Pharmaceutical composition for treating diseases, disorders, or symptoms related to abnormality in immune system

Abstract

To provide a safe immunity control method.SOLUTION: Provided is a pharmaceutical composition that contains CTLA-4 or a nucleic acid encoding the same, or a functional equivalent thereof, or a factor that induces at least one thereof, for the prevention or therapy of wounds, or of diseases, disorders, or symptoms associated with wounds.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to pharmaceutical compositions for treating diseases, disorders or conditions associated with immune system abnormalities. [Background technology]

[0002] Cytotoxic T-lymphocyte antigen 4 (CTLA-4) is an important negative regulatory molecule in the immune system. Constitutive high expression of CTLA-4 is a characteristic of regulatory T cells (Tregs). CTLA-4 is required for Tregs to suppress harmful immune responses and maintain immune homeostasis. Activated effector T cells also express CTLA-4, providing a feedback mechanism to prevent excessive immune responses.

[0003] CTLA-4 is known to have two splicing variants that can bind to the costimulatory molecule CD80 / 86: mCTLA-4, which has a transmembrane domain encoded by exon 3 and is anchored in the cell membrane, and sCTLA-4, which lacks exon 3 for secretion. However, most studies on CTLA-4 have not distinguished the role of each CTLA-4 variant in immune homeostasis. Summary of the Invention [Means for solving the problem]

[0004] Based on the discovery of the action of secreted CTLA-4 in the body, the inventors have found that a pharmaceutical composition containing CTLA-4, a nucleic acid encoding it, or a functional equivalent thereof, or a factor that induces at least one of them, is associated with immune regulation.

[0005] CTLA-4, especially secretory CTLA-4, can be used to induce M2 macrophages under inflammation conditions, promoting wound healing, etc. M2 macrophages can also express cytokines and molecules that negatively regulate the immune system, suppress inflammation, and even achieve tissue repair and remodeling.

[0006] Thus, the present disclosure provides: (Item 1) A pharmaceutical composition comprising CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a wound, or a disease, disorder or condition associated with a wound. (Item 2) 2. The pharmaceutical composition according to item 1, wherein the CTLA-4 comprises at least one selected from the group consisting of secretory CTLA-4 and membrane-type CTLA-4. (Item 3) The pharmaceutical composition of any one of the preceding claims, wherein the CTLA-4 comprises secreted CTLA-4. (Item 4) The pharmaceutical composition according to any one of the preceding items, which is administered locally. (Item 5) The pharmaceutical composition according to any one of the preceding items, which is administered systemically. (Item 6) The pharmaceutical composition of any one of the preceding items, administered in combination with an antibiotic, antifungal, or antiviral agent. (Item 7) A combination comprising CTLA-4 and an antibiotic for treating or preventing a wound, or a disease, disorder or condition involving a wound. (Item D1) A pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a disease, disorder or condition. (Item D2) The pharmaceutical composition described in the above item, wherein the functional equivalent includes a protein or peptide containing a MYPPPY motif region encoded by Exon 2 of the CTLA-4 gene, and a dimer or multimer of said protein or peptide. (Item D3) The pharmaceutical composition according to any one of the above items, wherein the functional equivalent comprises a protein expressed in which the signal sequence encoded by Exon 1 of the CTLA-4 gene is replaced with another signal sequence of homologous or heterologous origin. (Item D4) The pharmaceutical composition according to any one of the preceding items, which is administered locally. (Item D5) The pharmaceutical composition according to any one of the preceding items, which is administered systemically. (Item D6) The pharmaceutical composition of any one of the preceding items, administered in combination with an antibiotic, antifungal, or antiviral agent. (Item A1) A pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or a factor that induces at least one of them, for treating or preventing a disease, disorder or condition associated with an abnormality in the immune system. (Item A2) The pharmaceutical composition described in the above item, wherein the disease, disorder or symptom associated with an abnormality in the immune system includes an immune system disease accompanied by inflammation. (Item A3) The pharmaceutical composition according to any one of the preceding items, wherein the disease, disorder or condition associated with an abnormality in the immune system includes an autoimmune disease and / or an allergy, or a disease, disorder or condition associated therewith. (Item A4) The pharmaceutical composition according to any one of the preceding items, wherein the disease, disorder or condition associated with an abnormality in the immune system includes a disease, disorder or condition associated with an autoimmune disease. (Item A5) The pharmaceutical composition according to any one of the preceding claims, wherein the disease, disorder or condition associated with an abnormality in the immune system comprises an allergy-related disease, disorder or condition. (Item A6) The pharmaceutical composition according to any one of the above items, wherein the functional equivalent comprises a protein or peptide comprising a MYPPPY motif region encoded by Exon 2 of the CTLA-4 gene, and a dimer or multimer of said protein or peptide. (Item A7) The pharmaceutical composition according to any one of the above items, wherein the functional equivalent comprises a protein expressed in which the signal sequence encoded by Exon 1 of the CTLA-4 gene is replaced with another signal sequence of homologous or heterologous origin. (Item A8) The pharmaceutical composition according to any one of the preceding items, which is administered locally. (Item A9) The pharmaceutical composition according to any one of the preceding items, which is administered systemically. (Item A10) The pharmaceutical composition of any one of the preceding items, administered in combination with an antibiotic, antifungal, or antiviral agent. (Item B1) 1. A method for screening for a substance for treating or preventing a wound, or a disease, disorder or condition associated with a wound, comprising: contacting the cell with a candidate substance; measuring the expression level of CTLA-4 in the cells or on the surface of the cells; selecting a candidate substance that increases the amount or level of CTLA-4 in or on the cell surface compared to before contact with the candidate substance; A method comprising: (Item C1) 1. A method for screening a substance for treating or preventing a disease, disorder, or condition associated with an abnormality in the immune system, comprising: contacting the cell with a candidate substance; measuring the expression level of secretory CTLA-4 in or outside the cells; selecting a candidate substance that increases the amount or level of secreted CTLA-4 in or outside the cell compared to before contact with the candidate substance; A method comprising:

[0007] It is contemplated that one or more of the above features may be provided in combinations other than those specifically stated.Further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary.

[0008] Furthermore, features and notable actions and effects of the present disclosure other than those described above will become apparent to those skilled in the art by referring to the following description of the preferred embodiments of the present invention and the drawings. Effect of the Invention

[0009] The present disclosure can provide a pharmaceutical composition comprising CTLA-4 or a nucleic acid encoding it, or a functional equivalent thereof, or a factor inducing at least one of them, for treating or preventing a wound, or a disease, disorder, or symptom associated with a wound. The pharmaceutical composition of the present disclosure is involved in immune regulation, and is therefore expected to treat diseases associated with immune system abnormalities as well as repair and remodel tissues destroyed by autoimmune diseases and the like. [Brief description of the drawings]

