a is not incorporated in the resulting mature mRNA.
[0136] In one embodiment, the Cas protein comprises Cas9, and optionally the Cas protein comprises Cas9 nickase.
[0137] In one embodiment, the base-editing domain comprises a cytidine deaminase domain or an adenosine deaminase domain.
[0138] In one embodiment, an isolated nucleic acid is provided that encodes and is capable of expressing a guide RNA that can hybridize to a region in the gene for RBM3, the isolated nucleic acid comprising a sequence selected from SEQ ID NO: 90, 91 or 92, or a complementary sequence thereof.
[0139] Also provided are one or more isolated polynucleotides encoding the CRISPR / Cas-based base editing systems described herein, such as gRNAs.
[0140] In one embodiment, the polynucleotide comprises a first polynucleotide encoding a fusion protein and a second polynucleotide encoding at least one gRNA.
[0141] Also provided is an expression construct, optionally a vector, optionally a viral vector, comprising an isolated polynucleotide encoding the CRISPR / Cas system described above.
[0142] Cells comprising the isolated polynucleotide or expression construct are also provided.
[0143] Compositions comprising the CRISPR / Cas-based base editing system, isolated polynucleotide, or expression construct are also provided.
[0144] How to use a CRISPR / Cas-based base editing system In another aspect, a method of inhibiting nonsense-mediated decay of RBM3-encoding mature mRNA in a cell and / or increasing expression of RBM3 in a cell is provided, comprising exposing the cell to a CRISPR / Cas-based base editing system described herein, or a polynucleotide encoding a CRISPR / Cas-based base editing system, to alter a splice site of exon 3a.
[0145] In another aspect, a method for treating or preventing a disease affected by RMB3 expression in a subject or providing neuroprotective therapy to a subject is provided, the method comprising administering a CRISPR / Cas-based base editing system, an isolated nucleic acid, an expression construct, or the above-described composition to a subject.
[0146] In one embodiment, the treatment or procedure comprises: Neurological disease and / or neonatal hypoxic-ischemic encephalopathy, head trauma, or stroke; A neurodegenerative disease selected from any of Alzheimer's disease, Parkinson's disease, prion disease, frontotemporal dementia, tauopathy, amyotrophic lateral sclerosis (ALS), and vascular dementia; or Neurological damage occurring randomly during cardiac surgery or an induced coma; or For depression or anxiety;
[0147] Agents capable of inducing expression of RBM3 According to various aspects of the invention, in some embodiments, the agent is an agent that can inhibit alternative splicing of RBM3 pre-mRNA (inhibits inclusion of exon 3a). In certain embodiments, the agent is an agent that can induce skipping of exon 3. The agent can be exogenous to the cell.
[0148] The agents typically bind to specific regions of the pre-mRNA transcript and can regulate or alter the splicing of the pre-mRNA.
[0149] According to various aspects of the invention, in some embodiments, an agent may hybridize to a region of the RBM3 pre-mRNA to alter the splicing of the pre-mRNA such that the resulting mature mRNA does not include a premature stop codon (PTC) between exons 3 and 4. In some embodiments, the agent is complementary to the RBM3 pre-mRNA to alter the splicing of the pre-mRNA such that the resulting mature mRNA does not include a premature stop codon (PTC) between exons 3 and 4. In certain embodiments, splicing is altered such that exon 3a is not incorporated (skipped) in the resulting mature mRNA.
[0150] According to various aspects of the present invention, in some embodiments, the agent is useful for altering an RNA splice site encoded in the genomic sequence of RBM3. Thus, where appropriate, "agent" can refer to a CRISPR / Cas-based base editing system as described herein, a guide RNA as described herein, or a polynucleotide / expression construct encoding a CRISPR / Cas-based base editing system of the present invention. When a target splice site is shown to be "altered" by a system disclosed herein, it is understood that such a system is adapted to alter and can alter a splice site when introduced into a cell containing the target genomic DNA under appropriate conditions.
[0151] In some embodiments, the agent can hybridize to a target nucleic acid (e.g., pre-mRNA) sequence by Watson-Crick base pairing or wobble base pairing (GU). The agent can have exact sequence complementarity or close complementarity to the target sequence, e.g., essentially complementary (e.g., sufficient complementarity to bind to the target sequence and alter splicing of the pre-mRNA). The agent (e.g., gRNA) can have exact sequence complementarity or close complementarity to the target sequence, e.g., essentially complementary (e.g., sufficient complementarity to bind to the target sequence and allow alteration of the splice site).
[0152] As used herein, "resulting mature mRNA" refers to the product of splicing of a pre-mRNA. It does not necessarily refer to all of the mature mRNA, and an agent may alter the splicing such that at least a portion of the mature mRNA has the above properties.
[0153] In some embodiments, the agent is an agent that can hybridize (or is complementary to) a region spanning exon 3a or its splice site in the pre-mRNA. In certain embodiments, the agent is an agent that can hybridize (or is complementary to) a region spanning the 3' splice site of exon 3a in the pre-mRNA. In some embodiments, the agent is an agent that can hybridize (or is complementary to) a region spanning the 5' splice site of exon 3a in the pre-mRNA. In certain embodiments, the agent is capable of hybridizing (or is complementary to) a region located within 250 nucleotides upstream of exon 3a. In certain embodiments, the agent is capable of hybridizing (or is complementary to) a region located within 250 nucleotides downstream of exon 3a.
[0154] In some embodiments, the agent can hybridize (or be complementary to) a region located within 200 nucleotides upstream of exon 3a. In some embodiments, the agent can hybridize (or be complementary to) a region located within 200 nucleotides downstream of exon 3a. The region can be within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides upstream of exon 3a. The region can be within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides downstream of exon 3a. The region can be within 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides upstream of exon 3a. The region may be within 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides downstream of exon 3a. The region may be within 210, 220, 230, 240 or 250 nucleotides upstream of exon 3a. The region may be within 210, 220, 230, 240 or 250 nucleotides downstream of exon 3a. The region may be upstream or downstream of exon 3a and may correspond to annotated intron 3 of the RBM3 gene, for example, a region corresponding to a sequence shown in Table 3 below.
[0155] In some embodiments, the agent is a nucleic acid and / or a nucleic acid analog, such as an oligonucleotide or a polynucleotide, hi some embodiments, the agent is an antisense oligonucleotide (ASO).
[0156] One embodiment of the disclosure is a composition comprising a nucleic acid and / or a nucleic acid analog, such as a composition comprising a polynucleotide, that inhibits nonsense-mediated mRNA decay (NMD) of RBM3.
[0157] The nucleic acid or polynucleotide is usually an antisense oligonucleotide (ASO) that can hybridize with a specific region of the pre-mRNA transcript and regulate or alter splicing. The ASO can target alternative splice sites and block their use by the spliceosome. In some embodiments, the ASO targets regulatory sequences near or overlapping the 5' or 3' splice site of exon 3a. Ligation of the exon at the 5' splice site of human and mouse exon 3a occurs at the last nucleotide of the sequence shown in Table 1 and Figure IE (see also Figure 4A). Ligation of the exon at the 3' splice site is ligation at the first nucleotide of the sequence of exon 3a shown in Table 1 and Figure IE.
[0158] The agent (e.g., ASO) can prevent the binding of a trans-acting factor to a cis-regulatory element in the pre-mRNA. Thus, the agent can target a cis-regulatory element (a splicing enhancer element) that promotes or induces the inclusion of exon 3a. In certain embodiments, the agent targets the splicing enhancer element (e.g., can hybridize with the splicing enhancer element).
[0159] The splicing enhancer element may be located within exon 3a as described herein.
[0160] The splicing enhancer element may be located in the region upstream or downstream of exon 3a as described herein. Preferably, the splicing enhancer element is located within 250 nucleotides upstream or downstream of exon 3a. The splicing enhancer element may be located in the region between exon 3 and exon 4, which corresponds to the annotated intron 3 of the RBM3 gene. In some embodiments, the splicing enhancer element is located within 200 nucleotides upstream of exon 3a. In some embodiments, the splicing enhancer element is located within 200 nucleotides downstream of exon 3a. The splicing enhancer element may be within 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides upstream of exon 3a. The splicing enhancer element may be within 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides downstream of exon 3a. The splicing enhancer element may be within 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides upstream of exon 3a. The splicing enhancer element may be within 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides downstream of exon 3a. The splicing enhancer element may be within 210, 220, 230, 240 or 250 nucleotides upstream of exon 3a. The splicing enhancer element may be within 210, 220, 230, 240 or 250 nucleotides downstream of exon 3a.
[0161] Regulatory elements such as splicing enhancers and silencers can be identified by screening mutagenesis along a region of the RBM3 gene and measuring the level of inclusion of exon 3a in the transcript of each mutant relative to the wild-type gene. Exemplary methods are described in Example 3.
[0162] In another embodiment, a method is provided for identifying a cis-regulatory element capable of controlling the inclusion of exon 3a in a transcript of RBM3, the method comprising: i) mutating or deleting a set of nucleotides in a region within exon 3a, a region within 250 nucleotides upstream of exon 3a in the RBM3 gene, or a region within 250 nucleotides downstream of exon 3a; ii) measuring the level of inclusion of exon 3a in the transcript; and and iii) comparing the level of inclusion of step ii) with the level of inclusion in the transcript of the wild-type gene. The level of inclusion of exon 3a can be measured by splicing-sensitive RT-PCR.
[0163] In certain embodiments, the agent (e.g., ASO) targets a region that contains a splicing enhancer element. In specific embodiments, the region is selected from: M2, M2-2, M2-2, M2-3, M2-4, M2-6, M2-7 and M2-9, M4, and M4-7. In some embodiments, the region is M4-7. In some embodiments, the region is M2-9. In other embodiments, the region corresponds to the "M2 core" region (SEQ ID NO: 88) or the "M4 core" region (SEQ ID NO: 89). Table 2 provides the sequence, SEQ ID NO, and location of each region.
[0164] [Table 2]
[0165] [Table 3]
[0166] In certain embodiments, the agent (e.g., ASO) targets a region spanning the splice site of exon 3a. In certain embodiments, the region spans the 5' splice site of exon 3a, for example, the region can include nucleotides (nt) 259-271, 260-271, 261-271, 262-271, 263-271, 264-271, 265-271, 266-271, 267-271, 268-271, or 269-271 of SEQ ID NO:5. Thus, the region in human exon 3a may include nt positions 257-269, 258-269, 259-269, 260-269, 261-269, 262-269, 263-269, 264-269, 265-269, 266-269, or 267-269 of SEQ ID NO:6. In some embodiments, the region spans the 3' splice site of exon 3a. The region may include nucleotides positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:5. Thus, the region in human exon 3a may include nt positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:6. In some embodiments, the region comprises nt positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:6 and / or nucleotides positions 136-147, 137-147, 138-147, 139-147, 140-147, 141-147, 142-147, 143-147, 144-147, or 145-147 of SEQ ID NO:32. The region may include nt positions 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 of SEQ ID NO:5 and / or nt positions 117-127, 118-127, 119-127, 120-127, 121-127, 122-127, 123-127, 124-127, 125-127, or 126-127 of SEQ ID NO:30.
[0167] In some embodiments, the agent (e.g., ASO) targets a region within 250 nucleotides upstream of exon 3a or within 250 nucleotides downstream of exon 3a. These upstream and downstream regions can be intron 3 regions (shown in Table 3). The agent targets a splicing enhancer element within one of the upstream or downstream regions listed in Table 3. In certain embodiments, the agent targets a region within SEQ ID NO: 30, 31, 32, or 33, preferably which region contains a splicing enhancer element.
[0168] [Table 4]
[0169] In all embodiments herein, reference to "an mRNA" or "the mRNA" means one or more (at least one) mRNA molecules, and reference to "a pre-mRNA" or "the pre-mRNA" means one or more (at least one) pre-mRNA molecules.
[0170] ASOs are polynucleotides made of nucleotides that contain nucleobases that can hybridize with complementary nucleobases present on a target mRNA (e.g., pre-mRNA), a sugar moiety, and the backbone that links the monomers. The term ASO also embodies oligomeric molecules that contain nucleobases that can hybridize with complementary nucleobases on a target mRNA (e.g., pre-mRNA), but do not contain a sugar moiety, such as peptide nucleic acid (PNA).
[0171] In some embodiments, antisense oligonucleotides (ASOs) are synthetic oligonucleotides. ASOs can be artificial, modified, non-natural oligonucleotides, i.e., they contain one or more chemical modifications compared to natural RNA or DNA polynucleotides or nucleotides. Thus, ASOs can be composed of natural nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the above. The term "natural nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and / or modified backbones. Chemical modifications of ASOs or components of ASOs that are compatible with the methods and compositions described herein will be apparent to those skilled in the art and are described, for example, in U.S. Pat. No. 8,258,109B2, U.S. Pat. No. 5,656,612, U.S. Patent Application Publication No. 2012 / 0190728, and Diasand Stein, Mol. Cancer Ther. 2002, 1, 347-355, which are incorporated herein by reference in their entirety.
