RNA-editing oligonucleotides and uses thereof
Patent Information
- Application Number
- JP2024158942
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-09-13
- Filing Date
- 2024-09-13
- Publication Date
- 2025-10-09
AI Technical Summary
Existing synthetic single-stranded oligonucleotides lack the necessary selectivity and stability to effectively utilize ADAR proteins for therapeutically relevant RNA editing.
Development of novel oligonucleotides with specific structural modifications, such as chemical modifications and triplet configurations, to enhance ADAR recruitment and improve target RNA editing efficiency, including the use of ADAR recruitment domains and chemical linkages to increase stability and selectivity.
The modified oligonucleotides demonstrate enhanced recruitment of ADAR proteins, leading to improved selectivity and efficiency in RNA editing, potentially providing therapeutic benefits for various genetic disorders.
Smart Images

Figure 2025003992000001
Abstract
Description
[Background technology]
[0001] Adenosine deaminases acting on RNA (ADARs) are enzymes that bind to double-stranded RNA (dsRNA) and convert adenosine to inosine by deamination. In RNA, inosine functions similarly to guanosine for translation and replication. Thus, conversion of adenosine to inosine in mRNA can result in codon changes that may lead to changes in the encoded protein and its function. There are three known ADAR proteins expressed in humans: ADAR1, ADAR2, and ADAR3. ADAR1 and ADAR2 are expressed throughout the body, whereas ADAR3 is expressed only in the brain. ADAR1 and ADAR2 are catalytically active, whereas ADAR3 is thought to be inactive.
[0002] It has been shown that synthetic single-stranded oligonucleotides can use ADAR protein to edit target RNA by deaminating specific adenosines in the target RNA.The oligonucleotide is complementary to the target RNA, except for at least one mismatch opposite the adenosine to be deaminated.However, the methods disclosed so far have not been shown to have the necessary selectivity and / or stability to allow their use as therapy.Therefore, there is a need for novel oligonucleotides that can use ADAR protein to selectively edit target RNA in a therapeutically effective manner. Summary of the Invention
[0003] The present invention features compositions and methods useful for deaminating adenosines in target mRNAs, e.g., adenosines that may be deaminated to provide a therapeutic result in a subject in need thereof.
[0004] Adenosine deaminases acting on RNA (ADARs) are editing enzymes that recognize certain structural motifs in double-stranded RNA (dsRNA) and edit adenosines to inosines, resulting in recoding of amino acid codons that may lead to changes in the encoded protein and its function. The nucleobases surrounding the editing site, particularly the nucleobases immediately 5' to the editing site and the nucleobases immediately 3' to the editing site, which together with the editing site are referred to as a triplet, play an important role in the deamination of adenosines. A preference for U at the 5' position and G at the 3' position relative to the editing site was revealed by analysis of yeast RNA efficiently edited by overexpressed human ADAR2 and ADAR1. See Wang et al. (2018) Biochemistry, 57:1640-1651, Eifler et al. (2013) Biochemistry, 52:7857-7869, and Eggington et al. (2011) Nat. Commun., 319:1-9. Recruiting ADAR to specific sites of selected transcripts and deaminating adenosines regardless of the adjacent bases holds great promise for disease treatment. Based on structural and modeling studies of the editing site of dsRNA / ADAR complexes, several structural features that can be incorporated into guide oligonucleotides have been identified that, depending on their properties, can increase the recruitment of ADAR and increase the editing efficiency of target RNA. Novel oligonucleotides with chemical modifications, such as arabinoside (Ara), 2'-deoxy-2'-fluoro-arabinoside (FANA), 2'-O-methyl-arabinoside (Ara-OMe), α-deoxycytidine (α-dN), DNA abasic, RNA abasic, and 2'-O-methyl abasic, have been shown to recruit ADAR proteins and deaminate adenosines with different surrounding base compositions in target RNA. In addition, structure-activity relationship (SAR) studies have revealed that in addition to triplet modifications, 2'-O-methyl (2'-OMe) modifications to the ribose of some, but not all, nucleosides in guide oligonucleotides are compatible with efficient ADAR binding and editing.
[0005] Exemplary embodiments of the present invention are described in the paragraphs listed below.
[0006] E1. An oligonucleotide having the structure: [A m ]-X 1 -X 2 -X 3 -[B n ] wherein each of A and B is a nucleotide; m and n each independently represent an integer of 1 to 50; X 1 , X 2 , and X 3 are each independently a nucleotide, and X 1 , X 2 , or X 3 At least one of the formulae I to V: TIFF2025003992000001.tif50170, In the formula, N 1 is hydrogen or a nucleobase, R 1 is hydroxy, halogen, or C1-C6 alkoxy; R 2 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R 3 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R 4 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R 5 is hydrogen, hydroxy, halogen, or C1 to C6 alkoxy.
[0007] E2.R 4 is hydrogen and R 5 is not hydrogen or hydroxyl, or R 5 is hydrogen and R 4 is not hydrogen or R 5 is hydroxy and R 4The oligonucleotide according to E1, wherein is not hydrogen.
[0008] E3.[A m ] and / or [B n ], wherein at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 99%, or 100%) of the nucleotides in E1 or E2 comprise a nucleobase, a sugar, and an internucleoside linkage.
[0009] E4.X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3contains a guanine or hypoxanthine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase, or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 The oligonucleotide of any one of E1 to E3, wherein comprises a cytosine or 5-methylcytosine nucleobase.
[0010] E5.R 1 The oligonucleotide of any one of E1 to E4, wherein is hydroxy, halogen, or OCH3.
[0011] E6.R 2 The oligonucleotide according to any one of E1 to E5, wherein is hydrogen.
[0012] E7.X 1 , X 2 , or X 3 at least one of the formulas I, II, or V has the structure of 1 , X 2 , or X 3 The oligonucleotide according to any one of E1 to E6, wherein none of the above has the structure of formula III or formula IV.
[0013] E8.X 1 , X 2 , or X 3 At least one of the following has the structure of formula I or formula II: 1 , X 2 , or X 3The oligonucleotide according to any one of E1 to E7, none of which has the structure of formula III, formula IV, or formula V.
[0014] E9. The oligonucleotide of any one of E1-E8, wherein said halogen is fluoro.
[0015] E10.X 1 , X 2 , and X 3 at least one of the groups has the structure of formula I, wherein R 1 is fluoro and N 1 The oligonucleotide according to any one of E1 to E9, wherein is a nucleobase.
[0016] E11.X 1 has the structure of formula I, wherein R 1 is fluoro and N 1 The oligonucleotide of E10, wherein is a nucleobase.
[0017] E12.X 2 has the structure of formula I, wherein R 1 is fluoro and N 1 The oligonucleotide of E10 or E11, wherein is a nucleobase.
[0018] E13.X 3 has the structure of formula I, wherein R 1 is fluoro and N 1 The oligonucleotide according to any one of E10 to E12, wherein is a nucleic acid base.
[0019] E14.X 1 , X 2 , and X 3 at least one of the groups has the structure of formula I, wherein R 1 is hydroxy and N 1 The oligonucleotide according to any one of E1 to E9, wherein is a nucleobase.
[0020] E15.X 1has the structure of formula I, wherein R 1 is hydroxy and N 1 The oligonucleotide according to E14, wherein is a nucleobase.
[0021] E16.X 2 has the structure of formula I, wherein R 1 is hydroxy and N 1 The oligonucleotide of E14 or E15, wherein is a nucleobase.
[0022] E17.X 3 has the structure of formula I, wherein R 1 is hydroxy and N 1 The oligonucleotide according to any one of E14 to E16, wherein is a nucleobase.
[0023] E18.X 1 , X 2 , and X 3 at least one of the groups has the structure of formula I, wherein R 1 is methoxy and N 1 The oligonucleotide according to any one of E1 to E9, wherein is a nucleobase.
[0024] E19.X 1 has the structure of formula I, wherein R 1 is methoxy and N 1 The oligonucleotide according to E18, wherein is a nucleobase.
[0025] E20.X 2 has the structure of formula I, wherein R 1 is methoxy and N 1 The oligonucleotide of E18 or E19, wherein is a nucleobase.
[0026] E21.X 3 has the structure of formula I, wherein R 1 is methoxy and N 1 The oligonucleotide according to any one of E18 to E20, wherein is a nucleic acid base.
[0027] E22.X 1 , X 2 , and X 3 at least one of the groups has the structure of formula II, wherein R 2 is hydrogen and N 1 is a nucleobase or R 2 is hydrogen and N 1 The oligonucleotide of any one of E1 to E9, wherein is hydrogen.
[0028] E23.X 2 has the structure of formula II, wherein R 2 is hydrogen and N 1 is a nucleobase or R 2 is hydrogen and N 1 The oligonucleotide according to E22, wherein is hydrogen.
[0029] E24.X 1 and X 2 The oligonucleotide according to any one of E1 to E8, wherein at least one of the following has the structure of formula V.
[0030] E25.X 2 has the structure of formula V, wherein R 4 is hydrogen and R 5 The oligonucleotide according to E24, wherein is hydrogen.
[0031] E26.X 2 has the structure of formula V, wherein R 4 is hydrogen and R 5 The oligonucleotide according to E24, wherein is hydroxy.
[0032] E27.X 1 has the structure of formula V, wherein R 4 is hydrogen and R 5 The oligonucleotide according to E24, wherein is hydrogen.
[0033] E28.X 1 has the structure of formula V, wherein R 4 is hydrogen and R5 The oligonucleotide according to E24, wherein is hydroxy.
[0034] E29.X 2 has the structure of formula V, wherein R 4 is hydrogen and R 5 The oligonucleotide according to E24, wherein is methoxy.
[0035] E30.X 1 has any one of the structures of formulae I to V, X 2 and X 3 each is independently a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleic acid nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 2 has any one of the structures of formulae I to V, X 1 and X 3 each is independently a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleic acid nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 3 has any one of the structures of formulae I to V, X 1 and X 2 each is independently a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleic acid nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 1 and X 2 Each of the formulas I to V has a structure of any one of the formulas, 3is a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; and X 1 and X 3 Each of the formulas I to V has a structure of any one of the formulas, 2 is a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; and X 2 and X 3 Each of the formulas I to V has a structure of any one of the formulas, 1 is a ribonucleotide, a 2'-O-C1-C6 alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleic acid nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide.
[0036] E31.X 1 has any one of the structures of formulae I to V, X 2 and X 3 each of X is independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 2 has any one of the structures of formulae I to V, X 1 and X 3 each of X is independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 3 has any one of the structures of formulae I to V, X 1 and X 2each of X is independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 1 and X 2 Each of the formulas I to V has a structure of any one of the formulas, 3 is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide, and X 1 and X 3 Each of the formulas I to V has a structure of any one of the formulas, 2 is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide, and X 2 and X 3 Each of the formulas I to V has a structure of any one of the formulas, 1 is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide.
[0037] E32.X 1 has any one of the structures of formulae I to V, X 2 and X 3 each of which is a ribonucleotide, and X 2 has any one of the structures of formulae I to V, X 1 and X 3 each of which is a ribonucleotide, and X 3 has any one of the structures of formulae I to V, X 1 and X 2 each of which is a ribonucleotide, and X 1 and X 2 Each of the formulas I to V has a structure of any one of the formulas, 3 is a ribonucleotide and X 1 and X 3 Each of the formulas I to V has a structure of any one of the formulas, 2 is a ribonucleotide and X 2 and X 3 Each of the formulas I to V has a structure of any one of the formulas,1 The oligonucleotide according to E31, wherein is a ribonucleotide.
[0038] E33.X 1 , X 2 , and X 3 None of the above formula II has the structure, 1 The oligonucleotide according to any one of E1 to E22 and E24 to E32, wherein is a nucleic acid base.
[0039] E34.X 1 , X 2 , and X 3 None of the above formula II has the structure, 1 is a cytosine nucleobase.
[0040] E35.X 1 The oligonucleotide according to any one of E1 to E26 and E29 to E34, wherein said oligonucleotide comprises a uracil or thymine nucleobase.
[0041] E36.X 1 The oligonucleotide of E35, wherein said oligonucleotide comprises a uracil nucleobase.
[0042] E37.X 1 The oligonucleotide according to any one of E1 to E26 and E29 to E34, comprising a hypoxanthine nucleobase.
[0043] E38.X 1 The oligonucleotide according to any one of E1 to E26 and E29 to E34, wherein the oligonucleotide comprises a cytosine nucleobase.
[0044] E39.X 3 The oligonucleotide of any one of E1 to E38, wherein the oligonucleotide comprises a guanine nucleobase.
[0045] E40.X 3 The oligonucleotide of any one of E1 to E38, comprising a hypoxanthine nucleobase.
[0046] E41.X 3 The oligonucleotide of any one of E1 to E38, wherein the oligonucleotide comprises an adenine nucleobase.
[0047] E42.X 2 The oligonucleotide according to any one of E1 to E24, E27, E28, and E30 to E41, wherein the oligonucleotide comprises a cytosine or a 5-methylcytosine nucleobase.
[0048] E43.X 2 The oligonucleotide according to E42, wherein said oligonucleotide comprises a cytosine nucleobase.
[0049] E44.X 2 But the structure: TIFF2025003992000002.tif27170 (in the formula, R 1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C1-C6 alkoxy; R 2 is hydrogen, optionally substituted amino, or optionally substituted C1-C6 alkyl; R 3 and R 4 are independently hydrogen, halogen, or optionally substituted C1-C6 alkyl. The oligonucleotide according to any one of E1 to E24, E27, E28, and E30 to E41, comprising a nucleobase having the following structure, or a salt thereof:
[0050] E45.X 2 The oligonucleotide according to any one of E1 to E6, having a structure represented by any one of formulas I to V.
[0051] E46.X 2 The oligonucleotide according to any one of E1 to E45, wherein is not a 2'-O-methyl nucleotide.
[0052] E47.X 1 , X 2, and X 3 The oligonucleotide according to E46, which is not a 2'-O-methyl nucleotide.
[0053] E48.[A m The oligonucleotide of any one of E1 to E47, wherein:
[0054] E49.[A m The oligonucleotide of any one of E1-E48, wherein the nucleotide sequence (I) comprises at least one 2'-O-C1-C6 alkyl nucleotide, at least one 2'-amino nucleotide, at least one arabinonucleotide nucleotide, at least one bicyclic nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one constrained ethyl (cEt) nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
[0055] E50.[A m ] comprises at least one 2'-O-methyl nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
[0056] E51.[A m The oligonucleotide of any one of E1 to E50, wherein:
[0057] E52.[A m The oligonucleotide of any one of E1 to E51, wherein:
[0058] E53.[A mThe oligonucleotide of any one of E1 to E52, wherein:
[0059] E54. The oligonucleotide according to E52 or E53, wherein at least one phosphorothioate linkage is stereochemically pure.
[0060] E55.[B n The oligonucleotide of any one of E1 to E54, wherein:
[0061] E56.[B n The oligonucleotide of any one of E1 to E55, wherein:
[0114] comprises at least one 2'-O-C1-C6 alkyl nucleotide, at least one 2'-amino nucleotide, at least one arabinonucleotide nucleotide, at least one bicyclic nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
[0062] E57.[B n ] comprises at least one 2'-O-methyl nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
[0063] E58.[B n The oligonucleotide of any one of E1-E57, wherein:
[0064] E59.[B n The oligonucleotide of any one of E1 to E58, wherein:
[0065] E60.[B n The oligonucleotide of any one of E1 to E59, wherein:
[0066] E61. The oligonucleotide according to E59 or E60, wherein at least one phosphorothioate linkage is stereochemically pure.
[0067] E62.[A m ] and [B n The oligonucleotide of any one of E1 to E61, wherein at least 20% (e.g., at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%) of the nucleotides in all of the above combined are 2'-O-methyl nucleotides.
[0068] E63. The oligonucleotide according to any one of E1 to E62, wherein said oligonucleotide further comprises a 5' cap structure.
[0069] E64. The oligonucleotide according to E63, wherein said 5' cap structure is a 2,2,7-trimethylguanosine cap.
[0070] E65. The oligonucleotide of any one of E1-E64, wherein said oligonucleotide comprises at least one alternative nucleobase.
[0071] The alternative nucleobase is 5-methylcytosine, 5-hydroxycytosine, 5-methoxycytosine, N 4 -Methylcytosine, N 3 -Methylcytosine, N 4-ethylcytosine, pseudoisocytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, 5-aminocytosine, 5-ethynylcytosine, 5-propynylcytosine, pyrrolocytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, naphthyridine, 5-methoxyuracil, pseudouracil, dihydrouracil, 2-thiouracil, 4-thiouracil, 2-thiothymine, 4-thiothymine, 5,6-dihydrothymine, 5-halouracil, 5-propynyluracil, 5-aminomethyluracil, 5-hydroxymethyluracil, hypoxanthine, 7-deazaguanine, 8-aza-7-deazaguanine, 7-aza-2,6-diaminopurine, thienoguanine, N 1 -Methylguanine, N 2 -Methylguanine, 6-thioguanine, 8-methoxyguanine, 8-allyloxyguanine, 7-aminomethyl-7-deazaguanine, 7-methylguanine, imidazopyridopyrimidine, 7-deazaadenine, 3-deazaadenine, 8-aza-7-deazaadenine, 8-aza-7-deazaadenine, N 1 -Methyladenine, 2-methyladenine, N 6 The oligonucleotide according to E65, wherein the amino acid sequence is -methyladenine, 7-methyladenine, 8-methyladenine, or 8-azidoadenine.
[0072] E67. The oligonucleotide according to E65, wherein said alternative nucleobase is 2-amino-purine, 2,6-diamino-purine, 3-deaza-adenine, 7-deaza-adenine, 7-methyl-adenine, 8-azido-adenine, 8-methyl-adenine, 5-hydroxymethyl-cytosine, 5-methyl-cytosine, pyrrolo-cytosine, 7-aminomethyl-7-deaza-guanine, 7-deaza-guanine, 7-methyl-guanine, 8-aza-7-deaza-guanine, thieno-guanine, hypoxanthine, 4-thio-uracil, 5-methoxy-uracil, dihydro-uracil, or pseudouracil.
[0073] E68. The oligonucleotide according to E65, wherein said alternative nucleobase is 5-methyl-cytosine or 2-amino-purine.
[0074] E69. The oligonucleotide of any one of E1 to E68, wherein the 5' terminal nucleotide is a 2'-amino nucleotide.
[0075] E70. The oligonucleotide of any one of E1-E69, wherein A and B taken together consist of 18-80 nucleotides (e.g., 27-71, 36-62, 45-53, or 47-51 nucleotides).
[0076] The oligonucleotide according to any one of E1 to E70, wherein E71.m is 5 to 40 (e.g., 8 to 36, 12 to 32, 16 to 28, 20 to 24, or 30 to 40).
[0077] The oligonucleotide according to any one of E1 to E71, wherein E72.n is 5 to 40 (e.g., 7 to 17, 8 to 36, 12 to 32, 16 to 28, or 20 to 24).
[0078] E73. m and n are each independently an integer of 5 to 40; 1 , X 2 , and X 3 at least one of the groups has the structure of formula I, wherein R 1 is fluoro, hydroxy, or methoxy; N 1 is a nucleobase or has the structure of formula V, wherein R 4 is hydrogen and R 5 is hydrogen, and X does not have the structure of formula I or formula V 1 , X 2 , and X 3 Each of the is a ribonucleotide, [A m ] and [B n ] each contains at least five terminal 2'-O-methyl nucleotides and at least four terminal phosphorothioate linkages, m ] and [B n The oligonucleotide of claim E1, wherein at least 20% of the nucleotides in all of the sequences combined are 2'-O-methyl nucleotides.
[0079] E74.X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3contains a uracil or thymine nucleobase, or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 The oligonucleotide of E73, wherein said oligonucleotide comprises a cytosine or a 5-methylcytosine nucleobase.
[0080] E75. The oligonucleotide of any one of E1-E74, wherein said oligonucleotide further comprises one or more adenosine deaminase acting on RNA (ADAR) recruitment domains.
[0081] E76. The oligonucleotide of E75, wherein said oligonucleotide comprises one ADAR recruitment domain.
[0082] E77. The oligonucleotide of E76, wherein said ADAR recruitment domain is at the 5' end of said oligonucleotide.
[0083] E78. The oligonucleotide of E77, wherein said ADAR recruitment domain is at the 3' end of said oligonucleotide.
[0084] E79. The oligonucleotide of E78, wherein said oligonucleotide comprises a first ADAR recruitment domain and a second ADAR recruitment domain.
[0085] E80. The oligonucleotide of E79, wherein said first ADAR recruitment domain is at the 5' end of said oligonucleotide and said second ADAR recruitment domain is at the 3' end of said oligonucleotide.
[0086] E81. The oligonucleotide has formula VI: C-L1-D-L2-[A m ]-X 1 -X 2 -X 3 -[B n ] Equation VI wherein: [A m ]-X 1 -X 2 -X 3 -[B n E1 to E74] is the oligonucleotide according to any one of E1 to E74, C is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L1 is a loop region, D is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L2 is an optional linker, The oligonucleotide according to any one of E75 to E80, wherein the oligonucleotide comprises a double-stranded structure formed by C and D of 10 to 50 linked nucleosides in length, the double-stranded structure comprising at least one mismatch between the C nucleotide and the D nucleotide, and wherein C or D comprises at least one alternative nucleobase.
[0087] E82. The oligonucleotide according to E81, wherein C and D comprise at least one alternative nucleobase.
[0088] The oligonucleotide of E81 or E82, wherein L1 comprises a linked nucleoside.
[0089] The oligonucleotide according to E83, wherein E84.L1 consists of linked nucleosides.
[0090] The oligonucleotide of any one of E81 to E84, wherein E85.L1 comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0091] E86. The oligonucleotide of any one of E81 to E85, wherein C or D comprises at least one alternative internucleoside linkage and / or at least one alternative sugar moiety.
[0092] E87. The oligonucleotide of any one of E81-E85, wherein C and D each independently comprise at least one alternative internucleoside linkage and / or at least one alternative sugar moiety.
[0093] E88. The oligonucleotide has formula VII: C-L1-D-L2-[A m ]-X 1 -X 2 -X 3 -[B n ] Formula VII wherein: [A m ]-X 1 -X 2 -X 3 -[B n E1 to E74] is the oligonucleotide according to any one of E1 to E74, C is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L1 is a loop region that does not consist of linked nucleosides; D is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L2 is an optional linker, The oligonucleotide according to any one of E81 to E85, wherein the oligonucleotide comprises a double-stranded structure formed by C and D of 10 to 50 linked nucleosides in length, and the double-stranded structure comprises at least one mismatch between the C nucleotide and the D nucleotide.
[0094] E89.L1 is a compound of formula VIII: F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q -F 2 Formula VIII wherein F 1 is the bond between the loop region and C, and F 2 D and [A m or a bond between D and optionally said linker; G 1 , G 2 , G 3 , and G 4 each independently represents optionally substituted C1-C2 alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NR N Selected from R N is hydrogen, optionally substituted C 1~4 Alkyl, optionally substituted C 2~4 Alkenyl, optionally substituted C 2~4 Alkynyl, optionally substituted C 2~6 Heterocyclyl, optionally substituted C 6~12 Aryl or optionally substituted C 1~7 Heteroalkyl, C 1 and C 2 are each independently selected from carbonyl, thiocarbonyl, sulfonyl, or phosphoryl; j, k, m, n, p, and q are each independently 0 or 1; and I is optionally substituted C 1~10 Alkyl, optionally substituted C 2~10 Alkenyl, optionally substituted C 2~10 Alkynyl, optionally substituted C 2~6 Heterocyclyl, optionally substituted C 6~12 Aryl, optionally substituted C-C 10 Polyethylene glycol or optionally substituted C 1~10 Heteroalkyl, or F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G4 ) q -F 2 The oligonucleotide according to E83, wherein said chemical bond linking
[0095] E90.The oligonucleotide of E88 or E89, wherein L1 comprises a carbohydrate-containing linking moiety.
[0096] E91. The oligonucleotide of any one of E88 to E90, wherein C or D each comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0097] E92. The oligonucleotide of any one of E88 to E90, wherein C and D each comprise at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0098] E93. The oligonucleotide has Formula IX: C-L1-D-L2-[A m ]-X 1 -X 2 -X 3 -[B n ] Formula IX wherein: [A m ]-X 1 -X 2 -X 3 -[B n E1 to E74] is the oligonucleotide according to any one of E1 to E74, C is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L1 is a loop region comprising at least one alternative nucleobase or at least one alternative internucleoside linkage; D is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L2 is an optional linker, The oligonucleotide according to any one of E75 to E80, wherein the oligonucleotide comprises a double-stranded structure formed by C and D of 10 to 50 linked nucleosides in length, and the double-stranded structure comprises at least one mismatch between the C nucleotide and the D nucleotide.
[0099] The oligonucleotide of E93, wherein E94.L1 comprises at least one alternative nucleobase and at least one alternative internucleoside linkage.
[0100] E95. The oligonucleotide has Formula X: C-L1-D-L2-[A m ]-X 1 -X 2 -X 3 -[B n ] formula wherein: [A m ]-X 1 -X 2 -X 3 -[B n E1 to E74] is the oligonucleotide according to any one of E1 to E74, C is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L1 is a loop region comprising at least one alternative sugar moiety, the alternative sugar moiety being selected from the group consisting of a 2'-O-C1-C6 alkyl sugar moiety, a 2'-amino sugar moiety, a 2'-fluoro sugar moiety, a 2'-O-MOE sugar moiety, an arabinonucleic acid (ANA) sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid; D is a single-stranded oligonucleotide having a length of 10 to 50 linked nucleosides; L2 is an optional linker, The oligonucleotide according to any one of E75 to E80, wherein the oligonucleotide comprises a double-stranded structure formed by C and D of 10 to 50 linked nucleosides in length, and the double-stranded structure comprises at least one mismatch between the C nucleotide and the D nucleotide.
[0101] E96. The oligonucleotide of E95, wherein said bicyclic sugar moiety is selected from an oxy-LNA sugar moiety, a thio-LNA sugar moiety, an amino-LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety, and an LNA sugar moiety.
[0102] E97. The oligonucleotide of E95 or E96, wherein said ANA sugar moiety is a 2'-fluoro-ANA sugar moiety.
[0103] E98. The oligonucleotide of any one of E95 to E97, wherein C or D comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0104] E99. The oligonucleotide of any one of E95 to E97, wherein C and D each comprise at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0105] E100. The oligonucleotide of any one of E81 to E99, wherein C is complementary to at least 5 contiguous nucleobases of D.
[0106] E101. The oligonucleotide of any one of E81 to E99, wherein at least 80% (e.g., at least 85%, at least 90%, at least 95%) of the nucleobases of C are complementary to the nucleobases of D.
[0107] The oligonucleotide according to any one of E81 to E101, wherein E102.C comprises a nucleic acid base sequence having at least 80% sequence identity to the nucleic acid base sequence shown in any one of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34.
[0108] An oligonucleotide according to any one of E81 to E102, wherein E103.D comprises a nucleic acid base sequence having at least 80% sequence identity to a nucleic acid base sequence shown in any one of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35.
[0109] An oligonucleotide according to any one of E81 to E103, wherein E104.C-L1-D comprises a nucleic acid base sequence having at least 80% sequence identity to the nucleic acid base sequence shown in any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36.
[0110] E105. The at least one alternative nucleobase is 5-methylcytosine, 5-hydroxycytosine, 5-methoxycytosine, N4-methylcytosine, N3-methylcytosine, N4-ethylcytosine, pseudoisocytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, 5-aminocytosine, 5-ethynylcytosine, 5-propynylcytosine, pyrrolocytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, naphthyridine, 5-methoxyuracil, pseudouracil, dihydrouracil, 2-thiouracil, 4-thiouracil, 2-thiothymine, 4-thiothymine, 5,6-dihydrothymine, 5-halouracil, 5-propynyluracil, 5-aminomethyluracil, 5-hydroxymethyluracil ... The oligonucleotide according to any one of E81 to E87, E93, E94, E98, and E99, wherein the aryl group is selected from the group consisting of aryl, hypoxanthine, 7-deazaguanine, 8-aza-7-deazaguanine, 7-aza-2,6-diaminopurine, thienoguanine, N1-methylguanine, N2-methylguanine, 6-thioguanine, 8-methoxyguanine, 8-allyloxyguanine, 7-aminomethyl-7-deazaguanine, 7-methylguanine, imidazopyridopyrimidine, 7-deazaadenine, 3-deazaadenine, 8-aza-7-deazaadenine, 8-aza-7-deazaadenine, N1-methyladenine, 2-methyladenine, N6-methyladenine, 7-methyladenine, 8-methyladenine, and 8-azidoadenine.
[0111] E106. The oligonucleotide of any one of E81 to E87, E93, E94, E98, and E99, wherein said at least one alternative nucleobase is selected from the group consisting of 2-amino-purine, 2,6-diamino-purine, 3-deaza-adenine, 7-deaza-adenine, 7-methyl-adenine, 8-azido-adenine, 8-methyl-adenine, 5-hydroxymethyl-cytosine, 5-methyl-cytosine, pyrrolo-cytosine, 7-aminomethyl-7-deaza-guanine, 7-deaza-guanine, 7-methyl-guanine, 8-aza-7-deaza-guanine, thieno-guanine, hypoxanthine, 4-thio-uracil, 5-methoxy-uracil, dihydro-uracil, or pseudouracil.
[0112] E107. The oligonucleotide according to any one of E85-E87, E91-E94, E98, and E99, wherein the at least one alternative internucleoside linkage is selected from the group consisting of a phosphorothioate internucleoside linkage, a 2'-alkoxy internucleoside linkage, and an alkylphosphate internucleoside linkage.
[0113] E108. The oligonucleotide according to E107, wherein said at least one alternative internucleoside linkage is at least one phosphorothioate internucleoside linkage.
[0114] E109. The oligonucleotide of any one of E85-E87, E91, E92, and E95-E99, wherein the at least one alternative sugar moiety is selected from the group consisting of a 2'-O-alkyl sugar moiety, a 2'-O-methyl sugar moiety, a 2'-amino sugar moiety, a 2'-fluoro sugar moiety, a 2'-O-MOE sugar moiety, an ANA sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid.
[0115] E110. The oligonucleotide according to E109, wherein said bicyclic sugar moiety is selected from an oxy-LNA sugar moiety, a thio-LNA sugar moiety, an amino-LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety, and an LNA sugar moiety.
[0116] E111. The oligonucleotide according to E109, wherein said ANA sugar moiety is a 2'-fluoro-ANA sugar moiety.
[0117] E112. The oligonucleotide according to E109, wherein said at least one alternative sugar moiety is a 2'-O-methyl sugar moiety, a 2'-fluoro sugar moiety, or a 2'-O-MOE sugar moiety.
[0118] E113. The oligonucleotide of any one of E81 to E112, wherein said at least one mismatch is an A to C pair mismatch, a G to G pair mismatch, or a C to A pair mismatch.
[0119] E114. The oligonucleotide according to E113, wherein said oligonucleotide comprises at least two mismatches between C and D nucleotides.
[0120] E115. The oligonucleotide according to E114, wherein said at least two mismatches are separated by at least three linked nucleosides.
[0121] E116. The oligonucleotide according to E114, wherein said at least two mismatches are separated by three linked nucleosides.
[0122] E117. The oligonucleotide according to any one of E81 to E116, wherein said at least one mismatch comprises a nucleoside having an alternative nucleobase.
[0123] E118. The alternative nucleobase has the structure: TIFF2025003992000003.tif27170 (in the formula, R 1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C1-C6 alkoxy; R 2is hydrogen, optionally substituted amino, or optionally substituted C1-C6 alkyl; R 3 and R 4 are independently hydrogen, halogen, or optionally substituted C1-C6 alkyl. or a salt thereof.
[0124] E119. The oligonucleotide of any one of E81 to E118, wherein C-L1-D is an ADAR recruitment domain.
[0125] E120. The oligonucleotide of any one of E75 to E80 and E119, wherein said one or more ADAR recruitment domains is a glutamate ionotropic receptor AMPA type subunit 2 (GluR2) ADAR recruitment domain.
[0126] E121. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:37.
[0127] E122. The oligonucleotide has formula XI: TIFF2025003992000004.tif23170 Formula XI The oligonucleotide according to E121, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0128] E123. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:38.
[0129] E124. The oligonucleotide has formula XII: TIFF2025003992000005.tif23170 Formula XII The oligonucleotide according to E123, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0130] E125. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:39.
[0131] E126. The oligonucleotide has formula XIII: TIFF2025003992000006.tif23170 Formula XIII The oligonucleotide according to E125, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0132] E127. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:40.
[0133] E128. The oligonucleotide of any one of E75-E80 or E119-E127, wherein the one or more ADAR recruitment domains comprise at least one nuclease resistant nucleotide.
[0134] E129. The oligonucleotide according to E128, wherein said nuclease resistant nucleotides are 2'-O-methyl nucleotides.
[0135] E130. The oligonucleotide of any one of E75-E80 or E119-E127, wherein said one or more ADAR recruitment domains comprise at least one alternative internucleoside linkage.
[0136] E131. The oligonucleotide according to E130, wherein said alternative internucleoside linkage is a phosphorothioate internucleoside linkage.
[0137] E132. The oligonucleotide has formula XIV: TIFF2025003992000007.tif23170 Formula XIV The oligonucleotide according to any one of E127 to E131, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E81, * is a 2'-O-methyl nucleotide, s is a phosphorothioate internucleoside bond, and m represents a mismatch nucleotide.
[0138] E133. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:41.
[0139] E134. The oligonucleotide has formula XV: TIFF2025003992000008.tif21170 Formula XV The oligonucleotide according to E133, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0140] E135. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:42.
[0141] E136. The oligonucleotide has formula XVI: TIFF2025003992000009.tif22170 Formula XVI The oligonucleotide according to E135, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0142] E137. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:43.
[0143] E138. The oligonucleotide has formula XVII: TIFF2025003992000010.tif23170 Formula XVII The oligonucleotide according to E137, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0144] E139. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:44.
[0145] E140. The oligonucleotide has formula XVIII: TIFF2025003992000011.tif23170 Formula XVIII The oligonucleotide according to E139, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0146] E141. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:45.
[0147] E142. The oligonucleotide has formula XIX: TIFF2025003992000012.tif23170 Formula XIX The oligonucleotide according to E148, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0148] E143. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:46.
[0149] E144. The oligonucleotide has the formula XX: TIFF2025003992000013.tif21170 formula XX The oligonucleotide according to E143, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0150] E145. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:47.
[0151] E146. The oligonucleotide has formula XXI: TIFF2025003992000014.tif21170 Formula XXI The oligonucleotide according to E145, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0152] E147. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:48.
[0153] E148. The oligonucleotide has formula XXII: TIFF2025003992000015.tif21170 formula XXII The oligonucleotide according to E153, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0154] E149. The oligonucleotide of E120, wherein said GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:49.
[0155] E150. The oligonucleotide has formula XXIII: TIFF2025003992000016.tif21170 Formula XXIII The oligonucleotide according to E149, comprising the structure: wherein [ASO] comprises the oligonucleotide according to any one of E1 to E74, and m represents a mismatch nucleotide.
[0156] E151. The oligonucleotide of any one of E75 to E80, wherein said one or more ADAR recruitment domains is a Z-DNA ADAR recruitment domain.
[0157] E152. The oligonucleotide of any one of E75 to E80, wherein said one or more ADAR recruitment domains is an MS2 ADAR recruitment domain.
[0158] E153. The oligonucleotide of E152, wherein said MS2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:50.
[0159] E154. A conjugate comprising the oligonucleotide of any one of E1-E153 conjugated to a targeting moiety.
[0160] E155. The conjugate of E154, wherein said targeting moiety is a lipid, a sterol, a carbohydrate, and / or a peptide.
[0161] E156. The conjugate according to E155, wherein said oligonucleotide is conjugated to a sterol.
[0162] E157. The complex according to E156, wherein said sterol is cholesterol.
[0163] E158. The conjugate of any one of E155-E157, wherein said oligonucleotide is conjugated to a carbohydrate.
[0164] E159. The conjugate according to E158, wherein said carbohydrate is N-acetylgalactosamine.
[0165] E160. The conjugate according to any one of E155 to E159, wherein the oligonucleotide according to any one of E1 to E137 is conjugated to a peptide.
[0166] E161. The conjugate according to E160, wherein the peptide is a cell membrane penetrating peptide.
[0167] E162. The conjugate according to any one of E156 to E161, wherein said oligonucleotide is conjugated to a lipid.
[0168] E163. The complex according to E162, wherein said lipid is lithocholic acid, docosahexaenoic acid, or docosanoic acid.
[0169] E164. Compounds, An oligonucleotide according to any one of E1 to E153 or a complex according to any one of E154 to E163, and mRNA, The complex, wherein the oligonucleotide or the complex and the mRNA are hybridized to each other, and the complex contains a first mismatch at an adenosine of the mRNA.
[0170] E165. The conjugate according to E164, wherein said conjugate comprises a second mismatch that is 4 nucleotides 5' to said first mismatch.
[0171] E166. The conjugate according to E164 or E165, wherein said conjugate comprises 1, 2, 3, 4, 5, 6, 7, or 8 mismatches.
[0172] E167. The compound of any one of E164 to E166, wherein said mRNA comprises an adenosine that may be deaminated to produce a therapeutic result.
[0173] E168. The compound of any one of E164 to E166, wherein the mRNA comprises a guanosine to adenosine mutation compared to the corresponding native mRNA.
[0174] E169. The compound of E168, wherein said guanosine to adenosine mutation is a missense mutation or a nonsense mutation.
[0175] E170. The compound of any one of E164 to E169, wherein said first mismatch is at an adenosine in the start codon of said mRNA.
[0176] E171. The compound of any one of E164 to E169, wherein said first mismatch is at an adenosine in a stop codon of said mRNA.
[0177] E172. The compound of E171, wherein said stop codon is a premature stop codon.
[0178] A method for producing a complex described in any one of E173.E164 to E172, comprising contacting a cell with an oligonucleotide described in any one of E1 to E153 or a complex described in any one of E154 to E163.
[0179] E174. A method for deaminating adenosine in mRNA, the method comprising contacting a cell with an oligonucleotide according to any one of E1 to E153 or a complex according to any one of E154 to E163.
[0180] E175. A method for treating a disorder in a subject in need of such treatment, comprising administering to said subject an effective amount of an oligonucleotide according to any one of E1 to E153 or a conjugate according to any one of E154 to E163.
[0181] E176. The disorder is selected from the group consisting of cystic fibrosis, albinism, alpha-1-antitrypsin deficiency, Alzheimer's disease, amyotrophic lateral sclerosis, asthma, thalassemia 11, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease, distal spinal muscular atrophy, Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase deficiency, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease, hereditary polyaggregation syndrome, Leber's congenital amaurosis, Lesch-Neiman syndrome, The method of E175, wherein the disease is Hann's syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidoses, muscular dystrophies, myotonic dystrophy types I and II, neurofibromas, Niemann-Pick disease types A, B and C, NY-ESO-1 associated cancer, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disease, prothrombin mutation associated disorder (e.g., prothrombin G20210A mutation), pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome, sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturge-Weber syndrome, Rett syndrome, or cancer.
[0182] E177. The method of any one of E174 to E176, wherein the method further comprises administering an ADAR fusion protein to the cell or to the subject.
[0183] E178. The method of E177, wherein the ADAR fusion protein is administered to the cell or to the subject using an expression vector construct comprising a polynucleotide encoding an ADAR fusion protein.
[0184] E179. The method of E177 or E178, wherein the ADAR fusion protein comprises a deaminase domain of ADAR fused to MS2 bacteriophage coat protein.
[0185] E180. The method of E179, wherein the deaminase domain of ADAR is the deaminase domain of ADAR1.
[0186] E181. The method of E179, wherein the deaminase domain of ADAR is the deaminase domain of ADAR2.
[0187] E182. The method of any one of E175-E181, wherein administering comprises parenteral administration, intrathecal administration, or intracranial administration.
[0188] chemical terms The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0189] For any of the following chemical definitions, the number following the atomic symbol indicates the total number of atoms of that element present in a particular chemical moiety. As will be understood, other atoms, such as H atoms, or substituents as described herein may be present as necessary to satisfy the valence of the atom. For example, an unsubstituted C2 alkyl group has the formula -CH2CH3. When used with groups defined herein, references to the number of carbon atoms include the divalent carbon of acetal and ketal groups, but do not include the carbonyl carbon of acyl, ester, carbonate, or carbamate groups. References to the number of oxygen, nitrogen, or sulfur atoms of a heteroaryl group include only those atoms that form part of the heterocyclic ring.
[0190] When a particular substituent may occur more than once in the same structure, each instance of the substituent may be independently selected from the list of possible definitions for that substituent.
[0191] The term "alkyl," as used herein, refers to a branched or straight-chain monovalent saturated aliphatic hydrocarbon radical of 1 to 20 carbon atoms (e.g., 1 to 16 carbon atoms, 1 to 10 carbon atoms, 1 to 6 carbon atoms, or 1 to 3 carbon atoms).
[0192] Alkylene is a divalent alkyl group. The term "alkenyl," as used herein, alone or in combination with other groups, refers to a straight- or branched-chain hydrocarbon residue having a carbon-carbon double bond and having 2 to 20 carbon atoms (e.g., 2 to 16 carbon atoms, 2 to 10 carbon atoms, 2 to 6 carbon atoms, or 2 carbon atoms).
[0193] The term "halogen" as used herein means a fluorine (fluoro), chlorine (chloro), bromine (bromo), or iodine (iodo) radical.
[0194] The term "heteroalkyl" as used herein refers to an alkyl group, as defined herein, in which one or more of the constituent carbon atoms are replaced with nitrogen, oxygen, or sulfur. In some embodiments, the heteroalkyl group may be further substituted with one, two, three, or four substituents as described herein for alkyl groups. An example of a heteroalkyl group is "alkoxy", as used herein, refers to alkyl-O- (e.g., methoxy and ethoxy). Heteroalkylene is a divalent heteroalkyl group. The term "heteroalkenyl", as used herein, refers to an alkenyl group, as defined herein, in which one or more of the constituent carbon atoms are replaced with nitrogen, oxygen, or sulfur. In some embodiments, the heteroalkenyl group may be further substituted with one, two, three, or four substituents as described herein for alkenyl groups. An example of a heteroalkenyl group is "alkenoxy", as used herein, refers to alkenyl-O. Heteroalkenylene is a divalent heteroalkenyl group. The term "heteroalkynyl" as used herein refers to an alkynyl group, as defined herein, in which one or more of the constituent carbon atoms is replaced with nitrogen, oxygen, or sulfur. In some embodiments, the heteroalkynyl group can be further substituted with one, two, three, or four substituents, as described herein for alkynyl groups. An example of a heteroalkynyl group is "alkynoxy", as used herein, refers to alkynyl-O-. Heteroalkynylene is a divalent heteroalkynyl group.
[0195] The term "hydroxy" as used herein refers to an --OH group.
[0196] The alkyl, heteroalkyl groups may be substituted or unsubstituted. When substituted, there will typically be 1 to 4 substituents present unless otherwise specified. Substituents include, for example, alkyl (e.g., unsubstituted and substituted, where the substituents include any group described herein, e.g., aryl, halo, hydroxy), aryl (e.g., substituted and unsubstituted phenyl), carbocyclyl (e.g., substituted and unsubstituted cycloalkyl), halo (e.g., fluoro), hydroxyl, heteroalkyl (e.g., substituted and unsubstituted methoxy, ethoxy, or thioalkoxy), heteroaryl, heterocyclyl, amino (e.g., NH2 or mono- or dialkylamino), azido, cyano, nitro, or thiol. The aryl, carbocyclyl (e.g., cycloalkyl), heteroaryl, and heterocyclyl groups may also be substituted with alkyl (e.g., unsubstituted and substituted arylalkyl (e.g., substituted and unsubstituted benzyl) and the like.
[0197] The compounds of the present invention may have one or more asymmetric carbon atoms and may exist in the form of optically pure enantiomers, mixtures of enantiomers, such as racemates, optically pure diastereomers, mixtures of diastereomers, diastereomeric racemates, or mixtures of diastereomeric racemates. Optically active forms may be obtained, for example, by resolution of racemates, by asymmetric synthesis or asymmetric chromatography (chromatography using chiral adsorbents or eluents). That is, some of the disclosed compounds may exist in various stereoisomeric forms. Stereoisomers are compounds that differ only in their spatial arrangement. Enantiomers are pairs of stereoisomers whose mirror images are not superimposable, most commonly because they contain asymmetrically substituted carbon atoms that function as chiral centers. "Enantiomer" means one of a pair of molecules that are mirror images of each other and are not superimposable. Diastereomers are stereoisomers that are not mirror image related, most commonly because they contain two or more asymmetrically substituted carbon atoms and represent the arrangement of substituents around one or more chiral carbon atoms. Enantiomers of a compound may be prepared, for example, by separating the enantiomer from a racemate using one or more well-known techniques and methods, such as chiral chromatography and separation methods based thereon. Suitable techniques and / or methods for separating the enantiomers of the compounds described herein from a racemic mixture can be readily determined by one of ordinary skill in the art. "Racemate" or "racemic mixture" refers to a compound containing two enantiomers, and such mixtures do not exhibit any optical activity, i.e., they do not rotate the plane of polarized light. "Geometric isomer" refers to isomers that differ in the orientation of substituent atoms with respect to a carbon-carbon double bond, with a cycloalkyl ring, or with a bridged bicyclic system. Atoms (other than H) on either side of a carbon-carbon double bond may be in the E (substituents are on opposite sides of the carbon-carbon double bond) or Z (substituents are oriented on the same side) configuration. "R", "S", "S*", "R*", "E", "Z", "cis", and "trans" refer to the configuration relative to the core molecule. Some of the disclosed compounds may exist in atropisomeric forms.Atropisomers are stereoisomers resulting from restricted rotation around a single bond, where the steric strain barrier to rotation is high enough to allow the isolation of conformers. The compounds of the present invention may be prepared as individual isomers either by isomer-specific synthesis or by resolution from an isomeric mixture. Conventional resolution techniques include forming a salt of the free base of each isomer of an isomeric pair using an optically active acid (followed by fractional crystallization and regeneration of the free base), forming a salt of the acid form of each isomer of an isomeric pair using an optically active amine (followed by fractional crystallization and regeneration of the free acid), forming an ester or amide of each isomer of an isomeric pair using an optically pure acid, amine or alcohol (followed by chromatographic separation and removal of the chiral auxiliary), or resolving the isomeric mixture of either the starting material or the final product using a variety of well-known chromatographic methods. When the stereochemistry of the disclosed compounds is named or depicted by structure, the named or depicted stereoisomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% by weight relative to the other stereoisomer. When a single enantiomer is named or depicted by structure, the depicted or named enantiomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% optically pure by weight. When a single diastereomer is named or depicted by structure, the depicted or named diastereomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% pure by weight. Percent optical purity is the ratio of the weight of an enantiomer to the weight of the enantiomer and its optical isomer. Diastereomeric purity by weight is the ratio of the weight of one diastereomer to the weight of all diastereomers. When the stereochemistry of a disclosed compound is named or depicted by structure, the named or depicted stereoisomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% molar fraction pure relative to other stereoisomers.When a single enantiomer is named or depicted by structure, the depicted or named enantiomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% mole fraction pure. When a single diastereomer is named or depicted by structure, the depicted or named diastereomer is at least 60%, 70%, 80%, 90%, 99%, or 99.9% mole fraction pure. Percent purity by mole fraction is the ratio of moles of an enantiomer to moles of the enantiomer and its optical isomer. Similarly, percent purity by mole fraction is the ratio of moles of a diastereomer to moles of the diastereomer and its optical isomer. When a disclosed compound is named or depicted by structure without indicating stereochemistry and the compound has at least one chiral center, the name or structure should be understood to encompass either an enantiomer of the compound without the corresponding optical isomer, a racemic mixture of the compound, or a mixture enriched in one enantiomer compared to its corresponding optical isomer. When a disclosed compound is named or depicted by structure without indicating stereochemistry and has two or more chiral centers, the name or structure should be understood to encompass a diastereomer without the other diastereomer, multiple diastereomers without other diastereomeric pairs, mixtures of diastereomers, mixtures of diastereomeric pairs, mixtures of diastereomers enriched in one diastereomer compared to the other diastereomer(s), or mixtures of diastereomers enriched in one or more diastereomers compared to the other diastereomers. The present invention encompasses all of these forms.
[0198] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Methods and materials are described herein for use in this disclosure, and other suitable methods and materials known in the art may also be used. Materials, methods, and examples are merely illustrative and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0199] definition For convenience, the meanings of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless otherwise stated or implied from the context, the following terms and phrases include the meanings provided below. The definitions are provided to help describe certain embodiments and are not intended to limit the claimed technology, as the scope of the technology is limited only by the claims. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this technology belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided herein shall prevail.
[0200] In this application, unless otherwise clear from the context, (i) the term "a" may be understood to mean "at least one," (ii) the term "or" may be understood to mean "and / or," and (iii) the terms "including" and "comprising" may be understood to encompass the listed elements or steps, whether presented by themselves or with one or more additional elements or steps.
[0201] As used herein, the terms "about" and "approximately" refer to values within 10% above and below the stated value. For example, the term "about 5 nM" indicates a range of 4.5 to 5.5 nM.
[0202] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that may be logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each number in the series or range.
[0203] As used herein, "less than" or "less than" is understood as from the value adjacent to the phrase and the logically lower value or integer to zero, as is logical from the context.For example, an oligonucleotide having "five or less unmodified nucleotides" has 5, 4, 3, 2, 1, or 0 unmodified nucleotides.When "less than" is present before a series of numbers or a range, it is understood that "less than" can modify each number in the series of numbers or range.
[0204] As used herein, the term "administration" refers to administration of a composition (e.g., a compound or a preparation comprising a compound as described herein) to a subject or system. Administration to an animal subject (e.g., to a human) can be by any suitable route, such as those routes described herein.
[0205] As used herein, "combination therapy" or "administered in combination" means that two (or more) different agents or treatments are administered to a subject as part of a defined treatment regimen for a particular disease or condition. The treatment regimen defines the dose and periodicity of administration of each agent such that the effects of the separate agents on the subject overlap. In some embodiments, the delivery of two or more agents is simultaneous or parallel, and the agents may be co-formulated. In some embodiments, the two or more agents are not co-formulated, but are administered in a sequential manner as part of a defined regimen. In some embodiments, the administration of two or more agents or treatments in combination is such that the reduction in symptoms, or other parameters associated with the disorder, is greater than that observed with one agent or treatment delivered alone or in the absence of the other. The effect of the two treatments may be partially additive, fully additive, or greater than additive (e.g., synergistic). The sequential or substantially simultaneous administration of each therapeutic agent may be by any suitable route, including, but not limited to, oral, intravenous, intramuscular, and direct absorption through mucosal tissue. The therapeutic agents may be administered by the same route or by different routes, for example, a first therapeutic agent of the combination may be administered by intravenous injection, while a second therapeutic agent of the combination may be administered orally.
[0206] "G", "C", "A", "T" and "U" each generally represent naturally occurring nucleotides that contain guanine, cytosine, adenine, thymidine and uracil as bases, respectively. However, it will be understood that the term "nucleotide" can also refer to alternative nucleotides or surrogate replacement moieties, as further detailed below. Those skilled in the art will appreciate that guanine, cytosine, adenine and uracil can be substituted with other moieties without substantially changing the base pairing properties of an oligonucleotide that contains a nucleotide with such a replacement moiety. For example, but not limited to, a nucleotide that contains hypoxanthine as its base can base pair with a nucleotide that contains adenine, cytosine or uracil. Thus, a nucleotide that contains uracil, guanine or adenine can be replaced with, for example, a nucleotide that contains hypoxanthine in the nucleotide sequence of an oligonucleotide that is of interest in the present invention. In another example, adenine and cytosine anywhere in the oligonucleotide may be replaced with guanine and uracil, respectively, to form a GU wobble base pair with the target mRNA. Sequences containing such replacements are suitable for the compositions and methods featured in the present invention.
[0207] The terms "nucleobase" and "base" include purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds during nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses alternative nucleobases that may differ from naturally occurring nucleobases but function during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl.37 1.4.1.
[0208] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as an "alternate nucleobase" selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1-methylpseudouracil, 5-methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.
[0209] The nucleobase moieties may be designated by the letter code of the corresponding nucleobase, e.g., A, T, G, C, or U, and each letter may optionally include alternative nucleobases having equivalent functions. In some embodiments, e.g., for gapmers, 5-methylcytosine LNA nucleosides may be used.
[0210] "Sugar" or "sugar moiety" includes naturally occurring sugars having a furanose ring. Sugar also includes "sugar substitutes," defined as structures that can replace the furanose ring of a nucleoside. In certain embodiments, the sugar substitute is a non-furanose (or 4'-substituted furanose) ring or ring system or open system. Such structures may include simple changes compared to the natural furanose ring, such as a six-membered ring, or may be more complex, as in the case of the acyclic systems used in peptide nucleic acids. Sugar substitutes may also include sugar surrogates in which the furanose ring is replaced with another ring system, such as, for example, a morpholino or hexitol ring system. Sugar moieties useful for preparing oligonucleotides having a motif include, but are not limited to, β-D-ribose, β-D-2'-deoxyribose, substituted sugars (such as 2', 5' and bis-substituted sugars), 4'-S-sugars (such as 4'-S-ribose, 4'-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic sugar surrogates (such as bicyclic sugars derived from 2'-O-CH2-4' or 2'-O-(CH2)2-4' bridged ribose) and sugar surrogates (such as where the ribose ring is replaced with a morpholino or hexitol ring system). The type of heterocyclic base and internucleoside linkage used at each position varies and is not a determining factor of the motif. In most nucleosides with surrogate sugar moieties, the heterocyclic nucleobase is generally maintained to allow hybridization.
[0211] "Nucleotide" as used herein refers to a monomeric unit of an oligonucleotide or polynucleotide that includes a nucleoside and an internucleoside linkage. The internucleoside linkage may or may not include a phosphate linkage. Similarly, "linked nucleosides" may or may not be linked by a phosphate linkage. Many "alternative internucleoside linkages" are known in the art, including, but not limited to, phosphorothioate and boronophosphate linkages. Alternative nucleosides include bicyclic nucleosides (BNAs) (e.g., locked nucleosides (LNAs) and constrained ethyl (cEt) nucleosides), peptide nucleosides (PNAs), phosphotriesters, phosphorothioates, phosphoramidates, and other variants on the phosphate backbone of natural nucleosides, including those described herein.
[0212] "Alternative nucleotide," as used herein, refers to a nucleotide having an alternative nucleoside or alternative sugar and internucleoside linkage, which may include alternative nucleoside linkages.
[0213] The term "nucleoside" refers to a monomeric unit of an oligonucleotide or polynucleotide having a nucleobase and a sugar moiety. Nucleosides may include naturally occurring as well as alternative nucleosides, such as those described herein. The nucleobase of a nucleoside may be a naturally occurring nucleobase or an alternative nucleobase. Similarly, the sugar moiety of a nucleoside may be a naturally occurring sugar or an alternative sugar.
[0214] The term "alternative nucleoside" refers to a nucleoside having an alternative sugar or alternative nucleobase, such as those described herein.
[0215] The term "nuclease-resistant nucleotide" as used herein refers to a nucleotide that limits nuclease degradation of an oligonucleotide. Nuclease-resistant nucleotides generally increase the stability of an oligonucleotide by not functioning well as a substrate for nucleases. Nuclease-resistant nucleotides are known in the art, for example, 2'-O-methyl nucleotides and 2'-fluoro nucleotides.
[0216] The terms "oligonucleotide" and "polynucleotide" as used herein are defined as molecules that contain two or more covalently linked nucleosides as commonly understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically produced in the laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or modifications thereof. The oligonucleotides of the present invention may be artificial, being chemically synthesized and typically purified or isolated. Oligonucleotides are also intended to include compounds with (i) one or more furanose moieties replaced by furanose derivatives or any cyclic or acyclic structure that may be used as a covalent attachment point for the base moiety, (ii) one or more phosphodiester linkages that are either modified as in the case of phosphoramidate or phosphorothioate linkages, or completely replaced by suitable linkage moieties as in the case of formacetal or riboacetal linkages, and / or (iii) one or more linking furanose-phosphodiester linkages that are replaced by any cyclic or acyclic structure that may be used as a covalent attachment point for the base moiety. The oligonucleotides of the present invention may include one or more alternative nucleosides or nucleotides (including, for example, those described herein). It is further understood that oligonucleotides include compositions that lack sugar moieties or nucleobases, but can still pair with or hybridize to target sequences.
[0217] "Oligonucleotide" refers to short polynucleotides (eg, 100 or fewer linked nucleosides).
[0218] The oligonucleotide may be of any length that allows for deamination of adenosine of a desired target RNA via the ADAR-mediated pathway, and may be about 10-50 base pairs in length, e.g., about 15-50 base pairs in length or about 18-50 base pairs in length, e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 base pairs in length, e.g., about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30 ... 2, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19 The length may be in the range of 22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length, etc. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the invention.
[0219] The term "gapmer," as used herein, refers to an oligonucleotide that includes a region of an RNase H recruiting oligonucleotide (the gap) flanked on the 5' and 3' sides by regions that include one or more affinity-enhancing alternative nucleosides (wings or flanks). Various gapmer designs are described herein. Headmers and tailmers are oligonucleotides capable of recruiting RNase H that lack one of the wings, i.e., only one end of the oligonucleotide contains the affinity-enhancing alternative nucleoside. In the case of a headmer, the 3' wing is missing (i.e., the 5' wing includes the affinity-enhancing alternative nucleoside) and in the case of a tailmer, the 5' wing is missing (i.e., the 3' wing includes the affinity-enhancing alternative nucleoside). A "mixed wing gapmer" refers to a gapmer in which the wing region comprises at least one alternative nucleoside, such as at least one DNA nucleoside or at least one 2'-substituted alternative nucleoside, such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (2'-O-MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-F-ANA nucleoside(s), or bicyclic nucleosides (e.g., locked nucleosides or cEt nucleosides). In some embodiments, a mixed wing gapmer has one wing (e.g., on the 5' or 3' side) that comprises an alternative nucleoside and the other wing (on the 3' or 5' side, respectively) comprises the 2'-substituted alternative nucleoside(s).
[0220] The term "linker" or "linking group" refers to a bond between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest by one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently attach a third region, e.g., a conjugate moiety, to the oligonucleotide (e.g., at the end of region A or C). In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally include a linker region disposed between the oligonucleotide and the conjugate moiety. In some embodiments, the linker between the conjugate and the oligonucleotide is biochemically cleavable. Phosphodiester containing biochemically cleavable linkers are described in more detail in WO2014 / 076195 (herein incorporated by reference).
[0221] As used herein, the term "ADAR recruitment domain" refers to a nucleotide sequence that may be covalently linked to the oligonucleotide of the present invention to form a stem-loop structure that functions as a recruitment and binding region for ADAR enzymes. Oligonucleotides that include such ADAR recruitment domains may be referred to as "axiomer AONs" or "self-looping AONs". The ADAR recruitment domain portion may function to recruit endogenous ADAR enzymes present in cells. Such ADAR recruitment domains do not require the complexing entity or presence of modified recombinant ADAR enzymes. Alternatively, the ADAR recruitment portion may function to recruit recombinant ADAR fusion proteins that have been delivered to cells or to subjects via an expression vector construct that includes a polynucleotide encoding the ADAR fusion protein. Such ADAR fusion proteins may include the deaminase domain of ADAR1 or ADAR2 enzymes fused to another protein, for example, to MS2 bacteriophage coat protein. The ADAR recruitment domain may be a nucleotide sequence based on a natural substrate (e.g., GluR2 receptor pre-mRNA, e.g., GluR2 ADAR recruitment domain), a Z-DNA structure, or a domain known to recruit another protein that is part of an ADAR fusion protein, e.g., the MS2 ADAR recruitment domain, which is known to be recognized by the dsRNA binding region of ADAR. The stem-loop structure of the ADAR recruitment domain may be an intermolecular stem-loop structure formed by two separate nucleic acid strands, or an intramolecular stem-loop structure formed within a single nucleic acid strand.
[0222] As used herein, the term "Z-DNA" refers to the left-handed conformation of a DNA double helix or an RNA stem-loop structure. Such DNA or dsRNA helices are left-handed in a zigzag pattern (as opposed to right-handed, as in the more commonly seen B-DNA form). Z-DNA is a known high-affinity ADAR binding substrate and has been shown to bind to the human ADAR1 enzyme.
[0223] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide or nucleoside sequence to hybridize to form a double-stranded structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by those skilled in the art. Such conditions may be, for example, stringent conditions, which may include 400 mM NaCl, 40 mM PIPES (pH 6.4), 1 mM EDTA, 50°C, or 70°C for 12-16 hours, followed by washing (see, for example, Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as those that may occur within an organism, may be applied, such as physiologically relevant conditions. One skilled in the art will be able to determine the optimal set of conditions for testing the complementarity of two sequences according to the ultimate use of the hybridized nucleotides or nucleosides.
[0224] "Complementary" sequences, as used herein, may also include or be formed entirely of non-Watson-Crick base pairs and / or base pairs formed from non-natural and alternative nucleotides, so long as the above requirements regarding their ability to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogsteen base pairing. Complementary sequences between an oligonucleotide and a target sequence as described herein include base pairing over the entire length of one or both nucleotide sequences, an oligonucleotide or polynucleotide comprising a first nucleotide sequence, and an oligonucleotide or polynucleotide comprising a second nucleotide sequence. Such sequences may be referred to herein as being "fully complementary" to each other. However, when a first sequence is referred to as "substantially complementary" to a second sequence herein, the two sequences may be fully complementary while retaining the ability to hybridize under conditions most relevant to their ultimate use, e.g., deamination of adenosine, or they may form one or more, but generally no more than five, four, three or two mismatched base pairs upon hybridization to a duplex of up to 30 base pairs. "Substantially complementary" may also refer to a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA with a target adenosine). For example, a polynucleotide is complementary to at least a portion of an mRNA of interest if the sequence is substantially complementary to a non-interrupted portion of the mRNA of interest.
[0225] As used herein, the term "region of complementarity" refers to a region on an oligonucleotide that is substantially complementary to all or a portion of a gene, a primary transcript, a sequence (e.g., a target sequence, e.g., a target sequence having a target adenosine), or an mRNA that is processed to interfere with the expression of an endogenous gene. If the region of complementarity is not completely complementary to the target sequence, mismatches may occur in the internal or terminal regions of the molecule. In general, the most tolerated mismatches occur in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and / or 3' ends of the oligonucleotide.
[0226] The phrase "contacting a cell with an oligonucleotide", such as an oligonucleotide, as used herein includes contacting a cell by any possible means. Contacting a cell with an oligonucleotide includes contacting a cell with an oligonucleotide in vitro or contacting a cell with an oligonucleotide in vivo. Contacting can be performed directly or indirectly. Thus, for example, the oligonucleotide may be physically contacted with the cell by the individual who performs the method, or alternatively, the oligonucleotide agent may be in a situation that allows or causes it to contact the cell later.
[0227] Contacting cells in vitro can be, for example, by incubating cells with oligonucleotide. Contacting cells in vivo can be, for example, by injecting oligonucleotide into or near the tissue where the cells are located, or by injecting oligonucleotide agent into another area, for example, bloodstream or subcutaneous space, so that the agent will then reach the tissue where the contacted cells are located.For example, the oligonucleotide can contain and / or be bound to a ligand, for example, GalNAc3, which directs the oligonucleotide to the site of interest, for example, liver. A combination of in vitro and in vivo contact methods is also possible.For example, cells can also be contacted with oligonucleotide in vitro and then transplanted into a subject.
[0228] In one embodiment, contacting a cell with an oligonucleotide includes "introducing" or "delivering" an oligonucleotide into a cell by promoting or causing uptake or absorption into the cell. Absorption or uptake of an oligonucleotide can occur through unassisted diffusive or active cellular processes, or by auxiliary agents or devices. Introduction of an oligonucleotide into a cell can be in vitro and / or in vivo. For example, in in vivo introduction, an oligonucleotide can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art, such as electroporation and lipofection. Further approaches are described below and / or known in the art.
[0229] As used herein, "lipid nanoparticles" or "LNPs" are vesicles that contain a lipid layer that encapsulates pharma- ceutical active molecules, such as nucleic acid molecules, such as oligonucleotides. LNPs refer to stable nucleic acid-lipid particles. LNPs usually contain cationic ionic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.
[0230] As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one or more bilayers. Liposomes include unilamellar and multilamellar vesicles with a membrane formed from lipophilic material and an aqueous interior. The aqueous portion contains the oligonucleotide composition. The lipophilic material separates the aqueous interior from the aqueous exterior, which usually does not contain the oligonucleotide composition, but in some instances may. Liposomes also include "sterically stabilized" liposomes, which term, as used herein, refers to liposomes that contain one or more specialized lipids, which, when incorporated into the liposome, provide an increased circulation life compared to liposomes that lack such specialized lipids.
[0231] A "micelle" is defined herein as a particular type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecule face inward, while the hydrophilic portions remain in contact with the surrounding aqueous phase. The reverse arrangement exists when the environment is hydrophobic.
[0232] "Complementary" polynucleotides are those that can base pair according to standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form either guanine paired with cytosine (G:C) and adenine paired with thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. It is understood that two polynucleotides may hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other.
[0233] As used herein, the terms "effective amount," "therapeutically effective amount," and "sufficient amount" of an agent that produces a therapeutic effect (e.g., in a cell or a subject) described herein refer to an amount sufficient to produce a beneficial or desired result, including a clinical result, when administered to a subject, including a human, and thus "effective amount" or its synonyms will depend on the context in which it is being applied. For example, in the context of treating a disorder, it is an amount of an agent sufficient to achieve a therapeutic response when compared to the response obtained in the absence of administration. The amount of a given agent will vary depending on a variety of factors, such as the given agent, pharmaceutical formulation, route of administration, type of disease or disorder, identity of the subject or host being treated (e.g., age, sex, and / or weight), etc., but may nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of an agent is an amount that produces a beneficial or desired result in a subject when compared to a control. As defined herein, a therapeutically effective amount of an agent may be readily determined by one of skill in the art by routine methods known in the art. Dosing regimens may be adjusted to provide optimal therapeutic responses.
[0234] "Prophylactically effective amount" as used herein is intended to include an amount of oligonucleotide sufficient to prevent or ameliorate disease or one or more symptoms of disease when administered to a subject with or predisposed to having a disorder. Ameliorating disease includes slowing the progression of disease or reducing the severity of subsequent disease. "Prophylactically effective amount" may vary depending on the oligonucleotide, the method of administration of the agent, the degree of disease risk, and the medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other individual characteristics of the patient to be treated.
[0235] A "therapeutically effective amount" or a "prophylactically effective amount" also includes an amount of oligonucleotide (either administered in single or multiple doses) that produces some desired local or systemic effect, at a reasonable benefit / risk ratio applicable to any treatment. The oligonucleotides used in the methods of the invention may be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.
[0236] A prophylactically effective amount may also refer to an amount, for example, that when administered to a subject, including a human, sufficient to delay the onset of one or more of the disorders described herein by at least 120 days, e.g., at least 6 months, at least 12 months, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 10 years or more, as compared to expected onset.
[0237] "Determining the level of a protein" refers to detecting the protein, or the mRNA encoding the protein, by methods known in the art, either directly or indirectly. "Directly determining" refers to performing a process to obtain a physical entity or value (e.g., performing an assay or test on a sample, or "analyzing a sample" as that term is defined herein). "Indirectly determining" refers to receiving a physical entity or value from another party or source (e.g., a third party laboratory that directly obtained the physical entity or value). Methods for measuring protein levels generally include, but are not limited to, Western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescence polarization, phosphorescence, immunohistochemistry, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC) mass spectrometry, microcytometry, microscopy, fluorescence-activated cell sorting (FACS), and flow cytometry, as well as assays based on protein properties, including, but not limited to, enzyme activity or interaction with other protein partners.Methods for measuring mRNA levels are known in the art.
[0238] "Percent sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps if necessary to obtain the maximum percent sequence identity. Alignment to determine percent nucleic acid or amino acid sequence identity can be achieved in a variety of ways that are within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment over the entire length of the sequences being compared. For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence A to, with, or against a given nucleic acid or amino acid sequence B (which can be translated as a given nucleic acid or amino acid sequence A having a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of nucleotides or amino acids that a sequence alignment program (e.g., BLAST) scores as identical matches in that program's alignment of A and B, and Y is the total number of nucleic acids in B. It will be understood that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not be equal to the percent sequence identity of B to A.
[0239] "Level" refers to the level or activity of a protein, or an mRNA encoding a protein, when compared to a reference. The reference can be any useful reference, as defined herein. A "decreased level" or "increased level" of a protein refers to a decrease or increase in protein level when compared to a reference (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more decrease or increase, when compared to a reference, about 10%, about 15%, about 20%, about 30%, about 40%, about 500%, or more decrease or increase, when compared to a reference). By "protein level" is meant a decrease or increase of about 15%, about 20%, about 50%, about 75%, about 100%, or more than about 200%, a decrease or increase of about 0.01-fold, about 0.02-fold, about 0.1-fold, about 0.3-fold, about 0.5-fold, about 0.8-fold or less, or an increase of about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2.0-fold, about 3.0-fold, about 3.5-fold, about 4.5-fold, about 5.0-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold or more). Protein levels may be expressed as mass / volume (e.g., g / dL, mg / mL, μg / mL, ng / mL) or as a percentage compared to the total protein or mRNA in the sample.
[0240] The term "pharmaceutical composition" as used herein refers to a composition containing a compound described herein, which is formulated with a pharmaceutically acceptable excipient and is preferably manufactured or sold by approval of a government regulatory agency as part of a therapeutic regimen for treating a disease in a mammal.The pharmaceutical composition can be formulated, for example, for oral administration in unit dosage form (e.g., tablet, capsule, caplet, gelcap, or syrup), for topical administration (e.g., as a cream, gel, lotion, or ointment), for intravenous administration (e.g., as a sterile solution in a solvent system that is free of particulate embolic material and suitable for intravenous use), for intrathecal injection, for intraventricular injection, for intraparenchymal injection, or in any other pharmaceutically acceptable formulation.
[0241] "Pharmaceutically acceptable excipient" as used herein refers to any component other than the compounds described herein (e.g., a vehicle that can suspend or dissolve active compounds), and has the property of being substantially non-toxic and non-inflammatory in patients.Excipients may include, for example, anti-adhesive agents, antioxidants, binders, coating agents, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film-forming or coating agents, flavors, fragrances, flow agents (glidants), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and hydration water. Exemplary excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.
[0242] As used herein, the term "pharmaceutically acceptable salt" refers to any pharmaceutically acceptable salt of a compound for any of the compounds described herein. For example, pharmaceutically acceptable salts of any of the compounds described herein include those that are suitable for use in contact with human and animal tissues without causing undue toxicity, irritation, or allergic response within the scope of sound medical judgment, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977, and Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCH, 2008. Salts can be prepared in situ during the final isolation and purification of the compounds described herein, or separately by reacting the free base group with a suitable organic acid.
[0243] The compounds described herein may have ionic groups so that they can be prepared as pharmaceutically acceptable salts. These salts may be acid addition salts, including inorganic or organic acids, or salts may be prepared from inorganic or organic bases in the case of the acidic form of the compounds described herein. In many cases, compounds are prepared or used as pharmaceutically acceptable salts prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparing suitable salts are well known in the art. Salts may be prepared from pharmaceutically acceptable non-toxic acids and bases, including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, and 2-hydroxy-ethanesulfonate. Salts include, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine.
[0244] By "reference" is meant any useful reference used to compare protein or mRNA levels or activity. A reference can be any sample, standard, calibration curve, or level used for comparison purposes. A reference can be a normal reference sample or a reference standard or level. A "reference sample" can be, for example, a control, e.g., a predefined negative control value such as a "normal control" or a previous sample taken from the same subject, a sample from a normal healthy subject, e.g., a normal cell or normal tissue, a sample (e.g., cell or tissue) from a subject without a disease, a sample from a subject who has been diagnosed with a disease but has not yet been treated with a compound described herein, a sample from a subject who has been treated with a compound described herein, or a sample of a known normal concentration of purified protein (e.g., any described herein). By "reference standard or level" is meant a value or number obtained from a reference sample. A "normal control value" is a predefined value indicative of a non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range ("X to Y"), a high threshold value ("below X"), or a low threshold value ("above X"). A subject having a measurement within the normal control value for a particular biomarker is usually referred to as being "within the normal range" for that biomarker. The normal reference standard or level can be a value or value obtained from a normal subject without a disease or disorder, a subject treated with a compound described herein. In a preferred embodiment, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria: age, weight, sex, disease stage, and overall health. A standard curve of purified protein within the normal reference range, for example any of the levels described herein, can also be used as a reference.
[0245] As used herein, the term "subject" refers to any organism to which the compositions according to the invention may be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals, such as mice, rats, rabbits, non-human primates, and humans). A subject may be a human or animal that seeks or needs treatment, is in need of treatment, is undergoing treatment, will be undergoing treatment in the future, or is under the care of a professional trained in a particular disease or condition.
[0246] As used herein, the terms "treat", "treated" or "treating" refer to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow (reduce) an undesirable physiological condition, disorder, or disease, or to obtain a beneficial or desired clinical outcome. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction in the extent of the condition, disorder, or disease, stabilization (i.e., not worsening) of the condition, disorder, or disease, delay in onset of the condition, disorder, or disease or slowing its progression, improvement or remission (whether partial or total) of the condition, disorder, or disease state, whether detectable or undetectable, improvement in at least one measurable physical parameter, not necessarily discernible by the patient, or improvement or amelioration of the condition, disorder, or disease. Treatment includes eliciting a clinically significant response without causing an excessive level of side effects. Treatment also includes extending survival as compared to the expected survival in the absence of treatment.
[0247] As used herein, the terms "variant" and "derivative" are used interchangeably and refer to naturally occurring, synthetic, and semi-synthetic analogs of the compounds, peptides, proteins, or other substances described herein. Variants or derivatives of the compounds, peptides, proteins, or other substances described herein may retain or improve the biological activity of the original material.
[0248] The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description, and from the claims. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0249] The inventors have discovered that modified oligonucleotides can be utilized to deaminate target adenosines in mRNA. Thus, the present invention features compositions and methods useful for deaminating target adenosines on mRNA, e.g., adenosines that may be deaminated to provide a therapeutic outcome in a subject in need thereof.
[0250] I. Disability The present invention also provides an oligonucleotide of the present invention for use in a method for altering a target RNA sequence in a mammalian, preferably human, cell, as described herein.Similarly, the present invention provides the use of an oligonucleotide construct of the present invention in the manufacture of a medicament for altering a target RNA sequence in a mammalian, preferably human, cell, as described herein.
[0251] The present invention also relates to a method of deaminating at least one specific target adenosine present in a target RNA sequence in a cell, the method comprising the steps of providing to a cell an oligonucleotide as described herein, allowing uptake of the oligonucleotide by the cell, allowing annealing of the oligonucleotide to the target RNA sequence, allowing a mammalian ADAR enzyme comprising a native dsRNA binding domain as found in a wild-type enzyme to deaminate the target adenosine in the target RNA sequence to inosine, and optionally identifying the presence of inosine in the RNA sequence.
[0252] Therefore, the present invention also relates to oligonucleotides and methods in which two adjacent adenosines are simultaneously deaminated by an RNA editing enzyme such as ADAR. In this particular case, a UAA stop codon is converted to a codon encoding UII Trp. Other examples of modifications resulting from deamination of a target adenosine in a target codon are provided in Tables 1 and 2 below. TIFF2025003992000017.tif253170TIFF2025003992000018.tif70170TIFF2025003992000019.tif143170
[0253] Since adenosine to inosine deamination may result in a protein that is not affected by the mutant A at the target position, the identification of deamination to inosine may be a functional readout, for example an assessment of whether a functional protein is present, or even an assessment that the disease caused by the presence of adenosine is (partially) reversed. The functional assessment for each of the diseases mentioned herein will generally follow methods known to those skilled in the art. If the presence of the target adenosine causes aberrant splicing, the readout may be an assessment of whether aberrant splicing still occurs or not, or whether it is less. On the other hand, if the introduction of a splice site is desired for the deamination of the target adenosine, a similar approach may be used to confirm whether the required type of splicing is actually occurring. A very suitable technique for identifying the presence of inosine after deamination of the target adenosine is, of course, RT-PCR and sequencing, using methods well known to those skilled in the art.
[0254] Generally, any target RNA mutation that can be reversed using the oligonucleotide construct according to the present invention is a G to A mutation, and the oligonucleotide construct can be designed accordingly. Mutations that can be targeted using the oligonucleotide construct according to the present invention also include C to A, U to A (T to A at the DNA level) when recruiting adenosine deaminase. RNA editing in the latter situation may not necessarily revert the mutation to wild type, but the edited nucleotide may provide an improvement over the original mutation. For example, a mutation that causes an in-frame stop codon (resulting in a truncated protein upon translation) may not be the original amino acid at that position, but may be changed to a codon that codes for an amino acid that results in a (full-length) protein with at least some functionality, at least more functionality than the truncated protein.
[0255] The present invention relates to a method for treating genetic disorders such as cystic fibrosis, albinism, alpha-1-antitrypsin (A1AT) deficiency, Alzheimer's disease, amyotrophic lateral sclerosis, asthma, thalassemia 11, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase deficiency, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease (IBD), hereditary polyaggregation syndrome, Leber's congenital amaurosis, Lesch-Nyhan syndrome. The present invention is particularly suitable for the treatment of various cancer types, such as idiopathies, myocardial infarction, pulmonary hypertension, retinitis pigmentosa, pulmonary fibrosis, pulmonary fibrosis, myotonic dystrophy, myotonic dystrophy types I and II, neurofibromas, Niemann-Pick disease types A, B and C, NY-ESO-1 associated cancers, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary diseases, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturge-Weber syndrome, Rett syndrome, as well as various cancer types (e.g., BRCA1 and 2 linked breast and ovarian cancer).
[0256] The oligonucleotides of the invention may deaminate the adenosine mutations, resulting in increased protein activity.
[0257] In certain embodiments, treatment is administered to subjects who have been diagnosed with a genetic mutation but do not yet have disease symptoms (e.g., infants, e.g., subjects aged 1-12 months or less than 2 years of age, etc.) In other embodiments, treatment is administered to individuals who have at least one symptom.
[0258] Treatment may be performed on subjects of any age, beginning in infancy through adulthood. Subjects may begin treatment, for example, at birth, 6 months, or at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, or 18 years of age.
[0259] In certain embodiments, the oligonucleotide increases protein activity in vitro and / or in vivo (e.g., an increase of 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more, or an increase of more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold or more).
[0260] In some embodiments, the oligonucleotide increases protein activity in the brain (e.g., an increase of 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more, or an increase of more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold or more).
[0261] II. Oligonucleotide Agents The oligonucleotide of the present invention is complementary to the target mRNA, except for at least one mismatch that can recruit ADAR enzyme to deaminate selected adenosines on the target mRNA.In some embodiments, only one adenosine is deaminated.In some embodiments, one, two, or three adenosines are deaminated.The oligonucleotide is opposite the target adenosine, for example, X 2 The oligonucleotides of the invention may further comprise modifications (e.g., alternative nucleotides) to enhance stability and / or to enhance deamination efficiency.
[0262] A. Alternate Oligonucleotides In one embodiment, one or more of the nucleotides in the oligonucleotide of the present invention are naturally occurring and do not include, for example, chemical modifications and / or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides in the oligonucleotide of the present invention are chemically modified (e.g., substituted nucleotides) to enhance stability or other beneficial properties. Without being bound by theory, it is believed that certain modifications can increase nuclease resistance and / or serum stability or reduce immunogenicity. For example, the polynucleotide of the present invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine), or may contain nucleotides with one or more chemical modifications to one or more components of the nucleotide (e.g., nucleobase, sugar, or phospholinker moiety). The oligonucleotides of the invention may be linked to each other via naturally occurring phosphodiester bonds or may be modified so as to be covalently linked via phosphorothiolate, 3'-methylene phosphonate, 5'-methylene phosphonate, 3'-phosphoamidate, 2'-5' phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.
[0263] In some embodiments, one or more of the nucleotides in the oligonucleotide of the invention are represented by Formulas I-V: It has one of the following structures: TIFF2025003992000020.tif42170.
[0264] In some embodiments, one or more of the nucleotides in an oligonucleotide of the invention has the structure of any one of Formula I, e.g., the structure: TIFF2025003992000021.tif35170.
[0265] In some embodiments, one or more of the nucleotides in an oligonucleotide of the invention has the structure of any one of Formula II, e.g., the structure: TIFF2025003992000022.tif35170.
[0266] In some embodiments, one or more of the nucleotides in the oligonucleotides of the invention have the structure of any one of formula III.
[0267] In some embodiments, one or more of the nucleotides in an oligonucleotide of the invention has the structure of any one of formula IV, e.g., the structure: TIFF2025003992000023.tif34170.
[0268] In some embodiments, one or more of the nucleotides in an oligonucleotide of the invention has the structure of any one of Formula V, e.g., the structure: TIFF2025003992000024.tif36170.
[0269] In certain embodiments of the present invention, substantially all of the nucleotides in the oligonucleotide of the present invention are alternative nucleotides.In other embodiments of the present invention, substantially all of the nucleotides in the oligonucleotide of the present invention are alternative nucleotides.The oligonucleotide of the present invention in which "substantially all of the nucleotides are alternative nucleotides" is mostly, but not completely, modified and can contain 5, 4, 3, 2, or 1 or less naturally occurring nucleotides.In yet other embodiments of the present invention, the oligonucleotide of the present invention can contain 5, 4, 3, 2, or 1 or less alternative nucleotides.
[0270] In some embodiments, the oligonucleotide of the invention has the structure: [A m ]-X 1 -X 2 -X 3 -[Bn ] wherein each of A and B is a nucleotide, m and n are each independently an integer of 5 to 40, and X 1 , X 2 , and X 3 at least one of the groups has the structure of formula I, wherein R 1 is fluoro, hydroxy, or methoxy; N 1 is a nucleobase or has the structure of formula V, wherein R 4 is hydrogen and R 5 is hydrogen and does not have the structure of formula I 1 , X 2 , and X 3 Each of the is a ribonucleotide, [A m ] and [B n ] each contains at least five terminal 2'-O-methyl nucleotides, at least four terminal phosphorothioate linkages, and m ] and [B n In some embodiments, at least 20% of the nucleotides in X ] combined are 2'-O-methyl nucleotides. 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains an adenine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a guanine or hypoxanthine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase or X 1 contains a uracil or thymine nucleobase, and X 2contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains an adenine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a guanine or hypoxanthine nucleobase or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a uracil or thymine nucleobase, or X 1 contains a cytosine or 5-methylcytosine nucleobase, and X 2 contains a cytosine, 5-methylcytosine, uracil, or thymine nucleobase, or does not contain a nucleobase, and X 3 contains a cytosine or 5-methylcytosine nucleobase.
[0271] Exemplary oligonucleotides of the invention are shown below in Table 3, where A, C, G and U are ribonucleosides, mA, mC, mG and mU are 2'-O-methylribonucleosides, fC represents 2'-deoxy-2'-fluoroarabinocytidine, fA represents 2'-deoxy-2'-fluoroarabinocytidine, aC represents arabinocytidine, aA represents arabinoadenosine and amC represents 2'-O-methyl-arabinocytidine. where amA stands for 2'-O-methyl-arabinoadenosine, αC stands for α-2'-deoxycytidine, dS stands for 2'-deoxyribose (abasic DNA), rS stands for ribose (abasic RNA), mS stands for 2'-O-methyl-ribose (abasic 2'-OMe-RNA), and the asterisk indicates a phosphorothioate bond (the remaining bonds are phosphodiester bonds). TIFF2025003992000025.tif254170TIFF2025003992000026.tif243170TIFF2025003992000027.tif178170
[0272] In some embodiments, the oligonucleotide of the present invention comprises a stem-loop structure that functions as a recruitment domain (e.g., ADAR recruitment domain) of ADAR enzyme. Such oligonucleotides may be referred to as "axiomer AONs" or "self-looping AONs". The recruitment moiety functions to recruit native ADAR enzymes present in cells to dsRNA formed by hybridization of the target sequence with the targeting moiety. The recruitment moiety may be a stem-loop structure that mimics either a natural substrate (e.g., glutamate ionotropic receptor AMPA type subunit 2 (GluR2) receptor, e.g., GluR2 ADAR recruitment domain, etc.) or a Z-DNA structure (e.g., Z-DNA ADAR recruitment domain) known to be recognized by the dsRNA binding region of ADAR enzymes. GluR2 and Z-DNA ADAR recruitment domains are high affinity binding partners for ADAR, so complexing entity or presence of modified recombinant ADAR enzyme is not required. The stem-loop structure can be an intermolecular stem-loop structure formed by two separate nucleic acid strands, or an intramolecular stem-loop structure formed within a single nucleic acid strand.The stem-loop structure of the recruitment portion can be the stem-loop structure described in WO2016 / 097212, US2018 / 0208924, Merkle et al.Nature Biotechnology,37:133-8(2019), Katrekar et al.Nature Methods,16(3):239-42(2019), Fukuda et al.Scientific Reports,7:41478(2017), the stem-loop structure of the ADAR recruitment portion is incorporated herein by reference.In some embodiments, the oligonucleotide comprises one or more ADAR recruitment domains (e.g., one or two ADAR recruitment domains).
[0273] In some embodiments, oligonucleotides of the invention include those having the structure of any one of formulas VI, VII, IX, or X. In one embodiment, oligonucleotides of the invention have the structure of formula XXIV: C-L1-D Formula XXIV wherein C is a single-stranded oligonucleotide about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length), L1 is a loop region, and D is a single-stranded oligonucleotide about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).
[0274] In some embodiments, C comprises a region that is complementary to D such that the two strands hybridize under suitable conditions to form a duplex. Generally, the double-stranded structure is 5-50 linked nucleosides long, e.g., 5-49, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 5-6, 8-50, 8-45, 8-40, 8-35, 8-30, 8-25, 8-20, 8-15, 8-10, 15 20-50, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 15-16, 20-50, 20-45, 20-40, 20-35, 20-30, 20-25, 25-50, 25-45, 25-40, 25-35, or 25-30 linked nucleoside lengths. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as part of the invention. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D (e.g., 5, 10, 15, 20, 25, 30, or more contiguous nucleobases) and the oligonucleotide forms a double-stranded structure of 10 to 50 linked nucleosides in length (e.g., at least 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).
[0275] In some embodiments, the double-stranded structure comprises at least one mismatch (e.g., at least one, two, three, four, or five mismatches) between the C and D nucleotides. In some embodiments, the mismatch is an A to C pair mismatch. In some embodiments, the A nucleoside of the A to C mismatch is on the C strand and the C nucleoside of the A to C mismatch is on the D strand. In some embodiments, the A nucleoside of the A to C mismatch is on the D strand and the C nucleoside of the A to C mismatch is on the C strand. In other embodiments, the mismatch is a G to G pair mismatch. In yet other embodiments, the mismatch is a C to A pair mismatch. In some embodiments, the C nucleoside of the C to A mismatch is on the C strand and the A nucleoside of the C to A mismatch is on the D strand. In some embodiments, the C nucleoside of the C to A mismatch is on the D strand and the A nucleoside of the C to A mismatch is on the C strand. In some embodiments, the mismatch is an I to I pair mismatch. In some embodiments, the mismatch is an I to G pair mismatch. In some embodiments, the I nucleoside of the I to G mismatch is on the C strand and the G nucleoside of the I to G mismatch is on the D strand. In some embodiments, the I nucleoside of the I to G mismatch is on the D strand and the G nucleoside of the I to G mismatch is on the C strand. In some embodiments, the mismatch is a G to I pair mismatch. In some embodiments, the G nucleoside of the G to I mismatch is on the C strand and the I nucleoside of the G to I mismatch is on the D strand. In some embodiments, the G nucleoside of the G to I mismatch is on the D strand and the I nucleoside of the G to I mismatch is on the C strand. In some embodiments, the mismatch comprises a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure: TIFF2025003992000028.tif27170 (in the formula, R 1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C1-C6 alkoxy; R 2 is hydrogen, optionally substituted amino, or optionally substituted C1-C6 alkyl; R 3 and R 4 are independently hydrogen, halogen, or optionally substituted C1-C6 alkyl, or a salt thereof. 1 is a hydrogen bond donor group (e.g., a hydroxyl group, an amino group). In some embodiments, R 1 is a hydrogen bond accepting group (eg, an alkoxy group).
[0276] In some embodiments, the double-stranded structure comprises two mismatches. In some embodiments, the mismatches are separated by at least three linked nucleosides. For example, when the mismatches are "separated by three nucleotides", the oligonucleotide comprises the structure M1-N1-N2-N3-M2, where M1 is the first mismatch, N1, N2, and N3 are paired nucleobases, and M2 is the second mismatch. In some embodiments, M1 is the mismatch of A to C pair, and M2 is the mismatch of G to G pair.
[0277] In some embodiments, the loop region L1 comprises a linked nucleoside. In some embodiments, L1 comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0278] In other embodiments, the loop region has the structure of Formula VIII: F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q -F 2 Formula VIII wherein F 1 is the bond between the loop region and C, and F 2 is a bond between D and a nucleotide or between D and, optionally, a linker; G 1 , G 2 , G 3 , and G 4 each independently represents optionally substituted C1-C2 alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NR N Selected from R N is hydrogen, optionally substituted C 1~4 Alkyl, optionally substituted C 2~4 Alkenyl, optionally substituted C 2~4 Alkynyl, optionally substituted C 2~6 Heterocyclyl, optionally substituted C 6~12 Aryl or optionally substituted C 1~7 Heteroalkyl, C 1 and C 2 are each independently selected from carbonyl, thiocarbonyl, sulfonyl, or phosphoryl; j, k, m, n, p, and q are each independently 0 or 1; and I is optionally substituted C 1~10 Alkyl, optionally substituted C 2~10 Alkenyl, optionally substituted C 2~10 Alkynyl, optionally substituted C 2~6 Heterocyclyl, optionally substituted C 6~12 Aryl, optionally substituted C-C 10 Polyethylene glycol or optionally substituted C 1~10 Heteroalkyl, or F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 )q -F 2 In some embodiments, the linker is optional.
[0279] In some embodiments, the loop region L1 comprises a carbohydrate-containing linking moiety.
[0280] In one embodiment, one or more of the nucleotides in the oligonucleotide of the present invention are naturally occurring and do not include, for example, chemical modifications and / or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides in the oligonucleotide of the present invention are chemically modified (e.g., substituted nucleotides) to enhance stability or other beneficial properties. Without being bound by theory, it is believed that certain modifications can increase nuclease resistance and / or serum stability or reduce immunogenicity. For example, the polynucleotide of the present invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine), or may contain nucleotides with one or more chemical modifications to one or more components of the nucleotide (e.g., nucleobase, sugar, or phospholinker moiety). The oligonucleotides of the invention may be linked to each other via naturally occurring phosphodiester bonds or may be modified so as to be covalently linked via phosphorothiolate, 3'-methylene phosphonate, 5'-methylene phosphonate, 3'-phosphoamidate, 2'-5' phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.
[0281] In some embodiments, C comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, D comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, both C and D each comprise at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0282] In certain embodiments of the present invention, substantially all of the nucleotides in the oligonucleotide of the present invention are alternative nucleotides.In other embodiments of the present invention, substantially all of the nucleotides in the oligonucleotide of the present invention are alternative nucleotides.The oligonucleotide of the present invention in which "substantially all of the nucleotides are alternative nucleotides" is mostly, but not completely, modified and can contain 5, 4, 3, 2, or 1 or less naturally occurring nucleotides.In yet other embodiments of the present invention, the oligonucleotide of the present invention can contain 5, 4, 3, 2, or 1 or less alternative nucleotides.
[0283] In one embodiment, an oligonucleotide of the invention comprises an ADAR recruitment domain having the structure of formula XXIV, where C is a single stranded oligonucleotide 10-50 linked nucleosides in length, L1 is a loop region, and D is a single stranded oligonucleotide 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 adjacent nucleobases of D, and the oligonucleotide comprises a double stranded structure formed by C and D 10-50 linked nucleosides in length. In some embodiments, the double stranded structure comprises at least one mismatch. In some embodiments, C or D comprises at least one alternative nucleobase. In some embodiments, C and D each comprise at least one alternative nucleobase. In some embodiments, C and / or D independently further comprise at least one alternative internucleoside linkage and / or at least one alternative sugar moiety. In some embodiments, L1 comprises a linked nucleoside. In other embodiments, L1 consists of a linked nucleoside. In some embodiments, L1 comprises at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0284] In another embodiment, the oligonucleotide of the invention comprises an ADAR recruitment domain having the structure of formula XXIV, where C is a single stranded oligonucleotide 10-50 linked nucleosides in length, L1 is a loop region that does not consist of linked nucleosides, and D is a single stranded oligonucleotide 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 adjacent nucleobases of D, and the oligonucleotide comprises a double stranded structure formed by C and D 10-50 linked nucleosides in length. In some embodiments, the double stranded structure comprises at least one mismatch. In some embodiments, L1 has the structure of formula VIII, as described herein. In some embodiments, L1 comprises a carbohydrate-containing linking moiety. In some embodiments, C and / or D independently comprise at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0285] In another embodiment, the oligonucleotide of the invention comprises an ADAR recruitment domain having the structure of formula XXIV, where C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L1 is a loop region comprising at least one alternative nucleobase or at least one alternative internucleoside linkage, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 adjacent nucleobases of D, and the oligonucleotide comprises a double-stranded structure formed by C and D of 10-50 linked nucleosides in length. In some embodiments, the double-stranded structure comprises at least one mismatch. In some embodiments, L1 comprises at least one alternative nucleobase and at least one alternative internucleoside linkage.
[0286] In another embodiment, an oligonucleotide of the invention comprises an ADAR recruitment domain having the structure of formula XXIV, where C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L1 is a loop region comprising at least one alternative sugar moiety that is not a 2'-O-methyl sugar moiety (e.g., the alternative sugar moiety is selected from the group consisting of a 2'-O-C1-C6 alkyl sugar moiety, a 2'-amino sugar moiety, a 2'-fluoro sugar moiety, a 2'-O-MOE sugar moiety, an LNA sugar moiety, an arabinonucleic acid (ANA) sugar moiety, a 2'-fluoro-ANA sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid), and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least five adjacent nucleobases of D, and the oligonucleotide comprises a double-stranded structure formed by C and D of 10-50 linked nucleosides in length. In some embodiments, the double-stranded structure comprises at least one mismatch. In some embodiments, C and / or D independently comprise at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.
[0287] In some embodiments, C comprises a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the nucleobase sequence set forth in any one of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34, and D comprises a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence comprises at least one mismatch as described herein. In other embodiments, D comprises a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the nucleobase sequence set forth in any one of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35, and C comprises a nucleobase sequence complementary to the nucleobase sequence of D, wherein the sequence comprises at least one mismatch as described herein. In some embodiments, C-L1-D comprises a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the nucleobase sequence set forth in any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36, wherein the sequence comprises at least one mismatch as described herein.
[0288] The nucleobase sequences of SEQ ID NOs:1-36 are provided below: TIFF2025003992000029.tif254170TIFF2025003992000030.tif192170
[0289] Although the sequences of SEQ ID NOs: 1-36 are set forth as unmodified and / or unconjugated sequences, it will be understood that the RNA of the oligonucleotides of the present invention may comprise any one of the sequences shown in SEQ ID NOs: 1-36, having alternative nucleosides and / or being conjugated as described in detail below.
[0290] In some embodiments, the oligonucleotides of the invention may further comprise a 5' cap structure. In some embodiments, the 5' cap structure is a 2,2,7-trimethylguanosine cap.
[0291] Oligonucleotides of the invention can be synthesized by standard methods known in the art, as described further below, for example, by use of an automated DNA synthesizer, such as those commercially available from Biosearch, Applied Biosystems, Inc.
[0292] Oligonucleotide compounds can be prepared using liquid phase or solid phase organic synthesis or both.Organic synthesis provides the advantage that the oligonucleotides containing non-natural or alternative nucleotides can be easily prepared.The single-stranded oligonucleotides of the present invention can be prepared using liquid phase or solid phase organic synthesis or both.
[0293] It is further contemplated that further optimization can be achieved for any sequence identified herein, either by systematically adding or removing linked nucleosides to generate longer or shorter sequences.Furthermore, such optimized sequences can be adjusted by introducing alternative nucleosides, alternative sugar moieties, and / or alternative internucleoside linkages, for example, as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and / or alternative internucleoside linkages, as known in the art and / or as described herein, to further optimize the molecule (e.g., increase serum stability or circulatory half-life, increase thermal stability, enhance transmembrane delivery, target to specific locations or cell types, and / or increase interaction with RNA editing enzymes (e.g., ADAR)).
[0294] In some embodiments, the oligonucleotide comprises one ADAR recruitment domain. In some embodiments, the ADAR recruitment domain is at the 5' end of the oligonucleotide. In some embodiments, the ADAR recruitment domain is at the 3' end of the oligonucleotide. In some embodiments, the oligonucleotide comprises a first ADAR recruitment domain and a second ADAR recruitment domain. In some embodiments, the first ADAR recruitment domain is at the 5' end of the oligonucleotide and the second ADAR recruitment domain is at the 3' end of the oligonucleotide. In some embodiments, one or more of the ADAR recruitment domains is a GluR2 ADAR recruitment domain. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:37 in the 5' to 3' direction, as shown below: GGUGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCACC (SEQ ID NO:37)
[0295] In some embodiments, the oligonucleotide has Formula XI, as shown below: TIFF2025003992000031.tif23170 Formula XI where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:38 in the 5' to 3' direction, as shown below: GGUGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCACC (SEQ ID NO:38)
[0296] In some embodiments, the oligonucleotide has Formula XII, as shown below: TIFF2025003992000032.tif23170 Formula XII where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:39 in the 5' to 3' direction, as shown below: GGUGUCGAGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCGACACC (SEQ ID NO:39)
[0297] In some embodiments, the oligonucleotide has Formula XIII, as shown below: TIFF2025003992000033.tif21170 Formula XIII wherein [ASO] comprises any of the oligonucleotides of the present invention, and m represents a mismatch nucleotide.
[0298] In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:40 in the 5' to 3' direction, as shown below: *s*s*G**GAGAAGAGGAGAA*AA*A*G**AAA*G**G*****G*******GA*A**(Sequence number 40) where * is a 2'-O-methyl nucleotide and s is a phosphorothioate internucleoside linkage between the two linked nucleotides. In some embodiments, the oligonucleotide has Formula XIV, as shown below: TIFF2025003992000034.tif23170 Formula XIV wherein [ASO] comprises the oligonucleotide of any one of claims 1-38 or any one of claims 45-49, * is a 2'-O-methyl nucleotide, s is a phosphorothioate internucleoside linkage, and m represents a mismatch nucleotide. In some embodiments, the ADAR recruitment domain further comprises at least one nuclease-resistant nucleotide (e.g., a 2'-O-methyl nucleotide). In some embodiments, the ADAR recruitment domain comprises at least one alternative internucleoside linkage (e.g., a phosphorothioate internucleoside linkage). In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:41 in the 5' to 3' direction, as shown below: GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU (SEQ ID NO:41)
[0299] In some embodiments, the oligonucleotide has Formula XV, as shown below: TIFF2025003992000035.tif23170 Formula XV where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:42 in the 5' to 3' direction, as shown below: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO:42)
[0300] In some embodiments, the oligonucleotide has Formula XVI, as shown below: TIFF2025003992000036.tif23170 Formula XVI where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:43 in the 5' to 3' direction, as shown below: GGUGUCGAGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCUCGACACC (SEQ ID NO: 43)
[0301] In some embodiments, the oligonucleotide has Formula XVII, as shown below: TIFF2025003992000037.tif23170 Formula XVII where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:44 in the 5' to 3' direction, as shown below: GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU (SEQ ID NO:44)
[0302] In some embodiments, the oligonucleotide has Formula XVIII, as shown below: TIFF2025003992000038.tif21170 Formula XVIII where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:45 in the 5' to 3' direction, as shown below: GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCU (SEQ ID NO:45)
[0303] In some embodiments, the oligonucleotide has Formula XIX, as shown below: TIFF2025003992000039.tif23170 Formula XIX where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:46 in the 5' to 3' direction, as shown below: GUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUAC (SEQ ID NO:46)
[0304] In some embodiments, the oligonucleotide has the formula XX, as shown below: TIFF2025003992000040.tif21170 formula XX where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:47 in the 5' to 3' direction, as shown below: UGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUA (SEQ ID NO:47)
[0305] In some embodiments, the oligonucleotide has Formula XXI, as shown below: TIFF2025003992000041.tif21170 Formula XXI where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:48 in the 5' to 3' direction, as shown below: GGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACC (SEQ ID NO: 48)
[0306] In some embodiments, the oligonucleotide has Formula XXII, as shown below: TIFF2025003992000042.tif23170 Formula XXII where [ASO] comprises any of the oligonucleotides of the invention and m represents a mismatch nucleotide. In some embodiments, the GluR2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:49 in the 5' to 3' direction, as shown below: GUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCAC (SEQ ID NO:49)
[0307] In some embodiments, the oligonucleotide has Formula XXIII, as shown below: TIFF2025003992000043.tif21170 Formula XXIII wherein [ASO] comprises any of the oligonucleotides of the present invention, and m represents a mismatch nucleotide.
[0308] In some embodiments, the ADAR recruitment domain is a Z-DNA ADAR recruitment domain. In some embodiments, the ADAR recruitment domain is an MS2 ADAR recruitment domain. In some embodiments, the MS2 bacteriophage stem-loop structure may be used as an ADAR recruitment domain (e.g., an MS2 ADAR recruitment domain). The MS2 stem-loop is known to bind to the MS2 bacteriophage coat protein, and when it is fused to the deaminase domain of an ADAR (e.g., an ADAR fusion protein), it can be used for target-specific deamination. In some embodiments, the MS2 ADAR recruitment domain has the nucleotide sequence of SEQ ID NO:50 in the 5' to 3' direction, as shown below: ACATGAGGATCACCCATGT (SEQ ID NO:50)
[0309] In some embodiments, the ADAR fusion protein is administered to a cell or a subject using an expression vector construct that includes a polynucleotide encoding the ADAR fusion protein. In some embodiments, the ADAR fusion protein comprises an ADAR deaminase domain fused to MS2 bacteriophage coat protein. In some embodiments, the ADAR deaminase domain is the ADAR1 deaminase domain. In some embodiments, the ADAR deaminase domain is the ADAR2 deaminase domain. The ADAR fusion protein may be a fusion protein described in Katrekar et al. Nature Methods, 16(3):239-42 (2019), which ADAR fusion protein is incorporated herein by reference.
[0310] Nucleic acids of interest in the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, SLet al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Alternative nucleotides and nucleosides include those that include modifications, such as terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, reverse linkage) or 3'-end modifications (conjugation, DNA nucleotides, reverse linkage, etc.), base modifications, such as replacement with stabilizing bases, destabilizing bases, or bases that base pair with a broad repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and / or backbone modifications, including modification or substitution of phosphodiester linkages. The nucleobase may also be an isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g., C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to, alternative nucleosides containing modified backbones or non-natural internucleoside linkages. Nucleotides and nucleosides with modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referred to in the art, alternative RNAs that do not have a phosphorus atom in the internucleoside backbone of RNA can also be considered to be oligonucleosides. In some embodiments, the oligonucleotide will have a phosphorus atom in its internucleoside backbone.
[0311] Alternative internucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boronophosphates with normal 3'-5' linkages, 2'-5' linked analogs of these, and those with inverted polarity where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms.
[0312] Representative United States patents which teach the preparation of the above phosphorus-containing linkages include U.S. Pat. Nos. 3,687,808, 4,469,863, 4,476,301, 5,023,243, 5,177,195, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,717, 5,321,133, and 5,476,201. No. 1, No. 5,399,676, No. 5,405,939, No. 5,453,496, No. 5,455,233, No. 5,466,677, No. 5,476,925, No. 5,5 19,126, 5,536,821, 5,541,316, 5,550,111, 5,563,253, 5,571,799, 5,587,361, No. 5,625,050, No. 6,028,188, No. 6,124,445, No. 6,160,109, No. 6,169,170, No. 6,172,209, No. 6,239,2 No. 65, No. 6,277,603, No. 6,326,199, No. 6,346,614, No. 6,444,423, No. 6,531,590, No. 6,534,639, No. 6,6 Nos. 6,683,167, 6,858,715, 6,867,294, 6,878,805, 7,015,315, 7,041,816, 7,273,933, 7,321,029, and U.S. Patent No. RE39464, the contents of each of which are incorporated herein by reference in their entirety.
[0313] Alternative internucleoside linkages that do not include a phosphorus atom in the linkage have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH2 constituent moieties.
[0314] Representative U.S. patents which teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,64,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, and 5,489,677. Nos. 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439, the contents of each of which are incorporated herein by reference in their entirety.
[0315] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleoside linkage of the nucleotide units, i.e., the backbone, are replaced. The base units are maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar of the nucleoside is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, the contents of each of which are incorporated herein by reference in their entirety. Additional PNA compounds suitable for use in the oligonucleotides of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0316] Some embodiments of interest in the present invention include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [known as methylene (methylimino) or MMI backbones], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2- [wherein the natural phosphodiester backbone is represented as -OPO-CH2-] of the above-mentioned U.S. Patent No. 5,489,677, and the amide backbones of the above-mentioned U.S. Patent No. 5,602,240. In some embodiments, the oligonucleotides of interest herein have the morpholino backbone structure of the above-mentioned U.S. Patent No. 5,034,506. In other embodiments, the oligonucleotides described herein comprise phosphorodiamidate morpholino oligomers (PMOs) in which the deoxyribose moieties are replaced by morpholine rings and the charged phosphodiester intersubunit linkages are replaced by uncharged phosphorodiamidate linkages, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.
[0317] Alternative nucleosides and nucleotides can also contain one or more substituted sugar moieties. Oligonucleotides, such as those featured herein, can include one of the following at the 2' position: OH, F, O-, S-, or N-alkyl, O-, S-, or N-alkenyl, O-, S-, or N-alkynyl, or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It can be alkenyl and alkynyl. Exemplary suitable modifications include -O[(CH2) n O] m CH3, -O(CH2) n OCH3, -O(CH2) n -NH2, -O(CH2) n CH3, -O(CH2) n-ONH2 and -O(CH2) n -ON[(CH2) n CH3]2, where n and m are from 1 to about 10. In other embodiments, the oligonucleotide comprises one of the following at the 2' position: C1-C 10 Lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. In some embodiments, the modification comprises 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. 2'-O-MOE nucleosides confer several beneficial properties to oligonucleotides, including, but not limited to, increased nuclease resistance, improved pharmacokinetic properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity compared to unmodified oligonucleotides.
[0318] Another exemplary alternative contains the group -O(CH2)2ON(CH3)2, also known as 2'-dimethylaminooxyethoxy, i.e. 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e. 2'-O-(CH2)2-O-(CH2)2-N(CH3)2, as described in the Examples herein below. Further exemplary alternatives include 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers in these three families), 2'-alkoxyalkyl, and 2'-NMA (N-methylacetamide).
[0319] Other alternatives include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of oligonucleotides, particularly the 3' position of the sugar in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents which teach the preparation of such modified sugar structures include U.S. Pat. Nos. 4,981,957, 5,118,800, 5,319,080, 5,359,044, 5,393,878, 5,446,137, 5,466,786, 5,514,785, 5,519,134, 5,567,811, 5,520,136, and 5,530,782. Nos. 5,576,427, 5,591,722, 5,597,909, 5,610,300, 5,627,053, 5,639,873, 5,646,265, 5,658,873, 5,670,633, and 5,700,920, several of which are commonly owned with the present application. The entire contents of each of the aforementioned patents are incorporated herein by reference.
[0320] The oligonucleotides of the present invention may also include nucleobase (often simply referred to in the art as "base") alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1-methyl-pseudouracil, deoxyuracil, 5-hydroxy ... xybutynyl-2'-deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, These include 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine.Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JL, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including, for example, 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are an exemplary base substitution, especially when combined with a 2′-O-methoxyethyl sugar modification.
[0321] Representative United States patents that teach the preparation of other alternative nucleobases, in addition to some of the alternative nucleobases mentioned above, include the above-mentioned U.S. Patent Nos. 3,687,808, 4,845,205, 5,130,30, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, 5,587,469, 5,594,121, 5,587,469, 5,594,121, 5,595,121, 5,596,121, 5,597,121, 5,598,121, 5,599,122, 5,600, 5,601, 5,610, 5,611, 5,612, 5,613, 5,614, 5,615, 5,616, 5,617, 5,618, 5,619, 5,620, 5,621, 5,625, 5,630, 5,631, 5,632, 5,635, 5,640, 5,641, 5,642, 5,643, 5,645, 5,650, 5,651, 5,652, 5,655, 5,656, 5,657, 5,658, 5,65 Nos. 5,596,091, 5,614,617, 5,681,941, 5,750,692, 6,015,886, 6,147,200, 6,166,197, 6,222,025, 6,235,887, 6,380,368, 6,528,640, 6,639,062, 6,617,438, 7,045,610, 7,427,672, and 7,495,088, the contents of each of which are incorporated herein by reference in their entirety.
[0322] In other embodiments, the sugar moiety in a nucleotide can be a ribose molecule, optionally having a 2'-O-methyl, 2'-O-MOE, 2'-F, 2'-amino, 2'-O-propyl, 2'-aminopropyl, or 2'-OH modification.
[0323] The oligonucleotides of the invention may contain one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by a two-atom bridge. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments, the agents of the invention may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety, where the ribose moiety includes an additional bridge connecting the 2' and 4' carbons. In other words, a locked nucleoside is a nucleoside that includes a bicyclic sugar moiety that includes a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum and reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, but are not limited to, nucleosides that contain a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the present invention include one or more bicyclic nucleosides that contain a 4' to 2' bridge.Examples of such 4' to 2' bridged bicyclic nucleosides include 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see, e.g., U.S. Pat. No. 7,399,845), 4'-C (CH3)(CH3)-O-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,283), 4'-CH2-N(OCH3)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)2-2' (see, e.g., U.S. Patent Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2' (wherein R is H, C1-C. 12 alkyl, or a protecting group) (see, e.g., U.S. Pat. No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C(=CH2)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing patents are incorporated herein by reference.
[0324] Additional representative U.S. patents and U.S. patent publications that teach the preparation of locked nucleic acid nucleotides include the following: U.S. Patent Nos. 6,268,490, 6,525,191, 6,670,461, 6,770,748, 6,794,499, 6,998,484, 7,053,207, 7,034,133, 7,084,125, 7,399,845, 7,420,117, and 7,525,191. Nos. 7,427,672, 7,569,686, 7,741,457, 8,022,193, 8,030,467, 8,278,425, 8,278,426, 8,278,283, US2008 / 0039618, and US2009 / 0012281, the contents of each of which are incorporated herein by reference in their entirety.
[0325] Any of the foregoing bicyclic nucleosides may be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226).
[0326] The oligonucleotides of the present invention may also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid that includes a bicyclic sugar moiety that includes a 4'-CH(CH3)-O-2' bridge. In one embodiment, the constrained ethyl nucleotide is in the S conformation, referred to herein as "S-cEt".
[0327] The oligonucleotides of the invention may also contain one or more "conformationally restricted nucleotides" ("CRNs"). CRNs are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and --C5' carbons of ribose. The CRNs lock the ribose ring into a stable conformation and increase hybridization affinity to mRNA. The linker is long enough to place the oxygen in an optimal position for stability and affinity, reducing puckering of the ribose ring.
[0328] Representative publications that teach the preparation of some of the above-mentioned CRNs include, but are not limited to, U.S. Patent Publication No. 2013 / 0190383, and PCT Publication WO2013 / 036868, the entire contents of each of which are incorporated herein by reference.
[0329] In some embodiments, the oligonucleotides of the invention include one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNAs are unlocked acyclic nucleic acids in which one of the sugar linkages has been removed to form an unlocked "sugar" residue. In one example, UNAs also encompass monomers in which the C1'-C4' linkage (i.e., the covalent carbon-oxygen-carbon bond between the C1' and C4' carbons) has been removed. In another example, the C2'-C3' linkage (i.e., the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).
[0330] Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the contents of each of which are incorporated by reference in their entirety herein.
[0331] The ribose molecule may also be modified with a cyclopropane ring to produce tricyclodeoxynucleic acid (tricycloDNA). The ribose moiety may be replaced with another sugar, such as 1,5-anhydrohexitol, threose to produce threose nucleosides (TNAs), or arabinose to produce arabinonucleosides. The ribose molecule may also be replaced with a non-sugar, such as cyclohexene to produce cyclohexene nucleosides, or glycol to produce glycol nucleosides.
[0332] The ribose molecule may also be substituted with a non-sugar such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acid (GNA). Stabilizing modifications to the termini of the nucleotide molecules may potentially include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3''-phosphate, inverted base dT (idT), and the like. Disclosure of this modification may be found in PCT Publication No. WO2011 / 005861.
[0333] Other alternative chemistries for the oligonucleotides of the present invention include 5' phosphate or 5' phosphate mimics of oligonucleotides, such as 5' terminal phosphate or phosphate mimics.Suitable phosphate mimics are disclosed, for example, in US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.
[0334] Exemplary oligonucleotides of the present invention include sugar-modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotides include sugar-modified nucleosides and DNA nucleosides. The incorporation of alternative nucleosides into the oligonucleotides of the present invention may enhance the affinity of the oligonucleotide to a target nucleic acid. In this case, the alternative nucleoside may be referred to as an affinity-enhancing alternative nucleotide.
[0335] In some embodiments, the oligonucleotide comprises at least one alternative nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 alternative nucleosides. In other embodiments, the oligonucleotide comprises 1-10 alternative nucleosides, such as 2-9 alternative nucleosides, such as 3-8 alternative nucleosides, such as 4-7 alternative nucleosides, such as 6 or 7 alternative nucleosides. In one embodiment, the oligonucleotides of the invention may comprise alternatives, which are independently selected from these three types of alternatives (alternative sugar moieties, alternative nucleobases, and alternative internucleoside linkages), or combinations thereof. Preferably, the oligonucleotide comprises one or more nucleosides that comprise a sugar substitute moiety, e.g., a 2' sugar substitute nucleoside. In some embodiments, the oligonucleotide of the invention comprises one or more 2' sugar substitute nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, ANA, 2'-fluoro-ANA, and BNA (e.g., LNA) nucleosides. In some embodiments, the one or more substitute nucleosides are BNA.
[0336] In some embodiments, at least one of the alternative nucleosides is a BNA (e.g., an LNA), such as at least two of the alternative nucleosides, such as at least three, at least four, at least five, at least six, at least seven, or at least eight, etc. In still further embodiments, all of the alternative nucleosides are BNAs.
[0337] In further embodiments, the oligonucleotide comprises at least one alternative internucleoside bond. In some embodiments, the internucleoside bond in adjacent nucleotide sequence is phosphorothioate or boronophosphate internucleoside bond. In some embodiments, all internucleoside bonds in adjacent sequences of the oligonucleotide are phosphorothioate bond. In some embodiments, the phosphorothioate bond is stereochemically pure phosphorothioate bond. In some embodiments, the phosphorothioate bond is Sp phosphorothioate bond. In other embodiments, the phosphorothioate bond is Rp phosphorothioate bond.
[0338] In some embodiments, the oligonucleotide of the invention comprises at least one alternative nucleoside that is 2'-O-MOE-RNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc., 2'-O-MOE-RNA nucleoside units. In some embodiments, the 2'-O-MOE-RNA nucleoside units are linked by phosphorothioate linkages. In some embodiments, at least one of the alternative nucleosides is 2'-fluoro-DNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc., 2'-fluoro-DNA nucleoside units. In some embodiments, the oligonucleotide of the invention comprises at least one BNA unit and at least one 2'-substituted alternative nucleoside. In some embodiments of the invention, the oligonucleotide comprises both 2' sugar modified nucleosides and DNA units. In some embodiments, the oligonucleotide of the invention or its flanking nucleotide region is a gapmer oligonucleotide.
[0339] B. Oligonucleotides conjugated to ligands The oligonucleotides of the invention may be chemically linked to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include lipid moieties, such as cholesterol moieties (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86:6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), thioethers, such as beryl-S-tritylthiol (Manoharan et al., (1992) Ann. NY Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), thiocholesterol (Oberhauser et al., (1992) Nucl. Acids, 1:1062-1065), and the like. Res., 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids, 75:49-54). Res., 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), palmityl moieties (Mishra et al., (1995) Biochim. Biophys.Acta 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).
[0340] In one embodiment, a ligand alters the distribution, targeting, or lifetime of an oligonucleotide agent into which it is incorporated. In some embodiments, a ligand provides enhanced affinity for a selected target, e.g., a molecule, a cell or cell type, a compartment, e.g., a cell or organ compartment, a tissue, an organ, or a body site, e.g., when compared to a species in which such ligand is not present.
[0341] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids, and the like. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic ionic lipid, cationic porphyrin, quaternary salt of polyamine, or alpha helical peptide.
[0342] Ligands can also include targeting groups, such as cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, such as antibodies that bind to specific cell types, such as kidney cells. The targeting group can be thyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0343] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules, such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-( oleoyl), cholenoic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0344] The ligand can be a protein, e.g., a glycoprotein, or a peptide, e.g., a molecule with specific affinity for a co-ligand, or an antibody, e.g., an antibody that binds to a particular cell type, such as a hepatocyte. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose.
[0345] A ligand can be a substance, e.g., a drug, that can increase uptake of an oligonucleotide agent into a cell, e.g., by disrupting the cytoskeleton of the cell, e.g., by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0346] In some embodiments, the ligand attached to the oligonucleotide as described herein functions as a pharmacokinetic modulator (PK modulator). PK modulators include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing multiple phosphorothioate bonds are also known to bind to serum proteins, and therefore short oligonucleotides, for example, about 5-base, 10-base, 15-base, or 20-base oligonucleotides, containing multiple phosphorothioate bonds in the backbone, are also suitable for the present invention as ligands (e.g., as PK-modulating ligands). In addition, aptamers that bind serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.
[0347] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of oligonucleotides bearing pendant reactive functional groups, such as those resulting from the attachment of a linking molecule onto an oligonucleotide (described below). The reactive oligonucleotides may be reacted directly with commercially available ligands, with synthesized ligands bearing any of a variety of protecting groups, or with ligands having a linking moiety attached to the ligand.
[0348] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely produced by the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several suppliers, including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be used. It is also known to use similar techniques to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.
[0349] For the ligand-conjugated oligonucleotides of the invention, such as the ligand molecules having sequence-specific linked nucleosides of the invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors already bearing a linking moiety, ligand-nucleotide or nucleoside conjugate precursors already bearing a ligand molecule, or non-nucleoside ligand-bearing components.
[0350] When using a nucleotide conjugate precursor that already has a linking moiety, synthesis of the sequence-specific linked nucleoside is usually completed and then the ligand molecule is reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the invention are synthesized by automated synthesizers using phosphoramidites derived from ligand-nucleoside conjugates in addition to standard and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
[0351] i. Lipid complex In one embodiment, the ligand or complex is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to serum protein, for example, human serum albumin (HSA). HSA-binding ligand allows the distribution of the complex to target tissue, for example, non-renal target tissue in the body. For example, the target tissue can be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligand. For example, neproxin or aspirin can be used. Lipid or lipid-based ligand can (a) increase the degradation resistance of the complex, (b) increase targeting or transport to target cell or cell membrane, and / or (c) be used to adjust the binding to serum protein, for example, HSA.
[0352] Lipid-based ligands can be used to inhibit, for example, control, the binding of complexes to target tissues.For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to target the kidney, and therefore less likely to be excreted from the body.Lipids or lipid-based ligands that bind less strongly to HSA can be used to target complexes to the kidney.
[0353] In another embodiment, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferative cell. Exemplary vitamins include vitamins A, E, and K.
[0354] ii. Cell-penetrating agents In another embodiment, the ligand is a cell-penetrating agent, preferably a helical cell-penetrating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide, such as tat or antennapedia. If the agent is a peptide, it can be modified, including peptidyl mimetics, invertomers, non-peptide or pseudopeptide bonds, and the use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and lipophobic phase.
[0355] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules that can fold into defined three-dimensional structures similar to natural peptides. Attachment of peptides and peptidomimetics to oligonucleotide agents can affect the pharmacokinetic distribution of the oligonucleotide, such as by enhancing cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5-50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.
[0356] The peptide or peptidomimetic can be, for example, a cell penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., consisting mainly of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, which has the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 87). RFGF analogs containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 88)) can also be targeting moieties. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, it has been found that sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ, SEQ ID NO: 89) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK, SEQ ID NO: 90) can function as delivery peptides. The peptide or peptidomimetic can be encoded by random sequences of DNA, such as peptides identified from a phage display library, or a one bead one compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). An example of a peptide or peptidomimetic tethered to an oligonucleotide agent by a monomeric unit incorporated for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can have structural modifications, such as to increase stability or induce conformational properties. Any of the structural modifications described below can be utilized.
[0357] RGD peptides for use in the compositions and methods of the present invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a particular tissue(s). RGD-containing peptides and peptidomimetics may include synthetic RGD mimetics in addition to D-amino acids. In addition to RGD, other moieties that target integrin ligands can be used. Some complexes of this ligand target PECAM-1 or VEGF.
[0358] The cell-penetrating peptide can penetrate cells, such as microbial cells, such as bacterial or fungal cells, or mammalian cells, such as human cells. The microbial cell-penetrating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or cecropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two key amino acids (e.g., PR-39 or indolicidin). The cell-penetrating peptide can also include a nuclear localization signal (NLS). For example, the cell-penetrating peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0359] iii. Carbohydrate Complex In some embodiments of the compositions and methods of the present invention, the oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated oligonucleotides are advantageous in compositions suitable for in vivo therapeutic applications in addition to in vivo delivery of nucleic acids, as described herein. As used herein, "carbohydrate" refers to either a compound that is a carbohydrate itself, composed of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom, or a compound that has as part of it a carbohydrate moiety, each of which is composed of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides and oligosaccharides containing about 4, 5, 6, 7, 8 or 9 monosaccharide units), as well as polysaccharides, such as starch, glycogen, cellulose and polysaccharide gums. Particular monosaccharides include sugars of C5 or higher (e.g., C5, C6, C7, or C8), and disaccharides and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
[0360] In one embodiment, a complex carbohydrate for use in the compositions and methods of the present invention is a monosaccharide.
[0361] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and / or a cell penetrating peptide.
[0362] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO2014 / 179620 and WO2014 / 179627, the contents of each of which are incorporated by reference in their entirety.
[0363] iv. Linker In some embodiments, the conjugates or ligands described herein may be attached to the oligonucleotide using a variety of linkers, which may be cleavable or non-cleavable.
[0364] The linker typically includes a direct bond or an atom, such as oxygen or sulfur, or a unit, such as NR 8 , C(O), C(O)NH, SO, SO2, SO2NH, etc., or chains of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, aryl alkyl, aryl alkenyl, aryl alkynyl, heteroaryl alkyl, heteroaryl alkenyl, heteroaryl alkynyl, heterocyclyl alkyl, heterocyclyl alkenyl, heterocyclyl alkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylaryl alkyl, alkylaryl alkenyl, alkylaryl alkynyl, alkenylaryl alkyl, alkenylaryl alkenyl, alkenylaryl alkynyl, alkynylaryl alkyl, alkynylaryl alkenyl, alkynylaryl alkynyl, alkylheteroaryl alkyl, alkylheteroaryl alkyl, alkylheteroaryl alkyl, and the like, in which one or more methylenes are selected from O, S, S(O), SO, N(R), ... 8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic (wherein R 8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.
[0365] A cleavable linking group is a linking group that is sufficiently stable outside a cell, but is cleaved upon entry into a target cell to release the two moieties that the linker holds together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or more, or at least about 100-fold faster in a target cell or under a first reference condition (which may be selected, for example, to mimic or represent intracellular conditions) than in the subject's blood or under a second reference condition (which may be selected, for example, to mimic or represent conditions found in blood or serum).
[0366] Cleavable linking groups are susceptible to cleaving agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleaving agents are more prevalent or found at higher levels or activity inside cells than in serum or blood. Examples of such degrading agents include redox agents that are selective for a particular substrate or have no substrate specificity at all, such as oxidizing or reducing enzymes, or reducing agents, such as mercaptans present in cells, that can degrade redox-cleavable linking groups by reduction, esterases, endosomes or agents that can cause an acidic environment, such as those that cause a pH of 5 or less, general acids, peptidases (which can be substrate specific), and enzymes that can function as phosphatases to hydrolyze or degrade acid-cleavable linking groups.
[0367] Cleavable linking groups, such as disulfide bonds, may be sensitive to pH. While the pH of human serum is 7.4, the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have cleavable linking groups that are cleaved at a preferred pH, releasing the cationic lipid from the ligand inside the cell or into a desired compartment of the cell.
[0368] The linker may include a cleavable linking group that can be cleaved by a specific enzyme. The type of cleavable linking group incorporated into the linker may depend on the cell to be targeted. For example, a ligand that targets the liver may be linked to a cationic lipid via a linker that includes an ester group. Because liver cells are rich in esterase, the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterase. Other cell types that are rich in esterase include lung, renal cortex, and testis cells.
[0369] Linkers containing peptide bonds may be used when targeting cell types that are rich in peptidases, such as liver cells and synovial cells.
[0370] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degrading agent (or condition) to cleave the candidate linking group. It may also be desirable to further test the candidate cleavable linking group for its ability to resist cleavage in blood or when in contact with other non-target tissues. Thus, the relative susceptibility to cleavage between a first condition and a second condition can be determined, where the first condition is selected to indicate cleavage in target cells and the second condition is selected to indicate cleavage in other tissues or biological fluids, such as blood or serum. Evaluation can be performed in a cell-free system, in cells, in cell culture, in organ or tissue culture, or in whole animals. It may be useful to perform initial evaluation in a cell-free or culture conditions and confirm by further evaluation in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2-fold, 4-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or about 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) when compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0371] a. Redox-cleavable linking group In one embodiment, the cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of a reductively cleavable linking group is a disulfide linking group (--S--S--). The methods described herein can be used to determine whether a candidate cleavable linking group is a suitable "reductively cleavable linking group" or is suitable for use with, for example, a particular oligonucleotide moiety and a particular targeting agent. For example, the candidate can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rate that would be observed in cells, for example, target cells. The candidate can also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, the candidate compound is cleaved in blood at a maximum of about 10%. In other embodiments, useful candidate compounds are degraded at least about 2-fold, 4-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or about 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) when compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The cleavage rate of the candidate compound may be determined using standard enzyme kinetics assays under conditions selected to mimic the intracellular medium and compared to conditions selected to mimic the extracellular medium.
[0372] b. Phosphate-based cleavable linkers In another embodiment, the cleavable linker comprises a phosphate-based cleavable linking group. The phosphate-based cleavable linking group is cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that cleaves a phosphate group in a cell is an enzyme such as a phosphatase in the cell. An example of a phosphate-based linking group is OP(O)(OR k )-O-, -OP(S)(OR k )-O-, -OP(S)(SR k )-O-, -SP(O)(OR k )-O-, -OP(O)(OR k )-S-, -SP(O)(OR k)-S-, -OP(S)(OR k )-S-, -SP(S)(OR k )-O-, -OP(O)(R k )-O-, -OP(S)(R k )-O-, -SP(O)(R k )-O-, -SP(S)(R k )-O-, -SP(O)(R k )-S-, -OP(S)(R k )-S-. These candidates can be evaluated using methods similar to those described above.
[0373] c. acid-cleavable linking group In another embodiment, the cleavable linker comprises an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or less) or by an agent such as an enzyme that can function as a general acid. In a cell, certain low pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for the acid-cleavable linking group. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups can have the general formula -C=NN--, C(O)O, or -OC(O). A preferred embodiment is where the carbon attached to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group, such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.
[0374] d. Ester-based linking groups In another embodiment, the cleavable linker comprises an ester-based cleavable linking group. The ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable linking groups have the general formula --C(O)O--, or --OC(O)--. These candidates can be evaluated using methods similar to those described above.
[0375] e. Peptide-Based Cleavage Groups In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. The peptide-based cleavable linking group is a peptide bond formed between amino acids to generate oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not include amide groups (--C(O)NH--). The amide group can be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to generate peptides and proteins. The peptide-based cleaving group is generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to generate peptides and proteins, and does not include the entire amide functionality. The peptide-based cleavable linking group has the general formula --NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.
[0376] In one embodiment, the oligonucleotide of the present invention is conjugated to carbohydrate via a linker. The linker includes bivalent and trivalent branched linker groups. Exemplary oligonucleotide carbohydrate conjugates with linkers of the compositions and methods of the present invention include, but are not limited to, those described in formulas 24-35 of PCT Publication No. WO2018 / 195165.
[0377] Representative U.S. patents which teach the preparation of oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979, 4,948,882, 5,218,105, 5,525,465, 5,541,313, 5,545,730, 5,552,538, 5,578,717, 5,580,731, 5,591,584, 5,109,124, 5,118,802, 5,138,045, 5,414,077, 5,486,603, No. 5,512,439, No. 5,578,718, No. 5,608,046, No. 4,587,044, No. 4,605,735, No. 4,667,025, No. 4,762,779, No. 4,789,737, No. 4,824,941 , No. 4,835,263, No. 4,876,335, No. 4,904,582, No. 4,958,013, No. 5,0 No. 82,830, No. 5,112,963, No. 5,214,136, No. 5,082,830, No. 5,112,963 No. 5,214,136, No. 5,245,022, No. 5,254,469, No. 5,258,506, No. 5, No. 262,536, No. 5,272,250, No. 5,292,873, No. 5,317,098, No. 5,371,24 No. 1, No. 5,391,723, No. 5,416,203, No. 5,451,463, No. 5,510,475, No. 5 ,512,667, 5,514,785, 5,565,552, 5,567,810, 5,574,1 42, 5,585,481, 5,587,371, 5,595,726, 5,597,696, 5,599,923, 5,599,928, and 5,688,941, 6,294,664, 6,320,017, 6,576,752, 6,783,931, 6,900,297, 7,037,646, and 8,106,022, the contents of each of which are incorporated herein by reference in their entirety.
[0378] In certain cases, the nucleotides of the oligonucleotide may be modified by non-ligand groups. Numerous non-ligand molecules have been conjugated to oligonucleotides to enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide, and procedures for carrying out such conjugation are available in the scientific literature. Such non-ligand moieties include lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm, 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids, 1997, 1:131-132), and the like. Res., 1992, 20:533), aliphatic chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamines or polyethylene glycol chains (Manoharan et al., al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative U.S. patents teaching the preparation of such oligonucleotide conjugates are listed above. A typical conjugation protocol involves the synthesis of an oligonucleotide bearing an amino linker at one or more positions in the sequence. The amino group is then reacted with the molecule being conjugated using an appropriate coupling or activating reagent. The conjugation reaction can be carried out either with the oligonucleotide still attached to the solid support or in solution phase after oligonucleotide cleavage. Purification of the oligonucleotide conjugate by HPLC usually provides a pure conjugate.
[0379] III.Medicinal Use The oligonucleotide of the present invention may be used to treat any disorder that may be treated by adenosine deamination.For example, any disorder is caused by guanosine to adenosine mutation, introduction of premature stop codon, or expression of undesired protein.In some embodiments, the oligonucleotide of the present invention, when administered to a subject, can cause the correction of guanosine to adenosine mutation.In some embodiments, the oligonucleotide of the present invention can cause the termination of premature stop codon so that desired protein is expressed.In some embodiments, the oligonucleotide of the present invention can cause the inhibition of expression of undesired protein.
[0380] Particularly interesting target adenosines for editing using the oligonucleotides according to the invention are those that are part of a codon for an amino acid residue that defines an important function or property, such as a catalytic site, a binding site for other proteins, substrate binding, a localization domain, etc., for co- or post-translational modifications, such as glycosylation, hydroxylation, myristoylation, and protein cleavage by proteases (to mature the protein and / or as part of an intracellular pathway).
[0381] Many genetic diseases are caused by G to A mutations, and adenosine deamination at the mutated target adenosine will reverse the mutation to wild type, so they are diseases that may be treated by the oligonucleotide of the present invention. However, reversion to wild type may not always be necessary to obtain a beneficial effect. If the wild type nucleotide is other than G, A to G modification in the target may also be beneficial. In certain circumstances, this may be expected to be the case, but in other circumstances, some testing may be required. In certain circumstances, if the wild type is not G, the A to G modification in the target RNA may be silent (not translated into a different amino acid) or otherwise insignificant (e.g., an amino acid is replaced, but constitutes a conservative substitution that does not destroy protein structure and function), or the amino acid is part of a functional domain that has a certain tolerance to change. If the A to G transition caused by editing according to the present invention is in a non-coding RNA, or in a non-coding part of an RNA, the result may also be insignificant or less severe than the original mutation. Those skilled in the art will appreciate that the applicability of the present invention is very broad and is not even limited to the prevention or treatment of disease. The present invention may also be used to modify transcripts and test their effects, even if or especially when such modification induces a disease state, for example in a cell or non-human animal model.
[0382] Examples of genetic diseases which may be prevented and / or treated with the oligonucleotides according to the invention are any diseases in which modification of one or more adenosines in the target RNA would (potentially) result in a beneficial change.
[0383] The present invention is not limited to the correction of mutations, because it may be useful to change wild-type sequences to mutant sequences by applying oligonucleotides according to the present invention instead.One example where it may be advantageous to modify wild-type adenosines is to cause exon skipping, for example by modifying adenosines present at branching sites required for exon splicing.Another example is when adenosines define or are part of recognition sequences for protein binding, or are involved in secondary structures that define RNA stability.As mentioned above, the present invention therefore provides a research tool for diseases, and can be used to introduce new mutations that are less harmful than existing mutations.
[0384] Deamination of adenosine using the oligonucleotides disclosed herein includes any level of adenosine deamination, for example, at least one deaminated adenosine in the target sequence (e.g., at least 1, 2, 3, or more deaminated adenosines in the target sequence).
[0385] Adenosine deamination may be assessed by a decrease in the absolute or relative level of adenosine in the target sequence compared to a control level, which may be any type of control level utilized in the art, such as a pre-drug baseline level or a level determined from similar subjects, cells, or samples that are untreated or treated with a control (such as a buffer-only control or an inactive drug control).
[0386] Because the enzyme activity of ADAR converts adenosine to inosine, adenosine deamination can alternatively be evaluated by the increase in the absolute or relative level of inosine in target sequence compared to control level.Similarly, control level can be any kind of control level used in the art, such as pre-medication baseline level, or the level determined from the same subject, cell or sample that is untreated or treated with control (such as buffer only control or inactive drug control).
[0387] The level of adenosine and / or inosine in target sequence can be evaluated using any method known in the art for determining the nucleotide composition of polynucleotide sequence.For example, the relative or absolute level of adenosine or inosine in target sequence can be evaluated using nucleic acid sequencing technology, including but not limited to Sanger sequencing, next generation sequencing (NGS, such as pyrosequencing, reversible terminator chemistry sequencing, ligation sequencing, and real-time sequencing), such as those provided on commercially available platforms (e.g., Illumina, Qiagen, Pacific Biosciences, Thermo Fisher, Roche, and Oxford Nanopore Technologies).The clonal amplification of target sequence of NGS can be carried out using real-time polymerase chain reaction (also known as qPCR) on commercially available platforms from Applied Biosystems, Roche, Stratagene, Cepheid, Eppendorf, or Bio-Rad Laboratories. Additionally or alternatively, emulsion PCR may be used to amplify target sequences using commercially available platforms such as Droplet Digital PCR by Bio-Rad Laboratories.
[0388] In certain embodiments, surrogate markers can be used to detect adenosine deamination in target sequences. Effective treatment of subjects with genetic disorders involving G to A mutations with the oligonucleotides of the present disclosure, for example, as demonstrated by accepted diagnostic and monitoring standards, can be understood to demonstrate clinically relevant adenosine deamination. In certain embodiments, the method includes clinically relevant adenosine deamination, for example, as demonstrated by clinically relevant outcomes after treating subjects with the oligonucleotides of the present disclosure.
[0389] Adenosine deamination in a gene of interest may be manifested by an increase or decrease in the level of mRNA expressed by a first cell or population of cells (such cells may be present, for example, in a sample derived from a subject) in which the gene of interest is transcribed and the cell(s) have been treated (e.g., by contacting the cell(s) with an oligonucleotide of the present disclosure or by administering an oligonucleotide of the present invention to a subject in which the cells are or were present), and the deamination is manifested as an increase or decrease in expression of the gene of interest when compared to a second cell or population of cells that is substantially identical to the first cell or population of cells but in which the cell(s) have not been so treated (control cell(s) that have not been treated with the oligonucleotide or that have not been treated with an oligonucleotide targeted to the gene of interest). The degree of increase or decrease in mRNA levels for a gene of interest may be represented by the following formula: TIFF2025003992000044.tif14170
[0390] In other embodiments, the change in the level of the gene may be assessed with respect to a decrease in a parameter functionally related to the expression of the gene of interest, e.g., protein expression or signaling downstream of the gene of interest. The change in the level of the gene of interest may be determined in any cell that expresses the gene of interest, either endogenously or heterologously from an expression construct, and by any assay known in the art.
[0391] The change in expression level for a gene of interest may be manifested by an increase or decrease in the level of the protein produced by the gene of interest expressed by a cell or group of cells (e.g., the level of the protein expressed in a sample derived from a subject).As explained above, for the assessment of mRNA suppression, the change in the level of protein expression in a treated cell or group of cells may be expressed as a percentage of the protein level in a control cell or group of cells.
[0392] A control cell or cell population that may be used to assess changes in gene expression of interest includes a cell or cell population that has not yet been contacted with the oligonucleotide of the present disclosure. For example, the control cell or cell population may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with the oligonucleotide.
[0393] The level of mRNA for a gene of interest expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the expression level of a gene of interest in a sample is determined by detecting a transcribed polynucleotide, or a portion thereof, such as the mRNA of the gene of interest. RNA may be extracted from cells using RNA extraction techniques, including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B, Biogenesis), RNEASY™ RNA preparation kit (Qiagen) or PAXgene (PreAnalytix, Switzerland). Exemplary assay formats that utilize ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating mRNA of a gene of interest may be detected using methods described in PCT Publication WO2012 / 177906, the entire contents of which are incorporated herein by reference. In some embodiments, the expression level of a gene of interest is determined using a nucleic acid probe. The term "probe" as used herein refers to any molecule that can selectively bind to a specific sequence, for example, to an mRNA or a polypeptide. Probes can be synthesized by those skilled in the art or obtained from appropriate biological preparations. Probes can be specifically designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
[0394] The isolated mRNA can be used in hybridization or amplification assays, including, but not limited to, Southern or Northern analysis, polymerase chain reaction (PCR) analysis, and probe arrays. One method of determining mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of a gene of interest. In one embodiment, the mRNA is immobilized on a solid surface and contacted with the probe, for example, by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. One skilled in the art can easily adapt known mRNA detection methods for use in determining mRNA levels for a gene of interest.
[0395] Alternative methods for determining the expression level of a gene of interest in a sample include processes such as nucleic acid amplification of mRNA and / or reverse transcriptase (to prepare cDNA) in the sample, for example by means of RT-PCR (Mullis, 1987, experimental embodiment described in U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-beta replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are particularly useful for detection of nucleic acid molecules when such molecules are present in very low numbers. In certain aspects of the invention, the expression level of the gene of interest is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN™ system) or DUAL-GLO® luciferase assay.
[0396] The mRNA expression level of the gene of interest may be monitored using membrane blots (such as those used in hybridization analysis such as Northern, Southern, dot, etc.), or microwells, sample tubes, gels, beads or fibers (or any solid support containing bound nucleic acid). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Determining gene expression levels may also include using nucleic acid probes in solution.
[0397] In some embodiments, the level of mRNA expression is evaluated using branched DNA (bDNA) assay or real-time PCR (qPCR). The use of this PCR method is described and illustrated in the examples presented herein. Such methods can also be used for nucleic acid detection of genes of interest.
[0398] The level of the protein produced by the expression of the gene of interest may be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitation reaction, absorption spectroscopy, colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (simple or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay, and the like. Such assays may also be used to detect proteins that indicate the presence or replication of the protein produced by the gene of interest. Additionally, the above assays may be used to report changes in the mRNA sequence of interest that result in restoration or alteration of protein function, thereby providing a therapeutic effect and benefit to the subject, treating a disorder in the subject, and / or reducing the symptoms of the disorder in the subject.
[0399] In some embodiments of the method of the present invention, the oligonucleotide of the present disclosure is administered to the subject, so that the oligonucleotide is delivered to a specific site in the subject.The expression change of the gene of interest can be evaluated by using the measurement of the level or the change in the level of the mRNA or protein produced by the gene of interest in the sample from the specific site in the subject.
[0400] In other embodiments, the oligonucleotide is administered in an amount and for a time effective to result in one of the following (or more, e.g., two or more, three or more, four or more of the following): (a) reducing the number of adenosines within the target sequence of the gene of interest, (b) delaying the onset of the disorder, (c) increasing the subject's survival time, (d) increasing the subject's progression-free survival time, (e) restoring or altering protein function, and (f) reducing symptoms.
[0401] Treatment of disorders associated with G to A mutations can also result in a reduction in mortality in a population of treated subjects compared to an untreated population. For example, mortality is reduced by more than 2% (e.g., more than 5%, 10%, or 25%). The reduction in mortality in a population of treated subjects can be measured by any reproducible means, for example, by calculating the average number of disease-related deaths per unit time for a population after starting treatment with a compound or a pharma- ceutically acceptable salt of a compound described herein. The reduction in mortality of a population can also be measured, for example, by calculating the average number of disease-related deaths per unit time for a population after completing the first round of treatment with a compound or a pharma-ceutically acceptable salt of a compound described herein.
[0402] A. Delivery of Oligonucleotides Delivery of the oligonucleotide of the present invention to a cell, e.g., a cell of a subject, e.g., a human subject (e.g., a subject in need thereof, e.g., a subject with a disorder), can be accomplished in a variety of different ways. For example, delivery can be performed by contacting a cell with an oligonucleotide of the present invention, either in vitro or in vivo. In vivo delivery can also be performed directly by administering a composition comprising the oligonucleotide to a subject. Alternatively, in vivo delivery can be performed indirectly by administering one or more vectors that encode and induce expression of the oligonucleotide. A combination of in vitro and in vivo methods of contacting a cell is also possible. As described above, contacting a cell can be direct or indirect. Furthermore, contacting a cell can be achieved via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand that directs the oligonucleotide to a site of interest. The cell can include a cell of the central nervous system, or a muscle cell. These alternatives are further described below.
[0403] The contact of cells with oligonucleotides may be in vitro or in vivo. It may be adapted for use with the oligonucleotides of the present invention (see, for example, Akhtar S. and Julian R L., (1992) Trends Cell.Biol.2(5):139-144 and WO94 / 02595, which are incorporated herein by reference in their entirety). For in vivo delivery, factors to consider for delivering oligonucleotide molecules include, for example, the biological stability of the delivered molecule, the prevention of non-specific effects, and the accumulation of the delivered molecule in target tissue. The non-specific effects of oligonucleotides can be minimized by local administration, for example, by direct injection or implantation into tissue or by local administration of preparations. Local administration at the treatment site maximizes the local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or degrade the agent, and allows the administration of a lower total dose of the oligonucleotide molecule.
[0404] When oligonucleotides are administered systemically for the treatment of disease, they may contain alternative nucleobases, alternative sugar moieties, and / or alternative internucleoside linkages, or may alternatively be delivered using drug delivery systems, both of which function to prevent rapid degradation of the oligonucleotide by endo- and exonucleases in vivo. Modification of the oligonucleotide or pharmaceutical carrier may also allow targeting of the oligonucleotide composition to target tissues and avoid undesirable off-target effects. Oligonucleotide molecules may be modified by chemical conjugation to lipophilic groups, such as cholesterol, to enhance cellular uptake and prevent degradation. In alternative embodiments, oligonucleotides may be delivered using drug delivery systems, such as nanoparticles, lipid nanoparticles, polyplex nanoparticles, lipoplex nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of oligonucleotide molecules (negatively charged) and further enhance interactions with negatively charged cell membranes, allowing efficient uptake of the oligonucleotide by cells. Cationic lipids, dendrimers, or polymers can be either bound to oligonucleotides or induced to form vesicles or micelles that encase the oligonucleotides. The formation of vesicles or micelles further prevents the degradation of oligonucleotides when administered systemically. In general, any method for the delivery of nucleic acids known in the art can be adapted to deliver the oligonucleotides of the present invention. The preparation and administration method of cationic oligonucleotide complexes is well within the capabilities of those skilled in the art (see, for example, Sorensen, D R., et al. (2003) J.Mol.Biol 327:761-766; Verma, U N. et al., (2003) Clin.Cancer Res.9:1291-1300; Arnold, A S et al., (2007) J.Hypertens.25:197-205, the entire contents of which are incorporated herein by reference).Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethylenimine (Bonnet M E. et al., (2008) Pharm. Res. Aug 20, 2008), and ribozyme (Richards, D R., et al., (2008) Pharm. Res. Aug 20, 2008). 16, Epub ahead of print, Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, the oligonucleotides are complexed with cyclodextrins for systemic administration. Methods of administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is incorporated herein by reference in its entirety. In some embodiments, the oligonucleotides of the present invention are delivered by polyplex or lipoplex nanoparticles.Methods of administration and pharmaceutical compositions of oligonucleotides and polyplex and lipoplex nanoparticles can be found in U.S. Patent Application Nos. 2017 / 0121454, 2016 / 0369269, 2016 / 0279256, 2016 / 0251478, 2016 / 0230189, 2015 / 0335764, 2015 / 0307554, 2015 / 0174549, 2014 / 0342003, 2014 / 0135376, and 2013 / 0317086, which are incorporated by reference herein in their entireties.
[0405] i. Delivery method of membrane molecular assemblies The oligonucleotides of the present invention may also be delivered using a variety of membrane molecular assembly delivery methods, including polymer, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, colloidal dispersion systems may be used for targeted delivery of the oligonucleotide agents described herein. Colloidal dispersion systems include polymeric complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUVs), ranging in size from 0.2 to 4.0 μm, can encapsulate a significant fraction of an aqueous buffer solution containing large macromolecules. Liposomes are useful for transporting and delivering active ingredients to the site of action. Because liposomal membranes are structurally similar to biological membranes, when liposomes are applied to tissues, the liposomal bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome with the cell proceeds, the aqueous contents inside, including the oligonucleotide, are delivered into the cell, where the oligonucleotide can specifically bind to the target RNA and mediate RNase H-mediated gene silencing. In some cases, the liposome is also specifically targeted, for example, to direct the oligonucleotide to a specific cell type. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical properties of the liposome depend on pH, ionic strength, and the presence of divalent cations.
[0406] Liposomes containing oligonucleotides can be prepared in a variety of ways. In one example, the lipid components of the liposome are dissolved in a detergent so that micelles are formed with the lipid components. For example, the lipid components can be amphipathic cationic lipids or lipid complexes. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles containing the lipid components. The cationic groups on the lipids interact with the oligonucleotides and aggregate around the oligonucleotides to form liposomes. After aggregation, the detergent is removed, for example, by dialysis, to produce a liposome preparation of oligonucleotides.
[0407] If necessary, carrier compounds that aid in aggregation can be added during the aggregation reaction, for example, by controlled addition. For example, the carrier compound can be a polymer other than nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to promote aggregation.
[0408] Methods for making stable polynucleotide delivery vehicles incorporating polynucleotide / cationic lipid complexes as a structural component of the delivery vehicle are further described, for example, in WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation is also described in Feigner, PL et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, U.S. Pat. No. 4,897,355, U.S. Pat. No. 5,171,678, Bangham et al., (1965) M. Mol. Biol. 23:238, Olson et al., (1979) Biochim. Biophys. Acta 557:9, Szoka et al., (1978) Proc. Natl. Acad. Sci. 75:4194, Mayhew et al., (1984) Biochim. Biophys. Acta 775:169, Kim et al., (1983) Biochim. Biophys. Acta 728:339, and Fukunaga et al. al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include extrusion as well as sonication and freeze-thawing (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161). Microfluidization can be used when consistently small (50-200 nm) and relatively uniform aggregates are required (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169). These methods are easily adapted for packaging oligonucleotide preparations into liposomes.
[0409] Liposomes are broadly divided into two classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid / liposome complexes bind to the negatively charged cell surface and are internalized in endosomes. The acidic pH within the endosomes causes the liposomes to rupture, releasing their contents into the cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).
[0410] pH-sensitive or negatively charged liposomes entrap nucleic acids rather than complexing with them. Both the nucleic acid and the lipids are similarly charged, resulting in repulsion rather than complexation. Nevertheless, some nucleic acids are entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the foreign gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).
[0411] One major type of liposome composition includes phospholipids other than naturally occurring phosphatidylcholine. Neutral liposome compositions can be formed, for example, from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are primarily formed from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC), such as soybean PC and egg PC. Another type is formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.
[0412] Other examples of methods for introducing liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185, U.S. Pat. No. 5,171,678, WO 94 / 00569, WO 93 / 24640, WO 91 / 16024, Feigner, (1994) J. Biol. Chem. 269:2550, Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307, Nabel, (1992) Human Gene Ther. 3:649, Gershon, (1993) Biochem. 32:7143, and Strauss, (1992) EMBO J. 11:417.
[0413] Non-ionic liposomal systems have also been tested to determine their usefulness in drug delivery to the skin, particularly systems containing non-ionic surfactants and cholesterol.Non-ionic liposomal formulations containing NOVASOME™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine-A to the dermis of mouse skin.The results showed that such non-ionic liposomal systems were effective in promoting the deposition of cyclosporine-A into different layers of the skin (Hu et al., (1994) STP Pharma. Sci., 4(6): 466).
[0414] The liposomes may also be sterically stabilized liposomes, e.g., liposomes that contain one or more specialized lipids that provide improved circulation longevity, as compared to liposomes lacking such specialized lipids. An example of a sterically stabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome is monosialoganglioside G M1or (B) are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Without wishing to be bound by any particular theory, it is believed in the art that the enhanced circulation half-life of sterically stabilized liposomes containing at least gangliosides, sphingomyelin, or PEG-derivatized lipids is due to reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).
[0415] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., (1987), 507:64) report on monosialoganglioside G M1 reported the ability of galactocerebroside sulfate, galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. These findings were elaborated by Gabizon et al. (Proc. Natl. Acad. Sci. USA, (1988), 85:6949). U.S. Patent No. 4,837,028 and WO 88 / 04924, both by Allen et al., report the ability of (1) sphingomyelin and (2) ganglioside G M1 or galactocerebroside sulfate esters. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al.).
[0416] In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage that they can fuse with cell membranes. Non-cationic liposomes cannot fuse efficiently with the plasma membrane, but can be taken up by macrophages in vivo and used to deliver oligonucleotides to macrophages.
[0417] Additional advantages of liposomes include that liposomes derived from natural phospholipids are biocompatible and biodegradable, liposomes can incorporate a wide range of water-soluble and lipid-soluble drugs, and liposomes can protect oligonucleotides encapsulated in their internal compartment from metabolism and degradation (Rosoff, "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are lipid surface charge, vesicle size and water content of the liposomes.
[0418] The positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that naturally interact with nucleic acids and fuse with negatively charged lipids in the plasma membrane of tissue culture cells to form lipid-nucleic acid complexes that can deliver oligonucleotides (see, e.g., Feigner, PL et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355, for a description of DOTMA and its use with DNA).
[0419] The DOTMA analog 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with phospholipids to form DNA-complexed vesicles. LIPOFECTIN™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells, including positively charged DOTMA liposomes that naturally interact with negatively charged polynucleotides to form complexes. If sufficiently positively charged liposomes are used, the net charge of the resulting complex will also be positive. The positively charged complexes thus prepared naturally bind to negatively charged cell surfaces and fuse with the plasma membrane to efficiently deliver functional nucleic acids, for example, into tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.), differs from DOTMA in that the oleoyl moieties are linked by ester rather than ether bonds.
[0420] Other cationic lipid compounds that have been reported include those conjugated to a variety of moieties, including, for example, carboxyspermine conjugated to one of two types of lipids, including compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (TRANSFECTAM™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).
[0421] Another cationic lipid complex includes lipid derivatized with cholesterol ("DC-Chol") that is formulated into liposomes in combination with DOPE (see Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by complexing polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). In certain cell lines, those liposomes containing complexed cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.
[0422] Liposomal formulations are particularly suitable for topical administration, and liposomes offer several advantages over other formulations. Such advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug in the desired target, and the ability to administer oligonucleotides to the skin. In some implementations, liposomes are used to deliver oligonucleotides to epidermal cells and to enhance the penetration of oligonucleotides into dermal tissues, such as the skin. For example, liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2, 405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, RJ and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, RM and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. and See Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).
[0423] Non-ionic liposomal systems have also been tested to determine their usefulness in delivering drugs to the skin, particularly systems containing non-ionic surfactants and cholesterol.Non-ionic liposomal formulations containing NOVASOME I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) have been used to deliver drugs to the dermis of mouse skin.Such formulations containing oligonucleotides are useful for treating skin disorders.
[0424] Liposome targeting can also be based on, for example, organ specificity, cell specificity, and organelle specificity, and is known in the art.For liposome targeted delivery system, lipid groups can be incorporated into the lipid bilayer of liposome to maintain targeting ligand in stable association with the liposome bilayer.Various linking groups can be used to link lipid chains to targeting ligand.Additional methods are known in the art, and are described, for example, in U.S. Patent Application Publication No. 20060058255, whose linking groups are incorporated herein by reference.
[0425] Liposomes containing oligonucleotides can be made highly deformable. Such deformability can allow liposomes to penetrate pores smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposome, highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets that are so deformable that they can easily penetrate pores smaller than the droplets. Transfersomes can be made by adding a surface edge activator, usually a surfactant, to a standard liposome composition. Transfersomes containing oligonucleotides can be delivered subcutaneously, for example, by infection, to deliver oligonucleotides to keratinocytes in the skin. To pass through intact mammalian skin, lipid vesicles must pass through a series of micropores, each with a diameter of less than 50 nm, under the influence of a suitable transdermal gradient. Furthermore, lipid properties allow them to self-optimize (e.g., adapt to the shape of skin pores), self-repair, often reach their target without fragmentation, and often self-fill. Transfersomes have been used to deliver serum albumin to the skin, and transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0426] Other formulations suitable for the present invention are described in U.S. Provisional Patent Application Nos. 61 / 018,616, filed January 2, 2008, 61 / 018,611, filed January 2, 2008, 61 / 039,748, filed March 26, 2008, 61 / 047,087, filed April 22, 2008, and 61 / 051,528, filed May 8, 2008. PCT Application No. PCT / US2007 / 080331, filed October 3, 2007, also describes formulations suitable for the present invention.
[0427] Surfactants find a wide range of applications in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is by using the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as "head") provides the most useful means for classifying the different surfactants used in formulations (Rieger's Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
[0428] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find a wide range of applications in pharmaceuticals and cosmetics and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.
[0429] When surfactant molecule is dissolved or dispersed in water, if it carries negative charge, surfactant is classified as anionic.Anionic surfactants include carboxylates such as soap, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyltaurates and sulfosuccinates, and phosphates.The most important members of anionic surfactant class are alkyl sulfates and soaps.
[0430] A surfactant is classified as cationic if the surfactant molecule carries a positive charge when dissolved or dispersed in water. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used members of this class.
[0431] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.
[0432] The use of surfactants in medicines, formulations and emulsions has been reviewed (Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
[0433] The oligonucleotide for use in the method of the present invention can also be provided as a micelle formulation.Micelle is a specific type of molecular assembly, in which amphiphilic molecules are arranged in a globular structure, so that hydrophilic parts remain in contact with the surrounding aqueous phase, and all the hydrophobic parts of the molecule are facing inward.When the environment is hydrophobic, the reverse arrangement exists.
[0434] ii. Lipid nanoparticle-based delivery methods The oligonucleotides of the invention may be fully encapsulated in lipid formulations, such as lipid nanoparticles (LNPs), or other nucleic acid-lipid particles. LNPs are extremely useful for systemic administration because they exhibit extended circulatory life following intravenous (iv) injection and accumulate at distal sites (e.g., sites physically distant from the site of administration). LNPs include "pSPLPs," which include encapsulated aggregating agent-nucleic acid complexes as described in PCT Publication No. WO00 / 03683. The particles of the invention typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially non-toxic. In addition, the nucleic acid when present in the nucleic acid-lipid particles of the invention is resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Pat. Nos. 5,976,567, 5,981,501, 6,534,484, 6,586,410, 6,815,432, U.S. Publication No. 2010 / 0324120, and PCT Publication No. WO 96 / 40964.
[0435] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to oligonucleotide ratio) will be within the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above-listed ranges are also contemplated as part of the invention.
[0436] Non-limiting examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleoyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinole ... DLin-C-DAP, 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanediol (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or and their analogues, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienietetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), and 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazine-1-yeethylazanediyediedodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid may comprise, for example, about 20 mol% to about 50 mol% or about 40 mol% of the total lipid present in the particle.
[0437] The ionic / non-cationic lipids can be anionic lipids or neutral lipids, including distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (DOPE), dioleoylphosphatidylcholine (D ... Non-cationic lipids include, but are not limited to, 1-stearoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or mixtures thereof. The non-cationic lipid, when cholesterol is included, can be, for example, about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid present in the particle.
[0438] The conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG)-lipid, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C]8). The conjugated lipid that prevents particle aggregation can be, for example, 0 mol% to about 20 mol% or about 2 mol% of the total lipid present in the particle.
[0439] In some embodiments, the nucleic acid-lipid particles further comprise cholesterol, for example, at about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.
[0440] B. Combination Therapy The method of the present invention can be used alone or in combination with additional therapeutic agents, such as other drugs that treat the same disorder or symptoms associated therewith, or in combination with other types of therapy for the disorder. In combination treatment, the dosage of one or more of the therapeutic compounds may be reduced from the standard dosage when administered alone. For example, dosage may be empirically determined from drug combinations and permutations, or estimated by isobologram analysis (e.g., Black et al., Neurology 65:S3-S6(2005)). In this case, the dosage of the compounds when combined should provide therapeutic effect.
[0441] In some embodiments, the second therapeutic agent is a chemotherapeutic agent (eg, a cytotoxic agent or other chemical compound useful in the treatment of a disorder).
[0442] The second agent can be a therapeutic agent that is a non-pharmacological treatment, for example, the second therapeutic agent is physical therapy.
[0443] In any of the combination embodiments described herein, the first and second therapeutic agents are administered simultaneously or sequentially in any order. The first therapeutic agent may be administered immediately before or after the second therapeutic agent, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to 16 hours, up to 17 hours, up to 18 hours, up to 19 hours, up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours, up to 24 hours, or up to 1-7 days, 1-14 days, 1-21 days, or 1-30 days.
[0444] IV. Pharmaceutical Compositions The oligonucleotides described herein are preferably formulated into pharmaceutical compositions for administration to human subjects in a biocompatible form suitable for administration in vivo.
[0445] The compounds described herein may be used in the form of free base, salt, solvate, and as prodrugs. All forms are within the scope of the methods described herein. In the methods of the present invention, the compounds described or their salts, solvates, or prodrugs may be administered to a patient in various forms depending on the route of administration selected, as will be understood by those skilled in the art. The compounds described herein may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, intratumoral, or transdermal administration, and the pharmaceutical composition may be formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, pulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical administration methods. Parenteral administration may be performed by continuous infusion over a selected period of time.
[0446] The compounds described herein may be administered orally, for example, with an inert diluent or with an assimilable edible carrier, or the compounds may be sealed in hard or soft shell gelatin capsules, or the compounds may be compressed into tablets, or the compounds may be incorporated directly into dietary foods. For oral therapeutic administration, the compounds described herein may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. The compounds described herein may also be administered parenterally. Solutions of the compounds described herein may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof, with or without alcohol, and in oils. These preparations may contain a preservative to prevent the growth of microorganisms under ordinary conditions of storage and use. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. Pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that it may be easily administered by syringe. Compositions for nasal administration may be conveniently formulated as aerosols, drops, gels, and powders. Aerosol formulations usually comprise a solution or fine suspension of the active substance in a physiologically acceptable aqueous or non-aqueous solvent, and are usually presented in single or multiple doses in a sealed container, which may take the form of a cartridge or refill for use in a nebulizer device, in sterile form. Alternatively, the sealed container may be an integrated dispensing device, such as a single dose nasal inhaler or an aerosol dispenser equipped with a metering valve for disposal after use.If the dosage form comprises an aerosol dispenser, it will contain a propellant, which may be a compressed gas, e.g., compressed air, or an organic propellant, e.g., fluorochlorohydrocarbons. The aerosol dosage form may also take the form of a pump-type atomizer. Suitable compositions for buccal or sublingual administration include tablets, lozenges, and pastilles, in which the active ingredient is formulated with a carrier, e.g., sugar, acacia, tragacanth, gelatin, and glycerin. Compositions for rectal administration are conveniently in the form of a suppository, which contains a conventional suppository base, e.g., cocoa butter. The compounds described herein may be administered intratumorally, e.g., as an intratumoral injection. Intratumoral injection is a direct injection into the tumor vasculature, and is particularly contemplated for individual solid accessible tumors. Local, regional, or systemic administration may also be appropriate. The compounds described herein may be advantageously contacted by administering an injection or multiple injections to the tumor, e.g., spaced approximately 1 cm apart. In the case of surgical intervention, the present invention may be used preoperatively, such as to target inoperable tumors for resection. Continuous administration may also be applied, where applicable, for example, by implanting a catheter into the tumor or into the tumor vasculature.
[0447] The compounds described herein may be administered to animals, e.g., humans, alone or in combination with pharma- ceutically acceptable carriers, as described herein, the proportions being determined by the solubility and chemical properties of the compound, the chosen route of administration, and standard pharmaceutical practice.
[0448] V. Dosage The dosage of the compositions described herein (e.g., compositions comprising oligonucleotides) may vary depending on many factors, such as the pharmacodynamic properties of the compound, the method of administration, the age, health, and weight of the recipient, the nature and extent of symptoms, the frequency of treatment, and the type of concomitant treatment, if any, as well as the clearance rate of the compound in the treated animal. Those skilled in the art can determine the appropriate dosage based on the above factors. The compositions described herein may be initially administered at a suitable dosage, which may be adjusted accordingly depending on the clinical response. In some embodiments, the dosage of the compositions (e.g., compositions comprising oligonucleotides) is a prophylactically or therapeutically effective amount.
[0449] VI. Kit The invention also features kits that include (a) a pharmaceutical composition comprising an oligonucleotide agent that effects deamination of adenosine in mRNA in a cell or subject as described herein, and (b) a package insert that includes instructions for practicing any of the methods described herein. In some embodiments, the kit includes (a) a pharmaceutical composition comprising an oligonucleotide agent that effects deamination of adenosine in mRNA in a cell or subject as described herein, (b) an additional therapeutic agent, and (c) a package insert that includes instructions for practicing any of the methods described herein. EXAMPLES
[0450] Common methods All guide oligonucleotides were chemically synthesized on an automated RNA / DNA synthesizer using standard β-cyanoethyl phosphoramidite chemistry and a versatile solid support such as powdered porous glass (CPG). The phosphoramidites arabinoside, 2'-deoxy-2'-fluoro-arabinoside (FANA), 2'-O-methyl-arabinoside, α-2'-deoxycytidine, DNA abasic, RNA abasic, and 2'-O-methyl abasic were purchased from ChemGenes Corp. (Wilmington, MA). Other 5'-O-DMT-3'-phosphoramidites of RNA, 2'-O-methyl-RNA, and DNA monomers, i.e., A, C, G, U, and T, were purchased from commercial sources. All oligonucleotides were synthesized on a 200 nmol scale by BioSpring GmbH (Frankfurt, Germany). After synthesis, the oligonucleotides were cleaved from the solid support, deprotected, and purified by HPLC system using standard protocols. The oligonucleotides were desalted, dialyzed, and lyophilized. The purity of each lyophilized oligo was 95% or higher as determined by analytical reversed-phase HPLC. The sequence integrity of the oligonucleotides was determined by ESI-MS.
[0451] The human ADAR2 sequence (NM_001112.4) was cloned into the pcDNA3.1 plasmid under the control of the CMV promoter using BamHI and XbaI restriction sites (Quintara Bio, Berkeley, CA) and the sequence of the correct insert was verified. Hereafter, this plasmid will be referred to as ADAR2 / pcDNA3.1. For editing experiments, 2 μg of ADAR2 / pcDNA3.1 plasmid was transfected into 5 × 10 cells / 10 cm dish using 25 μL of Lipofectamine 3000 and 24 μL of P3000 (Life Technologies). 6HEK293T cells (ATCC) were transfected. After 4 h, the culture medium was supplemented with warmed fresh medium (DMEM High Glucose, Life Technologies). 12–16 h after transfection, the transfected HEK293T cells were transfected with guide oligonucleotides to a final concentration of 100 nM in each well. All transfections were performed with Lipofectamine 3000 (0.4 μL per well) in a 96-well format according to the manufacturer's instructions. 12–16 h after the second transfection, cells were washed once with ice-cold PBS and total mRNA isolation was performed using the Dyna Beads mRNA Direct Kit (Life Technologies) adapted for KingFisher Flex Purification (Life Technologies) according to the manufacturer's instructions. Samples were treated with TURBO DNase (Life Technologies) before elution. The resulting isolated mRNA was used for cDNA synthesis using SuperScript IV Vilo according to the manufacturer's instructions (Life Technologies). One μl of cDNA was used as template for PCR (Platinum II Hot-Start PCR Master Mix, Life Technologies) using gene-specific primers to generate amplicons for Sanger sequencing (Table 5). Sanger sequencing was performed by Quintara Biosciences (Berkeley, CA). Adenosine to guanosine editing yield was quantified by measuring the peak heights of adenosine and guanosine and dividing the peak height of guanosine by the measured total peak height of adenosine and guanosine combined. TIFF2025003992000045.tif40170
[0452] Example 1: Design of guide oligonucleotides with novel nucleotide modifications targeting the human RAB7A 3'-UTR target (UAG) Guide oligonucleotide targeting human RAB7A (3'-UTR): TIFF2025003992000046.tif11170 Shown below in Table 6 are exemplary modified guide oligonucleotides targeting human RAB7A with a UAG triplet. In Table 6, A, C, G and U are ribonucleosides, the underlined bold text is the center triplet, mA, mC, mG and mU are 2'-O-methyl ribonucleosides, and fC is 2'-deoxy-2'-fluoro-arabinocytidine (Formula I:R 1 = Fluoro and N 1 = cytosine), and fA represents 2'-deoxy-2'-fluoro-arabinoadenosine (Formula I:R 1 = Fluoro and N 1 = adenine), and aC represents arabinocytidine (Formula I:R 1 = Hydroxy and N 1 = cytosine), and aA represents arabinoadenosine (Formula I:R 1 = Hydroxy and N 1 = adenine), and amC represents 2'-O-methyl-arabinocytidine (Formula I:R 1 =Methoxy and N 1 = cytosine), and amA represents 2'-O-methyl-arabinoadenosine (Formula I:R 1 =Methoxy and N 1 = adenine), and αC represents α-2'-deoxycytidine (Formula II: R 2 = Hydrogen and N 1 = cytosine), and dS stands for 2'-deoxyribose (abasic DNA, formula V:R 4 = hydrogen and R 5 = hydrogen), rS represents ribose (abasic RNA, formula V:R 4 = hydrogen and R 5 = hydroxy), mS stands for 2'-O-methyl-ribose (abasic 2'-OMe-RNA, formula V:R 4 = hydrogen and R 5 = methoxy) and the asterisk indicates a phosphorothioate bond (the remaining bonds are phosphodiester bonds). TIFF2025003992000047.tif249170TIFF2025003992000048.tif239170TIFF20250039920 00049.tif246170TIFF2025003992000050.tif238170TIFF2025003992000051.tif159170
[0453] Other embodiments All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety. If any term in this application is found to be differently defined in a document incorporated herein by reference, the definition provided herein shall serve as the definition of that term.
[0454] While the invention has been described in relation to particular embodiments thereof, it will be understood that the invention is capable of further modifications, and that this application is intended to cover any variations, uses, or adaptations of the invention which are generally in accordance with the principles of the invention and which are known or within the practice in the art to which the invention pertains and which may conform to the essential characteristics as set forth above, including departures from the present disclosure as may be made in accordance with the scope of the claims.
Claims
1. An oligonucleotide having the structure: [A m ]-X 1 -X 2 -X 3 -[B n ] wherein each of A and B is a nucleotide; m and n are each independently an integer from 1 to 50, wherein A and B taken together consist of 18 to 80 nucleotides; [A m ] contains at least one phosphorothioate bond; [B n ] contains at least one phosphorothioate bond; X 1 , X 2 , and X 3 are each independently a nucleotide, and X 1 , X 2 , or X 3 at least one of the groups represented by Formulas II-V: and In the formula, N 1 is hydrogen or a nucleobase, R2 is hydrogen, hydroxy, halogen, or C 1 ~C 6 is an alkoxy, R 3 is hydrogen, hydroxy, halogen, or C 1 ~C 6 is an alkoxy, R 4 is hydrogen, hydroxy, halogen, or C 1 ~C 6 is an alkoxy, R 5 is hydrogen, hydroxy, halogen, or C 1 ~C 6 is an alkoxy, The oligonucleotide comprises one or more adenosine deaminase (ADAR) recruitment domains that act on RNA.
2. [A m ] and / or [B n 2. The oligonucleotide of claim 1, wherein at least 80% of the nucleotides in the formula (I) comprise a nucleobase, a sugar, and an internucleoside linkage.
3. R 1 is hydroxy, halogen, or OCH 3 The oligonucleotide according to claim 1 or 2,
4. X 2 and X 3 at least one of the groups has the structure of formula II or formula V; 1 , X 2 , or X 3 The oligonucleotide of any one of claims 1 to 3, wherein none of the following has the structure of Formula IV or Formula III:
5. X 3 has the structure of Formula II, and X 1 , X 2 , or X 3 The oligonucleotide of any one of claims 1 to 4, wherein none of the following has the structure of Formula III, Formula IV, or Formula V:
6. The oligonucleotide of any one of claims 1 to 5, wherein the halogen is fluoro.
7. X 1 , X 2 , and X 3 at least one of the groups has the structure of formula II, wherein R 2 is hydrogen, and N 1 The oligonucleotide according to any one of claims 1 to 6, wherein is a nucleic acid base.
8. X 1 and X 2 The oligonucleotide of any one of claims 1 to 4, wherein at least one of:
9. X 1 has the structure of formula V, wherein R 4 is hydrogen, and R 5 The oligonucleotide of claim 8, wherein is hydrogen, hydroxy, or methoxy.
10. X 1 has the structure of any one of formulas II to V above, then X 2 and X 3 each independently being a ribonucleotide, 2'-O-C 1 ~C 6 is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 2 has the structure of any one of formulas II to V above, then X 1 and X 3 each independently being a ribonucleotide, 2'-O-C 1 ~C 6 is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 3 has the structure of any one of formulas II to V above, then X 1 and X 2 each independently being a ribonucleotide, 2'-O-C 1 ~C 6 is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 1 and X 2 each has the structure of any one of formulas I to V above, then X 3 is a ribonucleotide, 2'-O-C 1 ~C 6 is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 1 and X 3 each has the structure of any one of Formulas II to V above, then X 2 is a ribonucleotide, 2'-O-C 1 ~C 6 is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide; 2 and X 3 each has the structure of any one of Formulas II to V above, then X 1 is a ribonucleotide, 2'-O-C 1 ~C 6 10. The oligonucleotide of any one of claims 1 to 9, which is an alkyl nucleotide, a 2'-amino nucleotide, an arabinonucleic acid nucleotide, a bicyclic nucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, a constrained ethyl nucleotide, an LNA nucleotide, or a DNA nucleotide.
11. X 1 has the structure of any one of formulas II to V above, then X 2 and X 3 are each independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 2 has the structure of any one of formulas II to V above, then X 1 and X 3 are each independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 3 has the structure of any one of formulas I to V above, then X 1 and X 2 are each independently a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide; 1 and X 2 each has the structure of any one of Formulas II to V above, then X 3 is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide, and X 1 and X 3 each has the structure of any one of formulas I to V above, then X 2 is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide, and X 2 and X 3 each has the structure of any one of Formulas II to V above, then X 1 The oligonucleotide of claim 10, wherein is a ribonucleotide, a 2'-F-nucleotide, a 2'-O-methoxyethyl nucleotide, or a DNA nucleotide.
12. X 1 has the structure of any one of formulas II to V above, then X 2 and X 3 each of X is a ribonucleotide; 2 has the structure of any one of formulas II to V above, then X 1 and X 3 each of X is a ribonucleotide; 3 has the structure of any one of formulas II to V above, then X 1 and X 2 each of X is a ribonucleotide; 1 and X 2 each has the structure of any one of Formulas II to V above, then X 3 is a ribonucleotide, and X 1 and X 3 each has the structure of any one of Formulas II to V above, then X 2 is a ribonucleotide, and X 2 and X 3 each has the structure of any one of Formulas II to V above, then X 1 The oligonucleotide of claim 11, wherein is a ribonucleotide.
13. X 1 The oligonucleotide of any one of claims 1 to 12, wherein comprises a uracil or thymine nucleobase.
14. X 1 The oligonucleotide of claim 13 , wherein
15. X 1 The oligonucleotide of any one of claims 1 to 12, wherein comprises a hypoxanthine nucleobase.
16. X 1 The oligonucleotide of any one of claims 1 to 12, wherein
17. X 3 The oligonucleotide of any one of claims 1 to 16, wherein comprises a guanine nucleobase.
18. X 3 The oligonucleotide of any one of claims 1 to 16, wherein comprises a hypoxanthine nucleobase.
19. X 3 17. The oligonucleotide of any one of claims 1 to 16, wherein comprises an adenine nucleobase.
20. X 2 The oligonucleotide of any one of claims 1 to 19, wherein comprises a cytosine or 5-methylcytosine nucleobase.
21. X 2 21. The oligonucleotide of claim 20, wherein
22. X 2 The oligonucleotide of any one of claims 1 to 21, wherein is not a 2'-O-methyl nucleotide.
23. X 1 , X 2 , and X 3 is not a 2'-O-methyl nucleotide.
24. [A m 24. The oligonucleotide of claim 1, wherein: ] comprises at least one nuclease-resistant nucleotide.
25. [A m ] is at least one 2'-O-C 1 ~C 6 25. The oligonucleotide of any one of claims 1 to 24, comprising alkyl nucleotides, at least one 2'-amino nucleotide, at least one arabinonucleotide nucleotide, at least one bicyclic nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one constrained ethyl (cEt) nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
26. [A m 26. The oligonucleotide of claim 25, wherein: ] comprises at least one 2'-O-methyl nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
27. [A m 27. The oligonucleotide of claim 1, wherein: ] comprises at least five terminal 2'-O-methyl nucleotides.
28. [A m 28. The oligonucleotide of claim 1, wherein: ] comprises at least four terminal phosphorothioate linkages.
29. 29. The oligonucleotide of claim 28, wherein at least one phosphorothioate linkage is stereochemically pure.
30. [B n 30. The oligonucleotide of claim 1, wherein: ] comprises at least one nuclease-resistant nucleotide.
31. 31. The oligonucleotide of claim 30, wherein the nuclease-resistant nucleotide comprises a chemically modified phospholinker moiety.
32. [B n ] is at least one 2'-O-C 1 ~C 6 32. The oligonucleotide of any one of claims 1 to 31, comprising alkyl nucleotides, at least one 2'-amino nucleotide, at least one arabinonucleotide nucleotide, at least one bicyclic nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
33. [B n 33. The oligonucleotide of claim 32, wherein: ] comprises at least one 2'-O-methyl nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl nucleotide, at least one cEt nucleotide, at least one LNA nucleotide, and / or at least one DNA nucleotide.
34. [B n 34. The oligonucleotide of any one of claims 1 to 33, wherein: ] comprises at least five terminal 2'-O-methyl nucleotides.
35. [B n 35. The oligonucleotide of any one of claims 1 to 34, wherein: ] comprises at least four terminal phosphorothioate linkages.
36. 36. The oligonucleotide of claim 35, wherein at least one phosphorothioate linkage is stereochemically pure.
37. [A m ] and [B n 35. The oligonucleotide of any one of claims 1 to 34, wherein at least 20% of the nucleotides in all of the above taken together are 2'-O-methyl nucleotides.
38. The oligonucleotide of any one of claims 1 to 37, wherein the oligonucleotide further comprises a 5' cap structure.
39. The oligonucleotide of any one of claims 1 to 38, wherein the oligonucleotide comprises at least one alternative nucleobase.
40. The oligonucleotide of any one of claims 1 to 39, wherein the 5'-terminal nucleotide is a 2'-amino nucleotide.
41. The oligonucleotide according to any one of claims 1 to 40, wherein m is 5 to 40.
42. The oligonucleotide according to any one of claims 1 to 41, wherein n is 5 to 40.
43. m and n are each independently an integer of 5 to 40; 1 , X 2 , and X 3 at least one of the groups has the structure of formula V, wherein R 4 is hydrogen, and R 5 is hydrogen, and X does not have the structure of formula V 1 , X 2 , and X 3 are ribonucleotides, and m ] and [B n ] each contains at least five terminal 2'-O-methyl nucleotides and at least four terminal phosphorothioate linkages, m ] and [B n 2. The oligonucleotide of claim 1, wherein at least 20% of the nucleotides in all of [a], [b], taken together, are 2'-O-methyl nucleotides.
44. A conjugate comprising an oligonucleotide according to any one of claims 1 to 43 conjugated to a targeting moiety.
45. 44. The conjugate of claim 43, wherein the targeting moiety is a lipid, a sterol, a carbohydrate, and / or a peptide.
46. A composite, An oligonucleotide according to any one of claims 1 to 43 or a complex according to claim 44 or 45, and mRNA, A complex wherein the oligonucleotide or the complex and the mRNA are hybridized to each other, and the complex contains a first mismatch to an adenosine of the mRNA.
47. 47. The conjugate of claim 46, wherein the conjugate comprises a second mismatch that is four nucleotides 5' to the first mismatch.
48. 48. The conjugate of claim 46 or 47, wherein the conjugate comprises 1, 2, 3, 4, 5, 6, 7, or 8 mismatches.
49. 49. The composition of any one of claims 46 to 48, wherein the mRNA comprises an adenosine that can be deaminated to produce a therapeutic result.
50. 49. The compound of any one of claims 46 to 48, wherein the mRNA comprises a guanosine to adenosine mutation compared to the corresponding native mRNA.
51. 51. The compound of claim 50, wherein the guanosine to adenosine mutation is a missense mutation or a nonsense mutation.
52. 52. The compound of any one of claims 46 to 51, wherein the first mismatch is at an adenosine in the start codon of the mRNA.
53. 52. The compound of any one of claims 46 to 51, wherein the first mismatch is at an adenosine in the stop codon of the mRNA.
54. 54. The composition of claim 53, wherein the stop codon is a premature stop codon.
55. A method for producing a conjugate according to any one of claims 46 to 54, comprising contacting a cell with an oligonucleotide according to any one of claims 1 to 43 or a conjugate according to claim 44 or 45.
56. 46. A method for deaminating adenosine in mRNA, the method comprising contacting a cell with the oligonucleotide of any one of claims 1 to 43 or the complex of claim 44 or 45.
57. 46. A medicament for treating a disorder in a subject in need thereof, comprising administering to said subject an effective amount of an oligonucleotide according to any one of claims 1 to 43 or a conjugate according to claim 44 or 45.
58. The disorder may be cystic fibrosis, albinism, alpha-1-antitrypsin deficiency, Alzheimer's disease, amyotrophic lateral sclerosis, asthma, thalassemia XI, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease, distal spinal muscular atrophy, Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase deficiency, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease, hereditary polyaggregation syndrome, Leber's congenital amaurosis , Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibroma, Niemann-Pick disease types A, B, and C, NY-ESO-1 associated cancer, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disease, prothrombin mutation-associated disorder, pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome, sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturge-Weber syndrome, Rett syndrome, or cancer.