Mir-181 inhibitors and uses thereof

Abstract

To provide agents capable of inhibiting miR-181, for use in treatment and / or prevention of mitochondrial disorders including mitochondrial diseases with eye and / or brain involvement and neurodegeneration affecting eye and / or brain associated with mitochondrial dysfunction.SOLUTION: A miR-181 inhibitor for use in the treatment and / or prevention of a mitochondrial disorder is provided.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to agents capable of inhibiting miR-181 for use in the treatment and / or prevention of mitochondrial disorders, including mitochondrial diseases involving the eye and / or brain, and neurodegenerative conditions affecting the eye and / or brain associated with mitochondrial dysfunction. [Background technology]

[0002] background Mitochondria are crucial in various cellular processes and their dysfunction contributes to the pathogenesis of various human disorders, either directly, in the case of mitochondrial diseases (MD), or indirectly, in the case of common neurodegenerative disorders including Parkinson's disease (PD) or Alzheimer's disease (AD), where mitochondrial dysfunction has been described as a central factor in the pathogenesis (Ref: PMID:23567191).

[0003] Primary mitochondrial diseases (PMDs) are a heterogeneous group of disorders caused by mutations in mitochondrial or nuclear-encoded genes involved in oxidative phosphorylation (OXPHOS). Clinical manifestations of PMDs range from single tissue / organ lesions to symptomatic multi-organ conditions with prominent central nervous system (CNS) involvement, which is particularly susceptible to mitochondrial dysfunction. PMDs include Leigh syndrome, Leber's hereditary optic neuropathy (LHON), mitochondrial myopathy, encephalopathy, lactic acidosis and stroke syndrome (MELAS), Kjer's optic neuropathy, neuropathy ataxia and retinitis pigmentosa (NARP), autosomal dominant optic atrophy, Kearns-Sayre syndrome, and myoclonic epilepsy with ragged-red fibers (MERRF) syndrome. Secondary mitochondrial diseases (SMDs) are a group of diseases caused by mutations in nuclear genes that directly affect mitochondrial function, including Friedreich's ataxia, hereditary spastic paraplegia, and Charcot-Marie-Tooth disease.

[0004] Although each individual disorder is rare, collectively, the total prevalence of MD in adults is estimated to be approximately 1 in 4300, making it one of the most prevalent groups of inherited neurological disorders ( Gorman et al., 2015 ).

[0005] Neurodegenerative disorders affecting the central nervous system and / or the eye are often associated with mitochondrial dysfunction; said disorders may be sporadic or familial in nature: for example, sporadic age-related neurodegenerative diseases include Parkinson's disease (PD), Alzheimer's disease (AD), age-related macular degeneration (AMD), diabetic retinopathy, and glaucoma.

[0006] Familial neurodegenerative diseases include familial PD, AD, Huntington's disease, retinitis pigmentosa (RP), and Stargardt's disease.

[0007] Mitochondrial diseases (both PMDs and SMDs) are biochemically and genetically heterogeneous, and their complexity has so far hindered the development of effective treatments. For the majority of patients, treatments are limited to either preventing or treating complications, such as diabetes, cardiac complications, and epilepsy. Available treatments are supportive (not targeting the primary defects) or focused on specific aspects of mitochondrial dysfunction. Thus, no effective treatment is available to date, and treating patients affected by mitochondrial diseases remains a major challenge (Lightowlers et al., 2015; Viscomi et al., 2015). In recent years, specific modulation of either mitochondrial biogenesis / dynamics or mitochondrial clearance / mitochondrial quality control has been tested as a possible therapeutic strategy in both in vitro and in vivo MD models (Cerutti et al., 2014; Civiletto et al., 2018; Civiletto et al., 2015; Johnson et al., 2013; Viscomi et al., 2011). Despite some promising data, the latter approach has led to inconsistent results and has not been effective across various MD models [reviewed in (Lightowlers et al., 2015; Viscomi et al., 2015)]. Thus, there is a demand for more effective modulation of mitochondrial pathways as a therapeutic strategy for MD.

[0008] There are no effective treatments available for neurodegenerative disorders such as PD or AD. AD is the most common cause of dementia, accounting for 60-80% of cases, while the prevalence of PD in industrialized countries is generally estimated at 1% of people over 60 years of age, which represents a significant burden on health systems given that treatment options to date are mostly symptomatic (Barnes and Yaffe, 2011; de Lau and Breteler, 2006).

[0009] MicroRNAs (miRNAs) are master regulators of gene expression and their ability to simultaneously modulate multiple molecular pathways involved in pathogenesis and disease progression make them promising therapeutic tools. miRNA modulation has been applied to treat a variety of disorders, reaching preclinical and clinical stages in certain cases (Broderick and Zamore, 2011; Christopher et al., 2016; Janssen et al., 2013; Ling et al., 2013). miRNAs play a key role in neuronal survival, and accumulating evidence indicates that alterations in miRNA-regulated gene networks increase the risk of neurodegenerative disorders (Hebert and De Strooper, 2009). Members of the miR-181 family are generated by three independent primary transcripts located on three separate chromosomes. Each transcript generates two precursor sequences for a total of six precursor sequences. Each precursor generates two miRNA strands: a total of 10 mature miRNA forms: miR-181a-5p, miR-181a-l-3p, miR-181a-2-3p, miR-181b-5p, miR-181b-l-3p, miR-181b-2-3p; a guide strand or 5p, and a passenger strand or 3p for miR-181c-5p, miR-181c-3p, miR-181d-5p and miR-181d-3p. The 5p mature sequence is the one that shows the highest expression levels in mammalian tissues (Karali et al., 2016) and contains the same 5' "seed" sequence suggesting a significant degree of functional redundancy (Henao-Mejia et al., 2013; Ji et al., 2009). As used herein, the six mature 5p miRNAs are defined as follows: miR-181a-l, miR-181a-2, miR-181b-l, miR-181b-2, miR-181c, and miR-181d.The mature forms of miR-181a-l and miR-181a-2, and miR-181b-l and miR-181b-2 are identical in sequence; the mature form of miR-181c has one nucleotide difference compared to miR-181a, while the mature form of miR-181d has one nucleotide difference compared to miR-181b. miR-181a and miR-181b (miR-181a / b) are highly conserved in vertebrates, are highly expressed in various regions of the brain and retina (Boudreau et al., 2014; Karali et al., 2016), and have recently been reported to target genes involved in mitochondria-dependent cell death (Hutchison et al., 2013; Ouyang et al., 2012; Rodriguez-Blazquez et al., 2015) and autophagy (Cheng et al., 2016; He et al., 2013; Tekirdag et al., 2013). [Prior art documents] [Patent documents]

[0010] [Patent Document 1] WO2010 / 040112 [Patent Document 2] U.S. Patent No. 5,013,830 [Patent Document 3] U.S. Patent No. 5,149,797 [Patent Document 4] U.S. Patent No. 5,220,007 [Patent Document 5] U.S. Patent No. 5,256,775 [Patent Document 6] U.S. Patent No. 5,366,878 [Patent Document 7] U.S. Patent No. 5,403,711 [Patent Document 8] U.S. Patent No. 5,491,133 [Patent Document 9] U.S. Patent No. 5,565,350 [Patent Document 10] U.S. Patent No. 5,623,065 [Patent Document 11] U.S. Patent No. 5,652,355 [Patent Document 12] U.S. Patent No. 5,652,356 [Patent Document 13] U.S. Patent No. 5,700,922 [Patent Document 14] U.S. Patent No. 5,034,506 [Patent Document 15] U.S. Patent No. 3,687,808 [Patent Document 16] U.S. Patent No. 4,469,863 [Patent Document 17] U.S. Patent No. 4,476,301 [Patent Document 18] U.S. Patent No. 5,023,243 [Patent Document 19] U.S. Patent No. 5,177,196 [Patent Document 20] U.S. Patent No. 5,188,897 [Patent Document 21] U.S. Patent No. 5,264,423 [Patent Document 22] U.S. Patent No. 5,276,019 [Patent Document 23] U.S. Patent No. 5,278,302 [Patent Document 24] U.S. Patent No. 5,286,717 [Patent Document 25] U.S. Patent No. 5,321,131 [Patent Document 26] U.S. Patent No. 5,399,676 [Patent Document 27] U.S. Patent No. 5,405,939 [Patent Document 28] U.S. Patent No. 5,453,496 [Patent Document 29] U.S. Patent No. 5,455,233 [Patent Document 30] U.S. Patent No. 5,466,677 [Patent Document 31] U.S. Patent No. 5,476,925 [Patent Document 32] U.S. Patent No. 5,519,126 [Patent Document 33] U.S. Patent No. 5,536,821 [Patent Document 34] U.S. Patent No. 5,541,306 [Patent Document 35] U.S. Patent No. 5,550,111 [Patent Document 36] U.S. Patent No. 5,563,253 [Patent Document 37] U.S. Patent No. 5,571,799 [Patent Document 38] U.S. Patent No. 5,587,361 [Patent Document 39] U.S. Patent No. 5,625,050 [Patent Document 40] U.S. Patent No. 5,166,315 [Patent Document 41] U.S. Patent No. 5,185,444 [Patent Document 42] U.S. Patent No. 5,214,134 [Patent Document 43] U.S. Patent No. 5,216,141 [Patent Document 44] U.S. Patent No. 5,235,033 [Patent Document 45] U.S. Patent No. 5,264,562 [Patent Document 46] U.S. Patent No. 5,264,564 [Patent Document 47] U.S. Patent No. 5,405,938 [Patent Document 48] U.S. Patent No. 5,434,257 [Patent Document 49] U.S. Patent No. 5,470,967 [Patent Document 50] U.S. Patent No. 5,489,677 [Patent Document 51] U.S. Patent No. 5,541,307 [Patent Document 52] U.S. Patent No. 5,561,225 [Patent Document 53] U.S. Patent No. 5,596,086 [Patent Document 54] U.S. Patent No. 5,602,240 [Patent Document 55] U.S. Patent No. 5,610,289 [Patent Document 56] U.S. Patent No. 5,608,046 [Patent Document 57] U.S. Patent No. 5,618,704 [Patent Document 58] U.S. Patent No. 5,623,070 [Patent Document 59] U.S. Patent No. 5,663,312 [Patent Document 60] U.S. Patent No. 5,633,360 [Patent Document 61] U.S. Patent No. 5,677,437 [Patent Document 62] U.S. Patent No. 5,677,439 [Patent Document 63] U.S. Patent No. 5,539,082 [Patent Document 64] U.S. Patent No. 5,714,331 [Patent Document 65] U.S. Patent No. 5,719,262 [Patent Document 66] U.S. Patent No. 4,845,205 [Patent Document 67] U.S. Patent No. 5,130,302 [Patent Document 68] U.S. Patent No. 5,134,066 [Patent Document 69] U.S. Patent No. 5,175,273 [Patent Document 70] U.S. Patent No. 5,367,066 [Patent Document 71] U.S. Patent No. 5,432,272 [Patent Document 72] U.S. Patent No. 5,457,187 [Patent Document 73] U.S. Patent No. 5,459,255 [Patent Document 74] U.S. Patent No. 5,484,908 [Patent Document 75] U.S. Patent No. 5,502,177 [Patent Document 76] U.S. Patent No. 5,525,711 [Patent Document 77] U.S. Patent No. 5,552,540 [Patent Document 78] U.S. Patent No. 5,587,469 [Patent Document 79] U.S. Patent No. 5,596,091 [Patent Document 80] U.S. Patent No. 5,614,617 [Patent Document 81] U.S. Patent No. 5,750,692 [Patent Document 82] U.S. Patent No. 5,681,941 [Patent Document 83] U.S. Patent No. 4,828,979 [Patent Document 84] U.S. Patent No. 4,948,882 [Patent Document 85] U.S. Patent No. 5,218,105 [Patent Document 86] U.S. Patent No. 5,525,465 [Patent Document 87] U.S. Patent No. 5,541,313 [Patent Document 88] U.S. Patent No. 5,545,730 [Patent Document 89] U.S. Patent No. 5,552,538 [Patent Document 90] U.S. Patent No. 5,578,717 [Patent Document 91] U.S. Patent No. 5,580,731 [Patent Document 92] U.S. Patent No. 5,591,584 [Patent Document 93] U.S. Patent No. 5,109,124 [Patent Document 94] U.S. Patent No. 5,118,802 [Patent Document 95] U.S. Patent No. 5,138,045 [Patent Document 96] U.S. Patent No. 5,414,077 [Patent Document 97] U.S. Patent No. 5,486,603 [Patent Document 98] U.S. Patent No. 5,512,439 [Patent Document 99] U.S. Patent No. 5,578,718 [Patent Document 100] U.S. Patent No. 4,587,044 [Patent Document 101] U.S. Patent No. 4,605,735 [Patent Document 102] U.S. Patent No. 4,667,025 [Patent Document 103] U.S. Patent No. 4,762,779 [Patent Document 104] U.S. Patent No. 4,789,737 [Patent Document 105] U.S. Patent No. 4,824,941 [Patent Document 106] U.S. Patent No. 4,835,263 [Patent Document 107] U.S. Patent No. 4,876,335 [Patent Document 108] U.S. Patent No. 4,904,582 [Patent Document 109] U.S. Patent No. 4,958,013 [Patent Document 110] U.S. Patent No. 5,082,830 [Patent Document 111] U.S. Patent No. 5,112,963 [Patent Document 112] U.S. Patent No. 5,214,136 [Patent Document 113] U.S. Patent No. 5,245,022 [Patent Document 114] U.S. Patent No. 5,254,469 [Patent Document 115] U.S. Patent No. 5,258,506 [Patent Document 116] U.S. Patent No. 5,262,536 [Patent Document 117] U.S. Patent No. 5,272,250 [Patent Document 118] U.S. Patent No. 5,292,873 [Patent Document 119] U.S. Patent No. 5,317,098 [Patent Document 120] U.S. Patent No. 5,371,241 [Patent Document 121] U.S. Patent No. 5,391,723 [Patent Document 122] U.S. Patent No. 5,416,203 [Patent Document 123] U.S. Patent No. 5,451,463 [Patent Document 124] U.S. Patent No. 5,510,475 [Patent Document 125] U.S. Patent No. 5,512,667 [Patent Document 126] U.S. Patent No. 5,514,785 [Patent Document 127] U.S. Patent No. 5,565,552 [Patent Document 128] U.S. Patent No. 5,567,810 [Patent Document 129] U.S. Patent No. 5,574,142 [Patent Document 130] U.S. Patent No. 5,585,481 [Patent Document 131] U.S. Patent No. 5,587,371 [Patent Document 132] U.S. Patent No. 5,595,726 [Patent Document 133] U.S. Patent No. 5,597,696 [Patent Document 134] U.S. Patent No. 5,599,923 [Patent Document 135] U.S. Patent No. 5,599,928 [Patent Document 136] U.S. Patent No. 5,688,941 [Patent Document 137] International Patent Application No. PCT / US92 / 09196 [Patent Document 138] U.S. Patent No. 6,287,860 [Patent Document 139] US2010 / 0317718 [Patent Document 140] US2010 / 0249052 [Patent Document 141] US2009 / 0181914 [Patent Document 142] US2010 / 0234451 [Patent Document 143] US2007 / 0191294 [Patent Document 144] US2008 / 0249039 [Patent Document 145] WO2010 / 129746 [Patent Document 146] W02010 / 040112 [Patent Document 147] U.S. Patent No. 6,268,490 [Patent Document 148] U.S. Patent No. 6,734,291 [Patent Document 149] U.S. Patent No. 6,770,748 [Patent Document 150] U.S. Patent No. 6,794,499 [Patent Document 151] U.S. Patent No. 7,034,133 [Patent Document 152] U.S. Patent No. 7,053,207 [Patent Document 153] U.S. Patent No. 7,060,809 [Patent Document 154] U.S. Patent No. 7,084,125 [Patent Document 155] U.S. Patent No. 7,572,582 [Patent Document 156] Pre-grant U.S. Publication No. 2010 / 0267018 [Patent Document 157] Pre-grant U.S. Publication No. 2010 / 0261175 [Patent Document 158] Pre-grant U.S. Publication No. 2010 / 0035968 [Patent Document 159] USSN 61 / 412,862 [Patent Document 160] U.S. Patent No. 6,693,187 [Patent Document 161] U.S. Patent No. 7,067,641 [Patent Document 162] U.S. Patent No. 6,838,283 [Patent Document 163] WO97 / 045069 [Patent Document 164] U.S. Patent Application No. 2012 / 0021044 [Patent Document 165] U.S. Patent Application No. 2012 / 0015865 [Patent Document 166] U.S. Patent Application No. 2011 / 0305769 [Patent Document 167] U.S. Patent Application No. 2011 / 0262527 [Patent Document 168] U.S. Patent Application No. 2011 / 0229581 [Patent Document 169] U.S. Patent Application No. 2010 / 0305198 [Patent Document 170] U.S. Patent Application No. 2010 / 0203112 [Patent Document 171] US Patent Application No. 2010 / 0104629

Patent document 172

Patent document 173

Patent document 174

Patent document 175

Non-licensed literature

[0011] [Non-licensed document 1] Kornberg, A., DNA Replication, WH Freeman & Co. San Francisco, 1980, pp. 75~77 [Non-licensed document 2] Sanghvi, YS, in Crooke, ST and Lebleu, B. Editors, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276~278 [Non-licensed document 3] The Concise Encyclopedia of Polymer Science And Engineering", pages 858~859, edited by Kroschwitz, JI, John Wiley & Sons, 1990

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Non-Patent Document 22

Non-Patent Document 23

Non - Patent Document 24

Non - Patent Document 25

Non - Patent Document 26

Non - Patent Document 27

Non - Patent Document 28

Non - Patent Document 29

Non - Patent Document 30

Non-Patent Document 31

Non-Patent Document 32

Non-Patent Document 33

Non-Patent Document 34

Non-Patent Document 35

Non-Patent Document 36

Non-Patent Document 37

Non-Patent Document 38

Non-Patent Document 39

Non-Patent Document 40

Non-Patent Document 41

Non-Patent Document 42

Non-Patent Document 43

Non-Patent Document 44

Non-Patent Document 45

Non-Patent Document 46

Non-Patent Document 47

Non-Patent Document 48

Non-Patent Document 49

Non-Patent Document 50

[0012] The present invention relates to miR-181 inhibitors for treating and / or preventing mitochondrial disorders, including mitochondrial diseases involving the eye and / or brain, and neurodegeneration associated with mitochondrial dysfunction affecting the eye and / or brain.The inventors have surprisingly found that miR-181, particularly miR-181 a and b, are involved in the global regulation of mitochondrial function by controlling genes related to mitochondrial biogenesis, functionality, and antioxidant response in the CNS;Furthermore, the inventors have found that miR-181a / b molecules modulate the expression of mitochondria-dependent programmed cell death and autophagy / mitophagy-related genes, and simultaneously and precisely modulate the mitochondrial pathway in the CNS.

[0013] The inventors have surprisingly demonstrated that inhibition of miR-181 exerts a neuroprotective effect in MD and neurodegeneration associated with mitochondrial dysfunction, with particular relevance for genetically heterogeneous conditions such as MD, PD and RP, where gene-independent therapeutic strategies are highly desirable. The inventors have found that miR-181a / b modulate mitochondrial turnover with excellent coordination of biogenesis and clearance. The inventors have demonstrated that inhibition of miR-181 specifically inhibits mitochondrial-mediated cell death and PMDs including Leigh syndrome, Leber's hereditary optic neuropathy (LHON), mitochondrial myopathy, encephalopathy, lactic acidosis and stroke syndrome (MELAS), myoclonic epilepsy with ragged-red fibers (MERRF), progressive external ophthalmoplegia (PEO), Pearson syndrome, maternally inherited myopathy and cardiomyopathy (MIMyCA), Kedzier optic neuropathy, neuropathy ataxia and retinitis pigmentosa (NARP), autosomal dominant optic atrophy, Kearns-Sayre syndrome, myoclonic epilepsy with ragged-red fibers (MERRF) syndrome; It has further been found that the compound exerts beneficial effects with respect to several pathologies characterized by mitochondrial dysfunction by protecting against neurodegenerative disorders affecting the central nervous system and / or eyes associated with mitochondrial dysfunction, including neurodegeneration in diseases such as SMD, including Friedreich's ataxia, hereditary spastic paraplegia, and Charcot-Marie-Tooth disease; sporadic age-related neurodegenerative diseases, e.g., Parkinson's disease (PD), Alzheimer's disease (AD), age-related macular degeneration (AMD), diabetic retinopathy, and glaucoma; and familial neurodegenerative diseases, including familial PD, AD, Huntington's disease, retinitis pigmentosa (RP), and Stargardt disease.

[0014] The present invention then provides inhibitors of miR-181 for use in the treatment and / or prevention of mitochondrial disorders.

[0015] In the present invention, mitochondrial disorder and mitochondrial disease are used interchangeably. According to this aspect of the invention, the treatment and / or prevention of a mitochondrial disorder may be effective in alleviating at least one symptom of said disorder.

[0016] It is believed that when the underlying cause of the disorder is treated, symptom management can be achieved as well. By symptom management, it is intended that the severity of the symptoms may be maintained (i.e., the worsening or progression of the symptoms is controlled) or, more preferably, the severity of the symptoms may be reduced in whole or in part.

[0017] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") or "prevention" (and grammatical variations thereof, such as "prevent" or "preventing") refers to a clinical intervention that attempts to alter the natural course of the individual being treated and can be performed during the prevention or course of a clinical pathology or disorder. Desirable effects of treatment include, but are not limited to, preventing the onset or recurrence of a disease or disorder, alleviating symptoms, eliminating any direct or indirect pathological consequences of a disease or disorder, preventing relapse, slowing the rate of progression of a disease / disorder, improving or palliating the condition of a disease / disorder, and remission or improving prognosis. In some embodiments, the inhibitors of the present invention are used to delay the onset of a disease or disorder or to slow the progression of a disease or disorder.

[0018] Preferably, the inhibitor is an inhibitory nucleic acid agent, a small molecule, or a genome editing agent. An editing agent is an agent capable of mediating targeted gene destruction or repair, and the agent is an engineered nuclease, such as a zinc finger nuclease, a transcription activator-like effector nuclease, or a clustered regularly interspaced short palindromic repeats system.

[0019] Preferably, the inhibitory nucleic acid agent is selected from the group consisting of siRNA, antisense oligonucleotides (eg, antagomirs, LNA), miRNA sponges, and / or ribozymes as defined herein.

[0020] More preferably, the inhibitor of miR-181 comprises at least one sequence complementary to miR-181. Preferably, the inhibitor of miR-181 comprises at least one sequence complementary to ACAUUCA (SEQ ID NO: 5) or comprises ACAUUCA (SEQ ID NO: 5). Preferably, said inhibitor reduces the function and / or activity of miR-181.

[0021] The function and activity of miR-181 can be measured by any method known in the art, particularly as described herein.

[0022] More preferably, said inhibitor has at least one property selected from the group consisting of: inhibiting miRNA activity, preferably inhibiting mRNA target binding, increasing the mRNA level of at least one specific miR-181 target, improving mitochondrial function, increasing the number of mitochondria, reducing oxidative stress and / or cell death, improving cell survival. The above properties can be measured by any method known in the art, in particular as described herein.