[0172] ASOs may contain modified nucleotides with 2'-O-4'-C methylene bridges (LNA, locked nucleic acid) nucleotides. ASOs may contain RNA and / or DNA nucleotides. ASOs may contain a combination of LNA nucleotides and unmodified nucleotides. ASOs may contain a combination of LNA nucleotides and RNA nucleotides. Antisense nucleic acids may contain a combination of LNA nucleotides and DNA nucleotides. The combinations may be alternating LNA and RNA, alternating LNA and DNA, or alternating RNA and DNA. Further preferred oligonucleotide modifications include locked nucleic acids (LNA), in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
[0173] Exemplary ASOs targeting RBM3 pre-mRNA at splicing enhancer elements or splice sites are shown in Table 4. In some embodiments, the ASO comprises one of the SEQ ID NOs: 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 69, and 70, optionally with one, two, or three nucleotide substitutions. In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, 83, 84, 85, 86, and 87, optionally with one, two, or three substitutions. In some embodiments, the ASO comprises or consists of one of SEQ ID NOs: 83, 84, 85, and 87, optionally with one, two, or three substitutions. In certain embodiments, the ASO comprises or consists of one of SEQ ID NOs: 44, 46, 47, 48, 83, 84, 85, 86, and 87, optionally with one, two, or three substitutions.
[0174] In some embodiments, the ASO comprises SEQ ID NO: 60, optionally, the sequence having one, two, or three nucleotide substitutions.
[0175] [Table 5]
[0176] [Table 6]
[0177] * The sequence of M2D is 100% conserved between human and mouse, such that SEQ ID NOs: 45 and 46 are identical. It will be appreciated that where an ASO is listed herein including both SEQ ID NOs: 45 and 46, the corresponding listing (i.e., only SEQ ID NO: 46) is disclosed mutatis mutandis, without this duplication.
[0178] The present invention provides antisense oligonucleotides comprising SEQ ID NO: 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, or 57 for use in methods of treating or preventing a disease affected by RBM3 expression in a subject. The ASO may comprise SEQ ID NO: 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, or 57 with one, two, or three nucleotide substitutions. In some embodiments, the ASO comprises SEQ ID NO: 60, optionally with one, two, or three nucleotide substitutions.
[0179] The present invention provides antisense oligonucleotides comprising SEQ ID NO: 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 83, 84, 85, 86 or 87 for use in a method of treating or preventing a disease affected by RBM3 expression in a subject.
[0180] The ASO may comprise SEQ ID NO: 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 83, 84, 85, 86 or 87 with 1, 2 or 3 nucleotide substitutions.
[0181] In some embodiments, the ASO used comprises or consists of one of SEQ ID NOs: 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, 83, 84, 85, 86 and 87.
[0182] In some embodiments, the ASO used comprises or consists of one of SEQ ID NOs: 83, 84, 85 and 87.
[0183] In certain embodiments, the ASO used comprises or consists of one of SEQ ID NOs: 44, 46, 47, 48, 83, 84, 85, 86 and 87.
[0184] Any of the ASOs described herein may contain modified sugar moieties, such as those found in naturally occurring nucleotides that contain ribose or deoxyribose, or sugar moieties that contain a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions, such as 2'-O-methyl, 2'-O-methoxyethyl (MOE), 2'-O-aminoethyl, 2'-fluoro (2'F); N3'->P5' phosphoramidate, 2' dimethylaminooxyethoxy, 2' dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the modification at the sugar moiety is selected from 2'-O-methyl, 2'-fluoro, and 2'-O-methoxyethyl (MOE).
[0185] The ASOs described herein also include backbone structures that link the components of the oligomer. The terms "backbone structure" and "oligonucleotide linkage" may be used interchangeably and refer to the linkage between the monomers of the ASO. In natural oligonucleotides, the backbone includes 3'-5' phosphodiester linkages that link the sugar moieties of the oligomer. The backbone structures or oligonucleotide linkages of the ASOs described herein include, but are not limited to, phosphorothioate, phosphorodithioate, phosphoroselerloate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoronmidate, and the like. In some embodiments, the backbone modification is a phosphorothioate linkage. For example, LaPlanche et al. Nucleic Acids Res. 14:9081 (1986); Stec et al. J. Am. Chem. Soc. 106:6077 (1984), Stein et al. Nucleic Acids Res. 16:3209 (1988), Zon et al. Anti Cancer Drug Design 6:539 (1991); Zon et al. See Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)) ■ Stec et al. US Pat. No. 5,151,510; Uhlmann and Peyman Chemical Reviews 90:543 (1990).
[0186] In some cases, each monomer of the ASO is similarly unmodified or modified, for example, each linkage of the backbone of the ASO contains a phosphorothioate linkage, or each ribose sugar moiety contains a 2'-O-methoxyethyl (MOE) modification. Modifications present on each of the monomeric components of the ASO are referred to as "uniformly modified" and the ASO is referred to as "fully modified". In some cases, a combination of different modifications may be desired, for example, an ASO may contain a combination of phosphorodiamidate linkages and sugar moieties containing morpholine rings (morpholinos). A combination of different modifications to an ASO is referred to as "mixed modification" or "mixed chemistry".
[0187] In some embodiments, the ASO comprises one or more backbone modifications. In some embodiments, the ASO comprises one or more sugar site modifications. In some embodiments, the ASO comprises one or more backbone modifications and one or more sugar site modifications. In some embodiments, the ASO comprises an MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises a 2'-O-methyl modification and a phosphorothioate backbone. In some embodiments, the ASO comprises a phosphorodiamidate morpholino (PMO). In some embodiments, the ASO comprises a peptide nucleic acid (PNA). In some embodiments, the ASO comprises a ribofuranosyl or 2' deoxyribofuranosyl modification. In some embodiments, the ASO comprises a 2'4'-constrained 2'O-methyloxyethyl (cMOE) modification. In some embodiments, the ASO comprises a cEt 2',4'-constrained 2'-O ethyl BNA modification.
[0188] The phosphate backbone of ASO can be modified to produce peptide nucleic acid molecules. As used herein, the term "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic, e.g., a DNA mimic, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleic acid bases are retained. The natural backbone of PNA has been shown to allow specific hybridization with DNA and RNA under conditions of low ionic strength. Synthesis of PNA oligomers can be performed, for example, using standard solid-phase peptide synthesis protocols.
[0189] Antisense nucleic acids can also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of the oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. The morpholino can also be modified, for example, as a peptide-linked morpholino, phosphorodiamidate morpholino, etc.
[0190] In other embodiments, antisense oligonucleotides can be linked to functional groups such as peptides (e.g., to target host cell receptors in vivo) or agents that facilitate transport across cell membranes or the blood-brain barrier. The disclosed oligonucleotide reagents can also be modified with chemical moieties (e.g., cholesterol) that improve the pharmacological properties of the oligonucleotide reagent in vivo. The disclosed oligonucleotides can also be formed as DNA / RNA heteroduplex oligonucleotides (HDOs) as described in Nagata et al. Nat Biotechnol (2021) https: / / doi.org / 10.1038 / s41587-021-00972-x, which is incorporated herein by reference in its entirety. Conjugation to cholesterol or α-tocopherol at the 5' end of the RNA strand has been shown to enable HDOs to reach the CNS after subcutaneous or intravenous administration (Nagata et al. 2021).
[0191] Any of the ASOs described herein, or any component of the ASO (e.g., nucleobases, sugar moieties, backbone) can be modified to achieve a desired property or activity of the ASO, or to reduce an undesirable property or activity of the ASO. For example, the ASO or one or more components of the ASO can be modified to increase binding affinity to a target sequence on an mRNA (e.g., pre-mRNA); decrease binding to non-target sequences; decrease degradation by cellular nucleases (i.e., RNase H); improve uptake of the ASO into cells and / or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; or modulate the half-life of the ASO.
[0192] In some embodiments, the ASO is composed of MOE-phosphorothioate-modified nucleotides. ASOs composed of such nucleotides are particularly well suited for the methods disclosed herein; oligonucleotides with such modifications have been shown to have significantly increased resistance to nuclease degradation and increased bioavailability, making them suitable for, for example, oral, intrathecal, and systemic delivery in some embodiments described herein. For example, after intrathecal injection, 23 The FDA-approved drug nusinersen is well distributed throughout the central nervous system. 22 Please refer to.
[0193] Methods for synthesizing oligonucleotides such as ASOs are known to those of skill in the art. Alternatively, or in addition, ASOs can be obtained from commercial sources.
[0194] Other methods In another embodiment, a method is provided for identifying an antisense oligonucleotide (ASO) capable of increasing expression of RBM3 in a cell, the method comprising: i) identifying an ASO that targets a region of the pre-mRNA of the RBM3 gene within a region selected from a region within exon 3a, a region spanning the splice site of exon 3a, a region located within 250 nucleotides upstream of exon 3a, and a region located within 250 nucleotides downstream of exon 3a, or a region described herein; ii) delivering the ASO identified in step i) to a cell; and and iii) measuring the expression level of RBM3 in the cells of step ii). iv) comparing the expression level of RBM3 measured in step iii) with the expression level in cells treated with control ASO or DMSO. The expression level of RBM3 can be at the transcript level or protein level. The expression level can be measured by RT-qPCR or Western blotting.
[0195] Unless otherwise specified, the left-handed end of a single-stranded nucleic acid (e.g., mRNA, oligonucleotide, ASO, etc.) sequence is the 5' end, and the left-handed direction of a single-stranded or double-stranded nucleic acid sequence is also referred to as the 5' direction. Similarly, the right-handed end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3' end or direction. Generally, a region or sequence that is 5' to a reference point in a nucleic acid is referred to as "upstream" and a region or sequence that is 3' to a reference point in a nucleic acid is referred to as "downstream". Generally, the initiation (initiation or start) codon is located near the 5' end and the stop codon is located near the 3' end.
[0196] In certain embodiments, methods are provided for inhibiting nonsense-mediated decay of RBM3-encoding mature mRNA in a cell, increasing / inducing expression of RBM3 in a cell, and modulating splicing of RBM3-encoding pre-mRNA in a cell, each of which comprises exposing a cell to an agent capable of hybridizing to a region of RBM3 pre-mRNA as described herein to alter splicing of the pre-mRNA such that exon 3a is not incorporated into the resulting mature mRNA.
[0197] As described herein, the method of inhibiting nonsense-mediated decay of RBM3-encoding mature mRNA in a cell, the method of increasing / inducing expression of RBM3 in a cell, and the method of modulating splicing of RBM3-encoding pre-mRNA in a cell aim to increase the level of expression of RBM3. In some embodiments, the method is performed in vitro. In certain embodiments, the method is performed without cooling, preferably the method is performed at a temperature of ≧34° C., ≧35° C., ≧36° C., or ≧37° C. In other embodiments, each of these methods is performed with cooling, preferably the method is performed at a temperature of ≦35° C., ≦34° C., ≦33° C., or ≦32° C. In some embodiments, the cell is a cell of the central nervous system. In some embodiments, the cell is a neuronal cell, preferably a primary neuron, more preferably a primary hippocampal neuronal cell. In some embodiments, the cell is an astrocyte, oligodendrocyte, microglia, ependymal cell, or brain stem cell. In certain embodiments, the cell is a mouse or human cell. In some embodiments, the cells are in vitro or ex vivo cells.
[0198] As used herein, "expression" may be gene expression or protein expression, and thus may be measured by quantifying the levels of RBM3 transcripts or the protein levels of RBM3.
[0199] Gene expression can be determined, for example, by detection of mRNA encoding RBM3. Methods for measuring or quantifying mRNA levels are well known in the art, and include, for example, RT-PCR, quantitative real-time PCR (RT-qPCR), microarray analysis, Northern blot analysis, RNase protection analysis, or any other suitable method, for example, as described in Rio, DC, RNA: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2011, which is incorporated herein in its entirety.
[0200] Protein expression can be determined, for example, by detection of protein, such as, for example, antibody-based methods well known to those of skill in the art, such as Western blot analysis, immunohistochemistry, immunocytochemistry, flow cytometry, ELISA, and mass spectrometry, or any other suitable method, for example, as described in Link, AJ, Proteomics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 2009, which is incorporated herein in its entirety.
[0201] As used herein, the term "inhibiting NMD" refers to reducing (partially or completely) the extent to which NMD occurs. Inhibiting NMD results in increased RBM3 mRNA levels. For example, inhibiting NMD of RBM3-encoded mature mRNA results in a measurable increase in the amount of RBM3 mRNA. As used herein, "RBM3 mRNA" or "RBM3 mRNA" includes all mRNA isoforms (transcripts) of the RBM3 gene, and RBM3 mRNA levels can be measured using RBM3-specific PCR primers that are not splicing sensitive. Examples of such primer pairs are shown in Table 6 of Example 5.
[0202] Inhibition of NMD results in an increase in RBM3 mRNA levels compared to RBM3 mRNA levels in the absence / absence of agonist or ASO treatment (e.g., no agonist or ASO is present in the cells, total levels) or compared to RBM3 mRNA levels with treatment with a control ASO (e.g., control ASO is present in the cells, total levels). The mRNA level is increased by 5% or more, e.g., 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 1000% or more. Inhibition of NMD results in a 1.01, 1.05, 1.10, 1.25, 1.50, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10-fold or greater increase in RBM3 mRNA levels compared to RBM3 mRNA levels in the absence / treatment of agonist or ASO (e.g., total levels, where no agonist or ASO is present in the cell) or compared to RBM3 mRNA levels following treatment with a control ASO (e.g., total levels, where a control ASO is present in the cell).