[0010] [Figure 1A] sCTLA-4 and mCTLA-4 mRNA expression in naive or effector CD4+ T cells from 8-week-old wild-type Balb / c mice. [Figure 1B] Increase in sCTLA-4 in human effector Tregs. Human sCTLA-4 mRNA expression was measured in CD4+CD45RA+CD25+ cells (naive Tregs), CD4+CD45RA-CD25high+ cells (effector Tregs: <1% of CD25high) and CD4+CD45RA-CD25int+ cells (Foxp3+ non-Tregs). [Figure 1C] sCTLA-4 and mCTLA-4 mRNA expression in CD4+Foxp3+(GFP+) cells isolated from OVA / CFA-immunized DEREG DO11.10 mice at days 0, 7, 14, and 21 post-immunization. [Figure 1D]Increased sCTLA-4 in Tregs isolated from chronically wounded mice. We measured sCTLA-4 and mCTLA-4 mRNA expression in Foxp3+(GFP+)CD4+T cells isolated from the superficial lymph nodes of DEREG male mice that had been accidentally injured during group fights. [Figure 1E] Schematic diagram of the CTLA-4 locus in S+M- mice. A vector was designed to delete the splicing acceptor site (86 bp) in front of exon 3. Homologous recombination was induced in ES cells by electroporation to generate chimeric mice, which were then crossed with FLPeR mice carrying the FLP1 recombinase gene to delete the neo cassette. The offspring are S+M-knockin mice. Schematic diagrams of the CTLA-4 locus in sCTLA-4(S)+mCTLA-4(M)+ wild-type mice, S+M- mice, and SM- mice are also shown. [Figure 1F] Co-staining of CTLA-4 and Foxp3 in CD4+ T cells after stimulation with PMA / ionomycin / monensin for 4 hours. [Figure 1G] Increased circulating CTLA-4 protein in S+M− mice. [Figure 1H] Exon 3 is skipped in CTLA_4 mRNA from S+M- mice. RNA expression of sCTLA-4 (using primers flanking exon 2-4 junction) and mCTLA-4 (using primers flanking exon 3-4 or exon 2-3 junction) in CD4+ T cells in spleen cells and lymphocytes from 3-week-old mice was measured. [Figure 1I] Three-week-old male S+M+, S+M- and SM- mice and their body weights. [Figure 1J] Spleen and lymph node enlargement in S+M- and SM- mice. [Figure 1K] Serum concentration of anti-dsDNA IgG antibody (antinuclear antibody). [Figure 1L] Serum concentration of anti-gastric parietal cell IgG antibodies. [Figure 1M]Survival curves of S+M-, SM-, S-M+ and S+M+ mice. Statistical significance between S+M- and SM- mice was obtained by log-rank test (P<0.0001). [Figure 2A] Percentage of CD80+ or ​​CD86+ subsets among splenic CD11b+ cells, CD11c+ cells, and B220+ cells. [Figure 2B] IL-4, IL-6, and IL-10 mRNA expression in isolated splenic CD11b+ cells. [Figure 2C] IL-10 concentration in the supernatant of F4 / 80+CD11b+ peritoneal macrophages cultured for 24 hours. [Figure 2D] Serum levels of IL-10. [Figure 2E] RNA-seq of F4 / 80+CD11b+ peritoneal macrophages. Multidimensional scaling plot (PCoA) of whole transcript analysis. [Figure 2F] Gene Ontology (GO) analysis of biological processes (1). The top set of GO terms most enriched in the comparison of Mφ groups isolated from the indicated mice is shown. [Figure 2G] Gene Ontology (GO) analysis of biological processes (2). The top set of GO terms most enriched in the comparison of Mφ groups isolated from the indicated mice is shown. [Figure 2H] Gene Ontology (GO) analysis of biological processes (3). The top set of GO terms most enriched in the comparison of Mφ groups isolated from the indicated mice is shown. [Figure 2I] Heat map of gene expression ratio (Log fold change) of peritoneal macrophages of S+M- and SM- mice relative to the gene expression level of wild-type S+M+ mice. A list of genes showing significant difference (P<0.001) between S+M- and SM- is shown. [Figure 2J] The relative FPKM values ​​of M1 / M2-associated genes in peritoneal macrophages are shown by a color-coded matrix. [Figure 2K] Comparison of the expression of representative genes induced by IL-4 and IL-13 in macrophages. [Figure 3A] Serum concentrations of IL-5 and IL-4. [Figure 3B] Percentage of IL-5-producing cells among Foxp3-CD4+ blood cells stimulated with PMA / ionomycin / monensin for 5 hours. [Figure 3C] Percentage of IL-4-producing cells among Foxp3-CD4+ blood cells stimulated with PMA / ionomycin / monensin for 5 hours. [Figure 3D] Percentage of eosinophils among CD45+ blood cells. [Figure 3E] Siglec-F expression in eosinophils infiltrating the spleen. [Figure 3F] IL-4 mRNA expression in eosinophils isolated from the spleen. [Figure 3G] Serum concentrations of eotaxin (CCL11) and CCL22. [Figure 3H] CCL24 expression levels in peritoneal macrophages. [Figure 3I] Increased CD206 expression in alveolar macrophages of S+M− mice. [Figure 3J] CD80 MFI and CD206 MFI of splenic macrophages from SM mice cultured with IL-4 and IL-10 for 24 h. [Figure 3K] Serum IL-33 was not increased in S+M- mice. [Figure 3L] Serum TSLP was not increased in S+M- mice. [Figure 3M] Innate lymphoid cells (ILCs) were not increased in the blood of S+M- mice. [Figure 3N] Innate lymphoid cells (ILCs) were not increased in the mesentery of S+M- mice. [Figure 3O] Basophils and c-Kit+ cells were not increased in CD45+ blood cells from S+M- mice. [Figure 4A]Th2 and Th1 differentiation in the presence of CD80 / 86 blocking antibodies. Naive T cells were stimulated with anti-CD3 mAb and T cell-depleted spleen cells (mainly antigen-presenting cells) under Th2 or Th1 conditions for 3 days using anti-CD80 and anti-CD86 mAbs, followed by stimulation with PMA / ionomycin / monensin for 5 hours to determine the percentage of Th2 or Th1 differentiation. [Figure 4B] The percentage of Th2 or Th1 differentiation was calculated assuming the condition without CD80 or CD86 blocking as 100%. [Figure 4C] Th2 and Th1 differentiation in the presence of sCTLA-4 recombinant proteins. Naive T cells were stimulated with sCTLA-4 WT (wild type), sCTLA-4 Y139A (mutant), or CTLA-4 Ig for 3 days with anti-CD3 mAb and T cell-depleted splenocytes (mainly antigen-presenting cells), followed by stimulation with PMA / ionomycin / monensin for 5 hours to determine the percentage of Th2 or Th1 differentiation. [Figure 4D] The percentage of Th2 cell or Th1 cell differentiation was calculated assuming that the condition using CTLA-4 Y139A (negative control) was set as 100%. [Figure 4E] Dose-response curves of the inhibitory effect of sCTLA-4 WT and CTLA-4 Ig on Th1 differentiation. The percentage of Th1 differentiation was calculated based on the condition using CTLA-4 Y139A (negative control) as 100%. Compared to sCTLA-4 Y139A, * indicates P<0.05, *** indicates P<0.001, and **** indicates P<0.0001. [Figure 4F] Dose-response curves of the inhibitory effect of sCTLA-4 WT and CTLA-4 Ig on Th2 differentiation. The percentage of Th2 differentiation was calculated based on the condition using CTLA-4 Y139A (negative control) as 100%. Compared to sCTLA-4 Y139A, * indicates P<0.05, *** indicates P<0.001, and **** indicates P<0.0001. [Figure 4G]mRNA expression of CD206, Arg1 and iNOS in RAW264.7 cells after 24 h of culture with sCTLA-4 WT (5 μg / mL), sCTLA-4 Y139A (5 μg / mL), CTLA-4 Ig (5 μg / mL) or IL-4 (10 ng / mL). [Figure 5A] mRNA expression of sCTLA-4 and mCTLA-4 in CD4+ T cells from each lymph node indicated. [Figure 5B] Large intestines of S+M-, SM- and S+M+ mice. [Figure 5C] Length of the large intestine. [Figure 5D] Hematoxylin and eosin staining of the colon. [Figure 5E] IFNγ- and IL-17A-producing cells in Foxp3 − CD4 + T cells in mesenteric lymph nodes. [Figure 5F] mRNA expression of CD206, Fizz1, iNOS, and IL-6 in CD45+Siglec-F-Ly6G-CD11b+F4 / 80+ macrophages isolated from the large intestine. [Figure 5G] Suppression of colitis by sCTLA-4. CD45RBhigh naive T cells isolated from CD45.1 congenic mice were intravenously administered to 6-week-old combined immunodeficient mice (C.B17 / Icr-scid) alone (black circle) or together with Foxp3+(GFP+)CD4+Tregs isolated from 3-week-old DEREG S+M- (white circle), DEREG SM- (white triangle), or DEREG S+M+ mice (white square). Body weight on the day of cell adoptive transfer (Day 0) was calculated as 100%. [Figure 5H] Hematoxylin and eosin stained colon section from a C.B17 / Icr-scid mouse 8 weeks after adoptive cell transfer as described in Figure 5G. [Figure 5I] Colitis was scored histologically, and data were subjected to Kruskal-Wallis and Dunn's multiple comparison tests. [Figure 5J]Suppression of tumor immunity by sCTLA-4. C57BL / 6 mice were subcutaneously injected with wild-type sCTLA-4 (sCTLA-4 WT), Y139A mutant sCTLA-4 (sCTLA-4 Y139A), or CTLA-4 Ig-producing B16F10 melanoma cells. The long and short sides of the tumors were measured every other day. The area of ​​the tumor was calculated using the two diameters. The dark bold line shows the mean growth curve of individual tumors (n numbers are shown in the legend) shown with dotted lines. Statistical significance between sCTLA-4 WT B16F10 and sCTLA-4 Y139A B16F10 was shown at days 6, 8, 11, 13, and 15 after inoculation (* indicates P<0.0005). [Figure 5K] Suppression of tumor immunity by sCTLA-4 is an effect on T cells. Nude mice were subcutaneously injected with wild-type sCTLA-4 (sCTLA-4 WT), Y139A mutant sCTLA-4 (sCTLA-4 Y139A), or CTLA-4 Ig-producing B16F10 melanoma cells. The long and short sides of the tumors were measured every other day. The tumor area was calculated using the two diameters. The dark bold line shows the mean growth curve of individual tumors (n=5), which are shown by dotted lines. [Figure 5L] Concentration of IFNγ in cell extracts of tumors 12 days after inoculation. Data were subjected to Kruskal-Wallis test followed by Dunn's test. [Figure 5M] Promotion of tumor M2 macrophage differentiation by sCTLA-4. CD206 expression on B16F10 melanoma-infiltrating macrophages 12 days after inoculation. [Figure 6A] Schematic diagram of the E. coli artificial chromosome (BAC) CTLA-4 locus in S-M+ mice. The BAC vector (RP23-146J17) was modified to delete the intron between exon 3 and exon 4. BAC transgenic mice were crossed with SM- mice to generate S-M+ mice. [Figure 6B] Co-staining of CTLA-4 and Foxp3 in CD4+ T cells from S-M+ and S+M+ mice. [Figure 6C]CD4+ T cells from 6-week-old S-M+ mice do not express sCTLA-4, but do express mCTLA-4. [Figure 6D] Co-staining of CD44 and CD62L in CD8+ T cells from spleens (Sp) or lymph nodes (Ln) of 8, 16 and 24 week old mice. Representative flow cytometry data shows CD8+ T cells from a 24 week old mouse. [Figure 6E] Co-staining of CD44 and CD62L in CD4+ T cells from spleens or lymph nodes of 24-week-old mice. [Figure 6F] 30-week-old female S-M+ mice and wild-type control (S+M+) mice. [Figure 6G] Representative images of the spleen and peripheral lymph nodes. [Figure 6H] Total cell counts in spleen (Sp), mesenteric or superficial lymph nodes (Ln). [Figure 6I] Representative hematoxylin-eosin stained sections of adipose tissue (n=10 each) and lungs (n=6 each) from S-M+ and control (S+M+) mice. [Figure 6J] Serum concentrations of anti-dsDNA IgG antibodies (antinuclear antibodies), anti-gastric parietal cell IgG antibodies, IL-6, and TNF-α. Data were subjected to the Mann-Whitney test. [Figure 6K] mRNA expression of iNOS (Nos2) and IL-6 in CD11b+F4 / 80+ peritoneal macrophages. [Figure 6L] CD8+ T cells from spleen, mesenteric lymph nodes, or superficial lymph nodes were stimulated with PMA / ionomycin / monensin for 5 hours and then co-stained for IFNγ and Eomes. [Figure 6M] CD4+ T cells from spleen, mesenteric lymph nodes, or superficial lymph nodes were stimulated with PMA / ionomycin / monensin for 5 hours and then co-stained for IFNγ and IL-17A. [Figure 6N]sCTLA-4 plays an important role in wound healing. Two wounds were made on the back skin of 12-week-old S-M+ and S+M+ mice using a 6 mm biopsy punch (n=8 mice per mouse). The average wound area (mm2) of the two wounds on the back of each mouse was measured from images on days 1 (d1), 3 (d3), and 5 (d5) after wounding. [Figure 6O] sCTLA-4 plays an important role in the re-epithelialization process after wounding. K14+ epidermal basal keratinocytes (green) and DAPI (blue) were visualized by immunofluorescence staining in wounded skin sections at day 5 (d5). Re-epithelialization was quantified by the length of the wound tongue that K14+ epidermal keratinocytes proliferated and filled during wound healing (Epi tongue length). The arrow indicates the wound edge at a time point (d1) that did not yet show signs of re-epithelialization. [Figure 6P] External observation of wound healing in 30-week-old mice. 30-week-old S-M+ mice (indicating autoimmune pathology) and S+M+ mice were wounded at two sites per mouse using a 6 mm biopsy punch (n=8 for each). The average wound area (mm2) of two sites on the back of each mouse was measured from images on days 1 (d1), 3 (d3), and 5 (d5) after wounding. [Figure 6Q] Quantification of the re-epithelialization process in 30-week-old mice. K14+ epidermal basal keratinocytes (green) and DAPI (blue) were visualized by immunofluorescence staining in wound skin sections at day 5 (d5), and re-epithelialization was quantified by Epi tongue length. The arrow indicates the wound edge at a time point (d1) that does not yet show signs of re-epithelialization. [Figure 6R] Inflammation caused by IFNγ-producing T cells delays wound healing. The degree of wound healing in 12-week-old S-M+ mice (Figure 6N) was compared with that in 30-week-old S-M+ mice (showing type 1 autoimmune pathology) (Figure 6P). [Figure 7A] Serum concentrations of IgE in 30-week-old mice. Data were subjected to the Mann-Whitney test. [Figure 7B]Follicular helper T cells (Tfh:Bcl-6+CXCR5+Foxp3-CD44+CD4+B220- (Fig. 7B) or PD-1+CXCR5+Foxp3-CD44+CD4+B220-) were increased in the Peyer's patches and mesenteric lymph nodes of S-M+ mice (Fig. 7C). [Figure 7C] Follicular helper T cells (Tfh:Bcl-6+CXCR5+Foxp3-CD44+CD4+B220- (Fig. 7B) or PD-1+CXCR5+Foxp3-CD44+CD4+B220-) were increased in the Peyer's patches and mesenteric lymph nodes of S-M+ mice (Fig. 7C). [Figure 7D] sCTLA-4 suppresses the progression of allergic pathology in healthy mice. OVA-induced asthma experiments in the lungs were performed according to the scheme shown in the figure. A significant increase in allergic reactive GATA3+Th2 was observed in healthy 8-week-old S-M+ mice that had not yet shown autoimmune pathology. [Figure 7E] A significant increase in allergic reactive GATA3+Th2 was observed in healthy 8-week-old S-M+ mice without autoimmune pathology. [Figure 7F] Percentage of lung CD11c-IA / IE-CD24+Siglec-F+eosinophils. [Figure 7G] Co-staining of CD206 and CD71 in alveolar macrophages (CD11c+Siglec-F+CD11bintCD64+). Expression of each was quantified as median fluorescence intensity (Figure 7H, I). [Figure 7H] CD206 expression was quantified as median fluorescence intensity. [Figure 7I] CD71 expression was quantified as median fluorescence intensity. [Figure 7J] sCTLA-4 suppresses lymphocyte infiltration into allergic tissues. Hematoxylin and eosin staining of lung tissue. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present disclosure will be described below while showing the best mode. Throughout this specification, the expression of the singular form should be understood to include the concept of the plural form, unless otherwise specified. Therefore, the singular article (for example, in the case of English, "a", "an", "the", etc.) should be understood to include the concept of the plural form, unless otherwise specified. In addition, it should be understood that the terms used in this specification are used in the sense commonly used in the field, unless otherwise specified. Therefore, unless otherwise defined, all technical terms and scientific and technical terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will take precedence.

[0012] The following provides definitions of terms particularly used in this specification and / or explains basic technical content as appropriate.

[0013] In this specification, "about" means ±10% of the following numerical value. For example, "about 20" includes "18 to 22". Numerical ranges include all numerical values ​​between and at the endpoints. "About" in relation to a range applies to both endpoints of the range. Thus, for example, "about 20 to 30" includes "18 to 33".

[0014] In this specification, amino acid residues are represented by the following abbreviations. Ala or A: Alanine Arg or R: Arginine Asn or N: Asparagine Asp or D: Aspartic acid Cys or C: Cysteine Gln or Q: Glutamine Glu or E: glutamic acid Gly or G: glycine His or H: histidine Ile or I: Isoleucine Leu or L: leucine Lys or K: Lysine Met or M: methionine Phe or F: Phenylalanine Pro or P: Proline Ser or S: serine Thr or T: Threonine Trp or W: Tryptophan Tyr or Y: Tyrosine Val or V: Valine

[0015] As used herein, "CTLA-4" refers to cytotoxic T-lymphocyte-associated protein 4. CTLA-4 nucleotide and polypeptide sequences are well known in the art. Exemplary human CTLA-4 amino acid sequences are described in NCBI reference numbers CCDS42803 and CCDS2362 (ID:CCDS42803 represents human secreted CTLA-4, ID:CCDS2362 represents human membrane-type CTLA-4, and generally, when simply referred to as CTLA-4, it refers to the membrane type), and exemplary mouse CTLA-4 amino acid sequences are described in NCBI reference numbers CCDS69893 and CCDS14993 (ID:CCDS69893 represents mouse secreted CTLA-4, ID:CCDS14993 represents mouse membrane-type CTLA-4, respectively).

[0016] As used herein, the term "membrane-type CTLA-4" refers to a splicing variant of CTLA-4, which has exons 1 to 4 and is anchored in the cell membrane by the transmembrane domain encoded by exon 3.

[0017] As used herein, the term "secreted CTLA-4" refers to one of the splicing variants of CTLA-4, which is a product of the ligation and translation of exons 1, 2, and 4. Secreted CTLA-4 lacks the transmembrane domain encoded by exon 3, and is therefore secreted outside the cell.

[0018] As used herein, the term "wound" refers to a state in which the tissue surface is damaged due to some cause, such as an abrasion, a laceration, an incision, a contusion, an ulcer, a bedsore, a diabetic ulcer, a burn, inflammation, or cell necrosis. The tissue includes, for example, the skin and mucosa. The skin includes the epidermis, dermis, and subcutaneous tissue. The mucosa includes the epithelium (or mucosal epithelium), the lamina propria, and the submucosa.

[0019] As used herein, the term "disease, disorder or condition associated with a wound" refers to the wound itself or any disease, disorder or condition associated with a wound. Thus, the term "disease, disorder or condition associated with a wound" includes wounds such as abrasions, lacerations, incisions, contusions, ulcers, bedsores, diabetic ulcers, burns, inflammation, and cell necrosis, as well as dermatitis such as localized scleroderma, psoriasis, pemphigus, pemphigoid, herpes gestationis, linear IgA bullous dermatosis, epidermolysis bullosa acquisita, and atopic dermatitis.

[0020] As used herein, the term "diseases, disorders, or symptoms associated with immune system abnormalities" refers to any disease, disorder, or symptom caused by immune system abnormalities. Thus, diseases, disorders, or symptoms associated with immune system abnormalities can include autoimmune diseases and / or allergies, or diseases, disorders, or symptoms associated therewith, and autoimmune diseases can include those described elsewhere herein.

[0021] As used herein, "allergy" refers to a hypersensitive reaction that occurs when a living body that has been sensitized to an antigen is reintroduced to that antigen, or a state that exhibits such a hypersensitive reaction. An allergic reaction can occur when contacting an antigen or ingesting the antigen. Therefore, as used herein, "allergy, or a disease, disorder, or symptom related thereto" includes atopic dermatitis, allergic rhinitis, hay fever, allergic conjunctivitis, allergic gastroenteritis, bronchial asthma, childhood asthma, food allergies, drug allergies, urticaria, and the like.

[0022] As used herein, the term "autoimmune disease" refers to a general term for diseases in which an abnormality occurs in the innate or adaptive immune system, which is supposed to recognize and eliminate foreign substances such as pathogenic microorganisms that invade from the outside, and components that make up one's own cells or tissues are recognized as foreign substances, resulting in the constant excessive production of autoantibodies and autoreactive lymphocytes, causing systemic or organ-specific inflammation accompanied by cytokine production, leading to tissue damage.Therefore, in the present specification, "diseases, disorders, or symptoms associated with an autoimmune disease" include, for example, Behcet's disease, systemic lupus erythematosus, multiple sclerosis (systemic sclerosis, progressive systemic sclerosis), scleroderma, polymyositis, dermatomyositis, periarteritis nodosa (polyarteritis nodosa, microscopic polyangiitis), aortitis syndrome (Takayasu's arteritis), malignant rheumatoid arthritis, rheumatoid arthritis, juvenile idiopathic arthritis, Wegener's granulomatosis, mixed connective tissue disease, Sjogren's syndrome, adult Still's disease, allergic granulomatous vasculitis, hypersensitivity vasculitis, Cogan's syndrome, RS3PE, temporal arteritis, polymyalgia rheumatica, fibromyalgia, antiphospholipid syndrome, eosinophilic fasciitis, IgG4-related disease (e.g., primary sclerosing cholangitis, autoimmune pancreatitis, etc.), Guillain-Barré syndrome, myasthenia gravis, chronic atrophic gastritis, autoimmune hepatitis, primary biliary cirrhosis, aortitis syndrome, Goodpasture's syndrome, rapidly progressive glomerulonephritis, megaloblastic anemia, autoimmune lytic encephalopathy, Hemolytic anemia, autoimmune neutropenia, idiopathic thrombocytopenic purpura, Graves' disease (hyperthyroidism), Hashimoto's disease, autoimmune adrenal insufficiency, primary hypothyroidism, idiopathic Addison's disease (chronic adrenal insufficiency), type I diabetes mellitus, slowly progressive type I diabetes mellitus (adult latent autoimmune diabetes), chronic discoid lupus erythematosus, localized scleroderma, psoriasis, psoriatic arthritis, pemphigus, pemphigoid, herpes gestationis, linear IgA bullous dermatosis, epidermolysis bullosa acquisita, alopecia areata, vitiligo, vulgaris Examples of autoimmune diseases include vitiligo, atopic dermatitis, neuromyelitis optica, chronic inflammatory demyelinating polyneuropathy, sarcoidosis, bullous pemphigoid, giant cell arteritis, amyotrophic lateral sclerosis, eosinophilic granulomatosis with polyangiitis, Harada's disease, autoimmune optic neuropathy, idiopathic azoospermia, habitual abortion, autoimmune enteritis, inflammatory bowel disease (e.g., ulcerative colitis, Crohn's disease), celiac disease, IBD, IBS, mastocytosis, and autoimmune diseases accompanied by proliferation of IFN-γ-producing CD4-positive helper T cells.

[0023] As used herein, "inflammation" refers to a pathological change caused as a result of a reaction of immune system cells. "Inflammation" includes various reaction mechanisms caused by various stimuli, damage, infection, etc. Whether inflammation has been induced can be identified using known inflammatory markers. Known examples of inflammatory markers include IL-2, IL-6, TNF-α, IL-1β, iNOS, INF-γ, COX-2, NF-κB, etc.

[0024] As used herein, "treat," "treat," "treatment" or "treatment" means reducing or eliminating the cause of a disease, slowing or halting its progression, reducing, alleviating, ameliorating or eliminating its symptoms, and / or inhibiting the worsening of its symptoms in a subject having a disease.

[0025] As used herein, the term "functional equivalent" refers to any entity that has the same intended function but a different structure compared to the original entity of interest. Therefore, the term "CTLA-4 or a nucleic acid encoding it, or a functional equivalent thereof" includes not only CTLA-4 or the nucleic acid encoding it itself, but also fragments, mutants, or variants (e.g., amino acid sequence variants, etc.) of CTLA-4 or the nucleic acid encoding it that have one or more therapeutic or preventive effects on wounds, or diseases, disorders, or symptoms associated with wounds, as well as CTLA-4 or the nucleic acid encoding it itself, or those that can be changed to fragments, mutants, or variants of CTLA-4 or the nucleic acid encoding it at the time of acting (e.g., CTLA-4 or the nucleic acid encoding it itself, or nucleic acids encoding fragments, mutants, or variants of CTLA-4 or the nucleic acid encoding it, and vectors, cells, etc. containing the nucleic acid). A representative example of "CTLA-4 or a nucleic acid encoding it, or a functional equivalent thereof" is at least one factor selected from the group consisting of CTLA-4 and its fragments. In this disclosure, it is understood that functional equivalents of CTLA-4 or the nucleic acid encoding same can be used in the same manner as CTLA-4 or the nucleic acid encoding same, even if not specifically mentioned.

[0026] As used herein, the term "fragment" refers to a polypeptide or polynucleotide having a sequence length of 1 to n-1 relative to the full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed depending on the purpose. For example, the lower limit of the length of the fragment can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or more amino acids in the case of a polypeptide, and a length represented by an integer not specifically listed here (e.g., 11, etc.) can also be suitable as the lower limit. In addition, in the case of a polynucleotide, the lower limit can be 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, or more nucleotides, and a length represented by an integer not specifically listed here (e.g., 11, etc.) can also be suitable as the lower limit. As used herein, it is understood that when such CTLA-4 functions as an activity, for example, a growth suppressing or maintaining factor, the fragment itself is also within the scope of the present invention. In accordance with the present invention, the term "activity" as used herein refers to the function of a molecule in the broadest sense. Activity generally includes, but is not limited to, the biological, biochemical, physical or chemical functions of a molecule. Activity includes, for example, enzymatic activity, the ability to interact with other molecules, and the ability to activate, promote, stabilize, inhibit, suppress or destabilize the function of other molecules, stability, the ability to localize to a specific subcellular location. Where applicable, the term also relates to the function of a protein complex in the broadest sense. As used herein, the term "biological function" refers to a specific function that a gene, nucleic acid molecule or polypeptide related thereto may have in a living organism, including, but not limited to, the production of specific antibodies, enzymatic activity, conferring resistance, and the like. As used herein, a biological function may be exerted by a "biological activity".As used herein, the term "biological activity" refers to the activity that a certain factor (e.g., polynucleotide, protein, etc.) may have in a living body, and includes activities that exert various functions (e.g., transcription promoting activity), and also includes, for example, the activity of activating or inactivating a certain molecule by interacting with another molecule. When two factors interact with each other, the biological activity is the binding between the two molecules and the biological change that occurs as a result of this. For example, when one molecule is precipitated using an antibody and the other molecule is also co-precipitated, the two molecules are considered to be bound. Therefore, observing such co-precipitation is one method of judgment. For example, when a certain factor is an enzyme, its biological activity includes its enzymatic activity. In another example, when a certain factor is a ligand, it includes the binding of the ligand to a corresponding receptor. Such biological activity can be measured by techniques well known in the art. Thus, "activity" refers to various measurable indicators that indicate or reveal binding (either directly or indirectly); affect a response (i.e., have a measurable effect in response to some exposure or stimulus), including, for example, the affinity of a compound to bind directly to a polypeptide or polynucleotide of the invention, or, for example, a measure of the amount of an upstream or downstream protein or other similar function after some stimulus or event.

[0027] "Functionally active" as used herein refers to a polypeptide, fragment or derivative that has a structural, regulatory, or biochemical function of a protein, such as biological activity, according to the aspect to which the polypeptide, fragment or derivative of the invention relates.

[0028] In the present specification, the term "fragment" of CTLA-4 refers to any fragment of CTLA-4, and it is understood that not only the full-length CTLA-4 but also a fragment of CTLA-4 can be used as a factor used in the present invention as long as it has its function, particularly treating or preventing a wound, or a disease, disorder or condition associated with a wound. Thus, the fragment of CTLA-4 used in the present invention usually has at least one function of CTLA-4. Such a function may particularly include the function of treating or preventing a wound, or a disease, disorder or condition associated with a wound.

[0029] In the present specification, the terms "drug", "agent" or "factor" (all of which correspond to the English term agent) are used interchangeably in a broad sense and may refer to any substance or other element (e.g., energy such as light, radioactivity, heat, electricity, etc.) as long as it can achieve the intended purpose. Examples of such substances include, but are not limited to, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA and genomic DNA, and RNA such as mRNA), polysaccharides, oligosaccharides, lipids, organic small molecules (e.g., hormones, ligands, signaling substances, organic small molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (e.g., small molecule ligands, etc.)), and composite molecules thereof. Representative examples of factors specific to a polynucleotide include, but are not limited to, polynucleotides having a certain sequence homology (e.g., 70% or more sequence identity) with respect to the sequence of the polynucleotide and polypeptides such as transcription factors that bind to promoter regions. Representative examples of factors specific to a polypeptide include, but are not limited to, an antibody or a derivative or analog thereof (e.g., a single-chain antibody) specifically directed against the polypeptide, a specific ligand or receptor when the polypeptide is a receptor or ligand, and a substrate when the polypeptide is an enzyme.

[0030] As used herein, the term "inducing factor" refers to a factor that promotes the production of CTLA-4 or a nucleic acid encoding it, or a functional equivalent thereof, by expressing, transcribing, translating, or inducing differentiation of CTLA-4 or a nucleic acid encoding it, or a functional equivalent thereof.

[0031] As used herein, the term "expression" of a gene, polynucleotide, polypeptide, etc. refers to a gene, etc. undergoing a certain action in vivo to become a different form. Preferably, the term refers to a gene, polynucleotide, etc. being transcribed and translated to become a polypeptide, but transcription to produce an mRNA is also an embodiment of expression. As used herein, the term "expression amount" refers to any amount of such "expression." Thus, as used herein, the term "expression product" includes such a polypeptide or protein, or an mRNA. More preferably, such a polypeptide form may be one that has undergone post-translational processing. For example, the expression level or amount of CTLA-4 can be determined by any method. Specifically, the expression level of CTLA-4 can be known by evaluating the amount of CTLA-4 mRNA, the amount of CTLA-4 protein, and the biological activity of the CTLA-4 protein. Such measurements can be used in companion diagnostics. The amount of CTLA-4 mRNA or protein can be determined by methods detailed elsewhere in this specification or other methods known in the art.

[0032] (Preferred embodiment) Preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description in this specification. In addition, the following embodiments of the present disclosure can be used alone or in combination.

[0033] [Composition] In one aspect of the disclosure, a pharmaceutical composition is provided comprising CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a wound, or a disease, disorder or condition involving a wound.

[0034] In another aspect of the present disclosure, a pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a disease, disorder or condition is provided.

[0035] In yet another aspect of the present disclosure, there is provided a pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a disease, disorder, or condition associated with an abnormality in the immune system.

[0036] CTLA-4 is constitutively expressed in regulatory T cells and is a molecule that negatively regulates the immune system. Therefore, the dysfunction of regulatory T cells or the deficiency of CTLA-4 molecules causes fatal autoimmune diseases, making CTLA-4 an essential molecule for maintaining immune homeostasis. When both CTLA-4 exons 2 and 3 are disrupted in Tregs by gene engineering, fatal autoimmune diseases with systemic lymphoproliferation and overproduction of IgE and IgG occur, similar to those observed in Treg-deficient scurfy mice. Furthermore, CTLA-4 haploinsufficiency in humans shows characteristics of autoimmune diseases. Single nucleotide polymorphisms that negatively affect the function or expression of secretory CTLA-4 (sCTLA-4, S) and membrane CTLA-4 (mCTLA-4, M) are associated with the risk of autoimmune diseases such as rheumatoid arthritis, Graves' disease, and type 1 diabetes. Furthermore, in many human chronic autoimmune diseases, serum levels of sCTLA-4 are elevated, and mCTLA-4 expression on T cells is also increased. These findings suggest that both sCTLA-4 and mCTLA-4 are important molecules in Treg-mediated self-tolerance and immunosuppression.

[0037] CTLA-4 interacts with its ligands, CD80 / CD86, and directly and indirectly reduces the expression of CD80 / 86 molecules, preventing excessive immune responses. For example, Tregs that highly express CTLA-4 pull out CD80 / 86 molecules on antigen-presenting cells (APCs), physically reducing CD80 / 86 on APCs. The reduction in CD80 on APCs increases free PD-L1 (which normally binds to CD80 in cis and suppresses the activity of PD-L1) on APCs, preventing the activation of T cells expressing PD-1. CTLA-4 can also competitively bind to CD80 / 86 molecules more preferentially than CD28, inhibiting costimulation (interaction between CD28 and CD80 / 86 molecules) for T cell activation. Exon 2 of CTLA-4 contains an evolutionarily conserved MYPPPY motif, which is important for binding to CD80 / 86 and stabilizing the interaction. There are two CTLA-4 splicing variants that contain exon 2. One is mCTLA-4, which has the transmembrane domain encoded by exon 3 and is anchored in the cell membrane, and the other is sCTLA-4, which does not contain exon 3 for secretion.

[0038] As described above, CTLA-4 is known to be an essential molecule for maintaining immune homeostasis, since a deficiency in the CTLA-4 molecule causes fatal autoimmune diseases, and it is known that a single nucleotide polymorphism that reduces the function or expression of secretory CTLA-4 is associated with the risk of autoimmune diseases such as Graves' disease and type 1 diabetes. In this example, it has also been shown that a deficiency in secretory CTLA-4 in mice causes dysregulation of type 1 immunity with aging, resulting in preclinical autoimmunity, and that it plays an important role in repairing inflammation, such as delayed wound healing (Figures 6A to 6R).

[0039] Most studies on CTLA-4 to date have not distinguished the role of each CTLA-4 variant in immune homeostasis. It has been shown that reducing the function or expression of sCTLA-4 by anti-sCTLA-4 specific antibodies or siRNA against sCTLA-4 enhances T cell recall responses, reduces cancer metastasis, and increases susceptibility to type 1 diabetes in NOD mice. However, blocking and knockdown analysis of sCTLA-4 alone is not sufficient to understand the role of sCTLA-4 and mCTLA-4 in vivo, and for example, the specific function of sCTLA-4 in the absence of mCTLA-4 has not been demonstrated.

[0040] As mentioned above, cytotoxic T-lymphocyte antigen 4 (CTLA-4) is a molecule that negatively regulates immunity and is constitutively highly expressed, especially in regulatory T cells (Tregs). Exon 2 of CTLA-4 contains an evolutionarily conserved MYPPPY motif, which is important for binding to and stabilizing the interaction with CD80 / 86.

[0041] There are two splicing variants of CTLA-4: membrane-type CTLA-4 (mCTLA-4) and secreted CTLA-4 (sCTLA-4). mCTLA-4 has exons 1 to 4 and is anchored in the cell membrane by the transmembrane domain encoded by exon 3. sCTLA-4 lacks exon 3 and is secreted outside the cell.

[0042] Therefore, in one embodiment of the present disclosure, the CTLA-4 contained in the pharmaceutical composition of the present disclosure may include at least one selected from the group consisting of secretory CTLA-4 and membrane-type CTLA-4.Preferably, the CTLA-4 contained in the pharmaceutical composition of the present disclosure includes secretory CTLA-4.

[0043] Additionally, in one embodiment of the present disclosure, functional equivalents of CTLA-4 include proteins or peptides containing the MYPPPY motif region encoded by Exon 2 of the CTLA-4 gene, dimers or multimers of such proteins or peptides, or proteins expressed in which the signal sequence encoded by Exon 1 of the CTLA-4 gene is replaced with another signal sequence of homologous or heterologous origin.

[0044] A representative amino acid sequence of human sCTLA-4 is disclosed in NCBI reference number CCDS42803. Also, a representative amino acid sequence of mouse sCTLA-4 is disclosed in NCBI reference number CCDS69893. The sCTLA-4 of the present application may be a protein derived from a human or mouse, or may be a protein derived from other mammals (e.g., rat, cow, horse, pig, sheep, monkey, dog, cat, bird, etc.).

[0045] In one embodiment, sCTLA-4 comprises or consists of the amino acid sequence identified by NCBI Reference No. CCDS42803, or the amino acid sequence identified by NCBI Reference No. CCDS42803 in which one or more amino acid residues have been deleted, substituted, added, and / or inserted. In this embodiment, "one or more" preferably means 1 to 20, more preferably 1 to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In other embodiments, sCTLA-4 comprises or consists of an amino acid sequence having about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or greater sequence identity to the amino acid sequence identified in NCBI Reference Number CCDS42803. In further embodiments, sCTLA-4 comprises a MYPPPY motif.

[0046] The above-mentioned amino acid substitution may be a conservative amino acid substitution or a non-conservative amino acid substitution. In this specification, a conservative amino acid substitution is one that is generally recognized as being within the range of substitution that can be made without changing the physiological activity of the resulting molecule, that is, within the range of conservative substitution (Watson et al., Molecular Biology of the Gene, etc.). For example, substitutions that occur between amino acids with similar side chains, such as aspartic acid and glutamic acid (acidic amino acids); lysine, arginine and histidine (basic amino acids); alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine and tryptophan (non-polar amino acids); glycine, asparagine, glutamine, cysteine, serine, threonine and tyrosine (uncharged polar amino acids); and phenylalanine, tryptophan and tyrosine (aromatic amino acids), can be mentioned. Similarly, amino acids can be classified into glycine, alanine, valine, leucine, isoleucine, serine and threonine (aliphatic amino acids), serine and threonine (aliphatic hydroxy amino acids), asparagine and glutamine (amide amino acids), cysteine ​​and methionine (sulfur-containing amino acids), etc. sCTLA-4 may be produced by a method generally known in the art based on the above sequence.

[0047] As used herein, "sequence identity" refers to the percentage of identical bases or amino acids at corresponding positions in two or more sequences (base sequences or amino acid sequences) when the two or more sequences are aligned, taking into account gaps and insertions, so as to maximize the degree of sequence identity. The method of determining identity is designed to give the maximum degree of identity between the aligned sequences. Methods for determining identity between two sequences include, but are not limited to, BLASTP, BLASTN, FASTA, etc. Also, it can be determined using DNASIS (manufactured by Hitachi Software Engineering Co., Ltd.) and GENETYX (manufactured by Genetyx Co., Ltd.). Alternatively, in the case of short peptides, it can be determined simply by comparing the sequences. Those skilled in the art can determine the identity between sequences using the methods described above.

[0048] The composition of the present disclosure may further include a pharma- ceutically acceptable carrier and / or additive. In the present disclosure, the term "pharma-ceutically acceptable carrier" includes any substance that can maintain the biological activity of the component when combined with sCTLA-4. For example, it includes a stabilizer, a dissolving agent, a suspending agent, an emulsifying agent, a soothing agent, a buffer, a preservative, a pH adjusting agent, and an antioxidant.

[0049] In one embodiment, the composition of the present disclosure can be administered in combination with an antibiotic, an antifungal agent, or an antiviral agent.A variety of antibiotics, antifungal agents, or antiviral agents known in the art can be used.In one aspect of the present disclosure, a combination comprising CTLA-4 and an antibiotic is disclosed for treating or preventing wounds or wound-associated diseases, disorders, or conditions.

[0050] The administration route of the composition of the present disclosure includes oral administration or parenteral administration, and is not particularly limited. Various known administration forms can be adopted depending on the application site and the target disease. For example, parenteral administration may be systemic administration or local administration, and more specifically, for example, intratracheal administration, intrathecal administration, subarachnoid administration, intracranial administration, intravenous administration, intraarterial administration, portal vein administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, intranasal administration, oral administration, etc.

[0051] Dosage forms include granules, fine granules, powders, coated tablets, tablets, suppositories, powders, capsules, microcapsules, chewable tablets, liquids, suspensions, emulsions, etc. Dosage forms that extend the release of the active substance may be employed. Dosage forms for injection or infusion include aqueous and non-aqueous injection solutions (which may contain antioxidants, buffers, bacteriostatic agents, isotonic agents, etc.); and aqueous and non-aqueous injection suspensions (which may contain suspending agents, thickening agents, etc.). These dosage forms may be provided as liquids in sealed ampoules or vials, or as lyophilized products, and prepared by adding sterile liquids (e.g., water for injection) immediately before use. Injection solutions or suspensions may be prepared from powders, granules, or tablets.

[0052] These dosage forms are prepared by formulating in a conventional manner. In addition, various pharma- ceutically acceptable pharmaceutical substances can be added according to the needs of the formulation. The pharmaceutical substances can be appropriately selected according to the dosage form of the formulation, and examples thereof include buffering agents, surfactants, stabilizers, preservatives, excipients, diluents, additives, disintegrants, binders, coating agents, lubricants, flavoring agents, sweeteners, solubilizers, etc.

[0053] The dosage and frequency of administration of the composition of the present disclosure can be appropriately determined by a person skilled in the art according to the animal species, health condition, age, body weight, administration route, administration form, etc. of the subject so that an effective amount of the active ingredient is administered to the subject. The effective amount in a certain situation can be easily determined by routine experiments and is within the skill and judgment of an ordinary clinician. For example, the daily dosage for an adult can be about 0.01 to about 1,000 mg / kg body weight, about 0.01 to about 100 mg / kg body weight, about 0.1 to about 10 mg / kg body weight, or about 1 to about 10 mg / kg body weight, but is not limited thereto.

[0054] The composition of the present disclosure can be used in combination with one or more additional active ingredients, particularly active ingredients for the treatment of autoimmune disease, wounds or allergies.The term "combined use" of ingredients refers not only to the use of a dosage form containing all of the ingredients and the use of a combination of dosage forms containing each ingredient separately, but also to the administration of each ingredient simultaneously, sequentially, or with a delay between any of the ingredients, as long as they are used for the treatment of autoimmune disease, wounds or allergies.

[0055] In one embodiment, diseases, disorders, or conditions associated with autoimmune diseases include, for example, Behcet's disease, systemic lupus erythematosus, multiple sclerosis (systemic sclerosis, progressive systemic sclerosis), scleroderma, polymyositis, dermatomyositis, periarteritis nodosa (polyarteritis nodosa, microscopic polyangiitis), aortitis syndrome (Takayasu's arteritis), malignant rheumatoid arthritis, rheumatoid arthritis, juvenile idiopathic arthritis, Wegener's granulomatosis, mixed connective tissue disease, Sjogren's syndrome, adult Still's disease, A. Allergic granulomatous vasculitis, hypersensitivity vasculitis, Cogan's syndrome, RS3PE, temporal arteritis, rheumatic polymyalgia, fibromyalgia, antiphospholipid syndrome, eosinophilic fasciitis, IgG4-related disease (e.g., primary sclerosing cholangitis, autoimmune pancreatitis, etc.), Guillain-Barré syndrome, myasthenia gravis, chronic atrophic gastritis, autoimmune hepatitis, primary biliary cirrhosis, aortitis syndrome, Goodpasture's syndrome, rapidly progressive glomerulonephritis, megaloblastic anemia, autoimmune hemolytic anemia, autoimmune epidemic neutropenia, idiopathic thrombocytopenic purpura, Graves' disease (hyperthyroidism), Hashimoto's disease, autoimmune adrenal insufficiency, primary hypothyroidism, idiopathic Addison's disease (chronic adrenal insufficiency), type I diabetes mellitus, slowly progressive type I diabetes mellitus (adult latent autoimmune diabetes), chronic discoid lupus erythematosus, localized scleroderma, psoriasis, psoriatic arthritis, pemphigus, pemphigoid, herpes gestationis, linear IgA bullous dermatosis, epidermolysis bullosa acquisita, alopecia areata, vitiligo, vitiligo vulgaris, atopic dermatitis Dermatitis, neuromyelitis optica, chronic inflammatory demyelinating polyneuropathy, sarcoidosis, bullous pemphigoid, giant cell arteritis, amyotrophic lateral sclerosis, eosinophilic granulomatosis with polyangiitis, Harada's disease, autoimmune optic neuropathy, idiopathic azoospermia, habitual abortion, autoimmune enteritis, inflammatory bowel disease (e.g., ulcerative colitis, Crohn's disease), celiac disease, IBD, IBS, mastocytosis, and autoimmune diseases accompanied by proliferation of IFNγ-producing CD4-positive helper T cells as a comprehensive pathology. In one embodiment, the autoimmune disease is autoimmune enteritis.

[0056] In one embodiment, the wound includes a state in which the tissue surface is lost due to some cause in skin or mucosal tissue, such as the epidermis, dermis, subcutaneous tissue, epithelium (or mucosal epithelium), lamina propria mucosa, and submucosa, due to an abrasion, laceration, incision, contusion, ulcer, bedsore, diabetic ulcer, burn, inflammation, cell necrosis, etc.

[0057] In one embodiment, the allergy-related disease, disorder or condition includes atopic dermatitis, allergic rhinitis, hay fever, allergic conjunctivitis, allergic gastroenteritis, bronchial asthma, childhood asthma, food allergies, drug allergies, urticaria, and the like.

[0058] As described above, CTLA-4 is known as a molecule essential for maintaining immune homeostasis, and therefore, in one embodiment of the present disclosure, any of wounds or diseases, disorders or symptoms associated with wounds, diseases, disorders or symptoms associated with immune system abnormalities, diseases, disorders or symptoms associated with autoimmune diseases, and diseases, disorders or symptoms associated with allergies can be said to be diseases, disorders or symptoms associated with abnormalities in membrane-type and / or secretory CTLA-4. Signals received by CD4-positive T cells for differentiation and activation include essential signal 1 (TCR) and signal 2 (CD28), and CTLA-4 is a molecule that inhibits signal 2. Therefore, in one embodiment of the present disclosure, diseases, disorders or symptoms that can be treated or prevented by the pharmaceutical composition of the present disclosure can be a state in which effector differentiation and activation of CD4-positive T cells are not suppressed, that is, a disease, disorder or symptom in which effector differentiation and activation of CD4-positive T cells occur constitutively. Furthermore, because signal 2 is more highly required for the differentiation and activation of IFNγ-producing CD4-positive helper T cells than for other types of effector T cells, diseases, disorders, or symptoms in which the effector differentiation and activation of CD4-positive T cells is not suppressed can also be said to be diseases, disorders, or symptoms in which the differentiation and activation of IFNγ-producing CD4-positive helper T cells is not suppressed (i.e., occurs constitutively). If the differentiation and activation of IFNγ-producing CD4-positive helper T cells is not suppressed, autoimmune enteritis and delayed wound healing may occur.

[0059] Subjects to which the compositions of the present application may be administered include animals, typically mammals (e.g., humans, mice, rats, hamsters, rabbits, cats, dogs, cows, sheep, monkeys, etc.), with humans being particularly preferred.

[0060] [Screening method] In one aspect of the present disclosure, a method is provided for screening a substance for treating or preventing a wound, or a disease, disorder or condition associated with a wound, comprising the steps of contacting a cell with a candidate substance, measuring the expression level of CTLA-4 in the cell or on the cell surface, and selecting the candidate substance that increases the amount or level of CTLA-4 in the cell or on the cell surface compared to before contact with the candidate substance.

[0061] In another aspect of the present disclosure, a method for screening a substance for treating or preventing a disease, disorder or symptom associated with an abnormality in the immune system is provided, comprising the steps of contacting a cell with a candidate substance, measuring the expression level of secreted CTLA-4 in or outside the cell, and selecting the candidate substance that increases the amount or level of secreted CTLA-4 in or outside the cell compared to before contact with the candidate substance.

[0062] In one embodiment, the "candidate substance" includes any substance such as a protein, an amino acid, a nucleic acid, a lipid, a carbohydrate, a low molecular weight compound, or an inorganic compound. A candidate substance can typically be used in a purified or isolated form, but may also be an unpurified or unisolated crude product or a mixture. A candidate substance may be provided in the form of a compound library, a nucleic acid library, a random peptide library, or the like, or may be provided as a natural product.

[0063] In the method according to one embodiment of the present disclosure, when cells are contacted with a candidate substance, the cells are not particularly limited as long as they can express membrane-type or secretory CTLA-4, and are, for example, regulatory T cells. The candidate substance can be added, for example, to a culture medium containing the cells.

[0064] The contact of the candidate substance with the target can be carried out, for example, by adding the test substance to the above-mentioned medium or various buffer solutions (e.g., HEPES buffer, phosphate buffer, phosphate-buffered saline, Tris-HCl buffer, borate buffer, acetate buffer, etc.) and incubating the cells for a certain period of time. The concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected, for example, within the range of about 0.1 nM to about 100 μM. The incubation time can be, for example, about 10 minutes to about 24 hours.

[0065] In one embodiment of the method of the present disclosure, the expression level of CTLA-4 in cells or on the cell surface is measured. In this case, the CTLA-4 measured is membrane-type CTLA-4. In another embodiment, the expression level of secretory CTLA-4 in cells or outside of cells can also be measured. The expression level of CTLA-4 in cells, outside of cells, or on the cell surface may be the gene amount and / or protein amount of CTLA-4 in cells, outside of cells, or on the cell surface. The gene amount and / or protein amount of CTLA-4 can be measured by a well-known method. The gene amount of CTLA-4 can be measured by, for example, RT-PCR, Northern blot, in situ hybridization, etc. The protein amount of CTLA-4 can be measured by ELISA, Western blot, etc.

[0066] In the method of one embodiment of the present disclosure, the candidate substance that increases the amount or level of CTLA-4 in the cell or on the cell surface compared to before contact with the candidate substance can be selected. In another embodiment, the candidate substance that increases the amount or level of secreted CTLA-4 in the cell or outside the cell compared to before contact with the candidate substance can be selected. In one embodiment, the expression level of membrane-type or secreted CTLA-4 in the cell measured in the step of measuring the expression level of CTLA-4 can also be compared with the expression level of membrane-type or secreted CTLA-4 of a control. The control can be, for example, a cell that has not been contacted with a candidate substance or a cell before being contacted with a candidate substance. If the expression level of membrane-type or secreted CTLA-4 in the cell, outside the cell, or on the cell surface is increased compared to the expression level of membrane-type or secreted CTLA-4 of the control, the candidate substance can be selected as a substance that induces or promotes the expression of membrane-type or secreted CTLA-4. The selected candidate substance can be used as a substance for preventing or treating a wound, or a disease, disorder, or symptom associated with a wound, or a disease, disorder, or symptom associated with an abnormality in the immune system.

[0067] (General technology) The molecular biological, biochemical and microbiological techniques used herein are well known and commonly used in the art, and are described, for example, in Sambrook J. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, FM (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, FM (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, MA (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, FM (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, FM (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, MA et al. (1995). PCR Strategies, Academic Press; Ausubel, FM (1999).These methods are described in Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; Sninsky, JJ et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, Special Edition of Experimental Medicine: "Gene Introduction & Expression Analysis Experimental Methods" Yodosha, 1997, etc., and the relevant parts (possibly in their entirety) of these are incorporated herein by reference.

[0068] Regarding DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, gene synthesis and fragment synthesis services such as those of GeneArt, GenScript, Integrated DNA Technologies (IDT), etc. can be used. In addition, for example, Gait, MJ (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, MJ (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, RL et al. (1992). The Biochemistry of the Nucleic Acids, Chapman & Hall; Shabarova, Z. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, GM et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, GT (I996). Bioconjugate Techniques, Academic Press, etc., the relevant portions of which are incorporated herein by reference.

[0069] In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when "within the range of" two values ​​is specified, the range includes the two values ​​themselves. All references cited herein, including scientific literature, patents, patent applications, and the like, are hereby incorporated by reference in their entirety to the same extent as if each was specifically set forth.

[0070] The present disclosure has been described above by showing preferred embodiments for ease of understanding. The present disclosure will be described below based on examples, but the above description and the following examples are provided for illustrative purposes only and are not provided for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims. EXAMPLES

[0071] [Materials and methods] mouse Female 5- to 6-week-old C.B17 / Icr-scid mice, 6- to 8-week-old BALB / cAJcl mice, BALB / cAJcl-nu / nu mice, and C57BL / 6JJcl mice were purchased from CLEA Japan. CTLA-4 full KO (exon 2 and exon 3 deletion), CD45.1, RAG2 KO, FLPeR, and DEREG mice have been reported previously (Waterhouse, P. et al. Lymphoproliferative Disorders with Early Lethality in Mice Deficient in Ctla-4. Science 270, 985-988 (1995).;Farley, F., Soriano, P., Steffen, L. & Dymecki, S. Widespread recombinase expression using FLPeR (Flipper) mice. genesis 28, 106-110 (2000).;Lahl, K. et al. Selective depletion of Foxp3+ regulatory T cells induces a scurfy-like disease. The Journal of Experimental Medicine 204, 57-63 (2007).). sCTLA-4 knock-in mice were generated by standard molecular techniques. Briefly, Balb / cI ES cells (provided by B. Ledermann; Noben-Trauth, Kohler, Burki & Ledermann. Efficient targeting of the IL-4 gene in a BALB / c embryonic stem cell line. Transgenic research 5, 487-91 (1996).) were transfected with a modified CTLA-4 targeting vector (RP23-146J17) that deleted the splice acceptor site (86 bp) in front of exon 3 of the CTLA-4 locus. The targeting vector was generated using a phage-based E. coli homologous recombination system.BAC (sCTLA-4-mCTLA-4+) transgenic (Tg) mice were generated by a CTLA-4 BAC transgene combining exon 3 and exon 4 and crossed with SM- mice. All mice were backcrossed to a BALB / c background more than 10 times unless otherwise stated. All mice were maintained under specific pathogen-free conditions and treated according to the animal welfare guidelines approved by the Osaka University Immunology Frontier Research Center or the Institute for Virus Research and Frontier Medical Sciences, Kyoto University. sCTLA-4 knock-in mice (S+M-mice) and CTLA-4 full KO mice (SM-mice) were used at 3 weeks of age, and BAC Tg CTLA-4 full KO mice (S-M+mice) were used at 30–32 weeks of age.

[0072] antibody The following antibodies were used for flow cytometry analysis and in vitro experiments and were obtained from BD Biosciences, BioLegend, and eBioscience: anti-mCD3 (145-2C11), anti-mCD28 (37.51), anti-mCD4 (RM4-5), anti-mCD8 (53-6.7), anti-mCD25 (PC61), anti-mGITR (DTA-1), anti-mFR4 (TH6), anti-mTCRβ (H57-597), anti-mCTLA-4 (UC10-4F10-11), anti-mPD1 (RPM1-30), anti-mCD44 (IM7), anti-mCD69 (H1.2F3), anti-mCD103 (2E7), anti-mCD62L (MEL-14), anti-mCD45RB (C363.16A), anti-mCD223 (C9B7W), anti-mCD90.2 (53-2.1), anti-mCD80 (16-10A1), anti-mCD86 (PO3.1), anti-mLy6C (HK1.4), anti-mLy6G (1A8), anti-mGr-1 (RB6-8C5), anti-TER119 (TER119), anti-Siglec-F (E50-2440), anti-mCD41 (MWReg30), anti-mCD117 (2B8), anti-CD200R3 (Ba13), anti-mCD24 (M1 / 69), anti-mFcεRIα (MAR-1), anti-mCD49b (DX5), anti-h / mCD11b (M1 / 70), anti-mCD11c (N418 or HL3), anti-mCX3CR1 (2A9-1), anti-mF4 / 80 (BM8), anti-mCD206 (C068C2), anti-mCD68 (FA-11), anti-mCD64 (X54-5 / 7.1), anti-mCD71 (RI7217), anti-I-A / I-E (M5 / 114.15.2), anti-mCD45 (30-F11), anti-mCD45.1 (A20), anti-mCD45.2 (104), anti-mCD45R / B220 (RA3-6B2), anti-mCD19 (1D3), anti-mCXCR5 (L138D7), anti-mBcl-6 (K112-91), anti-CD38 (90), anti-h / mGL-7 (GL-7), anti-mIgD (11-26c.2a), anti-mIgM (ll / 41), anti-mCD138 (281-2), anti-mCD16 / 32 (2.4G2), anti-mIL-2 (JES6-5H4), anti-mIFNγ (XMG1.2), anti-mIL-4 (BVD4-1D11), anti-mIL-5 (TRFK5), anti-mIL-17A (TC11-18H10.1), anti-mIL-10 (JES5-16E3), anti-mFoxp3 (FJK-16s), anti-mGata-3 (TWAJ), anti-mT-bet (O4-46), anti-mHelios (22F6), anti-mEomes (Dan11mag), anti-hCD25 (M-A251), anti-hCD4 (RPA-T4), anti-hCD45RA (HI100), anti-h / mKi-67 (B56), and anti-baculovirus gp64 (AcV1). Anti-iNOS mAb (4E5, Abcam) was labeled with Zenon Alexa Fluor 488 Mouse IgG1 Labeling Kit (molecular probes). Anti-CD3 (0.5 μg / mL) and anti-CD28 (1 μg / mL) or anti-CD3 / CD28 Dynabeads (Invitrogen) were used to activate mouse CD4+ T cells in vitro. To generate monoclonal antibodies, anti-sCTLA-4 specific amino acid peptide (NH2-AKEKKSSYNRGLCENAPNRARM-COOH; SEQ ID NO: 1) was used to generate anti-sCTLA-4 specific amino acid antibodies by standard techniques.

[0073] cell culture Mouse T cells were cultured in RPMI-1640 medium supplemented with 10% FCS (Gibco), penicillin-streptomycin (Gibco) and 50 μM 2-mercaptoethanol. T cells were depleted in the presence of 100 U / ml human IL-2 (Imunase35, Shionogi) and activated with anti-CD3 / CD28 Dynabeads (invitrogen) or anti-CD3 antibody with splenocytes treated with mitomycin C (KYOWA KIRIN). Splenocytes or lymphocytes prepared from 21-day-old sCTLA-4 KI (S+M-), CTLA-4 full KO (SM-) and littermate controls (S+M+) were stimulated with 25 ng / mL PMA (Sigma-Aldrich) and 1 μM ionomycin (Sigma-Aldrich) in the presence of Golgistop (Monensin, BD bioscience) for 5 h. Cells were fixed and permeabilized with Cytofix / Cytoperm and Perm / Wash (BD Biosciences) for cytokine staining, Foxp3 / Transcription Factor Staining Buffer Set (eBioscience) for Foxp3 staining, and Transcription Factor Buffer Set (BD Biosciences) for Foxp3 and cytokine co-staining. Mouse macrophages were cultured in the presence of 10 ng / mL IL-4 and 10 ng / mL IL-10 using HydroCell 24 Multi-well plates (CellSeed). B16F10 melanoma cells were cultured in DMEM supplemented with 10% FCS and penicillin-streptomycin. Sf9 cells were cultured in Trichoplusia ni Medium-Formulation Hink (TNM-FH) supplemented with 10% FCS, penicillin-streptomycin, and 0.1% Pluronic F-68 (Gibco) at 27°C in shake flasks shaken at 130 rpm.High Five cells (BTI-TN-5B1-4) were cultured in Express Five SFM (Thermo Fisher Scientific) supplemented with penicillin-streptomycin, 10 U / mL heparin, and 18 mM L-glutamine at 27 °C in shake flasks with shaking at 130 rpm.

[0074] ELISA IFNγ, IL-4, TNF-α and IL-6 were measured using ELISA kits from eBioscience. IL-3, IL-10 and TSLP were measured using ELISA kits from Biolegend. CTLA-4, IL-33 and M-CSF were measured using ELISA kits from R&D Systems. IL-5 and IL-17A were measured using Bio-plex kits from Bio-Rad Laboratories. Serum antibodies were measured by Mouse Isotyping 6plex Kit and Mouse IgE FlowCytomix Simplex kit (eBioscience). Eotaxin (CCL11), CCL17, CCL22 and CXCL13 were measured using LEGENDplex kits from Biolegend. Anti-mouse dsDNA IgG and anti-mouse IgE were measured using ELISA kits from Sibayagi. Anti-gastric wall antibodies were determined as previously described (Wing, K. et al. CTLA-4 control over Foxp3+ regulatory T cell function. Science 322, 271-5 (2008).). Total protein from B16F10 melanoma was collected using M-PER mammalian protein extraction reagent (Thermo Scientific) with Complete mini EDTA-free (Roche). Cell extracts were centrifuged at 18000×g for 10 min at 4° C. and the supernatant was collected. Protein concentration in the lysates was determined by Pierce BCA Protein Assay Kit (Thermo Scientific). The concentration of IFNγ (pg / mg of total protein) in tumor lysates was quantified by ELISA. IL-10 production in peritoneal macrophages was measured by ELISA after 24 h of in vitro cell culture.

[0075] Quantitative real-time PCR (qPCR) Total RNA was extracted with RNeasy mini kit (QIAGEN). cDNA was synthesized with SuperScriptIII (life technologies). Real-time PCR was performed with StepOnePlus Real-time PCR System (life technologies) using TaqMan Gene Expression Master Mix (life technologies) and TaqMan Gene Expression Assays (life technologies) or with LightCycler480 System (Roche) using LightCycler480 Probe Master (Roche) and Universal Probe Library Probes (Roche). Transcripts were normalized to HPRT1 levels. Assay numbers are as follows: Hprt, Mm01545399_m1; Il10, Mm00439614_m1; Ifng, Mm01168134_m1; Il4, Mm00445259_m1; Il17a, Mm00439618_m1; Il6, Mm00446190_m1; Ebi3, mm00469294_m1; Tgfb1, Mm03024053_m1; Nos2, Mm00440502_m1; Mrc1, Mm00485148_m1; Retnla, Mm00445109_m1; Arg1, Mm00475988_m1.The primer sequences for sCTLA-4 and mCTLA-4 are as follows: Mouse sCTLA-4; forward: 5'-cgcagatttatgtcattgctaaag - 3' (SEQ ID NO: 2); reverse: 5'- aaacggcctttcagttgatg - 3' (SEQ ID NO: 3); TaqMan probe (FAMNFQ-MGB): 5'- aagaagtcctcttacaacagg - 3' (SEQ ID NO: 4): Mouse mCTLA-4; forward: 5'-ggcaacgggacgcaga - 3' (SEQ ID NO: 5); reverse: 5'- cccaagctaactgcgacaagg - 3' (SEQ ID NO: 6); TaqMan probe (FAMNFQ-MGB): 5'- ttatgtcattgatccagaacc - 3' (SEQ ID NO: 7): Human sCTLA-4; forward: 5'-ggacacgggactctacatctg - 3' (SEQ ID NO: 8); reverse: 5'- aagagggcttcttttctttagca - 3' (SEQ ID NO: 9); universal probe library probe #39 (Roche): human mCTLA-4; forward: 5'-ataggcaacggaacccagat - 3' (SEQ ID NO: 10); reverse: 5'- cccgaactaactgctgcaa - 3' (SEQ ID NO: 11); universal probe library probe #69 (Roche): human HPRT1; forward: 5'-gaccagtcaacaggggacat - 3' (SEQ ID NO: 12); reverse: 5'- gtgtcaattatatcttccacaatcaag - 3' (SEQ ID NO: 13); universal probe library probe #22 (Roche).

[0076] Plasmids Mouse mCTLA-4 cDNA was cloned from Baldb / c CD4+CD25+ T cells. To generate sCTLA-4 cDNA, mCTLA-4 cDNA was subcloned into pCMV-Tag4A vector (Agilent Technologies), and an exon 3 deletion construct was generated using KOD Plus Mutagenesis Kit (TOYOBO). Y139A (tyrosine at position 139 > alanine) mutant sCTLA-4 was generated by introducing a mutation into the MYPPPY motif (ATGTACCCACCGCCATAC (SEQ ID NO: 14) → ATGTACCCACCGCCAGCC (SEQ ID NO: 15)). For retroviral gene transfer, wild-type sCTLA-4, Y139A mutant sCTLA-4, and CTLA-4 Ig (pME18S-mCTLA4 / WT-hIgG, received from T. Saito, RIKEN Center for Integrative Medical Sciences, Kanagawa, Japan) were subcloned into the pMCsIg retroviral vector (received from T. Kitamura, The Institute of Medical Sciences, The University of Tokyo, Tokyo, Japan) to generate pMCsIg-sCTLA-4, pMCsIg-sCTLA-4 Y139A, and pMCsIg-CTLA-4 Ig. To generate recombinant baculoviruses, FLAG-tagged WT sCTLA-4 and Y139A sCTLA-4 in pCMV-Tag4A were subcloned into pFastBac vector (Thermo Fisher Scientific) to generate pFastBac-sCTLA-4-FLAG and pFastBac-sCTLA-4 Y139A-FLAG.

[0077] B16F10 melanoma expressing sCTLA-4 or CTLA-4 Ig Transduction of retroviral constructs was performed as previously described (Zhong, S., Malecek, K., Perez-Garcia, A. & Krogsgaard, M. Retroviral Transduction of T-cell Receptors in Mouse T-cells. J Vis Exp Jove 2307 (2010). doi:10.3791 / 2307). B16F10 cells, which are adherent cells, were transduced with 8 μg / mL polybrene (Millipore) using a spin-inoculation protocol at 1000×g for 90 min at 32° C. After retroviral transduction, GFP+ transduced cells were sorted and enriched twice by BD FACSARIA II. Protein expression was assessed by FACS and ELISA.

[0078] Expression and purification of sCTLA-4 Recombinant baculoviruses were generated using the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific). High Five cells (BTI-TN-5B1-4) were infected with baculoviruses to produce FLAG-tagged WT sCTLA-4 and Y139A mutant sCTLA-4. FLAG-tagged WT sCTLA-4 (SEQ ID NO: 16, CCDS69893) or Y139A sCTLA-4 in the culture supernatant were purified by anti-FLAG M2 affinity gel (Sigma-Aldrich), washed with wash buffer (phosphate buffered saline, 0.05% Tween-20), eluted with elution buffer (phosphate buffered saline, 160 μg / mL 3xFLAG peptide (Sigma-Aldrich)), and dialyzed against phosphate buffered saline using Slide-A-Lyzer G2 Dialysis Cassettes (Thermo Fisher Scientific). The concentration of sCTLA-4 was estimated by ELISA and CBB staining.

[0079] Cell transplantation and tumor inoculation Six-week-old C.B17 / Icr-scid mice were treated with 4 × 10 purified CD45.1 congenic mice. 5 CD4+CD25-CD45RB high Cells were cultured alone or in 3 × 10 cultures derived from 3-week-old DEREG S+M- or DEREG SM- mice. 5 In tumor experiments, 1 × 10 6 B16F10 melanocytes were subcutaneously inoculated into C57BL / 6 mice.

[0080] Isolation of lamina propria cells Colonic lamina propria lymphocytes and myeloid cells were isolated using a method previously described (Weigmann, B. et al. Isolation and subsequent analysis of murine lamina propria mononuclear cells from colonic tissue. Nature Protocols 2, 2307-2311 (2007).). After enzymatic purification to obtain single cell suspension, CD45+Siglec-F-Ly6G-CD11b+F4 / 80+ colonic macrophages were FACS sorted (purity >99%) and mRNA was measured.

[0081] Histological analysis Histological analysis of the colon was performed as previously described (Yamaguchi, T. et al. Construction of self-recognizing regulatory T cells from conventional T cells by controlling CTLA-4 and IL-2 expression. Proc. Natl. Acad. Sci. USA 110, E2116-25 (2013).). Hematoxylin-eosin (HE) staining of lung sections was observed under a BZ-X700 microscope (KEYENCE). The total lung area and the area infiltrated by lymphocytes (cellular foci: >1000 μm2) were analyzed. 2) was calculated and quantified using BZ-X analyzer software (KEYENCE).

[0082] RNA sequencing Total RNA was isolated from CD11b high +F4 / 80 high + Peritoneal macrophages were extracted using miRNeasy Mini Kit (QIAGEN). Purity of macrophages after FACS sorting was >99%. cDNA libraries prepared with TruSeq RNA Sample Prep Kit (Illumina) were sequenced using HiSeq 2000 (Illumina). Read sequences were mapped to the reference genome (mm10) using TopHat. The overall read mapping rate from all samples was >94%. Expression levels and statistical significance were calculated and tested using Cuffdiff, a package included in Cufflinks. Output files were visualized using CummeRbund and gplots packages in the R environment. For gene ontology (GO) enrichment analysis, read counts for each gene were calculated using the script htseq-count in HTSeq, and differential expression analysis was performed using the edgeR package in Bioconductor. To evaluate the list of differentially expressed genes, the overrepresentation analysis (ORA) method of ErmineJ software was used.

[0083] Asthma Model Allergen sensitization, challenge and analysis were performed as previously described (Reddy, A., Lakshmi, S. & Reddy, R. Murine Model of Allergen Induced Asthma. Journal of Visualized Experiments e3771 (2012). doi:10.3791 / 3771; Misharin, A., Morales-Nebreda, L., Mutlu, G., Budinger, S. & Perlman, H. Flow Cytometric Analysis of Macrophages and Dendritic Cell Subsets in the Mouse Lung. American journal of respiratory cell and molecular biology 49, 130522202035005 (2013).). Briefly, mice were intraperitoneally (ip) administered 40 μg grade V ovalbumin (Sigma-Aldrich) emulsified in 2 mg alhydrogel adjuvant (InvivoGen) twice on days 0 and 7. On days 14, 16, 18, and 20, the trachea of ​​mice was surgically exposed and 50 μL 0.1% ovalbumin was injected intratracheally (it) with a microsyringe. On day 22, mice were sacrificed and lungs were perfused with PBS. Lung tissue sections were treated with enzyme solution (1 mg / mL hyaluronidase (Sigma-Aldrich), 0.05 mg / mL Liberase™ (Roche), and 0.1 mg / mL DNase I (Roche)) and then single-cell suspensions were obtained by gentleMACS Dissociator (Miltenyi Biotec).

[0084] Immunization of DO11.10 mice with ovalbumin 8–12 week old DEREG DO11.10 TCR transgenic mice were subcutaneously injected with 50 μL of a 1:1 emulsion of Freund's complete adjuvant H37 Ra (BD Difco) and 2 mg / mL grade V ovalbumin (Sigma-Aldrich) at 4 points on the back proximal to the axillary / brachial or inguinal lymph nodes. On days 0, 7, 14 and 21, CD4+Foxp3+(GFP+) Tregs were isolated from the draining lymph nodes (purity >99%) for quantification of sCTLA-4 and mCTLA-4 mRNA by qPCR.

[0085] Immunofluorescence of wound healing model and re-epithelialization Skin excision and wound healing quantification were performed as previously described (Keyes, B. et al. Impaired Epidermal to Dendritic T Cell Signaling Slows Wound Repair in Aged Skin. Cell 167, 1323-1338.e14 (2016).). Briefly, shaved dorsal skin was disinfected with ethanol and duplicate wounds were created with a 6 mm biopsy punch (Kai Medical). The average wound area (mm2) of duplicate wounds was measured on days 1, 3, and 5 after wounding. 2) was photographed with a ruler and the area was calculated using ImageJ software version 1.53a (National Institutes of Health). Five days after wounding, dorsal skin tissue was harvested for immunostaining, fixed in 4% paraformaldehyde for 48 hours at 4°C, embedded in paraffin, and sectioned (5 μm) along the long axis of the wounded area. The tissue was rehydrated and antigen-retrieved by steam sterilization at 121°C for 5 minutes in 10 mM sodium citrate (pH 6.0), stained with purified anti-keratin 14 antibody (Poly9060, chicken polyclonal IgY, 1:500, BioLegend), followed by staining with pre-adsorbed anti-chicken IgY secondary antibody conjugated with Alexa Fluor Plus 488 (goat polyclonal IgG, 1:1000, Thermo Fisher Scientific) and DAPI. Images of re-epithelialization beneath the wound were taken with a BZ-X700 microscope (KEYENCE), and the length of the K14+ epidermal keratinocyte layer that migrated from the wound edge was quantified with ImageJ software.

[0086] statistical analysis In all figures, each data point represents a value measured in different randomly selected individual animals, experiments performed independently, or quantification of mRNA isolated from separate animals. Unless otherwise stated, data were analyzed by one-way ANOVA using GraphPad Prism version 7.0d (GraphPad software), followed by Holm-Sidak multiple comparison test for multiple groups or unpaired two-tailed t-test for two groups, when applicable. When performing nonparametric tests for multiple groups, Kruskal-Wallis test and Dunn's multiple comparison test were applied. When statistical analysis was performed by nonparametric Mann-Whitney test or log-rank test for two groups, it was stated in each figure legend. P values ​​>0.05 were considered as NS (not significant).

[0087] [result] sCTLA-4 has an immunoregulatory role CD44 high CD62L lowEffector Tregs are CD44 low CD62L high Naïve Tregs or conventional CD44 high CD62L low The expression of sCTLA-4 was increased more than two-fold compared to effector T cells (Tconv) (Figure 1A). high Effector Tregs (<1%) had the highest expression of sCTLA-4 mRNA in vivo compared with CD4+CD45RA+CD25+ naive Tregs (Figure 1B). To examine the long-term dynamics of sCTLA-4 and mCTLA-4, DEREG DO11.10 TCR transgenic (Tg) mice were immunized with OVA antigen and CD4+ T cells were stimulated in vivo. sCTLA-4 in Tregs was decreased 7 days after immunization, but the amount of sCTLA-4 increased and exceeded the steady-state level 21 days after immunization (Figure 1C). This result suggests that sCTLA-4 may be required in the later stages of inflammation. Furthermore, male mice with chronic wounds on the skin due to fighting had higher expression of sCTLA-4 and mCTLA-4 compared with unwounded male mice (Figure 1D). These results suggest that activated Tregs temporarily shut down sCTLA-4 transcription and expression under inflammatory conditions, followed by an increase in sCTLA-4.

[0088] To evaluate the in vivo function of sCTLA-4 in inflammatory situations, we generated sCTLA-4+ mCTLA-4- mice (S+M- mice) (Figure 1E). Briefly, we deleted the splicing acceptor site upstream of exon 3 of the endogenous CTLA-4 locus. S+M- mice lacked mCTLA-4 at the protein and mRNA levels but expressed sCTLA-4 (Figures 1F-1H). As expected, mCTLA-4 deficiency caused fatal autoimmune disease accompanied by weight loss, spleen and lymph node enlargement, and elevated serum levels of autoantibodies (e.g., anti-dsDNA IgG antibodies and anti-gastric parietal cell antibodies) even in the presence of sCTLA-4 (Figures 1I-1L). Although sCTLA-4 was unable to prevent the autoimmune disease observed in conventional SM mice, it significantly suppressed the weight loss and lymphocyte increase associated with autoimmune disease and significantly extended survival time (Figure 1M).

[0089] We conclude that sCTLA-4 can alleviate the severe autoimmune phenotype caused by mCTLA-4 deficiency, whereas mCTLA-4 plays an important role in maintaining immune homeostasis, suggesting that sCTLA-4 is important in inflammatory situations but acts through a different mechanism than mCTLA-4.

[0090] sCTLA-4 promotes M2 macrophage differentiation Considering that mCTLA-4 and sCTLA-4 have a MYPPPY motif in exon 2 that interacts with CD80 / 86 molecules, we evaluated the proportion of antigen-presenting cells (e.g., CD11b+, CD11c+, and B220+ cells) expressing CD80 / 86. Despite the strong inflammation, CD80+CD11b+ cells in S+M- mice were not increased, whereas CD80+CD11b+ cells in SM- mice were increased by inflammation (Figure 2A). In contrast, there was no significant difference between S+M- and SM- mice in the CD80+ or ​​CD86+ subsets of CD11c+ or B220+ cells, whereas CD86+B220+ cells in S+M- mice were increased (Figure 2A). To examine whether sCTLA-4 affects the phenotype of CD11b+ cells, the cytokine expression levels of CD11b+ cells in the spleen and peritoneal cavity were measured by qPCR. Splenic CD11b+ cells from S+M- mice expressed IL-4 at the highest level, whereas splenic CD11b+ cells from SM- mice expressed IL-6 at the highest level (Fig. 2B). Furthermore, CD11b+F4 / 80+ peritoneal macrophages isolated from S+M- mice (the main population of peritoneal CD11b+ cells) produced higher levels of IL-10 than CD11b+F4 / 80+ peritoneal macrophages isolated from SM- mice (Fig. 2C). This result suggests that sCTLA-4 is involved in the phenotypic change of CD11b+ cells, which are mainly monocytes, macrophages, and granulocytes. Furthermore, S+M- mice had 1.5-fold higher serum IL-10 levels (Fig. 2D). In conclusion, both S+M- and SM- mice developed autoimmune diseases accompanied by lymphocyte hyperproliferation and antibody production, including autoantibodies, but the phenotype of the CD11b+ subset in S+M- mice was different from that in SM- mice with respect to the expression of CD80, IL4, IL-6, and IL-10.

[0091] We performed RNA-seq analysis to determine whether there were differences in the transcriptome (total transcripts) of CD11b+ macrophages with or without sCTLA-4. Principal coordinate analysis (PCoA) and gene ontology (GO) analysis confirmed that macrophages from S+M- mice had a different gene expression profile than macrophages from SM- mice, for example, with respect to phagocytosis, wound healing, cell chemotaxis, and angiogenesis (Figures 2E-2H). Genes showing significant differences in expression between macrophages from S+M- and SM- mice included many genes important for the function and properties of M1 or M2 macrophages (Figure 2I). We then selected established markers that define M1 / M2 macrophages and compared these genes. Macrophages from S+M- mice expressed high levels of Mrc1 (encoding CD206), Retnla (Fizz1), Arg1, and Ym1, which are well-known as M2 markers, while macrophages from SM- mice expressed high levels of NOS2 (iNOS), Il6, and Tnf, which are known as M1 markers (Figure 2J). In addition to Mrc1 and Retnla, Fcgr2b, Mgl2, Clec7a, and Igf1, which are typical genes regulated by IL-4 and IL-13 in macrophages, were all significantly more expressed in macrophages from S+M- mice (Figure 2K).

[0092] Taken together, the presence of sCTLA-4 in an inflammatory context directly or indirectly influenced the phenotype of CD11b+ cells, leading to the differentiation of macrophages towards an M2-like phenotype.

[0093] sCTLA-4 increases circulating Th2 and eosinophils during inflammatory conditions Because IL-4 is an important cytokine for inducing M2 macrophages in vitro and in vivo, we examined Th2 cytokine expression in S+M- mice. High blood concentrations of IL-5 and IL-4 were detected in S+M- mice (Figure 3A), and IL-4 / IL-5-producing CD4+T cells in the blood were significantly increased in S+M- mice (Figures 3B-3C). In contrast, the frequency of IL-4 / IL-5-producing CD4+T cells was significantly lower in the blood of SM- mice. Because IL-5 is involved in the differentiation, migration, and effector function of eosinophils, we evaluated the proportion of eosinophils in the blood. Eosinophils migrated significantly more in the blood of S+M- mice than in SM- mice (Figure 3D). Eosinophils mature in response to Th2 cytokine stimulation and express more IL-4 and the signature gene Siglec-F upon activation. Siglec-F induces apoptosis and suppresses excessive eosinophil proliferation in a negative feedback manner. Siglec-F was increased in tissue-infiltrating mature eosinophils from S+M- mice, and they expressed IL-4 at a level more than twice that of SM- mice (Figures 3E and 3F). Instead, eosinophils from SM- mice had reduced IL-4 production capacity compared with eosinophils from S+M- and S+M+ wild-type mice. The increase in IL-4 / IL-5-producing CD4+ T cells and circulating eosinophils in S+M- mice is consistent with the observation that the levels of eotaxin (CCL11), CCL22, and CCL24, which are increased by Th2 cytokines and decreased by Th1 cytokines, were significantly higher in S+M- mice compared with SM- mice (Figures 3G and 3H). This result suggests that the increase in Th2 cytokines and the suppression of Th1 cytokines under inflammation increase circulating Th2, IL-4-producing eosinophils and additional Th2 cytokines. Next, we evaluated the phenotype of alveolar macrophages in the lungs, which are prone to accumulation of Th2 and eosinophils. The expression of CD206 was significantly increased in alveolar macrophages of S+M- mice, indicating an M2-like phenotype. These results indicate that S+M- mice are biased toward differentiation into M2 macrophages not only in the peritoneal cavity but also in the lungs (Figure 3I).

[0094] We investigated whether the phenotypic differences in macrophages between S+M- and SM- mice were simply due to differences in the expression of Th2 cytokines. When splenic macrophages isolated from SM- mice were treated with IL-4 and IL-10 in vitro, macrophage CD80 was decreased and CD206 was increased (Figure 3J). This result suggests that CD11b+ cells isolated from S+M- mice express CD80. low and CD206 high Finally, to exclude the possibility that IL-4 / IL-5 overproducing ILC2s (type 2 innate lymphoid cells), basophils or mast cells were increased in S+M- mice, we assessed the IL33 / TSLP blood levels and percentage of cells that promote type 2 immune responses in these cells. Serum IL-33 and TSLP were suppressed in both S+M- and SM- mice (Figures 3K and 3L), the percentage of Lin-CD45+CD90+ ILCs (a common marker of innate lymphoid cells) in the blood and mesentery of S+M- mice was reduced (Figures 3M and 3N: GATA3+ ILC cells were undetectable in S+M- mice), and basophils or c-kit+ cells were not increased in S+M- mice (Figure 3O).

[0095] These data suggest that IL-4 / IL-5-producing Th2 cells are increased under inflammation, and that IL-4 high This suggests that an increase in infiltrating eosinophils contributes to the phenotypic changes of macrophages.

[0096] sCTLA-4 acts to bias Th1 and Th2 differentiation We evaluated whether the amount of available CD80 / 86 molecules, controlled by sCTLA-4, affects Th1 and Th2 differentiation. First, we used antibodies that inhibited either or both CD80 / 86 costimulation, and found that Th1 differentiation was highly dependent on the number of free CD80 / 86 molecules, whereas Th2 differentiation was independent (Figures 4A and 4B). Interestingly, blocking CD86 significantly promoted Th2 differentiation (Figure 4B). Based on the hypothesis that sCTLA-4 alters the ratio of Th1 and Th2 in vivo, we generated wild-type sCTLA-4 recombinant protein and mutant sCTLA-4 Y139A recombinant protein that cannot bind to CD80 / 86 to clarify the physiological role of sCTLA-4 in Th cell differentiation. Similar to the anti-CD80 / 86 antibody, the addition of recombinant sCTLA-4 in vitro dose-dependently inhibited Th1 differentiation, and conversely, at higher concentrations significantly promoted Th2 differentiation (Figures 4C-4F). These results suggest that sCTLA-4 has a similar function to anti-CD80 / 86 antibodies, and that blocking CD80 / 86 molecules with sCTLA-4 suppresses Th1 differentiation. Furthermore, it was suggested that sCTLA-4 does not affect Th2 differentiation under sufficient TCR stimulation, but rather promotes Th2 differentiation. Finally, to exclude the possibility that sCTLA-4, which was increased in S+M- mice, directly acted on monocytes / macrophages to differentiate into M2 macrophages, the monocyte / macrophage cell line RAW264.7 was treated with sCTLA-4. As a result, sCTLA-4 itself did not significantly affect M2 macrophage differentiation, unlike IL-4 and IL-10 (Figure 4G).

[0097] From the above, we conclude that sCTLA-4 has the function of suppressing Th1 differentiation and promoting Th2 differentiation even when TCR stimulation is sufficient, and indirectly promotes the differentiation of M2 macrophages.

[0098] sCTLA-4 counteracts Th1 inflammation in the intestinal and tumor environments In healthy conditions, CD4+ T cells in mesenteric lymph nodes and Peyer's patches expressed sCTLA-4 more than twice as much as those in other superficial lymph nodes (e.g., inguinal lymph nodes) (Figure 5A). Furthermore, SM- mice lacking sCTLA-4 had significantly shorter colons and significantly reduced body weight at 3 weeks of age compared to S+M- mice, and small foci of lymphocytic infiltration were observed in the colonic tissue (Figures 5B-D and 1I). Based on this, we investigated whether sCTLA-4 affects the differentiation of Th1 cells and colonic macrophages in mesenteric lymph nodes in vivo. The number of Th1 and Th17 cells in the mesenteric lymph nodes of SM- mice was significantly increased by the deletion of sCTLA-4 (Figure 5E). Furthermore, colonic macrophages isolated from SM- mice showed high expression of iNOS and IL-6 (indicating an M1-like phenotype) in association with an increase in IFNγ-producing Th1, whereas colonic macrophages isolated from S+M- mice showed high expression of CD206 and Fizz1 (indicating an M2-like phenotype) (Fig. 5F). These results suggest that the presence of sCTLA-4 suppresses the differentiation of Th1 and M1 macrophages in the intestine, even in mice with the same mCTLA-4 deficiency-induced autoimmune disease. Furthermore, it was found that differentiation of M2 macrophages was biased not only in the peritoneal cavity and lungs but also in the intestine of S+M- mice.

[0099] CD45RB high Inflammatory bowel disease (IBD) induced by adoptive transfer of CD4+ T cells into SCID mice is associated with the differentiation of effector Th1 cells. S+M- Treg or SM- Treg (the difference between the two is the presence or absence of sCTLA-4) are expressed by CD45RB highWe examined the in vivo Th1 suppressive function of sCTLA-4 by co-transferring it with naive CD4+ T cells into SCID mice. Co-transfer of S+M- Tregs protected mice from the development of colitis, whereas co-transfer of SM- Tregs failed to suppress colitis (Fig. 5G-I). Mice co-transferred with SM- Tregs showed significant weight loss, marked colonic epithelial cell hyperplasia, and elevated colitis disease scores (Fig. 5G-I). We next generated B16F10 melanoma cell lines secreting wild-type sCTLA-4 or mutant sCTLA-4 Y139A. The B16F10 melanoma line secreting sCTLA-4 Y139A has no ability to block CD80 / 86 molecules. We subcutaneously injected these B16F10 melanoma cell lines into C57BL / 6J wild-type mice to evaluate whether sCTLA-4 affects IFNγ-dependent antitumor immunity. sCTLA-4-producing melanoma, which mimics sCTLA-4 secreted by Tregs in the tumor microenvironment, showed rapid tumor growth, similar to the results in nude mice (T cell-deficient mice) (Figures 5J and 5K). This result suggests that sCTLA-4-producing melanoma suppressed T cell-dependent antitumor immunity. Consistent with this result, we found that sCTLA-4 in the tumor environment significantly suppressed IFNγ production (Figure 5L). The suppression of IFNγ was due to the upregulation of CD206 in the tumor tissue. high This was accompanied by a marked increase in M2-like tumor macrophages (TAMs) ( Fig. 5M ).

[0100] These results suggest that sCTLA-4-mediated inhibition of Th1 in an in vivo inflammatory environment promoted the differentiation of M2 macrophages.

[0101] sCTLA-4 prevents spontaneous differentiation of IFN-γ-producing T cells and autoantibody production in healthy subjects To investigate the function of sCTLA-4 in a more healthy state, we generated S-M+ (sCTLA-4 KO) mice (Figure 6A). These mice express only mCTLA-4 (mCTLA-4 mRNA and protein) at the same level as wild-type mice (Figures 6B and 6C). The percentage of CD44+CD8+ effector and memory T cells in the spleen and lymph nodes gradually increased with age, more than double that at 24 weeks of age compared to 8 weeks of age (Figure 6D). Since the percentage of CD44+CD4+ effector and memory T cells was increased in the lymph nodes (Figure 6E), we decided to compare them with wild-type mice at 30 weeks of age. Compared to mice lacking mCTLA-4, S-M+ mice had a normal appearance and did not show enlargement of the spleen or lymph nodes even at 30 weeks of age (Figures 6F-6H). However, 30-week-old S-M+ mice showed ectopic lymph node structures in adipose tissue and leukocyte infiltration in lung tissue (Figure 6I). In addition, the levels of autoantibodies anti-dsDNA IgG, anti-gastric parietal cell IgG, IL-6, and TNF-α were significantly higher in S-M+ mice than in S+M+ mice at 30 weeks of age (Figure 6J). Furthermore, macrophages isolated from the peritoneal cavity of S-M+ mice expressed significantly higher levels of iNOS and IL-6 (Figure 6K). This result indicates that peritoneal macrophages from S-M+ mice have an M1-like phenotype. Consistent with the above observations, sCTLA-4 deficiency resulted in a marked increase in IFNγ-producing CD8+ Eomes+ effector / memory T cells and IFNγ-producing CD4+ Th1 cells in the spleen, mesenteric lymph nodes, and superficial lymph nodes (Figures 6L and 6M). These results suggest that sCTLA-4 deficiency leads to age-related dysregulation of type 1 immunity, resulting in preclinical autoimmunity.

[0102] Inhibiting the phenotypic transition from pro-inflammatory M1 to anti-inflammatory M2 macrophages has unfavorable consequences for tissue repair. Therefore, we evaluated whether the contribution of sCTLA-4 to suppressing type 1 immunity (Th1, M1 type) and promoting type 2 immunity (Th2, M2 type) during inflammation could promote the wound healing process using a skin excision wound model. 12-week-old S-M+ mice consistently showed delayed wound closure compared to S+M+ control mice at 1, 3, and 5 days after wounding (Figure 6N). Consistent with the observations of traumatic wounds, the re-epithelialization process involving migration of K14+ keratinocytes (located in the epidermal basal layer) beneath the wound was significantly impaired in 12-week-old S-M+ mice (Figure 6O). On the other hand, in control mice with sCTLA-4, the wound was almost closed by re-epithelialization at 5 days after wounding (Figures 6N and 6O). Similar observations were obtained by comparing 30-week-old S-M+ mice with autoimmunity and S+M+ mice, confirming the importance of sCTLA-4 to the tissue repair process (Figures 6P and 6Q). As mentioned above, Th1 and IFNγ+CD8+ cells were significantly increased in 30-week-old S-M+ mice, so we further compared wound closure between 12-week-old and 30-week-old S-M+ mice. There was no significant difference in the wound area on days 1 and 3 after wounding, but on day 5, wound closure was significantly delayed in 30-week-old S-M+ mice compared to 12-week-old S-M+ mice (Figure 6R). These results suggest that sCTLA-4 promotes tissue repair and remodeling, which are important for the termination of inflammation.

[0103] Taken together, the data from S-M+ mice and the promotion of wound closure and re-epithelialization processes after cutaneous wounding by sCTLA-4 support the conclusion that sCTLA-4 acts to suppress Th1 differentiation and bias macrophage differentiation (M1→M2).

[0104] sCTLA-4 suppresses Tfh and allergen-reactive Th2 differentiation and IgE production Although S-M+ mice had high levels of IgE (Figure 7A), IL-4-producing Th2 cells were not detected in the lymph nodes of S-M+ mice (data not shown). It has been reported that IL-4 derived from Tfh cells, but not Th2 cells, is important for IgE class switching. It has also been reported that Tfh cells have a high CD80 / 86 requirement for differentiation. We therefore investigated whether sCTLA-4 affects Tfh differentiation in vivo. Deficiency of sCTLA-4 increased the proportion of Bcl6+PD1+CXCR5+Tfh cells in Peyer's patches and mesenteric lymph nodes, and increased the proportion of CD38-GL7+IgD-IgM-germinal center (GC) B cells in mesenteric lymph nodes (Figures 7B and 7C). Given that sCTLA-4 is highly expressed in Peyer's patches and mesenteric lymph nodes under healthy conditions, these results suggest that sCTLA-4 plays an important role in regulating the differentiation of Tfh cells (Figure 5A).

[0105] sCTLA-4 promotes Th2 differentiation by suppressing Th1 differentiation under inflammatory conditions, and suppresses spontaneous differentiation and increase of Th1 and Tfh cells under healthy conditions. We investigated whether sCTLA-4 acts as an inhibitor of allergy progression using an experimental asthma model that depends on allergen-reactive Th2 cells. Eight-week-old healthy S-M+ or S+M+ mice (without increased IFNγ+-producing T cells) were sensitized by intraperitoneal administration (ip) of a mixture of OVA and adjuvant, and then OVA solution was instilled into the surgical trachea (it) to stimulate OVA-reactive Th2 cells, inducing asthma. S-M+ mice had more Th2 cells, eosinophils, and M2 alveolar macrophages in the lung tissue compared with S+M+ mice (Figures 7D-7G). This suggests that in early inflammation under healthy conditions, sCTLA-4 functions as an activation threshold (a force that suppresses Th2 differentiation) of allergen-reactive naive T cells, rather than a promoter of Th2 differentiation. Importantly, M2 macrophage differentiation was promoted by the increase in Th2 and eosinophils even in the absence of sCTLA-4 (Figure 7F). These results indicate that in the absence of inflammation, when the amount of CD80 / 86 is low (low numbers of antigen-presenting cells and low expression of CD80 / 86 in healthy conditions), sCTLA-4 is sufficient to block CD80 / 86 and prevent the differentiation of Th2 cells. This suggests that sCTLA-4 can delay or suppress the development of allergy, as observed in S+M+ mice with sCTLA-4.

[0106] In conclusion, sCTLA-4 elevates the activation threshold of naive and effector T cells in both non-inflammatory and inflammatory conditions, regulates the balance between helper T cell and macrophage differentiation bias, suppresses autoimmunity and allergy in healthy conditions, and reduces or quells inflammation by promoting Th2·M2 macrophage differentiation and tissue repair / remodeling in inflammatory conditions.

[0107] As described herein, sCTLA-4 has the unique ability to regulate the differentiation bias of helper T cells by restricting the differentiation of naive T cells into effector T cells via CD80 / 86 and preventing persistent costimulation (CD28-CD80 / 86 interaction) during inflammation. It was also demonstrated that sCTLA-4 plays a key role in the differentiation of M2 macrophages in inflammatory conditions and is involved in the suppression of inflammation. Furthermore, sCTLA-4-rich tumor environment promoted tumor growth along with abundant M2 tumor macrophages, whereas in healthy conditions, sCTLA-4 prevented spontaneous autoantibody production in lymphoid tissues and abnormal differentiation of Th1, Tfh, Th17 and Th2. These results indicate that dysfunction or overproduction of sCTLA-4 is widely involved in various pathologies such as autoimmune diseases, tumors and allergies. These findings support the usefulness of sCTLA-4 recombinant protein or inhibitors as therapeutic agents.

[0108] (Treatment of inflammatory bowel disease) Inflammatory bowel disease, such as IBD, is induced in SCID mice by adoptive transfer of highly CD45RB positive naive T cells. During the observation period, recombinant secretory CTLA-4 is periodically administered intraperitoneally, and the progression and severity of inflammatory bowel disease are measured using multiple parameters. Body weight is measured weekly. After the observation period, the colon is histopathologically analyzed, and the effect of secretory CTLA-4 is evaluated using a pathology score. At the same time, the degree of proliferation of IFNγ-producing CD4 positive helper T cells in the intestinal lymph nodes is measured by FACS to evaluate the effect of secretory CTLA-4. If the effect of secretory CTLA-4 is observed, there will be suppression of weight loss, a decrease in the pathology score, and suppression of proliferation of IFNγ-producing CD4 positive helper T cells.

[0109] (Treatment of allergic diseases) Asthma allergic disease is induced in mice by sensitization using ovalbumin. During the observation period, recombinant secretory CTLA-4 is periodically administered intraperitoneally, and the final progression and severity of allergy are measured using multiple parameters. To evaluate whether secretory CTLA-4 retards Th2 differentiation and eosinophil accumulation, FACS analysis of lung tissue suspensions and bronchoalveolar lavage fluid, as well as histopathological analysis of the lungs, are performed. If the effects of secretory CTLA-4 are observed, the above-mentioned Th2 differentiation and eosinophil accumulation will be suppressed.

[0110] (wound healing) A wound is created on the back of the mouse using a biopsy punch. During the observation period, recombinant secreted CTLA-4 is periodically applied to the wound site or administered intraperitoneally, and the progress and extent of wound healing are measured by multiple parameters. The size of the wound is measured daily. In addition, the re-epithelialization process after wounding is quantified by the amount of K14+ epidermal basal keratinocytes covering the wound site. If secreted CTLA-4 is effective, in addition to promoting wound healing and reducing the size of the wound more quickly, the re-epithelialization process is also promoted.

[0111] (Note) Although the present disclosure has been illustrated using the preferred embodiments thereof, it is understood that the present disclosure should be interpreted in scope only by the claims. It is understood that the patents, patent applications, and other documents cited in this specification are incorporated by reference into this specification in the same manner as if the contents themselves were specifically set forth herein. [Industrial Applicability]

[0112] The pharmaceutical composition of the present disclosure can be used for the treatment and prevention of various autoimmune diseases, allergies, inflammatory diseases such as wounds, etc. Furthermore, the pharmaceutical composition of the present disclosure has no side effects when applied to a living body and can safely induce immunosuppression, and is therefore expected to be applicable in the medical field. [Sequence List Free Text]

[0113] SEQ ID NO: 1: Peptide sequence of sCTLA-4 specific amino acids SEQ ID NOs: 2-3: Forward and reverse primer sequences of mouse sCTLA-4 SEQ ID NO: 4: TaqMan probe (FAMNFQ-MGB) SEQ ID NOs: 5-6: Forward and reverse primer sequences of mouse mCTLA-4 SEQ ID NO: 7: TaqMan probe (FAMNFQ-MGB) SEQ ID NOs: 8-9: Forward and reverse primer sequences for human sCTLA-4 SEQ ID NOs: 10-11: Forward and reverse primer sequences for human mCTLA-4 SEQ ID NOs: 12-13: Forward and reverse primer sequences of human HPRT1 SEQ ID NO: 14: MYPPPY motif SEQ ID NO: 15: Mutated MYPPPY motif SEQ ID NO: 16: Amino acid sequence of WTsCTLA-4

Claims

1. A pharmaceutical composition comprising CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a wound, or a disease, disorder or condition involving a wound.

2. The pharmaceutical composition according to claim 1, wherein the CTLA-4 comprises at least one selected from the group consisting of secretory CTLA-4 and membrane-type CTLA-4.

3. The pharmaceutical composition of claim 1 or 2, wherein the CTLA-4 comprises secreted CTLA-4.

4. The pharmaceutical composition according to any one of claims 1 to 3, which is administered topically.

5. The pharmaceutical composition according to any one of claims 1 to 3, which is administered systemically.

6. The pharmaceutical composition of any one of claims 1 to 5, administered in combination with an antibiotic, an antifungal, or an antiviral agent.

7. A combination comprising CTLA-4 and an antibiotic for treating or preventing a wound, or a disease, disorder or condition involving a wound.

8. A pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or an agent that induces at least one of them, for treating or preventing a disease, disorder or condition.

9. The pharmaceutical composition according to claim 8, wherein the functional equivalent comprises a protein or peptide comprising a MYPPPY motif region encoded by Exon 2 of the CTLA-4 gene, and a dimer or multimer of said protein or peptide.

10. The pharmaceutical composition according to claim 8 or 9, wherein the functional equivalent comprises a protein expressed in which the signal sequence encoded by Exon 1 of the CTLA-4 gene is replaced with another signal sequence of homologous or heterologous origin.

11. The pharmaceutical composition according to any one of claims 8 to 10, which is administered topically.

12. The pharmaceutical composition according to any one of claims 8 to 10, which is administered systemically.

13. The pharmaceutical composition according to any one of claims 8 to 12, administered in combination with an antibiotic, an antifungal or an antiviral agent.

14. A pharmaceutical composition comprising secreted CTLA-4 or a nucleic acid encoding same, or a functional equivalent thereof, or a factor that induces at least one of them, for treating or preventing a disease, disorder, or symptom associated with an abnormality in the immune system.

15. The pharmaceutical composition according to claim 14, wherein the disease, disorder or condition associated with an abnormality in the immune system comprises an immune system disease accompanied by inflammation.

16. The pharmaceutical composition according to claim 14 or 15, wherein the disease, disorder or condition associated with an abnormality in the immune system comprises an autoimmune disease and / or an allergy, or a disease, disorder or condition associated therewith.

17. The pharmaceutical composition according to any one of claims 14 to 16, wherein the disease, disorder or condition associated with an abnormality in the immune system comprises a disease, disorder or condition associated with an autoimmune disease.

18. The pharmaceutical composition according to any one of claims 14 to 16, wherein the disease, disorder or condition associated with an abnormality in the immune system comprises an allergy-related disease, disorder or condition.

19. The pharmaceutical composition according to any one of claims 14 to 18, wherein the functional equivalent comprises a protein or peptide comprising a MYPPPY motif region encoded by Exon 2 of the CTLA-4 gene, and a dimer or multimer of said protein or peptide.

20. The pharmaceutical composition according to any one of claims 14 to 19, wherein the functional equivalent comprises a protein expressed by replacing a signal sequence encoded by Exon 1 of the CTLA-4 gene with another signal sequence of homologous or heterologous origin.

21. The pharmaceutical composition according to any one of claims 14 to 20, which is administered topically.

22. The pharmaceutical composition according to any one of claims 14 to 20, which is administered systemically.

23. The pharmaceutical composition of any one of claims 14 to 22, administered in combination with an antibiotic, an antifungal, or an antiviral agent.

24. 1. A method for screening for a substance for treating or preventing a wound, or a disease, disorder or condition associated with a wound, comprising: contacting the cell with a candidate substance; measuring the expression level of CTLA-4 in the cells or on the cell surface; selecting a candidate substance that increases the amount or level of CTLA-4 in the cell or on the cell surface compared to before contact with the candidate substance; A method comprising:

25. 1. A method for screening a substance for treating or preventing a disease, disorder, or condition associated with an abnormality in the immune system, comprising: contacting the cell with a candidate substance; measuring the expression level of secretory CTLA-4 in the cells or outside the cells; selecting the candidate substance that increases the amount or level of secreted CTLA-4 in or outside the cell compared to before contact with the candidate substance; A method comprising:

Images