[0023] Preferably, the miR-181 is a miR-181 precursor or a mature miR-181, and preferably, the miR-181 is selected from the group consisting of miR-181a-l, miR-181a-2, miR-181b-l, miR-181b-2, miR-181c, and miR-181d, or a combination thereof.

[0024] Preferably, the miR-inhibitor comprises the sequence ACAUUCA (SEQ ID NO:5) or comprises the sequence ACAUUCA (SEQ ID NO:5) and has at least 80% sequence identity with SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4. Preferably, the miR-inhibitor has at least 85%, 90%, 95%, 99% identity with SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4.

[0025] More preferably, the inhibitor is 18 to 21 nucleotides in length.

[0026] In a preferred embodiment, the inhibitor of miR- has the formula: (X1sX2sX3)n 1 S2(X1sX2sX3)n2 (In the formula, X1, X2, and X3 are independently - an MPS SEQ complementary to miR-181a and / or miR-181c, preferably modified at nucleotides 9 to 12 to create a bulge; - MPS SEQ ID NO: 1, preferably complementary to miR-181b and / or miR-181d, with modification of nucleotides 9 to 12 to create a bulge. Selected from; X3 may or may not be present; s is a spacer sequence of 4 to 6 nucleotides, preferably 4 nucleotides; S2 is preferably a central spacer sequence of 4 to 6 nucleotides, preferably 6 nucleotides, corresponding to a restriction enzyme site, preferably a site for the Xbal restriction enzyme; n1 and n2 are numbers independently selected from 3, 6 and 24, preferably 3, 6 and 12, and most preferably, n is 3, and n1 and n2 may be the same or different. It is a miRNA sponge having the following structure:

[0027] In a preferred embodiment, said miRNA sponge has the formula: (AsB)n1 S2(AsB)n 2 (In the formula, A is an MPS SEQ complementary to miR-181a and / or miR-181c, modified at nucleotides 9 to 12 to create a bulge; B is an MPS SEQ complementary to miR-181b and / or miR-181d, modified at nucleotides 9 to 12 to create a bulge; S is a spacer sequence of 4 to 6 nucleotides, preferably 4 nucleotides; S2 is preferably a central spacer sequence of 4 to 6 nucleotides, preferably 6 nucleotides, corresponding to a site for a restriction enzyme, preferably the Xbal restriction enzyme n 1 and n 2 is a number independently selected from 3, 6 and 24, preferably 3, 6 and 12, and most preferably, n is 3, and n1 and n2 may be the same or different. has.

[0028] Preferably, X1, X2, X3, A are 3'TTGTAAGTnln2n3n2ACAGCCACTCA5' (SEQ ID NO: 113); According to the IUPAC nomenclature, n1=A or C or G n2=A or C or T n3=A or G or T or X1, X2, X3, B are 3'TTGTAAGTn'ln'ln'2n'3ACAGCCACCCA5' (SEQ ID NO: 114); According to the IUPAC nomenclature, n'1=C or G or T n'2=A or G or T n'3 = A or C or T; or n 1 =3 and n 2 =3; or S consists of 4 nucleotides, preferably S=tagc; Or S2 consists of 6 nucleotides, preferably S2=Tctaga.

[0029] Preferably, the sequence of the inhibitor further comprises one or more locked nucleic acid (LNA) nucleotides and one or more non-locked nucleotides, wherein at least one of the non-locked nucleotides comprises a chemical modification, preferably the locked nucleic acid (LNA) nucleotide has a 2-4' methylene bridge, and preferably the chemical modification is a 2' O-alkyl or 2' halo modification.

[0030] More preferably, said inhibitor of miR-181 is used in combination with at least one additional agent.

[0031] More preferably, said at least one additional agent is an inhibitor of miR-181 according to the invention, as defined above.

[0032] This use then refers to the combination of one or more inhibitors of miR-181, i.e. one or more siRNAs, antisense oligonucleotides (e.g., antagomir, LNA), miRNA sponges, and / or ribozymes, which may be the same or different.

[0033] In a preferred embodiment, the at least one additional agent is an agent that increases mitochondrial biogenesis (i.e., increases oxidative phosphorylation and / or increases the activity of respiratory chain complexes, such as NAD+ precursors (e.g., nicotinamide riboside, among others), AMPK agonists (e.g., AICAR), Poly The agent is selected from the group consisting of agents that improve mitochondrial function selected from ADP-ribose polymerase (PARP) inhibitors (e.g., Olaparib (AZD-2281), among others), resveratrol, metformin, agents that activate pathways that control mitochondrial biogenesis resulting in improvement in the activity deficiency of retinoic acid), agents that modulate autophagy, e.g., activators of autophagy, e.g., mTOR inhibitors (e.g., rapamycin), agents that inhibit apoptosis, ROS scavengers, e.g., antioxidant compounds including lipoic acid, vitamins C and E, and CoQ, agents that shift heteroplasmy, scavengers of toxic compounds, N-acetylcysteine ​​(NAC), metronidazole, nucleotide supplementation, permeability transition pore inhibitors, e.g., cyclosporine A or derivatives thereof, agents that replace missing factors, e.g., enzyme replacement therapy to replace enzymes that are deficient or absent in the body, or gene therapy, e.g., therapeutic delivery of nucleic acids into the patient's cells as an agent to treat a disease. Preferred additional drugs of the present invention are drugs for treating diseases of the present invention, for example drugs for treating LHON disease: idebenone, a synthetic analogue of ubiquinone, which acts by improving mitochondrial oxidative metabolism in the brain and reducing oxidative stress (Lyseng-Williamson, 2016; Sanchez et al., 2016). Hydroxocobalamin, a synthetic injectable form of vitamin B12, recombinant AAV vector serotype 2 containing human wild-type mitochondrial ND4 gene, recombinant AAV vector containing human wild-type mitochondrial ND1 gene, elamipretide, a mitochondrial permeability transition pore opening blocker.

[0034] Preferably, said inhibitor of miR-181 and the at least one additional agent are administered sequentially or simultaneously.

[0035] The present invention also provides a pharmaceutical composition comprising an inhibitor of miR-181 as defined in any one of the previous embodiments, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier or diluent for use in the treatment and / or prevention of mitochondrial disorders.

[0036] Preferably, the composition further comprises at least one additional agent, preferably said at least one additional agent is an inhibitor of miR-181 as defined above, preferably said at least one additional agent is selected from the group consisting of agents that increase mitochondrial biogenesis, agents that modulate autophagy, agents that inhibit apoptosis, ROS scavengers, agents that shift heteroplasmy, scavengers of toxic compounds, nucleotide supplementation, agents that replace missing factors.

[0037] The present invention further provides a method for treating a mitochondrial disorder in a subject in need thereof, comprising administering to the subject at least one inhibitor of miR-181 as defined above or a pharmaceutical composition as defined above.

[0038] The present invention also provides a vector comprising at least one inhibitor of miR-181 as defined above and a promoter sequence, preferably the vector is a viral vector, preferably an adeno-associated viral vector, for use in the treatment and / or prevention of a mitochondrial disorder. Preferably, the mitochondrial disease is a primary or secondary mitochondrial disease.

[0039] Preferably, the mitochondrial disease is selected from the group consisting of mitochondrial diseases involving the eye and / or brain, neurodegenerative diseases affecting the eye and / or brain associated with mitochondrial dysfunction.

[0040] More preferably, the mitochondrial disease is Leigh syndrome, Leber's hereditary optic neuropathy (LHON), mitochondrial myopathy, encephalopathy, lactic acidosis and stroke syndrome (MELAS), myoclonic epilepsy with ragged red fibers (MERRF), progressive external ophthalmoplegia (PEO), Pearson's syndrome, maternally inherited myopathy and cardiomyopathy (MIMyCA), Kedziehl's optic neuropathy, neuropathy ataxia and retinitis pigmentosa (NARP), autosomal dominant optic atrophy. atrophy, Kearns-Sayre syndrome, myoclonic epilepsy with ragged-red fibers (MERRF) syndrome, Friedreich's ataxia, hereditary spastic paraplegia, Charcot-Marie-Tooth disease, sporadic age-related neurodegenerative diseases, Parkinson's disease (PD), Alzheimer's disease (AD), age-related macular degeneration (AMD), diabetic retinopathy, glaucoma, familial neurodegenerative diseases, familial PD, AD, Huntington's disease, retinitis pigmentosa (RP), and Stargardt's disease.

[0041] The invention will now be described, by way of non-limiting examples, with reference to the following figures. [Brief description of the drawings]

[0042] [Figure 1-1] miR-181a / b modulate mitochondrial biogenesis and mitophagy. A) qRT-PCR confirms that miR-181a / b silencing results in upregulation of the predicted targets of miR-181a / b in SH-SY5Y cells. N=3 independent experiments. B) Transfection of miR-181 mimics specifically inhibits luciferase activity of constructs containing the WT3'-UTR predicted target sequence. A point mutation (mut) in the miR-181a / b binding site abolishes luciferase repression. Data are normalized to negative mimic transfection (dashed line). N=6 independent experiments. [Figure 1-2]C) qRT-PCR reveals upregulation of miR-181a / b targets in the eyes of miR-181a / b-1- / - animals versus miR-181a / b-1+ / + animals. n>5 animals / genotype. D) miR-181a / b-1- / - mice show increased mtDNA content versus miR-181a / b-1+ / + mice. N=4 animals / genotype. [Figure 1-3] E) WB analysis (left panel) reveals increased levels of mitochondrial proteins (quantified in the right panel) in the eyes of miR-181a / b-1- / - (- / -) mice versus miR-181a / b-1+ / + (+ / +) mice. Data are normalized to either p115 or Gapdh. N=3 animals / genotype. Note that all comparison bands for + / + and - / - samples are from the same blot seeded and shown for clarity of data presentation. F) WB analysis (left panel) on mitochondrial and cytoplasmic fractions shows increased levels of p62 and parkin (quantified in the right panel) in the mitochondrial fraction of eyes of - / - mice versus + / + mice. Data are normalized to Ndufb8 or Gapdhd for mitochondrial and cytoplasmic fractions, respectively. N=3 animals / genotype. * p<0.05, ** p<0.01, *** p<0.001, one-tailed (A-C and E) and two-tailed (D) Student's t test. [Figure 2-1]Inhibition of miR-181a / b counteracts cell death in the Microphthalmia with Linear Skin defects (MLS) medakafish model. A) TUNEL assays in retinal and brain sections of st30 medaka control and MO-injected embryos reveal that the number of apoptotic cells was reduced in both hccs-MO / miR-181a / b-MO and cox7b-MO / miR-181a / b-MO injected embryos compared with hccs-MO and cox7b-MO injected embryos, respectively. Scale bar is 20 μm. B) Number of TUNEL positive cells / eye. n≧5 retinas per each model. [Figure 2-2] C) Caspase assay shows restored levels of caspase-3 and caspase-9 in hccs-MO / miR-181a / b-MO and cox7b-MO / miR-181a / b-MO injected embryos compared to hccs-MO and cox7b-MO injected embryos, respectively. n>5 embryos per model. *p<0.05, **p<0.01, ***p<0.001. Analysis of Deviance for Negative Binomial Generalized Linear Model (B) and One way ANOVA with post-hoc Tukey analysis (C), error bars are SEM. [Diagram 3]Downregulation of miR-181a / b ameliorates the phenotype of the MLS medaka model. (A-I) Representative images of st30 medaka embryos injected with hccs-MO (B) and cox7b-MO (H) alone or co-injected with miR-181a / b-MO (C, I). Co-injection with miR-181a / b-MO rescues microphthalmia and microcephaly in both hccs-MO and cox7b-MO embryos. (D-F, J-L) hccs-MO / miR-181a / b-MO-injected embryos and cox7b-MO / miR-181a / b-MO-injected embryos were treated with Baf-A1, PD98059, or HA14-1. Baf-A1 treatment counteracts the protective effect of miR-181a / b downregulation in both hccs-MO / miR-181a / b-MO and cox7b-MO / miR-181a / b-MO injected embryos (D, J). PD98059 treatment does not interfere with the modulation of MLS phenotype mediated by miR-181a / b downregulation (E, K). HA14-1 treatment counteracts the effect of miR-181a / b downregulation in hccs-MO / miR-181a / b-MO model but not in cox7b-MO / miR-181a / b-MO embryos (F, L). Scale bar is 100 μm. (M-N) Percentage of hccs-MO (M) and cox7b-MO (N) embryos with or without the MLS phenotype under the different conditions described in (A-L). n ≥ 300 embryos / condition, ** p < 0.01, *** p < 0.001, generalized linear model deviance analysis, error bars are SEM. [Figure 4-1]Inactivation of miR-181a / b-1 protects RGCs from cell death in a rotenone-induced mouse model of LHON syndrome. A) Immunofluorescence analysis with anti-NeuN antibody in retinas of miR-181a / b-1+ / + and miR-181a / b-1- / - mice injected intravitreally with rotenone or DMSO. RGCs are preserved in miR-181a / b-1- / - rotenone-injected mice compared to controls both 1 and 2 weeks after injection. Scale bar 50 μm. B) Number of RGCs / mm 1 and 2 weeks after injection (shown in %). N=10. C) Graphical representation of the results of the optokinetic tracking assay reported as fold change in cycles / degree. Visual acuity is preserved in miR-181a / b-1- / - rotenone-injected mice compared to controls both 1 and 2 weeks after injection. N=10. ***, p<0.001, one-way ANOVA with post-hoc Tukey analysis (B, C), error bars are SEM. [Figure 4-2] D) NADH dehydrogenase histochemistry in retinal sections from miR-181a / b-1+ / + and miR-181a / b-1- / - mice injected intravitreally with rotenone or DMSO. One week after injection, NADH dehydrogenase activity is lost in RGCs (GCL, area within dashed line) from miR-181a / b-1+ / + rotenone-injected eyes, but is preserved in miR-181a / b-1- / - rotenone-injected eyes. GCL is the ganglion cell layer, INL is the inner nuclear layer, and ONL is the outer nuclear layer. Scale bar is 50 μm. E) Immunofluorescence analysis with anti-CoxIV antibody in the retinas of miR-181a / b-1+ / + and miR-181a / b-1- / - mice injected with either rotenone or DMSO showed preserved mitochondria in miR-181a / b-1- / - rotenone-injected eyes. Scale bar 10 μm. [Diagram 5]Depletion of miR-181a / b protects RGCs and improves visual function in Ndufs4- / - mice. A-D) Immunofluorescence analysis with anti-NeuN antibody in retinas of WT, Ndufs4- / -, Ndufs4- / - / miR-181a / b-1- / - and miR-181a / b-1- / - mice. RGCs are preserved in Ndufs4- / - / miR-181a / b-1- / - mice versus Ndufs4- / - mice. Scale bar is 50 μm. E) Number (%) of RGCs / mm. N=5. F) Graphical representation of the results of the optokinetic tracking assay reported as fold change in cycles / degree. Visual acuity is preserved in Ndufs4- / - / miR-181a / b-1- / - mice versus Ndufs4- / - mice. N>8. G,H) Electroretinogram analysis reveals improved b-wave in Ndufs4- / - / miR-181a / b-1- / - mice versus Ndufs4- / - mice. N>5. p-values ​​were calculated by one-way ANOVA with post-hoc Tukey analysis in E,F and by two-way ANOVA repeated measures with post-hoc analysis in G. p-values ​​in G refer to the 20log cd.s / m2 and light-adapted points. p-values ​​for other points are reported in Appendix Table S1 and error bars are SEM. [Figure 6]Depletion of miR-181a / b increases transcription levels of Nrf1 and Park2 and enhances mitophagy in Ndufs4- / - retinas. A) q-RT-PCR reveals upregulation of miR-181a / b targets Nrf1 and Park2 in eyes of Ndufs4- / - / miR-181a / b-1- / - animals versus Ndufs4- / - animals. N=4 animals / genotype. B) Cell death analysis shows that downregulation of NRF1 abolishes miR-181a / b-mediated protection of SH-SY5Y cells treated with FCCP. N=4. C) WB analysis on mitochondrial fractions shows enhanced increased levels of p62 and parkin (quantified in D) in mitochondrial fractions of eyes from Ndufs4- / - / miR-181a / b-1- / - mice versus Ndufs4- / - mice. Data are normalized to Cs. N=3 animals / genotype, p values ​​calculated by one-way ANOVA with post-hoc analysis in B and one-tailed Student's t-test in D. Error bars are SEM. [Figure 7] Depletion of miR-181a / b enhances mitochondrial biogenesis in Ndufs4- / - mice. A-C) Electron microscopy analysis shows improved mitochondrial morphology and increased mitochondrial number in Ndufs4- / - / miR-181a / b-1- / - mice versus Ndufs4- / - mice. Scale bar is 1 μm. Quantitative increase in mitochondria is reported in C, as well as number of mitochondria / RGC in p30 and p55. N>2 animals / genotype. D) Ndufs4- / - / miR-181a / b-1- / - mice show increased mtDNA content versus Ndufs4- / - mice as measured by q-PCR. N>4 animals / genotype. E) Biochemical activities of MRC complexes I, II, and IV were normalized by percentage of citrate synthase (CS) activity in Ndufs4- / - / miR-181a / b-1- / - mice relative to Ndufs4- / - mice. N>3 animals / genotype. p values ​​were calculated by two-tailed Student's t test, error bars are SEM. [Figure 8] Inhibition of miR-181a / b protects DA neurons from 6-OHDA-induced cell death in medaka. A) RNA ISH in medaka brain shows strong expression of miR-181a and miR-181b in DA neurons localized to the locus coeruleus (arrow). Scale bar is 100 μm. (B-D) Anti-TH immunohistochemical staining of st38 control (DMSO-treated) brain (B), 6-OHDA-treated control brain (C) and 6-OHDA-treated miR-181a / b-MO-injected medaka brain (D) to visualize DA neurons. 6-OHDA treatment led to a reduction of TH-positive cells (arrow) in control but not miR-181a / b-injected fish. Scale bar is 100 μm. (B'-D') Stronger enlargements of B-D. Scale bar is 40 μm. E) Number of TH positive cells / locus coeruleus (expressed as %), N=6, **p<0.01, one-way ANOVA with post-hoc Tukey analysis, error bars are SEM. [Figure 9]Inactivation of miR-181a / b-1 ameliorates the phenotype of a 6-OHDA-induced PD mouse model. (A-C) Anti-TH immunohistochemical staining in the brains of miR-181a / b-1+ / + and miR-181a / b-1- / - mice unilaterally injected with 6-OHDA into the substantia nigra (SN). (A, B) Injection of 6-OHDA results in a reduction of TH-positive cells in the SN of miR-181a / b-1+ / + mice relative to the control saline-injected side (A), whereas in miR-181a / b-1- / - animals, DA neurons (arrows) are protected from 6-OHDA-induced death (B). (C, D) Striatal sections from miR-181a / b-1+ / + mice show reduced TH staining in the 6-OHDA-injected side versus the control saline-injected side (C), whereas there is no difference between the 6-OHDA-injected and control sides of miR-181a / b-1- / - mice (D). Scale bars are 1 mm. E) Number of TH-positive cells / section in the SN is reported as fold change, with the control hemisphere representing 1 for each mouse genotype. N=6. F) L-DOPA-induced rotation test measures behavior and motor deficits in miR-181a / b-1+ / +6-OHDA-injected mice. miR-181a / b-1- / -6-OHDA-injected mice are less sensitive to the rotation-inducing effect of L-DOPA. Net contralateral rotations (contralateral-ipsilateral rotations) were analyzed at each time interval (T1=0-600 s, T2=600-1200 s, T3=1200-1800 s, T4=1800-2400 s). N=8. *p<0.05, ***p<0.001. In E, one-way ANOVA with post hoc Tukey analysis; in F, two-way ANOVA with genotype effect with repeated measures; error bars are SEM. [Figure 10]The miR-181a / b-1 cluster accounts for the majority of miR-181a and miR-181b expression in mouse brain and eye. A, B) RNA in situ hybridization with miR-181a and miR-181b probes in sections of retina (A) and substantia nigra (SN) (B) from miR-181a / b-1+ / + and miR-181a / b-1- / - mice. Scale bars are 50 μm in (A) and 1 mm in (B). C, D) Expression analysis of miR-181a and miR-181b in miR-181a / b-1+ / + and miR-181a / b-1- / - eyes and brain by Taqman assay. Targeted deletion of miR-181a / b cluster-1 results in a significant reduction in the expression levels of mature miR-181a and miR-181b in both tissues. n=3, ***p<0.005, one-tailed Student's t test, error bars are SEM. E) NISSL staining of brain sections from miR-181a / b-1+ / + and miR-181a / b-1- / - mice shows no obvious morphological differences in miR-181a / b-1- / - mice compared to controls. Scale bar is 1 mm. ONL is the external nuclear layer, INL is the internal nuclear layer, and GCL is the ganglion cell layer. [Figure 11]Deletion of miR-181a / b-1 results in increased autophagic flux. A) qRT-PCR analysis reveals increased levels of miR-181a / b targets Bcl2, Mcl1, Xiap, Atg5, Erk2 and Park2 in eyes of miR-181a / b-1- / - animals versus miR-181a / b-1+ / + animals. n>5 animals / genotype. B) WB analysis of Lc3-I / Lc3-II and p62 in protein extracts of eyes of animals under fed and fasted conditions (left panel) reveals decreased levels of both proteins (quantified in right panel) in miR-181a / b-1- / -(- / -) mice versus miR-181a / b-1+ / +(+ / +) mice. n=2 mice for each genotype and condition. Error bars are SEM. C) qRT-PCR analysis reveals no change in Sqstm1 (p62) and Map1lc3b (LC3) transcript levels in miR-181a / b-1- / - and miR-181a / b-1+ / + mouse eyes under both fed and fasted conditions. These data indicate that the decreased levels of autophagy markers Lc3-II and p62 observed by WB analysis are due to increased autophagic flux in miR-181a / b-1- / - eyes. n=3 for each genotype and condition. **p<0.01, ***p<0.001, one-tailed Student's t-test. [Figure 12] Silencing miR-181a / b protects SH-SY5Y cells from FCCP-induced cell death. Cell death analysis shows that miR-181a / b silencing (100 nM) protects SH-SY5Y cells from FCCP treatment. n = 3 independent experiments. ** p < 0.01, two-tailed Student's t test. Error bars are SEM. [Figure 13]Knockdown of miR-181a / b in medaka results in upregulation of genes involved in mitochondrial function and mitophagy. qRT-PCR performed on total RNA extracted from whole miR-181a / b-MO medaka embryos to analyze the transcript levels of miR-181a / b targets involved in mitochondrial-dependent cell death (bcl2, mcl1), mitophagy (atg5, erk2), and mitochondrial biogenesis and function (cox11, coq10b, prdx3), as well as the transcript level of the indirect target ppargc1a. n=3, **p<0.05, ***p<0.005, one-tailed Student's t test, error bars are SEM. [Figure 14] MO-mediated silencing of miR-181a / b and absence of abnormal phenotypes following drug administration. (A, B) Medaka embryos injected with only miR-181a / b-MO (B) show no difference in phenotype compared to control embryos (A). (C, E) Bafilomycin A (Baf-Al) (C), PD98059 (D) and HA14-1 (E) do not induce morphological changes in control embryos at the concentrations used in this study. Scale bar is 100 μm. (F) The concentrations of bafilomycin A used in this study block autophagy as demonstrated by WB analysis of Ic3-I / II. [Figure 15]Deletion of miR-181a / b-1 does not cause significant alterations in retinal morphology and function in mice. (A-J) Immunofluorescence staining of different retinal markers [(A,B) rhodopsin (Rhod) for rods, (C,D) cone arrestin (C-Arr) for cones, (E,F) Pax6 for RGCs and axonal cells, (G,H) GS6 for Müller cells, (I,J) Synthaxin (Synt) for synaptic structures in the inner plexiform layer] reveals no abnormalities in the cell layer structure in the retinas of miR-181a / b-1- / - mice compared to control mice. Scale bar is 50 μm. K, L) Electroretinogram analysis reveals no difference in the a-wave (K) and b-wave (L) patterns in miR-181a / b-1+ / + and miR-181a / b-1- / - mice, indicating that ablation of miR-181a / b does not cause retinal dysfunction. n=10 in each genotype. M) Graphical representation of the number of RGCs / mm (shown in %) shows no significant difference in miR-181a / b-1+ / + and miR-181a / b-1- / - mice. n=10 in each genotype. ONL is the outer nuclear layer, OPL is the outer plexiform layer, INL is the inner nuclear layer, IPL is the inner plexiform layer, and GCL is the ganglion cell layer. [Figure 16] Inhibition of miR-181a / b reduces lipofuscin (A2E) accumulation in an in vitro model of AMD. A) Confocal images of ARPE-19 cells transfected with control LNA and LNA-miR-181a / b and then treated with A2E. Autofluorescence analysis shows the amount of A2E accumulation and that inhibition of miR-181a / b reduces A2E accumulation compared to control cells. B) Graphical representation of quantification of A2E autofluorescence intensity, A2E SPOT intensity and A2E SPOT area per cell in LNA-miR-181a / b transfected cells compared to control cells reported as fold change. Student's t-test, p-values ​​are *** <0.001 and ** <0.005. [Figure 17]Depletion of miR-181a / b reduces lipofuscin (A2E) accumulation in Abca4- / - mice. A) qRT-PCR analysis of miR-181a / b targets sod1 and cat1 transcripts in Abca4- / - / miR-181a / b-1- / - RPE. B) Representative images of lipofuscin accumulation in RPE and POS in Abca4- / - and Abca4- / - / miR-181a / b-1- / - retinal sections. C) Quantification of lipofuscin autofluorescence in RPE and POS. Error bars are SEM. *, p<0.05, **, p<0.01, ***, P<0.001. [Figure 18] Reduction of miR-181a / b improves visual function in a mouse model of retinitis pigmentosa. ERG responses from P347S and P347S / miR-181a / b+ / - mice at p30 highlight improvement in miR-181a / b heterozygous depleted animals. N=16, *p<0.01, ***p<0.001. [Constant luminance (cd·s / m2), light adaptation=2.4log cd·s / m2] [Figure 19] Reduction of miR-181a / b improves photoreceptor marker expression in a mouse model of retinitis pigmentosa. A) Immunofluorescence images of P347S and P347S / miR-181a / b+ / - retinas at p30 stained with two different retinal markers, rhodopsin and cone arrestin (green), and DAPI (blue). B) ONL thickness analysis of P347S and P347S / miR-181a / b+ / - at p30. C) qRT-PCR analysis reveals increased levels of main PR markers (rhodopsin, S-opsin, M-opsin, Pde6b, and cone arrestin) in P347S / miR-181a / b+ / - mouse retinas versus P347S mouse retinas at p30. N=3, error bars are SEM. [Figure 20]Reduction of miR-181a / b improves photoreceptor outer segment length. P347S / miR-181a / b+ / - photoreceptors showed increased outer segment (OS) length relative to P347S animals. *p<0.05, Student's t-test. Error bars are SEM. [Figure 21] Reduction of miR-181a / b improves visual function in a mouse model of retinitis pigmentosa at late time points. ERG responses from P347S and P347S / miR-181a / b+ / - mice at p90 highlight improvement in miR-181a / b heterozygous depleted animals. N=24, ***p<0.001. [Figure 22] Reduction of miR-181a / b improves photoreceptor marker expression and survival in a mouse model of retinitis pigmentosa. A) Immunofluorescence images of P347S and P347S / miR-181a / b+ / - retinas at p90 stained with two different retinal markers, rhodopsin and cone arrestin (green), and DAPI (blue). B) ONL thickness analysis of P347S and P347S / miR-181a / b+- at p90 highlighting the significant increase in ONL thickness. C) qRT-PCR analysis reveals increased levels of main PR markers (rhodopsin, S-opsin, M-opsin, Pde6b, and cone arrestin) in P347S / miR-181a / b+ / - mouse retinas compared to P347S mouse retinas at p30. N=3, error bars are SEM. [Figure 23] A) Downregulation of transcriptome analysis of P347S eyes versus WT eyes. B) qRT-PCR analysis of several miR-181a / b targets (Hprt, Cox11, Erk2, Bcl2, Nrf1, Coq10b, Atg5, Xiap, Pgc1a, Park2, Prdx3) in P347S / 181a / b+ / - eyes compared to P347S at p30. *p<0.05, **p<0.01, one-tailed Student's t-test. Error bars are SEM. [Figure 24]Reduction of miR-181a / b reduces activated caspase-3 in P347S retinas. A) Immunofluorescence images of frozen retinal sections of P347S and P347S / miR-181a / b+ / - at p30 stained with anti-active caspase-3 antibody (green) and DAPI (blue). The assay reveals a lower number of apoptotic cells in P347S / miR-181a / b+ / - retinas versus P347S retinas. B) Counting of anti-active caspase-3 positive cells was performed manually. N=5, *p<0.05, Student's t test. Error bars are SEM. [Diagram 25] Reduction of miR-181a / b reduces TUNEL staining in P347S retinas. A) TUNEL-POD staining of P347S and P347S / miR-181a / b+ / - frozen retinas at p30. Brown spots indicate DNA double-strand or single-strand breaks. The assay reveals a reduced number of apoptotic cells in P347S / miR-181a / b+ / - mice versus P347S / miR-181a / b+ / + mice. B) Counting of TUNEL-POD positive cells was performed manually. N=3, *p<0.05, Student's t-test. Error bars are SEM. [Figure 26] Reduction of miR-181a / b improves mitochondrial morphology in P347S photoreceptors. A) Electron microscopy (EM) images of retinas from WT, P347S, and P347S / miR-181a / b+ / - animals at p30, n=2 animals / genotype. EM images of PR mitochondria from WT, P347S, and P347S / miR-181a / b+ / - at p30 showed improved mitochondrial phenotype in miR-181a / b downregulated animals. B) Quantification of mitochondrial major diameter length. N=2, **p<0.01, Student's t test. Error bars are SEM. [Figure 27-1]Reduction of miR-181a / b improves mitochondrial marker expression in P347S eyes. A) Protein levels of Mfn2 detected by WB analysis in protein extracts from eyes of wild-type, P347S and P347S / miR-181a / b+ / - animals at p30. Data are normalized to p115 for quantification in D). n=2 animals / genotype. Error bars are SEM. B) Protein levels of CI subunits NDUFB8, CII SDHB, CIII UQCRC2, CIV MTC01, CV ATP5A detected by WB analysis in protein extracts from eyes of wild-type, P347S and P347S / miR-181a / b+ / - animals at p30. Data are normalized to p115 for quantification in D). n=2 animals / genotype. Error bars are SEM. C) Protein levels of citrate synthase detected by WB analysis in protein extracts from eyes of wild-type, P347S and P347S / miR-181a / b+ / - animals at p30, quantification of which protein levels is also shown in D), data normalized to p115. n=4 animals / genotype. [Figure 27-2] D) Graphical representation of protein quantification of WB shown in A, B, and C. Data are normalized to p115. * p<0.05, ** p<0.01, *** p<0.001, two-tailed Student's t-test. Error bars are SEM. [Figure 28]In vitro validation of sponge efficiency of miR-181a / b. A) AAV2.1-CMV-eGFP-miR-181 sponge map. B) qRT-PCR analysis of miR-181a / b direct target transcripts (XIAP, NRF1, PRDX3, MCL1, ATG5, SIRT1, BCL2, ERK2, PARK2, COX11) in SH-SY5Y mice 48 hours after transfection with AAV2.1-CMV-eGFP-miR-181a / b sponge (sponge 181). Transcript levels of miR-181a / b targets are increased in sponge 181 samples versus control samples (CTRL=AAV2.1-CMV-eGFP transfected cells). N=3. The data indicate that the miR-181 sponge sequestered endogenous miR-181a / b, thus preventing them from binding to their direct targets and inhibiting their activity.

