Genetically modified pig, method for producing genetically modified pig, and drug discovery support method

Abstract

To provide a pig lacking the Klotho gene.SOLUTION: The present invention provides a genetically modified pig (Sus scrofa), where gene manipulation of a fertilized egg results in the knockout of the Klotho gene. The fertilized egg gene manipulation is genome editing. The genome editing includes, as the gRNA sequence, any one or any combination of five specific sequences. The knockout of the Klotho gene is a deletion of one or both alleles. The deletion of one or both alleles of the Klotho gene causes a frameshift mutation. The genetically modified pig exhibits phenotypes of arterial calcification and bone mass reduction.SELECTED DRAWING: Figure 3

Description

[Technical field]

[0001] In particular, the present invention relates to genetically modified pigs, methods for producing genetically modified pigs, and methods for supporting drug discovery. [Background technology]

[0002] The Klotho gene was first identified in mice. According to Non-Patent Document 1, a Klotho gene knockout mouse, which was established by chance in the process of creating a transgenic mouse, showed aging-like symptoms at a young age. For this reason, it is recognized as an accelerated aging model (aging model) animal. However, because the size of mice and humans differs greatly, there was a strong need to create a Klotho-deficient pig model that could accurately reproduce human disease and allow experimental results to be effectively extrapolated to humans. Here, because embryonic stem cells have not been established in pigs, genetically modified pigs targeting specific genes have traditionally been produced using somatic cell nuclear transfer technology. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] JP 2017-184639 A [Non-patent literature]

[0004] [Non-Patent Document 1] Makoto Kuro-o et al., “Mutation of the mouse klotho gene leads to a syndrome resembling aging,” Nature, 1997, 390(6655), p45-51 [Non-Patent Document 2] Sanghoon Lee et al., “Failure to maintain full-term pregnancies in pig carrying klotho monoallelic knockout fetuses,” BMC Biotechnology, 2021, 21:1 [Non-Patent Document 3] Shoji Ichikawa et al., “A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis”, The Journal of Clinical Investigation, 2007, 117(9), p.2684-2691 Summary of the Invention [Problem to be solved by the invention]

[0005] However, according to the description in Non-Patent Document 2, in the past, when somatic cell nuclear transfer technology was used in which the nucleus of a somatic cell with a modified Klotho gene was used as a donor, miscarriage occurred even with a deficiency of just one allele, and it was not possible to obtain live offspring from Klotho-deficient pigs.

[0006] The present invention has been made in view of the above circumstances, and an object of the present invention is to solve the above-mentioned problems. [Means for solving the problem]

[0007] The genetically modified pig of the present invention is a genetically modified pig (Sus scrofa), characterized in that the Klotho gene has been knocked out by genetic manipulation of fertilized eggs. The genetically modified pig of the present invention is characterized in that the knockout of the Klotho gene is a deletion of one or both alleles. The genetically modified pig of the present invention is characterized in that the deletion of one or both alleles of the Klotho gene is a frameshift mutation. The genetically modified pigs of the present invention are characterized by exhibiting a phenotype of arterial calcification and bone loss. The method for producing a genetically modified pig of the present invention is a method for producing a genetically modified pig (Sus scrofa), and is characterized in that the Klotho gene is knocked out by genetic manipulation of fertilized eggs. The method for producing a genetically modified pig of the present invention is characterized in that the genetic manipulation of the fertilized egg is genome editing. The method for producing a genetically modified pig of the present invention is characterized in that the genome editing includes any one or any combination of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 as a gRNA sequence. The method for producing a genetically modified pig of the present invention is characterized by crossing parents of a lineage in which one allele of the Klotho gene is deleted, produced by the method for producing a genetically modified pig, to produce a first-generation hybrid genetically modified pig that exhibits a phenotype of arterial calcification and bone loss. The drug discovery support method of the present invention is characterized in that the genetically modified pig or a genetically modified pig produced by the method for producing a genetically modified pig is used as an aging model animal to develop drugs and treatments. Effect of the Invention

[0008] According to the present invention, live offspring of Klotho-deficient pigs can be provided by genetically engineering fertilized eggs. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 is a conceptual diagram of genome editing into a pig fertilized egg in accordance with an embodiment of the present invention. [Diagram 2] 1 is a graph showing genome editing efficiency in blastocysts according to an embodiment of the present invention. [Diagram 3] 1 is a photograph showing the phenotype of a Klotho knockout pig according to an example of the present invention. [Figure 4] 1 is a graph showing weight gain in Klotho knockout pigs according to an embodiment of the present invention. [Diagram 5]1 is a photograph showing joint swelling and ectopic calcification in a Klotho knockout pig according to an embodiment of the present invention. [Figure 6] 1 is a photograph showing a CT image of a Klotho knockout pig according to an embodiment of the present invention. [Figure 7] 1 is a graph showing serum phosphorus concentrations in Klotho knockout pigs according to an embodiment of the present invention. [Figure 8] 1 is a graph showing serum CPP concentrations in Klotho knockout pigs according to an embodiment of the present invention. [Figure 9] 1 is a photograph showing the kidney of a Klotho knockout pig according to an example of the present invention. [Figure 10] 1 is a photograph showing bones of a Klotho knockout pig according to an embodiment of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] <Embodiment> The Klotho gene was first identified in mice by one of the present inventors. According to Non-Patent Document 1, a Klotho gene knockout mouse was established by chance when the Klotho gene was deleted during the process of creating a transgenic mouse. Since the mouse exhibits aging-like symptoms at a young age, the mouse is recognized as an aging model animal. However, because mice and humans differ greatly in size, there has been a strong demand for the creation of a Klotho-deficient pig model that can reproduce human diseases with high accuracy and effectively extrapolate experimental results obtained using the model to humans. Here, since embryonic stem cells have not been established in pigs, genetically modified pigs targeting specific genes have been created by somatic cell nuclear transfer in the past. However, as described in Non-Patent Document 2, when somatic cell nuclear transfer technology using the nucleus of a somatic cell modified with the Klotho gene as a donor was used, miscarriage occurred even with the deficiency of one allele, so it was not possible to obtain a live birth of a Klotho-deficient pig.

