CNS DELIVERY OF mRNA AND METHODS OF USING THE SAME

Abstract

To provide methods and compositions for efficient delivery of messenger RNA (mRNA) to the central nervous system (CNS).SOLUTION: In particular, the present invention provides methods and compositions for administering intrathecally to a subject in need of delivery a composition comprising an mRNA encoding a protein, encapsulated within a liposome, such that the administration of the composition results in intracellular delivery of mRNA in neurons in the brain and / or spinal cord. The present invention is particularly useful for treatment of CNS diseases, disorders or abnormalities, such as spinal muscular atrophy.SELECTED DRAWING: None

Description

[Technical field]

[0001] (Related Applications) This application claims priority to US 62 / 020,161 (filed July 2, 2014) and US 61 / 894,246 (filed October 22, 2013), the disclosures of which are incorporated by reference. Sequence Listing

[0002] This specification references a Sequence Listing (filed electronically in a .txt file named "2006685-0690_SL.txt" on October 22, 2014). This .txt file was created on October 22, 2014 and has a size of 19,590 bytes. The entire contents of this Sequence Listing are incorporated by reference. [Background technology]

[0003] Effective therapies are further needed for the treatment of CNS disorders, such as disorders that arise directly or indirectly as a result of defects, abnormal expression or dysregulation of proteins in neuronal cells. There are many obstacles to implementing effective therapies for CNS disorders, primarily due to the separation and segregation of the biological tissues of the CNS by the impermeable blood-brain barrier (BBB).

[0004] For example, spinal muscular atrophy is a CNS disease caused by a protein deficiency. Generally, healthy individuals have a functional copy of each of the survival motor neuron (SMN) genes, (SMN-1 and SMN-2), which are nearly identical in sequence. Patients diagnosed with spinal muscular atrophy are generally unable to express the full-length SMN-1 protein, and rely only on low expression of the full-length SMN-2 protein, which is not sufficient to prevent the death of motor neurons in the brain. In recent years, messenger RNA (mRNA) therapy has become an increasingly important option in the treatment of various diseases, especially those related to one or more protein deficiencies.While showing promise in non-neurological diseases, those skilled in the art have been deterred from implementing such methods to treat CNS diseases due to the inability of liposomes to cross the BBB and the unique and complex membrane composition of neuronal cells, which imposes unique challenges for delivering mRNA into neuronal cells (Svennerhol et.al., Biochimica et Biophysica Acta, 1992,1128:1-7, and Karthigasan et.al., Journal of Neurochemistry, 1994,62:1203-1213). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Svennerhol et.al., Biochimica et Biophysica Acta, 1992, 1128:1-7 [Non-Patent Document 2] Karthigasan et.al.,Journal of Neurochemistry,1994,62:1203-1213 Summary of the Invention [Means for solving the problem]

[0006] The present invention provides, inter alia, improved methods and compositions for the efficient delivery of mRNA encoding therapeutic proteins to neurons and other cell types of the CNS. The invention relates, in part, to the delivery of lipid or polymer-based nanoparticles loaded with mRNA directly to the CNS pleura. This invention is based on the surprising discovery that a neuronal cell membrane can be administered to the interstitial space (e.g., by intraspinal administration) and effectively cross the neuronal cell membrane, resulting in intracellular delivery of mRNA in neurons in the brain and / or spinal cord. Prior to the present invention, it was reported that neuronal cell membranes are characterized by a unique and complex lipid composition that differs from that of non-neuronal cells (Svennerhol et.al., Biochimica et Biophysica Acta, 1992, 1128:1-7, and Karthigasan et.al., Journal of Neurochemistry, 1994, 62:1203-1213). Thus, neuronal membranes were thought to be difficult to penetrate. Even liposomes that are effective in delivering nucleic acids to non-neuronal cells were not expected to be effective for penetrating neuronal membranes. It was truly surprising that the lipid or polymer-based nanoparticles described herein could effectively deliver mRNA to neurons, even though they are located deep in the central part of the brain and spinal column and difficult to reach motor neurons. Thus, the present invention provides an improved and effective method for CNS delivery of mRNA, and is expected to be an effective mRNA therapy for treating various CNS diseases.

[0007] Thus, in one aspect, the invention provides a method of delivering mRNA to the central nervous system (CNS). In some embodiments, the method according to the invention comprises intrathecal administration to a subject in need of a composition comprising a protein-encoding mRNA encapsulated in a liposome, such that administration of the composition results in intracellular delivery of the mRNA in neurons in the brain and / or spinal cord, where the liposome comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0008] In some embodiments, the mRNA is delivered to neurons located in the brain. In some embodiments, the mRNA is delivered to neurons located in the spinal cord. In some embodiments, the mRNA is delivered to motor neurons. In some embodiments, the mRNA is delivered to upper motor neurons and / or lower motor neurons. In some embodiments, the motor neurons are located in the anterior horn and / or dorsal root ganglion of the spinal cord.

[0009] In some embodiments, suitable liposomes comprise one or more cationic lipids, one or more neutral lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

[0010] In some embodiments, suitable cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003. In some specific embodiments, the one or more cationic lipids comprise C12-200. In some specific embodiments, the cationic lipid comprises DLinK22DMA.

[0011] In certain embodiments, cationic lipids suitable for the present invention have the structure of formula I-c1-a: [ka] or a pharma- ceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is an alkyl group of the formula each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group of the formula And each R L is independently C 8-12 is an alkyl group.

[0012] In certain embodiments, a suitable cationic lipid is cKK-E12: [ka] It is.

[0013] In some embodiments, suitable non-cationic lipids are distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine-4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomer phosphatidylethanolamine (OM ... The lipid is selected from 16-O-dimethyl polyethylene, 16-O-trans polyethylene, 18-1-trans polyethylene, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), phosphatidyl lipid, or a mixture thereof.

[0014] In some embodiments, a suitable non-cationic lipid is a phosphatidyl lipid. In some embodiments, a suitable phosphatidyl lipid is a sphingolipid. In some particular embodiments, a suitable sphingolipid is sphingomyelin.

[0015] In some embodiments, the one or more cholesterol-based lipids suitable for the present invention are selected from cholesterol, pegylated cholesterol, and / or DC-Chol (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine.

[0016] In some embodiments, the PEG-modified lipid or lipids suitable for the present invention are selected from the group consisting of C6-C 20 In some embodiments, a suitable PEG-modified lipid comprises a poly(ethylene) glycol chain of 5 kDa or greater in length covalently attached to a lipid having an alkyl chain of 1 kDa or greater in length. In some embodiments, the ceramide is a derivatized ceramide such as glycerol (methacrylamide glycol)-2000. In some embodiments, the preferred PEG-modified lipid or PEGylated lipid is PEGylated cholesterol or dimyristoylglycerol (DMG)-PEG-2K. In some embodiments, the one or more PEG-modified lipids are selected from the group consisting of DMG-PEG, C8-PEG, DOG PEG, ceramide PEG, DSPE-PEG, and mixtures thereof. In some embodiments, the one or more PEG-modified lipids comprise about 1-10% (e.g., about 1-8%, about 1-6%, or about 1-5%) by molar ratio of the total lipid composition. In some embodiments, the one or more PEG-modified lipids comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% by molar ratio of the total lipid composition. In some particular embodiments, the PEG-modified lipid comprises at least 5% by molar ratio of the total lipid composition.

[0017] In some embodiments, suitable liposomes comprise a mixture selected from C12-200, sphingomyelin, DOPE, cholesterol, and DMG PEG; C12-200, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K, or DODMA, DOPE, cholesterol, and DMG-PEG2K; DODMA, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K, and / or mixtures thereof.

[0018] In some embodiments, suitable liposomes include commercially available enhancers. In some embodiments, the liposomes include biodegradable lipids. In some embodiments, the liposomes include ionic lipids. In some embodiments, the liposomes include cleavable lipids.

[0019] In some embodiments, suitable liposomes have a size of about 250 nm, 200 nm, 150 nm, 125 nm, 110 nm, 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, or 50 nm or less. In some embodiments, suitable liposomes have a size in the range of about 40 to 100 nm (e.g., about 40 to 90 nm, about 40 to 80 nm, about 40 to 70 nm, or about 40 to 60 nm). As used herein, the size of a liposome is determined by the length of the largest diameter of the liposome particle.

[0020] In some embodiments, the mRNA has a length greater than about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb.

[0021] In some embodiments, the therapeutic protein encoded by the mRNA is a cytosolic protein. In some embodiments, the therapeutic protein encoded by the mRNA is a secreted protein. In some embodiments, the therapeutic protein encoded by the mRNA is an enzyme. In some embodiments, the enzyme is a lysosomal enzyme. In some embodiments, the therapeutic protein encoded by the mRNA is a protein associated with a CNS disease. In some embodiments, the therapeutic protein encoded by the mRNA functions in neurons normally in the brain and / or spinal cord. In some embodiments, the therapeutic protein encoded by the mRNA functions in motor neurons normally in the spinal cord.

[0022] In some embodiments, the therapeutic protein encoded by the mRNA is survival motor neuron protein. In some embodiments, the therapeutic protein encoded by the mRNA is survival motor neuron-1 protein. In some embodiments, the therapeutic protein encoded by the mRNA is a splice isoform, fragment, or truncated variant of survival motor neuron protein-1. In some embodiments, the SMN-1 protein comprises the amino acid sequence of SEQ ID NO:2. In some embodiments, the mRNA encoding the SMN-1 protein comprises the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the mRNA encoding the SMN-1 protein is codon optimized and comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:11.

[0023] In some embodiments, a suitable mRNA of the present invention comprises a 5'UTR sequence. In some embodiments, the 5'UTR sequence comprises SEQ ID NO:7. In some embodiments, the mRNA comprises a 3'UTR. In some embodiments, the 3'UTR comprises SEQ ID NO:8 or SEQ ID NO:9. In some embodiments, the mRNA comprises a cap structure. In some embodiments, a suitable cap structure is selected from a cap 0, cap 1, or cap 2 structure. In some embodiments, a suitable cap structure is an anti-reverse cap analog (ARCA) or a modified ARCA.

[0024] In some embodiments, the mRNA encoding a therapeutic protein comprises one or more modified nucleotides, in some embodiments, the one or more nucleotides are selected from the group consisting of pseudouridine, 2-aminoadenosine, 2-thiouridine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, N-1-methylpseudouridine, 2-thiocytidine, and mixtures thereof.

[0025] In some embodiments, the mRNA encoding the therapeutic protein is unmodified.

[0026] In some embodiments, intracellular delivery of the mRNA results in expression of the protein encoded by the mRNA. In some embodiments, the encoded protein is expressed in the cytosol of the neuron. In some embodiments, the encoded protein is expressed and secreted extracellularly from the neuron after expression.

[0027] In some embodiments, the mRNA is administered at a dose in the range of about 0.01 to 10.0 mg per kg of body weight, for example, about 0.01 to 9.0 mg, 0.01 to 8.0 mg, 0.01 to 7.0 mg, 0.01 to 6.0 mg, 0.01 to 5.0 mg, 0.01 to 4.0 mg, 0.01 to 3.0 mg, 0.01 to 2.5 mg, 0.01 to 2.0 mg, 0.01 to 1.5 mg, 0.01 to 1.0 mg, 0.01-0.5 mg, 0.01-0.25 mg, 0.01 to 0.1 mg, 0.1 to 10.0 mg, 0.1 to 5.0 mg, 0.1 to 4.0 mg, 0.1 to 3.0 mg, 0.1 to 2.0 mg, 0.1 to 1.0 mg, or 0.1 to 0.5 mg per kg of body weight. In some embodiments, the mRNA is administered at a dose of less than about 10.0 mg, 9.0 mg, 8.0 mg, 7.0 mg, 6.0 mg, 5.0 mg, 4.5 mg, 4.0 mg, 3.5 mg, 3.0 mg, 2.5 mg, 2.0 mg, 1.5 mg, 1.0 mg, 0.8 mg, 0.6 mg, 0.5 mg, 0.4 mg, 0.3 mg, 0.2 mg, 0.1 mg, 0.05 mg, 0.04 mg, 0.03 mg, 0.02 mg, or 0.01 mg per kg of body weight.

[0028] In some embodiments, the mRNA is delivered without eliciting substantial toxicity or an immune response.

[0029] In another aspect, methods are provided for treating a disease, disorder, or condition related to a deficiency of a protein in the central nervous system (CNS) by delivering messenger RNA (mRNA) encoding the missing protein to the CNS using the methods described herein. In some embodiments, the CNS disease, disorder, or condition is the result of a deficiency of a protein. In some embodiments, the CNS disease, disorder, or condition is the result of a deficiency of a protein in a motor neuron.

[0030] In particular, the present invention provides methods and compositions for treating spinal muscular atrophy.

[0031] In one embodiment, the invention provides a method of treating spinal muscular atrophy by delivering messenger RNA (mRNA) encoding survival motor neuron (SMN) protein to the CNS using the methods described herein.

[0032] In another aspect, the present invention provides a composition for treating spinal muscular atrophy, comprising an mRNA encoding survival motor neuron (SMN) protein encapsulated in a liposome, wherein the mRNA comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:11 (corresponding to codon-optimized human SMN mRNA), and further wherein the liposome comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0033] In a related aspect, the present invention provides a composition for treating spinal muscular atrophy, comprising mRNA encoding survival motor neuron (SMN) protein encapsulated in a liposome, wherein the liposome comprises a cationic lipid of formula I-c1-a: [ka] or a pharma- ceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is an alkyl group of the formula each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group of the formula And each R L is independently C 8-12 is an alkyl group.

[0034] In some embodiments, a suitable cationic lipid is cKK-E12: [ka] It is.

[0035] In some embodiments, the present invention provides a composition for treating spinal muscular atrophy, comprising mRNA encoding survival motor neuron (SMN) protein encapsulated in a liposome, wherein the liposome comprises: C12-200, sphingomyelin, DOPE, cholesterol, and DMGPEG; C12-200, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; DODMA, DOPE, cholesterol, and DMG-PEG2K; or The mixture includes a mixture selected from DODMA, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K.