[0203] Inhibition of NMD of RBM3-encoded mature mRNA by inhibiting inclusion of exon 3a results in increased levels of mRNA isoforms that do not contain exon 3a, i.e., mature mRNAs in which exon 3a is not incorporated (exon 3a is skipped) or in which exons 3 and 4 are spliced together without the intervening exon. The levels of such mRNAs can be measured using splicing-sensitive PCR primers. Inhibiting NMD by inhibiting inclusion of exon 3a results in a 5% or greater, e.g., 9%, 10%, 15%, 20%, 25%, 30%, or greater increase in mRNA levels compared to levels in the absence / absence of agonist or ASO treatment (e.g., no agonist or ASO is present in the cell, total levels) or compared to levels treated with a control ASO (e.g., a control ASO is present in the cell, total levels). %, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 1000% or more increase in such mRNA levels. Inhibition of NMD results in a 1.01, 1.05, 1.10, 1.25, 1.50, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10-fold or greater increase in the level of such mRNA compared to levels in the absence / treatment of agonist or ASO (e.g., total levels, no ASO present in the cells) or compared to levels following treatment with a control ASO (e.g., total levels, no control ASO present in the cells).
[0204] Inhibition of NMD by blocking exon 3a inclusion reduces the inclusion frequency of exon 3a. Exon 3a inclusion frequency can be quantified as "percent spliced out" (PSI), which corresponds to the proportion of the abundance of an mRNA isoform in which exon 3a is included over the abundance of all RBM3 isoforms (×100%). The difference in PSI between two conditions is called "dPSI" and is calculated by subtraction (dPSI(%)=PSI コントロール -PSI 処置 ). Translation inhibitors can be used to stabilize exon 3a-containing mRNAs, thus allowing their accumulation and detection. An exemplary inhibitor of translation is cycloheximide (CHX). Inhibition of NMD by inhibiting the inclusion of exon 3a results in a reduction in the frequency of exon 3a inclusion (PSI) compared to the inclusion level in the absence / treatment of the agonist or ASO (e.g., no agonist or ASO is present in the cell, PSI) or compared to the inclusion level (PSI) when a control ASO is present in the cell, which reduction is 1% or more, for example 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more.
[0205] Inhibition of NMD by inhibiting inclusion of exon 3a increases the level of protein, e.g., the protein product level of the transcript of RBM3. For example, inhibition of NMD of RBM3-encoded mature mRNA by inhibiting inclusion of exon 3a measurably increases the amount of total protein that can be translated from RBM3 mRNA. The protein product can be a truncated or full-length protein. In some embodiments, inhibition of NMD by inhibiting inclusion of exon 3a increases RBM3 protein levels by 5% or more, e.g., 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 450%, 500% or more, compared to RBM3 protein levels in the absence / treatment of the agonist or ASO (e.g., the expression level of RBM3 protein when no ASO is present in the cell) or when treatment with a control ASO is performed. In some embodiments, inhibition of NMD by inhibiting inclusion of exon 3a results in an increase in protein levels of 1.01, 1.05, 1.10, 1.20, 1.25, 1.3, 1.35, 1.40, 1.45 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, 1.80, 1.85, 1.90, 1.95, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 fold or more compared to RBM3 protein levels in the absence / treatment of the agonist or ASO or in the presence of a control ASO.
[0206] Method of administration ASOs can be provided to an individual by any of a variety of methods, such as those described by Juliano et al., referenced above, including delivery of "free" or "naked" ASOs that are taken up by some cells, delivery of ASOs conjugated to cell membrane-permeable peptides (CPPs, e.g., TAT and antennapedia peptides), delivery of ASOs conjugated to ligands for cell receptor uptake (e.g., ASO-cholesterol conjugates, ASO-folate conjugates, N-acetylgalactosamine conjugates, ASO-insulin-like growth factor 1 conjugates, ASO-RGD peptide conjugates, ASO-bombesin conjugates, etc.), delivery of ASOs coupled to nanocarriers (e.g., ASOs coupled to lipid-based carriers, perfluorocarbon nanoparticles, ASO-antibody conjugates, etc.). Other methods of delivering nucleic acids, such as ASOs, are known in the art and include, but are not limited to, cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBOJ., 1991, 10, 1111-1118; Kabanov et al, FEBS Lett, 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac glycerol or triethylammonium 1,2-di-O-hexadecyl-rac glycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al. Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al. Tetrahedron Lett., 1995, 36, 3651-3654), palmityl moieties (Mishra et al, Biochim. Biophys. Acta, 1995, 1264, 229- 237), or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0207] Disease or condition The methods and agents of the invention may be useful in the treatment or prevention of any disease that may be affected by RBM3 expression. Accordingly, the invention provides the agents described herein for use in a method of treating or preventing a disease affected by RBM3 expression in a subject.
[0208] Therapeutic hypothermia is known to induce expression of RBM3, and the methods and agents of the present invention may be useful in the treatment or prevention of any disease or condition that is treated or prevented by inducing therapeutic hypothermia.
[0209] Therapeutic hypothermia is one of the most powerful neuroprotective agents studied to date (Yenari M. & Han H., Neuroprotective mechanisms of hypothermia in brain ischaemia. Nature Reviews Neuroscience, 13, 267-278 (2012)). Thus, in some embodiments, the disease is a neurodegenerative disease or a neurological injury or injury. In some embodiments, the disease is depression or anxiety. In some embodiments, the agents of the present invention are used as neuroprotective agents. For example, the agents of the present invention may be used during cardiac surgery or induced coma, or in the treatment of hypoxic-ischemic encephalopathy in neonates, or may be used as neuroprotective agents to treat or prevent the diseases or conditions described herein. A neuroprotective agent is an agent that can increase neuroprotection.
[0210] In some embodiments, the disease is a neurodegenerative disease. In certain embodiments, the disease is Alzheimer's disease, prion disease, Parkinson's disease, frontotemporal dementia, amyotrophic lateral sclerosis, tauopathy, amyotrophic lateral sclerosis (ALS), vascular dementia and related disorders.
[0211] Induction or overexpression of RBM3 is protective in animal models of prion disease and Alzheimer's disease (Peretti et al; Nature 518, pages 236-239 (2015), Peretti et al; Life Science Alliance vol. 4 no. 4 e202000884 (2021).
[0212] In some embodiments, the disease is neurological damage or injury. In certain embodiments, the disease is stroke, head or brain injury, spinal cord injury, neonatal hypoxic-ischemic encephalopathy. In some embodiments, the disease is anoxic brain injury. In some embodiments, the disease is neurological damage caused by cardiac arrest. In certain embodiments, the disease is neurological damage caused during cardiac surgery or induced coma.
[0213] The following sections provide further explanation related to diseases / conditions that are affected by RBM3 and / or induced hypothermia.
[0214] Therapeutic hypothermia can not only effectively reduce primary injury and secondary injury in acute ischemia (Yenari M & Han H, 2012) and spinal cord injury (SCI) (Alkabie S, Boileau AJ (2015) The role of therapeutic hypothermia after traumatic spinal cord injury-a systematic review. World Neurosurg. doi:10.1016 / j.wneu.2015.1009.1079), but also slow the progression of chronic neurodegenerative diseases (Salerian AJ, Saleri NG (2008) Cooling core body temperature may slow down neurodegeneration. CNS Spectr 13(3):227-229). In mouse models, hypothermia and induction of RBM3 by cooling, either by inducing upstream or downstream mediators, is highly neuroprotective in prion disease and Alzheimer's disease mice, restoring synapse number, memory, preventing brain cell death, and increasing survival time (Peretti et. al. Nature 2015; Bastide et al., 2017, Current Biology 27, 638-650; Peretti et al. Life Sci Alliance. 2021;4(4):e202000884. doi: 10.26508 / lsa.202000884). In vitro, two cold-inducible proteins, CIRP and RBM3, both function against apoptosis in cultured primary neurons or neuronal-like PC12 cells [Chip S, et al. (2011) Neurobiol Dis 43(2):388-396; Zhang HT, et al. (2015) Brain Res 1622:474-483; Kita H, et al. (2002) Hum Mol Genet 11(19):2279-2287; Zhu et al. Cell. Mol. Life Sci. (2016) 73:3839-3859].
[0215] Yenari M & Han H (2012) reported that clinical studies have demonstrated that therapeutic hypothermia improves anoxic brain injury caused by cardiac arrest (Bernard, SA et al. Treatment of comatose survivors of out-of-hospital cardiac arrest with induced hypothermia. N. Engl. J. Med. 346, 557-563 (2002); The Hypothermia after Cardiac Arrest Study Group. Mild therapeutic hypothermia to improve the neurologic outcome after cardiac arrest. N. Engl. J. Med. 346, 549-556 (2002)) and neonatal hypoxic-ischemic encephalopathy (Gluckman, PD et al. Selective head cooling with mild systemic hypothermia after neonatal encephalopathy: multicentre randomised trial. Lancet 365, 663-670 (2005); Shankaran, S. et al. Whole-body hypothermia They discuss the role of therapeutic hypothermia in neuroprotection in some clinical conditions, including for neonates with hypoxic-ischemic encephalopathy. N. Engl. J. Med. 353, 1574-1584 (2005)). The above studies demonstrate a clear role for RBM3 induced by therapeutic hypothermia, experimental cooling or overexpression in mouse models in the treatment and prevention of spinal cord injury, neurodegenerative diseases, anoxic brain injury and hypoxic-ischemic neonatal encephalopathy.
[0216] In addition to its neuroprotective effects, high RBM3 levels are clinically associated with long-term overall survival in cancer (Avila-Gomez P. et al., Cold stress protein RBM3 responds to hypothermia and is associated with good stroke outcome, Brain Communications, Volume 2, Issue 2, 2020, https: / / doi.org / 10.1093 / braincomms / fcaa078). For example, long-term overall survival was observed in patients with intestinal-type gastric cancer (Ye FP et al. Med Sci Monit 2017; 23: 6033-41), invasive breast cancer (Kang et al., J Breast Cancer 2018; 21: 288-96) and colon cancer (Jang HH et al., Anticancer Res 2017; 37: 1779-85), and metastatic colorectal cancer (Siesing C, et al. PLoS One 2017; 12: e0182512.).
[0217] In some embodiments, the disease is cancer, hi certain embodiments, the cancer is gastric cancer, breast cancer, colon cancer, or colorectal cancer.
[0218] The present invention provides methods and compositions for the treatment or prevention of a disease or condition.
[0219] The term "treatment" as used herein in the context of treating a condition generally relates to treatment and therapy of a human subject in which some desired therapeutic effect is achieved, such as inhibition of progression of the condition, and includes reducing the rate of progression, stopping the rate of progression, reversing the condition, ameliorating the condition, and curing the condition. Treatment as a preventative measure (i.e., prevention, prevention) is also included.
[0220] In some embodiments, the method further includes contacting, introducing, delivering, or administering to a subject two active agents or two ASOs described herein.
[0221] Administration of an agent (e.g., an ASO) according to the present invention is preferably in a "therapeutically effective" or "prophylactically effective" amount, which is sufficient to show benefit to a subject.
[0222] The term "therapeutically effective amount" as used herein relates to an amount of an agent (e.g., an ASO) effective to produce some desired therapeutic effect, commensurate with a reasonable benefit / risk ratio, when administered in accordance with a desired treatment regimen.
[0223] Similarly, the term "prophylactically effective amount" as used herein relates to an amount of an agent (e.g., an ASO) that is effective, when administered in accordance with a desired treatment regimen, to produce some desired prophylactic effect commensurate with a reasonable benefit / risk ratio.
[0224] "Prophylaxis" in the context of this specification should not be understood to describe complete success, i.e. complete protection or complete prevention. Rather, prophylaxis in the context of this invention refers to measures taken prior to detection of a symptomatic condition with the intent of preserving health by helping to delay, reduce, or avoid that particular condition.
[0225] For therapeutic applications, the agents of the present invention are preferably formulated as a pharmaceutical or drug together with one or more other pharma- ceutically acceptable ingredients well known to those skilled in the art, including but not limited to pharma- ceutically acceptable carriers, adjuvants, excipients, diluents, fillers, buffers, preservatives, antioxidants, lubricants, stabilizers, solubilizers, surfactants (e.g., wetting agents), masking agents, colorants, flavoring agents, and sweetening agents.
[0226] As used herein, the term "pharmaceutical acceptable" refers to compounds, ingredients, materials, compositions, dosage forms, etc., that are suitable for use in contact with the tissues of a subject (e.g., a human) of interest without undue toxicity, irritation, allergic response, or other problem or complication, within sound medical judgment and commensurate with a reasonable benefit / risk ratio.
[0227] Each carrier, adjuvant, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation.
[0228] Suitable carriers, adjuvants, excipients, etc. can be found in standard pharmaceutical texts, such as Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990; and Handbook of Pharmaceutical Excipients, 2nd edition, 1994.
[0229] The present invention further provides compositions comprising an agent (e.g., an ASO, a vector) described herein. The composition is preferably a pharmaceutical composition or a medicament.
[0230] A suitable antisense nucleic acid as disclosed herein can be administered to the subject. For example, the antisense nucleic acid can be an ASO as described herein. In some embodiments, the ASO is expressed from a transgene, for example as an antisense RNA transcript. The transgene can be administered to the subject in a DNA expression construct engineered to express the antisense RNA transcript in the subject. The DNA expression construct can be administered directly or using a viral vector (e.g., a recombinant AAV (rAAV) vector) or other suitable vector. Viral vectors that have been used in gene therapy protocols include, but are not limited to, retroviruses, other RNA viruses, such as poliovirus or Sindbis virus, adenovirus, adeno-associated virus (AAV), herpes virus, SV40, vaccinia, lentivirus, and other DNA viruses. Alternatively, the transgene can be expressed ex vivo, and the resulting antisense RNA transcript can be administered directly to the subject.