[0011] Although the reason why Klotho-deficient pigs could not be produced was unknown, the present inventors speculated that modification of the Klotho gene aggravated epigenetic abnormalities, causing embryos to not develop normally. For this reason, the present inventors came up with the idea that developing an embryo from a fertilized egg would be a clue to solving the problem as another method for producing genetically modified pigs that does not require the process of somatic cell reprogramming. For this reason, the present inventors developed the method described in Patent Document 1 without using somatic cell nuclear transfer technology, and performed direct genetic modification on an in vitro fertilized egg, which is not often performed in pigs. Specifically, in this embodiment, a genome editing tool targeting the Klotho gene was introduced into an in vitro fertilized egg of a pig by electroporation. At this time, various sequences were tried for the gRNA used in genome editing, and the genome editing efficiency in the blastocyst was examined, and a gRNA that can highly efficiently modify the Klotho gene of a pig was determined. Then, a Klotho gene-modified embryo was produced, and the embryo was transplanted into a surrogate mother pig to produce a Klotho gene-modified pig. As a result of carrying out numerous experiments as described above, the present inventors have succeeded in obtaining surviving Klotho knockout pigs (single-allele-deficient pigs and double-allele-deficient pigs), thereby completing the present invention.

[0012] The obtained pigs lacking both alleles of the Klotho gene showed phenotypes such as calcification in the arteries, slowed weight gain, swollen joints, reduced bone mass and extremely brittle bones, and difficulty standing up. Thus, the pigs lacking both alleles are expected to be used as a model for accelerated aging that exhibits arteriosclerosis and pathological fractures, and as a model for the development of drugs for treating lifestyle-related diseases, surgical treatment devices for right calcification of large blood vessels, and aging inhibitors. In particular, pigs are large animals and bear a greater weight load than mice, so they exhibit phenotypes not seen in mice, such as joint swelling and difficulty standing, making them extremely useful as a human model, such as a potential model for pathological fractures associated with aging. On the other hand, since the above-mentioned fatal phenotype is not observed in the case of one allele deficiency, it is possible to stably produce pigs that are deficient in both alleles by maturing them and breeding them. The genetically modified pig according to this embodiment, the method for producing the same, and the drug discovery support method will be described in detail below.

[0013] (Genetically modified pigs and methods for producing genetically modified pigs) The method for producing a genetically modified pig according to this embodiment (method for producing and obtaining a lineage) is a method for producing a genetically modified pig (Sus scrofa, particularly Sus scrofa domesticus), and is characterized in that the Klotho gene is knocked out by genetic manipulation of fertilized eggs. In this embodiment, the genetic manipulation of the fertilized egg is carried out by genome editing. As the genome editing, it is preferable to use a method such as CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas9, double nicking method using nickase (Cas9 (D10A)), ZFN (Zinc-Finger nuclease), TALEN (Transcription activator-like effector nuclease), etc., which are known to those skilled in the art, and to use a method that can knock out with high accuracy and little off-target effect by targeting the sequence of Klotho gene in the genome. Below, an example using CRISPR-Cas9 is described.

[0014] Here, CRISPR-Cas9 is composed of a complex of CRISPR RNA (crRNA) and transactivating CRISPR RNA (tracrRNA), or a guide RNA such as sgRNA artificially connected to them to form a single-stranded RNA (hereinafter, simply referred to as "gRNA"), and a nuclease called Cas9. The gRNA specifically recognizes and binds to the target DNA sequence, and guides Cas9. Cas9 then cuts the double strand of DNA. This double-strand break repair mechanism makes it possible to introduce mutations such as deletions and insertions due to errors in non-homologous end joining (NHEJ) at the target site. This makes it possible to lose the function of a gene (hereinafter, also referred to as "knockout") by various gene function losses due to frameshifts, introduction of termination codons, changes in exon-intron boundary sequences, changes in the three-dimensional structure of the translation product, etc. (hereinafter, simply referred to as "frameshift mutations, etc.").

[0015] In this embodiment, the gRNA sequence in this CRISPR-Cas9 may include any one of gRNA#1 "tgcttctttccgcccaactc" (SEQ ID NO: 1), gRNA#2 "actgatccagtgggagctta" (SEQ ID NO: 2), gRNA#3 "ctatggtcggtcatcctgcg" (SEQ ID NO: 3), gRNA#4 "tccatcaataaatacgggtt" (SEQ ID NO: 4), and gRNA#5 "tcaggctgggagattccagt" (SEQ ID NO: 5) and any combination thereof. That is, any one or any combination of the sequences of SEQ ID NOs: 1 to 5 can be used as the target sequence. These sequences can be included in a vector for generating gRNA as DNA sequences as described above, and gRNA can be generated by transcription to perform genome editing. Here, the sequences of SEQ ID NOs: 1 to 5 target a site other than exon 1 of the porcine Klotho genome. Although the present inventors have prepared a gRNA targeting exon 1, it is not preferable due to the GC content in the sequence, and therefore may not be used in this embodiment. In addition, the sequences of SEQ ID NOs: 1 to 5 can also be used as targets for genome editing other than CRISPR-Cas9.

