5-aminolevulinic acid-producing bacteria, method for producing same, and method for producing 5-aminolevulinic acid using the same

Abstract

To create a strain of 5-aminolevulinic acid-producing bacteria, which is a strain suitable for the industrial production of 5-aminolevulinic acid from the viewpoint of safety, by using a technique that does not leave foreign genes in the final strain, particularly self-cloning technology although it is a genetic recombination technique; and to provide a method for producing 5-aminolevulinic acid using the created strain.SOLUTION: The above problem is solved by: creating a strain of photosynthetic bacteria belonging to α-proteobacteria class, which has an expression control region including PrrnB promoter upstream of a gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, the expression control region being derived from the same species of photosynthetic bacteria as the strain and inducing the expression of hemT, and the induction resulting in an increase in the productivity of 5-aminolevulinic acid compared to a wild-type strain; and culturing the created strain.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to the creation of a self-cloning strain of an α-proteobacterium using a self-cloning technique, and a method for producing 5-aminolevulinic acid using the created strain. [Background technology]

[0002] 5-aminolevulinic acid (ALA) is a compound that is widely present in the biosphere as a metabolic intermediate in the pigment biosynthesis pathway that synthesizes tetrapyrrole compounds (vitamin B12, heme, chlorophyll, etc.) and plays an important role in living organisms. 5-aminolevulinic acid is also a natural compound that exhibits excellent effects as a herbicide, insecticide, plant growth regulator, and plant photosynthesis enhancer (Patent Documents 1 and 2). Furthermore, 5-aminolevulinic acid is used as a raw material for pharmaceuticals, supplements, cosmetics, feed, fertilizers, etc., and widely supports people's lives in various aspects.

[0003] It is known that 5-aminolevulinic acid is biosynthesized in vivo from glycine and succinyl-CoA by 5-aminolevulinic acid synthase, or from glutamic acid via glutamyl-tRNA (Patent Document 3).

[0004] Although the usefulness of 5-aminolevulinic acid is widely known, one of the problems in practical use is the high production cost. Although chemical synthesis has been considered for some time, a sufficiently satisfactory method has not yet been developed.

[0005] Meanwhile, methods for producing 5-aminolevulinic acid using microorganisms have also been studied. For example, a method using the genus Propionibacterium, Methanobacterium, or Methanosarcina has been proposed (Patent Document 4). However, the production of 5-aminolevulinic acid by fermentation was insufficient in terms of production volume, and was not industrially satisfactory.

[0006] A method using photosynthetic bacteria of the genus Rhodobacter is also known, and it has been reported that this method produces a larger amount of 5-aminolevulinic acid than the method using the above-mentioned microorganisms (Patent Document 5, etc.). Furthermore, a method has been carried out in which bacteria of the genus Rhodobacter are mutagenized, a strain with high 5-aminolevulinic acid productivity is selected, and the selected strain is subjected to repeated mutagen treatment and selection to obtain a mutant strain with higher 5-aminolevulinic acid production, which is then used (Non-Patent Documents 1 and 2).

[0007] As another approach to high-level production of 5-aminolevulinic acid in microorganisms, selection or preparation of microbial strains using gene recombination techniques has been carried out. For example, a 5-aminolevulinic acid synthase gene derived from photosynthetic bacteria is introduced into Escherichia coli to prepare a transformant (Non-Patent Document 3, Patent Document 6), or a 5-aminolevulinic acid synthase gene derived from photosynthetic bacteria is introduced into a photosynthetic bacterium to prepare a transformant (Patent Document 7), etc. are known.

[0008] From the viewpoint of production costs and productivity, in the past, for industrial production of 5-aminolevulinic acid, selection or creation of a strain highly productive of 5-aminolevulinic acid was mainly carried out by (1) drug-induced mutation or (2) recombinant gene technology. However, in the case of (1), it is necessary to repeat the introduction of mutations and selection multiple times until the desired highly productive strain is obtained, and further, careful analysis of the properties of the selected strain and the mutated genes is required to ensure safety. In addition, in the case of (2), it is considered necessary to comprehensively analyze the properties of the strain created to ensure safety, because the transformant often contains a foreign gene. Therefore, in either case, it has taken a considerable amount of time and effort to realize industrial production, and has often been accompanied by difficulties. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] Japanese Patent Application Laid-Open No. 61-502814 [Patent Document 2] Japanese Patent Application Laid-Open No. 2-138201 [Patent Document 3] Japanese Patent Application Laid-Open No. 2013-208074 [Patent Document 4] Japanese Patent Application Laid-Open No. 5-184376 [Patent Document 5] Japanese Patent Application Laid-Open No. 5-184376 [Patent Document 6] Japanese Patent Application Laid-Open No. 2005-333907 [Patent Document 7] Japanese Patent Application Laid-Open No. 9-173071 [Non-Patent Document]

[0010] [Non-Patent Document 1] Nishikawa, S., et al. (1999) Rhodobacter sphaeroides mutants which accumulate 5-aminolevulinic acid under aerobic and dark conditions., J. Biosci. Bioeng., vol. 87, pp. 798-804. [Non-Patent Document 2] Kamiyama et al. (2000) Production of 5-aminolevulinic acid by a mutant strain of a photosynthetic bacterium. -Monograph-, Journal of the Society of Biotechnology, vol. 78, no. 2, pp. 48-55. [Non-Patent Document 3] Xie, L. et al., (2003) Appl. Microbiol. Biotechnol., vol. 63, pp. 267-273. [Summary of the Invention] [Problems to be Solved by the Invention]

[0011] When using drug-induced mutants or transformants into which foreign genes have been introduced for industrial production of 5-aminolevulinic acid, as described above, there is a problem that considerable effort and cost are required to ensure safety, and that difficulties are often involved. The present invention aims to avoid or alleviate this problem. [Means for solving the problem]

[0012] Therefore, the present inventors attempted to create a strain that is highly productive of 5-aminolevulinic acid and is suitable from the viewpoint of safety for industrial production of 5-aminolevulinic acid by using a technique that does not leave foreign genes in the final strain, particularly a self-cloning technique, although it is a genetic recombination technique. As a result, they unexpectedly found that the above problems can be solved by combining a specific expression control region (promoter, etc.) and a 5-aminolevulinic acid synthase gene (ALAS gene), both of which are derived from the same genome, and thus completed the present invention.