[0231] Any suitable polynucleotide (e.g., a polynucleotide encoding a CRISPR / Cas-based base editing system) disclosed herein may be administered to a subject. For example, in some embodiments, as described herein, a CRISPR / Cas-based base editing system may be expressed from one or more transgenes and administered to a subject in a DNA expression construct engineered to express the CRISPR / Cas-based base editing system in the subject. The DNA expression construct may be administered directly or using a viral vector (e.g., a recombinant AAV (rAAV) vector) or other suitable vector. Viral vectors that have been used in gene therapy protocols include, but are not limited to, retroviruses, other RNA viruses, such as polioviruses or Sindbis viruses, adenoviruses, adeno-associated viruses (AAV), herpes viruses, SV40, vaccinia, lentiviruses, and other DNA viruses.
[0232] As disclosed herein, antisense nucleic acids (including DNA expression constructs that can be used to express them) can be administered by a suitable route. For use in therapy, an effective amount of antisense nucleic acids (e.g., oligonucleotides) and / or other therapeutic agents can be administered to a subject by any form that delivers the agent to the tissue of interest. In some embodiments, the agent (e.g., ASO) is administered intrathecally or systemically. Other suitable routes of administration include, but are not limited to, oral, parenteral, intramuscular, intravenous, intraperitoneal, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal administration. Systemic routes include oral and parenteral routes. Several types of devices are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDIs), breath-actuated MDIs, dry powder inhalers (DPIs), spacer / holding chambers in combination with MDIs and nebulizers.
[0233] For oral administration, the agent can be easily formulated by combining the active compound with pharma- ceutically acceptable carriers well known in the art. Such carriers allow the disclosed agent to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc., to be orally ingested by the subject to be treated. Pharmaceutical preparations for oral use can be obtained by adding suitable auxiliaries, optionally as desired, to obtain tablets or dragee cores, grinding the resulting mixture, and processing the mixture of granules as solid excipients. Suitable excipients are, in particular, fillers, such as sugars, for example lactose, sucrose, mannitol, or sorbitol; cellulose preparations, for example corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Optionally, the oral formulations can also be formulated in saline or buffers to neutralize internal acid conditions, or can be administered without a carrier.
[0234] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, and sealed soft capsules made of gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules may contain the active ingredient in admixture with fillers such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate, and optionally stabilizers. In soft capsules, the active agent may be dissolved or suspended in a suitable liquid, such as fatty oils, liquid paraffin, or liquid polyethylene glycol. Additionally, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres are well defined in the art. Formulations for oral administration are usually in dosages suitable for such administration.
[0235] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0236] For administration by inhalation, the agents (e.g., antisense nucleic acids) used according to the present disclosure can be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve that delivers a metered amount. Capsules and cartridges, for example made of gelatin, for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base, such as lactose or starch.
[0237] When it is desirable to deliver them systemically, the agents (e.g., antisense nucleic acids) can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection can be in unit dosage form, e.g., in ampoules or multi-dose containers, with added preservatives. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents, such as suspending, stabilizing and / or dispersing agents.
[0238] subject The subject may be an animal or a human. The subject is preferably a mammal, more preferably a human. The subject may be a non-human mammal, but more preferably a human. The subject may be male or female. The subject may be a patient. The patient may have a disease / condition as described herein. The subject may be diagnosed with a disease / condition requiring treatment, may be suspected of having such a disease / condition, or may be at risk of developing such a disease / condition.
[0239] array
[0240] [Table 7]
[0241] [Table 8]
[0242] [Table 9]
[0243] [Table 10]
[0244] [Table 11]
[0245] Aspects and embodiments of the present invention will now be discussed with reference to the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
[0246] The features disclosed in the above specification, or in the following claims, or in the accompanying drawings, which are expressed in their specific form or in terms of means for performing the disclosed functions, or methods or processes for obtaining the disclosed results, as appropriate, may be used to realize such features separately or in any combination of such features in various forms thereof.
[0247] While the present invention has been described in conjunction with the exemplary embodiments set forth above, many equivalent modifications and variations will be apparent to those skilled in the art in light of this disclosure. Accordingly, the exemplary embodiments of the present invention set forth above are considered to be illustrative and non-limiting. Various changes may be made to the above-described embodiments without departing from the spirit and scope of the present invention.
[0248] For the avoidance of doubt, the theoretical explanations provided herein are provided for the purpose of enhancing the understanding of the reader, and the inventors do not wish to be bound by any of these theoretical explanations.
[0249] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0250] Throughout this specification, including the claims which follow, unless otherwise required by context, the terms "comprise" and "include", as well as variations such as "comprises", "comprising" and "including", will be understood to imply the inclusion of a specified integer or step or group of integers or steps and not the exclusion of any other integer or step or group of steps.
[0251] It should be noted that, as used in the specification and the appended claims, the singular forms "a," "a kind," and "the" include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. The term "about" with respect to numerical values is arbitrary and may mean, for example, + / - 10%.
[0252] Drawing Overview BRIEF DESCRIPTION OF THE DRAWINGS Embodiments and experiments illustrating the principles of the present invention are discussed in conjunction with the accompanying drawings. [Brief description of the drawings]
[0253] [Figure 1A]Rbm3 intron 3 contains an evolutionarily conserved heat-induced poison exon. Figure 1A shows a Sashimi plot identifying a new exon (E3a; with seven premature stop codons: PTC) within Rbm3 intron 3. Mouse primary hepatocytes were incubated at 34°C or 38°C with or without the translation inhibitor cycloheximide (CHX, DMSO as solvent control) and analyzed by RNA sequencing. Below the simplified exon-intron structure, the distribution of sequencing raw reads (on the y-axis) from the Sashimi plot is shown. The number of reads at exon-exon junctions is indicated by the number linking exons. Note that exon 3a is predominantly included at 38°C in CHX. At the bottom, the high sequence conservation across placental species is shown. [Figure 1B] Regulation of Rbm3 exon 3a is conserved in humans. HEK293 cells were presynchronized for 48 h in a square wave temperature cycle (12 h 34°C / 12 h 38°C) (1B). During the last 24 h, cells were treated with DMSO or CHX every 4 h, harvested 4 h later, and analyzed by splicing-sensitive RT-PCR. [Figure 1C] Cells were incubated for 12 h at the indicated temperatures (DMSO / CHX final 4 h) and analyzed by splicing-sensitive RT-PCR. Statistical significance was determined by unpaired t-test and indicated by asterisks: p-values: *p<0.05, **p<0.01, ***p<0.001 (n=3, mean±SD). [Figure 1D] Gene expression of Rbm3 is inversely correlated with exon 3a inclusion. Transcripts per million (TpM) values for Rbm3 are derived from RNA-sequencing data from HEK293 cells incubated for 12 h at the indicated time points and plotted on the right y-axis (light grey, n=2, mean ± SD). Exon 3a inclusion levels are derived from 1C. [Figure 1E]Shown is a sequence alignment of SEQ ID NO: 5 and SEQ ID NO: 6. Mouse RBM3 exon 3a is located in the GRCm39 reference genome chromosome X8010684-8010414 (SEQ ID NO: 5). Human RBM3 exon 3a is located in the GRCh38 reference genome chromosome X48575815-48576083 (SEQ ID NO: 6). Both sequences are shown in Table 1. [Figure 1F] Figure 1 shows stabilization of Rbm3 exon 3a in response to NMD factor knockdown and rescue experiments. Sequencing data were obtained from SRP08313517. [Figure 2A] Rbm3 exon 3a controls temperature-dependent RBM3 expression. CRISPR / CAS9 mediated removal of Rbm3 exon 3a. One of two guide RNAs (#1,#2) targeting the upstream intron was co-transfected with a guide RNA (#3) targeting the downstream intron. Below is the genotyping PCR after clonal selection of HEK293. px459 transfected cells after clonal selection serve as a negative control. [Figure 2B] RT-qPCR of Rbm3 levels in edited cell lines (2B). Clonal cell lines from Figure 2A were incubated at 35°C or 40°C for 24 hours. Isolated RNA was examined by qPCR and Rbm3 expression is shown relative to GAPDH levels (n=2-3). [Figure 2C] Western blot (2C) analysis of Rbm3 levels in edited cell lines. In 2C, lysates from an independent experiment were examined for Rbm3 protein expression, with hnRNP L serving as a loading control. [Figure 2D] Western blot analysis of Rbm3 levels in edited cell lines incubated for 24 hours at 37° C. or 39° C. Lysates were probed for Rbm3 protein expression, hnRNP L served as a loading control. [Figure 2E]Manipulation of Rbm3 exon 3a splicing with morpholinos directly controls Rbm3 expression levels. Morpholinos blocking either the 3'ss or 5'ss of exon 3a were transfected into HEK293 cells for 48 hours at 37°C. Rbm3 expression is shown relative to GAPDH levels and normalized to the non-targeting CTRL morpholino. Statistical significance was determined by unpaired t-test and is indicated by asterisks: p-value: **p<0.01 (n>4). [Figure 2F] Blocking Rbm3 exon 3a inclusion via blocking morpholinos induces Rbm3 protein levels. HEK293 cells (2F) were transfected with the indicated morpholinos for 48 h. HEK293 cells were shifted to 39°C for the final 24 h. Rbm3 protein levels were examined by Western blotting. hnRNP L or GAPDH served as loading controls. [Figure 2G] N2A cells (2G) were transfected with the indicated morpholinos for 48 h. N2A cells were incubated at the indicated temperature (35° C., 37° C., or 39° C.) for the final 24 h. [Figure 2H] Inhibition of CLK1 / 4 kinase by TG003 abolishes the effect of temperature on Rbm3 expression. Whippet-induced TpM values are shown relative to DMSO (35°C). This reveals a nearly 2-fold difference in Rbm3 levels compared to DMSO at 35°C vs. 39°C for 6 hours. Note that this is essentially abolished by the addition of TG003 during the shift from 39°C to 35°C. Data from Haltenhof et al., 2020. [Figure 3A] Minigene mutagenesis allows mapping of cis-regulatory elements controlling Rbm3 exon 3a inclusion. The minigene construct containing the entire untruncated sequence from E3 to E4 (including the upstream 3'ss and downstream 5'ss) is shown. [Figure 3B]Rbm3 minigene recapitulates temperature-controlled exon 3a inclusion. Minigenes from mouse only or mouse and human were transfected into HEK293 (3B) and incubated at the indicated temperatures for >12 h. Exon 3a inclusion was examined by splicing-sensitive PCR. A representative gel image is shown (top). The asterisk marks the product derived from alternative 3 at nucleotide 107 in exon 3a. Quantification of NMD isoform formation in HEK293 is shown (bottom) (n=3; p-values derived by unpaired t-test **p<0.01, ***p<0.001). [Figure 3C] Minigenes from mouse only or mouse and human were transfected into mouse N2A cells (3C) and incubated for >12 hours at the indicated temperatures. Quantification of NMD isoform formation in N2A is shown (n=3; **p<0.01, ***p<0.001 derived by unpaired t-test). [Figure 3D] Systematic mutational screen of regulators in mouse minigenes. The indicated sequence (3D) was replaced by a sequence from human β-globin (M3 contains an internal alternative 3'ss at nucleotide 107 of exon 3a (indicated by an asterisk and line), M6 contains a 5'ss, and the remaining isomers contain exon 2 sequence). Mutations that result in exon skipping upon heating are highlighted in grey (M2 and M4). [Figure 3E] Analysis of NMD exon inclusion in mutants M1-M6 at 33° C. and 39° C. in HEK293 and N2A cells (3E). [Figure 3F] Detailed mutation screening of the M2 region is shown. In the M2 deletion (del), the M2 sequence is removed (and not replaced) (3F). In M2-1 through M2-9, the indicated sequence is replaced by a human β-globin sequence. [Figure 3G]Representative PCR images are shown (3G) after transfection of each mutant in Fig. 3F into HEK293 at 39° C. Mutations resulting in exon skipping (M2, M2 deletion, M2-2, M2-3, M2-4, M2-6, M2-7 and M2-9) are highlighted in grey. [Figure 3H] Detailed mutation screening of the M2 region (boundaries shown on the left) and the M4 region (boundaries shown on the right) is shown. In the M2 or M4 deletion (del), the M2 or M4 sequence is removed (and not replaced). In M2-1 to M2-9 or M4-1 to M4-7, the indicated sequence