[0036] Other features, objects, and advantages of the present invention will become apparent from the following detailed description, drawings, and claims. It should be understood, however, that the detailed description, drawings, and claims, while indicating embodiments of the present invention, are given by way of illustration only and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art. In an embodiment of the present invention, for example, the following items are provided: (Item 1) 1. A method for delivering messenger RNA (mRNA) to the central nervous system (CNS), comprising: administering intrathecally to a subject in need thereof a composition comprising an mRNA encoding a protein encapsulated in a liposome, such that administration of the composition results in intracellular delivery of the mRNA in neurons in the brain and / or spinal cord; A method wherein the liposome comprises a cationic or non-cationic lipid, a cholesterol-based lipid and a PEG-modified lipid. (Item 2) 2. The method of claim 1, wherein the neurons in the brain and / or spinal cord comprise motor neurons in the spinal cord. (Item 3) 2. The method of claim 1, wherein the neurons in the brain and / or spinal cord are selected from the group consisting of oligodendrocytes, oligodendroglial cells, astrocytes, glial cells, and combinations thereof. (Item 4) 3. The method of claim 1 or 2, wherein the neurons in the brain and / or spinal cord comprise spinal cord anterior horn cells and dorsal root ganglia. (Item 5) The method of any one of the preceding items, wherein the liposome comprises one or more cationic lipids, one or more neutral lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. (Item 6) 6. The method of claim 5, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof. (Item 7) The method according to claim 6, wherein the one or more cationic lipids include C12-200. 7. The method of claim 6, wherein the one or more cationic lipids comprise DLinkC2DMA. (Item 9) The cationic lipid is cKK-E12: [ka] 7. The method according to item 6, wherein (Item 10) The one or more non-cationic lipids may be selected from the group consisting of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphatidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), amine), DMPE (1,2-dimyristoyl-sn-glycero-3-ethanolamine phosphate), DOPG (,2-dioleoyl-sn-glycero-3-phosphate-(1'-rac-glycerol)), sphingomyelin, ceramide, cephalin, cerebroside, diacylglycerol, POPC, DOPG, DPPG, POPC, POPE, DSPE, SOPE, sphingomyelin. (Item 11) 11. The method of claim 10, wherein the one or more non-cationic lipids comprise sphingomyelin. (Item 12) The method of any one of the preceding items, wherein the one or more PEG-modified lipids are selected from the group consisting of DMG-PEG, C8-PEG, DOG PEG, ceramide PEG, DSPE-PEG, and combinations thereof. (Item 13) Item 13. The method according to item 12, wherein the one or more PEG-modified lipids constitute about 1 to 10% by molar ratio in the total lipid composition. (Item 14) 13. The method of claim 12, wherein the one or more PEG-modified lipids constitute about 5% by molar ratio in the total lipid composition. (Item 15) 13. The method of any one of the preceding items, wherein the one or more cholesterol-based lipids are selected from cholesterol, or PEGylated cholesterol. (Item 16) The liposome is C12-200, sphingomyelin, DOPE, cholesterol, and DMGPEG; C12-200, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; DODMA, DOPE, cholesterol, and DMG-PEG2K; or DODMA, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K, The method of any one of the preceding items, including a combination selected from: (Item 17) 13. The method of any one of the preceding items, wherein the liposomes have a size in the range of about 40 to 100 nm. (Item 18) 10. The method of any one of the preceding items, wherein the mRNA has a length of about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb or more. (Item 19) The method of any one of the preceding items, wherein the protein encoded by the mRNA normally functions in the neuron in the brain and / or spinal cord. (Item 20) 13. The method of any one of the preceding items, wherein the protein encoded by the mRNA normally functions in a motor neuron in the spinal cord. (Item 21) 11. The method of any one of the preceding items, wherein the protein encoded by the mRNA is survival motor neuron (SMN) protein. (Item 22) 13. The method of any one of the preceding items, wherein the mRNA is codon optimized. (Item 23) 23. The method of claim 22, wherein the codon-optimized mRNA comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:11. (Item 24) 23. The method of claim 22, wherein the codon-optimized mRNA comprises SEQ ID NO: 3 or SEQ ID NO: 4. (Item 25) 25. The method of claim 24, wherein the mRNA comprises the 5'UTR sequence of SEQ ID NO:7. (Item 26) 25. The method of claim 24, wherein the mRNA comprises the 3'UTR sequence of SEQ ID NO:8 or SEQ ID NO:9. (Item 27) 2. The method of any one of the preceding items, wherein the mRNA comprises a cap structure. (Item 28) 28. The method of claim 27, wherein the cap structure is selected from a cap0, cap1, or cap2 structure. (Item 29) 28. The method of claim 27, wherein the cap structure is an anti-reverse cap analog (ARCA) or a modified ARCA. (Item 30) 21. The method according to any one of items 1 to 20, wherein the protein encoded by the mRNA is an enzyme. (Item 31) 31. The method of claim 30, wherein the enzyme is a lysosomal enzyme. (Item 32) 13. The method of any one of the preceding items, wherein intracellular delivery of the mRNA results in intracellular expression of the protein encoded by the mRNA in the cytosol of the neuron. (Item 33) 13. The method of any one of the preceding items, wherein intracellular delivery of the mRNA results in intracellular expression of the protein encoded by the mRNA and, following expression, extracellular secretion from the neuron. (Item 34) 13. The method of any one of the preceding items, wherein the mRNA comprises one or more modified nucleotides. (Item 35) 35. The method of claim 34, wherein the one or more modified nucleotides comprise pseudouridine, 2-aminoadenosine, 2-thiouridine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, N-1-methylpseudouridine, and / or 2-thiocytidine. (Item 36) 34. The method according to any one of items 1 to 33, wherein the mRNA is unmodified. (Item 37) 13. The method of any one of the preceding items, wherein the mRNA is delivered in an amount ranging from about 0.01 mg to about 10 mg per kg of body weight. (Item 38) The method of any one of the preceding items, wherein the mRNA is delivered without eliciting substantial toxicity or immune response. (Item 39) 13. The method of any one of the preceding items, wherein the subject is deficient in the protein encoded by the mRNA in the CNS. (Item 40) A method for treating a disease, disorder, or abnormality in the central nervous system (CNS) associated with a deficiency of a protein, comprising delivering messenger RNA (mRNA) encoding the deficient protein to the CNS using a method according to any one of the preceding items. (Item 41) 1. A method of treating spinal muscular atrophy, comprising: administering intrathecally to a subject in need of treatment a composition comprising mRNA encoding a survival motor neuron (SMN) protein encapsulated in a liposome, such that administration of the composition results in intracellular delivery of the mRNA in neurons in the brain and / or spinal cord; A method wherein the liposome comprises a cationic or non-cationic lipid, a cholesterol-based lipid and a PEG-modified lipid. (Item 42) 42. The method of claim 41, wherein the neurons in the brain and / or spinal cord comprise motor neurons in the spinal cord. (Item 43) 43. The method of claim 41 or 42, wherein the neurons in the brain and / or spinal cord comprise spinal anterior horn cells and dorsal root ganglia. (Item 44) 44. The method according to any one of items 41 to 43, wherein the codon-optimized mRNA comprises SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO: 11. (Item 45) 44. The method according to any one of items 41 to 43, wherein the codon-optimized mRNA comprises SEQ ID NO: 3 or SEQ ID NO: 4. (Item 46) 46. ​​The method of claim 45, wherein the mRNA comprises the 5'UTR sequence of SEQ ID NO:7. (Item 47) 46. ​​The method of claim 45, wherein the mRNA comprises the 3'UTR sequence of SEQ ID NO:8 or SEQ ID NO:9. (Item 48) 48. The method according to any one of items 41 to 47, wherein the one or more non-cationic lipids comprise sphingomyelin. (Item 49) The liposome is C12-200, sphingomyelin, DOPE, cholesterol, and DMG PEG; C12-200, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; DODMA, DOPE, cholesterol, and DMG-PEG2K; or DODMA, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K, 49. The method according to any one of items 41 to 48, comprising a combination selected from the following: (Item 50) A composition for the treatment of spinal muscular atrophy, comprising: an mRNA encoding said survival motor neuron (SMN) protein encapsulated within a liposome, wherein said codon-optimized mRNA comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:11; Further, the composition wherein the liposome comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid. (Item 51) A composition for the treatment of spinal muscular atrophy, comprising: A composition comprising an mRNA encoding said survival motor neuron (SMN) protein encapsulated within a liposome, wherein said liposome comprises a cationic lipid of formula I-c1-a, [ka] or a pharma- ceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is an alkyl group of the formula each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group of the formula and each R L is independently C 8-12 is an alkyl group. (Item 52) The cationic lipid is cKK-E12: [ka] Item 45. The method according to item 44, wherein (Item 53) A composition for treating spinal muscular atrophy, comprising: and an mRNA encoding said survival motor neuron (SMN) protein encapsulated within a liposome, wherein said liposome comprises: C12-200, sphingomyelin, DOPE, cholesterol, and DMG PEG; C12-200, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PE G2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; DODMA, DOPE, cholesterol, and DMG-PEG2K; or DODMA, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K, A composition comprising a combination selected from: [Brief description of the drawings]

[0037] The drawings are only illustrative and are not limiting of the invention.

[0038] [Figure 1] Figure 1 shows detection of human SMN-1 protein from exogenous hSMN-1 mRNA transfected into BHK-21 cells by Western blot using various antibodies specific for human SMN: (A) anti-SMN 4F11 antibody at 1:1,000 dilution, (B) Pierce PA5-27309 a-SMN antibody at 1:10,000 dilution, and (C) LSBio C138149 a-SMN antibody at 1:10,000 dilution. [Figure 2A] Figures 2A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 1. [Figure 2B] Figures 2A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 1. [Figure 2C]Figures 2A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 1. [Figure 3A] Figures 3A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 2. [Figure 3B] Figures 3A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 2. [Figure 3C] Figures 3A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 2. [Figure 4A] Figures 4A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 3. [Figure 4B] Figures 4A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 3. [Figure 4C] Figures 4A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 3. [Figure 5A]5A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 4. [Figure 5B] 5A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 4. [Figure 5C] 5A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 4. [Figure 6A] 6A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 5. [Figure 6B] 6A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 5. [Figure 6C] 6A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 5. [Figure 7A] 7A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 6. [Figure 7B]7A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 6. [Figure 7C] 7A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 6. [Figure 8A] 8A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 7. [Figure 8B] 8A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 7. [Figure 8C] 8A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery with liposomal formulation 7. [Figure 9A] 9A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 8. [Figure 9B] 9A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 8. [Figure 9C]9A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 8. [Figure 10A] 10A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 9. [Figure 10B] 10A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 9. [Figure 10C] 10A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 9. [Figure 11A] 11A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 10. [Figure 11B] 11A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 10. [Figure 11C] 11A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 10. [Figure 12A]12A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 11. [Figure 12B] 12A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 11. [Figure 12C] 12A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 11. [Figure 13A] 13A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 12. [Figure 13B] 13A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 12. [Figure 13C] 13A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 12. [Figure 14A] 14A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 13. [Figure 14B]14A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 13. [Figure 14C] 14A-C show multiplexed nucleic acid in situ detection of human survival motor neuron (hSMN-1) mRNA in (A) cervical, (B) thoracic, and (C) lumbar spinal cord tissues 24 hours after intrathecal delivery using liposomal formulation 13. [Figure 15] Figure 15 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery of vehicle control. Images are shown at 5x magnification. [Figure 16] Figure 16 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery of vehicle control. Images are shown at 10x magnification. [Figure 17] FIG. 17 shows in situ detection of UbC mRNA in spinal cord tissue 24 hours after vehicle control intrathecal delivery. [Figure 18] Figure 18 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery of vehicle control. Images are shown at 5x magnification. [Figure 19] Figure 19 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery. Images are shown at 5x magnification. [Figure 20] Figure 20 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery. Images are shown at 10x magnification. [Figure 21] Figure 21 shows in situ detection of human survival motor neuron (hSMN-1) mRNA in spinal cord tissue 24 hours after intrathecal delivery. Images are shown at 10x and 20x magnification. [Figure 22]Figure 22 shows positive detection of human SMN-1 protein produced in the spinal cord of rats 24 hours after intraspinal administration of lipid nanoparticles loaded with human SMN-1 mRNA. Anti-human SMN 4F11 antibody was used at a dilution of 1:2500. Panel A represents spinal cord tissue from a treated rat, and panel B represents spinal cord tissue from an untreated rat. [Figure 23A] Figures 23A-C show in situ detection of human survival motor neuron (hSMN-1) mRNA in brain tissue 30 minutes after intrathecal delivery. In situ detection in brain (A) shows strong signal observed in both grey and white matter of the brain. Two regions of brain (B) section 1 and brain (C) section 2 have been enlarged for more detailed analysis. [Figure 23B] Figures 23A-C show in situ detection of human survival motor neuron (hSMN-1) mRNA in brain tissue 30 minutes after intrathecal delivery. In situ detection in brain (A) shows strong signal observed in both grey and white matter of the brain. Two regions of brain (B) section 1 and brain (C) section 2 have been enlarged for more detailed analysis. [Figure 23C] Figures 23A-C show in situ detection of human survival motor neuron (hSMN-1) mRNA in brain tissue 30 minutes after intrathecal delivery. In situ detection in brain (A) shows strong signal observed in both grey and white matter of the brain. Two regions of brain (B) section 1 and brain (C) section 2 have been enlarged for more detailed analysis. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions for the following terms, as well as other terms, are set forth throughout the specification.

[0040] "Alkyl" As used herein, the term "alkyl" refers to a straight chain radical or a branched saturated hydrocarbon radical having 1 to 15 carbon atoms ("C1-15 In some embodiments, an alkyl group refers to a group having 1 to 3 carbon atoms ("C 1-3 C 1-3 Examples of alkyl groups include methyl (C1), ethyl (C2), n-propyl (C3), and isopropyl (C3). In some embodiments, the alkyl group is a group having 8 to 12 carbon atoms ("C 8-12 C 8-12 Examples of alkyl groups include n-octyl (C8), n-nonyl (C9), n-decyl (C 10 ), n-undecyl (C 11 ), n-dodecyl (C 12 The prefix "n-" (normal) refers to an unbranched alkyl group. For example, n-C8 alkyl refers to (CH2)7CH3, and nC 10 Alkyl refers to (CH2)9CH3 and the like.

[0041] "Approximately" or "about" As used herein, the term "approximately" or "about" when applied to one or more applicable values, refers to a value similar to a stated reference value. In one embodiment, the term "approximately" or "about" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value, unless otherwise stated or apparent from the context (unless such number exceeds 100% of the possible values).

[0042] "Amelioration" As used herein, the term "amelioration" refers to the prevention, reduction or alleviation of a condition, or improvement of the condition of a subject. Amelioration includes, but does not require, complete recovery or prevention of a disease condition. In some embodiments, amelioration includes increasing the level of an associated protein or its activity that is lacking in the associated disease tissue.

[0043] "Amino Acid" As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance capable of being incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure H2N-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid, in some embodiments, an amino acid is a d-amino acid, and in some embodiments, an amino acid is an l-amino acid. "Standard amino acid" refers to any of the 20 standard l-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than the standard amino acids, whether it is synthesized or obtained from natural sources. As used herein, "synthetic amino acid" encompasses chemically modified amino acids, including, but not limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including the carboxy- and / or amino-terminal amino acids of a peptide, may be modified by methylation, amidation, acetylation, protecting groups, and / or substitutions with other chemical groups that can alter the half-life of the peptide without adversely affecting their activity. An amino acid may participate in a disulfide bond. An amino acid may include one or post-translational modifications, such as association with one or more chemicals (e.g., a methyl group, an acetate group, an acetyl group, a phosphate group, a formyl moiety, an isoprenoid group, a sulfate group, a polyethylene glycol moiety, a lipid moiety, a carbohydrate moiety, a biotin moiety, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and may refer to a free amino acid and / or an amino acid residue of a peptide. Whether a free amino acid or a residue of a peptide is indicated will be clear from the context in which the term is used.

[0044] "Animal" As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human, at any stage of development. In some embodiments, "animal" refers to a non-human animal, at any stage of development. In certain embodiments, the non-human animal is a mammal, such as a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig. In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, worms, and / or worms. In some embodiments, animals may be transgenic animals, transgenic animals, and / or clones.

[0045] "Biologically active" As used herein, the phrase "biologically active" refers to the characteristic of any agent that has activity in a biological system, particularly in an organism. For example, an agent that has a biological effect on an organism when administered to the organism is considered to be biologically active. In certain embodiments where a protein or polypeptide is biologically active, a portion of the protein or polypeptide that shares at least one biological activity of the protein or polypeptide is generally referred to as a "biologically active" portion.

[0046] "Delivery" The term "delivery", when used in the context of CNS delivery, encompasses intracellular delivery of mRNA in a neuron where the encoded protein is expressed and retained in the neuron, and intracellular delivery of mRNA in a neuron where the encoded protein is expressed and secreted, such as into the CSF, for provision by other neurons.

[0047] "Expression" As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (such as splicing, editing, 5' capping, and / or 3' capping), (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein. In this application, the terms "expression" and "production" and grammatical equivalents are used interchangeably.

[0048] "Fragment" As used herein, the term "fragment" refers to a polypeptide and is defined as any separate portion of a particular polypeptide that is unique or characteristic of that polypeptide. As used herein, the term also refers to any separate portion of a particular polypeptide that retains at least a portion of the activity of the full-length polypeptide. Preferably, the retained active portion is at least 10% of the activity of the full-length polypeptide. More preferably, the retained active portion is at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the full-length polypeptide. Even more preferably, the retained active portion is at least 95%, 96%, 97%, 98% or 99% of the activity of the full-length polypeptide. Most preferably, the retained active portion is 100% of the activity of the full-length polypeptide. As used herein, the term refers to any portion of a particular polypeptide that includes at least the established sequence elements found in the full-length polypeptide. Preferably, the sequence element spans at least 4-5, more preferably at least about 10, 15, 20, 25, 30, 35, 40, 45, 50 or more amino acids of the full length polypeptide.

[0049] "Functional" As used herein, a "functional" biomolecule is a biomolecule in a form that exhibits a property and / or activity by which it is characterized.

[0050] "Half-life" As used herein, the term "half-life" refers to the time required for a quantity, such as concentration or activity, of a nucleic acid or protein to fall to half of its initially measured value over a period of time.

[0051] "Improve," "Increase," or "Decrease" As used herein, the terms "improve," "increase," or "decrease," or grammatical equivalents, refer to a value as compared to a baseline measurement, e.g., a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject afflicted with the same form of disease as the subject being treated and of approximately the same age as the subject being treated.

[0052] "In Vitro" As used herein, the term "in vitro" refers to phenomena that occur in an artificial environment, such as in a test tube, or in a reactor, in cell culture, etc., rather than in a multicellular organism.

[0053] "In Vivo" As used herein, the term "in vivo" refers to events that occur in multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term may also be used to refer to events that occur within living cells (e.g., as opposed to in vitro systems).

[0054] "Intrathecal Administration" As used herein, the term "intracerecal administration" or "intracerecal injection" refers to an injection into the spinal canal (the intrathecal space surrounding the spinal cord). A variety of techniques may be used, including, but not limited to, lateral ventricular injection, such as through a burr hole, cisterna magna, or lumbar puncture. In some embodiments, "intracerecal administration" or "intracerecal delivery" according to the present invention is used. " refers to IT administration or delivery via the lumbar region or area, i.e., lumbar IT administration or delivery. As used herein, the term "lumbar region" or "lumbar area" refers to the area between the third and fourth lumbar vertebrae (lower back), more generally, the L2-S1 region of the spine.

[0055] "Lower Motor Neuron" As used herein, the term "lower motor neuron" refers to the motor neuron that connects the brainstem and spinal cord to muscle fibers. In other words, lower motor neurons carry nerve impulses from upper motor neurons to muscles. Generally, the axons of lower motor neurons terminate at the effector (muscle). Lower motor neurons include "spinal cord neurons" and "ventral horn cells of the spinal cord."

[0056] "Lysosomal Enzymes" As used herein, the term "lysosomal enzymes" refers to any enzyme that can reduce stored material in mammalian lysosomes or rescue or ameliorate the symptoms of one or more lysosomal storage diseases. Lysosomal enzymes suitable for the present invention include both wild-type or modified lysosomal enzymes and can be produced using recombinant and synthetic methods or purified from natural sources. Examples of lysosomal enzymes are listed in Table 2.

[0057] "Lysosomal Enzyme Deficiency" As used herein, "lysosomal enzyme deficiency" refers to a group of genetic disorders resulting from a deficiency in at least one of the enzymes required to break down macromolecules (e.g., enzyme substrates) into peptides, amino acids, monosaccharides, nucleic acids, and fatty acids in the lysosomes. As a result, individuals suffering from lysosomal enzyme deficiency accumulate substances in various biological tissues (e.g., CNS, liver, spleen, intestine, blood vessel walls, and other organs).

[0058] "Lysosomal storage disease" As used herein, the term "lysosomal storage disease" refers to any disease resulting from a deficiency of one or more lysosomal enzymes required to metabolize natural macromolecules. Generally, these diseases result in the accumulation of undegraded molecules in the lysosomes, leading to an increase in the number of storage granules (also called storage vesicles). These diseases and various examples are described in detail below.

[0059] "Messenger RNA (mRNA)" As used herein, "messenger RNA (mRNA)" refers to a polynucleotide that is encoded by at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA can include one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, or chemically synthesized. Optionally, for example, in the case of chemically synthesized molecules, mRNA can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in a 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is designed to contain natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine), nucleoside analogs (2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C 5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intervening bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., For example, phosphorothioate and 5'-N-phosphoramidite linkages.

[0060] "Nucleic Acid" As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to an individual nucleic acid residue (e.g., a nucleotide and / or a nucleoside). In some embodiments, "nucleic acid" refers to a polynucleotide chain that includes an individual nucleic acid residue. In some embodiments, "nucleic acid" encompasses RNA, as well as single-stranded and / or double-stranded DNA, and / or cDNA.

[0061] "Patient" As used herein, the term "patient" or "subject" refers to any organism to which provided compositions may be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Exemplary patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Human includes pre- and post-natal forms.

[0062] "Pharmaceutically acceptable" As used herein, the term "pharmacologically acceptable" refers to a substance which, within the scope of sound medical judgment, is suitable for use in contact with the biological tissues of humans and animals without undue toxicity, irritation, allergic response, or other problem or complication, and which is commensurate with a reasonable benefit / risk ratio.

[0063] "Pharmaceutically acceptable salt" Pharmaceutically acceptable salts are known in the art. For example, SM Berge et al. have described pharmaceutically acceptable salts in detail in J.Pharmaceutical Sciences (1977)66:1-19. The pharmaceutically acceptable salts of the compounds in the present invention include those derived from suitable inorganic and organic acids and organic bases. Examples of pharmaceutically acceptable, non-toxic acid addition salts are the salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or by other methods used in the prior art, such as ion exchange. Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogensulfate, borate, acetate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, Salts derived from appropriate bases include lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, peroxosulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N-phenylpropionate salts. + (C 1-4Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharma-ceutically acceptable salts include, where appropriate, non-toxic ammonium salts, quaternary ammonium, and amine cations formed with counterions such as, for example, halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharma-ceutically acceptable salts include salts formed by the quaternization of amines with suitable electrophiles such as, for example, alkyl halides to form salts containing quaternary alkylamino groups.

[0064] "Specimen" As used herein, the term "specimen" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the specimen is human. A "specimen" may be a patient and refers to a human presented to a health care provider for diagnosis or treatment of disease. As used herein, the term "specimen" is used interchangeably with "individual" or "patient." A specimen may be afflicted or affected by a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0065] "Therapeutically Effective Amount" As used herein, the term "therapeutically effective amount" of a therapeutic agent refers to an amount sufficient when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition to treat, diagnose, prevent, and / or delay the onset of symptoms of the disease, disorder, and / or condition. It will be understood by those of skill in the art that a therapeutically effective amount is generally an amount administered by a dosing regimen comprising at least one unit dose.

[0066] "Treatment" As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a substance (e.g., a provided composition) that partially or completely alleviates, ameliorates, revives, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, characteristics, and / or causes of a particular disease, disorder, and / or condition (e.g., influenza). The treatment may be with respect to a subject that does not exhibit symptoms of the relevant disease, disorder, and / or condition and / or subjects that exhibit only early symptoms of the disease, disorder, and / or condition. Alternatively or additionally, the treatment may be with respect to a subject that exhibits one or more confirmed symptoms of the relevant disease, disorder, and / or condition. In some embodiments, the treatment may be with respect to a subject that has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, the treatment may be with respect to a subject that is believed to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the relevant disease, disorder, and / or condition.

[0067] "Upper Motor Neuron" As used herein, the terms "upper motor neuron" and "corticospinal neuron" are used synonymously to refer to motor neurons that originate in the motor areas of the cerebral cortex or in the brainstem and convey motor information to a final common pathway. Generally, an upper motor neuron refers to any motor neuron that is not directly responsible for innervating a target muscle. Detailed Description

[0068] The present invention provides, inter alia, methods and compositions for efficient delivery of messenger RNA (mRNA) to the central nervous system (CNS). In particular, the present invention provides methods and compositions for intrathecal administration to a subject in need of a composition comprising a protein-encoding mRNA encapsulated in liposomes, such that administration of the composition results in intracellular delivery of the mRNA in neurons in the brain and / or spinal cord. The present invention is particularly useful for treating CNS diseases, disorders, or disorders, such as spinal muscular atrophy. As used herein, the term "liposome" refers to any lamellar, multi-layered, or solid lipid nanoparticle vesicle. Generally, liposomes as used herein can be formed by mixing one or more lipids, or by mixing one or more lipids with a polymer. Thus, the term "liposome" as used herein includes both lipid and polymer-based nanoparticles. In some embodiments, liposomes suitable for the present invention include cationic or non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids.

[0069] Various aspects of the invention are described in detail in the following sections. Each clause may apply to any aspect of the invention. In this application, "or" means "and / or" unless stated otherwise. mRNA associated with CNS diseases, disorders, or disorders

[0070] The present invention can be used to deliver any mRNA to the central nervous system. In particular, the present invention is useful for delivering mRNA that encodes a protein that is related to or associated with a CNS disease, disorder, or disorder. As used herein, "CNS disease, disorder, or disorder" refers to a disease, disorder, or disorder that affects one or more neurological functions of the central nervous system (i.e., the brain and / or spinal cord). In some embodiments, a CNS disease, disorder, or disorder can be caused by a protein deficiency or dysfunction in neurons of the CNS (i.e., the brain and / or spinal cord).

[0071] Typical CNS diseases, disorders, or abnormalities include acid lipase deficiency, acid maltase deficiency, acquired epileptic aphasia, acute disseminated encephalomyelitis, hyperactivity syndrome, Adie pupil, Adie syndrome, adrenoleukodystrophy, agnosia, Aicardi syndrome, Aicardi-Goutières disorder, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angelman syndrome, hemangiomatosis, anoxia, antiphospholipid syndrome, aphasia, apraxia, arachnoiditis, Arnold-Chiari malformation, Asperger syndrome, and pulmonary circulation disorders. Ataxia, ataxia-telangiectasia, ataxia and cerebellar or spinocerebellar degeneration, attention deficit hyperactivity disorder, autism, autonomic dysfunction, Barth syndrome, Batten disease, Becker myotonia, Behçet's disease, Bell's palsy, Bernard-Ross syndrome, Binswanger disease, ataxia pigmenti, Bradbury-Eggleston syndrome, spinal hemiplegia, spinal-bulbar muscular atrophy, Cadasil, Canavan disease, causalgia, cavernoma, cavernous hemangioma, central cervical syndrome, central spinal syndrome, central pontine myelinolysis, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral beriberi, cerebral gigantism, cerebral palsy, cerebro-ophthalmo-facial Bone syndrome (COFS), cholesterol ester storage disease, chorea, chorea-acanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic dysregulation, Cockayne syndrome type II, Coffin-Lowry syndrome, colpocephaly, congenital myasthenia, corticobasal degeneration, cranial arteritis, Cree encephalitis, Creutzfeldt-Jakob syndrome, Cushing's syndrome, cytomegalic inclusion disease, dancing eyes-dancing feet syndrome, Dandy-Walker syndrome, Dawson's disease, septo-optic dysplasia, Dejerine-Klumpke palsy, dentate nucleus cerebellar atrophy, dentate nucleus Rubral atrophy, dermatomyositis, developmental dyspraxia, neuromyelitis optica, diffuse sclerosis, severe infantile myoclonic epilepsy, autonomic neuropathy, dysgraphia, dyslexia, swallowing disorder, conduct disorder, myoclonic cerebellar synkinesis disorder, progressive cerebellar dyssynchrony, Fabry disease, Fahr's disease, familial autonomic neuropathy, familial hemangioma, idiopathic familial basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Farber disease, fibromuscular dysplasia, Fisher syndrome, hypotonia syndrome, Friedreich's ataxia, Gaucher disease, systemic gangliosidosis, Gerstmann syndrome,Gerstmann-Sträussler-Scheinker syndrome, giant axonal neuropathy, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, glycogen storage disease, Guillain-Barré syndrome, Hallervorden-Spatz disease, persistent hemicrania, crossed hemiplegia, hereditary spastic paraplegia, polyneuropathy-type hereditary ataxia, Holmes-Adie syndrome, holoprosencephaly, Hughes syndrome, Huntington's disease, hydranencephaly, hydromyelia, hypercortisolism, immune-mediated, encephalomyelitis, inclusion body myositis, incontinentia pigmenti, childhood hypotonia, infantile neuroaxonal dystrophy, acid storage disease, foramen occipitalis, Isaac syndrome, Huber syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsbourne syndrome, Klein-Levin syndrome, Klippel-Fehr syndrome, Klippel-Trenagnony syndrome (KTS), Klüber-Bucy syndrome, Korsakoff amnesic syndrome, Krabbe disease, Kugel-Welander disease, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral bulbar syndrome, Leigh disease, Lennox-Gastaut syndrome, Lesch-Nyhan syndrome, Levine-Critchley syndrome, dementia with Lewy bodies, lipoid proteinosis, lissencephaly, closed, Involvement syndrome, Lou Gehrig's disease, neurological sequelae of lupus, Lyme disease, Machado-Joseph disease, macrocephaly, Melkerson-Rosenthal syndrome, Menkes disease, paresthesia femoralgia, metachromatic leukodystrophy, microcephaly, Miller-Fisher syndrome, Moebius syndrome, multiple sclerosis, muscular dystrophy, myasthenia gravis, myelinoclastic diffuse sclerosis, narcolepsy, neuroacanthocytosis, neurofibromatosis, neuroleptic malignant syndrome, neurosarcoidosis, Niemann-Pick disease, Ohtahara syndrome, olivopontocerebellar atrophy, opsoc Lonus-myoclonus, O'Sullivan-MacLeod syndrome, pantothenate kinase-associated neurodegeneration, paraneoplastic syndromes, paresthesia, Parkinson's disease, paroxysmal choreoathetosis, paroxysmal hemicrania, Parry-Romberg, Pelizaeus-Merzbacher disease, Pena-Shocker II syndrome, periventricular leukomalacia, phytanic acid storage disease, Pick's disease, piriformis syndrome, polymyositis, Pompe disease, post-polio syndrome, primary dentate atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive facial hemiatrophy, progressive gait ataxia, progressive multifocal leukoencephalopathy, Progressive sclerosing poliodystrophy, Progressive supranuclear palsy, Prosopagnosia, Ramsay Hunt syndrome I, Ramsay Hunt syndrome II, Rasmussen encephalitis, Refsum disease, Rett syndrome, Reye syndrome, Riley-Day syndrome, Sandhoff disease, Schilder's disease, Seitelberger disease, Severe myoclonic epilepsy in infancy (SMEI), Shy-Drager syndrome, Sjogren's syndrome, Spasticity, Spina bifida, Spinal muscular atrophy, Spinocerebellar atrophy, Spinocerebellar degeneration, Steele-Richardson-Olszewski syndrome, Striatonigral degeneration, Sturge-Weber syndrome group, tardive dyskinesia, Tay-Sachs disease, thoracic outlet syndrome, thyrotoxic myopathy, painful tics, Todd's palsy, trigeminal neuralgia, tropical spastic paraparesis, Troyer's syndrome, von Echonomo disease, von Hippel-Lindau disease (VHL), von Recklinghausen's disease, Wallenberg syndrome, Werdnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, Whipple's disease, Williams syndrome, Wilson's disease, Wolman disease, X-linked spinal-bulbar muscular atrophy, and Zellweger syndrome. Motor neuron disease

[0072] In some embodiments, the CNS disease, disorder, or abnormality is a disease, disorder, or abnormality that affects one or more functions of motor neurons, also referred to as a motor neuron disease. In some embodiments, the motor neuron disease may be caused by a protein deficiency or dysfunction in the motor neurons of the CNS (i.e., the brain and / or spinal cord). As used herein, the term "motor neurons" refers to those neurons that control the activity of voluntary muscles. Generally, motor neurons include upper motor neurons and lower motor neurons. As used herein, "upper motor neurons" refers to motor neurons that originate in the motor areas of the cerebral cortex or the brainstem and transmit motor information to the final common pathway. Upper motor neurons are also referred to as "corticospinal neurons." Generally, upper motor neurons refer to any motor neuron that is not directly responsible for stimulating a target muscle. As used herein, the term "lower motor neurons" refers to motor neurons that connect the brainstem and spinal cord to muscle fibers. In other words, lower motor neurons transmit nerve impulses from upper motor neurons to muscles. Generally, the axons of lower motor neurons terminate in effectors (muscles). Lower motor neurons include "spinal neurons" and "ventral horn cells."

[0073] Exemplary motor neuron diseases, disorders, or abnormalities include, but are not limited to, amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy, hereditary spastic paraplegia, progressive muscular atrophy (PMA), progressive bulbar palsy (PBP), distal hereditary motor neuropathy, and spinal muscular atrophy.

[0074] In some embodiments, the motor neuron disease, disorder, or abnormality is a form of spinal muscular atrophy. A group of spinal muscular atrophies are characterized by degeneration of lower motor neurons. Spinal muscular atrophy is a genetically and clinically heterogeneous group of rare debilitating diseases that affect the spinal cord. The degeneration of cells in the lower motor neurons, also known as the anterior horns of the spinal cord, causes a decline in motor function, resulting in atrophy and excessive wasting of various muscle groups in the body. The diseases that comprise this group can be divided into proximal, distal, autosomal recessive proximal and focal spinal muscular atrophies. However, considering that protein deficiency is the primary cause in various forms of spinal muscular atrophy, each disease component is usually classified according to the gene associated with the abnormality. Table 1 below lists the six major groups of spinal muscular atrophy. [Table 1-1] [Table 1-2] Disorders involving CNS components

[0075] In some embodiments, the CNS disease, disorder, or abnormality is a disease related to a CNS component. Generally, a disease related to a CNS component is caused by a protein deficiency that results in one or more biological tissues, one or more CNS pathologies and / or symptoms, including both the CNS and peripheral tissues in the body. For example, in some embodiments, a protein deficiency can result in the excessive accumulation of intracellular and / or extracellular components, such as glycosaminoglycans (GAGs), lipids, plaques (i.e., β-amyloid), or proteins. Thus, in some embodiments, a disease related to a CNS component is a lysosomal storage disease caused by a deficiency of a lysosomal enzyme, which results in the excessive accumulation of glycosaminoglycans (GAGs) in both the CNS and peripheral tissues.

[0076] In some embodiments, the lysosomal storage disease having a CNS etiology and / or symptom is aspartylglucosaminuria, cholesterol ester storage disease, Wolman disease, cystinosis, Danon disease, Fabry disease, Farber lipogranulomatosis, Farber disease, fucosidosis, galactosialidosis I / II, Gaucher disease I / II / III, globoid cell leukodystrophy, Krabbe disease, glycogen storage disease II, Pompe disease, GM1 gangliosidosis type I / II / III, GM2 gangliosidosis type I, Tay-Sachs disease, GM2 gangliosidosis type II, Sandhoff disease, GM2 gangliosidosis, α-mannosidosis type I / II, β-mannosidosis, metachromatic leukodystrophy, mucolipidosis I, sialidosis I / II, mucolipidosis II These include, but are not limited to, mucopolysaccharidosis type I / III, I-cell disease, mucolipidosis IIIC pseudo-Hurler multiple dystrophy, mucopolysaccharidosis type I, mucopolysaccharidosis type II, mucopolysaccharidosis type IIIA, Sanfilippo syndrome, mucopolysaccharidosis type IIIB, mucopolysaccharidosis type IIIC, mucopolysaccharidosis IIID, mucopolysaccharidosis type IVA, Morquio syndrome, mucopolysaccharidosis type IVB, mucopolysaccharidosis type VI, mucopolysaccharidosis type VII, Sly syndrome, mucopolysaccharidosis type IX, multiple sulfatase deficiency, neuronal ceroid lipofuscinosis, CLN1 Batten disease, CLN2 Batten disease, Niemann-Pick disease types A / B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, pyknodysostosis, Schindler disease types I / II, Gaucher disease, and sialic acid storage diseases.

[0077] A detailed review of the genetic etiology, clinical symptoms, and molecular biology of lysosomal storage diseases is detailed in Scriver et al., eds., The Metabolic and Molecular Basis of Inherited Disease, 7.sup.th Ed., Vol.II, McGraw Hill, (1995). Thus, the enzyme deficiencies in the above diseases are known to those skilled in the art, some of which are illustrated in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3]

[0078] In various embodiments, the present invention may be used to deliver an mRNA encoding a protein that is deficient in any CNS disease, disorder, or condition described herein. In some embodiments, the present invention may be used to deliver an mRNA encoding a protein that is deficient in a motor neuron disease, such as the motor neuron diseases shown in Table 1. In certain embodiments, the present invention may be used to deliver an mRNA encoding a protein that is deficient in spinal muscular atrophy (SMA), such as SMN1, described in detail below. In some embodiments, the present invention may be used to deliver an mRNA encoding a lysosomal enzyme that is deficient in a lysosomal storage disease with a CNS component. In some embodiments, the present invention may be used to deliver an mRNA encoding a lysosomal enzyme selected from Table 2. In some embodiments, the presently suitable mRNA may encode a wild-type or naturally occurring amino acid sequence. In some embodiments, the presently suitable mRNA may be a wild-type or naturally occurring amino acid sequence. In some embodiments, the presently suitable mRNA may be a codon-optimized sequence. In some embodiments, mRNA suitable for use in the present invention may encode an amino acid sequence that has substantial homology or identify a wild-type or naturally occurring amino acid protein sequence (e.g., having a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% identical to a wild-type or naturally occurring amino acid sequence). Survival Motor Neurons

[0079] In some embodiments, the methods and compositions provided by the present invention are used to deliver mRNA encoding a survival motor neuron protein to the CNS for the treatment of spinal muscular atrophy (SMA).

[0080] A suitable SMN mRNA encodes any full-length, fragment, or portion of the SMN protein that can substitute for the activity of a naturally occurring SMN protein or that can rescue one or more phenotypes or symptoms associated with spinal muscular atrophy. The mRNA sequence of human motor neuron-1 (hSMN-1) and the corresponding amino acid sequence of a representative wild-type or naturally occurring hSMN-1 protein are shown in Table 3. [Table 3-1] [Table 3-2]

[0081] Thus, in some embodiments, a suitable mRNA in the present invention is the wild-type hSMN-1 mRNA sequence (SEQ ID NO: 1). In some embodiments, a suitable mRNA may be the codon-optimized hSMN-1 mRNA sequence represented by (SEQ ID NO: 3). AUGGCCAUGAGCAGCGGAGGCAGCGGCGGAGGAGUGCCCGAGCAGGAGGACAGCGUGCUGUUCAGGAGAGGCACCGGCCAGAGCGAUGACAGCGAUAUCUGGGACGAUACCGCUCUGAUCAAGGCCUACGACAAGGCCGUGGCCAGCUUCAAGCACGCCCUGAAAAACGGCGACAUCUGCGAGACCAGCGGCAAGCCCAAGACAACCCCCAAGAGAAAGCCCGCCAAGAAGAAUAAGAGCCAGAAAAAGAACACCGCCGCCAGCCUGCAGCAGUGGAAGGUGGGCGACAAGUGCAGCGCCAUCUGGAGCGAGGACGGCUGCAUCUACCCCGCCACCAUCGCCAGCAUCGACUUCAAGAGAGAGACCUGCGUGGUCGUGUACACCGGCUACGGCAACAGAGAGGAGCAGAACCUGAGCGACCUGCUGAGCCCCAUUUGUGAGGUGGCCAAUAACAUCGAACAGAACGCCCAGGAGAACGAGAAUGAAAGCCAGGUGAGCACCGACGAGAGCGAGAACAGC AGAUCUCCUGGCAACAAGAGCGACAACAUCAAGCCUAAGUCUGCCCCUUGGAACAGCUUCCUGCCCCCUCCUCCACCCAUGCCCGGACCCAGACUGGGACCCGGAAAACCUGGCCUGAAGUUCAACGGACCACCUCCCCCUCCACCUCCUCCCCCACCUCAUCUCCUGAGCUGCUGGCUGCCACCCUUCCCCAGCGGACCCCCUAUCAUCCCACCACCCCCUCCCAUCUGCCCCGACAGCCUGGACGACGCCGAUGCCCUGGGCAGCAUGCUGAUCAGCUGGUACAUGAGCGGCUACCACACAGGAUACUACAUGGGCUUCAGACAGAACCAGAAGGAGGGCAGAUGCUCCCACUCCCUGAACUGA

[0082] Alternatively, in some embodiments, a suitable mRNA may be the codon-optimized hSMN-1 mRNA sequence represented by (SEQ ID NO:4). AUGGCCAUGAGCAGCGGAGGAAGCGGAGGAGGAGUGCCAGAACAGGAAGAUAGCGUGCUGUUUCGCCGGGGCACCGGACAAUCGGACGACAGCGAUAUUUGGGACGACACUGCGCUCAUCAAGGCCUACGACAAGGCGGUGGCUUCGUUCAAGCACGCUCUGAAGAACGGGGAUAUCUGUGAAACCAGCGGUAAACCAAAAACUACGCCGAAAAGGAAACC CGCCAAAAAGAACAAGUCACAGAAGAAGAAUACCGCUGCGAGCUUGCAGCAGUGGAAGGUGGGCGACAAGUGCUCCGCGAUUUGGUCGGAAGAUGGUUGCAUCUACCCGGCAACCAUCGCCUCCAUCGACUUUAAGCGGAGACUUGCGUCGUGGUCUACACCGGAUACGGCAAUAGAGAGGAACAGAAUCUGUCAGACCUUCUGUCGCCAAUCUGCGAGG UCGCCAACAAUAUCGAACAAAACGCCCAAGAGAACGAGAAUGAGUCCCAAGUGUCCACGGACGAAUCGGAAAACUCACGGUCCCCUGGGAACAAGUCAGAUAACAUCAAGCCUAAAUCGGCACCAUGGAACUCCUUCCUGCCGCCUCCGCCUCCGAUGCCGGGCCCGCGCCUGGGACCGGGUAAACCCGGGCUCAAGUUCAAUGGACCGCCACCCCCACCC CCGCCACCGCCGCCCCACCUCCUCUCGUGCUGGCUGCCGCCGUUCCCUUCCGACCGCCUAUCAUUCCGCCACCUCCACCUAUCUGCCCAGACAGCCUGGAUGAUGCCGACGCAUUGGGCUCCAUGCUCAUCUCAUGGUACAUGUCGGGAUACCAUACUGGGUAUUACAUGGGCUUCAGACAGAACCAGAAGGAAGGACGCUGUUCCCAUAGCCUGAACUAG

[0083] In some embodiments, a suitable mRNA encodes a full-length, fragment, or portion of the human survival motor neuron-2 (hSMN-2) protein. hSMN-2 and mRNA sequences corresponding to the amino acid sequence of an exemplary wild-type or naturally occurring hSMN-2 protein are shown in Table 4. [Table 4-1] [Table 4-2]

[0084] Thus, in some embodiments, a preferred mRNA in the present invention is the wild-type hSMN-2 mRNA sequence (SEQ ID NO: 5). In some embodiments, a preferred mRNA may be a codon-optimized hSMN-1 mRNA sequence.

[0085] In some embodiments, a suitable mRNA sequence may be an mRNA sequence encoding a homolog or analog of human SMN-1 (SEQ ID NO:2) or human SMN-2 (SEQ ID NO:6). For example, a homolog or analog of a human SMN-1 or SMN-2 protein may be a modified human SMN-1 or SMN-2 protein that retains significant SMN-1 or SMN-2 protein activity and contains one or more amino acid substitutions, deletions, and / or insertions when compared to a wild-type or naturally occurring human SMN-1 protein (e.g., SEQ ID NO:2) or human SMN-2 protein (e.g., SEQ ID NO:6). In some embodiments, a suitable mRNA in the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO:2 or SEQ ID NO:6. In some embodiments, a suitable mRNA of the present invention encodes a protein substantially identical to the human SMN-1 protein (SEQ ID NO:2) or the human SMN-2 protein (SEQ ID NO:6). In some embodiments, a suitable mRNA of the present invention encodes an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:2 or SEQ ID NO:6. In some embodiments, a suitable mRNA of the present invention encodes a protein substantially identical to the human SMN-1 protein or the human SMN The mRNA may encode a fragment or portion of an SMN-1 or SMN-2 protein, wherein the protein fragment or portion retains an activity of SMN-1 or SMN-2 that is similar to the activity of the respective wild-type protein. In some embodiments, an mRNA suitable in the present invention comprises a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

[0086] The human SMN-1 gene undergoes alternative processing and transcriptional modification to generate alternative splice isoforms. For example, there are five known hSMN-1 splice isoforms, hSMN-1 isoforms b, c, e, f, and g. The human SMN-2 gene also undergoes alternative processing and transcriptional modification to generate alternative splice isoforms. There are four known hSMN-2 splice isoforms, hSMN-2 isoforms a, b, c, and d. In some embodiments, the invention is used to deliver mRNA encoding an hSMN-1 isoform (e.g., isoforms b, c, e, f, or g). In some embodiments, the invention is used to deliver mRNA encoding an hSMN-2 isoform (e.g., isoforms a, b, c, or d). The nucleotide and amino acid sequences of hSMN-1 and hSMN-2 isoforms are known in the art. Thus, in some embodiments, the present invention may be used to deliver mRNAs encoding hSMN-1 or hSMN-2 proteins or their isoforms. In some embodiments, the present invention may be suitable for use with mRNAs that are wild-type or naturally occurring hSMN-1 or hSMN-2 isoform sequences. In some embodiments, the present invention may be suitable for use with mRNAs that are codon-optimized hSMN-1 or hSMN-2 isoform sequences. In some embodiments, the present invention may be suitable for use with mRNAs that encode amino acid sequences with substantial homology or identify wild-type or naturally occurring hSMN-1 or hSMN-2 isoform sequences (e.g., having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% sequence identity to wild-type or naturally occurring hSMN-1 or hSMN-2 isoform sequences). Synthesis of mRNA

[0087] The mRNA according to the present invention can be synthesized by any of a variety of known methods. For example, the mRNA according to the present invention can be synthesized by in vitro transcription reaction (IVT). Briefly, IVT is generally performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), deoxyribonuclease I, pyrophosphatase, and / or ribonuclease inhibitor. The exact conditions will vary depending on the specific application.

[0088] In some embodiments, for the preparation of mRNA according to the present invention, a DNA template is transcribed in vitro. A suitable DNA template will generally have a promoter, such as, for example, a T3, T7, or SP6 promoter, for in vitro transcription followed by the desired nucleotide sequence appropriate for the desired mRNA and a termination signal.

[0089] The desired mRNA sequence according to the invention is determined and incorporated into a DNA template using standard techniques. For example, starting with the desired amino acid sequence (e.g., an enzyme sequence), a virtual reverse transcription is carried out based on the altered genetic information. Optimized algorithms are preferably used. The G / C content can be used to select the most suitable codons. Generally, the G / C content can be optimized on the one hand to achieve the best G / C content, but on the other hand, taking into account the maximum possible frequency of tRNAs according to the codon usage. The optimized RNA sequence can be verified and expressed, for example, with the aid of a suitable display device and compared with the original (wild type) sequence. The secondary structure can also be analyzed, ascertaining the stabilizing and destabilizing properties, or respective regions, of the RNA. Modified mRNA

[0090] In some embodiments, the mRNA according to the present invention can be synthesized as unmodified or modified mRNA. Generally, the mRNA is modified to enhance stability. Modification of the mRNA can include, for example, modification of the nucleotides of the RNA. Thus, the mRNA modified according to the present invention can include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA can be synthesized as a nucleotide sequence of the naturally occurring nucleotide and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)), or pyrimidines (thymine (T), cytosine (C), uracil (U)), such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyladenine, N6-methyladenine, N6-isopentenyladenine, N6-isopenten ... uracil, 2-thio-cytosine, 3-methylcytosine, 4-acetylcytosine, 5-methylcytosine, 2,6-diaminopurine, 1-methylguanine, 2-methylguanine, 2,2-dimethylguanine, 7-methylguanine, inosine, 1-methylinosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxymethylaminomethyl)-2-thio-uracil, The nucleotides may be synthesized as modified nucleotide analogs or derivatives of purines and pyrimidines, such as, but not limited to, modified nucleotide analogs or derivatives of purines and pyrimidines, such as, but not limited to, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyluracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (V), 1-methylpseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine and inosine.The preparation of such analogs is known to those skilled in the art, e.g., US 4,373,071, US 4,401,796, US 4,415,732, US 4,458,066, US 4,500,707, US 4,668,777, US 4,973,679, US 5,047,524, US 5,132,418, US 5,153,319, US 5,262,530, and US 5,700,642, the disclosures of which are incorporated by reference in their entireties.

[0091] In some embodiments, mRNA may comprise RNA backbone modification. Generally, backbone modification is a modification that chemically modifies the phosphate backbone of nucleotides contained in RNA. Exemplary backbone modifications generally include, but are not limited to, modifications from the group consisting of methylphosphonate, methylphosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, and positively charged guanidinium group, which means replacing phosphodiester bond with other anionic, cationic, or neutral groups.

[0092] In some embodiments, the mRNA may include sugar modifications. Exemplary sugar modifications include 2'-deoxy-2'-fluoro oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxy and chemical modifications of the sugar of a nucleotide, including, but not limited to, sugar modifications selected from the group consisting of 2'-oxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate, 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine-5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and isomers thereof (2'-aracytidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azido triphosphate (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0093] In some embodiments, the mRNA may contain a modification of the base of a nucleotide (base modification). A modified nucleotide containing a base modification is also referred to as a base-modified nucleotide. The base-modified nucleotide may be 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine-5'-triphosphate, acid, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1 methylguanosine 5'-triphosphate, N6 methyladenosine 5'-triphosphate, O6 methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate or xanthosine 5'-triphosphate.

[0094] Generally, mRNA synthesis involves the addition of a "cap" at the N-terminus (5') and a "tail" at the C-terminus (3'). The presence of the cap is important for conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation. Cap Construction

[0095] In some embodiments, the mRNA comprises a 5' cap structure. Generally, the 5' cap is added as follows: first, a phosphate at the RNA end is added to the 5' nucleotide, removing one terminal phosphate group and releasing two terminal phosphates. Then, a guanylyltransferase adds guanosine triphosphate (GTP) to the terminal phosphate, generating a 5'5'5 triphosphate linkage. Then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0096] The naturally occurring cap structure is attached to the 5' end of the first transcribed nucleotide by a triphosphate bridge, 7 It contains 7-methylguanosine, resulting in a dinucleotide cap of G(5')ppp(5')N, where N can be any nucleotide. In vivo, the cap is added enzymatically. The cap is added in the nucleus and is catalyzed by the enzyme guanylyltransferase. Addition of the cap to the 5' end of the RNA occurs immediately after the initiation of transcription. The terminal nucleoside is typically guanosine, in the opposite orientation to all other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0097] The normal cap of mRNA produced by in vitro transcription is m 7G(5')ppp(5')G, which is used as a dinucleotide cap in in vitro transcription with T7 or SP6 RNA polymerase to obtain RNA with a cap structure at the 5' end. A common method for in vitro synthesis of capped mRNA is to use m 7 G(5')ppp(5')G(m 7 It uses a preformed dinucleotide of the form GpppG.

[0098] Currently, the common form of synthetic dinucleotide cap used in in vitro translation experiments is the anti-reverse cap analog ("ARCA") or modified ARCA, which is a modified cap analogue that generally replaces the 2' or 3' OH group with an OCH3.

[0099] Additional cap analogs include m 7 GpppG, m 7 GppA, m 7 GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m 2,7 GpppG; trimethylated cap analogs (e.g., m 2,2,7 GpppG), dimethylated symmetrical cap analogues (e.g., m 7 Gpppm 7 G), or anti-reverse cap analogs (e.g., ARCA;m 7,2’Ome GpppG, m 72’d GpppG, m 7,3’Ome GpppG, m 7,3’d GpppG, and their tetraphosphate derivatives). e' cap analogs with superior translational properties”, RNA, 9:1108-1122 (2003) thing).

[0100] In some embodiments, a suitable cap is attached to the 5' end of the first transcribed nucleotide by a triphosphate bridge, m 7 G(5')ppp(5')N, 7-methylguanylic acid ("m 7 G"), where N is any nucleotide. 7 The preferred embodiment of the G-cap is m 7 G(5')ppp(5')G.

[0101] In some embodiments, the cap is a Cap 0 structure, which lacks 2'-O-methyl residues on the ribose attached to bases 1 and 2. In some embodiments, the cap is a Cap 1 structure, which has a 2'-O-methyl residue on base 2. In some embodiments, the cap is a Cap 2 structure, which has a 2'-O-methyl residue on both base 2 and base 3.

[0102] Various m 7 G-cap analogs are known in the art and many are commercially available. 7 This includes GpppG, as well as ARCA 3'-OCH3 and 2'-OCH3 cap analogs (Jemielity, J. et al., RNA, 9:1108-1122 (2003)). Additional cap analogs for use in embodiments of the invention include N7-benzylated dinucleoside tetraphosphate analogs (described in Grudzien, E. et al., RNA, 10:1479-1487 (2004)), phosphorothioate cap analogs (described in Grudzien-Nogalska, E., et al., RNA, 13:1745-1755 (2007)), and tail cap analogs described in US 8,093,367 and US 8,304,529, including biotinylated cap analogs, which are incorporated herein by reference. Tail Structure

[0103] In general, the presence of a "tail" serves to protect the mRNA from exonuclease degradation. PolyA tails are believed to stabilize natural messenger and synthetic sense RNA. Therefore, in certain embodiments, long polyA tails can be added to mRNA molecules to make the RNA more stable. PolyA tails can be added using a variety of art-recognized techniques. For example, long polyA tails can be added to synthetic or in vitro transcribed RNA using polyA polymerase (Yokoe, et al. Nature Biotechnology. 1996;14:1252-1256). Transcription vectors can also encode long polyA tails. Additionally, polyA tails can be added by direct transcription from PCR products. PolyA can also be attached to the 3' end of sense RNA with RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press:1991 edition)).

[0104] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. Generally, the length of the polyA tail can be at least about 10, 50, 100, 200, 300, 400, or 500 nucleotides. In some embodiments, generally, the polyA tail at the 3' end of the mRNA comprises about 10-300 adenosine nucleotides (e.g., about 10-200 adenosine nucleotides, about 10-150 adenosine nucleotides, about 10-100 adenosine nucleotides, about 20-70 adenosine nucleotides, or about 20-60 adenosine nucleotides). In some embodiments, the mRNA comprises a 3' poly(C) tail structure. Generally, the poly-C tail at the 3' end of an mRNA comprises about 10-200 cytosine nucleotides (e.g., about 10-150 cytosine nucleotides, about 10-100 cytosine nucleotides, about 20-70 cytosine nucleotides, about 20-60 cytosine nucleotides, or about 10-40 cytosine nucleotides). The poly-C tail may be in addition to or may replace the poly-A tail.

[0105] In some embodiments, the length of the polyA or polyC tail is adjusted to control the stability and thus protein transcription of the modified sense mRNA molecule of the invention. For example, since the length of the polyA tail can affect the half-life of the sense mRNA molecule, the length of the polyA tail can also be adjusted to change the resistance level of the mRNA to nucleases and control the elapsed time of polynucleotide expression and / or polypeptide production in the target cell. 5' and 3' untranslated regions

[0106] In some embodiments, the mRNA comprises 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region contains one or more elements that affect mRNA stability or translation, such as an iron responsive element. In some embodiments, the 5' untranslated region may be between about 50-500 nucleotides in length.

[0107] In some embodiments, the 3' untranslated region comprises one or more polyadenylation signals, binding sites for proteins that affect the positional stability of the mRNA within the cell, or binding sites for one or more microRNAs. In some embodiments, the 3' untranslated region may be between about 50-500 or more nucleotides in length.

[0108] Exemplary 3' and / or 5' UTR sequences can be derived from stable (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzyme) mRNA molecules and increase the stability of the sense mRNA molecule. For example, the 5' UTR sequence can include a partial sequence of the CMV immediate early 1 (IE1) gene, or a fragment thereof, Improved nuclease resistance and / or improved half-life of the polynucleotide. Also contemplated is the inclusion of sequences encoding human growth hormone (hGH) or fragments thereof into the 3' end or untranslated regions of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to its unmodified counterpart, and also include modifications made, for example, to improve the resistance of the polynucleotide to in vivo nuclease degradation. Delivery Vehicles

[0109] According to the present invention, mRNA can be delivered to the CNS as naked RNA (unpackaged) or by a delivery vehicle. As used herein, the terms "delivery vehicle," "transcription vehicle," "nanoparticle," or grammatically equivalent, are used interchangeably.

[0110] In some embodiments, the mRNA may be delivered via a single delivery vehicle. In some embodiments, the mRNA may be delivered via one or more delivery vehicles, each of different compositions. According to various embodiments, suitable delivery vehicles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, natural and synthetically derived exosomes, natural, synthetic, and semi-synthetic lamellar bodies, nanoparticulates, calcium silicate phosphor nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vector tags. Liposomal Delivery Vehicles

[0111] In some embodiments, the suitable delivery carrier is a liposomal delivery carrier, such as a lipid nanoparticle. As used herein, a liposomal delivery carrier, such as a lipid nanoparticle, is generally characterized as a microscopic vesicle with an inner aqueous portion separated from the outer medium by one or more bilayer membranes. The liposomal bilayer membrane is generally formed by amphiphilic molecules, such as synthetic or naturally occurring lipids, that contain spatially separated hydrophilic and hydrophobic regions (Lasic, Trends Biotechnol., 16:307-321, 1998). Generally, the liposomal delivery carrier (e.g., lipid nanoparticles or liposomes) suitable in the present invention is formed by combining one or more different lipids and / or polymers. In some embodiments, the liposomal delivery carrier (e.g., lipid nanoparticles or liposomes) comprises one or more cationic lipids, one or more non-cationic / helper lipids, one or more cholesterol-based lipids, and / or one or more PEGylated lipids. Cationic lipids

[0112] In some embodiments, a suitable delivery vehicle comprises a cationic lipid. As used herein, the term "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. In particular, some cationic lipids, known as titratable or pH-titratable cationic lipids, are particularly effective for delivery of mRNA. A variety of cationic (e.g., titratable) lipids have been described in the literature, many of which are commercially available. Particularly suitable cationic lipids for use in the compositions and methods of the present invention are described in WO2010 / 053572 (and in particular CI2-200, paragraphs

[002] 25], and WO2012 / 170930, both of which are The methods described herein are incorporated by reference. In some embodiments, the cationic lipid N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride, or "DOTMA", is used (Feigner et al. Proc. Nat'l Acad. Sci. 84, 7413 (1987), US 4,897,355). DOTMA can be assembled alone or combined with the neutral lipid, dioleoylphosphatidyl-ethanolamine, or "DOPE", or other cationic or non-cationic lipids into liposomal transfer carriers or lipid nanoparticles, and the liposomes can be used to improve the delivery of nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-carboxyspermylglycine dioctadecylamide, or "DOGS", 2,3-dioleoyloxy-N-[2(spermyloxy)propyl]-N,N,N-trimethylammonium chloride, or "DOTMA". N,N-dimethyl-l-propanaminium, or "DOSPA" (Behr et al. Proc. Nat.'l Acad. Sci. 86, 6982 (1989) and US Pat. No. 5,171,678, US Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane, or "DODAP", and 1,2-dioleoyl-3-trimethylammonium-propane, or "DOTAP". Cationic lipids of interest include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane, or "DSDMA", 1,2-dioleoyloxy-N,N-dimethyl-3-aminopropane, or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane, or "DLinDMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane, or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride, or "DODAC", N,N-distearyl-N,N-dimethylammonium bromide, or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide, or "DMRIE", 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis,-9,12-octadecadienoxy)propane, or "CLinDMA", 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy]- 3-Dimethyl ll-(cis,cis-9',l-2'-octadecadienoxy)propane, or "CpLinDMA", N,N-Dimethyl-3,4-dioleoyloxybenzylamine, or "DMOBA", 1,2-N,N'-Dioleylcarbamyl-3-dimethylaminopropane, or "DOcarbDAP", 2,3-Dilinoleyloxy-N,N-dimethylpropylamine, or "DLinDAP", 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane, or "DLincarbDAP", 1,2-Dilinoleylcarbamyl-3-dimethylaminopropane, or "DLinCDAP", 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]- Dioxolane, or "DLin--DMA", 2,2-Dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane, or "DLIN-K-XTC2-DMA" and 2-(2,2-di((9Z,12Z)-octadeca-9,L2,dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLIN-KC2-DMA)) (see WO2010 / 042877, Semple et al., Nature Biotech. 28:172-176 (2010)), or mixtures thereof (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO2005 / 121348A1).

[0113] In some embodiments, the one or more cationic lipids present in such compositions are selected from the group consisting of XTC (2,2-dilinoleyl 1-4-dimethylaminoethyl 1-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[ d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3 -oxo-3-(undecylamino)propyl)-N1,N16-diudecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), and ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety).

[0114] In certain embodiments, the compositions and methods of the present invention include ionic cationic lipids, such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-l-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z Lipid nanoparticles including (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-l-amine (HGT5001) and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002) are used.

[0115] In some embodiments, the liposomes provided comprise a cationic lipid as described in WO2013063468 and in U.S. provisional application filed on even date herewith, entitled "Lipid Formulations for Delivery of Messenger RNA," both of which are incorporated by reference. In some embodiments, the cationic lipid comprises a compound of formula I-c1-a: [ka] or a pharma- ceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is an alkyl group of the formula each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is an alkyl group of the formula And each R L is independently C 8-12 is an alkyl group.

[0116] In some embodiments, each R 2is independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 are independently hydrogen or methyl. In the embodiment, each R 2 is hydrogen.

[0117] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0118] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0119] In some embodiments, each R L is independently C 8-12 In some embodiments, each R L are independently nC 8-12 In some embodiments, each R L is independently C 9-11 In some embodiments, each R L are independently nC 9-11 In some embodiments, each R L is independently C 10 In some embodiments, each R L are independently nC 10 It is an alkyl.

[0120] In some embodiments, each R 2 is independently hydrogen or methyl, each q is independently 3 to 5, each R' is independently hydrogen or methyl, and each R L is independently C 8-12 It is an alkyl.

[0121] In some embodiments, each R 2is hydrogen, each q is independently 3 to 5, each R' is hydrogen, and each R L is independently C 8-12 It is an alkyl.

[0122] In some embodiments, each R 2 is hydrogen, each q is 4, each R' is hydrogen, and each R L is independently C 8-12 It is an alkyl.

[0123] In some embodiments, the cationic lipid comprises a compound of formula Ig, [ka] or a pharma- ceutically acceptable salt thereof, wherein each R L is independently C 8-12 In some embodiments, each R L are independently nC 8-12 In some embodiments, each R L is independently C 9-11 In some embodiments, each R L are independently nC 9-11 In some embodiments, each R L is independently C 10 In some embodiments, each R L are independently nC 10 It is an alkyl.

[0124] In certain embodiments, the liposomes provided contain the cationic lipid cKK-E12, or or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below. [ka]

[0125] In some embodiments, suitable lipid nanoparticles of the present invention comprise at least one of the following cationic lipids: C12-200, DLin-KC2-DMA, cKK-E12, Re-1, DODMA, DODAP, HGT4003, ICE, XTC, DSPC, MC3, HGT5000, or HGT5001.

[0126] In some embodiments, the proportion of cationic lipids in the liposomes may be greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, greater than about 50%, greater than about 60%, or greater than about 70% by molar ratio. In some embodiments, the cationic lipids make up about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposomes by molar ratio. In some embodiments, the cationic lipids make up about 30%, about 35%, about 40%, about 45%, or about 50% of the liposomes by molar ratio. Non-cationic / helper lipids

[0127] In some embodiments, the liposomes provided include one or more non-cationic (helper) lipids. As used herein, the term "non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. In some embodiments, the non-cationic lipid is a neutral lipid, i.e., a lipid that does not carry a net charge under the conditions in which the composition is assembled and / or administered. The non-cationic lipids are distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl Phosphatidylethanolamine-4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethylpolyethylene, 16-O-dimethylpolyethylene, 18-1-transpolyethylene, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE) ), or mixtures thereof.

[0128] In some embodiments, suitable non-cationic (helper) lipids include one or more phosphatidyl lipids, such as phosphatidyl compounds (eg, phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, and phosphatidylethanolamine).

[0129] In some embodiments, suitable non-cationic (helper) lipids include one or more sphingolipids, such as sphingosine, ceramide, sphingomyelin, cerebrosides, and gangliosides.

[0130] In some embodiments, the non-cationic (helper) lipids may constitute, by molar ratio, about 5% to about 90% (e.g., about 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, or 10-20%) of the total lipids present in the liposome. In some embodiments, the proportion of non-cationic (helper) lipids in the liposome may be, by molar ratio, greater than about 5%, greater than about 10%, greater than about 15%, greater than about 20%, greater than about 25%, greater than about 30%, greater than about 35%, or greater than about 40%. Cholesterol-based lipids

[0131] In some embodiments, the liposome provided comprises one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, cholesterol, PEGylated cholesterol, DC-CHOi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolfetal. Bio Techniques 23, 139 (1997), US5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise, by molar ratio, about 2% to about 30%, or about 5% to 20%, based on the total lipid present in the liposome. In some embodiments, the proportion of cholesterol-based lipids in the lipid nanoparticles may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40% by molar ratio. PEGylated lipids

[0132] In some embodiments, the lipid nanoparticles provided include one or more PEGylated lipids, such as polyethylene glycol (PEG)-modified phospholipids and N-octanoyl-sphingosine-l-[succinyl(methoxypolyethylene glycol)] Derivatized ceramides (PE-2000) (C8PEG-2000 ceramide) The use of derivatized lipids, such as PEG-CER, is contemplated by the present invention with one or more cationic lipids, and in some embodiments, in admixture with other lipids. In some embodiments, suitable PEGylated lipids have short acyl chains (e.g., C 14 or C 18 In some embodiments, the PEGylated lipid DSPE-PEG-maleimide-lectin may be used. Other contemplated PEG-modified lipids include those having a C6 to C 20 Examples of suitable PEGylated lipids include, but are not limited to, polyethylene glycol chains of 5 kDa or greater in length covalently attached to lipids having alkyl chains of 10 kDa or greater in length. Without wishing to be bound by a particular theory, it is contemplated that the addition of PEGylated lipids may increase circulation longevity, prevent complex aggregation, and facilitate delivery of liposomes encapsulating mRNA to target cells.

[0133] In some embodiments, PEG-modified phospholipids and / or derivatized lipids may be comprised of about 0% to about 20%, about 0% to about 15%, about 0% to about 10%, about 1% to about 10%, about 1% to about 8%, about 1% to about 6%, about 1% to about 5%, about 2% to about 10%, or about 4% to about 10% in terms of molar ratio relative to the total lipids present in the liposome. In some embodiments, the proportion of the PEG-modified phospholipid and / or the derivatized lipid may be about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% or less in terms of molar ratio relative to the total lipids present in the liposome. In some embodiments, the proportion of PEG-modified phospholipids and / or derivatized lipids, by molar ratio, can be about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, or about 20% or more of the total lipids present in the liposome. polymer

[0134] In some embodiments, suitable delivery vehicles are constructed using polymers as carriers, either alone or in combination with other carriers, including various lipids as described herein. Thus, in some embodiments, liposome delivery vehicles, as used herein, also encompass polymers including nanoparticles. Suitable polymers may include, for example, polyacrylates, polyalkylcyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactone, dextran, albumin, gelatin, alginates, collagen, chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be linear or branched PEI, e.g., 25 kDa branched PEI (Sigma #408727), with a molecular weight in the range of 10-40 kDa.

[0135] In various embodiments, suitable delivery vehicles (e.g., lipid nanoparticles) are prepared by combining one or more lipid and / or polymer components described herein. For example, lipid nanoparticles may be prepared by combining C12-200, sphingomyelin, DOPE, cholesterol, and DMGPEG; or C12-200, DOPE, cholesterol, and DMG-PEG2K; or cKK-E12, DOPE, cholesterol, and DMG-PEG2K; or cKK-E12, sphingomyelin, DOPE, cholesterol, and DMG-PEG2K; or HGT5001, DOPE, cholesterol, and DMG-PEG2K; or HGT4003, DOPE, cholesterol, and DMG-PEG2K; or or ICE, DOPE, cholesterol and DMG-PEG2K; or DODMA, DOPE, cholesterol and DMG-PEG2K; or DODMA, sphingomyelin, DOPE, cholesterol and DMG-PEG2K; or Re-1, DOPE, cholesterol, DMG-PEG2K; or cKK-EE12, DOPE, cholesterol, DMG-PEG2K and / or DSPE-PEG-myelin-lectin.

[0136] In various embodiments, cationic lipids, non-cationic lipids, cholesterol, and / or PEG-modified lipids may be combined in various relative molar ratios. For example, the ratio of cationic lipids (e.g., cKK-E12, C12-200, etc.) to non-cationic lipids (e.g., DOPE, sphingomyelin, etc.), cholesterol-based lipids (e.g., cholesterol), and PEGylated lipids (e.g., DMG-PEG2K) may be between about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipids (e.g., cKK-E12, C12-200, etc.) to non-cationic lipids (e.g., DOPE, sphingomyelin, etc.), cholesterol-based lipids (e.g., cholesterol), and PEGylated lipids (e.g., DMG-PEG2K) is approximately 40:30:20:10, respectively. In some embodiments, cationic lipids (e.g., cKK-E12, C12-200, etc.) , the ratio of non-cationic lipids (e.g., DOPE, sphingomyelin, etc.), cholesterol-based lipids (e.g., cholesterol), and PEGylated lipids (e.g., DMG-PEG2K) is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipids (e.g., cKK-E12, C12-200, etc.) to non-cationic lipids (e.g., DOPE, sphingomyelin, etc.), cholesterol-based lipids (e.g., cholesterol), and PEGylated lipids (e.g., DMG-PEG2K) is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipids (e.g., cKK-E12, C12-200, etc.) to non-cationic lipids (e.g., DOPE, sphingomyelin, etc.), cholesterol-based lipids (e.g., cholesterol), and PEGylated lipids (e.g., DMG-PEG2K) is approximately 50:25:20:5, respectively. Preparation of lipid nanoparticles

[0137] Delivery carriers such as lipid nanoparticles used in the present invention can be prepared using various techniques currently known in the art. Multilamellar liposomes (MLVs) can be prepared by conventional techniques. For example, lipids are dissolved in a suitable solvent, and the selected lipids are deposited on the inner wall of a suitable container or vessel, and the solvent is then evaporated or spray-dried to leave a thin film on the inside of the vessel. Then, an aqueous phase is added to the vessel while being vortexed to form MLVs. Unilamellar liposomes (ULVs) can then be formed by homogenization, sonication, or extrusion of the multilamellar liposomes. In addition, unilamellar liposomes can be formed by detergent removal techniques.

[0138] In a specific embodiment of the invention, the composition of the invention includes a transcription carrier, in which the mRNA is associated with both surfaces of the transcription carrier and encapsulated within the same transcription carrier. For example, during preparation of the composition of the invention, cationic lipids can be associated with the mRNA via electrostatic interactions.

[0139] The liposome bilayer may also be formed by amphiphilic polymers and surface active substances (e.g., polymersomes, niosomes, etc.). The process of binding the desired mRNA to the liposome is often referred to as "loading". Exemplary methods are described in Lasic, et al., FEBS Lett., 312:255-258, 1992, incorporated herein by reference. The nucleic acid incorporated into the liposome may be located entirely or partially in the liposome's internal space within the liposome's bilayer, or may be associated with the external surface of the liposome membrane. The incorporation of nucleic acid into liposomes is also referred to herein as "encapsulation", where the nucleic acid is completely contained within the liposome's internal space. The purpose of incorporating mRNA into a transcription carrier such as a liposome is often to protect the nucleic acid from an environment that contains enzymes or chemicals that may degrade the nucleic acid and / or the system or receptors that cause rapid secretion of the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate delivery of the mRNA to a target CNS cell or biological tissue.

[0140] Suitable liposome delivery carriers according to the present invention may be made in various sizes. In some embodiments, the size of the liposome is determined by the length of the largest diameter of the liposome particle. In some embodiments, suitable liposome delivery carriers have a size of about 250 nm or less (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, or 40 nm or less). In some embodiments, suitable liposome delivery carriers have a size of about 40 to 100 nm (e.g., about 40 to 90 nm, about 40 to 80 nm, about 40 to 70 nm, about 40 to 60 nm, about 40 to 50 nm, about 50 to 100 nm, about 50 to 90 nm, about 50 to 80 nm, about 50 to 70 nm, about 50 to 60 nm, about 60 to 100 nm, about 60 to 9 ... The nanoparticles have a size in the range of about 0 to 80 nm, about 60 to 70 nm, about 70 to 100 nm, about 70 to 90 nm, about 70 to 80 nm, about 80 to 100 nm, about 80 to 90 nm, or about 90 to 100 nm.

[0141] Various methods known in the art are available for sizing the population of liposomal transfer carriers. One such sizing method is described in US 4,737,323, which is incorporated herein by reference. Sonicating the liposomal suspension, either by bath or probe sonication, can produce progressive size reduction down to the desired small ULVs. Homogenization is another method that relies on shear energy to fragment larger liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated in a standard emulsion homogenizer until they reach the size of the selected liposome. The size of the liposomal carriers can be determined by quasi-elastic light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), which is incorporated herein by reference. The diameter of standard liposomes can be reduced by sonicating the formed liposomes. To guide efficient liposome synthesis, intermittent sonication cycles may be alternated with QELS assessment. CNS delivery

[0142] As described herein, mRNA or mRNA containing delivery carriers (e.g., lipid nanoparticles loaded with mRNA) are suitable for CNS delivery. In some embodiments, lipid nanoparticles loaded with mRNA can be delivered to the CNS by a variety of techniques and routes, including, but not limited to, intraparenchymal, intracerebral, intracerebroventricular (ICV), intrathecal (e.g., IT-lumbar, IT-cisternoma) administration, and any other technique and route of direct or indirect injection into the CNS and / or CSF. intrathecal delivery

[0143] In some embodiments, mRNA-loaded lipid nanoparticles are delivered to the CNS by injection into the cerebrospinal fluid (CSF) of a subject in need of treatment. In some embodiments, intrathecal administration is used to inject mRNA or mRNA-loaded nanoparticles into the CSF. As used herein, intrathecal administration (also referred to as intrathecal injection) refers to an injection into the spinal canal (the intrathecal space surrounding the spinal cord). A variety of techniques may be used, including, but not limited to, lateral ventricular injection, such as through a burr hole, cisterna magna, or lumbar puncture. An exemplary method is described in Lazorthes et al. Advances in Drug Delivery Systems and Applications in Neurosurgery, 143-192, and Omaya et al., Cancer Drug Delivery, 1:169-179, the contents of which are incorporated by reference.

[0144] According to the present invention, the mRNA or nanoparticles loaded with mRNA may be injected into any area surrounding the spinal canal. In some embodiments, the mRNA or nanoparticles loaded with mRNA are injected into the lumbar region, or into the cisterna magna, or intraventricularly into the ventricular space. As used herein, the term "lumbar region" or "lumbar region" refers to the area between the third and fourth lumbar vertebrae (low back), more generally, the L2-S1 region of the spine. In general, intrathecal injection via the lumbar region or lumbar region is also referred to as "lumbar IT delivery" or "lumbar IT administration." The term "cisterna magna" refers to the space around and below the cerebellum, through the opening between the skull and the upper spine. In general, intrathecal injection via the cisterna magna is also referred to as "cisternal delivery." The term "ventricle" refers to the cavity in the brain that is continuous with the central canal of the spinal cord. In general, injection via the ventricular space is referred to as intracerebroventricular (ICV) delivery.

[0145] In some embodiments, "intral administration" or "intral delivery" according to the present invention refers to lumbar IT administration or delivery, for example, between the third and fourth lumbar vertebrae (lower back), or more generally, to the L2-S1 region of the spine.

[0146] In some embodiments, intrathecal administration can be performed by either lumbar puncture (i.e., slow bolus) or port-catheter delivery system (i.e., infusion or bolus). In some embodiments, a catheter is inserted between the lumbar lamina and the tip is penetrated into the thecal space to the desired level (typically L3-L4). Administration

[0147] The present invention contemplates single as well as multiple administrations of a therapeutically effective amount of the mRNA or mRNA-loaded nanoparticles described herein. The mRNA or mRNA-loaded nanoparticles may be administered at regular intervals depending on the nature, severity and extent of the subject's CNS disease or condition. In some embodiments, the therapeutically effective amount of the mRNA or mRNA-loaded nanoparticles may be administered intrathecally periodically at regular intervals (e.g., once a year, once every six months, once every five months, once every three months, every other month (once every two months), monthly (once a month), every other week (once every two weeks), weekly, daily or continuously).

[0148] In some embodiments, the CNS disease is associated with a peripheral tract condition. Thus, in some embodiments, intrathecal administration can be used in conjunction with other routes of administration, such as intravenously, subcutaneously, intramuscularly, parenterally, transdermally, or mucosally (e.g., orally or nasally).

[0149] As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of mRNA contained in the pharmaceutical composition of the present invention. In general, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject (e.g., treat, regulate, cure, prevent, and / or ameliorate the underlying disease or condition). For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. In general, the amount of mRNA administered to a subject in need thereof will depend on the characteristics of the subject. Such characteristics include the subject's symptoms, disease severity, general health, age, sex, and weight. Those skilled in the art can easily determine the appropriate dosage depending on these and other relevant factors. In addition, objective and subjective testing may be optionally used to determine optimal dosage ranges.

[0150] In some embodiments, the therapeutically effective amount is from about 0.001 mg to about 10 mg per kg of body weight, from about 0.005 mg to about 10 mg per kg of body weight, from about 0.01 mg to about 10 mg per kg of body weight, from about 0.01 mg to about 9 mg per kg of body weight, from about 0.01 mg to about 8 mg per kg of body weight, from about 0.01 mg to about 7 mg per kg of body weight, from about 0.01 mg to about 6 mg per kg of body weight, from about 0.01 mg to about 5 mg per kg of body weight, from about 0.01 mg to about 10 ... The range is from about 0.01 mg to about 4 mg per kg, from about 0.01 mg to about 3 mg per kg of body weight, from about 0.01 mg to about 2 mg per kg of body weight, from about 0.01 mg to about 1 mg per kg of body weight, from about 0.01 mg to about 0.5 mg per kg of body weight, from about 0.1 mg to about 10 mg per kg of body weight, from about 0.1 mg to about 5 mg per kg of body weight, from about 0.5 mg to about 10 mg per kg of body weight, or from about 0.5 mg to about 5 mg per kg of body weight.

[0151] In some embodiments, the therapeutically effective amount is from about 0.001 mg to 100 mg per kg of brain weight, from about 0.001 mg to 90 mg per kg of brain weight, from about 0.001 mg to 80 mg per kg of brain weight, from about 0.001 mg to 70 mg per kg of brain weight, from about 0.001 mg to 60 mg per kg of brain weight, from about 0. 0.001 mg to 50 mg per kg of brain weight, about 0.001 mg to 40 mg per kg of brain weight, about 0.001 mg to 30 mg per kg of brain weight, about 0.001 mg to 20 mg per kg of brain weight, about 0.001 mg to 10 mg per kg of brain weight, about 0.001 mg to 5 mg per kg of brain weight, about 0.001 mg to 1 mg per kg of brain weight, about 0.01 mg to 100 mg per kg of brain weight, about 0.05 mg to 100 mg per kg of brain weight, about 0.1 mg to 100 mg per kg of brain weight, or about 0.5 mg to 100 mg per kg of brain weight.

[0152] One of skill in the art will appreciate that brain weight and body weight can be correlated (Dekaban AS. "Changes in brain weights during the span of human life: relation of brain weights to body heights and body weights," Ann Neurol 1978; 4:345-56). Thus, in some embodiments, dosages can be converted as shown in Table 5. [Table 5] Delivery to neurons and other cell types in the brain and / or spinal cord

[0153] The method according to the invention provides for the delivery of mRNA in various neurons and other cell types in the brain and / or spinal cord. In some embodiments, mRNA encoding a therapeutic protein is delivered to various cells in the brain, including but not limited to neurons, glial cells, perivascular cells, and / or meningeal cells. In particular, the method according to the invention provides for the delivery of mRNA in various neurons and other cell types affected by a CNS disease and / or defect, or in various neurons and other cell types in which a defective protein associated with a CNS disease is normally expressed. In some embodiments, the method according to the invention provides for the delivery of mRNA in various neurons and other cell types in the CNS where there is a detectable or abnormally high amount of an enzyme substrate stored in the lysosomes of cells of a biological tissue, for example, in a patient suffering from or susceptible to a lysosomal storage disease. In some embodiments, the method according to the invention provides for the delivery of mRNA in various neurons and other cell types that exhibit pathology, symptoms, or characteristics associated with a disease. For example, mRNA can be delivered to neurons or other cell types that deteriorate, degenerate, or undergo apoptosis, such as those neurons or non-neuronal cells associated with psychodegenerative diseases (e.g., Alzheimer's disease, Parkinson's disease, and Huntington's disease), or motor neurons associated with motor neuron diseases (e.g., amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy, hereditary spastic paraplegia, progressive muscular atrophy (PMA), progressive bulbar palsy (PBP), distal hereditary motor neuropathy, and spinal muscular atrophy).

[0154] In some embodiments, the mRNA is delivered to neurons and / or non-neuronal cells located in the brain. In some embodiments, the mRNA is delivered to neurons and / or non-neuronal cells located in the spinal cord. In some embodiments, the mRNA is delivered to a motor neuron. In some embodiments, the mRNA is delivered to an upper motor neuron and / or a lower motor neuron. In some embodiments, the motor neuron is located in the anterior horn and / or dorsal root ganglion of the spinal cord.

[0155] In some embodiments, the mRNA is delivered intracellularly within various neurons and other cell types in the brain and / or spinal cord. In some embodiments, the mRNA is delivered to the axon of a neuron. In some embodiments, mRNA delivery according to the invention results in intracellular expression of the protein encoded by the mRNA in the cytosol of the neuron. In some embodiments, mRNA delivery according to the invention results in intracellular expression of the protein encoded by the mRNA in an intracellular compartment of the neuron, e.g., lysosomes, mitochondria, transmembrane, etc. In some embodiments, mRNA delivery according to the invention results in intracellular expression of the protein encoded by the mRNA and in the neuron and secretion of the protein extracellularly from the neuron.

[0156] Further exemplary neurons and other cell types in the brain and / or spinal cord are illustrated below. brain

[0157] Generally, the method according to the invention can be used to deliver mRNA and encoded proteins to neurons and other cell types in various regions of the brain. Generally, the brain can be divided into separate regions, layers, and biological cells. For example, the biological tissue of the meninges is a membrane system that surrounds the central nervous system, including the brain. The meninges contain three layers, including the dura mater, the arachnoid mater, and the pia mater. Generally, the first function of the meninges and cerebrospinal fluid is to protect the central nervous system. In some embodiments, the mRNA and encoded proteins are delivered to neurons or non-neuronal cells in one or more layers of the meninges.

[0158] The brain has three divisions, including the cerebrum, cerebellum, and brain stem. Located above most other brain structures, the cerebral hemispheres are covered by the cortex. Below the cerebrum lies the brain stem, which resembles a stem onto which the cerebrum is attached. At the rear of the brain, below the cerebrum and behind the brain stem, is the cerebellum.

[0159] Located near the midline of the brain and above the midbrain, the diencephalon contains the thalamus, posterior thalamus, hypothalamus, epithalamus, ventral thalamus, and ventral tectum. The mesencephalon, also called the midbrain, contains the optic tectum, tegmentum, aqueduct, and cerebral peduncle, red nucleus, and cranial nerve 3 nuclei. The midbrain is associated with vision, hearing, motor control, sleep / wake, vigilance, and temperature regulation.

[0160] In some embodiments, the mRNA and the encoded protein are delivered to neurons and / or non-neuronal cells in one or more biological tissues of the cerebellum. In certain embodiments, the target one or more biological tissues of the cerebellum are selected from the group consisting of molecular layer biological tissue, Purkinje cell layer biological tissue, granule cell layer biological tissue, cerebellar peduncle, and combinations thereof. In some embodiments, the mRNA and the encoded protein are delivered to one or more deep tissues of the cerebellum, including, but not limited to, Purkinje cell layer biological tissue, granule cell layer biological tissue, deep cerebellar white matter biological tissue (e.g., deep to the granule cell layer), and deep cerebellar nuclei biological tissue.

[0161] In some embodiments, the mRNA and encoded protein are delivered to one or more biological tissues in the brainstem.

[0162] In some embodiments, the mRNA and encoded protein are delivered to various brain tissues, including, but not limited to, gray matter, white matter, periventricular zone, pia-arachnoid, meninges, neocortex, cerebellum, deep tissues of the cerebral cortex, molecular layer, caudate / putamen region, midbrain, deep regions of the pons or medulla, and combinations thereof. The encoded protein is delivered to oligodendrocytes in the deep white matter. Spinal cord

[0163] In some embodiments, the methods of the present invention can be used to deliver mRNA and the encoded protein to neurons and other cell types in various regions of the spinal cord. Generally, regions of the spinal cord or biological tissues can be characterized based on the depth of the biological tissue. For example, spinal cord tissues can be characterized as superficial or superficial tissues, mid-deep tissues, and / or deep tissues.

[0164] In some embodiments, the mRNA and encoded protein are delivered to one or more superficial or superficial tissues of the spinal cord. In some embodiments, the targeted superficial or superficial tissues of the spinal cord include the pia mater and / or white matter tracts.

[0165] In some embodiments, the mRNA and encoded protein are delivered to one or more deep tissues of the spinal cord, hi some embodiments, the targeted deep tissues of the spinal cord include spinal cord gray matter and / or ependymal cells.

[0166] The present invention will be more fully understood by reference to the following examples, which should not, however, be construed as limiting the scope of the invention. All literature citations are incorporated by reference. EXAMPLES

[0167] Example 1 Formulations and messenger RNA substances This example provides an exemplary lysosomal formulation for effective delivery and expression of mRNA in the CNS. In general, the formulations described herein contain a multi-component lipid mixture using varying ratios of one or more cationic lipids, neutral lipids, cholesterol and / or PEGylated lipids designed to encapsulate various nucleic acid-based materials. Messenger RNA materials

[0168] Codon-optimized human survival motor neuron-1 (hSMN-1) messenger RNA was synthesized by in vitro transcription from a gene-encoding plasmid DNA template followed by the addition of a 5' cap structure (cap1) (Fechter, P.; Brownlee, GG "Recognition of mRNA cap structures by viral and cellular proteins" J. Gen. Virology 2005, 86, 1239-1249) and a 3' poly(A) tail of approximately 250 nucleotides in length as determined by gel electrophoresis. The 5' and 3' untranslated regions present in each mRNA product are represented by X and Y, respectively, and are defined as described. Survival motor neuron (hSMN-1) mRNA X-SEQ ID NO:3-Y 5' and 3' UTR sequences X(5'UTR sequence)= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 7) Y(3'UTR sequence)= CGGGUGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUC CUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 8) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 9)

[0169] For example, a codon-optimized human survival motor neuron-1 (hSMN-1) messenger RNA comprises: Alternatively, codon-optimized human survival motor neuron-1 (hSMN-1) messenger RNA is GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCCAAGAGUGACUCACCGUCCUUGACACGAUGGCCAUGAGCAGCGGAGGCAGCGGCGGAGGAGUGCCCGAGCAGGAGGACAGCGUGCUGUUCAGGAGAGGCACCGGCC AGAGCGAUGACAGCGAUAUCUGGGACGAUACCGCUCUGAUCAAGGCCUACGACAAGGCCGUGGCCAGCUUCAAGCACGCCCUGAAAAACGGCGACAUCUGCGAGACCAGCGGCAAGCCCAAGACAACCCCCAAGAGAAAGCCCGCCAAGAAGAAUAAGAGCCAGAAAAAAGAACACCGCCGCCAGCCUGCAGCAGUGGAAGGUGGGCGACAAGUGCAGCGC It contains [[SEQ.ID.NO:11]] CAUCUGGAGCGAGGACGGCUGCAUCUACCCCGCCACCAUCGCCAGCAUCGACUUCAAGAGAGAGACCUGCGUGGUCGUGUACACCGGCUACGGCAACAGAGAGGAGCAGAACCUGAGCGACCUGCUGAGCCCCAUUUGUGAGGUGGCCAAUAACAUCGAACAGAACGCCCAGGAGAACGAGAAUGAAAGCCAGGUGAGCACCGACGAGAGCGAGAACAGCAGAUCUCCUGGCAACAAGAGCGACAACAUCAAGCCUAAGUCUGCCCCUUGGAACAGCUUCCUGCCCCCUCCUCCACCCAUGCCCGGACCCAGACUGGGACCCGGAAAACCUGGCCUGAAGUUCAACGGACCACCUCCCCCUCCACCUCCUCCCCCACCUCAUCUCCUGAGCUGCUGGCUGCCACCCUUCCCCAGCGGACCCCCUAUCAUCCCACCACCCCCUCCCAUCUGCCCCGACAGCCUGGACGACGCCGAUGCCCUGGGCAGCAUGCUGAUCAGCUGGUACAUGAGCGGCUACCACACAGGAUACUACAUGGGCUUCAGACAGAACCAGAAGGAGGGCAGAUGCUCCCACUCCCUGAACUGAGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU. Typical manufacturing procedures

[0170] Lipid nanoparticles (LNPs) were formed by standard ethanol injection method (Ponsa, M.; Foradada, M.; Estelrich, J. “Liposomes obtained by the ethanol injection method” Int. J. Pharm. 1993, 95, 51-56). For the various lipid components, 50 mg / ml ethanol stock solutions were prepared and stored at -20°C. In preparation of each representative formulation listed in Table 5 below, the indicated lipid components were added to the ethanol solution to achieve the given final concentration and molar ratio to prepare a final volume of 3 ml of ethanol. Separately, an aqueous buffer solution of hSMN-1 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / ml stock solution. The lipid solution was rapidly injected into the aqueous mRNA solution, either manually or with a syringe pump, and vortexed to obtain a final 20% ethanol suspension. The resulting nanoparticle suspension was filtered, dialyzed against 1x PBS (pH 7.4), concentrated, and stored between 2-8°C. SMN-1 mRNA concentrations were measured by Ribogreen® (Invitrogen) assay. Encapsulation of mRNA was determined by performing Ribogreen assay in the presence or absence of 0.1% Triton®-X100. Particle size (Dynamic Light Scattering (DLS)) and zeta potential were determined using a Malvern Zetasizer instrument in 1x PBS and 1 mM KCl solutions, respectively. [Table 6-1] [Table 6-2] [Table 6-3] Example 2 Intrathecal administration of mRNA-loaded liposomal nanoparticles

[0171] This example demonstrates an exemplary method for intrathecal administration of mRNA-loaded liposomal nanoparticles and methods for analyzing the mRNA delivered into neurons.

[0172] All studies were performed on either rats or mice that were approximately 6-8 weeks old at the start of each experiment. At the start of the experiment, each animal was anesthetized with isoflurane (at 1-3% concentration) via inhalation. Once anesthetized, each animal had hair shaved from the exact injection site (L4-L5 or L5-L6). Following needle insertion, a reflex tail flick was used to indicate puncture into the dura and to confirm intrathecal placement. Each animal received a single bolus intraspinal injection of one of the test formulations listed in Table 6. All animals were sacrificed 24 hours after injection and perfused with saline. Isolation of organ tissue for analysis

[0173] All animals had their whole brains and spinal cords removed. Brains were cut longitudinally and placed into one tissue cassette per animal. Whole spinal cords were stored in a 15 ml tube containing 10% neutral buffered formalin (NBF) for no less than 24 hours and no more than 72 hours before being transferred to a 70% tissue grade alcohol solution. Each spinal cord sample was cut into cervical, thoracic, and lumbar sections. Each spinal cord section was cut in half and both halves were placed into separate cassettes for processing for each section (cervical, thoracic, and lumbar). All three cassettes were embedded into one paraffin block per animal. When applicable, brains and portions of spinal cord were snap frozen and stored at -80°C. hSMN-1 Western blot analysis

[0174] Following standard Western blot procedures, different antibodies that recognize the hSMN-1 protein are used, including (A) anti-SMN 4F11 antibody diluted 1:1000, (B) Pierce PA5-27309 a-SMN antibody diluted 1:1,000, and (C) LSBio C138149 a-SMN antibody diluted 1:1,000. In each experiment, 1 microgram of hSMN mRNA was transfected at ~1 x 106 BHK-21 cells were transfected with hSMN-1. Cells were treated with OptiMem® and harvested 16-18 hours post-transfection. Cell lysates were harvested, processed, and loaded onto 8-16% Tris-Glycine gels. The gels were transferred to PVDF membranes and treated with the respective primary antibodies. Goat anti-mouse HRP antibody was used as secondary antibody at 1:10,000 dilution for 45 minutes at room temperature, followed by washing and measurement. The data show that each antibody tested shows strong signal for hSMN-1 and is specific for human SMN, as shown by the absence of cross-reactive signal in untreated BHK cells (Figure 1). In situ hybridization (ISH) analysis

[0175] Representative biological samples were analyzed for hSMN-1 mRNA using two different in situ hybridization methods. In situ hybridization was performed using RNAscope® (Advanced The assay was performed using Cell Diagnostics' ZZ probe technology. The probe was generated based on the codon-optimized sequence of human SMN messenger RNA (SEQ ID NO: 3). Briefly, the RNAscope® assay is an in situ hybridization assay designed to visualize single RNA molecules per cell in slide-mounted formalin-fixed paraffin-embedded (FFPE) tissues. Each embedded tissue sample was pretreated according to the manufacturer's protocol and incubated with a target specific hSMN-1 RNA probe. The hSMN-1 probe was shown to be specific for human SMN-1 and to have no cross-reactivity with mouse or rat SMN-1. Once bound, the hSMN-1 probe hybridized to a cascade of signal amplification molecules through a series of six consecutive rounds of amplification. The samples were then treated with an HRP-labeled probe specific for the signal amplification cassette and assayed by color visualization using 3,3'-diaminobenzidine (DAB). A probe specific for ubiquitin C was used as a positive control. Positive SMN signals were compared with untreated and vehicle control treated rat or mouse tissues. Stained samples were viewed under a standard bright field microscope.

[0176] As a second approach, a fully automated in situ hybridization analysis was performed with a Leica BondRx detection system. Probes were generated based on the codon-optimized sequence of human SMN messenger RNA (SEQ ID NO: 3). Briefly, each embedded tissue sample was pretreated according to the manufacturer's protocol and incubated with a target-specific HRP-labeled hSMN-1 RNA probe. A Ubiquitin C probe was used as a positive control (Figure 18) and a DapB probe was used as a negative control probe (Figure 17). Hybridization was assayed using Fast Red, an alkaline phosphatase staining substrate. Immunohistochemical analysis

[0177] Lipid nanoparticles loaded with human SMN-1 mRNA were administered to rats by intrathecal injection, and tissue samples were collected and processed 24 hours after administration as described above. The rat spinal cord tissue samples were then assayed for hSMN-1 protein expression. Briefly, paraffin-embedded fixed tissues were processed and mounted on slides. The slides were dewaxed, rehydrated, and antigen retrieval was performed using citrate buffer and a pressure cooker. Primary antibody incubation was performed overnight at 4°C using various blocking buffers followed by 4F11 antibody at a 1:2500 dilution. The resulting slides were washed and incubated with secondary antibody polymer at ambient temperature, followed by washing and color development. The data show that human SMN-1 protein staining is observed only 24 hours after intrathecal administration of hSMN-1 mRNA, when compared to untreated controls (Figure 22). This confirms previous findings demonstrating delivery of hSMN-1 mRNA to spinal cord tissue. Furthermore, the data show that once delivered to hSMN-1 cells, the mRNA is efficiently expressed to produce hSMN-1 protein. Example 3 Efficient intracellular delivery of mRNA in neurons

[0178] The data presented in this example demonstrate that intraspinal administration of liposomes (lipid or polymer-based nanoparticles) loaded with hSMN-1 mRNA is successful in intracellular delivery of mRNA in neurons throughout the brain and spinal cord, including difficult to reach cells such as anterior horn cells and dorsal root ganglion.

[0179] The results indicate that mRNA encapsulated in lipid nanoparticles can be efficiently delivered to various cellular tissues of the CNS following intrathecal administration. Using the 13 different formulations disclosed in Table 6, mRNA was efficiently delivered and internalized into various neurons of the spinal cord (Figures 2A-14C) as evidenced by two independent in situ hybridization assays. Surprisingly, intracellular mRNA delivery was demonstrated and expressed as protein in the difficult-to-reach neuronal site of the spinal cord anterior horn, located deep within the biological tissue of the spinal column (Figures 19-22). There was little or no background observed in mouse or rat SMN-1, indicating specificity for the human SMN-1 probe (Figures 15-17). Positive SMN signals were compared to untreated and vehicle control treated rat or mouse tissues. Stained samples were viewed under a standard brightfield microscope.

[0180] These data demonstrate that lipid or nanoparticle based mRNA delivery techniques described herein are capable of successfully penetrating the complex and dense cell membranes of spinal cord neurons and delivering a payload of mRNA for production of the encoded protein within the neuron. The mRNA delivery techniques described herein also successfully penetrate difficult to access neurons such as anterior horn cells and dorsal root ganglia. It is particularly surprising that the results of the present study were consistent with those reported in the literature. Thus, the data presented herein indicate that lipid or polymer nanoparticle based mRNA delivery methods are promising options for the treatment of CNS diseases. In particular, the present invention shows that nanoparticles loaded with hSMN mRNA can be efficiently delivered to neurons, including hard to reach motor neurons, of the spinal cord for the production of SMN protein and the treatment of spinal muscular atrophy. Example 4 Efficient intracellular delivery of mRNA within grey and white matter of the brain

[0181] The data presented in this example demonstrate that intraspinal administration of liposomes (e.g., lipid or polymer-based nanoparticles) loaded with hSMN-1 mRNA is successful in intracellular delivery of mRNA to neurons in the brain, including in difficult-to-access tissues located deep within the brain, such as the white matter.

[0182] The studies were conducted on rats that were approximately 6-8 weeks old at the start of each experiment using the methods and techniques described above. Briefly, at the start of the experiment, each animal was anesthetized with isoflurane (1-3% impact) via inhalation. Once anesthetized, the exact injection site (L4-L5, or L5-L6) was shaved for each animal. Following needle insertion, a reflex tail flick was used to indicate puncture of the dura and to confirm intrathecal placement. Each animal received a single bolus intraspinal injection of one of the test formulations listed in Table 6. All animals were sacrificed 30 minutes out to 24 hours post-injection and perfused with saline. The data presented in Example 4 describes the results of mRNA delivery using formulation 13 in Table 6 above. In situ hybridization (ISH) analysis

[0183] Lipid nanoparticles loaded with human SMN-1 mRNA were administered to rats via intrathecal injection, and tissue samples were collected at 30 minutes and assayed for hSMN-1 mRNA using RNAscope® (Advanced Cell Diagnostics) ZZ probe technology 24 hours after administration, as described above. Each embedded tissue sample was pretreated and incubated with the specific hSMN-1 RNA probe of interest, as per the manufacturer's protocol. The data show that staining was observed throughout brain tissue as soon as 30 minutes after intrathecal administration of hSMN-1 mRNA, compared to untreated controls (FIG. 23A). This confirms previous findings and highlights the speed and efficacy of the mRNA delivery method, which delivers mRNA as soon as 30 minutes after IT delivery. Furthermore, the data show the surprising and unexpected discovery that mRNA delivery according to the present invention efficiently delivers mRNA to both gray matter tissue (located at the periphery of the brain) and white matter tissue (located deep within the brain). Therefore, this approach can serve as a viable therapy to treat neurological or neuromuscular diseases that develop as a result of dysregulation of cells located deep within the hard-to-reach white matter tissue of the brain. Equivalent

[0184] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. The scope of the invention is not limited to the foregoing description, but rather is set forth in the following claims.

Claims

[Claim 1] Methods and compositions for efficiently delivering messenger RNA (mRNA) as described herein to the central nervous system (CNS).

Images