[0013] In some aspects, the present invention provides the following [1] to

[20] .

[0014] [1] A photosynthetic bacterial strain belonging to the class α-proteobacteria having an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding the 5-aminolevulinic acid synthase HemT, wherein the expression control region is derived from the same species of photosynthetic bacteria as the strain and induces expression of hemT, such induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain. [2] The strain according to [1] above, into which an expression control region containing PrrnB has been inserted by homologous recombination technology and which is substantially free of foreign gene sequences of heterologous origin. [3] The strain of [1] or [2] above, wherein the photosynthetic bacterium belonging to the α-proteobacteria class is a bacterium of the genus Rhodobacter, Rhodospirillum, Rhodopseudomonas, Chromatium, Ectothiorhodospira, Chlorobium, Prosthecochloris, Chloroflexus, Chloronema, or Helicobacterium. [4] Any one of the strains of [1] to [3] above, wherein the photosynthetic bacterium belonging to the α-proteobacteria class is a bacterium of the genus Rhodobacter. [5] The strain of [4] above, wherein the species of the bacteria of the genus Rhodobacter is Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter sulfidophillus, Rhodobacter adriaticus, or Rhodobacter veldkampii. [6] Any one of the strains [1] to [5] above, wherein hemT contains any one of the following base sequences: (i) the nucleotide sequence of SEQ ID NO: 1; (ii) a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 2; (iii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of (i) or (ii) above and encoding a protein having 5-aminolevulinic acid synthase activity; and (iv) A nucleotide sequence in which 1 to 120 nucleotides are deleted, substituted, added or inserted relative to the nucleotide sequence of (i) or (ii) above, and which encodes a protein having 5-aminolevulinic acid synthase activity. [7] Any one of the strains of [1] to [5] above, wherein hemT is derived from the genome of any one of Rhodobacter sphaeroides strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, or KD131, and the photosynthetic bacterial species is Rhodobacter sphaeroides. [8] Any one of the strains [1] to [7] above, wherein PrrnB contains any one of the following base sequences: (i) the base sequence of SEQ ID NO: 3; (ii) the nucleotide sequence of SEQ ID NO: 4; (iii) the nucleotide sequence of SEQ ID NO: 5; (iv) a functional fragment of PrrnB, which is composed of a base sequence having a 5'-end at any one of positions 1 to 158 of SEQ ID NO: 5 and a 3'-end at any one of positions 188 to 195 of SEQ ID NO: 5, and has an activity of inducing the expression of hemT; (v) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 4 or 5 and having an activity of inducing the expression of hemT; and (vi) A nucleotide sequence in which 1 to 19 nucleotides are deleted, substituted or added to the nucleotide sequence of SEQ ID NO: 4 or 5, and which has an activity of inducing the expression of hemT. [9] Any one of the strains of [1] to [7] above, wherein PrrnB is derived from the genome of any one of Rhodobacter sphaeroides strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.3 (ATCC17025), ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, KD131, or HJ, and the photosynthetic bacterial species is Rhodobacter sphaeroides.

[10] The strain according to any one of [1] to [9] above, wherein the inserted PrrnB is located upstream of the coding region of the hemT gene and within 10,000 bases upstream of the start codon of the hemT gene, preferably within 1,000 bases, more preferably within 100 bases, and even more preferably adjacent to the transcription start site of the hemT gene.

[0015]

[11] A method for producing 5-aminolevulinic acid, comprising culturing any one of the strains [1] to

[10] in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and collecting 5-aminolevulinic acid from the culture.

[12] The method according to

[11] above, wherein the medium is a liquid medium and the culture is performed by shaking culture.

[13] The method according to

[10] or

[11] , wherein the culture is carried out under oxygen-limited microaerobic or anaerobic conditions.

[14] The method according to

[10] or

[11] , wherein the culture is carried out under aerobic conditions.

[0016]

[15] A method for producing a photosynthetic bacterial strain belonging to the α-proteobacteria class, which has an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, wherein the expression control region is derived from the same species of photosynthetic bacteria as the strain and induces expression of hemT, such induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain, the method for producing the strain, characterized in that it includes a step of functionally linking PrrnB to hemT.

[16] A method for preparing any one of the strains [1] to

[10] above, comprising a step of functionally binding PrrnB to hemT.

[0017]

[17] A method for producing a photosynthetic bacterium strain with high productivity of 5-aminolevulinic acid, comprising the step of inserting, into a wild-type strain of the photosynthetic bacterium, an expression control region including a ribosomal RNA operon promoter (PrrnB) derived from the same species upstream of a gene (hemT) encoding 5-aminolevulinic acid synthase HemT in the genome of the wild-type strain by homologous recombination technology, wherein the inserted PrrnB induces expression of hemT, and the induction results in increased productivity of 5-aminolevulinic acid compared to the wild-type strain, and the photosynthetic bacterium is a species belonging to the α-proteobacteria class.

[18] The method of

[17] above, which uses a plasmid vector for homologous recombination, wherein the plasmid vector contains an expression control region containing PrrnB, and homologous regions consisting of sequences homologous to the upstream and downstream regions of the genome adjacent to the target region of homologous recombination are arranged on both sides of the expression control region containing PrrnB.

[19] The method according to

[17] or

[18] , wherein the sequence of the homologous region is a base sequence of 20 bases or more, 100 bases or more, 500 bases or more, or 1,000 bases or more.