[0016] The method for producing a genetically modified pig of this embodiment is characterized by producing a genetically modified pig from a fertilized egg treated by the above-mentioned genome editing. Here, in the method for producing a genetically modified pig according to the present embodiment, eggs collected from a mother pig by a method known to those skilled in the art, or eggs frozen and stored are thawed, and then immature eggs are matured in vitro (in vitro maturation, IVM) for about 1 to 2 days and used for in vitro fertilization (in vitro fertilization, IVF). Then, the fertilized eggs are subjected to the above-mentioned genome editing operation. When performing genome editing, fertilized eggs thawed after cryopreservation may be used. Then, the fertilized eggs are cultured until they become blastocysts. The genotype may be checked at this point. The cultured blastocyst is transplanted into the uterus of a surrogate mother pig, and the surrogate mother is allowed to continue the pregnancy and the baby is born, thereby obtaining a baby. Alternatively, in order to obtain a baby, the fertilized eggs before developing into blastocysts may be transplanted into the oviduct of the surrogate mother pig. It is possible to confirm the genotype of the baby to obtain a genetically modified pig according to the present embodiment.

[0017] [Genetically modified pigs] The genetically modified pig of this embodiment is characterized in that it is a genetically modified pig produced by the above-mentioned genetically modified pig production method. That is, the genetically modified pig according to this embodiment is a genetically modified pig (Sus scrofa), and is characterized in that the Klotho gene has been knocked out by genetic manipulation of fertilized eggs. In this embodiment, the knockout of the Klotho gene may be a deletion of one or both alleles. The deletion of one or both alleles by the knockout can be confirmed by a method known to those skilled in the art, such as PCR (Polymerase Chain Reaction) or sequencing.

[0018] Here, the genetically modified pig produced by this embodiment can be distinguished by a person skilled in the art by sequencing the gene sequence of the genome associated with genome editing, etc. However, if the advancement of genome editing techniques makes it impossible to distinguish from normal mutations, there may be special circumstances in which it is very difficult for a person skilled in the art to directly identify the structure or characteristics in the field to which the person skilled in the art of this embodiment belongs.

[0019] In addition, in the genetically modified pig according to this embodiment, the deletion of one or both alleles of the Klotho gene may be a frameshift mutation or the like. In this case, a functional Klotho gene product is not translated from the chromosome related to the deleted allele. When both alleles undergo this frameshift mutation or the like, the functional Klotho gene product is no longer present, resulting in a phenotype as described below. Pigs exhibiting this phenotype will develop aging-like pathology early and become fatal early. For this reason, the offspring (founder, F0) born after genome editing can be used as an aging model animal.

[0020] On the other hand, since no lethal phenotype is observed in the case of single-allelic deficiency, it is possible to stably produce biallelic deficiency pigs in the first hybrid generation (F1) by crossbreeding. In other words, the genetically modified pig of this embodiment can be obtained by crossing parent pigs of a lineage in which one allele of the Klotho gene is missing, produced by the above-mentioned method for producing a genetically modified pig, and producing (producing) a first-generation hybrid (F1) genetically modified pig that exhibits a phenotype of arterial calcification and bone loss. Here, in this embodiment, the single allele deletion may be one in which both alleles are mutated by genome editing, but one of the alleles is an in-frame mutation that does not result in a lethal phenotype.

[0021] Next, the phenotype of the genetically modified pig according to this embodiment will be described. The genetically modified pig according to this embodiment is characterized by exhibiting a phenotype of arterial calcification and bone loss. In the genetically modified pig according to this embodiment, phosphorus accumulates in the blood due to the loss of function of the Kloth gene, resulting in the formation of calcium phosphate crystals. These calcium phosphate crystals, together with fetuin-A present in the blood, become colloidal particles (Calciprotein Particles, hereafter referred to as "CPPs") that disperse in a colloidal manner in the liquid phase. In large quantities, these CPPs damage blood vessels and promote calcification. In addition, the genetically modified pig according to the present embodiment is considered to have a decreased bone mass and pathological fractures due to impaired bone mineralization. In addition, the genetically modified pig according to the present embodiment also has symptoms such as joint swelling, bone morphological abnormalities, ectopic calcification, and kidney damage. This joint swelling is a phenotype that does not appear in mice with a low body weight, and is considered to be closer to that of humans. In this way, the genetically modified pig according to this embodiment can be used as an aging model pig exhibiting arteriosclerosis and pathological fractures.

[0022] [Drug discovery support method] The drug discovery support method of this embodiment is characterized in that drug development is carried out using a first-generation hybrid (F1) genetically modified pig produced by the method for producing a genetically modified pig according to this embodiment as an aging model animal. That is, in the drug discovery support method of this embodiment, the genetically modified pig described above can be evaluated and used as an accelerated aging model pig (aging model animal) in anti-aging research such as the development of new medicines and new treatments. In this case, in the drug discovery support method of this embodiment, it is possible to administer a drug for an aging-related disease to the genetically modified pig of this embodiment, treat it, and evaluate the condition of the genetically modified pig to evaluate the effectiveness, toxicity, side effects, etc.