is replaced by human β-globin exon 2 sequence from the same relative position. Above, a representative PCR image is shown. Below, quantification of detected isoforms is shown (n=2). [Figure 3I] The temperature response of the indicated minigenes is shown. In 3I, we used substitutions of M2 and M4 sequences. [Figure 3J] In 3J, we deleted the evolutionarily conserved core of M2 and M4 regions. Briefly, M2-2 and M2-3 were 100% conserved between humans and mice. Therefore, M2-2 and M2-3 are regarded as the core sequences of M2 enhancer, which are then deleted in hRBM3 minigene. For M4 region, M4-3 is the central region of the conserved sequence. Therefore, M4-5 and part of the upstream sequence of M4-4 were deleted as the core sequence of M4 mutation in hRBM3 minigene. [Figure 3K] Systematic mutation screen of regulators. Analysis of fold change of E3a% in HEK293 at 37° C. and 39° C. (mean±SD, n=2). [Figure 4A] Screening of oligonucleotides to control Rbm3 expression. Oligonucleotides were designed targeting either enhancer element M2-9 (bottom left), enhancer element M4-7 (bottom right) or the 5'ss. M2-9 corresponds to exon 3a nucleotides 42-71 and M4-7 corresponds to nucleotides 152-171. [Figure 4B]Figure 1 shows efficient Rbm3 induction in N2A cells. ASOs were transfected for approximately 24 hours and Rbm3 induction was measured for CTRL ASO (see Table 6) and for HPRT expression. Figure 1 shows the effect of oligonucleotides targeting the M2-9 element on Rbm3 expression at 39°C. [Figure 4C] 1 shows the effect of oligonucleotides targeting the M4-7 element on Rbm3 expression at 39° C. [Figure 4D] 1 shows the effect of oligonucleotides targeting the 5'ss element on Rbm3 expression at 39°C. [Figure 4E] The effect of combinations of two oligonucleotides (MOE and M2D, MOE and M2A, and M2D and M2A) on Rbm3 expression (same CTRL sample) at 39° C. is shown. [Figure 4F] The effect of MOE and M2D on Rbm3 expression at 37° C., including additional controls, in non-transfected cells (N2A_37° C.), is shown. [Figure 4G] The effect of MOE+2 on Rbm3 expression at 37° C. is shown, including additional controls, in non-transfected cells (N2A_37° C.). [Figure 4H] Morpholino oligonucleotides corresponding to the M2Db sequence induce RBM3 expression (highlighted in grey) in a dose-dependent manner (concentrations: 0.5, 1 and 3 μM); both at 37° C. and 39° C. Morpholinos were transfected for 48 hours. [Figure 4I] PS- and MOE-modified M2Da efficiently induced Rbm3 expression in human HEK293 cells. M2Da induced RBM3 expression by 1.5-fold. [Figure 4J] M2D induces Rbm3 mRNA expression. ASOs were transfected in human HeLa cells for 24 hours at 37°C or 40°C. Induction of Rbm3 was measured relative to CTRL ASO at 37°C and relative to GAPDH expression (mean ± SD, n=3, all individual data points shown; p-value derived by unpaired t-test****p<0.0001). [Figure 5A] In vivo administration of ASO targeting exon 3A induces RBM3 expression and reduces exon 3A inclusion in the brain without cooling. Western blots showing RBM3 levels after treatment with M2D, M2Db, MOE+2 and M4D, scrambled control ASO (SCRM) and PBS only are shown. n=2 mice / condition. Mice received 100 μg of scrambled or RBM3 ASO by intracerebroventricular injection. Three weeks after injection, hippocampal RBM3 levels were analyzed by western blot. [Figure 5B] Quantification of RBM3 levels relative to PBS-injected control mice from Western blots in Figure 5C, 2 mice / group. [Figure 5C] ASO (300 μg) induces RBM3 protein expression in vivo. Hippocampal samples from two independent mice / conditions were analyzed by Western blot (top) and RBM3 protein was quantified relative to actin and PBS (bottom, n=2). [Figure 5D] ASOs targeting M2, M4 or 5'ss reduce E3a inclusion in vivo (dose 300 μg / mouse). Cerebellar RNA samples from two independent mice / disease conditions were analyzed by splicing-sensitive RT-PCR and E3a% signal was quantified (n=2). [Figure 6A] Rbm3 exon 3a controls temperature-dependent RBM3 expression (Additional Data). CRISPR / CAS9-mediated deletion of RBM3 E3a was performed as described with respect to Figure 2A and in Example 2. RT-PCR in CHX-treated Hek293 cells confirms CRISPR / CAS9-mediated deletion of E3a in ΔE3a clones at the RNA level. [Figure 6B] RT-qPCR (6B) analysis of Rbm3 levels in edited cell lines. Clonal cell lines from 6A were incubated at the indicated temperatures for 24 hours. In 6B, isolated RNA was examined by qPCR and Rbm3 expression is shown relative to Gapdh levels. [Figure 6C]Western blot (6C) analysis of Rbm3 levels in edited cell lines. A representative Western blot shows RBM3 protein detected. [Figure 6D] Western blot (6D) analysis of Rbm3 levels in edited cell lines. Lysates from independent experiments were examined for RBM3 protein expression, and hnRNP L served as a loading control (mean ± SD, n=6 (3 / clone, shown in black / grey), all individual data points shown). Statistical significance was determined by unpaired t-test and indicated by asterisks *p<0.05, ***p<0.001, ****p<0.0001). [Figure 7A] Screening of oligonucleotides controlling human Rbm3 expression (human ASOs shown in Table 7). ASOs targeting M2-9, M4-7 or 5'ss (see Figure 7B) prevent Rbm3 E3a inclusion in human HeLa cells. ASO transfected cells were maintained at 40°C for 24 hours. Control samples at 37°C and 40°C are shown; CHX was added for the last 4 hours. Exon 3a inclusion was examined by splicing-sensitive RT-PCR, and representative gels and phosphor imager quantification are shown (mean ± SD, n=3). Asterisks mark the use of internal 5' and 3'ss promoted by all ASOs targeting the M4 region. ASOs targeting the 5'ss induced the use of internal 5'ss (marked by two asterisks). [Figure 7B]ASOs targeting M2-9, M4-7 or 5'ss prevent inclusion of Rbm3 E3a in human HeLa cells. ASO-transfected cells were maintained at 40°C for 24 hours. Control samples at 37°C and 40°C are shown; CHX was added for the last 4 hours. Inclusion of exon 3a was examined by splicing-sensitive RT-PCR. Quantification is shown (n=2; for all M2D variants and M2E, n=5, for M4B, n=1). Asterisks mark the use of internal 5' and 3'ss promoted by all ASOs targeting the M4 region. Note that all variants targeting the M2D region prevent inclusion of E3a to levels lower than those seen in control cells at 37°C. [Figure 7C] A representative gel used to quantify exon 3a inclusion in Figure 7B is shown. [Figure 7D] A representative gel used to quantify exon 3a inclusion in Figure 7B is shown. [Figure 8A] M2D increases hippocampal RBM3 levels and is highly neuroprotective in vivo. Schematic diagram of experimental design. Prion-inoculated tg37+ / - mice were injected with 200 μg M2D or scrambled ASO at 3 weeks post-inoculation (wpi). [Figure 8B] Western blots of hippocampal lysates from prion-infected mice treated with scrambled ASO or M2D show that M2D increases RBM3 expression 2-fold compared to scrambled mice at 12 weeks post-inoculation (wpi), 9 weeks after ASO injection. [Figure 8C] Representative images of hematoxylin and eosin stained brain slices from normal brain homogenate (NBH) or prion treated mice further treated with scrambled or M2D-ASO are shown. Slices were prepared 12 weeks post-inoculation when scrambled treated mice were screened for prion symptoms. M2D confers significant neuroprotection in the hippocampus with preservation of CA1-3 pyramidal cell layers, protection from global hippocampal shrinkage, and reduction of spongiform degeneration. [Figure 8D]1 shows NeuN counts in pyramidal neurons in scrambled and M2D-treated prion mice versus NBH. M2D confers neuroprotection to levels close to those seen in NBH mice. [Figure 8E] Semi-quantitative scoring of spongiosis in NBH, scrambled and M2D treated prion mice. Sections showing no signs of spongiosis were scored as 0 and severe spongiosis was scored as 4 (White et al., 2008). M2D significantly reduced spongiosis compared to scrambled prion mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0254] Working Example In the following examples, we demonstrate that a previously unannotated Rbm3 exon, referred to herein as exon 3a, is responsible for heat-induced splice-linked nonsense-mediated decay (NMD) of RBM3. We further map specific regions that can be targeted to control the expression of RBM3. Increased RBM3 expression was achieved by antisense oligonucleotides targeting these regions.
[0255] Example 1: Rbm3 intron 3 contains an evolutionarily conserved heat-inducible poison exon. Unexpectedly, a more focused analysis of mouse primary hepatocyte RNA sequencing data revealed an evolutionarily conserved unannotated exon (exon 3a, E3a) within intron 3 that had escaped our earlier comprehensive analysis (Figure 1A). This exon is absent at cold temperatures (34°C), detectable at warm temperatures (38°C), and strongly stabilized with cycloheximide (CHX)-mediated NMD inhibition demonstrated by the higher number of exon 3-exon 3a and exon 3a-exon 4 junction reads in CHX (290 and 240 at 38°C in CHX vs. 67 and 28 at 38°C in DMSO) and higher read density corresponding to exon 3a in CHX vs. DMSO at 38°C (Figure 1A). Exon 3a contains seven premature stop codons (PTCs) (Figure 1A, top).
[0256] Consistent with high evolutionary conservation (Figure 1A, bottom), and a nearly identical exon 3a sequence in humans, inclusion of temperature-regulated RBM3 exon 3a was found in human HEK293 cells (Figures 1B, 1C, and 1E). RBM3 exon 3a responded rapidly to external square-wave temperature rhythms (within 4 h of exposure to a higher temperature of 38°C) (Figure 1B), and thus could control RBM3 expression in response to circadian body temperature rhythms. 9,16 Moreover, exon 3a inclusion is temperature responsive within the physiologically relevant temperature range of 33°C to 39°C (Figures 1C and 1D), correlating with highly temperature-sensitive RBM3 expression. RBM3 exon 3a inclusion is particularly prominent at mild heat shock temperatures (39°C) and may therefore be involved in the reduction of RBM3 expression at febrile temperatures.
[0257] The presence of seven PTCs within exon 3a (Figure 1A) and its strong stabilization upon addition of the translation inhibitor CHX (NMD is a translation-coupled process) suggest that the exon 3a isoform undergoes NMD-mediated degradation. To provide further evidence for degradation by the NMD pathway, we examined exon 3a stabilization in response to NMD factor knockdown.17 UPF1 binds to PCT-containing mRNAs and promotes the recruitment of NMD factors such as SMG6 and SMG7 and their assembly into the NMD-activating complex.
[0258] Consistent with NMD-mediated degradation, the RBM3 exon 3a isoform is stabilized with UPF1, SMG6 or SMG7 knockdown, and dramatically stabilized with SMG6 / 7 double knockdown (NMD isoform approx. 75%) (Figure 1F). The stabilization of exon 3a can be reversed in rescue experiments (si_Smg6+7+Smg7, si_Smg6+7+Smg6). The higher the reversal in the Smg6 rescue sample, the more the sample shows a pronounced SMG6-dependent NMD degradation than SMG7-dependent NMD degradation of the exon 3a isoform.
[0259] In summary, these data identify an unannotated poison exon, exon 3a, in RBM3 as responsible for heat-induced splice-linked NMD, as inclusion of exon 3a was confirmed at higher temperatures and led to NMD-mediated degradation. Thus, cold-induced expression of RBM3 can be attributed to the heat-dependent inclusion of poison exon 3a.
[0260] Example 2: Rbm3 exon 3a controls temperature-dependent RBM3 expression. To investigate whether RBM3 exon 3a is involved in temperature-regulated RBM3 expression, we used CRISPR / Cas9-mediated genome editing to generate cell lines lacking RBM3 exon 3a. After clonal selection, two homozygous cell lines derived from separate guide RNA pairs, sgRNA#2 and sgRNA#3, and sgRNA#1 and sgRNA#3 (Figure 2A), were obtained. The control cell line generated from px459 empty vector transfected cells showed strong, temperature-regulated RBM3 mRNA and protein expression, which was nearly suppressed in the cell line lacking exon 3a (Figures 2B and 2C, and Figures 6B, 6C, and 6D). Consistent with the strong exon 3a inclusion upon heating (see Example 1), the increase in RBM3 protein expression in the cell line lacking exon 3a compared to the control cell line is more pronounced upon heating (Figures 2C and 2D); even at 37°C, removal of exon 3a induces RBM3 expression (Figure 2D).
[0261] Importantly, cell lines lacking E3a not only lost Rbm3 temperature sensitivity but also displayed constant, high Rbm3 expression levels that were only achieved at low temperatures in control cells. These data indicate that NMD-coupled temperature-regulated alternative splicing is the primary mechanism controlling Rbm3 expression levels over a physiologically relevant temperature range. Temperature-dependent phosphorylation of SR proteins may contribute to this regulation, as the effect of temperature on Rbm3 expression is strongly reduced in conditions with an inhibited CDC-like kinase (CLK; Haltenhof et al., 2020 and Figure 2H) (Preussner et. al., Body Temperature Cycles Control Rhythmic Alternative Splicing in Mammals. Mol. Cell 67, 433-446.e434 (2017). https: / / doi.org:10.1016 / j.molcel.2017.06.006; Haltenhof et al., A Conserved Kinase-Based Body-Temperature Sensor Globally Controls Alternative Splicing and Gene Expression. Mol. Cell, 78, 57-69.e4 (2020)).
[0262] We next used splice site blocking morpholinos to block the inclusion of RBM3 exon 3a and directly measured the effect on gene expression levels. Morpholinos targeting either the 3' or 5' splice site of exon 3a induced RBM3 mRNA levels in HEK293, with the 5' splice site blocking morpholino having a stronger effect, as it induced mRNA levels by up to 10-fold (Figure 2E). The morpholinos also induced RBM3 protein expression at 39°C (Figure 2F) and 37°C (Figure 2G), confirming that Rbm3 expression can be controlled in trans by targeting the splicing of E3a.