[20] The method according to any one of

[17] to

[19] above, wherein the region in the plasmid vector containing an expression control region including PrrnB, which is sandwiched between two homologous regions, is substantially free of foreign genes derived from a biological species that is heterologous to a species of photosynthetic bacteria belonging to the α-proteobacteria class. Effect of the Invention

[0018] The present invention provides a method for producing a photosynthetic bacterial strain using a self-cloning technique, in which the expression of HemT, a 5-aminolevulinic acid synthase, is induced by a homologous or endogenous ribosomal RNA operon promoter (PrrnB), thereby increasing the productivity of 5-aminolevulinic acid without using a heterologous gene, and the produced strain is substantially free of heterologous nucleic acid sequences. The strain of the present invention produced by the self-cloning technique is unlikely to cause unexpected side effects due to genetic recombination, and is therefore a boon for industries requiring high safety for products, such as the pharmaceutical, food and beverage industries, as well as for consumers. For example, the European Regulation on the Protection of Human Health and the Environment (Directorate-General XI of the Commission of the European Communities, 1992) stipulates that self-cloning used for genetic recombination of non-pathogenic microorganisms should be exempt from regulatory oversight. In terms of regulatory treatment, the strain of the present invention has an advantage over drug-induced mutants and transformants into which foreign genes have been introduced, and is advantageous in the industrial production of 5-aminolevulinic acid. [Brief description of the drawings]

[0019] Figure 1 is a schematic diagram showing the procedure for constructing a promoter-inserted strain of photosynthetic bacteria by the self-cloning technique. More specifically, Figure 1 shows the procedure for inserting the rrnB promoter (PrrnB) or rsp_7571 promoter (Prsp_7571) derived from the photosynthetic bacterium Rhodobacter sphaeroides strain 2.4.1 upstream of the hemA gene in the genome of the same strain by homologous recombination. In the vector used for homologous recombination, Up (genomic sequence upstream of the hemA locus) and hemA are placed on either side of the promoter as homologous regions adjacent to PrrnB or Prsp_7571. Outside the homologous regions, a gentamicin resistance gene (Gm r ), and the levansucrase gene (sacB) was placed as a negative selection marker. The final strain with PrrnB inserted upstream of the hemA gene was designated the BA strain, and the strain with Prsp_7571 inserted was designated the 7A strain. Figure 2 shows the genomic gene organization around the ALAS gene (hemA or hemT) in the strain constructed by inserting a promoter by the self-cloning technique. (A) shows the gene organization of the region of chromosome 1 where the hemA gene is present in the genome of R. sphaeroides. (B) shows the genes of the region of chromosome 2 where the hemT gene is present in the genome of R. sphaeroides. In the figure, the white arrow indicates the coding sequence of the gene, and the black arrow indicates the transcription start site and transcription direction. The thick black line indicates the inserted promoter sequence (PrrnB or Prsp_7571). WT indicates a rifampicin-resistant strain derived from R. sphaeroides strain 2.4.1 (wild strain). BA indicates a strain in which PrrnB is inserted upstream of hemA. BAT indicates a strain in which PrrnB is inserted upstream of hemA and upstream of hemT. 7A indicates a strain in which Prsp_7571 is inserted upstream of hemA. 7AT indicates a strain in which Prsp_7571 was inserted upstream of hemA and upstream of hemT, BT indicates a strain in which PrrnB was inserted upstream of hemT, and 7T indicates a strain in which Prsp_7571 was inserted upstream of hemT. Figure 3 shows the results of quantification by RT-PCR of the expression level of the ALAS gene (hemA or hemT) in strains constructed by inserting a promoter using the self-cloning technique. The upper row shows the expression level of the hemA gene as a relative value to the expression level in the WT strain under aerobic conditions, which is set to 1. The lower row shows the expression level of the hemT gene as a relative value to the expression level in the WT strain under aerobic conditions, which is set to 1. The white bars show the results when the strains were cultured under aerobic conditions, and the gray bars show the results when the strains were cultured under microaerobic conditions. The names of the WT and the six strains created by the self-cloning technique are the same as in Figure 2. Figure 4 shows the time course of 5-aminolevulinic acid productivity in strains constructed by inserting a promoter using the self-cloning technique. The vertical axis shows the 5-aminolevulinic acid (ALA) concentration (mM), and the horizontal axis shows the culture time (h). The names of the WT and the six strains constructed using the self-cloning technique are the same as those in Figure 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Hereinafter, several embodiments of the present invention will be described in detail. However, the present invention is not limited to the following embodiments.

[0021] A photosynthetic bacterial strain according to one embodiment of the present invention is a photosynthetic bacterial strain belonging to the α-proteobacteria class in which an expression control region including a ribosomal RNA operon promoter (PrrnB) is located upstream of a gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, and the expression control region is derived from the same species of photosynthetic bacteria as the strain and induces expression of hemT, such induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain.

[0022] First, photosynthetic bacteria will be described. Photosynthetic bacteria are bacteria that belong to the α-proteobacteria class in biological classification. The photosynthetic bacteria may be any bacteria that grows by photosynthetic inorganic or organic nutrition using light energy. For example, bacteria belonging to the genera Rhodobacter, Rhodospirillum, Rhodopseudomonas, Chromatium, Ectothiorhodospira, Chlorobium, Prosthecochloris, Chloroflexus, Chloronema, and Helicobacterium may be mentioned, and preferably bacteria belonging to the genus Rhodobacter may be mentioned.

[0023] Examples of bacteria belonging to the genus Rhodobacter include bacteria belonging to Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter sulfidophillus, Rhodobacter adriaticus, Rhodobacter veldkampii, etc., with preferred examples being bacteria belonging to Rhodobacter sphaeroides.

[0024] The classification system of photosynthetic bacteria is still in flux, and is being successively divided and reorganized. In recent years, some species of the genus Rhodobacter have been transferred to three new genera, Cereibacter, Fuscovulum, and Phaeovulum, and thus Rhodobacter sphaeroides and Rhodobacter veldkampii, which belong to the genus Rhodobacter, are now classified as Cereibacter sphaeroides and Phaeovulum veldkampii, respectively. However, these species remain classified in the order Rhodobacter, and are still widely recognized as species of the genus Rhodobacter. Therefore, in this specification, Cereibacter sphaeroides and Phaeovulum veldkampii are synonymous with Rhodobacter sphaeroides and Rhodobacter veldkampii, respectively, and are treated as bacterial species belonging to the genus Rhodobacter.