[0023] Drugs for diseases related to the drug discovery of this embodiment include drugs according to various characteristics shown in the phenotype of the genetically modified pig according to this embodiment, such as osteoarthritis accompanied by swelling of joints due to aging, pseudogout, other walking difficulties, kidney damage due to CPP accumulation, brain diseases such as Alzheimer's disease, autoimmune diseases, and other drugs related to aging. Candidate drugs for drug screening that require investigating the effects and toxicity of drugs, candidate drugs for treating symptoms that impair weakness and health lifespan due to aging itself, aging inhibitors, life extension drugs, rejuvenation drugs, etc. Candidate drugs of this embodiment include, for example, low molecular weight compounds, peptides, proteins, cell extracts, supernatants, fermentation products, other synthetic compounds, natural compounds, etc. These candidate drugs may have any purity or degree of purification. In addition, the diseases targeted by the drug screening of this embodiment include any disease. Furthermore, it is also possible to use as a drug a composition that acts on genes, gene products, agonists / antagonists, and other pathways that are the subject of Klotho expression regulation.

[0024] The effects and side effects of these drugs and treatments can be examined by analyzing the phenotype of the genetically modified pig, measuring the life span, analyzing the expression of marker genes, morphological analysis, evaluating toxicity, and the like. Furthermore, screening may be performed according to a clinical trial protocol or by any method known to those skilled in the art. In this embodiment, for example, a bone biopsy may be performed. Alternatively, the accumulation of Alzheimer's-related factors, such as β-amyloid and tau protein, may be measured by collecting cerebrospinal fluid. In these analyses, if a candidate drug is administered and treatment is performed on an individual, organ, tissue, and / or cell, and symptoms are cured or normal function is maintained, the candidate drug can be assumed to be effective and to have little toxicity or side effects.

[0025] Furthermore, the genetically modified pig according to this embodiment can be used to develop surgical devices and devices, such as devices for treating vascular calcification, osteomalacia and osteoporosis, dementia and joint disorders, and renal disorders associated with aging, as a drug discovery support in a broad sense. It can also be used in the development of dietary therapy, exercise therapy, stimulation therapy, and other therapies for alleviating symptoms associated with aging.

[0026] Here, the genetically modified pig according to this embodiment may be dialyzed with a CPP removal column, since it shows various pathological conditions as if aging had accelerated due to the abnormal accumulation of CPP as described above, and dies very early. This makes it possible to reveal factors that accelerate or decelerate aging, which are not dependent on CPP. This CPP column cannot be applied to small animals such as mice, but can be applied to pigs, which are animals whose body weight is a specific value or more. However, if the genetically modified pig according to this embodiment has the same physique as a normal pig, it will weigh around 25 kg even at 8 weeks of age, when the phenotype begins to be observed, and this is the specific value to which the CPP removal column can be applied. However, if the body weight is lower than that, the CPP removal column may be applied after waiting until the body weight exceeds the specific value. In addition, it is considered that the influence of CPP can be further suppressed by using phosphorus-restricted feed for the genetically modified pig according to this embodiment.

[0027] With the above configuration, the following effects can be obtained. Conventionally, Klotho gene knockout mice have been recognized as an aging model animal because they exhibit aging-like symptoms at a young age. However, because mice and humans differ greatly in size, there has been a strong demand for the production of Klotho-deficient pigs that can reproduce human diseases with high accuracy and whose experimental results can be extrapolated to humans. Conventionally, genetically modified pigs targeting specific genes have been produced using somatic cell nuclear transfer technology. However, according to Non-Patent Document 2, when somatic cell nuclear transfer technology is used, miscarriage occurs even with the deficiency of one allele, so it was not possible to obtain a live birth from Klotho-deficient pigs. This was presumed to be because the placental structure differs between pigs and mice, and the effect of Klotho gene deficiency in pigs on maintaining pregnancy.

[0028] In contrast, in the present embodiment, it is possible to actually obtain a pig litter with the Klotho gene knocked out by directly genetically modifying an in vitro fertilized egg without using somatic cell nuclear transfer technology. Specifically, a genome editing tool targeting the Klotho gene is introduced into an in vitro fertilized pig egg by electroporation or the like to create a Klotho gene modified embryo, which is then transplanted into a surrogate mother pig, making it possible to actually obtain a pig litter.

[0029] In this embodiment, the sequences of SEQ ID NOs: 1 to 5 were selected as target sequences for the Klotho gene in gRNA used for genome editing of fertilized eggs. By introducing gRNA with these sequences and the Cas9 protein, it is possible to obtain Klotho gene-modified blastula embryos with excellent genome editing efficiency. By transferring these blastula embryos to surrogate pigs, it is possible to obtain genetically modified pigs with uni- or bi-allele deficiency without miscarriage.

[0030] The biallelic deficient pig according to this embodiment exhibits pathological traits associated with aging, such as calcification in arteries, slowed weight gain, bone loss, difficulty standing, and joint swelling, at a young age. Therefore, as an aging model pig exhibiting arteriosclerosis and pathological fractures, it can be used as a model animal for the development of drugs for treating lifestyle-related diseases, devices for treating large blood vessel calcification, and aging inhibitors. In other words, the genetically modified pig with biallelic deficiency can be used as an aging model pig as it is. Furthermore, since the lethal phenotype described above is not observed in the case of a single allele deficiency, by crossing parents from a lineage in which one allele of the Klotho gene is deleted, it is possible to stably produce aging model pigs in the next generation as well.

[0031] In addition, because conventional Klotho-deficient mice are small animals, phenotypes such as bone fractures and joint swelling could not be observed.

[0032] In contrast, the genetically modified pig according to the present embodiment exhibits a phenotype not seen in mice, such as difficulty standing, because pigs are large animals and the weight load is greater than that of mice. This makes it possible to use the pig as a pathological model associated with aging.

[0033] In addition, it has been known to those skilled in the art that normal Klotho protein forms a complex with the FGF receptor (FGFR) FGF23, and cooperates with it to reduce phosphorus reabsorption in the proximal tubules, suppress active vitamin D production, and suppress phosphorus reabsorption from the intestine. Regarding this point, a case report in Non-Patent Document 3 describes that when an abnormal Klotho protein (H193R) is expressed due to a missense mutation (point mutation) in the Klotho gene in humans, it leads to severe hyperphosphatemia and hypercalcemia. This mutation in the Klotho gene caused familial tumoral calcification. This was because phosphorus was accumulated in the blood and CPP increased due to the deficiency of the Klotho gene. Here, conventional Klotho-deficient mice also showed abnormal accumulation of CPPs, leading to a variety of pathological conditions, such as arteriosclerosis, cardiac hypertrophy, sarcopenia, emphysema, bone loss, and dementia, as if they were aging at an accelerated rate, and eventually died.

[0034] In contrast, the genetically modified pig according to the present embodiment can be raised in a state of accelerated premature aging for as long as possible because a column for removing CPPs can be used as described above if the pig is heavy in weight, making it more useful as a human disease model.

[0035] In the above description, an example of obtaining a litter (individual) of genetically modified pigs according to this embodiment has been described. However, the genetically modified pig according to this embodiment may not be an individual itself, but may include any one or any combination of organs, tissues, and cells. Among these, the individual includes chimeric individuals, model organisms, and other individuals required for experiments, reproductive engineering, and medical treatment. The organs and tissues do not necessarily have to be matured to the organ level, and it is sufficient that specific differentiated cells have a specific structure as a cell mass. Furthermore, the cells include dissociated cell masses without a specific structure. By configuring it in this way, it becomes possible to perform evaluation as an aging model without obtaining an individual.

[0036] Furthermore, the genetically modified pig according to this embodiment can also be constructed so that genes other than the Klotho gene are knocked out at the same time. This configuration allows us to evaluate the effects of adding genes that are likely to cause specific diseases due to aging more clearly, or conversely, to observe the antagonism between the Klotho gene and genes related to longevity. In addition, adding various reporter genes allows us to study sites and tissues related to aging, and other genes and pathways related to aging and phosphorus accumulation.

[0037] In the above explanation, an example of producing a knockout pig lacking the function of the Klotho gene has been described as a genetically modified pig according to this embodiment. However, the genetically modified pig according to this embodiment may not have the function of the Klotho gene completely missing or deleted due to a frameshift mutation, etc. Specifically, the genetically modified pig according to this embodiment may have a missense mutation or a mutation with a different ratio of splicing variants inserted, and may not have the function of the Klotho gene completely deleted. Alternatively, the genetically modified pig may have a conditional knockout, in which the function of the Klotho gene is impaired by a specific stimulus or drug. Such a configuration makes it possible to develop new drugs suited to various conditions and situations.

[0038] In addition, the genetically modified pig according to this embodiment can also be used for purposes other than evaluation as an aging model animal. For example, it is considered possible to use organs of the genetically modified pig according to this embodiment for xenotransplantation into animals that require low sensitivity to phosphorus. Alternatively, it is also possible to maintain the genetically modified pig according to this embodiment as a breed (lineage), and use the products for special herbal medicines, medicinal foods, cooking, etc. In this case, genome editing is a safe genetic modification method and can be used because it has little impact on the environment. EXAMPLES

[0039] The method for producing a genetically modified pig according to the embodiment of the present invention and the genetically modified pig produced will be described in more detail below as an example based on an experiment. However, this example is merely an example and is not intended to be limiting.

[0040] [IVM and IVF] (Culture medium) "IVM I medium" and "IVM II medium" were prepared and used as media for porcine oocyte culture (IVM) and in vitro fertilization (IVF), etc. Table 1 below shows the composition of "IVM I medium":

[0041] [Table 1]

[0042] Of these, the eCG and hCG stocks were eCG 1000 units / ml + hCG 1000 units / ml.

[0043] Table 2 below shows the composition of "IVM II medium":

[0044] [Table 2]

[0045] PFF (porcine follicular fluid) is collected from the remaining ovaries each time eggs are collected, centrifuged at 3000 rpm for 1 hour, and the supernatant is frozen at -20°C. Once a certain amount has been collected, it is all thawed, mixed, centrifuged at 3000 rpm for 1 hour, and the supernatant is aliquoted and stored at -20°C.

[0046] In all cases, "(cold)" indicates storage at 4°C, "(frozen)" indicates storage at -20°C, and "(medicine)" indicates storage in a desiccator. These media have a shelf life of about two weeks after preparation and are stored refrigerated.

[0047] The chemicals used to prepare these media are as follows: Medium 199 (Gibco, 11150-059), colihormone A (Nihon Zenyaku Co., Ltd.), serotropin (Asuka Animal Health Co., Ltd.), gentamicin (Gentamicin sulfate salt, Sigma, G3632-1G), L-cysteine ​​(hydrochloride, Sigma, C7477-25G), β-mercaptoethanol (β-ME, Sigma, M3148-25ML), D-sorbitol (Sigma, S7547-250G), and Na-Pruvate (Sigma, P5280-25G).

[0048] (Instruments) 4-well dish (NUNC; NN4 well multi-dish sterile, Thermo Fisher Scientific, 176740), Petri dish (FALCON, 351008), mineral oil (Sigma, M8410), liquid paraffin (for cell culture, Nacalai Tesque, 26137-85). The tubes used were made of polystyrene. Mineral oil and liquid paraffin were not necessary, but were used to prevent contamination, rapid changes in pH, and evaporation of the medium. Mineral oil was tested for lot quality because there were large lot differences. Liquid paraffin is also relatively stable, but lot quality may be tested.

[0049] (Operations on the day of egg collection) (1) IVM I medium was placed in a 4-well dish according to the number of eggs. Specifically, the conditions were 50 eggs / 1 well / 500 μl. The liquid surface was covered with mineral oil. The mineral oil used was manufactured by Sigma. Lot check was performed for the mineral oil. Liquid paraffin manufactured by Nacalai Tesque was also used instead of mineral oil. (2) Two Petri dishes were prepared for washing, and 2 ml of IVM I medium was placed in each dish. Mineral oil was then added so that the liquid level was covered. (3) IVM I medium was warmed in an incubator at 39.0°C and 5% CO2 for more than 2 hours. (4) Once the medium had warmed, the collected eggs were thoroughly washed with IVM I medium for washing and then transferred to a 4-well dish. (5) The cells were cultured for 22 to 24 hours in an incubator at 39.0°C and 5% CO2. Note that a multi-gas incubator at 39.0°C, 5% O2, and 5% CO2 may also be used for this culture.

[0050] (Day 1 operations) (1) IVM II medium was placed in a 4-well dish according to the number of eggs. Specifically, the conditions were 50 eggs / 1 well / 500 μl. The liquid surface was covered with mineral oil or the like. (2) Two Petri dishes were prepared for washing, and 2 ml of IVM II medium was poured into each dish. Mineral oil was also dripped onto each dish until the liquid level was covered. (3) The IVM II medium was warmed in an incubator at 39.0°C and 5% CO2 for 2 hours or more. (4) Once the medium had warmed, the eggs cultured in IVM I medium were transferred to IVM II medium for washing and finally transferred to a 4-well dish. (5) The cells were cultured for 22 to 24 hours in an incubator at 39.0°C and 5% CO2. Note that a multi-gas incubator at 39.0°C, 5% O2, and 5% CO2 may also be used.

[0051] [IVF] (Operation on the second day, 44 hours after the start of culture) The required amount of PFM, PZM-5, and PBM media was equilibrated in an incubator from the day before to 2 hours before use. The following media were used: medium for porcine embryo development (PZM-5, Functional Peptide Institute, IFP0410P), medium for porcine late embryo culture (PBM, Functional Peptide Institute, IFP1030P), and medium for porcine in vitro fertilization (PFM, Functional Peptide Institute, IFP1020P). (1) Two Petri dishes were prepared for washing. 2 ml of PFM was added to each dish, and mineral oil was added so that the liquid level was covered. (2) After 44 hours of maturation culture, the eggs were washed by transferring them to two dishes containing PFM for washing, and then transferred to a 4-well dish containing equilibrated PFM at 50 eggs / well / 250 μl. (3) Frozen boar sperm were thawed, placed in 5 ml of PFM, and centrifuged at 500×g for 5 minutes. The supernatant was discarded, and the sperm was diluted again with an appropriate amount of PFM, and the concentration was measured. (4) 2×10 6 The sperm were diluted with PFM to sperm / ml and added in 250 μl portions to four-well dishes containing eggs. The final sperm concentration was 1 × 10 6 The sperm / ml. (5) The insemination was carried out for 5 to 10 hours under the conditions of 39.0℃, 5% O2, and 5% CO2. (6) Using a thin pipette roughly the same size as the eggs, the cumulus cells and sperm were removed by pipetting in a dish containing PFM for washing. (7) A Petri dish for washing was prepared, a drop was made with 500 μl of PZM-5, and covered with mineral oil. The fertilized eggs from which the cumulus cells had been removed were placed in the drop and washed. (8) Genome editing was performed on fertilized eggs by electroporation, as described below. (9) The fertilized eggs were transferred to a 4-well dish containing equilibrated PZM-5. The conditions were 50 fertilized eggs / well / 500 μl. (10) After culturing for 3 days, the cells were cultured in PBM for 4 days. The preparation of the dish for washing and the culturing method were the same as those using PZM-5 described above.

[0052] [Electroporation] With reference to FIG. 1, details of genome editing by electroporation will be described.

[0053] (Preparation of crRNA and tracrRNA) (Chemicals used) Alt-R® CRISPR-Cas9 tracrRNA #1072534, 100 nmol (Integrated DNA Technologies (IDT)), or #1072533 20 nmol. Alt-R® CRISPR-Cas9 crRNA 2 nmol or 10 nmol (order by specifying the gRNA sequence) (IDT). Duplex Buffer (included with tracrRNA).

[0054] (1) Preparation of Alt-R® CRISPR-Cas9 tracrRNA for genome editing by electroporation: The molecular weight of tracrRNA is 22182, so 20nM is 443.64μg and 100nmol is 2218.2μg. Therefore, for the 100nmol package, 2218.2μl of Duplex Buffer was added to the tracrRNA tube. For the 20nmol package, 443.64μl of Duplex Buffer was added to the tracrRNA tube. This resulted in a final concentration of 1μg / μl. (2) Preparation of Alt-R® CRISPR-Cas9 crRNA for genome editing by electroporation: First, we checked the molecular weight of the crRNA. For example, if the molecular weight is 18655.6, in the 10 nmol package, we added 186.556 μl of Duplex Buffer to the tube of tracrRNA. This resulted in a final concentration of 1 μg / μl.

[0055] (gRNA sequence) In this embodiment, the sequence of the gRNA used is as follows: gRNA#1 "tgcttctttccgcccaactc" (sequence number 1), gRNA#2 "actgatccagtgggagctta" (sequence number 2), gRNA#3 "ctatggtcggtcatcctgcg" (sequence number 3), gRNA#4 "tccatcaataaatacgggtt" (sequence number 4), gRNA#5 "tcaggctgggagattccagt" (sequence number 5).

[0056] (Electroporation) (1) 50 oocytes were divided into groups, and 10 μl of gRNA / Cas9 Mix was used for each group. The gRNA used was Alt-R CRISPR crRNAs and the tracrRNA system (IDT, USA).

[0057] As described above, the genome editing solution containing gRNA / Cas9 Mix was prepared by mixing 1 μl (concentration 100 ng / μl) of crRNA (1 μg / μl), 1 μl (concentration 100 ng / μl) of tracrRNA (1 μg / μl), and 7.66 μl of Duplex Buffer, and then treating the mixture at 95°C for 3 minutes. After cooling to room temperature, 0.34 μl of Cas9 protein (concentration approximately 100 ng / μl) was added to make a total of 10 μl. Here, the Cas9 protein used was Guide-it Recombinant Cas9 (Electroporation-Ready) (Takara Bio, Z2640N (632640), concentration 3 μg / μl).

[0058] (2) The electroporator (CUY21EDIT II, ​​manufactured by BEX) was set to, for example, 25 V, 1 ms, and 5 pulses (PdA: 1000 mA, Pd on: 1.00 ms, Pd off: 99.0 ms, Pd N: 5). Pronuclear stage embryos 10 to 12 hours after the start of IVF were used for electroporation. Embryos were washed using 100 μl drops made with Opti-MEM I (Thermo Fisher Scientific). (3) 10 μl of gRNA / Cas9 Mix was filled between the electrodes of a chamber (BEX, LF501PT1-20), and pronuclear embryos (fertilized eggs) were aligned in a straight line. (4) Electroporation was performed. (5) Embryos were washed with PZM-5 and cultured.

[0059] 〔result〕 (Genome editing efficiency of gRNA in blastocysts) Five types of gRNAs, gRNA#1 to gRNA#5, were designed and subjected to genome editing in fertilized eggs, which were then cultured to the blastocyst stage to confirm the efficiency. The results are shown in Figure 2. Figure 2(a) shows the genome editing efficiency (%) for each gRNA. The horizontal axis shows each gRNA, while the vertical axis shows the efficiency (%). Figure 2(b) shows the allele type in the blastocysts. "Mosaic" indicates the percentage of blastocysts that have a modified Klotho gene but also have a wild-type allele, "Biallelic" indicates the percentage of blastocysts in which both alleles are modified, and "WT" indicates the percentage of blastocysts in which neither allele is modified (wild type). Based on these results, gRNA#1, gRNA#2, gRNA#3, and gRNA#5 were selected as gRNA sequences with excellent genome editing efficiency.

[0060] (Porting results) The genome-edited fertilized eggs created using the above method were transplanted into the fallopian tubes of surrogate pigs. A total of 200 embryos were transplanted per transplant. For example, when transplanting a mixture of three types, 66 embryos genome-edited with gRNA#1, 67 embryos genome-edited with gRNA#2, and 67 embryos genome-edited with gRNA#3 were mixed and transplanted. The transplant results are shown in Table 3 below:

[0061] [Table 3]

[0062] Here, five mice were transplanted with equal numbers of embryos that had been genome-edited with gRNA#1, gRNA#2, and gRNA#3, but all were infertile. On the other hand, when an equal number of embryos edited with gRNA#1 and #2 were mixed and transplanted, both pigs conceived, and none of the 10 pigs born were biallelic (missing both alleles). Furthermore, all of the pigs that lacked one allele of the Klotho gene (heterozygous deficiency, hereafter referred to as "single allele-deficient pigs") were derived from embryos edited with gRNA#2. In addition, both of the two pigs that received embryos that had been genome-edited with gRNA#5 became pregnant, and of the 10 pigs born, 9 had both alleles modified. Of these, 7 had frameshift mutations introduced into both alleles (homozygous deficiency, hereafter referred to as "biallele-deficient pigs").

[0063] As a result, only when an embryo in which genome editing was introduced with the gRNA sequence of gRNA#5 was transplanted into a surrogate mother pig, a pig with a very high probability of having both alleles deleted was born. As mentioned above, the gRNA sequence of gRNA#5 exhibits a mosaic (mosaic) in which various alleles in which the wild type or Klotho gene is modified are mixed in the blastocyst. Therefore, gRNA#5 is considered to be a gRNA sequence that can give birth to a pig with both alleles deleted and avoid miscarriage. On the other hand, with gRNA#2, pigs were born that lacked one allele, and by using these, it was possible to produce pigs that stably lacked both alleles in the next generation. Furthermore, because the number of surrogate pigs (N) is small, it is thought that repeated procedures will result in offspring with genome editing efficiencies close to those achieved in blastocysts as described above.

[0064] (Phenotype of pigs with Klotho gene knockout) Figure 3 shows the phenotype (appearance) of a biallelic deficient pig. Figure 3(a) shows the pig's condition at birth (Day 1), and Figure 3(b) shows the pig's condition 77 days later (Day 77) when it had difficulty standing up. First, at birth, some of the first generation (F0) pigs lacking both alleles were born small, with three out of seven individuals weighing less than 700g at birth. This was smaller than the wild type pigs, which weighed around 1,500g. In addition, some of the pigs lacking both alleles, although not all of them, showed growth (weight gain) retardation during development. After 2 to 3 months, the pigs lacking both alleles gradually became less active and were eventually unable to stand up. They also gradually ate less food and stopped gaining weight.

[0065] 4 shows a graph of the weight gain of the monoallelic pigs and biallelic pigs of this embodiment, and the wild type pigs without the alleles deleted as a comparative example. The horizontal axis shows the number of days from birth (Day 1) to the 13th week, and the vertical axis shows the weight (kg). The weight gain of the biallelic knockout pigs slowed from week 5. All the biallelic knockout pigs were sacrificed by week 14 for further analysis.

[0066] Further photographs of the phenotype (appearance) of biallelic deletion pigs are shown in Figure 5. These pigs develop painful and pronounced joint swelling and become less active, as shown in Figure 5(a)(b). The arrows indicate the location of this joint swelling. In addition, weight loss is stable or decreased due to loss of appetite. As shown in Figure 5(c), biallelic knockout pigs also developed calcification in blood vessels and other areas. In the photograph in Figure 5(c), the arrows indicate the location of ectopic calcification on the 57th day after birth.

[0067] Figure 6 shows CT images of the pigs lacking both alleles. "WT" indicates wild type, and "Klotho knockout" indicates pigs lacking both alleles. As a result, large blood vessels in the heart and elsewhere were calcified compared to the wild type.

[0068] Serum phosphorus concentration is shown in Figure 7. Five pigs with both alleles missing (homozygous deficiency), four pigs with one allele missing (heterozygous deficiency), and two wild-type pigs were compared based on the average values ​​of blood samples taken every two weeks until the pigs reached three months of age. The horizontal axis of Figure 7 indicates each allele type, and the vertical axis indicates serum phosphorus concentration (mg / dl). In pigs lacking both alleles (homozygous deficiency), blood phosphorus concentrations were significantly higher. "*" in the graph indicates P<0.01.

[0069] Figure 8 shows serum CPP concentrations. As in Figure 7, five pigs with both alleles missing (homozygous deficiency), four pigs with one allele missing (heterozygous deficiency), and two wild-type pigs were compared based on average values ​​taken every two weeks until the pigs reached three months of age. The horizontal axis of Figure 8 shows each allele type, and the vertical axis shows blood CPP concentrations (AU). In pigs lacking both alleles (homozygous deficiency), the serum CPP level was significantly increased. "*" indicates P<0.01.

[0070] The state of the kidneys is shown in Figure 9. Compared to the wild type (WT), the kidneys of the biallelic deficient pigs (Klotho KO) were clearly inflamed and in poor condition, as can be seen by the naked eye, as they appear darker than the wild type in the photograph.

[0071] The kidneys of these biallelic deficient pigs were subjected to pathological (histological) analysis, specifically, microscopic observation for tubular necrosis, calcification in the arterial media, calcification in the glomerulus, calcification in the renal tubules, and interstitial fibrosis. Table 4 below shows the results of the histological analysis of the kidneys.

[0072] [Table 4]

[0073] The numbers indicate the scores of each ID under the microscope, ranging from 1 to 10. 1 to 3 indicate few, 4 to 7 indicate moderate, and 8 to 10 indicate many. Among these, IDs 21-21 and 21-22 were stillborn pigs. 21-14, 21-19, 22-006, and 22-009 were pigs with in-frame mutations. 21-20 was a wild-type pig.

[0074] Figure 10 shows the bones of a pig lacking both alleles. The bones had such a low strength that they could be easily cut with scissors, and bone morphological abnormalities were observed. The site of this bone morphological abnormality is indicated by the arrow.

[0075] Each of the phenotypes described above varied in the founder (F0) biallelic deletion pigs. Although these phenotypes began to be observed at around 8 weeks of age, early mice had to be euthanized at around 9 weeks of age, weighing around 18 kg, whereas late mice were euthanized at 14 weeks of age, weighing 30-40 kg.

[0076] It goes without saying that the configurations and operations of the above-described embodiments are merely examples and can be modified as appropriate without departing from the spirit and scope of the present invention. [Industrial Applicability]

[0077] According to the present invention, by using Klotho knockout pigs, an aging model animal close in size to humans can be provided, which is expected to lead to the development of medicines and therapies for treating various symptoms caused by aging, and can be used industrially.

Claims

1. A genetically modified pig (Sus scrofa), The Klotho gene was knocked out by genetic manipulation of fertilized eggs. A genetically modified pig.

2. The knockout of the Klotho gene is a deletion of one or both alleles. The genetically modified pig according to claim 1.

3. The deletion of one or both alleles of the Klotho gene is a frameshift mutation. The genetically modified pig according to claim 2 .

4. Presents with a phenotype of arterial calcification and bone loss The genetically modified pig according to claim 1.

5. A method for producing a genetically modified pig (Sus scrofa), comprising: Knock out the Klotho gene by genetic manipulation of fertilized eggs A method for producing a genetically modified pig.

6. The genetic manipulation of the fertilized egg is genome editing. The method for producing a genetically modified pig according to claim 5.

7. The genome editing is The gRNA sequence includes any one or any combination of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 ...4, and SEQ ID NO:

5. A method for producing a genetically modified pig as described in claim 6.

8. A method for producing a genetically modified pig according to any one of claims 5 to 7, comprising crossing parents of a lineage in which one allele of the Klotho gene is deleted, Generating first generation genetically modified pigs exhibiting arterial calcification and bone loss phenotypes A method for producing a genetically modified pig.

9. A genetically modified pig according to any one of claims 1 to 4, or The genetically modified pig produced by the method for producing a genetically modified pig according to any one of claims 5 to 7 is used as an aging model animal to develop medicines and treatment methods. A drug discovery support method comprising:

Images