[0263] Taken together, these data provide strong evidence for splicing-regulated RBM3 expression and identify exon 3a as a target for therapeutic increase in RBM3 expression without cooling.
[0264] Example 3: Minigene mutagenesis allows mapping of cis-regulatory elements controlling Rbm3 exon 3a inclusion. One method to manipulate alternative (non-productive) splicing is the use of antisense oligonucleotides. Antisense oligonucleotides have broad therapeutic potential. 18,19 , which has been used to induce exon skipping 20,21 Therefore, exhaustive screening is often required to design the most potent antisense oligonucleotides. To narrow the potential target sites for antisense-based therapy, we started with a minigene analysis. In the minigene context, NMD isoforms are not degraded because the minigene is not translated. The minigene allows systematic mutagenesis analysis to decipher cis-regulatory elements.
[0265] Human or mouse genomic sequences containing RBM3 exons 3 to 4 (Figure 3A) were cloned into minigenes and transfected into human HEK293 or mouse neuronal N2A cells, after which minigene splicing was analyzed (Figures 3B and 3C). Exon 3a-containing NMD isoforms of the minigene were detected at warm temperatures (Figure 3B), and similar to endogenous splicing, minigene splicing responded to temperature in a graded manner (Figure 3B, bottom) and was indistinguishable between species (Figure 3C), indicating that the minigene contains all cis-regulatory elements required for temperature-controlled alternative splicing. An alternative 3'ss internal to exon 3a and located at nucleotide 107 of exon 3a (see Figure 1E for reference) results in the temperature-dependent incorporation of a portion of exon 3a, i.e., nucleotides 108 to 271, as indicated by an asterisk in Figure 3B.
[0266] Mutagenesis screening replacing 50 nucleotide windows with human β-globin sequences revealed two strong enhancer elements in windows M2 and M4 (Figures 3D and 3E). We also identified silencer elements in the region downstream of the 3'ss (M1), in the region close to the internal 3'ss (M3), and in the region upstream of the 5'ss (M6) (Figures 3D, 3E, and 3K). Interestingly, inclusion of exon 3a is only possible at cold temperatures after mutation of sequences containing an internal alternative 3' splice site (m3) or 5' splice site (m6) (M3, M6 in Figure 3E). Thus, these sequences contain strong silencer elements that prevent inclusion of exon 3a in cold conditions. In contrast, mutations m2 and m4 prevent inclusion of exon 3a even when heat is applied, and thus enhancer elements are encoded (M2, M4 in Figure 3E). Importantly, deletion of the m2 sequence also abolished the inclusion of exon 3a, and smaller substitutions (M2-1 through M2-9) revealed the location of an enhancer element within nucleotides 42-71 (corresponding to M2-2, M2-3, M2-4, and M2-9 in Figures 3F and 3G) as these substitutions result in exon skipping under heat conditions. Deletion (instead of substitution) of the M2 or M4 enhancer sequence also abolished the inclusion of exon 3a, and smaller substitutions revealed the location of an enhancer element within nucleotides 142-171 in the M4 region and specifically an enhancer element at nucleotides 152-171 (referred to herein as M4-7) as a second, similarly strong enhancer element (Figure 3H).
[0267] Furthermore, mutation of enhancers M2 or M4 (deletion of their evolutionarily conserved core) strongly reduced the splicing response to temperature (Figures 3I and 3J).
[0268] The "M2 core" is located at nucleotides 42-61 of exon 3a and corresponds to the sequence ggcgacgactggtcctgcat (SEQ ID NO:88).
[0269] The "M4 core" is located at nucleotides 146-160 of exon 3a and corresponds to the sequence ggacctcgtgagtct (SEQ ID NO:89).
[0270] The identified enhancer elements at nucleotides 42-71 (M2-9 region) and 152-171 (M4-7 region) of exon 3a can be targeted to prevent inclusion of exon 3a.
[0271] Example 4: Screening for oligonucleotides that regulate Rbm3 expression Based on minigene analysis that identified nucleotides 42-71 in M2 (M2-9) and nucleotides 152-171 in M4 (M4-7) as regions containing enhancer elements (Example 3), antisense oligonucleotides (ASOs) against these regions were developed and screened. Furthermore, based on morpholino experiments showing that blocking the 5' splice site of exon 3a induces Rbm3 protein levels (see Example 2 and Figures 2E-2G), antisense oligonucleotides against the 5' splice site of exon 3a were screened. Figure 4A shows the sequences of seven oligonucleotides targeting M2-9, four oligonucleotides targeting M4-7, and three oligonucleotides targeting the 5'ss of exon 3a.
[0272] The ASO tested was the FDA-approved drug nusinersen. 22 , which combines uniform 2'-O-methoxyethyl (MOE) modified bases and phosphorothioate (PS) modified backbones, which should allow for distribution throughout the CNS following intrathecal injection. 23 PS / MOE chemistry, as well as morpholino chemistry (as used in Example 2), can also be used for systemic delivery in vivo. 24 .
[0273] N2A cells were transfected with each PS / MOE-modified ASO for approximately 24 hours, and Rbm3 induction was measured relative to a control PS / MOE-modified ASO (CTRL) and relative to HPRT expression. The sequences of the antisense oligonucleotides are shown in Table 6.
[0274] [Table 12]
[0275] [Table 13]
[0276] All seven ASOs tested targeting enhancer elements in the M2 region and all four ASOs tested against the M4 region increased RBM3 levels at 39°C in N2A cells, with at least a two-fold increase for the M2D and M4D ASO variants (Figures 4B and 4C, respectively).
[0277] ASOs targeting the 5' splice site also increased RBM3 levels by 2-fold (MOE, FIG. 4D), an effect that was not improved by the extended ASOs MOElongA and MOElongB.
[0278] Combining M2-targeting (M2D) and 5'ss-targeting (MOE) ASOs increased RBM3 levels by more than four-fold (Figure 4E). Combinations of various M2-targeting ASOs (M2A) and MOE increased RBM3 levels by approximately two-fold, as did the combination of M2A and M2D.
[0279] The effect of selected ASOs was tested at lower temperatures (37°C). Both M2D and MOE increase RBM3 levels by approximately two-fold even at 37°C (Figure 4F). M2D led to a higher increase in RBM3 levels at 39°C, indicating that the enhancer element targeted by M2D is more active at higher temperatures. Importantly, M2D ASO induced Rbm3 expression at 40°C to the levels seen in control cells at 37°C, and also induced Rbm3 expression by two-fold at 37°C (Figure 4J).
[0280] Mouse N2A cells were also treated with an ASO carrying a two-nucleotide shift variant of MOE, designated MOE+2 (see Table 6). Like M2D and MOE, MOE+2 induces RBM3 expression two-fold at 37°C (Figure 4G).
[0281] In summary, this experiment demonstrates that ASOs targeting exon 3a M2, M4 or 5'ss increase RBM3 mRNA and protein levels in N2A cells, identifying the ASOs as promising for in vivo applications. ASOs M2D, M2Db, M4D and MOE+2 were selected for in vivo studies described in Example 7.
[0282] Mouse N2A cells were treated with ASOs carrying different modifications (morpholinos; MO_M2Db) corresponding to the sequence of M2Db (Table 4, and also shown in Table 6). This ASO induced RBM3 expression in a dose-dependent manner at 37° C. and 39° C., achieving a greater than 1.5-fold increase in RBM3 expression at 3 μM (FIG. 4H).
[0283] HEK293 cells were also transfected with PS- and MOE-modified M2Da, which led to a 1.5-fold increase in RBM3 expression at 37°C (Figure 4I).
[0284] Together with the effects of M2D in human HeLa cells (Figure 4J), these experiments in human HEK293 indicate that morpholinos and / or PS- and MOE-modified ASOs targeting exon 3aM2 can also significantly induce RBM3 expression in human cells.
[0285] Example 5: Screening of human ASO sequences that control the inclusion of exon 3a in human RBM3 ASOs targeting M2-9, M4-7 or 5'ss of human rbm3 exon 3a were designed based on minigene analysis and are shown in Table 7. ASO screening was performed and several ASOs targeting the respective enhancer or 5'ss in human rbm3 were identified that prevented E3a inclusion in HeLa cells (Figures 7A and 7B-7D and Table 7). ASOs targeting the M4 region or 5'ss partially exploited alternative 3' or 5' splice sites, and all variants targeting the M2D region quantitatively abolished E3a inclusion (Figure 7D).
[0286] This data indicates that ASOs targeting human RBM3 exon 3a, specifically the M2-9 region, are promising agents for inhibiting exon 3a inclusion and RBM3 expression in human cells and have potential therapeutic applications.
[0287] [Table 14]
[0288] [Table 15]
[0289] Example 6: Materials and methods used in Examples 1 to 4 RNA-Seq analysis and bioinformatics Sequencing data from mouse primary hepatocyte RNA are deposited under GSE158882 5Sequencing data from HeLa cells after knockdown and rescue of Upf1, Smg6, and Smg7 were obtained from SRP083135. 17 .STAR version 2.5.3a 25 Reads were mapped to the reference genomes (mm10 for mouse, hg38 for human) using ggsashimi. Show more conservation scores 26 RBM3 Sashimi plots were generated using a customized version of the .Percent spliced (PSI) values of RBM3 exon 3a after knockdown and deletion were manually calculated from the junction read counts.
[0290] tissue culture cells HEK293T and N2A cell stocks were maintained in liquid nitrogen and early passage aliquots were thawed at regular intervals. Cell morphology was routinely assessed and checked monthly using a PCR-based assay to exclude Mycoplasma contamination. HEK293T cells were cultured in DMEM high glucose with 10% FBS and 1% penicillin / streptomycin. N2A cells were cultured in 50% OptiMEM / 50% OptiMEM Glutamax with 10% FBS and 1% penicillin / streptomycin. Mouse hippocampal neuronal cells were isolated as described previously (Peretti et al. Life Sci Alliance. 2021;4(4):e202000884. doi: 10.26508 / lsa.202000884). All cell lines were routinely maintained at 37°C and 5% CO2.
[0291] For temperature experiments, cells were transferred into pre-equilibrated incubators for the indicated times. In a square wave temperature cycle, we used two incubators set at 34°C and 38°C, and cells were transferred every 12 hours. 27 .
[0292] Transfection of HEK293T or N2A cells (for minigenes or CRISPR guides) using Rotifect (Roth) was performed according to the manufacturer's instructions. Cycloheximide (Sigma) was used at a final concentration of 40 μg / ml or DMSO as a solvent control.
[0293] For morpholino experiments, cells were seeded and transfected one day later using Endoporter according to the manufacturer's manual. Morpholinos (Rbm3 5'ss: GTCTCCCCTGCTACTACTTACATCT (SEQ ID NO: 36); 3'ss: CCTCCACCCCCTAGAACAGAAGGCA (SEQ ID NO: 60); and standard controls) and Endoporter transfection reagent were purchased from Gene Tools.
[0294] PS / MOE-modified antisense oligonucleotides (1 μl, 100 ng / μl) were purchased from Microsynth and transfected into N2A cells or HEK293T cells by Rotifect (3 wells on a 12-well plate). * 10 6 cells / well), and then 4 hours later, the transfected N2A cells were transferred into a 39°C (or 37°C) incubator, and RNA extraction and RT-qPCR were performed 24 hours later.
[0295] Morpholinos targeting mouse exon 3a M2-9 (MO_M2Db) were transfected into N2A cells at 0.5, 1 and 3 μM for 48 hours at 37° C. and 39° C.
[0296] RT-PCR and RT-qPCR RT-PCR was performed as described above. 28Briefly, RNA was extracted using RNATri (Bio&Sell) and 1 μg of RNA was used in a gene-specific RT reaction. Endogenous RBM3 splicing was analyzed with a radiolabeled forward primer in exon 3 (5'-TCATCACCTTCACCAACCCA (SEQ ID NO: 7)) and a reverse primer in exon 5 (5'-TCTAGAGTAGCTGCGACCAC (SEQ ID NO: 8)).
[0297] For analysis of minigene splicing, the RNA was further digested with DNase I and repurified. Minigene splicing was examined with minigene-specific primers: T7fwd: 5'-GACTCACTATAGGGAGACCC (SEQ ID NO:61); BGHrev: 5'-TAGAAGGCACAGTCGAGG (SEQ ID NO:62).
[0298] For qRT-PCR, Rbm3 gene-specific primers were combined with housekeeping gene reverse primers in one RT reaction. qPCR was then performed in a 96-well format using the Blue S'Green qPCR Kit Separate ROX (Biozym) on a Stratagene Mx3000P instrument. qPCR was performed in technical duplicates and the average value was used to normalize expression to housekeeping genes (human: GAPDH; mouse: HPRT); DCT and D(DCT) were calculated for the different conditions.
[0299] [Table 16]
[0300] Generation of CRISPR-Cas9 edited cells and analysis of Rbm3 expression For genome engineering in HEK293 cells, sequences flanking exon 3a of Rbm3 were analyzed in silico for sgRNA candidates using the Benchling tool. The top-ranked candidate sgRNAs upstream and downstream of the exon29 The oligonucleotide pair was synthesized and subcloned into the PX459 vector. sgRNA sequence #1: 5'-TGTGTCTGCTCGGGGCAGCG (SEQ ID NO:11); sgRNA sequence #2: 5'-CCTGTGAGTGGGCACTGCG (SEQ ID NO: 12); sgRNA sequence #3: 5'-TCCTGATGAAGCCATTCTG (SEQ ID NO: 13).