[0025] Next, 5-aminolevulinic acid synthase (ALAS) will be described. There are two known pathways for the biosynthesis of 5-aminolevulinic acid, the C4 pathway and the C5 pathway. ALAS (EC 2.3.1.37) possessed by photosynthetic bacteria has an enzyme activity that catalyzes the reaction of producing 5-aminolevulinic acid from glycine and succinyl-CoA in the C4 pathway (also called the Shemin pathway). Since the basic gene constitution of photosynthetic bacteria, Rhodobacter genus, or Rhodobacter sphaeroides is substantially identical or highly similar to each other, it is considered that the same effect can be obtained in the present invention regardless of the ALAS gene derived from any bacterium, as long as it has an ALAS gene that is homologous in sequence and / or function.

[0026] Specific examples of ALAS include HemA and HemT of Rhodobacter sphaeroides. HemA and HemT have in common the fact that they catalyze the reaction to produce 5-aminolevulinic acid from succinyl-CoA, but each is under different expression control. The hemA gene encoding the former is located on the first chromosome and is induced to be expressed under anaerobic conditions, whereas the hemT gene encoding the latter is located on the second chromosome and has been reported to be a silent gene in the 2.4.1 strain of Rhodobacter sphaeroides. As described in detail in the Examples below, self-cloning strains in which the expression control regions of these genes were replaced with those of other genes by homologous recombination technology were produced and tested. When the rrnB promoter (PrrnB) was placed upstream of the hemT gene, high productivity of 5-aminolevulinic acid was observed, whereas when it was placed upstream of the hemA gene, no improvement in productivity of 5-aminolevulinic acid was observed. Therefore, the strain of the present invention is a photosynthetic bacterium having a high productivity of 5-aminolevulinic acid, expressing ALAS, and having a gene (hemT) encoding HemT placed under the control of PrrnB. Here, the hemT gene is preferably a gene derived from the same species of the photosynthetic bacterium or an endogenous gene.

[0027] Next, the hemT gene, the expression of which is induced by the rrnB promoter (PrrnB) derived from the genome of the same species and introduced by homologous recombination technology in the strain of the photosynthetic bacteria of the present invention, will be described. The hemT gene may have any sequence as long as it is derived from the genome of the photosynthetic bacteria and encodes a polypeptide having 5-aminolevulinic acid synthase activity, and examples of the hemT gene include the following hemT genes. That is, the hemT gene is derived from the genome of any of the strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, and KD131 of Rhodobacter sphaeroides. When inducing the expression of these hemT genes, a self-cloning technique is used, and therefore the strain of the present invention is a strain of Rhodobacter sphaeroides, which is the same species as the species from which the hemT gene is derived. Here, the strain of the present invention may be the same species as the species from which the hemT gene is derived, and does not necessarily have to be the same strain as the strain from which the hemT gene is derived.

[0028] A specific example of the hemT gene is a nucleic acid containing a nucleotide sequence encoding a protein having the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. Here, the nucleotide sequence of SEQ ID NO: 1 corresponds to the full length of the coding region of the hemT gene contained in the genome of Rhodobacter sphaeroides strain 2.4.1, and SEQ ID NO: 2 corresponds to the amino acid sequence encoded by the hemT gene. Also preferably used in the present invention are a base sequence which has 90% or more (preferably 92% or more, more preferably 95% or more, even more preferably 98% or more, and most preferably 99% or more) sequence identity with a base sequence encoding a protein having the base sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and which encodes a protein having 5-aminolevulinic acid synthase activity, and a base sequence in which 1 to 120 (preferably 1 to 60, more preferably 1 to 40, even more preferably 1 to 20, and most preferably 1 to 10) bases have been deleted, substituted, added, or inserted from the base sequence encoding a protein having the base sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and which encodes a protein having 5-aminolevulinic acid synthase activity. When a BLAST search was performed on the base sequence of SEQ ID NO:1, the hemT genes derived from the genomes of any of the Rhodobacter sphaeroides strains H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, CH10, and KD131 all showed a sequence identity of 91% or more.

[0029] Next, PrrnB derived from the genome of the same species that is introduced into the photosynthetic bacterial strain of the present invention by homologous recombination technology to induce expression of the hemT gene will be described. PrrnB is a nucleic acid derived from the ribosomal RNA operon promoter (PrrnB) of the genome of the photosynthetic bacteria, and an expression control region containing the PrrnB is used in the present invention. The expression control region containing the rrnB promoter may have any sequence as long as it has the activity of inducing expression of the hemT gene under its control in the strain of the present invention, and examples of the expression control region containing PrrnB in the genome of the following strains can be mentioned. That is, the expression control region includes PrrnB derived from the genome of any of Rhodobacter sphaeroides strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.3 (ATCC17025), ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, KD131, and HJ.

[0030] A specific example of PrrnB is a nucleic acid containing the base sequence of SEQ ID NO: 4 or 5. Here, the base sequence of SEQ ID NO: 4 or 5 corresponds to a rrnB promoter region having a length of 58 or 195 bases contained in the genome of the 2.4.1 strain of Rhodobacter sphaeroides or a nucleic acid containing the same. In addition, a base sequence having a sequence identity of 90% or more (preferably 94% or more, more preferably 96% or more, even more preferably 98% or more, and most preferably 99% or more) with the base sequence of SEQ ID NO: 4 or 5 and having an activity of inducing the expression of hemT, or a base sequence in which 1 to 19 bases (preferably 1 to 15 bases, more preferably 1 to 10 bases, even more preferably 1 to 5 bases, and most preferably 1 to 3 bases) are deleted, substituted, added, or inserted from the base sequence of SEQ ID NO: 4 or 5 and having an activity of inducing the expression of hemT, can also be suitably used in the present invention. In addition, when a BLAST search was performed on the base sequence of SEQ ID NO: 4 or 5, PrrnB derived from the genome of any of the Rhodobacter sphaeroides strains H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, CH10, KD131, and HJ strains all showed sequence identity of 96% or more.