[0043] A brief description of the sequence in the sequence listing Comparison of sequences of miR-181 family members

[0044] [ka]

[0045] miR-181a (SEQ ID NO: 1) AACAUUCAACGCUGUCGGUGAGU miR-181b (SEQ ID NO: 2) AACAUUCAUUGCUGUCGGUGGGU miR-181c (SEQ ID NO: 3) AACAUUCAAC-CUGUCGGUGAGU miR-181d (SEQ ID NO: 4) AACAUUCAUUGUUGUCGGUGGGU miR-181 seed sequence (SEQ ID NO:5) ACAUUCA LNA A (SEQ ID NO: 6) CGACAGCGTTGAATGT LNA B (SEQ ID NO: 7) CGACAGCAATGAATGT miR-181 sponge sequence: (SEQ ID NO:8)

[0046] [ka]

[0047] Legend for miR-181 sponge: miR-181 sponge "MBS SEQ A" in bold font; miR-181 sponge "MBS SEQ B" in underlined font; spacer "1": tagc in italics; spacer "2" or spacer in the middle: Tctaga (restriction enzyme)

[0048] miR-181 sponge sequence: SEQ ID NO:9

[0049] [ka]

[0050] miR-181 sponge sequence: SEQ ID NO: 10

[0051] [ka]

[0052] miR-181 sponge sequence: SEQ ID NO: 11

[0053] [ka]

[0054] miR-181 sponge sequence: SEQ ID NO: 12

[0055] [ka]

[0056] miR-181 sponge sequence: SEQ ID NO: 13

[0057] [ka]

[0058] AAV2.1 CMV-eGFP-miR-181 sponge sequence (SEQ ID NO: 14) > [AAV2.1_CMV_eGFP_miR-181 sponge] - 5838 bp

[0059] Definition The terms "polynucleotide," "oligonucleotide," "nucleic acid," and "nucleic acid molecule" are used herein to include polymeric forms of nucleotides of any length, i.e., either ribonucleotides or deoxyribonucleotides. The term refers only to the primary structure of the molecule. Thus, the term includes triple-, double-, and single-stranded DNA, as well as triple-, double-, and single-stranded RNA. The term also includes modifications by methylation and / or by capping, as well as unmodified forms of polynucleotides. More specifically, the terms "polynucleotide", "oligonucleotide", "nucleic acid" and "nucleic acid molecule" include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide that is a purine or pyrimidine based N- or C-glycoside, and other polymers that contain non-nucleotide backbones, such as polyamide (e.g., peptide nucleic acid (PNA)) and polymorpholino (commercially available as Neugene from Anti-Virals, Inc., Corvallis, Oreg.) polymers, as well as other synthetic sequence-specific nucleic acid polymers, provided that the polymer contains nucleic acid bases in a configuration that allows for base pairing and base stacking as found in DNA and RNA. No distinction in length between the terms "polynucleotide", "oligonucleotide", "nucleic acid" and "nucleic acid molecule" is intended, and these terms are used interchangeably.Thus, these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3'P5' phosphoramidites, 2'-O-alkyl-substituted RNA, double- and single-stranded DNA, and double- and single-stranded RNA, microRNA, DNA:RNA hybrids, and hybrids between PNA and DNA or RNA, and also include known types of modifications, such as labels, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with analogs, as known in the art. (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine (8-oooadenosine), 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), internucleotide modifications, e.g., those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidites, carbamates, etc.), those with negatively charged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidites, carbamates, etc.), For example, phosphorothioates, phosphorodithioates, etc.), and those with positively charged linkages (e.g., aminoalkyl phosphoramidites, aminoalkyl phosphotriesters), those containing pendant moieties, such as proteins (nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those containing intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), and unmodified forms of polynucleotides or oligonucleotides. The term also includes locked nucleic acids (e.g., including ribonucleotides with a methylene bridge between the 2'-oxygen atom and the 4'-carbon atom). See, for example, (Elayadi and Corey, 2001; Koshkin et al., 1998; Kurreck et al., 2002; Obika et al., 1998; Orum and Wengel, 2001).

[0060] The terms "label" and "detectable label" refer to detectable molecules including, but not limited to, radioisotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, colorants, dyes, metal ions, metal sols, ligands (e.g., biotin or haptens), and the like. The term "fluorophore" refers to a substance or portion thereof capable of exhibiting fluorescence in the detectable range. Specific examples of labels that may be used in the present invention include, but are not limited to, phycoerythrin, Alexa dyes, fluorescein, YPet, CyPet, Cascade blue, allophycocyanin, Cy3, Cy5, Cy7, rhodamine, dansyl, umbelliferone, Texas red, luminol, acridinium esters (acradium ester), biotin, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), blue fluorescent protein (BFP), red fluorescent protein (RFP), Dronpa, mCherry, mOrange, mPlum, Venus firefly luciferase, Renilla luciferase, NADPH, beta-galactosidase, horseradish peroxidase, glucose oxidase, alkaline phosphatase, chloramphenicol acetyltransferase, urease, MRI contrast agents (e.g., gadodiamide, gadobenic acid, gadopentetic acid, gadoteridol, gadofosveset, gadoversetamide, and gadoxetic acid), and computed tomography (CT) contrast agents (e.g., diatrizoic acid, metrizoic acid, lodamide, rotalamic acid, roxitalamic acid, ioglicic acid, acetolizoic acid, rocarminic acid, methiodal, geodon, metrizamide, iohexol, loxaglic acid, lopamidol, lopromide, lotoran, lobelsol, lopentol, rodixanol, lomeprol, lobitridol, roxilan, lodoxamic acid, rotroxic acid, roglicamic acid, adipiodone, lobenzamic acid, ropanoic acid, roscetamic acid, ipodate sodium, tyropanoic acid, ipodate calcium).

[0061] "Recombinant," as used herein to describe a nucleic acid molecule, means a polynucleotide of genomic, RNA, miRNA, cDNA, viral, semisynthetic, or synthetic origin, because by virtue of its recombinant origin or manipulation it is unrelated to all or a portion of the polynucleotide with which it is naturally associated.

[0062] The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. Generally, a gene of interest is cloned and then expressed in transformed organisms, as explained further below.

[0063] MicroRNA As used herein, the terms "microRNA," "miRNA," "mature microRNA," and "mature miRNA" refer to non-coding single-stranded RNA molecules that are about 19 to about 25 nucleotides in length (including about 19, about 20, about 21, about 22, about 23, about 24, and about 25 nucleotides) that effectively reduce expression levels of target polynucleotides and polypeptides via the RNA interference pathway (i.e., through association with RISC and subsequent degradation or inhibition of translation of the target mRNA). The term "microRNA" refers to both endogenous miRNAs that have been found in any organism (e.g., plants, animals) and artificial miRNAs that include single-stranded RNA molecules having sequences of about 19 to 25 nucleotides in length other than those found in endogenous miRNAs that effectively reduce expression of target polynucleotides via RNA interference.

[0064] MicroRNAs are grouped into families based on their targeting properties, which primarily depend on the identity of the extended seed region of the microRNA (nucleotides 2-8 of the miRNA); members of the same seed family are usually evolutionarily related, and evolutionarily related miRNAs are usually members of the same seed family. However, the use of the term "family" does not strictly indicate a common ancestry, as described in (Bartel, 2018).

[0065] The miRNA of the present invention belongs to the miRNA 181 family of miRNAs.

[0066] As defined herein, miRNA 181 is a group of miRNAs that share the same seed sequence, i.e., ACAUUCA (SEQ ID NO: 5). Preferably, said group of miRNAs is defined herein as a family of miRNAs.

[0067] Members of the miR-181 family are generated by three independent primary transcripts located on three separate chromosomes. Each transcript generates two precursor sequences for a total of six precursor sequences. Each precursor generates two miRNA strands: a total of 10 mature miRNA forms: miR-181a-5p, miR-181a-l-3p, miR-181a-2-3p, miR-181b-5p, miR-181b-l-3p, miR-181b-2-3p, and a guide strand or 5p and a passenger strand or 3p for miR-181c-5p, miR-181c-3p, miR-181d-5p, and miR-181d-3p. The 5p mature sequences are those that show the highest expression levels in mammalian tissues (Karali et al., 2016) and contain the same 5' "seed" sequence suggesting a significant degree of functional redundancy (Henao-Mejia et al., 2013; Ji et al., 2009). As used herein, the six mature 5p miRNAs will be defined as follows: miR-181a-1, miR-181a-2, miR-181b-l, miR-181b-2, miR-181c, and miR-181d. The mature forms of miR-181a-l and miR-181a-2, and miR-181b-l and miR-181b-2 are identical in sequence; the mature form of miR-181c has one nucleotide difference compared to miR-181a, while the mature form of miR-181d has one nucleotide difference compared to miR-181b.

[0068] A "target site" is a nucleic acid sequence recognized by a microRNA. A single target site typically has about 6 to about 10 nucleotides. Typically, a target site is located within the 3'UTR of an mRNA, although a target site may also be located in the 5'UTR or coding region of an mRNA.

[0069] An "inhibitor target site" is a sequence within the mature sequence of miRNA 181 that is complementary to said inhibitor nucleic acid. The miRNA 181 sequence may be a precursor sequence or a mature sequence. Preferably, the miRNA 181 sequence is the mature sequence.

[0070] inhibitory nucleic acid Inhibitory nucleic acids include inhibitory RNA and inhibitory DNA, and may be, for example, ribonucleotides or deoxyribonucleotides. By the term "inhibitory nucleic acid" is meant a nucleic acid molecule that contains a sequence that is complementary to and binds to a target nucleic acid (e.g., a target microRNA, e.g., any of the microRNAs defined by SEQ ID NO: 1, 2, 3, or 4), and mediates a decrease in the level or activity of the target nucleic acid molecule (e.g., activity in mRNA target binding) by steric hindrance of the target or by its degradation. Non-limiting examples of inhibitory nucleic acids include interfering RNA, shRNA, siRNA, ribozyme, antagomir, LIMA, miR sponge, and antisense oligonucleotide. Methods for making inhibitory RNA are described herein. Further methods for making inhibitory nucleic acids are known in the art.

[0071] As used herein, "interfering RNA" refers to any double- or single-stranded RNA capable of inhibiting or downregulating the expression of a gene - either directly or indirectly (i.e., upon translation) - by mediating RNA interference. Interfering RNA includes, but is not limited to, small interfering RNA ("siRNA") and small heparin RNA ("shRNA"). "RNA interference" refers to the selective degradation of sequence-compatible messenger RNA transcripts.

[0072] As used herein, "shRNA" (short hairpin RNA) refers to an RNA molecule that includes an antisense region, a loop portion, and a sense region, where the sense region has complementary nucleotides that base pair with the antisense region to form a double-stranded stem. After post-transcriptional processing, the short hairpin RNA is converted into a short interfering RNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family.

[0073] "Small interfering RNA" or "siRNA," as used herein, refers to any small RNA molecule capable of inhibiting or downregulating gene expression by mediating RNA interference in a sequence-specific manner. Small RNAs can be, for example, about 18-21 nucleotides in length.

[0074] As used herein, "antagomir" refers to a small synthetic RNA with complementarity to a specific microRNA target, optionally with one or more base modifications that prevent mismatching or cleavage at the cleavage site.

[0075] As used herein, the phrase "post-transcriptional processing" refers to mRNA processing that occurs after transcription and is mediated, for example, by the enzymes Dicer and / or Drosha. Inhibitory agents useful in the treatment methods described herein include inhibitory nucleic acid molecules that reduce the expression or activity of any of the microRNAs (e.g., mature or precursor microRNAs) of SEQ ID NO: 1, 2, 3, or 4, or combinations thereof.

[0076] Inhibitory nucleic acids useful in the methods and compositions of the present invention include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds, such as siRNA compounds, modified bases / locked nucleic acids (LNA), antagomir, peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that hybridize and modulate at least a portion of a target nucleic acid molecule. In some embodiments, inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides that contain modified bonds, interference RNA (RAi), single-stranded interference RA (siRA); micro, buffered RA (miRA); small RNA (stRA); or single-stranded heparin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNA (saRNA), or combinations thereof. For example, see WO2010 / 040112.

[0077] In some embodiments, the inhibitory nucleic acid is 10-50, 13-50, or 13-30 nucleotides in length. One of skill in the art will recognize that this embodies an oligonucleotide having an antisense portion that is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therein. In some embodiments, the oligonucleotide is 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13-30 nucleotides in length. One of skill in the art will recognize that this embodies inhibitory nucleic acids having antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or any range therein.

[0078] In some embodiments, the inhibitory nucleic acid is a chimeric oligonucleotide that contains two or more chemically distinct regions, each of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confer one or more beneficial properties (e.g., increased nuclease resistance, increased cellular uptake, increased binding affinity to the target, etc.) and a region that is a substrate for an enzyme capable of cleaving RNA:DNA or RNA:RNA hybrids. The chimeric inhibitory nucleic acid of the present invention can be formed as a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative U.S. patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is incorporated herein by reference.

[0079] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro modified nucleotide. In other preferred embodiments, the RNA modifications comprise 2'-fluoro, 2'-amino, and 2'-O-methyl modifications at the ribose of pyrimidines, basic residues, or inverted bases at the 3' end of the RNA. Such modifications are commonly incorporated into oligonucleotides, which have been shown to have higher Tm (i.e., higher target binding affinity) for a given target than 2'-deoxyoligonucleotides.

[0080] Some nucleotides and nucleotide modifications have been shown to make the oligonucleotides into which they are incorporated more resistant to nuclease digestion than the native oligonucleotides - the modified oligonucleotides survive intact for longer periods of time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those containing modified backbones, such as phosphorothioates, phosphotriesters, methylphosphonates, short alkyl or cycloalkyl intersugar linkages, or short heteroatom or heterocyclic intersugar linkages. Most preferred are oligonucleotides having phosphorothioate backbones and heteroatom backbones, particularly CH2-NH-O-CH2, CH,~N(CH3)~O~CH2 (also known as methylene(methylimino) or MMI backbone], CH2-ON(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 and ON(CH3)-CH2-CH2 backbones, where the native phosphodiester backbone is represented as OPO-CH); amide backbones (see (De Mesmaeker et al., 1995); morpholino backbone structures (see U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbones (wherein the phosphodiester backbone of the oligonucleotide is replaced by a polyamide backbone and the nucleotides are attached directly or indirectly to the aza nitrogen atoms of the polyamide backbone (see (Nielsen et al., 1991))).Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3' alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3' amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of these, as well as those with inverted polarity, in which adjacent pairs of nucleotide units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; U.S. Patent Nos. 3,633,693, 3,643,653, and 3,643,653. 87,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; No. 5,276,019; No. 5,278,302; No. 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939; No. 5,453,496 See US Pat. Nos. 5,455,233, 5,466,677, 5,476,925, 5,519,126, 5,536,821, 5,541,306, 5,550,111, 5,563,253, 5,571,799, 5,587,361, and 5,625,050, each of which is incorporated by reference. Morpholino-based oligomeric compounds are described in (Braasch and Corey, 2002; Heasman, 2002; Lacerra et al., 2000; Nasevicius and Ekker, 2000) and U.S. Pat. No. 5,034,506. Cyclohexenyl nucleic acid oligonucleotide mimetics have been described in (Wang et al., 2000a).

[0081] Modified oligonucleotide backbones that do not contain a phosphorus atom have a backbone formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include those with morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others with a mixture of N, O, S and CH2 constituent moieties; U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033. No. 5,264,562; No. 5,264,564; No. 5,405,938; No. 5,434,257; No. 5,466,677; No. 5,470,96 No. 7; No. 5,489,677; No. 5,541,307; No. 5,561,225; No. 5,596,086; No. 5,602,240; No. 5,610,28 9; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439 (each of which is incorporated herein by reference).

[0082] The one or more substituted sugar moieties may be contained, for example, at the 2' position in at least one of the following: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2 or O(CH2)nCH3 (where n is 1 to about 10); Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving group; reporter group; intercalator; group for improving the pharmacodynamic properties of oligonucleotides; or group for improving the pharmacodynamic properties of oligonucleotides and other substituents with similar properties. A preferred modification includes 2'-methoxyethoxy [2'-O-(2-methoxyethyl)], also known as 2'-O-CH2CHOCH3] (Martin, 1995). Other preferred modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of pentofuranosyl groups.

[0083] Inhibitory nucleic acids may also, or alternatively, include modifications or substitutions of nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases that are found only at low frequency or transiently in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2'deoxycytosine, and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentobiosyl HMC, as well as synthetic nucleobases such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine or other heterosubstituted alkyl adenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. See Kornberg, A., DNA Replication, WH Freeman & Co., San Francisco, 1980, pp. 75-77; and (Gebeyehu et al., 1987). "Universal" bases known in the art, such as inosine, may also be included. The 5-Me-C substitution has been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, in Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and is currently the preferred base substitution.

[0084] It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the above-mentioned modifications may be incorporated in a single oligonucleotide or even within a single nucleoside within an oligonucleotide.

[0085] In some embodiments, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide unit are replaced with novel groups. The base unit is maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an oligonucleotide is replaced with an amide-containing backbone, e.g., an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly bound to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is incorporated herein by reference. Further teaching of PNA compounds can be found in (Nielsen et al., 1991).

[0086] Inhibitory nucleic acids may contain modifications or substitutions of one or more nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propyluracil and cytosine, 6-azouracil, cytosine and These include thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.

[0087] Further nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in "The Concise Encyclopedia of Polymer Science And Engineering", pages 858-859, edited by Kroschwitz, JI, John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, ST and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine). 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, YS, Crooke, ST, and Lebleu, B., eds., Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are currently the preferred base substitution, even more particularly when combined with a 2'-O methoxyethyl sugar modification.Modified nucleobases are disclosed in U.S. Patent Nos. 3,687,808, as well as U.S. Patent Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,90 Nos. 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is incorporated herein by reference.

[0088] In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, intracellular distribution, or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, cholesterol moieties (Letsinger et al., 1989), cholic acid (Manoharan et al., 1994), thioethers such as hexyl-S-tritylthiol (Manoharan et al., 1992; Manoharan et al., 1993), thiocholesterol (Oberhauser and Wagner, 1992), aliphatic chains such as dodecanediol or undecyl residues (Kabanov et al., 1990; Svinarchuk et al., 1993), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., 1995; Shea et al., 1990), polyamines or polyethylene glycol chains (Mancharan et al., Nucleosides & Nucleotides 14:969-973, 1995), or adamantane acetic acid (Manoharan et al., 1995), a palmityl moiety (Mishra et al., 1995), or an octadecylamine or hexylamino-carbonyl-methoxycholesterol moiety (Crooke et al., 1996).U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; No. 5,109,124; No. 5,118,802; No. 5,138,045; No. 5,414,077; No. 5,486,603; No. 5,512,43 No. 9; No. 5,578,718; No. 5,608,046; No. 4,587,044; No. 4,605,735; No. 4,667,025; No. 4,76 No. 2,779; No. 4,789,737; No. 4,824,941; No. 4,835,263; No. 4,876,335; No. 4,904,582; No. 4,904,582; No. 4,958,013; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,082,830; No. 5,112,96 No. 3; No. 5,214,136; No. 5,245,022; No. 5,254,469; No. 5,258,506; No. 5,262,536; No. 5,27 No. 2,250; No. 5,292,873; No. 5,317,098; No. 5,371,241, No. 5,391,723; No. 5,416,203, No. See also Nos. 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is incorporated herein by reference.

[0089] These moieties or conjugates may include conjugate groups covalently attached to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the present invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacokinetic properties of oligomers, and groups that enhance the pharmacodynamic properties of oligomers. Exemplary conjugate groups include cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. In the context of the present invention, groups that enhance the pharmacokinetic properties include groups that improve uptake, enhance resistance to degradation, and / or enhance sequence-specific hybridization with target nucleic acids. In the context of the present invention, groups that enhance the pharmacodynamic properties include groups that improve uptake, distribution, metabolism, or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT / US92 / 09196, filed October 23, 1992, and U.S. Patent No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholic acid, thioethers, such as hexyl-5-tritylthiol, thiocholesterol, aliphatic chains, such as dodecanediol or undecyl residues, phospholipids, such as di-hexadecyl-rac-glycerol or triethylammonium, 1,2-di-O-hexadecyl-rac-glycero-3-H phosphonate, polyamines or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties.See, e.g., U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; Same No. 5,486,603; Same No. 5,512,439; Same No. 5,578,718; Same No. 5,608,046; Same No. 4,587,044; Same No. 4,605,735; Same No. 4,667,025; Same No. 4,762,77 No. 9; No. 4,789,737; No. 4,824,941; No. 4,835,263; No. 4,876,335; No. 4,904,582; No. 4,958,013; No. 5,082,830; No. 5,112 , No. 5,214,136; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,245,022; No. 5,254,469; No. 5,258,506; No. 5 ,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; See US Pat. Nos. 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is incorporated herein by reference.

[0090] The inhibitory nucleic acid useful in the method of the present invention is sufficiently complementary to the target miRNA, i.e., hybridizes sufficiently appropriately and with sufficient specificity to give the desired effect. "Complementary" refers to the ability to pair through hydrogen bonds between two sequences that contain naturally occurring bases or their analogs or non-naturally occurring bases or their analogs. For example, if a base at a position of the inhibitory nucleic acid is capable of hydrogen bonding with a base at a corresponding position of the miRNA, then the bases are considered to be complementary to each other at that position. In some embodiments, 100% complementarity is not required. In some embodiments, 100% complementarity is required. Routine methods can be used to design inhibitory nucleic acids that bind to target sequences with sufficient specificity.

[0091] While specific sequences of certain exemplary target segments are provided herein, one of skill in the art will recognize that these serve to illustrate and describe certain embodiments within the scope of the present invention. Additional target segments are readily identifiable by one of skill in the art in light of the present disclosure. Target segments of 5, 6, 7, 8, 9, 10 or more nucleotides in length that include a stretch of at least 5 consecutive nucleotides within or immediately adjacent to a seed sequence are considered suitable for targeting as well. In some embodiments, the target segment includes a sequence that includes at least 5 consecutive nucleotides from the 5' end of one of the seed sequences (the remaining nucleotides are a continuous stretch of the same RNA that begins immediately upstream of the 5' end of the seed sequence and continues until the inhibitory nucleic acid contains about 5 to about 30 nucleotides). In some embodiments, the target segment is represented by an RNA sequence that includes at least 5 consecutive nucleotides from the 3' end of one of the seed sequences (the remaining nucleotides are a continuous stretch of the same miRNA that begins immediately downstream of the 3' end of the target segment and continues until the inhibitory nucleic acid contains about 5 to about 30 nucleotides). Those skilled in the art who have the sequences provided herein will be able to identify further preferred regions for targeting without undue experimentation.In some embodiments, the inhibitory nucleic acid contains a sequence that is complementary to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides present in the target (e.g., target miRNA, e.g., mature or precursor miR-181, or target mRNA).

[0092] Once one or more target regions, segments or sites are identified, an inhibitory nucleic acid compound is selected that is sufficiently complementary to the target, i.e., hybridizes sufficiently appropriately and with sufficient specificity (i.e., does not substantially bind to other non-target RNAs) to give the desired effect. In the context of the present invention, hybridization refers to hydrogen bonding, which can be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. "Complementary" as used herein refers to the ability for precise pairing between two nucleotides. For example, if a nucleotide at a particular position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of an miRNA molecule or an mRNA molecule, then the inhibitory nucleic acid and the miRNA or mRNA are considered to be complementary to each other at that position. If a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other, then the inhibitory nucleic acid and the miRNA or mRNA are complementary to each other. Thus, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity or exact pairing such that stable and specific binding occurs between an inhibitory nucleic acid and an miRNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at a corresponding position of an miRNA or mRNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.

[0093] It is understood in the art that a complementary nucleic acid sequence does not need to be 100% complementary to the sequence of its target nucleic acid in order to be specifically hybridizable. A complementary nucleic acid sequence for the method of the present invention is specifically hybridizable if there is sufficient complementarity that the binding of this sequence to the target miRNA or mRNA molecule interferes with the normal function of the target miRNA or mRNA, causing loss of expression or activity, and avoids non-specific binding of this sequence to non-target RNA sequences under conditions where specific binding is desired, such as physiological conditions in the case of in vivo assays or therapeutic treatments, and conditions where the assay is performed under suitable stringency conditions in the case of in vitro assays. For example, stringent salt concentrations will usually be less than about 750 mM NaCI and 75 mM trisodium citrate, preferably less than about 500 mM NaCI and 50 mM trisodium citrate, more preferably less than about 250 mM NaCI and 25 mM trisodium citrate. Low stringency hybridization can be achieved in the absence of organic solvents, such as formamide, while high stringency hybridization can be achieved in the presence of at least about 35% formamide, more preferably at least about 50% formamide. Stringent temperature conditions will usually include a temperature of at least about 30°C, more preferably at least about 37°C, and most preferably at least about 42°C. Various additional parameters, such as hybridization time, detergent concentration, e.g., sodium dodecyl sulfate (SDS), and inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are achieved by combining these various conditions as necessary. In a preferred embodiment, hybridization will occur at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS.In a more preferred embodiment, hybridization will occur at 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 pg / ml denatured salmon sperm DNA (ssDNA) at 37° C. In a most preferred embodiment, hybridization will occur at 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 pg / ml ssDNA at 42° C. Useful variations on these conditions will be readily apparent to those of skill in the art.

[0094] In most applications, the washing steps performed after hybridization will also differ in stringency. Stringency conditions of washing can be defined by salt concentration and temperature. As mentioned above, stringency of washing can be increased by decreasing salt concentration or increasing temperature. For example, stringent salt concentrations of washing steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for washing steps will usually include a temperature of at least about 25°C, more preferably at least about 42°C, even more preferably at least about 68°C. In a preferred embodiment, washing steps will be performed at 25°C with 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, the washing step will be performed at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, the washing step will be performed at 68° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations of these conditions will be readily apparent to those of skill in the art. Hybridization techniques are well known to those of skill in the art and are described, for example, in {Benton, 1977; Grunstein, 1975 and Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

[0095] In general, the inhibitory nucleic acid useful in the methods described herein has at least 80% sequence complementarity to the target region in the target nucleic acid, for example, 90%, 95%, or 100% sequence complementarity to the target region in the miRNA. For example, an antisense compound in which 18 of the 20 nucleobases of an antisense oligonucleotide are complementary and thus specifically hybridizes to the target region will represent 90 percent complementarity. The percent complementarity of an inhibitory nucleic acid with respect to a region of a target nucleic acid can be routinely determined using basic local alignment search tools (BLAST programs) (Altschul, 1990; Zhang, 1997). Antisense and other compounds of the present invention that hybridize to miRNA or mRNA can be identified by routine experimentation. In general, inhibitory nucleic acids must retain specificity for their targets, i.e., they must not directly bind to transcripts other than the intended target (which may be one or more miRNAs belonging to the same family or to different families) or directly and significantly affect the expression levels of transcripts other than the intended target.

[0096] For further disclosure regarding inhibitory nucleic acids, see US2010 / 0317718 (antisense oligos); US2010 / 0249052 (double-stranded ribonucleic acid (dsRNA)); US2009 / 0181914 and US2010 / 0234451 (LNA); US2007 / 0191294 (siRNA analogues); US2008 / 0249039 (modified siRNA); and WO2010 / 129746 and WO2010 / 040112 (inhibitory nucleic acids).

[0097] Antisense Antisense oligonucleotides are typically designed to block the expression of DNA or RNA targets by binding to the target and interrupting expression at the transcription, translation, or splicing level.Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to target microRNA or target inflammatory marker mRNA.Therefore, oligonucleotides are selected that are sufficiently complementary to the target, i.e., hybridize sufficiently appropriately and with sufficient specificity, to give the desired effect.

[0098] Modified Bases / Locked Nucleic Acids (LNA) In some embodiments, the inhibitory nucleic acids used in the methods described herein contain one or more modified linkages or bases, including phosphorothioates, methylphosphonates, peptide nucleic acids, or locked nucleic acid (LNA) molecules.

[0099] LNA is a modified ribonucleotide that contains an extra bridge between the 2' and 4' carbons of the ribose sugar moiety, which results in a "locked" conformation that enhances thermal stability. Thus, LNA comprises a class of bicyclic RNA analogs in which the furanose ring in the sugar-phosphate backbone is chemically locked in the RNA to mimic the N-type (C3'-endo) conformation by introducing a 2'-0, 4'-C methylene bridge. The modification increases the nuclease resistance and binding affinity of antisense oligonucleotides to cognate miRNAs.

[0100] Preferably, the modified nucleotide is a locked nucleic acid molecule comprising [alpha]-L-LNA. LNA comprises a ribonucleic acid analogue in which the ribose ring is "locked" by a methylene bridge between the 2'-oxygen and the 4'-carbon, i.e., an oligonucleotide containing at least one LNA monomer, i.e., one 2'-0,4'-C-methylene-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs, but the locked configuration enhances the rate and stability of the base pairing reaction (Jepsen et al., 2004). LNA also has a higher affinity for base pairing with RNA compared to DNA. Due to these properties, LNA is particularly useful as a probe for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as a knockdown tool for miRNA, and as an antisense oligonucleotide against target mRNA or other RNA, such as the miRNAs and mRNAs described herein.

[0101] LNA molecules can include molecules that contain 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, with one strand substantially identical, e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% identical, e.g., with 3, 2, 1, or 0 mismatched nucleotides, to a target region in a miRNA or mRNA. LNA molecules can be chemically synthesized using methods known in the art.

[0102] LNA molecules can be designed using any method known in the art; several algorithms are known and commercially available (e.g., on the Internet, e.g., at exiqon.com). See, e.g., (Levin et al., 2006; McTigue et al., 2004; You et al., 2006). For example, a "gene walk" method similar to that used to design antisense oligos can be used to optimize the inhibitory activity of LNAs; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of the target miRNA or mRNA can be prepared and subsequently tested for activity.

[0103] Optionally, gaps, e.g., 5-10 or more nucleotides, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. The GC content is preferably between about 30-60%. General guidelines for designing LNAs are known in the art; e.g., LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within the LNA. If possible, runs of three or more consecutive G or C or more than four LNA residues should be avoided (e.g., in very short (e.g., about 9-10 nt) oligonucleotides, this may not be possible). In some embodiments, the LNA is a xylo-LNA.

[0104] In some embodiments, LNA molecules can be designed to target specific regions of miPvNA. For example, specific functional regions, such as regions containing seed sequences, can be targeted. Alternatively or additionally, highly conserved regions can be targeted, such as regions identified by aligning sequences from different species, such as primates (e.g., humans) and rodents (e.g., mice), and looking for regions with a high degree of identity. Percent identity can be routinely determined using the Basic Local Alignment Search Tool (BLAST program) (Altschul et al., 1990; Zhang and Madden, 1997) (Altschul et al., J. Mol. Biol. 215:403-410, 1990; Zhang and Madden, Genome Res. 7:649-656, 1997), for example, using default parameters.

[0105] For additional information regarding LNAs, see U.S. Patent Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and pregrant U.S. Publication Nos. 2010 / 0267018; 2010 / 0261175; and 2010 / 0035968; Koshkin et al., Tetrahedron 54:3607-3630, 1998; Obika et al., Tetrahedron Lett. 39:5401-5404, 1998; See Jepsen et al., Oligonucleotides 14:130-146, 2004; Kauppinen et al., Drug Disc. Today 2(3):287-290, 2005; and Ponting et al., Cell 136(4):629-641, 2009, "Locked nucleic acids" (LNAs), J Am Chem Soc. May 29, 2002;124(21):5974-82. "Locked nucleic acid (LNA) recognition of RNA: NMR solution structures of LNA:RNA hybrids". Petersen Ml, Bondensgaard K, Wengel J, Jacobsen JP; Handb Exp Pharmacol. 2006;(173):405-22. "Locked nucleic acid: high-affinity targeting of complementary RNA for RNomics" Kauppinen S1, Vester B, Wengel J.; RNA Biol. July-August 2009; 6(3):321-3. Epub July 18, 2009.

[0106] "Locked nucleic acids as a novel class of therapeutic agents." Veedu RN1, Wengel J. Chem Biodivers. 2010 Mar;7(3):536-42. doi: 10.1002 / cbdv.200900343. "Locked nucleic acids: promising nucleic acid analogs for therapeutic applications." Veedu RN1, Wengel J. Curr Opin Mol Ther. 2001 Jun;3(3):239-43.; "Locked nucleic acids: a promising molecular family for gene-function analysis and antisense drug development." Orum H1, Wengel J. and references cited therein.

[0107] See also USSN 61 / 412,862, which is incorporated by reference in its entirety.

[0108] Alternatively, antisense oligonucleotides may comprise peptide nucleic acids (PNAs), which contain a peptide-based backbone rather than a sugar-phosphate backbone, e.g., in which the deoxyribose backbone is replaced by a polyamide chain of N-(2 aminoethyl)-glycine units (Fabani, MM; Abreu-Goodger, C.; Williams, D.; Lyons, PA; Torres, AG; Smith, KG; Enright, AJ; Gait, MJ; Vigorito, E. Efficient inhibition of miR-155 function in vivo by peptide nucleic acids. Nucleic Acids Res. 2010,38, 4466-4475). Antisense oligonucleotides may contain, but are not limited to, sugar modifications such as 2'-0-alkyl (e.g., 2'-0-methyl, 2'-0-methoxyethyl), 2'-fluoro, and 4'thio modifications, and backbone modifications such as one or more phosphorothioate, morpholino, or phosphocarboxylate linkages (see, e.g., U.S. Pat. Nos. 6,693,187 and 7,067,641, which are incorporated herein by reference in their entirety). In some embodiments, suitable antisense oligonucleotides are 2'-0-methoxyethyl "gapmers," which contain ribonucleotides at the 5' and 3' ends, along with at least 10 central deoxyribonucleotides, that are 2'-0-methoxyethyl modified. These "gapmers" are capable of inducing RNase H-dependent degradation mechanisms of RNA tags. Other modifications of antisense oligonucleotides that enhance stability and improve efficacy, such as those described in U.S. Pat. No. 6,838,283, incorporated herein by reference in its entirety, are known in the art and are suitable for use in the methods of the present invention.

[0109] Further antisense oligonucleotides of the invention contain small RNA zippers.

[0110] Antisense oligonucleotides useful for inhibiting the activity of microRNAs are about 19 to about 25 nucleotides in length. Antisense oligonucleotides may comprise sequences that are at least partially complementary to the mature and / or precursor miRNA sequences, e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the mature and / or precursor miRNA sequences. In some embodiments, antisense oligonucleotides may be substantially complementary to the mature and / or precursor miRNA sequences, i.e., at least about 95%, 96%, 97%, 98%, or 99% complementary to the target polynucleotide sequence. In some embodiments, antisense oligonucleotides comprise sequences that are 100% complementary to the mature and / or precursor miRNA sequences.

[0111] The antisense nucleotides of the present invention may be target sequences of miR-181, including but not limited to miR-181a (SEQ ID NO: 1), miR-181b (SEQ ID NO: 2), miR-181c (SEQ ID NO: 3), or miR-181d (SEQ ID NO: 4), or combinations thereof.

[0112] Preferred antisense nucleotides of the invention are locked nucleic acids that are at least partially complementary to the mature miR-181a sequence of SEQ ID NO: 1 or 3, e.g., comprise a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to said miRNA sequence and the target miRNA 181a and / or mir-181c.

[0113] Further preferred antisense nucleotides of the invention are locked nucleic acids that comprise a sequence at least partially complementary to the mature miR-181a sequence of SEQ ID NO: 2 or 4, e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to said miRNA sequence and to the target miRNA 181b and / or mir-181 d. Particularly preferred locked nucleic acids comprise SEQ ID NO: 1, 2, 3 or 4, and are modified at one or more nucleotides.

[0114] A preferred embodiment of the present invention comprises a combination of LNAs targeting mir-181a / c and miR-181b / d, and a particularly preferred embodiment comprises the combination of LNA A (sequence number 6) and LNA B (sequence number 7) described herein.

[0115] Antagomir In some embodiments, the antisense is an antagomir (Krutzfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, KG; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005, 438, 685-689). An antagomir is a chemically modified antisense nucleotide that targets a microRNA (e.g., targeting hsa-miR-181). For example, an antagomir for use in the methods described herein may comprise a nucleotide sequence sufficiently complementary to hybridize to a miRNA target sequence of about 12-25 nucleotides, preferably about 15-23 nucleotides. Suitably, the antagomir may be a single-stranded, chemically modified ribonucleotide that is at least partially complementary to the miRNA sequence. The antagomir may comprise one or more modified nucleotides, e.g., 2'-O-methyl sugar modifications.

[0116] Typically, for example, the antagomir contains a cholesterol moiety at the 3' end. In some embodiments, the antagomir has various modifications for pharmacological properties such as protection from RNase and enhanced tissue and cellular uptake. For example, in addition to the modifications discussed above for antisense oligos, the antagomir may have one or more of full or partial 2'-O-methylation of sugars and / or phosphorothioate backbones. The phosphorothioate modification provides protection against RNase activity, and its lipophilicity contributes to enhanced tissue uptake. In some embodiments, the antagomir may contain six phosphorothioate backbone modifications; two phosphorothioates are located at the 5' end and four are located at the 3' end. See, e.g., Krutzfeldt et al., Nature 438:685-689, 2005; Czech, N. Engl. J. Med. 354: 1194-1195, 2006; Robertson et al., Silence 1:10, 2010; Marquez and McCaffrey, Human Gene Ther. 19(l):27-38, 2008; van Rooij et al., Circ. Res. 103(9):919-928, 2008; and Liu et al., Int. J. Mol. Sci. 9:978-999, 2008.

[0117] Antagomires useful in the methods of the present invention may be modified with respect to their length or otherwise with respect to the number of nucleotides that compose the antagomir. In general, antagomires are about 20-21 nucleotides long for optimal function, a size that fits the size of most mature microRNAs. Antagomires must retain specificity for their targets, i.e., they must not directly bind to transcripts other than the intended target or directly significantly affect the expression levels of transcripts other than the intended target.

[0118] Antagomir may be at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the mature and / or precursor miRNA sequence. In some embodiments, the antagomir may be substantially complementary to the mature miRNA sequence, i.e., at least about 95%, 96%, 97%, 98%, or 99% complementary to the target polynucleotide sequence. In other embodiments, the antagomir is 100% complementary to the mature miRNA sequence.

[0119] In some embodiments, the inhibitory nucleic acid is locked and comprises a cholesterol moiety (eg, a locked antagomir).

[0120] siRNA In some embodiments, the nucleic acid sequence complementary to the target miRNA or target mRNA may be an interfering RNA, including but not limited to a small interfering RNA ("siRNA") or a small hairpin RNA ("shRNA"). Methods for constructing an interfering RNA are well known in the art. For example, an interfering RNA may be assembled from two separate oligonucleotides, where one strand is a sense strand and the other is an antisense strand, where the antisense and sense strands are self-complementary (i.e., each strand comprises a nucleotide sequence that is complementary to the nucleotide sequence of the other strand; e.g., where the antisense and sense strands form a duplex or double-stranded structure); the antisense strand comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene), and the sense strand comprises a nucleotide sequence that corresponds to the target nucleic acid sequence or a portion thereof. Alternatively, an interfering RNA may be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker. Interfering RNA can be a polynucleotide having a double strand, asymmetric double strand, hairpin or asymmetric hairpin secondary structure, and having self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence complementary to the nucleotide sequence in a separate target nucleic acid molecule or a part thereof, and the sense region comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a part thereof.Interfering RNA can be a circular single-stranded polynucleotide having a stem comprising two or more loop structures and self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence complementary to the nucleotide sequence in a target nucleic acid molecule or a part thereof, and the sense region comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a part thereof, and where the circular polynucleotide can be processed in vivo or in vitro to produce an active siRNA capable of mediating RNA interference.

[0121] In some embodiments, the region encoding the interfering RNA encodes a self-complementary RNA molecule having a sense region, an antisense region, and a loop region. Such an RNA molecule, when desirably expressed, forms a "hairpin" structure and is referred to herein as an "shRNA." The loop region is generally about 2 to about 10 nucleotides in length. In some embodiments, the loop region is about 6 to about 9 nucleotides in length. In some embodiments, the sense and antisense regions are about 15 to about 20 nucleotides in length. After post-transcriptional processing, the small hairpin RNA is converted into an siRNA by a cleavage event mediated by the enzyme Dicer, a member of the RNase III family. The siRNA is then capable of inhibiting expression of genes with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, 2002; Lee et al., Nature BiotechnoL, 20, 500-505, 2002; Miyagishi and Taira, Nature Biotechnol. 20:497-500, 2002; Paddison et al., Genes & Dev. 16:948-958, 2002; Paul, Nature Biotechnol. 20, 505-508, 2002; Sui, Proc. Natl. Acad. Sci. USA, 99(6):5515-5520, 2002; Yu et al., Proc. Natl. Acad. Sci. USA 99:6047-6052, 2002.

[0122] miRNA sponge miRNA sponges or decoys (Ebert et al., Nat Methods. 2007 Sep;4(9):721-6 Epub 2007 Aug. 12. Generation of miRNA sponge constructs. Kluiver, J., Slezak-Prochazka, I., Smigielska-Czepiel, K., Halsema, N., Kroesen, BJ, and Anke van den Berg. Methods - 2012 Jul. 23. E-pub ahead of print.; F. C. Tay, et al., Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells, Adv. Drug Deliv. Rev. (2014)) are in vivo engineered proteins that contain multiple high-affinity miRNA antisense binding sites (MBS) that mimic those found in mRNA and are complementary to the targeted miRNA. miRNAs are transcripts expressed in vivo, and these transcripts can efficiently sequester specific miRNAs, thereby preventing them from binding to endogenous target genes. These binding sites are usually tandem repeats of the same site designed to target either a single specific miRNA or members of a miRNA family that share the same seed region; the interaction between the microRNA and the target is thought to depend on base pairing in the seed region (positions 2-8 of the microRNA), and the decoy target should interact with all members of the microRNA seed family. In doing so, it is better to inhibit a functional class of microRNAs than to inhibit antisense oligonucleotides that are thought to block a single microRNA sequence.

[0123] The design of miRNA or decoys is disclosed, for example, in "Ebert MS, Neilson JR, Sharp PA (2007) MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods 4: 721-72" and "Kluiver J, Slezak-Prochazka I, Smigielska-Czepiel K, Halsema N, Kroesen BJ, van den Berg A (2012) Generation of miRNA sponge constructs. Methods 58: 113-117."

[0124] Sponge sequences typically consist of multiple miRNA binding sites (MBS) separated by spacer sequences of 4-6 nucleotides in length. The MBS are either fully antisense or contain a bulge in the central position. However, it has been reported that perfectly base-paired miRNA sponge interactions are susceptible to Ago2-mediated cleavage, and thus MBS containing a four nucleotide central bulge are more effective. miRNA sponges offer the advantage of inhibiting all seed family members, and even when multiple MBS are introduced, they can be used for inhibition of the entire miRNA cluster. Given their advantages over other means of miRNA inhibition, miRNA sponges also have potential for use in the treatment of disease (Ebert MS et al., Nat Methods 2007; Ebert MS and Sharp PA, RNA 2010; Liu Z et al., Int J Mol Sci 2008; Kluiver J et al., Methods 2012; Kluiver et al., PLoS One 2012, all of which are incorporated by reference).

[0125] Design of miRNA sponge constructs and off-target testing may be performed using the web-based tool MiRNAsong: microRNA SpONge Generator and Tester.

[0126] Preferably, the sponge is composed of a high affinity miRNA antisense binding site (MBS) comprising a sequence complementary to the target miRNA, and a bulge region, i.e., a mismatch region at nucleotides 9-12 of the MPS sequence. Preferably, the complementary region is at least 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the target miRNA. Most preferably, the complementary region is at least 80% identical to the target miRNA. Preferably, the sequence complementary to the target miRNA sequence comprises a seed sequence, e.g., a sequence within a given miRNA that is essential for recognition of the target transcript, and the "bulge" region is outside of said seed sequence. Each MBS sequence (MBS SEQ.) is the same length as the mature target miRNA. Each MBS SEQ. is repeated several times, i.e., 6-24 times, preferably 6-12 times, most preferably 6 times. Suitably, the MBS SEQ.s are separated from each other by a "spacer" sequence consisting of 4 to 6 nucleotides, preferably 4 nucleotides.

[0127] Suitably, the miRNA sponge of the present invention may comprise two or more MBS sequences targeting two or more miRNAs, preferably two or more miRNAs within the same family or two or more miRNAs from different families.

[0128] Preferably, a miRNA sponge comprising a MPB sequence complementary to a given seed sequence inhibits all miRNAs with said seed sequence. Preferably, a family of miRNAs comprises miRNAs with highly related sequences, and preferably miRNAs from the same family share the same seed sequence.

[0129] The inhibitor of the present invention is composed of two MBS sequences separated by a spacer sequence; preferably, the two MBS sequences can target the same or different miRNAs.

[0130] For example, a miRNA inhibitor may have the following formula: (X1sX2sX3)n 1 S2(X1sX2sX3)n 2 (In the formula, X1, X2, and X3 are independently - an MPS SEQ complementary to miR-181a and / or miR-181c, preferably modified at nucleotides 9 to 12 to create a bulge; - MPS SEQ ID NO: 1, preferably complementary to miR-181b and / or miR-181d, with modification of nucleotides 9 to 12 to create a bulge. Selected from; X3 may or may not be present; s is a spacer sequence of 4 to 6 nucleotides, preferably 4 nucleotides; S2 is preferably a central spacer sequence of 4 to 6 nucleotides, preferably 6 nucleotides, corresponding to a restriction enzyme site, preferably a site for the Xbal restriction enzyme; n1 and n2 are numbers independently selected from 3, 6 and 24, preferably 3, 6 and 12, and most preferably, n is 3, and n1 and n2 may be the same or different. may have the following structure:

[0131] A preferred miRNA inhibitor of the present invention has the following formula: (AsB)n 1 S2(AsB)n 2 (In the formula, A is an MPS SEQ complementary to miR-181a and / or miR-181c, preferably modified at nucleotides 9 to 12 to create a bulge; B is an MPS SEQ complementary to miR-181b and / or miR-181d, preferably modified at nucleotides 9 to 12 to create a bulge; S is a spacer sequence of 4 to 6 nucleotides, preferably 4 nucleotides; S2 is preferably a central spacer sequence of 4 to 6 nucleotides, preferably 6 nucleotides, corresponding to a restriction enzyme site, preferably a site for the Xbal restriction enzyme; wherein n1 and n2 are numbers independently selected from 3, 6, and 24, preferably 3, 6, and 12, and most preferably, n is 3, and n1 and n2 may be the same or different).

[0132] Preferably, X1, X2, X3, and A are 3'TT GT AAGTVHDH AC AG CC ACT C A5'; Here, according to the IUPAC nomenclature, V=A or C or G H=A or C or T D=A or G or T

[0133] More preferably, X1, X2, X3, and B are 3'TTGTAAGTBBDHACAGCCACCCA5'; According to the IUPAC nomenclature, B=C or G or T D=A or G or T H=A or C or T

[0134] More preferably, n 1 =3 and n 2 =3

[0135] Preferably, S consists of 4 nucleotides, preferably S=tagc.

[0136] More preferably, S2 consists of 6 nucleotides, preferably S2=Tctaga

[0137] Suitably, in some embodiments, the inhibitor of miR-181 is a chemically modified antisense oligonucleotide, suitably an LNA, an RNA inhibitor, such as an antagomir, or an miRNA sponge comprising a sequence substantially complementary to the mature sequence of miR-181a and / or miR-181b, or a combination thereof.

[0138] As used herein, "substantially complementary" refers to a sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target polynucleotide sequence (e.g., a mature or precursor miRNA sequence).

[0139] The antisense oligonucleotide may comprise a sequence substantially complementary to a precursor miRNA sequence (pre-miRNA). The antisense oligonucleotide comprises a sequence substantially complementary to a sequence located outside the stem-loop region of the pre-miRNA sequence. The antisense oligonucleotide of the present invention is substantially complementary to a mature miRNA sequence.

[0140] The target RNA cleavage reaction guided by siRNA is highly sequence-specific. In general, siRNAs containing nucleotide sequences identical to a portion of the target nucleic acid (i.e., the target region including the seed sequence of the target miRNA or mRNA) are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus, the present invention has the advantage of being able to tolerate the sequence diversity expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations in the target sequence have also been found to be effective for inhibition. Alternatively, siRNAs with nucleotide analogue substitutions or insertions may be effective for inhibition. In general, siRNAs must retain specificity for their targets, i.e., they must not directly bind to transcripts other than the intended target or directly significantly affect the expression levels of transcripts other than the intended target.

[0141] By "therapeutically effective dose or amount" of a miRNA, miRNA mimic, or miRNA inhibitor is intended an amount that, when administered as described herein, results in a positive therapeutic response, e.g., increased mRNA levels of a specific miR-181 target, improved mitochondrial function and / or increased number of mitochondria, improved cell survival accompanied by reduced oxidative stress and cell death.

[0142] Ribozymes Trans-cleaving enzymatic nucleic acid molecules can also be used; these have shown promise as therapeutic agents for human diseases (Usman and McSwiggen, Ann. Rep. Med. Chem. 30:285-294, 1995; Christoffersen and Marr, J. Med. Chem. 38:2023-2037, 1995). Enzymatic nucleic acid molecules may be designed to cleave specific miRNA or mRNA targets in the background of cellular RNA. Such cleavage events render the miRNA or mRNA non-functional.

[0143] Generally, enzymatic nucleic acids with RNA cleavage activity act by first binding to a target RNA. Such binding occurs through a target binding portion of the enzymatic nucleic acid that is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes the target RNA, then binds to it through complementary base pairing, and once bound to the correct site, acts enzymatically to cleave the target RNA. Such strategic cleavage of the target RNA will destroy its activity. After the enzymatic nucleic acid binds and cleaves its RNA target, it is released from that RNA to search for another target, and can repeatedly bind and cleave new targets.

[0144] Several approaches, e.g. in vitro selection (evolution) strategies (Orgel, Proc. R. Soc. London, B 205:435, 1979), have been used to obtain new nucleic acid catalysts capable of catalyzing various reactions such as cleavage and ligation of phosphodiester and amide bonds (Joyce, Gene, 82, 83-87, 1989; Beaudry et al., Science 257, 635-641, 1992; Joyce, Scientific American 267, 90-97, 1992; Breaker et al., TIBTECH 12:268, 1994; Barrel et al., Science 2611411-1418, 1993; Szostak, TIBS 17, 89-93, 1993; Kumar et al., FASEB J., 9:1183, 1995; Breaker, Curr. Op. Biotech., 1:442, 1996. The development of a ribozyme that is optimal for catalytic activity would be a major contribution to any strategy that uses RNA-cleaving ribozymes to regulate gene expression. Hammerhead ribozymes, for example, can be synthesized by cleaving RNA at saturating (10 mM) concentrations of Mg 2+ Approximately 1 min in the presence of cofactors -1 The artificial "RNA ligase" ribozyme functions with a catalytic rate (kcat) of about 100 min. -1 It has been shown that certain modified hammerhead ribozymes with substrate-binding arms composed of DNA catalyze the corresponding self-modification reactions with rates of 100 min. -1 It is known to catalyze RNA cleavage with multiple turnover rates approaching 100%.

[0145] Production and Use of Inhibitory Nucleic Acids The nucleic acid sequences used to practice the methods described herein, whether as RNA, cDNA, genomic DNA, vector, virus or hybrids thereof, may be isolated from a variety of sources, genetically engineered, amplified and / or recombinantly expressed / produced.

[0146] Recombinant nucleic acid sequences may be individually isolated or cloned and tested for the desired activity. Any recombinant expression system may be used, including, for example, in vitro, bacterial, fungal, mammalian, yeast, insect, or plant cell expression systems. The nucleic acid sequences of the invention (e.g., any of the inhibitory or sense nucleic acids described herein) may be inserted into a vector for delivery and expressed from a transcription unit within the vector. The recombinant vector may be a DNA plasmid or a viral vector. The generation of vector constructs may be accomplished using any suitable genetic engineering technique known in the art, including, but not limited to, standard PCR techniques, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, as described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989), Coffin et al. (Retroviruses. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, ed., Oxford University Press, (2000).

[0147] As will be appreciated by those skilled in the art, a variety of suitable vectors are available for transferring the nucleic acid of the present invention into cells. The selection of a suitable vector for delivering the nucleic acid and the optimization of the conditions for inserting the selected expression vector into cells are within the skill of the art and do not require undue experimentation. The viral vector comprises a nucleotide sequence having a sequence for producing a recombinant virus in a packaging cell. The viral vector expressing the nucleic acid of the present invention may be constructed based on a viral backbone, including, but not limited to, retrovirus, lentivirus, herpesvirus, adenovirus, adeno-associated virus, poxvirus, or alphavirus. The recombinant vector (e.g., viral vector) capable of expressing the nucleic acid of the present invention may be delivered as described herein and maintained in the target cell (e.g., stable transformant). For example, such a recombinant vector (e.g., a recombinant vector that provides expression of an antisense oligomer complementary to hsa-miR-155) can be administered (e.g., injected or infused) into the cerebrospinal fluid of a subject (e.g., intracranial, intraparenchymal, intraventricular, and intrathecal injections, see, e.g., Bergen et al., Pharmaceutical Res. 25:983-998, 2007). Some exemplary recombinant viral vectors that can be used to express any of the nucleic acids described herein are also described by Bergen et al. (supra). Additional examples of recombinant viral vectors are known in the art.

[0148] The nucleic acids (e.g., inhibitory nucleic acids) provided herein may be further complexed with one or more cationic polymers (e.g., poly-L-lysine and poly(ethyleneimine), cationic lipids (e.g., 1,2-dioleoyl-3-trimethylammonium propone (DOTAP), N-methyl-4-(dioleyl)methylpyridinium, and 3P-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol), and / or nanoparticles (e.g., cationic polybutylcyanoacrylate nanoparticles, silica nanoparticles, or polyethylene glycol-based nanoparticles) prior to administration to a subject (e.g., injection or infusion into the cerebrospinal fluid of a subject). Further examples of cationic polymers, cationic lipids, and nanoparticles for therapeutic delivery of nucleic acids are known in the art. Therapeutic delivery of nucleic acids has been shown to be achieved following intrathecal injection of polyethyleneimine / DNA complexes (Wang et al., Mol. Ther. 12:314-320, 2005). The methods of delivery of nucleic acids described herein are not limiting. Additional methods for therapeutic delivery of nucleic acids to subjects are known in the art.

[0149] In some embodiments, the inhibitory nucleic acid (e.g., one or more inhibitory nucleic acids targeting hsa-miR-155) may be administered systemically (e.g., intravenously, intraarterially, intramuscularly, subcutaneously, or intraperitoneally) or intrathecally (e.g., epidurally). In some embodiments, the inhibitory nucleic acid is administered in combination with (e.g., complexed with) one or more cationic lipids. Non-limiting examples of cationic lipids that can be used to administer one or more inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids described herein) include lipofectamine, the cationic lipid molecules described in WO 97 / 045069, and U.S. Patent Application Nos. 2012 / 0021044, 2012 / 0015865, 2011 / 0305769, 2011 / 0262527, 2011 / 0229581, 2010 / 0305198, 2010 / 0203112, and 2010 / 0104629, each of which is incorporated herein by reference. Nucleic acid sequences used to practice the present invention may be synthesized in vitro by well-known chemical synthesis techniques, e.g., as described in Adams, J. Am. Chem. Soc. 105:661, 1983; Belousov, Nucleic Acids Res. 25:3440-3444, 1997; Frenkel, Free Radic. Biol. Med. 19:373-380, 1995; Blommers, Biochemistry 33:7886-7896, 1994; Narang, Meth. Enzymol. 68:90, 1994; Brown, Meth. Enzymol. 68: 109, 1979; Beaucage, Tetra. Lett. 22: 1859, 1981; and U.S. Pat. No. 4,458,066.

[0150] The nucleic acid sequences of the invention can be stabilized against nucleolytic degradation by incorporating modifications, such as nucleotide modifications. For example, the nucleic acid sequences of the invention include phosphorothioates at the first, second, or third internucleotide linkages at least at the 5' or 3' end of the nucleotide sequence. As another example, the nucleic acid sequences can include 2'-modified nucleotides, such as 2'-deoxy, 2'-deoxy-2'-fluoro, 2<*>-O-methyl, 2<*>-O-methoxyethyl (2<*>-O-MOE), 2<*>-O-aminopropyl (2<*>-O-AP), 2<*>-O-dimethylaminoethyl (2<*>-O-DMAOE), 2<*>-O-dimethylaminopropyl (2<*>-O-DMAP), 2<*>-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE). ~ N-Methylacetamide (2'-O ~ As another example, the nucleic acid sequence may include at least one 2'-O-methyl modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-O-methyl modification. In some embodiments, the nucleic acid is "locked", i.e., includes nucleic acid analogs in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290, 2005; Koshkin et al., J. Am. Chem. Soc, 120(50):13252-13253, 1998). For additional modifications, see US2010 / 0004320, US2009 / 0298916, and US2009 / 0143326, each of which is incorporated by reference.

[0151] Techniques for manipulating nucleic acids used to practice the invention, such as subcloning, labeling probes (e.g., random primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization, and the like, are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3rd Edition (2001); Current Protocols in Molecular Biology, edited by Ausubel et al. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, edited by Tijssen, Elsevier, NY (1993).

[0152] Treatment Also provided are methods of treating a mitochondrial disorder, comprising administering to a subject at least one agent (e.g., at least 2, 3, 4, 5, or 6) that reduces the level or activity of one or more (e.g., at least 2, 3, 4, 5, or 6) microRNAs of SEQ ID NO:1, 2, 3 or 4 (e.g., inhibitory nucleic acids, e.g., antagomir).

[0153] In some embodiments, the subject is administered at least one inhibitory nucleic acid that includes a sequence complementary to a contiguous sequence present in miR-181 (e.g., a contiguous sequence present in mature or precursor hsa-miR-181). In non-limiting embodiments, the inhibitory nucleic acid may be an antisense oligonucleotide, a ribozyme, an siRNA, or an antagomir. In some embodiments, the at least one inhibitory nucleic acid is injected into the cerebrospinal fluid of the subject. In some embodiments, the injection is an intracranial injection or an intrathecal injection. In some embodiments, the at least one inhibitory nucleic acid is complexed with one or more cationic polymers and / or cationic lipids (e.g., any of the cationic polymers described herein or known in the art). Antagomires that reduce the expression and / or activity of specific target miRNAs (e.g., miR-181) can be designed using methods known in the art (see, e.g., Krutzfeld et al., Nature 438:685-689, 2005). Further exemplary methods for designing and making antagomir and other types of inhibitory nucleic acids are described herein.

[0154] In some embodiments, the inhibitory nucleic acid that reduces miR-181 levels is an antagomir-181 LNA sequence. Methods for designing antagomirs against target microRNA molecules are described in Obad et al., Nature Genetics 43:371-378, 2011. Additional inhibitory nucleic acids that reduce miR-181 levels or expression are described in Worm et al., Nucleic Acids Res.37:5784-5792, 2009, and Murugaiyan et al., J.Immunol.187:2213-2221, 2011.

[0155] The subject can be administered at least one dose (e.g., at least 2, 3, 4, or 5 doses) of the agent (e.g., one or more inhibitory nucleic acids). The agent (e.g., one or more inhibitory nucleic acids) can be administered to the subject at least once a day (e.g., twice a day, three times a day, and four times a day), at least once a week (e.g., twice a week, three times a week, four times a week), and / or at least once a month. The subject can be treated (e.g., the agent can be administered periodically) for a long period of time (e.g., at least 1 month, 2 months, 6 months, 1 year, 2 years, 3 years, 4 years, or 5 years). As described in detail herein, the dosage of the agent administered to the subject can be determined by a physician taking into account several physiological factors, including, but not limited to, the sex of the subject, the mass of the subject, the age of the subject, and the presence of other medical conditions. The agent can be administered to the subject orally, intravenously, intra-arterially, subcutaneously, intramuscularly, intracranially, or by injection into the cerebrospinal fluid. Similarly, an agent may be formulated as a solid (e.g., for oral administration) or in a physiologically acceptable liquid carrier (e.g., saline) (e.g., for intravenous, intraarterial, subcutaneous, intramuscular, cerebrospinal fluid (intracerebrospinal), or intracranial administration). In some embodiments, an agent (e.g., one or more inhibitory nucleic acids) may be administered by injection or by infusion over a period of time.

[0156] The agents administered to a subject for the treatment of a mitochondrial disorder are described in this document and can be used in any combination (e.g., at least one, two, three, four, or five of any combination of agents or classes of agents described below).

[0157] Diseases of the present invention Diseases that may be treated and / or prevented in the present invention include Leigh syndrome, Leber's hereditary optic neuropathy (LHON), mitochondrial myopathy, encephalopathy, lactic acidosis and stroke syndrome (MELAS), myoclonus epilepsy with ragged-red fibers (MERRF), progressive external ophthalmoplegia (PEO), Pearson syndrome, maternally inherited myopathy and cardiomyopathy (MIMyCA), Kedzier optic neuropathy, neuropathy ataxia and retinitis pigmentosa (NARP), autosomal dominant optic atrophy, Kearns-Sayre syndrome, myoclonus ... myoclonus with ragged-red fibers (MERRF), progressive external ophthalmoplegia (PEO), Pearson syndrome, maternally inherited myopathy and cardiomyopathy (MIMyCA), maternally inherited myopathy and cardiomyopathy (MIMyCA), maternally inherited myopathy and cardiomyopathy (MIMyCA), maternally inherited myopathy and cardiomyopathy (MIMyCA), maternally inherited myopathy and diseases such as SMDs including Friedreich's ataxia, hereditary spastic paraplegia, and Charcot-Marie-Tooth disease; sporadic age-related neurodegenerative diseases, e.g., Parkinson's disease (PD), Alzheimer's disease (AD), age-related macular degeneration (AMD), diabetic retinopathy, and glaucoma; and neurodegenerative disorders affecting the central nervous system and / or eyes associated with mitochondrial dysfunction, including familial neurodegenerative diseases, including familial PD, AD, Huntington's disease, retinitis pigmentosa (RP), and Stargardt disease.

[0158] LHON is a nonsyndromic form of mitochondrial optic neuropathy characterized by RGS degeneration leading to loss of central vision. It is one of the most frequent mitochondrial diseases (prevalence 1:30000), typically occurring between the ages of 15 and 35. Like other MDs, LHON is characterized by a high genetic heterogeneity, as it is caused by point mutations in multiple genes encoded by the mitochondrial genome (mtDNA). In approximately 95% of LHON patients, mutations are located in the ND1, ND4, or ND6 genes that encode complex I subunits (Carelli, 2004; Meyerson, 2015).

[0159] Microphthalmia with linear skin defects (MLS) syndrome is an X-linked neurodevelopmental disorder characterized by microphthalmia, brain abnormalities, and skin defects in heterozygous females and intrauterine lethality in hemizygous males. The disease is due to mutations in key MRC entities, such as holocytochrome c-type synthase (HCCS), involved in the functionality of complex III (Bernard et al., 2003; Indrieri et al., 2013; Wimplinger et al., 2006), and COX7B, subunit 7B of cytochrome c oxidase (MRC complex IV) (Indrieri et al., 2012).

[0160] Mutations in the rhodopsin gene are the cause of dominant and recessive retinitis pigmentosa (RP), accounting for approximately 10% of all cases. Dominant rhodopsin mutations are therefore either gain-of-function or dominant-negative. Several classes are defined: class I is wild-type (wt) opsin-like in its ability to localize to the plasma membrane and bind 11-cis-retinaldehyde to form spectrally active rhodopsin; class II has likely defects in protein folding and / or stability, aberrantly accumulates in the rough endoplasmic reticulum, is not efficiently transported to the plasma membrane like wt opsin, and is unable to bind 11-cis-retinaldehyde to form spectrally active photopigments; class III constitutively activates transducin.

[0161] Among the class I variants are those that affect proline-347, a residue close to the carboxy terminus, which is conserved in all known visual pigments. Six different missense mutations affecting this residue have been identified in patients with RP, indicating that proline-347 mediates several biological functions of rhodopsin.

[0162] Delivery method In certain embodiments, the inhibitor of miR-181 is expressed from a vector in vivo. A "vector" is a composition of interest that can be used to deliver a nucleic acid of interest to the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides with ionic or amphipathic compounds, plasmids, and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, and the like. An expression construct may replicate in a living cell or may be synthetically produced. For the purposes of this application, the terms "expression construct", "expression vector", and "vector" are used interchangeably in a general illustrative sense to demonstrate the application of the invention and are not intended to limit the invention.

[0163] In one embodiment, an expression vector for an inhibitor of miR-181 comprises a promoter "operably linked" to a polynucleotide encoding a miR-181 inhibitor. The phrases "operably linked" or "under transcriptional control," as used herein, mean that the promoter is in the correct location and orientation with respect to the polynucleotide to control initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0164] Particularly preferred viral vectors are AAV vectors, preferably AAV9, AAV5 and AAV2 vectors (e.g., AAV2 / 2, AAV2 / 8, AAV2 / 7m8, AAV2 / 9, AAV2 / PhP.B).

[0165] A preferred promoter of the invention is a ubiquitous promoter, e.g., a promoter that drives ubiquitous expression of an miRNA of the invention, e.g., a CMV or CBA promoter; alternatively, the promoter of the invention may be a cell or tissue specific promoter, e.g., the a-syn promoter for neuron-specific expression or the RHO promoter for photoreceptor-specific expression.

[0166] Non-viral delivery systems are complexes composed of plasmids and synthetic, usually positively charged materials, such as liposomes, polysaccharides, polypeptides, and artificial polymers, such as those described in D. Ibraheem, A. Elaissari, H. Fessi, Gene therapy and DNA delivery systems, Int. J. Pharm. 459 (2014) pp. 70-83, incorporated herein by reference. One such example is a delivery system based on the use of dicetyl phosphate-tetraethylenepentamide-based polycationic liposomes (TEPA-PCL). Through this system, miRNA and other nucleotides, including miRNA sponges, are delivered into cells by macropinocytosis and released into the cytoplasm with high efficiency. Non-viral delivery systems are attractive as they offer the potential for low immunogenicity and low toxicity, thereby providing improved safety.

[0167] Detailed Description of the Invention Materials and Methods Animal testing Ethics statement: All studies on fish and mice were performed in accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experiments (article 7; DL 116 / 92; protocol number: 389 / 2015-PR). All animal procedures were previously reviewed and approved by the Institutional Ethics Committee at the Telethon Institute of Genetics and Medicine (Pozzuoli, Italy).

[0168] cell line HeLa and SH-SY5Y cells were obtained from ATCC (CRM-CCL-2, CRL-2266) and maintained in culture in Dulbecco's Modified Eagle's Medium (GIBCO) supplemented with 10% FBS (SIGMA) and 1% penicillin / streptomycin or a 1:1 mixture of Dulbecco's Modified Eagle's Medium and Nutrient Mixture F-12, respectively, as suggested by the supplier.

[0169] Luciferase assay The binding sites predicted by the human 3'UTR sequence containing miR-181a / b were amplified by PCR and inserted into the pGL3-tk-luciferase vector. A construct containing the mutagenized miR-181a / b binding sites was obtained using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). The primer sequences are reported in Table I. The plasmids were transfected into HeLa cells (PolyFect reagent, QJAGEN). After 7 hours, the cells were transfected with 100 nM miRIDIAN Negative Mimic or Mimic-miR-181 (DHARMACON) using interferon (Polyplus). After 24 hours, luciferase activity was quantified using the Dual-Luciferase Reporter Assay (Promega).

[0170] [Table 1]

[0171] RNA extraction Tissue or cell samples for total RNA extraction were treated in QIAzol Lysis Reagent (QIAGEN). Total RNA was extracted using the RNeasy extraction kit (QIAGEN) according to the manufacturer's instructions.

[0172] Quantitative real-time PCR For quantitative real-time PCR (qRT-PCR) experiments, cDNA was generated using the QuantiTect Reverse Transcription Kit (QJAGEN) according to the manufacturer's instructions. Primers for the qRT-PCR reaction were designed to span two different exons to avoid genomic DNA amplification using in silico tools (www.basic.northwestern.edu / biotools / oligocalc.html), to predict their melting temperature (Tm) and to avoid possible self-annealing or primer dimerization. The specificity of the designed primers was tested in silico using the BLAT or BLAST tools of Genome Browser (https: / / genome.ucsc.edu / ) or Ensembl (http: / / www.ensembl.org / index.html). Primers were tested according to (Bustin et al., 2009). Primer sequences are reported in Table II (Table 2). Quantitative data obtained in qRT-PCR on cDNA from the different treatments are expressed in terms of cycle threshold (Ct). HPRT and GAPDH genes were used as endogenous reference controls for the experiment. Ct values ​​were averaged for each in-plate technical triplicate. The averaged Ct were normalized as the difference in Ct value (ΔCt) between the analyzed mRNA and each reference gene for each sample in the analysis. The ΔCt value for each sample was then normalized with respect to the ΔCt value of the subject (ΔΔCt). Changes were reported as fold changes (2 -ΔΔCt Each plate was performed in duplicate and all results are presented as the mean ± SEM of at least three independent biological assays.

[0173] For analyses under fed and fasted conditions, mice in the fasted condition were euthanized after 12 hours of nutrient deprivation (e.g., food supply was stopped for 12 hours), whereas mice in the fed condition were euthanized after 12 hours of nutrient deprivation and 1 hour of re-feeding (e.g., food supply was returned to each cage).

[0174] [Table 2A]

[0175] [Table 2B]

[0176] [Table 2C]

[0177] SH-SY5Y transfection and FCCP treatment SH-SY5Y cells were transfected with 100 nM of a negative control miRNA inhibitor, as well as miR-181a and miR-181b inhibitors (DHARMACON IH-300552-07-0005 and IH-300554-08-0005, respectively) using Dharmafect (DHARMACON). miR inhibitors are synthetic single-stranded RNA molecules designed to inhibit endogenous microRNA activity. After 72 h of transfection, SH-SY5Y cells were treated with 25 μM FCCP (Sigma, C2920). After 6 h of FCCP treatment, cell death was assessed by trypan blue staining.

[0178] LNA treatment of ARPE cells ARPE-19 cells (CRL-2302) were transfected with 80 nM of LNA negative control miRNA inhibitor, and miR-181a (CGACAGCGTTGAATGT SEQ ID NO: 6) LNA and miR-181b (CGACAGCAATGAATGT SEQ ID NO: 7) LNA inhibitors (Exiqon) using interferon (Polyplus). After 48 hours of transfection, ARPE-19 cells were treated with 100 μM A2E (ACME BIOSCIENCE INC, Customer synthesis A2E, AB4344). After 6 hours of A2E treatment, cell autofluorescence was evaluated.

[0179] Mature miRNA quantification assay For mature quantitative detection of miR-181a and miR-181b, we used hydrolysis probes (TaqMan, Applied Biosystem). cDNA for mature miRNA analysis was generated using the TaqMan MicroRNA Reverse Transcription Kit with miRNA-specific primers according to the manufacturer's instructions. Quantification data obtained by TaqMan-PCR reactions on differently treated TaqMan-cDNA are expressed as cycle threshold (Ct). A TaqMan probe for RNA sno234 was used as an endogenous control for the experiment. Ct values ​​were analyzed as described in the "Quantitative Real-time PCR" section. Each plate was performed in duplicate, and all results are presented as the mean ± SEM of three independent biological replicates.

[0180] RNA in situ hybridization (ISH) Mouse eyes or brains were fixed overnight in 4% PFA, cryoprotected in 30% sucrose, and embedded in OCT. Twenty micrometer frozen sections were treated with 5 μg / mL proteinase K for 15 min. After washing with 2 mg / mL glycine and post-fixing with 4% PFA / 0.2% glutaraldehyde, sections were prehybridized with 50% formamide, 5× saline sodium citrate buffer (SSC) to pH 6 and citric acid, 1% sodium dodecyl sulfate (SDS), 500 μg / mL yeast tRNA, and 50 μg / mL heparin. miRCURY detection miR-181a and miR-181b Locked Nucleic Acid Probes (Exiqon) were used at a final concentration of 30 nM. Probe hybridization was performed overnight at 42°C. Hybridized sections were washed with 50% formamide, 2xSSC at the hybridization temperature. Sections were blocked for 1 h with MABT (100 mM maleic acid, 150 mM NaCl, and 0.1% Tween 20) containing 1% blocking reagent (Roche) and 10% sheep serum, and incubated overnight at 4°C with alkaline phosphatase (AP)-labeled anti-digoxigenin antibody (1:2000, Roche) in MABT / 1% blocking reagent. Sections were stained with NBT-BCIP (Roche) and photographed with a Leica DM5000 microscope. Medaka ISH was performed as described ( Carrella et al., 2015 ).

[0181] Quantitative mitochondrial DNA content analysis SYBR Green real-time PCR was performed using primers for the COI gene (mtDNA) and RNase P (a reference nuclear gene) as described (Viscomi et al., 2009). The mtDNA relative copy number was calculated from the cycle threshold (ΔCt) and the mDNA copy number / cell was multiplied by 2 × 2 -ΔCt to account for two copies of RNase P in each nucleus.

[0182] Protein isolation and Western blotting (WB) For total protein extraction, tissue and cell samples were homogenized in RIPA buffer with protease inhibitor cocktail tablets (Roche). Protein extract concentrations were determined using the Bio-Rad protein assay (Bio-Rad). A total of 30 μg of protein from each sample was loaded onto an SDS-polyacrylamide gel. Mitochondrial and cytoplasmic extracts were obtained from whole eyes excluding the lens as described (Comitato et al., 2014). 30 μg of protein from the mitochondrial and cytoplasmic fractions was loaded onto an SDS-polyacrylamide gel. For WB, gels were electroblotted onto nitrocellulose filters and incubated with the following primary antibodies: anti-p62 (Abnova, clone 2C11, 1:1000); anti-LC3B (Novus, 1:500); anti-Mfn2 (Abcam, ab56889, 1:1000); anti-citrate synthase (Abcam, ab9660, 1:1000); anti-p115 (Santa Cruz, sc-48363, 1:3000); anti-Tim23 (Santa Cruz, sc-13298, 1:250); anti-Ndufb11 (Proteintech, 1:1000); anti-Ndufb8 (Abcam, pan OXPHOS rodent WB antibody cocktail ab110413, 1:250); anti-CoxIV (Cell Signaling, 4844, 1:1000); anti-parkin (Cell Signaling, 4211, 1:500); and anti-Gapdh (Santa Cruz, sc-32233, 1:3000). Proteins of interest were visualized with Luminata Crescendo substrate (Millipore) or Super Signal West Femto substrate (Thermo Scientific) according to the manufacturer's protocol and detected with horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit IgG antibodies (1:3000, GE Healthcare). WB images were acquired using a Chemidoc-lt imaging system (UVP) and band intensities were calculated using ImageJ software. Signals of each protein stain were quantified and then normalized to GAPDH or p115 of the same sample or to Ndufb8 (mitochondrial fraction) (internal normalization). These normalized values ​​were then compared to those of control samples. Only bands from the same blot were compared. The average of these normalized values ​​of three different biological replicates is reported as the relative fold change. For analysis under fed and fasted conditions, mice in fasted conditions were euthanized after 12 hours of nutrient deprivation, whereas mice in fed conditions were euthanized after 12 hours of nutrient deprivation and 1 hour of re-feeding.

[0183] Medaka and morpholino Medaka (Cab strain) were kept and staged as described (Iwamatsu, 2004). The design, specificity and inhibition efficiency of MOs were previously described (Carrella et al., 2015; Indrieri et al., 2013; Indrieri et al., 2012). Morpholino oligos are advanced tools that block sites in RNA to disrupt cellular processes. Morpholino oligos bind specifically to selected target sites and block access of cellular components to the target site. This property can be exploited to block translation, block splicing, block miRNAs or their targets, and block ribozyme activity. Morpholino oligos are fundamentally different from natural nucleic acids, with a methylene morpholine ring replacing the ribose or deoxyribose sugar moiety and nonionic phosphorodiamidate bridges replacing the anionic phosphates of DNA and RNA. Each morpholine ring is appropriately positioned to one of the strand DNA bases (A, C, G, T) for pairing, thereby allowing the 25-base morpholino oligo to bind strongly and specifically to the complementary 25-base target site of the RNA strand via Watson-Crick pairing. The invariant backbone of the morpholino oligo is not recognized by the enzyme, so it is completely stable against nucleases. hccs-MO, cox7b-MO, miR-181a-MO and miR-181b-MOs (MO-miR-181a 5'-AACTCACCGACAGCGTTGAATGTTC-3' SEQ ID NO: 111; MO-miR-181b 5'-AACCCACCGACAGCAATGAATGTTG-3' SEQ ID NO: 112) were injected into fertilized single-cell medaka embryos at concentrations of 0.3 mM, 0.1 mM, 0.075 mM and 0.075 mM, respectively.

[0184] Tunel assay Whole-mount TUNEL assays were performed on st30 medaka embryos using the In Situ Cell Death Detection Kit (Roche) as described (Indrieri et al., 2013). After staining, embryos were embedded in a BSA / gelatin mix and sectioned with a vibratome. Sections were analyzed under a Leica DM-6000 microscope, and TUNEL-positive cells were manually counted throughout the retina.

[0185] Caspase assay For samples, 20 embryos were dechorionated at st32 and frozen in liquid nitrogen for at least 24 h. Caspase assays were performed on protein lysates using caspase-3 / 7- and caspase-9-GLO luciferase reagents (Promega) as previously reported (Indrieri et al., 2013). Luminescence signals were normalized to the protein concentration of each sample.

[0186] Drug treatment of medaka St24 embryos were chorion-deprived and incubated with 50 nM bafilomycin A (SIGMA, B1793), 25 μM PD98059 (Cell Signaling, #9900) or 6 μM HA14-1 (SIGMA, 48787) for 24 h. Drugs were diluted in 3% DMSO / embryo medium. PD medaka models were generated by growing embryos from st32 to st38 in 500 μM 6-OHDA (SIGMA, H4381) in 3% DMSO / 0.2% ascorbic acid / embryo medium. Medium was refreshed twice a day. Control embryos were grown in 3% DMSO / embryo medium.

[0187] Detection of dopaminergic neurons in medaka fish Control and miR-181a / b-MO DMSO- or 6-OHDA-treated fish were fixed in 4% PFA. Fish were treated with 10 μg / ml proteinase K for 1 h 30 min, washed with 2 mg / ml glycine, and fixed in 4% PFA for 20 min. Embryos were then incubated with 0.1% sodium citrate / 0.1% Trison X-100 for 10 min on ice. After overnight incubation with anti-TH antibody (Abcam, ab112, 1:500), fish were incubated with peroxidase-conjugated anti-rabbit antibody (1:200, Vector Laboratories) followed by diaminobenzidine staining (DAB, Sigma). Embryos were embedded in BSA / gelatin mix and sectioned with a vibratome. Sections were observed under a Leica DM-6000 microscope, and anti-TH positive cells were manually counted in all medaka locus coeruleus.

[0188] Rotenone injection Rotenone (Sigma, R8875) was injected intravitreally at a final concentration of 5 mM as reported (Heitz et al., 2012). For histological analysis of RGCs, miR-181a / b-1 was administered to 2-month-old mice. + / + and miR-181a / b-1 - / - One eye was injected with rotenone and the other eye was injected with DMSO (internal control). For optokinetic testing, mice were injected bilaterally with 5 mM rotenone or DMSO.

[0189] NADH dehydrogenase activity staining NADH dehydrogenase histochemical reaction was performed as described with minor modifications {Marella, 2010}. Briefly, retinal sections were washed three times with PBS and then incubated for 30 min at 37° C. in a solution containing 2 mg / ml nitroblue tetrazolium, 0.5 mM NADH, 50 mM Tris-Cl, pH 7.6. Slides were washed twice with PBS and mounted with PBS / glycerol 50%.

[0190] Optokinetic Tracking Visual acuity in rotenone-injected mice was assessed using the Optomotor system (OptoMotry, Cerebral Mechanics, Inc.) as described ( Chadderton et al., 2013 ).

[0191] Immunofluorescence and immunohistochemistry analysis For immunofluorescence analysis, mouse eyes were fixed in 4% PFA, cryoprotected in 30% sucrose, embedded in OCT, and cryosectioned. Sections were permeabilized for cone arrestin immunostaining by boiling in sodium citrate buffer or by incubating with 1% NP40 for 15 min. The following primary antibodies were incubated overnight: anti-rhodopsin (Abcam, ab3267, 1:5000); anti-cone arrestin (Millipore, 1:1000); anti-Pax6 (Covance, 1:250); anti-GS6 (Millipore, 1:100); anti-Syntaxin (SIGMA, 1:100); anti-NeuN (Millipore, clone A60, 1:400); anti-CoxIV (Cell Signaling, 4844, 1:400). Sections were then incubated with Alexa Fluor secondary antibody (1:1000, Invitrogen). Sections were counterstained with DAPI (Vector Laboratories). RGCs stained with anti-NeuN antibody were counted in the area surrounding the optic nerve in eight different slides for each eye. Sections were photographed with a LSM710 Zeiss confocal microscope. For detection of dopaminergic neurons in mice, mice were anesthetized and then perfused with 4% PFA 30–35 days after surgery. Brains were postfixed with 4% PFA and sectioned with a vibratome. The deepest part of the midbrain was sectioned and sections were collected consecutively. Free-floating sections were incubated in PBS1× / FBS10% / Triton0.1% for 20 min and then in BSA0.1% / FBS10% / Triton0.1% in PBS1× for 1 h. After overnight incubation with anti-TH antibody (Abcam, ab112, 1:1000), sections were incubated with peroxidase-conjugated anti-rabbit antibody (1:200, Vector Laboratories, Burlingame, CA, USA) followed by diaminobenzidine staining (DAB, Sigma). All sections containing the SN region were selected using the mouse brain atlas {Paxinos, 2004} (previous section -2.54 to -3.64 mm). Every fourth section covering the entire extent of the SN was used for counting. Brain sections were observed under a Leica DM-6000 microscope, and TH-positive cells were counted manually in both the 6-OHDA-injected and control sides of each animal. The criterion for counting TH-positive cells was the presence of a nucleus in the focal plane. The SN versus the stratum compacta was carefully defined using the mouse brain atlas {Paxinos, 2004}, with special attention paid to not including other TH-positive areas of the SN and the anterior tegmental nucleus region.

[0192] Electroretinogram (ERG) Mice were kept in the dark for 3 h and anesthetized. Flash electroretinograms (ERGs) were elicited by 10 ms light flashes generated with a Ganzfeld stimulator (CSO, Costruzione Strumenti Oftalmici, Florence, Italy) and recorded as previously described (Botta et al., 2016; Surace et al., 2005). ERG and b-wave thresholds were assessed using the following protocol: Eyes were irradiated with a 10 ms light flash generated by ... anesthetized (Surace et al., 2005) under dark-adapted conditions, at a range of -5.2 to +1.3 log cd * s / m 2 (1×10 -5.2 ~20.0cd * s / m 2The ERG analysis under dark-adapted conditions consisted of 11 stimuli spaced 0.6 log units apart (-5.2 to +1.3 log cd * s / m 2 ) were considered. To minimize noise, the three ERG responses were scaled from -5.2 to 0.0 log cd * s / m 2 One ERG response was averaged for each 0.6 log unit stimulus from 0.0 to +1.3 log cd * s / m 2 The a-wave and b-wave amplitudes recorded under dark-adapted conditions were considered as the amplitudes of the a-wave and b-wave with increasing light intensity (-4 to +1.3 log cd * s / m 2 The photopic EGR was plotted as a function of 50 cd / m 2 At a constant background luminance of 20.0 cd * s / m 2 Recordings were made after a dark adaptation session in which the eye was stimulated with ten 10 ms light flashes at 400 Hz.

[0193] 6-OHDA injections and behavioral assays miR-181a / b-1 in 2-month-old male mice + / + and miR-181a / b-1 - / -Mice were anesthetized and placed in a stereotaxic frame (Kopf Instruments). 6-OHDA (2 mg / kg, Sigma) was dissolved in a solution of NaCl 0.9% / 0.01% ascorbic acid and injected unilaterally into the right substantia nigra at coordinates AP=-3.1; L=±0.8; DV=-4.8,-5.2 according to {Paxinos, 2004}. To protect the noradrenergic system {De Leonibus, 2007}, mice received an injection of desipramine (35 mg / kg, ip, Sigma) 15 min before being anesthetized. The total volume of the 6-OHDA injection was 0.8 μL (0.5 μL at DV=-5.2 and 0.3 μL at DV=-4.8). Saline was injected into the other side of the brain. After surgery, animals received 1 ml saline and 1 ml sucrose solution twice a day for the first 3 days to prevent excessive weight loss associated with lesion-induced dysphagia. After 15 days, animals were tested for L-DOPA-induced contralateral rotations as a readout parameter for the extent of the lesion {De Leonibus, 2009}. Behavioral testing was performed during the light phase. Animals were allowed to acclimate to the behavioral space for at least 30 min before testing. Mice were placed in plexiglass cylinders (19 cm diameter), injected with benserazide (20 mg / kg, ip, Sigma), and video tracked for 20 min (AnyMaze, Stoelting). After this acclimatization period, mice were injected with L-DOPA (24 mg / kg, ip, Sigma) and video tracked for another 40 min. An on spot rotation is defined as one complete 360° rotation of the body. P347S mice are transgenic mice carrying a human proline-347 to serine (P347S) mutation described in PMID:8943080.

[0194] statistical analysis Animals were randomly assigned to experimental and control groups. No data were excluded from the analysis. Behavioral and visual testing was performed blindly. The number of experimental replicates was indicated in each figure legend. In all experiments, the significance of differences between groups was assessed by one- or two-way ANOVA with post-hoc Tukey analysis, one- or two-tailed Student's t-test, generalized linear model deviance analysis, or negative binomial generalized linear model deviance analysis, as reported in the figure legends. p<0.05 was considered significant. Quantified data are expressed as mean ± SEM, and p<0.05 was considered significant. EXAMPLES

[0195] Example 1 Mitochondrial turnover in miR-181a / b control We identified PPARGC1A and NRF1, key regulators of mitochondrial biogenesis (Finck & Kelly, 2006; Wu et al., 1999), COX11 and COQ10B, involved in mitochondrial respiratory chain (MRC) assembly (Carr et al., 2002; Desbats et al., 2015), and PRDX3, an important mitochondrial ROS scavenger (Wonsey et al., 2002), as putative miR-181a / b target genes by bioinformatic search (Gennarino et al., 2012). Interestingly, qRT-PCR analysis showed increased levels of all the above-described transcripts in SH-SY5Y human neuroblastoma cells after silencing of miR-181a / b with inhibitors purchased from Dharmacon, as described in detail below (Figure 1A). To validate the newly predicted miR-181a / b targets, the 3'-UTR of each human gene (PPARGC1A, NRF1, COX11, COQ10B, and PRDX3) containing the predicted miR-181 target site was cloned into the pGL3-TK luciferase plasmid downstream of the coding region of a luciferase reporter gene. The ability of transfected miR-181 mimics to affect luciferase activity was then tested. The presence of the 3'-UTR sequence of the analyzed gene inhibited luciferase activity in response to miR-181 mimics (a synthetic double-stranded oligonucleotide identical in sequence to miRNA181a and b, which mimics the function, FIG. 1B, purchased from Dharmacon, and described in detail in the Methods section). In addition, point mutations in the miR-181a / b binding sites in the 3'-UTR of each gene abolished luciferase repression, demonstrating that these miRNAs directly and specifically target the NRF1, COX11, COQ10B, and PRDX3 genes (Figure 1B). Direct targeting of PPARGC1A was not confirmed (Figure 1B), indicating that the upregulation observed by qRT-PCR after silencing miR-181a / b (Figure 1A) could be the result of an indirect effect. Based on the above results, we reasoned that downregulation of miR-181a / b could stimulate mitochondrial biogenesis and tested this hypothesis in vivo. In mammals, miR-181a and miR-181b are grouped into two clusters, namely miR-181a / b-1 and miR-181a / b-2, which are localized to different genomic loci (chromosomes 1 and 2, respectively). The mature forms of miR-181a-1 and miR-181a-2, and the mature forms of miR-181b-1 and miR-181b-2, show identical sequences. Moreover, both miR-181a and miR-181b contain the same "seed" sequence (Ji et al., 2009), ACAUUCA, i.e., the region that is thought to play the most important role in target recognition (Bartel, 2009). A mouse model with targeted deletion of the miR-181a / b-1 cluster, described in (Henao-Mejia et al., 2013), was chosen because this cluster accounts for the majority of mature miR-181a / b expression in both brain and retina, as demonstrated by RNA in situ hybridization, Taqman assays, and increases in several validated miR-181a / b targets, such as Bcl2, Mcl1, Xiap, Atg5, Erk2, and Park2 {Cheng et al., 2016; He et al., 2013; Hutchison et al., 2013; Ouyang et al., 2012; Rodriguez-Ortiz et al., 2014; Tekirdag et al., 2013) (Figures 7A-D, 9). Interestingly, miR-181a / b-1 - / - Increased expression levels of Nrf1, Ppargcla, Cox11, Cog10b and Prdx3 in mouse eyes were observed by RT-PCR and shown in Figure 1C. Increased levels of Nrf1 and Ppargcla indicate enhanced mitochondrial biogenesis (Finck & Kelly, 2006; Wu et al., 1999). Consistent with this observation, an increase in mitochondrial DNA (mtDNA) was detected by qRT-PCR measurement and shown in Figure 1D, and miR-181a / b-1 - / -Increased protein levels of MRC complex subunits (Ndufb11 and Cox4) and general mitochondrial markers (Mfn2, Tim23 and citrate synthase [Cs]) were detected by Western blot (WB) assessment in mouse eyes, as shown in Figure 1E. Overall, these data demonstrate that inactivation of miR-181a / b stimulates mitochondrial biogenesis in the CNS, suggesting a broad action of these two miRNAs in global mitochondrial turnover. We further investigated whether inactivation of miR-181a / b enhances mitophagy in mouse eyes. As shown in Figure 8A, the transcript levels of genes were increased by miR-181a / b-1 as measured by RT-PCR. - / - Furthermore, enhanced recruitment of Park2 / Parkin and autophagy adaptor Sgstm1 / p62 in the mitochondrial fraction was detected by Western blot analysis, as shown in Figure 1F, and miR-181a / b-1 - / - These results indicate an increase in mitophagy in the eye. General autophagy was further analyzed by assessing the levels of Sgstm1 / p62 and the autophagy marker Map1lc3b / Lc3-II in total protein extracts. By WB, reduced levels of these two proteins were observed, further evidence being observed in fasting conditions (Figure 8B), with no change in the corresponding transcript levels (Figure 8C), and miR-181a / b-1 - / - 1 shows an increase in the rate of autophagic flux in the eye. Collectively, these results reveal a critical role for miR-181a / b in regulating mitochondrial turnover in concert with mitochondrial biogenesis and clearance in vivo.

[0196] Example 2 Inhibition of miR-181a / b protects neurons from cell death and ameliorates the phenotype in an in vivo model of MLS syndrome. Surprisingly, we found that inactivation of miR-181a / b protects against mitochondrial damage. First, we tested whether in vitro downregulation of miR-181a / b protects SH-SY5Y cells from FCCP, a potent uncoupler of oxidative phosphorylation (OXPHOS). 50% of control cells died 6 hours after treatment with FCCP, while miR-181a / b silenced cells did not show any change in cell death (Figure 9), demonstrating that miR-181a / b silencing does in fact protect cells from mitochondrial damage. We further evaluated the neuroprotective effect of miR-181a / b inactivation on in vivo models of mitochondrial-mediated neurodegeneration in two fish models of microphthalmia with linear skin defects (MLS) syndrome, a rare form of MD. MLS is a neurodevelopmental disorder characterized by microphthalmia, brain abnormalities and skin defects in heterozygous females and intrauterine lethality in hemizygous males {Indrieri, 2016}. The disease is caused by mutations in key entities of MRC, such as holocytochrome c-type synthase (HCCS), involved in the functionality of complex III (Bernard et al., 2003; Indrieri et al., 2013; Wimplinger et al., 2006), and COX7B, subunit 7B of cytochrome c oxidase (MRC complex IV) (Indrieri et al., 2012). Two medaka (Oryzias latipes) models of MLS were previously generated by knockdown using a morpholino (MO)-based approach, hccs or cox7B expression (Indrieri et al., 2013; Indrieri et al., 2012). Both models (hccs-MO and cox7b-MO) show severe microphthalmia and microcephaly phenotypes due to increased cell death in the CNS (Indrieri et al., 2013; Indrieri et al., 2012). In medaka, mature forms of miR-181a and b are completely conserved compared to their mammalian counterparts in both sequence identity (100%) and expression patterns, especially in the retina (Carrella et al., 2015). MO-mediated silencing of medaka miR-181a / b results in increased levels of most targets involved in mitochondrial function and autophagy (Figure 10). Interestingly, downregulation of miR-181a / b in either MLS medaka model resulted in a notable reduction in cell death in the brain and eye, as shown by TUNEL and caspase activation assays in FIG. 2 .Accordingly, downregulation of miR-181a / b resulted in complete rescue of the disease phenotype in approximately 50% of both hccs (Figure 3A-C,M) and cox7B (Figure 3G-I,N) morphants, whereas MO-mediated silencing of miR-181a / b did not cause any obvious morphological alterations (Figure 11A,B). These data demonstrate that downregulation of miR-181a / b improves the phenotype of both MRC complex III and IV deficiency models, indicating that the protective effect of silencing miR-181a / b in the MLS model is gene-independent. Since miR-181a / b regulates mitophagy and autophagy in the eye, we tested whether the above processes are related to the phenotypic improvement mediated by downregulation of miR-181a / b.To this end, hccs-MO / miR-181a / b-MO-injected embryos and cox7b-MO / miR-181a / b-MO-injected embryos were treated with 50 nM of Bafilomycin A1 (Baf-A1), a general autophagy inhibitor.This concentration can block autophagy without inducing any obvious morphological abnormalities in control embryos (Figure 11C, F). Interestingly, Baf-A1 treatment abolished the protective effect of miR-181a / b downregulation in a significant number of both hccs-MO / miR-181a / b-MO embryos (Figures 3D,M) and cox7b-MO / miR-181a / b-MO embryos (Figures 3J,N), indicating that increased autophagy / mitophagy substantially contributed to the phenotypic improvement in the MLS medaka model. Since downregulation of miR-181a / b also increases the mRNA levels of erk2, a key component of the MAPK / ERK cascade, and bcl2 and mcl1, members of the Bcl2 anti-apoptotic family, as shown in Figure 10, we also tested whether the latter two pathways were involved in the amelioration of the MLS phenotype. Therefore, we treated hccs-MO / miR-181a / b-MO- and cox7b-MO / miR-181a / b-MO-injected embryos with PD98059, a selective inhibitor of the MAPK / ERK pathway (Alessi et al., 1995), or with HA14-1, an inhibitor of Bcl-2 protein (Wang et al., 2000). PD98059 and HA14-1 were used at concentrations that did not induce any morphological changes in control embryos [(Carrella et al., 2015) and Figure 11D, E]. PD98059 treatment did not have any effect on the degree of phenotypic rescue in any of the MLS models (Figure 3E,K,M,N), suggesting that the MAPK pathway is not inherently involved in the protective effect exerted by downregulation of miR-181a / b in the analyzed MLS models. On the other hand, HA14-1 significantly reduced the degree of phenotypic rescue in hccs-MO / miR-181a / b-MO-injected embryos, but not in cox7b-MO / miR-181a / b-MO-injected embryos (Figure 3F,L-N). Taken together, these data suggest that increased autophagy / mitophagy is involved in the amelioration of the MLS phenotype in both models, indicating a primary role for this pathway in miR-181a / b downregulation-mediated neuronal protection.Furthermore, increased levels of bcl2 play a role in the amelioration of only hccs-deficient embryos, indicating that the contribution of the Bcl2-mediated apoptotic pathway may differ depending on the specific mitochondrial defect.

[0197] Example 3 Inhibition of miR-181a / b ameliorates the phenotype in a mouse model of LHON syndrome. The efficacy of miR-181a / b inhibition was further tested in a drug-induced mouse model of Leber's hereditary optic neuropathy (LHON). LHON is a non-syndromic mitochondrial optic neuropathy characterized by retinal ganglion cell (RGC) degeneration resulting in loss of central vision. LHON represents one of the most frequent forms of MD with a prevalence of 1:30000 individuals, with onset occurring between 15 and 35 years of age (Carelli et al., 2004). Like other MDs, LHON is characterized by a high genetic heterogeneity, as it is caused by point mutations in multiple genes encoded by the mitochondrial genome (Carelli et al., 2004; Meyerson et al., 2015). In approximately 95% of patients with LHON, mutations are located in the ND1, ND4 or ND6 genes, which encode complex I subunits (Carelli et al., 2004; Meyerson et al., 2015). Intravitreal injection of rotenone, an MRC complex I inhibitor, results in selective damage of RGCs, and the injected mice are considered a reliable drug-induced LHON model (Carelli et al., 2013). To evaluate whether genetic inactivation of miR-181a / b exerts a protective effect against rotenone-induced LHON, we used miR-181a / b-1 + / + Mice and miR-181a / b-1 - / - Mice were intravitreally injected with rotenone unilaterally. As an internal control, the contralateral eye was injected with DMSO. As previously reported (Heitz et al., 2012), rotenone-injected miR-181a / b-1 + / + Control mice showed a notable reduction in the number of RGCs (Figure 4A, B). In contrast, miR-181a / b-1 - / - In mice, there was no difference in the number of RGCs in rotenone- and DMSO-injected retinas at 1 and 2 weeks after injection (Figure 4A, B). - / - Mice were injected with rotenone to express miR-181a / b-1 + / +We also showed that MRC complex I activity was protected in RGCs, as demonstrated by staining for NADH dehydrogenase activity, for mice (Figure 4C). Thus, CoxIV immunofluorescence analysis highlighted that depletion of miR-181a / b-1 protects the integrity of the mitochondrial network from rotenone-induced damage (Figure 4D). Finally, we also tested retinal function by the optomotor response (OKR). In this analysis, miR-181a / b-1 + / + Mice and miR-181a / b-1 - / - Mice were injected bilaterally with rotenone or DMSO. Interestingly, miR-181a / b-1 + / + Mice showed a severe decrease in visual performance starting one week after rotenone treatment, whereas miR-181a / b-1 - / - Mice were significantly protected from rotenone-induced toxicity (Figure 4E). Ablation of miR-181a / b-1 rescued mice from visual dysfunction even 2 weeks after rotenone injection (Figure 4A,E). Importantly, ablation of miR-181a / b-1 did not, by itself, cause abnormalities in retinal morphology and RGC numbers [as shown by immunofluorescence analysis with representative retinal cell markers (Figure 12A-J,M)], nor did it cause any changes in retinal function [as assessed by electroretinogram (ERG) analysis (Figure 12K-L)]. Taken together, these data indicate that inhibition of miR-181a / b exerts a protective effect in a mammalian model of LHON and thus represents a therapeutic strategy for this condition.

[0198] Example 4 Inactivation of miR-181a / b is mediated by Ndufs4 - / - Rescue of the LHON phenotype in a mouse model. Rotenone-injected mice are considered a reliable LHON model (Carelli et al., 2013). However, the latter is an acute model in which it is difficult to dissect the mechanism by which downregulation of miR-181a / b exerts a protective function. Therefore, we aimed to investigate whether Ndufs4 - / -Utilizing a mouse model (Kruse et al., 2008), we further characterized and validated the efficacy of miR-181a / b inactivation in a mammalian model of MD. Homozygous mutations in NDUFS4 are responsible for one of the most severe forms of Leigh syndrome (LS), an inherited neurodegenerative condition characterized by a poor prognosis in which patients typically die before reaching the age of 3 years. NDUFS4 is a nuclear DNA-encoded MRC complex I subunit located in the NADH dehydrogenase domain of the complex, responsible for its catalytic activity (Breuer et al., 2013; Stroud et al., 2016; Zhu et al., 2016). Mice with homozygous Ndufs4 inactivation develop severe encephalopathy that resembles LS, resulting in death at postnatal (P) days 50–60 (Breuer et al., 2013; Kruse et al., 2008). In addition, since these mice also exhibit an LHON phenotype characterized by RGC dysfunction starting from P16–P20 and resulting in detectable RGC death after P42 ( Song et al., 2017 ; Yu et al., 2015 ), the Ndufs4 knockout line is a good model to study the effects of miR-181a / b inactivation in LHON. - / - Mouse Ndufs4 - / - To study the effect of inactivation of miR-181a / b on retinal phenotype, we crossed Ndufs4 mice with - / - / miR-181a / b-1 - / - Animals were obtained by transfection with Ndufs4 as previously reported ( Yu et al., 2015 ). - / - Mice showed a significant reduction in the number of RGCs at P55, as determined by counting NeuN-positive cells (Fig. 5A, B, E). - / - / miR-181a / b-1 - / - The number of NeuN-positive cells was rescued in the retina (Fig. 5C, E), and the number of NeuN-positive cells was significantly higher in WT mice than in miR-181a / b-1 mice. - / - The OKR test showed that the Ndufs4 - / - Compared with mice, Ndufs4 - / - / miR-181a / b-1 - / -We showed a significant improvement in visual acuity in Ndufs4 mice (Figure 5F), demonstrating the striking effect of downregulating miR-181a / b on both RGC dysfunction and death. Finally, we showed that Ndufs4 mice, which showed an absence of b-wave response, showed a significant improvement in visual acuity in Ndufs4 mice (Figure 5F). - / - We also analyzed ERG responses, which have previously been reported to be altered in mice ( Kruse et al., 2008 ; Yu et al., 2015 ). - / - For mice, Nduf4 - / - / miR-181a / b-1 - / - A significant improvement in the b-wave (scotopic and photopic range) was observed in mice (Figure 5G-H), indicating a significant improvement in the retinal response to light stimulation at P30. Collectively, these results support the finding that Nduf4 - / - We show that downregulation of miR-181a / b protects RGCs from death in our model and improves visual function before the miRNA exerts its activity against RGC death. miR-181a / b inhibition induces Ndufs4 - / - To gain insight into the molecular mechanisms underlying the amelioration of retinal phenotypes, Ndufs4 - / - / miR-181a / b-1 - / - Analysis of the expression levels of miR-181a / b targets in mice and Ndufs4 - / - A significant increase in Nrf1 and Park2 transcripts was observed compared to WT mice (Figure 6A). As previously described, Park2 and Nrf1 are key players in the regulation of mitophagy (Narendra et al., 2008) and mitochondrial biogenesis (Finck & Kelly, 2006; Wu et al., 1999), respectively, i.e., miR-181a / b-1 was upregulated in WT mice compared to miR-181a / b-1. - / - These are pathways that we have shown to be upregulated in mice (Figure 1). Thus, we hypothesize that activation of these pathways is related to Ndufs4 - / - / miR-181a / b-1 - / - We hypothesized that this may significantly contribute to the phenotypic improvement observed in Ndufs4 mice. Of note, the levels of Parkin and p62 were significantly increased in the Ndufs4 mice. - / - For mice, Ndufs4 - / - / miR-181a / b-1 - / -MiR-181a / b depletion was increased in the mitochondrial fraction of mice (Fig. 6C,D), indicating enhanced mitophagy activation in response to depletion of miR-181a / b. Electron microscopy (EM) studies showed a lack of accumulation of autophagosomes / lysosomes containing undigested material, ruling out a possible mitophagy block at the level of autophagosome recruitment or autophagosome / lysosome fusion (Fig. 7B). Moreover, consistent with the upregulation of Nrf1, Ndufs4 - / - For mice, Ndufs4 - / - / miR-181a / b-1 - / - Increased numbers of mitochondria in mouse RGCs at both P30 and P55 were observed by EM (Figure 7A-C). Increased mitochondrial biogenesis was also observed in Ndufs4 as measured by q-PCR. - / - Ndufs4 for mice - / - / miR-181a / b-1 - / - This was confirmed by the increased number of mtDNA in mice (Figure 7D). - / - / miR-181a / b-1 - / - Increased number of mitochondria in mouse RGCs was observed in mice with Ndufs4 - / - This was accompanied by a notable improvement in morphology, such as an increased number of crystals and more electron-dense matrix compared to Ndufs4 mice (Fig. 7A, B). Notably, downregulation of NRF1 significantly abolished miR-181a / b-mediated rescue in SH-SY5Y cells treated with FCCP, indicating that NRF1 is in fact involved in the neuroprotective effect exerted by downregulation of miR-181a / b (Fig. 6B). Finally, the biochemical activities of MRC complexes I, II, and IV were also analyzed. The latter analysis demonstrated an increase in the activity of complexes I and II, as well as a similar trend of complex IV activity, normalized to the activity of the Krebs cycle enzyme citrate synthase, at P30 in Ndufs4 mice. - / - Ndufs4 compared to mice - / - / miR-181a / b-1 - / - We showed that downregulation of miR-181a / b in mice (Figure 7E) reduced Ndufs4 - / -We demonstrated that downregulation of miR-181a / b can partially counteract the biochemical deficiency of MRC complex I in mice. Collectively, these data indicate that downregulation of miR-181a / b exerts a protective effect primarily through the simultaneous stimulation of mitophagy and mitochondrial biogenesis, leading to enhanced mitochondrial turnover in the retina and ultimately to improved mitochondrial morphology and biochemical phenotype.

[0199] Example 5 Inhibition of miR-181a / b protects dopaminergic neurons in a 6-OHDA-induced model of Parkinson's disease. miR-181a / b have been previously shown to be significantly expressed in the substantia nigra (SN) and striatum [(Boudreau et al., 2014) and Figure 10B)] and upregulated in the brains of PD patients. We assessed the effect of miR-181a / b inactivation in a drug-induced model of PD generated in fish and mice using the neurotoxin 6-hydroxydopamine (6-OHDA). 6-OHDA induces selective death of nigrostriatal dopaminergic (DA) neurons in fish (Parng et al., 2007) and mice (Jagmag et al., 2015) and was primarily used to investigate the motor and biochemical dysfunction of PD. Expression of miR-181a and miR-181b in the brain is conserved in medaka, with a strong signal in the locus coeruleus, where teleost DA neurons are clustered (Figure 8A). In control medaka larvae, 6-OHDA treatment resulted in a loss of approximately 30% of DA neurons in the locus coeruleus, as shown by tyrosine hydroxylase (TH) immunostaining and counting (Fig. 8B, C, E). Conversely, animals injected with miR-181a / bMOs (MO-miR-181a 5'-AACTCACCGACAGCGTTGAATGTTC-3' SEQ ID NO: 111; MO-miR-181b 5'-AACCCACCGACAGCAATGAATGTTG-3' SEQ ID NO: 112) described in

[39] were protected from 6-OHDA toxicity and showed no significant difference in the number of TH-positive cells compared to untreated controls (Fig. 8B, D, E). In addition, we analyzed a murine PD model generated by stereotaxic injection of 6-OHDA. In agreement with reported data ( Jagmag et al., 2015 ), miR-181a / b-1 + / + Unilateral injection of 6-OHDA into the SN of mice resulted in massive destruction of DA neurons (Fig. 9A) and striatal terminals (Fig. 9C) compared to the control saline-injected side, as shown by immunostaining and counting of TH-positive cells (Fig. 9A, C, E). Interestingly, miR-181a / b-1 - / - Mice showed increased survival of DA neurons in the 6-OHDA-injected side ( Fig. 9B, D, E ). Contralateral rotation induced by L-DOPA is the most widely used readout of nigral and striatal DA neuron degeneration in unilaterally injected rodents with 6-OHDA {De Leonibus, 2009}. - / - Mice were treated with miR-181a / b-1 + / + mice, and therefore showed lower rotational behavior compared to miR-181a / b-1 - / - It was confirmed that the degree of denervation in the animals was reduced (Figure 9F). Of note, similar to what was observed in the retina, ablation of miR-181a / b-1 did not by itself cause any obvious morphological abnormalities in the SN, as shown by NISSL staining (Figure 9E). Taken together, our data indicate that downregulation of miR-181a / b ameliorates the phenotype of preclinical models of PD by protecting DA neurons from 6-OHDA-induced death in medaka and mice.

[0200] Example 6 Inhibition of miR-181a / b in age-related macular degeneration Mitochondrial dysfunction has been implicated in the pathophysiology of several age-related diseases, including age-related macular degeneration (AMD), a complex multifactorial degenerative disease. While visual dysfunction in AMD is brought about by photoreceptor damage, the primary pathogenic event involves retinal pigment epithelium (RPE) degeneration. In AMD, accumulation of lipofuscin, a product of photoreceptor outer segment (POS) turnover, in the RPE has been hypothesized to be the primary cause of the disease, leading to RPE dysfunction and apoptosis via reactive oxygen species (ROS) production. Growing evidence indicates that autophagy impairment and mitochondrial dysfunction in both RPE and photoreceptors exacerbates oxidative stress and contributes to the pathogenesis of AMD. We tested the efficacy of miR-181a / b inhibition in improving the AMD phenotype. In particular, we used an in vitro model of AMD consisting of the ARPE-19 cell line (RPE) loaded with lipofuscin (A2E). Accumulation of A2E in ARPE-19 could be measured by quantification of autofluorescence. ARPE-19 cells were transfected with locked nucleic acid (LNA) oligonucleotide antisense that inhibits miR-181 activity and compared to control samples. Two days after transfection, control and LNA-miR-181 transfected cells were loaded with 100 μM A2E for 6 hours (FIG. 16A). Inhibition of miR-181 reduced A2E autofluorescence by about 50%, suggesting reduced accumulation of lipofuscin compared to control cells, which was quantified in a graph (A2E intensity average, FIG. 16B). Furthermore, downregulation of miR-181 resulted in a decrease in A2E spot intensity and A2E spot area compared to control cells (FIG. 16B), suggesting that inhibition of miR-181 results in amelioration of retinal pathology associated with lipofuscin accumulation. AMD is mostly caused by environmental and lifestyle factors, but also by genetic factors such as polymorphisms in ABCA4, which increase the risk of AMD. Recessive mutations in the ABCA4 gene are responsible for Stargardt disease, a macular degeneration characterized by lipofuscin accumulation, a condition commonly found in AMD. Thus, Abca4 - / - The mouse model is considered a suitable in vivo model to evaluate AND therapeutic strategies. - / - Mice and miR-181a / b-1 - / - Mice were bred to test the effect of downregulating miR-181a / b. - / - / miR-181a / b-1 - / - In mouse RPE, we observed increased levels of miR-181a / b target mRNAs, as well as increased levels of Sod1 and Cat1, which encode antioxidant proteins (Figure 17A). - / - Mice exhibited a marked accumulation of A2E in the RPE and photoreceptor outer segments (POS), which appears to play a major role in the pathophysiology of retinal disease. The level of lipofuscin autofluorescence (excitation: 560 ± 40 nm, emission: 645 ± 75) was assessed in retinal frozen sections (either RPE only or POS). Interestingly, preliminary data in 5-month-old mice showed that Abca4 - / - Compared with mice, Abca4 - / - / miR-181a / b-1 - / - Showing a reduction in lipofuscin autofluorescence (AF) in the RPE and POS (Figure 17B, C).

[0201] Example 7 Inhibition of miR-181 in retinitis pigmentosa Mutations in the rhodopsin gene are the cause of dominant and recessive retinitis pigmentosa (RP), accounting for approximately 10% of all cases. Dominant rhodopsin mutants are therefore either gain-of-function mutants or dominant-negative mutants. Several classes have been defined. - Class I are wild-type (wt) rhodopsin-like in their ability to localize to the plasma membrane and bind 11-cis-retinaldehyde to form spectrally active rhodopsin, whereas mutations affecting the ciliary targeting signal VXPX can mislocalize to locations including synapses and inhibit synaptic vesicle fusion or aberrantly activate transducin. - Class II proteins probably have defects in protein folding and / or stability, abnormally accumulate in the rough endoplasmic reticulum, are not efficiently transported to the plasma membrane, and are unable to combine with 11-cis-retinaldehyde to form spectrally active photopigments. - Class III constitutively activates transducin. Among the class I variants are those that affect proline-347, a residue close to the carboxyl terminus that is conserved in all known visual pigments. Six different missense mutations affecting this residue have been identified in patients with RP, indicating that proline-347 mediates some important functions of rhodopsin. Transgenic mice carrying the human proline-347 to serine (P347S) mutation (reference PMID:8943080) develop photoreceptor degeneration. At 1 month of age (P30), the photoreceptor layer is already significantly reduced, and at 3 months of age (P90), only one row of photoreceptor cell bodies is present in P347S retinas. Consistently, electroretinogram (ERG) responses are significantly reduced at P30 and almost null at P90. We crossed P347S transgenic animals with miR-181a / b-1 heterozygous animals. Retinas from P347S transgenic mice were cultured with P347S / miR-181a / b-1 heterozygous animals from littermates. + / - The retinas of mice were compared to those of mice that were characterized by ERG studies at P30 and P90, and by histological and molecular analyses. P347S / miR-181a / b compared with P347S retina at P30 + / -The retinal ERG response (b-wave) is significantly higher (N=16) as shown in FIG. 18. The light-adapted response, which is due to cone function, shows less of an increase. Thus, immunofluorescence (IF) staining with two major markers for rods (rhodopsin, Rhod) and cones (C-arrestin, C-arr), respectively, showed increased levels of rhodopsin staining, but no difference in C-arrestin staining (FIG. 19A), even though the outer nuclear layer (ONL) thickness showed no difference (FIG. 19B). The increase in the levels of rhodopsin, as well as other photoreceptor markers, was also confirmed by qRT-PCR analysis and reported in FIG. 19C. Furthermore, at P30, we also observed an improvement in outer segment (OS) length, quantified in the graph shown in FIG. 20. In P90, P347S / miR-181a / b + / - The ERG responses of P347S / miR-181a / b animals still resulted significantly higher compared to P347S animals (Figure 21). IF staining with Rhod and C-arr showed increased levels of both markers at P90 (Figure 22), and histochemical sections showed increased levels of both markers in P347S / miR-181a / b mice. + / - The ONL was revealed to be composed of more than one row of photoreceptor cell bodies, differences compared to P347 ONL are reported graphically in Figure 22 B. Increased levels of rhodopsin and C-arrestin, as well as other photoreceptor markers, were also analyzed by qRT-PCR analysis and reported in Figure 22 C. In addition to the data showing how miR-181a / b may regulate mitochondria-related pathways in the P347S mouse model, the transcriptomic data of the P347S mouse model, which revealed a strong downregulation of mitochondria-related genes and pathways (Figure 23A), prompted us to analyze the mitochondrial phenotype in P347S mice carrying a heterozygous deletion of the miR-181a / b-1 genomic cluster. To understand how downregulation of miR-181a / b improves the retinal phenotype of P347S mice, we performed a randomized controlled trial to determine whether miR-181a / b validated targets were downregulated in the P347S / miR-181a / b model compared to the P347S model. + / -We verified how miR-181a / b was upregulated in the mouse retina. Molecular analysis was performed by qRT-PCR of the following validated miR-181a / b targets (Figure 23B): Ppargc1a and Nrf1, involved in mitochondrial biogenesis; Cox11 and Coq10b, components of the mitochondrial respiratory chain; Prdx3, encoding a protein with antioxidant function; Erk2, Atg5 and Park2, involved in regulating the autophagy / mitophagy pathway; Xiap, which plays an important role in regulating mitochondria-mediated cell death; Bcl2 and Mcl1, which are anti-apoptotic and pro-survival genes. We found upregulation of all targets except Atg5: Cox11, Erk2, Mcl1, Bcl2, Nrf1, Coq10b, Xiap, Ppargc1a, Park2 and Prdx3. Taken together, all these data suggest that the upregulation of the above miR-181a / b target genes is related to the P347S / miR-181a / b + / - It is suggested that this may in principle contribute to the PR protection observed in mice. To gain further insight into the protective effect exerted by depletion of miR-181a / b cluster 1 in P347S mice, we performed cell death assays. As previously shown, miR-181a / b targets multiple anti-apoptotic and pro-survival genes. First, P347S and P347S / miR-181a / b + / - Immunofluorescence was performed on frozen retinas for anti-active caspase-3 in mice (Figure 24A). Caspase-3 is activated in apoptotic cells by both the extrinsic (death ligand) and intrinsic (mitochondrial) pathways. The protein exists as an inactive zymogen and undergoes proteolytic processing to generate the active enzyme, which plays a major role in the apoptotic pathway. As revealed by immunofluorescence assay and its quantification (Figure 24B), P347S / miR-181a / b + / -In the mouse model, there was a significant reduction in anti-active caspase-3 positive cells, indicating that downregulation of miR-181a / b indeed protects cells from apoptosis. Furthermore, we confirmed the data using an additional marker of cell death, the TUNEL-POD assay. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) is a method to detect DNA fragmentation by labeling the 3'-hydroxyl end. A hallmark of cell death is DNA degradation. DNA breaks can result in double-stranded and single-stranded DNA breaks (nicks). Both types of breaks can be detected by labeling the free 3'-OH end with modified nucleotides (e.g., biotin-dUTP, fluorescein-dUTP) by enzymatic reaction. The enzyme terminal deoxyribonucleotidyl transferase (TdT) catalyzes the template-dependent polymerization of deoxyribonucleotides to the 3'-ends of single- and double-stranded DNA. Using this technique, it is possible to detect all types of cell death, mechanism independent, as shown in Figure 25A, where dead cells are labeled in dark grey and indicated by arrows, and quantified in Figure 25B, in P347S mice versus P347S / miR-181a / b mice. + / - There is a strong reduction in dead cells in the mouse retina. All these data taken together indicate that depletion of miR-181a / b cluster 1 protects cells from death in P347S mice. In accordance with the transcriptomic data (Figure 23A), transmission electron microscopy (TEM) revealed a mitochondrial phenotype characterized by smaller and fragmented mitochondria in the P347S mouse model (Figure 26A). TEM analysis revealed that P347S / miR-181 + / - Mouse retina expresses P347S / miR-181 + / + It showed a better structure compared to mice. P347S / miR-181 + / + The OS of mice was completely disrupted, whereas P347S / miR-181 + / -In the P347S / miR-181 animal, both the OS and IS are better organized and packaged (Figure 26A). Furthermore, the difference in mitochondrial morphology between the two models is striking. In the P347S retina, mitochondria are fragmented and very small. Conversely, in the P347S / miR-181 animal, mitochondria are more fragmented and smaller. + / - In animals, mitochondria were more elongated and had better morphology (Figure 26A, quantified in the graphs in Figure 26B), consistent with all previous data implicating miR-181 in mitochondrial functionality. The improvement of mitochondria-related phenotypes was further investigated by WB. We analyzed the protein levels of Mfn2 (mitofusin), a GTPase located in the outer mitochondrial membrane (Figure 27A). Mfn2 is a protein involved in mitochondrial fusion. Within cells, mitochondria exist in an ever-changing dynamic state, constantly elongating and differentiating (fusing and fissioning, respectively). Fission has been shown to serve to separate dysfunctional mitochondria, while fusion aids in the equilibrium of matrix metabolites with intact mtDNA. Certain damaged mitochondria can be fused with other healthy mitochondria to attempt to rescue the damaged mitochondria. The balance of these two events is believed to be essential for mitochondrial homeostasis, cell stability and cell survival. In certain mitochondria, fusion is mediated by three different GTPases, including Mfn2. WB analysis showed that mitochondria were more highly regulated in P347S / miR-181a / b mice compared to P347S mice. + / - We found a trend toward increased Mfn2 protein levels in mice. + / +It is tempting to speculate that upregulation of Mfn2 may be involved in the improvement of mitochondrial morphology visualized by TEM in mouse retina of mice. We also performed OXPHOS BLOT to analyze MRC (Figure 27B). This procedure relies on Western blot, in which antibodies against specific antigens of the five mitochondrial chain complexes are used simultaneously. Downregulation of these proteins was observed in the P347S mouse model relative to the eyes of WT mice. P347S / miR-181a / b + / - In the model, a significant rescue of protein levels was detected. In addition, an upregulation of protein levels was found for the common mitochondrial marker citrate synthase (Cs), an enzyme involved in the first step of the citric acid cycle (Krebs cycle) (Figure 27C). This protein is located in the mitochondrial matrix and is expressed by P347S / miR-181a / b versus P347S eyes. + / - It can provide an indication of increased mitochondrial mass in the eye, and the data is quantified in the graph in Figure 27D.

[0202] Example 8 In vitro validation of miR-181 sponge efficiency An AAV vector (serotype 2) (see miR-181 sponge sequence above) expressing a "sponge" construct for miR-181 inhibition under the control of a cytomegalovirus (CMV) constitutive promoter was generated (AAV.CMV.miR-181.sponge). The AAV2 serotype has been previously reported to efficiently transduce RGCs when administered intravitreally in several species, including mice and non-human primates (Koilkonda et al., 2014a; Koilkonda et al., 2014b; Kwong et al., 2015; Tshilenge et al., 2016). This AAV serotype is commonly used by researchers involved in gene therapy of retinal diseases (Botta et al., 2016; Maguire et al., 2009; Maguire et al., 2008; Mussolino et al., 2011). miRNA sponges are RNA molecules with tandemly repeated miRNA antisense sequences (miRNA binding sites (MBS)) that can sequester miRNAs from their endogenous targets, and are a valuable tool to achieve long-term miRNA loss-of-function in vivo (Ebert & Sharp, 2010). miRNA sponges have been successfully applied to animal models (Ebert & Sharp, 2010; Tay et al., 2015). Sponge design was performed according to (Ebert et al., 2007; Gentner et al., 2009; Kluiver et al., 2012). Briefly, we designed 6MBS antisense against miRNA181a and 6MBS antisense against miRNA181b, with a central mismatch ("bulge") at positions 9-12 of the miR-181a or b sequence. The bulge was created by changing the nucleotides at positions 9-12 to reduce the chance of base pairing (including GU wobble). The two MBSs are separated by a 4 nt sequence (the "spacer"). The sponge oligonucleotide duplex (double strand) was cloned into a vector containing an expression cassette in which the miRNA-binding sponge sequence was inserted into the 3'UTR of a GFP reporter gene (Karali et al., 2011). qRT-PCR analysis of miR-181a / b direct target transcripts (XIAP, NRF1, PRDX3, MCL1, ATG5, SIRT1, BCL2, ERK2, PARK2, COX11) in SH-SY5Y cells transfected with AAV2.1-CMV-eGFP-miR-181 sponge (sponge 181) 48 hours after transfection. Transcript levels of miR-181a / b targets are increased in sponge 181 samples compared to control samples (CTRL=AAV2.1-CMV-eGFP transfected cells, N=3) (FIG. 28). The data indicate that miR-181 sponge sequesters endogenous miR-181, thus preventing endogenous miR-181a / b from binding to its direct targets and inhibiting their activity. One of the pathways modulated by miR-181a / b is mitochondrial-dependent cell death, in which the Bcl-2 protein family has a major regulatory role. This protein family controls mitochondrial outer membrane permeability (MOMP), the formation of an inner membrane channel called the mitochondrial permeability transition pore (PTP), and the release of cytochrome c and other apoptotic triggers (Rasola & Bernardi, 2007; Tait & Green, 2010). Although the contribution of apoptosis to the pathogenesis of primary MD has not been definitively established, increasing the levels of anti-apoptotic Bcl-2 proteins could be an effective strategy to prolong cell survival and delay disease progression. Notably, inhibition of MOMP and PTP, either by overexpression of the Bcl-2 family protein Bcl-xL or by cyclosporine A (CsA) treatment, countered the increased cell death and improved the phenotype of the hccs-deficient MLS medaka model (Indrieri et al., 2013). The importance of mitochondrial-dependent cell death in diseases associated with mitochondrial dysfunction has also been demonstrated by the positive effects of CsA treatment in patients with Ullrich congenital muscular dystrophy and Bethlem myopathy (Merlini et al., 2008), as well as in animal models of PD (Tamburrino et al., 2015). Herein, we show that inhibition of miR-181a / b leads to increased levels of Bcl-2 family members such as Bcl-2 and Mcl-1, rescuing the phenotype in both MLS models tested. Furthermore, HA14-1, a potent inhibitor of Bcl-2 proteins (Wang et al., 2000b), significantly abolishes miR-181a / b-mediated improvement of the MLS phenotype in the hccs-deficient model, but not in the cox7b-deficient model. These data indicate that a single pathway, e.g., mitochondrial-dependent cell death and its modulation, can have differential effects on highly related forms of MD depending on the underlying genetic defect. Furthermore, this observation strengthens our hypothesis that acting on two or more pathways simultaneously may represent a more effective strategy to treat genetically heterogeneous MD. Increased autophagy and mitophagy have been shown to exert protective effects in different neurodegenerative diseases, including PD (Decressac et al., 2013; Martinez-Vicente, 2017). Of note, two gene products mutated in early-onset familial forms of PD, namely parkin and PINK1, are involved in the clearance of damaged mitochondria via the autophagy pathway (Geisler et al., 2010; Vives-Bauza et al., 2010). Moreover, treatment with rapamycin, an mTOR inhibitor that activates autophagy, reduced the expression of Ndufs4, a model of Leigh syndrome, one of the most severe forms of MD. - / - In mice, miR-181a / b significantly delayed both neurodegenerative progression and lethal outcome (Johnson et al., 2013). Herein, we show that downregulation of miR-181a / b leads to increased autophagy and mitophagy in the CNS. Consistent with these data, inhibition of general autophagy in both hccs / miR-181a / b-MO and cox7B / miR-181a / b-MO embryos reduced the neuroprotective effect of miR-181a / b downregulation on the MLS phenotype, indicating that increased autophagy / mitophagy significantly contributes to the rescue of the phenotype in both models. Although removal of dysfunctional mitochondria limits the risk of apoptosis, uncontrolled activation of mitophagy without adequate compensatory mitochondrial biogenesis can contribute to further mitochondrial dysfunction, resulting in mitochondrial mass defects, energy collapse and cell death (Villanueva Paz et al., 2016; Zhu et al., 2013). Moreover, enhanced mitochondrial biogenesis may be protective in itself in MD. Variability in mitochondrial DNA content and mitochondrial biogenesis is in fact associated with incomplete penetrance in non-clinical carriers of LHON (Giordano et al., 2014), and increased biogenesis was found to improve the phenotype of different in vitro and in vivo MD models (Komen & Thorburn, 2014). However, some divergent and contradictory results obtained using compounds that induce mitochondrial biogenesis (including bezafibrate, resveratrol, and AICAR) (Komen & Thorburn, 2014) clearly indicate that additional research is needed to effectively exploit the modulation of mitochondrial biogenesis to increase mitochondrial function in patients. The precise balance between mitophagy and mitochondrial biogenesis has emerged as a key aspect determining cell viability in diseases characterized by mitochondrial dysfunction (Zhu et al., 2013). Herein, we show that miR-181a / b can simultaneously regulate both processes. Concomitant with the increase in mitophagy observed following inactivation of miR-181a / b, we observed increased levels of several mitochondrial proteins and mtDNA, indicating enhanced mitochondrial biogenesis. Accordingly, miR-181a / b-depleted animals showed enhanced MRC complex I activity and preserved mitochondrial integrity in a rotenone-induced LHON model. Taken together, we demonstrate that miR-181a / b represent novel controllers of mitochondrial turnover and that this activity may play a key role in neuroprotection. MD is a group of genetically heterogeneous disorders. Although each individual disorder is rare, collectively, the total prevalence of adult MD is estimated to be approximately 1 in 4300, making it one of the most prevalent groups of inherited neurological diseases (Gorman et al., 2015). In this study, we demonstrate that downregulation of miR-181a / b exerts a neuroprotective effect in multiple MD models. Our results are of particular interest for genetically heterogeneous conditions such as LHON, where a gene-independent therapeutic strategy is highly desirable. Furthermore, the proof-of-principle data we have generated in an in vivo model of PD highlights miR-181a / b as a new possible therapeutic target for this disease. miR-181a / b-1 - / - It should be noted that the mice showed a normal life span (Henao-Mejia et al., 2013) and no overt abnormalities in the brain and eyes, providing initial support for the safety of downregulating these two miRNAs in the CNS. The numerous rare and common neurodegenerative disorders associated with primary or secondary mitochondrial dysfunction collectively represent a significant burden to public health, and modulation of miR-181a / b in the CNS represents a promising strategy for the treatment of these neurodegenerative disorders.

[0203] [References] TIFF2025024167000012.tif209151TIFF2025024167000013.tif218150TIFF2025024167000014.tif21815 0TIFF2025024167000015.tif218150TIFF2025024167000016.tif216150TIFF2025024167000017.tif58147

Claims

[Claim 1] An inhibitor of miR-181 for use in the treatment and / or prevention of mitochondrial disorders.

Images