[0301] Cells were co-transfected with guide RNA #3 and either #1 or #2 in 6-well plates using Rotifect (Roth) according to the manufacturer's instructions. 48 hours after transfection, transfected cells were selected with 1 μg / ml puromycin and clonal cell lines were isolated by dilution. 29 Genomic DNA was extracted using DNA extraction buffer (200 mM Tris / HCl pH 8.3, 500 mM KCl, 5 mM MgCl2, 0.1% gelatin in H2O) and genotyping PCR was performed with primers binding in the intron upstream and downstream of the cleavage site (FWD: 5'-ATCTGCAGAGGGACCTTGTC (SEQ ID NO: 63); REV: 5'-CAGACTTGCCTGCATGATCC (SEQ ID NO: 64)) to confirm exon knockout at the DNA level. In promising clones, exon knockout was further confirmed after RNA isolation by splice-sensitive PCR using one forward primer in exon 3 and one reverse primer in exon 4 (data not shown). Rbm3 total expression levels were examined by RT-qPCR and Western blot.
[0302] Western blot Whole cell extracts (WCE) were prepared in lysis buffer (20 mM Tris (pH 8.0), 2% NP-40 (v / v), 0.01% sodium deoxycholate (w / v), 4 mM EDTA and 200 mM NaCl) supplemented with a protease inhibitor mix (aprotinin, leupeptin, vanadate (Vanadat) and PMSF). Concentrations were determined using a RotiNanoquant (Roth) according to the manufacturer's instructions. SDS-PAGE and Western blotting followed standard procedures. Western blots were quantified using ImageQuant TL software. The following antibodies were used for Western blot: hnRNPL (4D11, Santa Cruz), Rbm3 (14363-1-AP, proteintech), Gapdh (GT239, GeneTex).
[0303] Minigene constructs Cloning was performed using PCR to introduce HindIII and XhoI sites and ligation into pcDNA3.1(+). Constructs were cloned using a forward primer in the intron upstream of exon 3 (mouse: 5'-AATTTAAGCTTctgtggctgtgcctggct (SEQ ID NO: 65); human: 5'-AACTTAAGCTTTCCGGCCACCCTTTGCTAC (SEQ ID NO: 66)), a reverse primer in the intron downstream of exon 4 (mouse: 5'-AATTTCTCGAGttcagacataggctcttaacatt (SEQ ID NO: 67); human: 5'-TAGACTCGAGATAGGCAACTCTCCCTCTCAC (SEQ ID NO: 68)) and human or mouse DNA as template.
[0304] For each of the mRbm3 mutations and submutation clones, the mutant sequence was either deleted or replaced by a sequence from human β-globin (M3 contains the 3'ss, M6 contains the 5', and the remaining isomers contain exon 2 sequence). Briefly, two DNA fragments were amplified from the mRbm3 minigene using a PCR primer pair that introduces the mutations. These two DNA fragments were then used as templates for PCR to obtain the full-length mRbm3 mutants. All minigene sequences were confirmed by sequencing (Microsynth SeqLab).
[0305] Example 7: ASO targeting exon 3A induces RBM3 expression in mice 7.1 Results The tolerability study included injections of four different RBM3-targeting ASOs (M2D, M2Db, MOE+2, and M4D) and a scrambled control (SCRM), as well as a PBS control alone. n=2 for each ASO. ASO administration was continued for 3 weeks prior to sampling. 1 There were no associated adverse effects (unsteady gait, weight loss, seizures, etc.) and doses of 30 μg, 100 μg, and 300 μg / mouse were all well tolerated.
[0306] Efficacy: All ASOs increased RBM3 expression in the hippocampus by up to 1.5-fold at each dose as demonstrated by Western blot (Figures 5A, 5B, and 5C), correlating with reduced levels of E3a inclusion (Figure 5D).
[0307] This upregulation seen with ASOs is similar to RBM3 levels induced by cooling, which has been shown to be neuroprotective in multiple models. 2-4 The lack of effect seen with M2Db may reflect a lack of efficacy due to the stability or pharmacokinetics of this ASO, or the small number tested.
[0308] Briefly, RBM3-targeted ASOs (M2D, MOE+2, and M4D), which are complementary to different regions of RBM3 exon 3A, induce RBM3 expression in mice without cooling to levels similar to those occurring with hypothermia.
[0309] References 1. AL Southwell et al., In vivo evaluation of candidate allele-specific mutant huntingtin gene silencing antisense oligonucleotides. Molecular therapy: the journal of the American Society of Gene Therapy 22, 2093-2106 (2014). 2. A. Bastide et al., RTN3 Is a Novel Cold-Induced Protein and Mediates Neuroprotective Effects of RBM3. Curr Biol 27, 638-650 (2017). 3. D. Peretti et al., RBM3 mediates structural plasticity and protective effects of cooling in neurodegeneration. Nature 518, 236-239 (2015). 4. D. Peretti et al., TrkB signaling regulates the cold-shock protein RBM3-mediated neuroprotection. Life science alliance 4, (2021).
[0310] 7.2 Materials and Methods Administration of ASO All ASOs (Merck) were diluted in sterile PBS to a final volume of 10 μl and delivered to mice by intraventricular injection into the left lateral ventricle at the indicated doses (30 μg, 100 μg or 300 μg). Mice were first anesthetized using isoflurane before mounting in a stereotaxic frame. An incision was made along the midline of the exposed scalp and skull. A small hole was drilled into the skull 0.3 mm anterior and 1 mm lateral from Bregma, a Hamilton 33G neurosyringe was lowered 3 mm below the surface of the skull, ASOs were injected over 1 min, and the needle was slowly removed 2 min after cessation of injection. The head wound was closed with adhesive before surgical recovery. Mice were monitored daily for 3 weeks before sampling. Mice were killed by spinal dislocation and brains were immediately dissected into tubes and flash frozen in liquid nitrogen. Samples collected were: hippocampus, prefrontal cortex and cerebellum.
[0311] Sample preparation Hippocampi were lysed on ice in 350 μL of RIPA buffer (50 mM Tris (pH 8), 50 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS) (Sigma) supplemented with protease and phosphatase inhibitors (Roche). Samples were sonicated at 4°C and then centrifuged at 13,000 rpm for 10 min to remove debris. Protein concentrations were determined using the bicinchoninic acid (BCA) assay (Pierce).
[0312] Western blotting 15 μg of lysate was separated by SDS-PAGE, transferred onto a 0.2 μm nitrocellulose membrane, and blocked in 5% bovine serum albumin (BSA). Membranes were incubated overnight with RBM3 antibody (1:2000, Proteintech). Actin was used as a loading control (1:5000, Cell Signaling). Blots were imaged on a BioRad ChemiDoc and quantified using ImageJ.
[0313] Example 8: ASO treatment enhances hippocampal RBM3 levels and is significantly neuroprotective The therapeutic potential of ASO-mediated E3a inclusion in prion disease was tested in a model widely used to test the effects of cooling and RBM3 overexpression (Peretti, 2015; Bastide, 2017. Curr. Biol. 27, 638-650, doi:10.1016 / j.cub.2017.01.047; Peretti, 2021), as well as many other interventions (Mallucci, 2003. Science (New York, NY) 302, 871-874, doi:10.1126 / science.1090187), on the progression of neurodegeneration.
[0314] Hemizygous tg37+ / - mice overexpress prion protein (PrP) approximately three-fold compared to wild-type levels (Mallucci, 2002 EMBO J. 21, 202-210, doi:10.1093 / emboj / 21.3.202). When inoculated with Rocky Mountain Laboratory (RML) prions, these mice exhibit rapid incubation times and succumb to disease as little as 12 weeks after inoculation, with rapidly progressive widespread neurodegeneration throughout the brain, including in the hippocampal CA1-3 regions (Mallucci, 2002).
[0315] Early cooling (at 3 weeks post-inoculation) to boost PBM3 levels or lentiviral delivery of RBM3 to the hippocampus is significantly neuroprotective in both prion disease tg37 and Alzheimer's disease 5xFAD mice, whereas RNAi of RBM3 abolishes the protective effect of cooling (Peretti, 2015).
[0316] To address whether ASO-mediated induction of RBM3 expression via E3a skipping in the absence of cooling is similarly neuroprotective, we treated prion diseased tg37 mice (n=8) with 200 μg of M2D or scrambled ASO control (Figure 8A; this dose was chosen as the average of the effective doses of 100 and 300 μg).
[0317] ASO was delivered by a single intracerebroventricular injection at 3 weeks post-inoculation, consistent with the time point of our previous intervention (early cooling, or LV-RBM3, Peretti, 2005). Mice treated with M2D / scrambled ASO were analyzed for neuroprotection at 12 weeks post-inoculation, when all scrambled ASO-treated mice succumbed to prion disease. Remarkably, a single dose of M2D ASO resulted in 2-fold higher RBM3 levels at 12 weeks post-inoculation than in scrambled-treated mice 9 weeks after injection (Figure 8B). As previously described (Peretti, 2015), higher levels of RBM3 were associated with greater neuroprotection: 7 / 8 M2D-treated mice showed extensive preservation of pyramidal neurons in the hippocampal CA1-3 regions (Figures 8C and 8D), compared to scrambled ASO-treated mice, in which 5 out of 6 mice showed significant neuronal loss in these regions (Figures 8C and 8D). M2D-mediated neuroprotection was also associated with a reduction in cavernosity, with M2D-treated mice exhibiting significantly lower cavernosity scores compared to scramble-treated mice (Figure 8E).
[0318] These data support the robust and sustained induction of RBM3 without cooling by a single dose of M2D, resulting in significant neuroprotection in the setting of rapidly progressive neurodegenerative disease at 9 weeks as described above. The ability to increase RBM3 levels with a single dose of a well-tolerated ASO using FDA-approved chemistry instead of therapeutic hypothermia has strong implications for neuroprotection in a variety of conditions, from acute setting treatment in neonates to cardiac surgery, stroke and head trauma in adults, and longer-term neuroprotection in degenerative disease. In the acute setting, this approach provides neuroprotection of RBM3 expression while avoiding the substantial risks associated with intensive care and cooling, such as clotting problems, pneumonia, and invasive monitoring. Moreover, the approach has significant appeal in preventing neurodegeneration. ASOs have been very successful in children with SMA and were recently approved for the treatment of the rapidly progressive neurodegenerative disease, ALS, in adults (Miller, TM et al. Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. N Engl J Med 387, 1099-1110, doi:10.1056 / NEJMoa2204705 (2022)). In the study of Alzheimer's and related dementia diseases, induction of the neuroprotective effects of RBM3 via ASO delivery resulting in its long-term expression is a compelling therapeutic approach, enhancing neuronal resilience and synaptic regeneration, which are key to resisting the direct and indirect toxic effects of these protein misfolding diseases, especially those associated with aging.
[0319] 8.1 Experimental details mouse All animal work was carried out in accordance with UK Home Office regulations, under the Animal [Scientific Procedures] Act 1986, and in accordance with the Institutional Guidelines for the Care and Use of Animals for Research. All studies were ethically reviewed by the University of Cambridge Animal Welfare and Ethical Review Body (AWERB). Mice were housed in groups of 2–5 animals / cage under a 12-h light / dark cycle and tested during the light phase. Water and standard mouse chow were available ad libitum. Mice were randomly assigned to treatment groups by cage number. Experimenters were blinded to group assignment during the experiment and when clinical signs were assessed. For behavioural testing, no formal randomisation was required or used. Procedures were in full compliance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines.
[0320] Prion infection in mice Three-week-old tg37+ / - mice were inoculated intracerebrally with 30 μL of 1% brain homogenate of Chandler / RML (Rocky Mountain Laboratories) prion under general anesthesia as described (Mallucci, 2002). Animals were culled if they developed clinical signs of scrapie, as defined in Mallucci, 2002; Mallucci, 2003; Mallucci, 2007 Neuron 53, 325-335, doi:10.1016 / j. Neuron.2007.01.005. Control mice received 1% normal brain homogenate.