[0031] Functional fragments of the rrnB promoter (PrrnB) are also used in the present invention as long as they have the activity of inducing the expression of hemT. According to Henry et al. (Proc. Natl. Acad. Sci. USA, (2020) vol. 117, pp. 29658-29668), PrrnB contains a 6-base sequence (TTGCGC) in the -35 region recognized by transcription factors and a 6-base sequence (TAGAAA) in the -10 region recognized by RNA polymerase, and a 29-base sequence (TTGCGCCCGGGGCCGTCTGCTCCTAGAAA; SEQ ID NO: 3) containing both sequences, or a 58-base sequence (TACGGAGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTCA; SEQ ID NO: 4) containing both sequences is considered to be the minimum unit or promoter region that functions as a functional fragment of the rrnB promoter, and is a suitable functional fragment of PrrnB. Here, the base sequence of SEQ ID NO: 3 or 4 corresponds to the base sequence of positions 159 to 187 or positions 138 to 195 of the base sequence of SEQ ID NO: 5. Therefore, a nucleic acid having a 5'-end at any position from 1 to 158 of SEQ ID NO: 5 and a 3'-end at any position from 188 to 195, which includes the entire base sequence of SEQ ID NO: 3 or 4 and corresponds to a partial sequence of the base sequence of SEQ ID NO: 5, or a nucleic acid having a 5'-end at any position from 1 to 137 of SEQ ID NO: 3 and a 3'-end at positions 194 or 195, is also preferably used in the present invention as a functional fragment or promoter region of PrrnB of the present invention. In each of the base sequences of SEQ ID NO: 4 and SEQ ID NO: 5, the adenine residue at the 3'-end serves as the transcription initiation point. In the present invention, the expression-inducing activity of hemT literally means an activity to induce the expression of hemT, and although it is not necessarily limited to this, it means, for example, an activity to induce expression of hemT 5-fold, 10-fold, 20-fold or 30-fold, and particularly preferably 40-fold or more, compared to the expression of hemT in a wild-type or standard strain; and from another perspective, it means an activity that is equal to or greater than the expression-inducing activity of hemT by a nucleic acid having the base sequence of any one of SEQ ID NOs: 3, 4 or 5.

[0032] Next, the insertion position of the rrnB promoter (PrrnB) or its functional fragment will be described. The insertion position is not necessarily limited as long as PrrnB or its functional fragment functions as a promoter and induces the transcription of the hemT gene located downstream. Usually, the insertion position is upstream of the coding region of the hemT gene, the transcription start point, or the ribosome binding sequence. An example of the insertion position is upstream of the coding region of the hemT gene, and within 10,000 bases upstream of the start codon of the hemT gene, preferably within 1,000 bases, more preferably within 100 bases, and even more preferably adjacent to the transcription start position of the hemT gene. However, since the purpose is to induce the expression of the hemT gene, it is required that there is no transcription termination sequence between the inserted PrrnB or its functional fragment and the start codon of the hemT gene, and if there is one, the sequence is modified to remove the transcription termination sequence. In addition, the insertion sequence containing the promoter region which is PrrnB or a functional fragment thereof may also contain a transcription initiation site (adenine base), a ribosome binding sequence, or other genes, etc., as appropriate.

[0033] The photosynthetic bacteria strain according to one embodiment of the present invention is produced by a self-cloning technique and is substantially free of nucleic acid sequences derived from heterologous organisms, such as foreign genes. In self-cloning, an organism of the same species is used as a source of transforming DNA and a host for transformation. Thus, in the present invention, an insertion sequence containing PrrnB or a functional fragment thereof derived from a certain type of photosynthetic bacteria is used as a source and inserted into the host genome of the same type of photosynthetic bacteria. By this insertion, PrrnB or a functional fragment thereof derived from the same type of photosynthetic bacteria is functionally linked to the hemT gene, and expression of hemT is induced in the self-cloning strain by the expression induction activity of the rrnB promoter. The genome of the strain of the present invention produced by the self-cloning technique does not contain any nucleic acid derived from an organism of a species different from the host photosynthetic bacteria, or substantially does not contain any nucleic acid derived from an organism of a species different from the host photosynthetic bacteria. Here, "substantially free" means that only heterologous nucleic acid or artificial sequence nucleic acid with a very short sequence length of about 1 to 30 bases (preferably 20 bases or less, more preferably 10 bases or less, and even more preferably 6 bases or less) such as a polylinker used to facilitate in vitro cloning is allowed to exist. Here, it is not intended to encompass heterologous nucleic acids such as heterologous antibiotic resistance genes used as selection markers.

[0034] Self-cloning is a technique well known to those skilled in the art (see, for example, Akada et al., (1999) J. Biosci. Bioeng., vol. 87, pp. 43-48, JP 2003-144164 A), and can be appropriately performed by those skilled in the art by combining and applying general molecular biology experimental techniques.

[0035] One embodiment of the present invention is a method for producing a photosynthetic bacterium strain with high productivity of 5-aminolevulinic acid, which comprises inserting an expression control region including a ribosomal RNA operon promoter (PrrnB) into a wild-type strain of photosynthetic bacteria upstream of a gene (hemT) encoding 5-aminolevulinic acid synthase HemT in the genome of the wild-type strain by a homologous recombination technique, wherein the inserted PrrnB induces expression of hemT, and the induction results in an increase in productivity of 5-aminolevulinic acid compared to the wild-type strain, and the photosynthetic bacterium is a species of bacteria belonging to the class α-Proteobacteria.

[0036] One embodiment of the method for producing a photosynthetic bacterium strain with high productivity of 5-aminolevulinic acid of the present invention is a method using a plasmid vector for homologous recombination. Here, the plasmid vector contains an expression control region containing PrrnB, and homologous regions consisting of sequences homologous to the upstream and downstream regions of the genome adjacent to the target region of homologous recombination are arranged on both sides of the expression control region containing PrrnB. The homologous region may have any sequence length as long as it can efficiently induce homologous recombination in a target site-specific manner, and may have a sequence length of, for example, 20 bases or more, 100 bases or more, 500 bases or more, or 1,000 bases or more. The portion located outside the homologous region from the expression control region containing PrrnB is not inserted into the host by homologous recombination, so it may contain a nucleic acid heterologous to the genome of the host. An example of the heterologous nucleic acid is a positive selection marker (Gm R These include antibiotic resistance genes (e.g., sacB) and negative selection markers (e.g., sacC).

[0037] Another embodiment of the present invention is a method for producing 5-aminolevulinic acid, which is characterized by culturing the photosynthetic bacteria of the present invention in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and collecting 5-aminolevulinic acid from the culture. Cultivating photosynthetic bacteria for the purpose of producing 5-aminolevulinic acid and collecting the product 5-aminolevulinic acid are both well-known techniques, and those skilled in the art can appropriately carry out such procedures by referring to known documents. As long as 5-aminolevulinic acid can be produced, the medium may be a solid medium or a liquid medium, and the medium components may be any as long as they contain a substrate (glycine, etc.) related to the production of 5-aminolevulinic acid and are suitable for the growth of photosynthetic bacteria. As described in Patent Document 3, a medium containing a plant protein hydrolysate in addition to normal nutritional components such as yeast extract can also be used. A preferred example of the method for producing 5-aminolevulinic acid of the present invention is a method using a liquid medium and performing shaking culture. The oxygen conditions in the culture may be aerobic, microaerobic (oxygen-limited), or anaerobic as long as 5-aminolevulinic acid can be produced, but microaerobic conditions are preferred. This is because oxygen inhibits pigment synthesis in photosynthetic bacteria, particularly purple nonsulfur bacteria, and 5-aminolevulinic acid synthase is said to be inactivated by oxygen. Microaerobic conditions can be achieved by artificially suppressing oxygen supply, but they can also be achieved naturally during continuous shaking culture in an environment with insufficient ventilation. In addition, if light irradiation is not performed during culture, the photosynthetic bacteria will be placed in a heterotrophic environment and will require oxygen for growth, so anaerobic conditions are not suitable. In order to increase the productivity of 5-aminolevulinic acid, various environmental conditions related to the culture of the strain, such as medium components, oxygen supply conditions, and light irradiation amount, including combinations thereof, can be appropriately adjusted.

[0038] The culture temperature and the pH of the medium may be any temperature and pH as long as the photosynthetic bacterial strain of the present invention grows and produces 5-aminolevulinic acid, but for example, the culture temperature is preferably 10 to 40° C., particularly 20 to 35° C., and the pH of the medium is preferably 3 to 9, particularly 6 to 8. If the pH changes during the production of 5-aminolevulinic acid, it is preferable to adjust the pH using an alkaline solution such as sodium hydroxide, ammonia, or potassium hydroxide, or an acid such as hydrochloric acid, sulfuric acid, or phosphoric acid.

[0039] 5-Aminolevulinic acid produced by the photosynthetic bacterial strain of the present invention through cultivation can be purified by a conventional method, for example, separation and purification can be performed as necessary by a conventional method such as ion exchange, chromatography, or extraction. EXAMPLES

[0040] The present invention will be described in detail below with reference to examples. However, these are given for illustrative purposes only and the present invention is not limited to these examples.

[0041] Materials and Methods 1. Strains, media, cultures, plasmids, and primers Rhodobacter sphaeroides strains were grown in PYS medium (0.3% Bacto peptone, 0.3% Bacto yeast extract, 2 mM CaCl 2 and 2 mM MgSO 4 ) was used as the growth medium and grown aerobically in a shaker at 30 °C. E. coli was grown at 37 °C in Luria-Bertani medium (1% Bacto Tryptone, 0.5% Bacto Yeast Extract, 0.5% NaCl) as the growth medium. The strains, plasmids and primers used in the following examples are shown below.

[0042] E. coli JM109; Yanisch-Perron et al., Gene (1985) vol. 33, pp. 103-119. JM109 λ pir; JM109 lysogenized with λ pir bacteriophage; Penfold and Pemberton, Gene (1992) vol. 118, pp. 145-146. S17-1; F-, thi, pro, hsdR, [RP4-2 Tc::Mu Km::Tn7 (Tp Sm)]; Simon et al., Bio / Technology (1983) vol. 1, pp. 784-791. S17-1; S17-1 lysogenized with λ pir bacteriophage; De Lorenzo, et al., J. Bacteriol. (1990) vol. 172, pp. 6568-6572.

[0043] Photosynthetic bacterium Rhodobacter sphaeroides 2.4.1; Wild strain; Sistrom, J. Gen. Microbiol., (1960) vol. 22, pp. 778-785. WT; rifampicin-resistant strain derived from strain 2.4.1 BA; The rrnB promoter was inserted upstream of the hemA transcription start site BT; The rrnB promoter was inserted upstream of the hemT transcription start site BAT; The rrnB promoter was inserted upstream of both the hemA and hemT transcription start sites 7A inserted; The rsp_7571 promoter was upstream of the hemA start codon 7T; The rsp_7571 promoter was upstream of the hemT start codon 7AT inserted; The rsp_7571 promoter was upstream of both the hemA start codon and hemT start codon The WT, BA, BT, BAT, 7A, 7T, and 7AT strains were newly constructed in the present invention.

[0044] Plasmids pZJD29A; Suicide vector, sacB, Gm r ; Swem et al., EMBO J. (2003) vol. 22, pp. 4699-4708. pZJD29A PrrnB hemA; Sequence to insert PrrnB upstream of the hemA transcription start site on pZJD29A. pZJD29A PrrnB hemT; Sequence to insert PrrnB upstream of the hemT transcription start site on pZJD29A. pZJD29A Prsp_7571 hemA; Sequence to insert Prsp_7571 upstream of the hemA coding sequence on pZJD29A. pZJD29A Prsp_7571 hemT; Sequence to insert Prsp_7571 upstream of the hemT coding sequence on pZJD29A

[0045] Primers (for cloning) MCShemAUP-F; sequence number 6 upstream of hemA transcription start site PrrnBhemAUP-R; SEQ ID NO:7; upstream of hemA transcription start site PrrnBhemADW-F; sequence number 8; downstream of hemA transcription start site MCShemADW-R; SEQ ID NO:9; downstream of hemA transcription start site hemAUPPrrnB-F; SEQ ID NO:10 Promotor of rrnB hemADWPrrnB-R; SEQ ID NO:11; Promotor of rrnB MCShemTUP-F; SEQ ID NO:12; upstream of hemT transcription start site PrrnBhemTUP-R; SEQ ID NO:13; upstream of hemT transcription start site PrrnBhemTDW-F; SEQ ID NO:14; downstream of hemT transcription start site MCShemTDW-R; SEQ ID NO:15; downstream of hemT transcription start site hemTUPPrrnB-F; SEQ ID NO: 16; Promotor of rrnB hemTDWPrrnB-R; SEQ ID NO: 17; Promotor of rrnB MCShemAUP-F2; SEQ ID NO:18; upstream of hemA start codon P7571hemAUP-R; SEQ ID NO:19; upstream of hemA start codon P7571hemADW-F; sequence number 20; downstream of hemA start codon MCShemADW-R2; sequence number 21; downstream of hemA start codon hemAUPP7571-F; SEQ ID NO:22; Promotor of rsp_7571 hemADWP7571-R; SEQ ID NO:23; Promotor of rsp_7571 MCShemTUP-F2; SEQ ID NO:24; upstream of hemT start codon P7571hemTDW-F; SEQ ID NO:25; upstream of hemT start codon P7571hemTUP-R; SEQ ID NO:26; downstream of hemT start codon MCShemTDW-R2; SEQ ID NO:27; downstream of hemT start codon hemTUPP7571-F; SEQ ID NO:28; Promotor of rsp_7571 hemTDWP7571-R; SEQ ID NO:29; Promotor of rsp_7571

[0046] 2. Quantitative Real-time PCR RNA was extracted from logarithmically growing cells using RNeasy Mini Kit (QIAGEN). cDNA was synthesized from RNA by reverse transcription using PrimeScript RT reagent Kit (TaKaRa bio). cDNA was quantified by real-time PCR using TB Green Premix Ex Taq II (TaKaRa bio) with Thermal Cycler Dice Real Time System III (TaKaRa bio). Each cDNA sample was quantified three times as technical replicates. The primer sequences used for amplification are shown below. The cycle threshold (Ct) value of each sample was calculated by the 2nd derivative maximum method. The normalized ΔCt was calculated using the rpoZ gene encoding the ω subunit of RNA polymerase as an endogenous control for each cell. The ΔΔCt of each sample was calculated using the ΔCt of WT cultured under aerobic conditions as a calibrator.

[0047] The primers used for quantitative real-time PCR are shown below. rpoZqRT-F; SEQ ID NO: 30; Gomelsky et al., Microbiology (2003) vol. 149, pp. 377-388. rpoZqRT-R; SEQ ID NO:31; Gomelsky et al., Microbiology (2003) vol. 149, pp. 377-388. hemTqRT-F; SEQ ID NO: 32; newly designed in this application hemTqRT-R; SEQ ID NO: 33; newly designed in this application hemAqRT-F; SEQ ID NO: 34; newly designed in this application hemAqRT-F; SEQ ID NO: 35; newly designed in this application

[0048] 3. Detection of ALAS activity ALAS activity in crude cell extracts was measured according to the method of Yubisui et al. (Arch. Biochem. Biophys., (1972), 150, 77-85.). The culture medium was centrifuged at 8,000 × g for 5 min at 4°C, and the resulting cell pellet was suspended in ice-cold 50 mM Tris-HCl buffer (pH 7.5). The cell suspension was sonicated and centrifuged at 10,000 × g for 5 min at 4°C, and the protein concentration of the resulting supernatant was measured by Bradford protein assay. Enzyme solution (95% cell homogenate supernatant, 20 mM Tris-HCl (pH 7.5), 0.35 mM pyridoxal phosphate) and substrate solution (0.5 M glycine, 1 mM succinyl CoA) were incubated at 37°C for 5 min. The enzyme reaction was started by adding 25% of the volume of the substrate solution to the enzyme solution. After 5 minutes, the reaction was stopped by adding 10% trichloroacetic acid in an amount of 30% by volume relative to the reaction solution and cooling on ice. The concentration of 5-aminolevulinic acid in each reaction solution was measured according to the method of Mauzerall et al. (J. Biol. Chem., (1956), 219, 435.). 5-aminolevulinic acid in each sample was boiled in 2M acetate buffer (pH 4.6) at 100°C for 15 minutes and reacted with 1% acetylacetone. 175% volume of modified Ehrlich reagent (20 g / L p-dimethylaminobenzaldehyde, 12% perchloric acid, 60% glacial acetic acid) was added to the reaction solution, and the pyrrole compound formed was colorimetrically quantified by measuring the absorbance at 553 nm.

[0049] Fermentative production of 4.5-aminolevulinic acid 5-Aminolevulinic acid was produced by strains of Rhodobacter sphaeroides using the method of Nishikawa et al. (J. Biosci. Bioeng., (1999), 87, 798-804.). Each strain was cultured in 120 mL of GGY2 medium (50 mM glucose, 3.8 g / L sodium L-glutamate monohydrate, 2.0 g / L Bacto Yeast Extract, NaH 2 PO 4 12H 2 O 1.13g / L, NaH 2 PO4·2H 2 O 1.07 g / L, (NH 4 ) 2 HPO 4 0.8 g / L, MgSO 4 7H 2 O 0.2 g / L, CaCl 2 2H 2 O 53 mg / L, MnSO 42.4 mL of preculture was added to 1.2 mg / L of 5-aminolevulinic acid, 1.0 mg / L of nicotinic acid, 1.0 mg / L of thiamine hydrochloride, and 0.01 mg / L of biotin, and cultured at 30°C, 170 rpm, and 48 h in the dark under aerobic conditions. Each culture was centrifuged at 5,000 × g for 5 min. A cell pellet (wet weight 1.0 g) was suspended in 20 ml of fresh GGY2 medium containing substrate (60 mM glycine) and metabolic inhibitor (30 mM levulinic acid), and cultured in a test tube at 30°C, 150 rpm, and 48 h in the dark under shaking. Each strain was cultured in three independent test tubes. After 0, 12, 18, 24, 36, 42, and 48 h of culture, the 5-aminolevulinic acid concentration in the culture supernatant was measured in the same manner as described above (detection of ALAS activity).

[0050] Example 1: Construction of self-cloning strains in which the rrnB or rsp_7571 promoter was inserted upstream of the hemA or hemT gene of Rhodobacter sphaeroides (Fig. 1, Fig. 2) (1) To insert the rrnB promoter upstream of the transcription start site of hemA, a suicide vector pZJD29A PrrnB hemA was constructed. 600 bp DNA fragments upstream and downstream of the transcription start site of hemA and the rrnB promoter were PCR amplified and inserted into pZJD29A. Similarly, pZJD29A PrrnB hemT was also constructed. These plasmids were conjugated to R. sphaeroides using E. coli, and single recombinants in which the plasmid was homologously recombined into the genome were obtained using the antibiotic resistance gene on the plasmid as a marker. These strains were selected on sucrose plates to obtain double recombinants in which the plasmid-derived sequence had been removed from the genome by homologous recombination. The genomes of the obtained strains were confirmed to have the promoter inserted. Thus, R. sphaeroides strains in which the rrnB promoter was inserted upstream of hemA, hemT, or both hemA and hemT were constructed. More specifically, the 195 bp upstream of the transcription start site of rrnB was inserted upstream of the transcription start sites of hemA, hemT, or both hemA and hemT (Fig. 2). Here, the strain in which PrrnB was inserted only in hemA was named BA, the strain in which PrrnB was inserted only in hemT was named BT, and the strain in which PrrnB was inserted in both hemA and hemT was named BAT. The transcription initiation sites of rrnB, hemA, and hemT were determined by reference to Dryden et al. (J. Bacteriol., (1993), 175, 6392-6402.) and Neidle et al. (J. Bacteriol., (1993), 175, 2292-2303.). The rrnB promoter (PrrnB) is known as a constitutive promoter that exhibits the highest transcription activity among the promoters of ribosomal RNA operons (rrnA, rrnB, rrnC).

[0051] (2) Self-cloning strains of Rhodobacter sphaeroides carrying the rsp_7571 promoter inserted upstream of the transcription start site of the hemA or hemT gene were constructed as follows. To insert the rsp_7571 promoter upstream of the hemA start codon, pZJD29A Prsp_7571 hemA was constructed. Two 600bp DNA fragments, upstream and downstream of the hemA start codon, and the rsp_7571 promoter were amplified by PCR and inserted into pZJD29A. Similarly, pZJD29A Prsp_7571 hemT was also constructed. These plasmids were used to construct R. sphaeroides strains carrying the rsp_7571 promoter. More specifically, 498 bp upstream of the initiation codon of rsp_7571 was inserted upstream of the initiation codon of hemA and / or hemT (Fig. 2). The strain in which Prsp_7571 was inserted only in hemA was designated 7A, the strain in which Prsp_7571 was inserted only in hemT was designated 7T, and the strain in which Prsp_7571 was inserted in both hemA and hemT was designated 7AT. The promoter of rsp_7571 (Prsp_7571 ) is known to be a highly active constitutive promoter in Rhodobacter sphaeroides strain 2.4.1.

[0052] Example 2 Functional confirmation of the inserted PrrnB and Prsp_7571 promoters To confirm whether the inserted PrrnB promoter was functional, we quantified the mRNA expression of hemA and hemT in WT, BA, BT, and BAT cultured under aerobic and microaerobic conditions (Fig. 3 ). In BA and BAT, where PrrnB was inserted upstream of hemA, the hemA mRNA levels increased 3.5-fold and 2.4-fold, respectively, under aerobic conditions. Under microaerobic conditions, the difference was narrowed because expression of WT hemA was induced, but the hemA expression levels in BA and BAT were still increased 1.3-fold compared to WT (Fig. 3, top). In BT and BAT, where PrrnB was inserted upstream of hemT, the expression levels of hemT increased 24-fold and 41-fold, respectively, under aerobic conditions, and 37-fold and 46-fold, respectively, under microaerobic conditions (Fig. 3, bottom). These results indicate that insertion of PrrnB into the promoter region of the ALAS gene increases its expression. On the other hand, no positive effect was observed due to the insertion of Prsp_7571 into the hemA and hemT promoters: the transcription levels of hemA and hemT did not increase in 7A, 7T, and 7AT compared to those of the WT under aerobic and semi-aerobic conditions (Fig. 3). From the above results, it was confirmed that in the present invention, good results were obtained with the BT or BAT strain, which is a self-cloning strain in which the rrnB promoter is placed upstream of the hemT gene.

[0053] Example 3 Fermentative production of 5-aminolevulinic acid The productivity of 5-aminolevulinic acid of the constructed strains was evaluated using a medium supplemented with glycine, which is a substrate of 5-aminolevulinic acid, and levulinic acid, which is a metabolic inhibitor of 5-aminolevulinic acid. After the cells were transferred to the production medium, an increase (around 20 hours) and a decrease (after 20 hours) in the amount of 5-aminolevulinic acid accumulated were observed in the BT and WT cultures (Fig. 4). In particular, the maximum 5-aminolevulinic acid concentration in the BT culture was 9.2 mM, about 12 times that of the WT (0.78 mM). In the cultures of the other strains, BA, and BAT, 5-aminolevulinic acid accumulated at a lower level than that of the WT (Fig. 4).

Claims

1. A photosynthetic bacterial strain belonging to the class α-proteobacteria having an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of a gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, wherein the expression control region is derived from the same species of photosynthetic bacteria as the strain and induces expression of hemT, such induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain.

2. A method for producing 5-aminolevulinic acid, comprising culturing the strain according to claim 1 in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and collecting 5-aminolevulinic acid from the culture.

3. A method for producing a photosynthetic bacterial strain belonging to the class α-proteobacteria, which has an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of a gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, said expression control region being derived from the same species of photosynthetic bacteria as said strain and inducing expression of hemT, said induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain, said method for producing said strain, characterized in that it comprises a step of functionally linking PrrnB to hemT.

Images