[0321] References Numerous publications have been cited above to more fully describe and disclose the present invention and the state of the art to which it pertains. Full citations for some of these references are provided below. Each of these references is incorporated herein in its entirety. 1 Danno, S. et al. Increased transcript level of RBM3, a member of the glycine-rich RNA-binding protein family, in human cells in response to cold stress. Biochem. Biophys. Res. Commun. 236, 804-807, doi:10.1006 / bbrc.1997.7059 (1997). 2 Nishiyama, H. et al. A glycine-rich RNA-binding protein mediating cold-inducible suppression of mammalian cell growth. J. Cell Biol. 137, 899-908, doi:10.1083 / jcb.137.4.899 (1997). 3 Ciuzan, O., Hancock, J., Pamfil, D., Wilson, I. & Ladomery, M. The evolutionarily conserved multifunctional glycine-rich RNA-binding proteins play key roles in development and stress adaptation. Physiol. Plant. 153, 1-11, doi:10.1111 / ppl.12286 (2015). 4 Jackson, T. C. et al. Cold stress protein RBM3 responds to temperature change in an ultra-sensitive manner in young neurons. Neuroscience 305, 268-278, doi:https: / / doi.org / 10.1016 / j.neuroscience.2015.08.012 (2015). 5 Neumann, A. et al. Alternative splicing coupled mRNA decay shapes the temperature-dependent transcriptome. EMBO Rep 21, e51369, doi:10.15252 / embr.202051369 (2020). 6 Lykke-Andersen, S. & Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nature Reviews Molecular Cell Biology 16, 665, doi:10.1038 / nrm4063 https: / / www.nature.com / articles / nrm4063#supplementary-information (2015). 7 Haltenhof, T. et al. A conserved kinase-based body temperature sensor globally controls alternative splicing and gene expression. Mol. Cell (2020). 8 Hoekstra, M. M., Emmenegger, Y., Hubbard, J. & Franken, P. Cold-inducible RNA-binding protein (CIRBP) adjusts clock-gene expression and REM-sleep recovery following sleep deprivation. Elife 8, doi:10.7554 / eLife.43400 (2019). 9 Morf, J. et al. Cold-inducible RNA-binding protein modulates circadian gene expression posttranscriptionally. Science (New York, N.Y.) 338, 379-383, doi:10.1126 / science.1217726 (2012). 10 Lujan, D. A., Ochoa, J. L. & Hartley, R. S. Cold-inducible RNA binding protein in cancer and inflammation. Wiley Interdiscip Rev RNA 9, doi:10.1002 / wrna.1462 (2018). 11 Qiang, X. et al. Cold-inducible RNA-binding protein (CIRP) triggers inflammatory responses in hemorrhagic shock and sepsis. Nat. Med. 19, 1489-1495, doi:10.1038 / nm.3368 (2013). 12 Chip, S. et al. The RNA-binding protein RBM3 is involved in hypothermia induced neuroprotection. Neurobiology of Disease 43, 388-396, doi:https: / / doi.org / 10.1016 / j.nbd.2011.04.010 (2011). 13 Zhu, X. et al. RBM3 promotes neurogenesis in a niche-dependent manner via IMP2-IGF2 signaling pathway after hypoxic-ischemic brain injury. Nature communications 10, 3983, doi:10.1038 / s41467-019-11870-x (2019). 14 Yang, H. J. et al. Cold-inducible protein RBM3 mediates hypothermic neuroprotection against neurotoxin rotenone via inhibition on MAPK signalling. J. Cell. Mol. Med. 23, 7010-7020, doi:10.1111 / jcmm.14588 (2019). 15 Peretti, D. et al. RBM3 mediates structural plasticity and protective effects of cooling in neurodegeneration. Nature 518, 236-239, doi:10.1038 / nature14142 (2015). 16 Liu, Y. et al. Cold-induced RNA-binding proteins regulate circadian gene expression by controlling alternative polyadenylation. Sci Rep 3, 2054, doi:10.1038 / srep02054 (2013). 17 Colombo, M., Karousis, E. D., Bourquin, J., Bruggmann, R. & Muehlemann, O. Transcriptome-wide identification of NMD-targeted human mRNAs reveals extensive redundancy between SMG6- and SMG7-mediated degradation pathways. RNA (New York, N.Y.) 23, 189-201, doi:10.1261 / rna.059055.116 (2017). 18 Lim, K. H. et al. Antisense oligonucleotide modulation of non-productive alternative splicing upregulates gene expression. Nature communications 11, 3501, doi:10.1038 / s41467-020-17093-9 (2020). 19 Bennett, C. F. Therapeutic Antisense Oligonucleotides Are Coming of Age. Annu. Rev. Med. 70, 307-321, doi:10.1146 / annurev-med-041217-010829 (2019). 20 Erdos, M. R. et al. A targeted antisense therapeutic approach for Hutchinson-Gilford progeria syndrome. Nat. Med. 27, 536-545, doi:10.1038 / s41591-021-01274-0 (2021). 21 Puttaraju, M. et al. Systematic screening identifies therapeutic antisense oligonucleotides for Hutchinson-Gilford progeria syndrome. Nat. Med. 27, 526-535, doi:10.1038 / s41591-021-01262-4 (2021). 22 Hua, Y. et al. Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model. Nature 478, 123-126, doi:10.1038 / nature10485 (2011). 23 Finkel, R. S. et al. Treatment of infantile-onset spinal muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. The Lancet 388, 3017-3026, doi:https: / / doi.org / 10.1016 / S0140-6736(16)31408-8 (2016). 24 Sheng, L., Rigo, F., Bennett, C. F., Krainer, A. R. & Hua, Y. Comparison of the efficacy of MOE and PMO modifications of systemic antisense oligonucleotides in a severe SMA mouse model. Nucleic Acids Res. 48, 2853-2865, doi:10.1093 / nar / gkaa126 (2020). 25 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21, doi:10.1093 / bioinformatics / bts635 %J Bioinformatics (2012). 26 Garrido-Martin, D., Palumbo, E., Guigo, R. & Breschi, A. ggsashimi: Sashimi plot revised for browser- and annotation-independent splicing visualization. PLoS Comput Biol 14, e1006360, doi:10.1371 / journal.pcbi.1006360 (2018). 27 Preussner, M. et al. Body Temperature Cycles Control Rhythmic Alternative Splicing in Mammals. Mol. Cell 67, 433-446.e434, doi:10.1016 / j.molcel.2017.06.006 (2017). 28 Preussner, M. et al. Rhythmic U2af26 alternative splicing controls PERIOD1 stability and the circadian clock in mice. Mol. Cell 54, 651-662, doi:10.1016 / j.molcel.2014.04.015 (2014). 29 Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308, doi:10.1038 / nprot.2013.143 (2013). 30 Williams, D. R. et al. Seasonally hibernating phenotype assessed through transcript screening. Physiol Genomics 24, 13-22 (2005). 31 Smart, F. et al. Two isoforms of the cold-inducible mRNA-binding protein RBM3 localize to dendrites and promote translation. J. Neurochem. 101, 1367-1379 (2007). 32 Llorian, M. et al. The alternative splicing program of differentiated smooth muscle cells involves concerted non-productive splicing of post-transcriptional regulators. Nucleic Acids Research 44, 8933-8950 (2016).
[0322] For standard techniques in molecular biology, see Sambrook, J., Russell, D. W. Molecular Cloning, A Laboratory Manual. 3rd ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Claims
1. 1. An agent for use in a method of preventing or treating a disease in a subject, or for use as a neuroprotective agent, comprising: the agent is an oligonucleotide capable of hybridizing to a region of the RBM3 pre-mRNA so as to alter the splicing of the pre-mRNA such that exon 3a is not incorporated into the resulting mature mRNA; The disease is (i) neurological disease and / or neonatal hypoxic-ischemic encephalopathy, head trauma, or stroke; (ii) a neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, prion disease, frontotemporal dementia, tauopathy, amyotrophic lateral sclerosis (ALS), and vascular dementia; or (iii) neurological damage occurring arbitrarily during cardiac surgery or induced coma; is selected from The region of the RBM3 pre-mRNA is (i) a region within exon 3a corresponding to SEQ ID NO: 15 or SEQ ID NO: 27; and (ii) a region spanning the 5' splice site of exon 3a and within 50 nucleotides downstream of exon 3a; an agent selected from
2. 2. The agent of claim 1, wherein the region within exon 3a corresponds to SEQ ID NO: 29, or the region within exon 3a corresponds to SEQ ID NO: 16, 17, 19, 21, 23, or 25.
3. 2. The agent of claim 1, wherein the region spanning the 5' splice site of exon 3a comprises nucleotides 257-269, 258-269, 259-269, 260-269, 261-269, 262-269, 263-269, 264-269, 265-269, 266-269, or 267-269 of SEQ ID NO:6 and nucleotides 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 of SEQ ID NO:
33.
4. 4. The agent of any one of claims 1 to 3, wherein the agent is an antisense oligonucleotide (ASO), and optionally the ASO is 10 to 30 nucleotides in length, optionally 25 nucleotides in length, optionally 15, 16, 17, 18 or 19 nucleotides in length, or optionally 19 nucleotides in length. (i) the ASO comprises or consists of one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 83, 84, 85, 86 and 87; (ii) the ASO comprises or consists of one of SEQ ID NOs: 51, 52, 53, 54, 55, 56, and 57; or (iii) the ASO comprises or consists of one of SEQ ID NOs: 34, 35, 36, 37, 38, 39, 69 and 70; The agent of claim 4.
6. The antisense oligonucleotide (ASO) of claim 5.
7. The agent of claim 4, wherein the ASO comprises LNA, RNA, or DNA nucleotides, and optionally the ASO comprises alternating LNA and RNA nucleotides, alternating LNA and DNA nucleotides, or alternating RNA and DNA nucleotides. (i) the ASO optionally comprises a backbone modification that is a phosphorothioate linkage; and / or (ii) the ASO optionally comprises a sugar moiety modification that is a 2'-O-methoxyethyl (MOE) modification; and / or (iii) the ASO comprises 2'-O-methoxyethyl (MOE) modifications and phosphorothioate linkages, optionally fully 2'-O-methoxyethyl modified and fully phosphorothioate modified; or (iv) the ASO is a phosphorodiamidate morpholino oligonucleotide; The agent of claim 5.
9. 1. A method for identifying an antisense oligonucleotide (ASO) capable of increasing expression of RBM3 in a cell, comprising: i) identifying an ASO that targets a region of the pre-mRNA of the RBM3 gene, wherein the region is selected from a region within exon 3a, a region spanning the splice site of exon 3a, a region located within 250 nucleotides upstream of exon 3a, and a region located within 250 nucleotides downstream of exon 3a; ii) delivering the ASO identified in step i) to the cell; and iii) measuring the expression level of RBM3 in the cells of step ii). and optionally, iv) further comprising a step of comparing the expression level of RBM3 measured in step iii) with the expression level in cells treated with a control, which may optionally be ASO or DMSO; method.
10. 10. The method of claim 9, wherein the level of expression is measured by RT-qPCR or Western blotting.
11. An expression construct, optionally a vector, optionally a viral vector, encoding the ASO of claim 5.
12. A host cell comprising the expression construct of claim 11.
13. a pair of guide RNAs that remove exon 3a from the RBM3 gene, wherein the first guide RNA is capable of hybridizing to a genomic sequence upstream of exon 3a and the second guide RNA is capable of hybridizing to a genomic sequence downstream of exon 3a; the first guide RNA comprises SEQ ID NO: 11 or SEQ ID NO: 12, and the second guide RNA comprises SEQ ID NO: 13; Guide RNA Vs.
14. 1. A CRISPR / Cas-based base editing system for altering an RNA splice site encoded in genomic DNA of a subject, comprising: The CRISPR / Cas-based base editing system comprises a fusion protein and at least one guide RNA (gRNA); the fusion protein comprises a Cas protein and a base editing domain; The at least one gRNA is capable of hybridizing to a region in the RBM3 gene; and The region: (i) comprising nucleotides 136-147, 137-147, 138-147, 139-147, 140-147, 141-147, 142-147, 143-147, 144-147, 145-147, or 146-147 of SEQ ID NO:32, or a complementary sequence thereof, and optionally, said region further comprises nucleotides 1 and 2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, or 1-15 of SEQ ID NO:6, or a complementary sequence thereof, such that the splice site located at nucleotides 146-147 of SEQ ID NO:32 is altered; (ii) comprises SEQ ID NO: 6 or a complementary sequence thereof, such that the splice junction located at nucleotides 106-107 of SEQ ID NO: 6 is altered; or (iii) nucleotides 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 of SEQ ID NO:33, or a complementary sequence thereof, optionally further comprising nucleotides 254-269, 255-269, 256-269, 257-269, 258-269, 259-269, 260-269, 261-269, 262-269, 263-269, 264-269, 265-269, 266-269, or 267-269 of SEQ ID NO:6, such that a splice site located in the first two nucleotides of SEQ ID NO:33 is altered; Optionally, the gRNA that hybridizes to the target region, or the targeting domain of the gRNA, is 16, 17, 18, 19, 20, or 21 nucleotides in length.
15. 15. The CRISPR / Cas-based base editing system of claim 14, wherein the region spans nucleotides 106-107 of SEQ ID NO:6 and comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides such that the splice site located at nucleotides 106-107 of SEQ ID NO:6 is altered.
16. the target region is selected from SEQ ID NOs: 90, 91, and 92; 15. The CRISPR / Cas-based base editing system of claim 14, wherein optionally, the at least one gRNA comprises or consists of a sequence that is the RNA equivalent of SEQ ID NOs: 90, 91, and 92, or a complementary sequence thereof.
17. 15. The CRISPR / Cas-based base editing system of claim 14, wherein alteration of an RNA splice site encoded in the genomic DNA results in exon 3a not being incorporated into the resulting mature mRNA.
18. the Cas protein comprises Cas9, and optionally the Cas protein comprises Cas9 nickase; and / or the base-editing domain comprises a cytidine deaminase domain or an adenosine deaminase domain; The CRISPR / Cas-based base editing system of claim 14.
19. 19. The CRISPR / Cas-based base editing system of any one of claims 14 to 18, for use in a method for preventing or treating a disease in a subject, or for use as a neuroprotective agent, the method comprising administering the CRISPR / Cas-based base editing system to the subject; The disease is (i) neurological disease and / or neonatal hypoxic-ischemic encephalopathy, head trauma, or stroke; (ii) a neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, prion disease, frontotemporal dementia, tauopathy, amyotrophic lateral sclerosis (ALS), and vascular dementia; or (iii) neurological damage occurring arbitrarily during cardiac surgery or induced coma; A CRISPR / Cas-based base editing system selected from the group consisting of: