Bisulfite-free, whole genome methylation analysis

Abstract

To provide methods for cost-effective bisulfite-free identification in DNA, including whole genomic DNA, of the locations of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and 5-formylcytosine.SOLUTION: The methods described herein are based on the conversion of modified cytosine (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU), for example by Tet-assisted pyridine borane treatment, followed by endonuclease cleavage of the DHU, and identification of the cleavage site, which corresponds to the location of the modified cytosine.SELECTED DRAWING: Figure 29A

Description

Detailed Description of the Invention

[0001] [Technical field] The present disclosure provides methods for identifying the locations of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and / or 5-formylcytosine throughout the genome. [Background technology] 5-Methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) are the two major epigenetic marks found in mammalian genomes. 5hmC is generated from 5mC by dioxygenases of the ten-eleven translocation (TET) family. Tet can further oxidize 5hmC to 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC), which are much less abundant (10-100 times less abundant than 5hmC) than 5mC and 5hmC in mammalian genomes. 5mC and 5hmC work together to play important roles in a wide range of biological processes, from gene regulation to normal development. Aberrant methylation and hydroxymethylation of DNA have been associated with various diseases and are widely recognized as hallmarks of cancer. Thus, the determination of 5mC and 5hmC in DNA sequences is not only important for basic research but also useful for clinical applications, including diagnosis and therapy.

[0002] 5fC and 5caC are two of the final oxidized derivatives of 5mC that can be converted to unmodified cytosine by thymine DNA glycosylase (TDG) in the base excision repair pathway. Thus, 5fC and 5caC are two important key intermediates in the active demethylation process that plays a key role in embryonic development. 5fC and 5caC have been identified in these situations and can serve as indicators that 5mC demethylation is near completion. 5fC and 5caC may also perform additional functions, such as binding to specific proteins and acting on the speed and specificity of RNA polymerase II.

[0003] The current gold standard and most widely used method for DNA methylation and hydroxymethylation analysis is bisulfite sequencing (BS) and its derivatives, such as Tet-assisted bisulfite sequencing (TAB-Seq) and oxidized bisulfite phytosequencing (oxBS). Similarly, bisulfite sequencing is the most established method for assaying whole genome DNA methylation. Both of these methods use bisulfite treatment to convert unmethylated cytosines to uracil, while leaving 5mC and / or 5hmC intact. Through PCR amplification of bisulfite-treated DNA (where uracil is read as thymine), modification information for each cytosine can be obtained at single-base resolution (converting C to T gives the position of unmethylated cytosine). However, bisulfite sequencing has at least two major drawbacks. First, bisulfite treatment is a harsh chemical reaction in which, under the required acidic and thermal conditions, over 90% of DNA is degraded due to depurination. This degradation severely limits its application to low-input samples, such as circulating cell-free DNA and clinical samples, including single-cell sequencing. Second, bisulfite sequencing relies on the complete conversion of unmodified cytosines to thymines. Unmodified cytosines account for approximately 95% of all cytosines in the human genome. Conversion of all these positions to thymines would result in a significant decrease in sequence complexity, poorer sequencing quality, lower mapping rates, uneven genome coverage, and higher sequencing costs. Bisulfite sequencing methods are also prone to false detection of 5mC and 5hmC due to incomplete conversion of unmodified cytosines to thymines.

[0004] Whole genome resolution methylome sequencing provides the most comprehensive analysis of DNA methylation, but the high sequencing cost often limits its application. Reduced Representation Bisulfite Sequencing (RRBS) can be used to reduce sequencing costs. However, RRBS only targets a small portion of CpG sites in a given sequence context, and does not provide a comprehensive picture of methylation. Therefore, there is a need for an approach that improves mCpG coverage at a low cost. Summary of the Invention The present disclosure provides a method for genome-wide base resolution methylome analysis. In an embodiment, the method identifies one or more positions of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine, and / or 5-formylcytosine in a DNA sample. In an embodiment, the DNA sample comprises a whole genome. The methods described herein provide DNA methylation and hydroxymethylation analysis with mild reactions that detect modified cytosines at base resolution without affecting unmodified cytosines. Provided herein is an improved method for identifying 5mC and / or 5hmC by combining oxidation with TET and reduction with borane derivatives (e.g., pyridine borane and 2-picoline borane (pic-BH3)), which is referred to herein as TAPS (TET-assisted pyridine borane sequencing) (Table 1). TAPS directly detects modifications with high sensitivity and specificity without affecting unmodified cytosines, and can be modified to detect other cytosine modifications as described herein. TAPS is non-destructive and preserves DNA up to 10 kb. Compared to bisulfite sequencing, TAPS provides higher mapping rates, uniform coverage, lower sequencing costs, and improved quality, resulting in more comprehensive and less expensive methylome analysis. As described herein, a variation of this method is used to identify 5fC and / or 5caC, without the oxidation step.

[0005] Whole-genome TAPS (wgTAPS) reduces the sequencing cost by half compared to whole-genome bisulfite sequencing (WGBS). However, the cost of whole-genome sequencing is still prohibitive for many projects, especially considering that 5mC and 5hmC account for only about 4% of all cytosine residues in mammalian genomes, and therefore around 65%-80% of the reads generated by short-read whole-genome sequencing do not contain any methylated CpG sites (mCpG). To reduce sequencing costs, Reduced Representation Bisulfite Sequencing (RRBS) is a widely used method in which CpG-rich regions are enriched by restriction enzymes before bisulfite treatment. However, RRBS covers only a small portion of CpG sites in a given sequence context, so a comprehensive picture of methylation cannot be obtained. Therefore, there is a need for an approach that improves mCpG coverage at a low cost. In one embodiment, the disclosure provides a modified version of the TAPS method (herein referred to as endonuclease enriched TAPS (eeTAPS)) that provides a new strategy for cost-effective genome-wide methylation analysis at 1 CpG resolution. In another embodiment, the disclosure provides a modified variant of the TAPS method (e.g., TAPSβ and CAPS) that can be used to detect 5mC, 5hmC, 5fC, and / or 5caC.

[0006] That is, the present disclosure provides a low-cost method for identifying one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and / or 5-formylcytosine in the whole genome. The method described herein is based on converting modified cytosines (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU), for example by TET-assisted pyridine borane treatment, and then cleaving the DHU sites with an endonuclease to generate DNA fragments, which are then sequenced into a sequencing library. Unfragmented genomic DNA cannot be sequenced directly, and only if modified cytosines that are converted to DHU are present can the genomic DNA be cleaved into DNA fragments and sequenced at each end of the fragments (which indicate the position of the modified cytosine). Sequencing the cleaved fragments allows identification of methylated cytosines in the original DNA sample with base-by-base resolution. Furthermore, since hypermethylated cytosines are more prone to cleavage than hypomethylated sites, this method can be used to semi-quantitate DNA methylation.

[0007] In one aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5mC and / or 5hmC; b. modifying the DNA, which comprises the steps of: i. converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC; ii. converting the 5caC and / or 5fC to DHU to provide a modified DNA sample comprising the modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of a cleavage site provides a method that results in the location of either 5mC or 5hmC in the target DNA.

[0008] In another aspect, the present disclosure provides a method for identifying 5-methylcytosine (5mC) in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. modifying the DNA sample, which comprises the steps of: i. adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the DNA sample; ii. converting 5mC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC); iii. converting the 5caC and / or 5fC to dihydrouracil (DHU) to provide a modified DNA sample containing modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method to obtain the location of 5mC in the target DNA.

[0009] In another aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5mC and / or 5hmC; b. modifying the DNA, which comprises the steps of: i. converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC; ii. converting the 5caC and / or 5fC to DHU to provide a modified DNA sample comprising the modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of a cleavage site provides a method that results in the location of either 5mC or 5hmC in the target DNA.

[0010] In another aspect, the present disclosure provides a method for identifying 5mC and identifying 5hmC in a DNA sample, comprising: a. identifying 5mC in the DNA sample, comprising the steps of: i. Providing a first DNA sample containing target DNA having 5mC and / or 5hmC. ii. modifying DNA in said first sample, comprising the steps of: 1. Adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the first DNA sample. 2. Converting 5mC in the first DNA sample to 5caC and / or 5fC. 3. Converting the 5caC and / or 5fC to DHU to provide a first modified DNA sample containing modified target DNA. iii. cleaving the modified target DNA iv. adding an adaptor DNA molecule to the cleaved modified target DNA. v. detecting the sequence of the modified target DNA, the presence of a cleavage site providing the location of a 5mC in the target DNA. b. identifying 5mC or 5hmC in the DNA sample, comprising the steps of: i. Providing a second DNA sample containing target DNA having 5mC and / or 5hmC. ii. modifying the DNA in the second sample, comprising the steps of: 1. converting 5mC and 5hmC in the second DNA sample to 5caC and / or 5fC 2. Converting the 5caC and / or 5fC to DHU to provide a second modified DNA sample containing modified target DNA. iii. cleaving the modified target DNA iv. adding an adaptor DNA molecule to the cleaved modified target DNA. v. detecting the sequence of the modified target DNA from the second sample, wherein the presence of a cleavage site results in the location of either 5mC or 5hmC in the target DNA. c. comparing the results of steps (a) and (b), wherein a cleavage site present in step (b) but not present in step (a) results in the location of 5hmC in the target DNA; and The present invention provides a method comprising:

[0011] In embodiments, the blocking group added to the 5hmC in the DNA sample is a sugar. In embodiments, the sugar is a natural sugar or a modified sugar, e.g., glucose or a modified glucose. In embodiments, the blocking group is added to the 5hmC by contacting the DNA sample with a UDP linked to a sugar, e.g., UDP-glucose, or a UDP linked to a modified glucose, in the presence of a glucosyltransferase enzyme, e.g., T4 bacteriophage β-glucosyltransferase (βGT) and T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof.

[0012] In an embodiment, the steps of converting 5mC in a DNA sample to 5caC and / or 5fC and converting 5mC and 5hmC in a DNA sample to 5caC and / or 5fC each comprise contacting the DNA sample with a ten-eleven translocation (TET) enzyme. In a further embodiment, the TET enzyme is one or more of human TET1, human TET2, human TET3, mouse Tet1, mouse Tet2, mouse Tet3, Naegleria TET (NgTET), Coprinopsis cinerea (CcTET), and derivatives or analogs thereof. In an embodiment, the TET enzyme is NgTET or a derivative thereof. In an embodiment, the TET enzyme is mouse mTet1 (mTet1CD) or a derivative thereof. In another embodiment, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0013] In another aspect, the present disclosure provides a method for identifying 5caC or 5fC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5caC and / or 5fC; b. converting the 5caC and 5fC to DHU to provide a modified DNA sample containing modified target DNA; c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of a cleavage site provides a method that results in the location of either 5caC or 5fC in the target DNA.

[0014] In another aspect, the present disclosure provides a method for identifying 5caC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5caC; b. adding a blocking group to the 5fC in the DNA sample; c. converting the 5caC to DHU to provide a modified DNA sample containing modified target DNA; d. cleaving the modified target DNA; e. adding an adaptor DNA molecule to the cleaved modified target DNA; f. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5caC in the target DNA.

[0015] In embodiments, the step of adding a blocking group to 5fC in the DNA sample comprises contacting the DNA with an aldehyde-reactive compound, including, for example, hydroxylamine derivatives (such as O-ethylhydroxylamine), hydrazine derivatives, and hydrazide derivatives.

[0016] In another aspect, the present disclosure provides a method for identifying 5fC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5fC; b. adding a blocking group to the 5caC in the DNA sample; c. converting the 5fC to DHU to provide a modified DNA sample comprising modified target DNA; d. cleaving the modified target DNA; e. adding an adaptor DNA molecule to the cleaved modified target DNA; f. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5fC in the target DNA.

[0017] In embodiments, the step of adding a blocking group to 5caC in the DNA sample comprises contacting the DNA sample with a carboxylic acid derivatization reagent, such as 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), and (ii) an amine (such as ethylamine), a hydrazine, or a hydroxylamine compound.

[0018] In another aspect, the present disclosure provides a method for identifying 5hmC in a DNA sample, comprising: a. Providing a DNA sample containing target DNA having 5hmC; b. modifying the DNA in the sample, comprising the steps of: i. converting 5hmC in the DNA sample to 5caC and / or 5fC ii. converting the 5caC and / or 5fC to dihydrouracil (DHU) to provide a modified DNA sample containing modified target DNA. c. cleaving the modified target DNA; and d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5hmC in the target DNA.

[0019] In embodiments, the step of converting 5hmC to 5caC and / or 5fC comprises contacting the DNA sample with an oxidizing agent. In further embodiments, the oxidizing agent is potassium perruthenate, Cu(II) / TEMPO, potassium ruthenate, or manganese oxide.

[0020] In an embodiment, the DNA sample comprises genomic DNA. In an embodiment, the DNA sample comprises picogram amounts of DNA. In an embodiment, the DNA sample comprises about 1 pg to about 900 pg of DNA, about 1 pg to about 500 pg of DNA, about 1 pg to about 100 pg of DNA, about 1 pg to about 50 pg of DNA, about 1 to about 10 pg of DNA, less than about 200 pg of DNA, less than about 100 pg of DNA, less than about 50 pg of DNA, less than about 20 pg of DNA, and less than about 5 pg of DNA. In another embodiment, the DNA sample comprises nanogram amounts of DNA. In embodiments, the DNA sample comprises about 1 to about 500 ng DNA, about 1 to about 200 ng DNA, about 1 to about 100 ng DNA, about 1 to about 50 ng DNA, about 1 ng to about 10 ng DNA, about 1 ng to about 5 ng DNA, less than about 100 ng DNA, less than about 50 ng DNA, about 5 ng DNA, or less than about 2 ng DNA. In embodiments, the DNA sample comprises circulating cell-free DNA (cfDNA). In embodiments, the DNA sample comprises microgram amounts of DNA.

[0021] In embodiments, the step of converting 5caC and / or 5fC to DHU comprises contacting the DNA sample with a reducing agent, including, for example, pyridine borane, 2-picoline borane (pic-BH3), tert-butylamine borane, borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In preferred embodiments, the reducing agent is pic-BH3 and / or pyridine borane.

[0022] In an embodiment, the step of cleaving the modified target DNA comprises contacting the modified DNA sample containing the modified target DNA with one or more endonucleases that specifically cleave the modified target DNA in the presence of DHU, thereby specifically cleaving the modified target DNA containing DHU. In an embodiment, the endonuclease is a bifunctional DNA endonuclease having DNA N-glycosylase activity and AP lyase activity, such as Tma endonuclease III, endonuclease VIII, formamidopyrimidine DNA glycosylase (Fpg) and / or hNEIL1. In an embodiment, the modified target DNA is cleaved using a uracil-specific removal reagent (USER). The USER enzyme comprises a combination of uracil DNA glycosylase (UDG) and endonuclease VIII. Other enzymes that can be used alone or in combination to cleave modified target DNA are apurinic / apyrimidinic endonuclease 1 (APE1), UDG, endonuclease III, Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg, and / or hNEIL1.

[0023] In an embodiment, the method further comprises a step of size-selecting the cleaved modified target DNA. In an embodiment, the method further comprises a step of amplifying the copy number of the modified target DNA. In an embodiment, the amplifying step is performed before the step of detecting the sequence of the modified target DNA. Amplifying the copy number of the modified target DNA may be performed by performing a polymerase chain reaction (PCR), a primer extension method, and / or cloning.

[0024] In embodiments, determining the sequence of the modified target DNA comprises chain termination sequencing, microarray, high throughput sequencing and restriction enzyme analysis. In embodiments, detecting the sequence of the modified target DNA comprises next generation sequencing.

[0025] In one aspect, the disclosure provides a method of cleaving a modified target DNA, comprising contacting a modified target DNA containing one or more DHUs (i.e., DHU residues) with one or more endonucleases that cleave the modified target DNA at or adjacent to the one or more DHUs. The one or more endonucleases can be, for example, any type of endonucleases described herein or a combination thereof. In an embodiment, the one or more DHUs in the modified target DNA are derived from 5mC and / or 5hmC, for example, by the methods described herein. In an embodiment, the one or more DHUs in the modified target DNA are derived from 5caC and / or 5fC, for example, by the methods described herein.

[0026] In embodiments, the method further comprises modifying a target DNA containing 5mC and / or 5hmC prior to the contacting step to provide the modified target DNA, the modification comprising (i) converting 5mC and 5hmC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC), e.g., by a method described herein, and (ii) converting the 5caC and / or 5fC to dihydrouracil (DHU), e.g., by a method described herein.

[0027] In embodiments, the method further includes modifying the target DNA containing 5mC and 5hmC prior to the contacting step to provide a modified target DNA, the modification including (i) adding a blocking group to the 5hmC in the target DNA, e.g., by a method described herein; (ii) converting the 5mC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC), e.g., by a method described herein; and (iii) converting the 5caC and / or 5fC to dihydrouracil (DHU), e.g., by a method described herein.

[0028] In embodiments, the method further comprises modifying the target DNA containing 5caC and / or 5fC to provide a modified target DNA prior to the contacting step, the modification comprising converting the 5caC and / or 5fC to dihydrouracil (DHU), for example, by a method described herein.

[0029] In embodiments, the method further includes modifying the target DNA containing 5caC and / or 5fC prior to the contacting step to provide a modified target DNA, the modification including (i) adding a blocking group to the 5fC in the target DNA, e.g., by a method described herein, and (ii) converting the 5caC to dihydrouracil (DHU), e.g., by a method described herein.

[0030] In embodiments, the method further includes modifying the target DNA containing 5caC and / or 5fC prior to the contacting step to provide a modified target DNA, the modification including (i) adding a blocking group to the 5caC in the target DNA, e.g., by a method described herein, and (ii) converting the 5fC to dihydrouracil (DHU), e.g., by a method described herein.

[0031] In embodiments, the method further comprises, prior to the contacting step, modifying the target DNA containing 5mC and / or 5hmC to provide modified target DNA, the modification comprising (i) converting 5mC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC), e.g., by a method described herein, and (ii) converting the 5caC and / or 5fC to dihydrouracil (DHU), e.g., by a method described herein. BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] Screening of borane-containing compounds. Borane-containing compounds were screened for the conversion of 5caC to DHU in 11-mer oligonucleotides ("oligos"), and the conversion was estimated by MALDI. 2-picoline borane (pic-borane), borane pyridine, and tert-butylamine borane were able to completely convert 5caC to DHU, while the conversion was around 30% for ethylenediamine borane and dimethylamine borane. No detectable products were measured (not detected) for dicyclohexylamine borane, morpholine borane, 4-methylmorpholine borane, and trimethylamine borane. Other reducing agents such as sodium borohydride and sodium tri(acetoxy)borohydride were rapidly decomposed in acidic medium, leading to incomplete conversion. Sodium cyanoborohydride was not used due to the possible formation of hydrogen cyanide under acidic conditions. Pic-borane and pyridine borane were selected due to their complete conversion, low toxicity, and high stability. Figure 2. Pic-borane reaction of DNA oligos. (A) A model DNA containing 5caC was treated with 11-mer pic-borane and characterized by MALDI. Calculated mass (m / z) is shown above each graph, and observed mass is shown to the left of the peak. (B) Conversion of dC and various cytosine derivatives was quantified by HPLC-MS / MS. Data are presented as the mean ± standard deviation of three replicates. [Figure 3A] Pic-borane reaction of a single nucleoside. 1 The H NMR results are in accordance with previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). 1H NMR (MeOH-d4, 400MHz) chart. δ ppm: 6.28 (t, 1H, J = 7 Hz), 4.30 (m, 1H), 3.81 (m, 1H), 3.63 (m, 2H), 3.46 (m, 2H), 2.65 (t, 2H, J = 6 Hz), 2.20 (m, 1H), 2.03 (m, 1H). [Figure 3B] Pic-borane reaction of a single nucleoside. 13 The C NMR results are in accordance with previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). 13 C NMR (MeOH-d4, 400 MHz) chart. δ ppm: 171.56 (CO), 153.54 (CO), 85.97 (CH), 83.86 (CH), 70.99 (CH), 61.92 (CH2), 36.04 (CH2), 35.46 (CH2), 30.49 (CH2). FIG. 4A shows the conversion of 5caC to DHU by borane and the proposed mechanism of the borane reaction of 5caC to DHU. FIG. 4B shows the proposed mechanism for the conversion of 5fC to DHU by borane and the borane reaction of 5fC to DHU. [Figure 5] (A) TAPS converts both 5mC and 5hmC to DHU, which functions as thymine during replication. (B) Overview of the TAPS, TAPSβ, and CAPS methods. Figure 6-1: MALDI characterization of model DNA oligos containing 5fC and 5caC with and without blocking of 5fC and 5caC with pic-borane. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked with hydroxylamine derivatives such as O-ethylhydroxylamine (EtONH2), which form oximes that prevent conversion by pic-borane. 5caC was blocked with ethylamine via EDC linkage to convert it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 6-2] MALDI characterization of model DNA oligos containing 5fC and 5caC with and without blocking of 5fC and 5caC with pic-borane. 5fC and 5caC are converted to dihydrouracil (DHU) with pic-BH3. 5fC was blocked with hydroxylamine derivatives such as O-ethylhydroxylamine (EtONH2), which form oximes that prevent conversion by pic-borane. 5caC was blocked with ethylamine via EDC linkage to convert it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) is shown above each graph, and observed MS is shown to the left of the peak. [Figure 7-1] MALDI characterization of model DNA oligos containing 5mC and 5hmC with and without blocking of 5hmC with KRuO4 and pic-borane. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized to 5fC by KRuO4 and then converted to DHU by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 7-2] MALDI characterization of model DNA oligos containing 5mC and 5hmC with and without blocking of 5hmC with KRuO4 and pic-borane. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized to 5fC by KRuO4 and then converted to DHU by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 8] Restriction enzyme digestion showed that TAPS can effectively convert 5mC to T. (A) Diagram of restriction enzyme digestion assay to confirm sequence change by TAPS. (B) TaqαI digestion test to confirm C to T conversion by TAPS. TAPS was performed on a 222-bp model DNA containing a TaqαI restriction site and five fully methylated CpG sites (5mC) and its unmethylated control (C). As shown in 5mC, C, and C TAPS, the PCR-amplified 222-bp model DNA can be cleaved into approximately 160-bp and approximately 60-bp fragments by TaqαI. As shown in the 5mC-TAPS lane, after TAPS was performed on the methylated DNA, the T(mC)GA sequence was converted to TTGA and was no longer cleaved by TaqαI digestion. FIG. 9. TAPS on 222 bp model DNA and mESC gDNA. (A) Sanger sequencing of 222 bp model DNA containing five fully methylated CpG sites and its unmethylated control before (5mC, C) and after (5mC TAPS, C TAPS) TAPS. Only 5mC is converted to T by the TAPS method. (B) Quantification by HPLC-MS / MS of the relative modification levels in mESC gDNA control after oxidation with NgTET1 and reduction with pic-borane. Data are presented as the mean ± standard deviation of three replicates. [Figure 10A] TAPS does not result in significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp unmethylated DNA, 222 bp methylated DNA, and mESC gDNA before cooling in an ice bath. After TAPS, no detectable DNA degradation was observed, and the DNA remained double-stranded and visible without cooling. With bisulfite conversion, degradation occurred and the DNA became single-stranded and was visible only after cooling on ice. [Figure 10B] TAPS does not result in significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp unmethylated DNA, 222 bp methylated DNA, and mESC gDNA after cooling in an ice bath (B). After TAPS, no detectable DNA degradation was observed, and the DNA remained double-stranded and visible without cooling. With bisulfite conversion, degradation occurred and the DNA became single-stranded and was visible only after cooling on ice. FIG. 10C: TAPS does not cause significant DNA degradation compared to bisulfite. Agarose gel images of mESC gDNA of various fragment lengths treated with TAPS and bisulfite before (left panel) and after chilling on ice (right panel). After TAPS, the DNA remained double stranded and was directly visible on the gel. Bisulfite treatment caused more damage and fragmentation of the samples, with the DNA becoming single stranded and only visible after chilling on ice. As shown in FIG. 15, conversion by TAPS was complete for all gDNA fragments, regardless of fragment length. [Figure 10D] TAPS does not cause significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp model DNA before and after TAPS (three independent replicates), showing no detectable degradation after the reaction. [Figure 11] Comparison of amplification curves and melting curves between model DNA before and after TAPS. qPCR assay showed small differences in the amplification curves of model DNA before and after TAPS. The melting curve of methylated DNA (5mC) shifted to lower temperatures after TAPS, indicating a decrease in Tm and possible C to T conversion, but no shift was observed for unmethylated DNA (C). [Figure 12] As shown by Sanger sequencing, complete conversion of C to T was induced after TAPS, TAPSβ, and CAPS. Model DNA containing one methylated CpG site and one hydroxymethylated CpG site was prepared as described herein. Conversion by TAPS was performed according to the protocol of oxidation by NgTET1 and reduction by pyridine borane as described herein. Conversion by TAPSβ was performed according to the protocol of blocking 5hmC, oxidation by NgTET1, and reduction by pyridine borane. Conversion by CAPS was performed according to the protocol of oxidation of 5hmC and reduction by pyridine borane. After conversion, 1 ng of the converted DNA sample was PCR amplified by Taq DNA polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC, whereas CAPS selectively converted 5hmC. Unmodified cytosines and other bases were not converted by any of these three methods. FIG. 13A: TAPS is compatible with a variety of DNA and RNA polymerases and induces complete C to T conversion as shown by Sanger sequencing. Model DNA containing methylated CpG sites and primer sequences for polymerase testing are described herein. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase, Taq polymerase, and Vent exopolymerase read DHU as T, thus inducing complete C to T conversion after PCR. Alternatively, primer extension was performed with biotin-labeled primers and isothermal polymerases, including Klenow fragment, Bst DNA polymerase, and phi29 DNA polymerase. The newly synthesized DNA strands were separated by Dynabeads MyOne Streptavidin C1, then amplified by PCR with Taq polymerase, and processed for Sanger sequencing. T7 RNA polymerase could efficiently bypass DHU and insert an adenine opposite the DHU site, as demonstrated by RT-PCR and Sanger sequencing. (FIG. 13B) Certain other commercially available polymerases did not efficiently amplify DNA containing DHU. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase and Taq polymerase read DHU as T, leading to complete conversion of C to T. Low or no conversion of C to T was observed with certain other commercially available polymerases, including KAPA HiFi polymerase, Pfu polymerase, Phusion polymerase, and NEB Q5 polymerase (not shown). [Figure 14] DHU shows no PCR bias compared to T and C. Model DNAs containing one DHU / U / T / C modification were synthesized using the corresponding DNA oligos as described herein. Based on the qPCR reactions, standard curves of each model DNA with DHU / U / T / C modifications were plotted, and the model DNA input was serially diluted 1:10 (0.1 pg to 1 ng. All qPCR experiments were performed in triplicate). The slope of the regression between the log concentration (ng) values ​​and the mean Ct values ​​was calculated by the SLOPE function in Excel. PCR efficiency was calculated using the formula: Efficiency (%) = (10^(-1 / slope)-1) x 100%. Amplification factor was calculated using the formula: Amplification factor = 10^(-1 / slope). The PCR efficiency for model DNAs with DHU, T, or C modifications was almost the same, indicating that DHU can be read as a normal base and does not appear to cause PCR bias. FIG. 15. TAPS completely converted 5mC to T, regardless of DNA fragment length. (A) Agarose gel image of TaqαI-digestion assay confirmed complete conversion of 5mC to T in all samples, regardless of DNA fragment length. After TAPS, a 194 bp model sequence from the lambda genome was PCR amplified and digested with TaqαI enzyme. PCR products amplified from unconverted samples could be cleaved, whereas products amplified from TAPS-treated samples remained intact, suggesting loss of the restriction site, i.e., complete conversion of 5mC to T. (B) Quantification of gel bands estimated the C to T conversion percentage, which was 100% for all DNA fragment lengths tested. Figure 16: Conversion and false positives under different TAPS conditions. The combination of mTet1 and pyridine borane resulted in the highest conversion of methylated C (96.5%, calculated on fully CpG-methylated lambda DNA) and the lowest conversion of unmodified C (0.23%, calculated on a 2 kb unmodified spike-in) compared to other conditions using NgTET1 or pic-borane. Shown above the bars are the conversion rates ± standard error for all cytosine sites tested. FIG. 17: Conversion rates for short spike-ins: (A) 120mer-1 and (B) 120mer-2 containing 5mC and 5hmC. Near complete conversion occurred at the 5mC and 5hmC sites in both strands. The actual sequences are shown above and below, along with the modification status. FIG. 18A: Improved sequencing quality of TAPS over whole genome bisulfite sequencing (WGBS). Conversion rates of 5mC and 5hmC in DNA treated with TAPS. Left: Synthetic spike-ins (CpN) methylated or hydroxymethylated at known positions. FIG. 18B: Improved sequencing quality of TAPS compared to whole genome bisulfite sequencing (WGBS). False positive rate of TAPS obtained from an unmodified 2 kb spike-in. FIG. 18C: Improved sequencing quality of TAPS over whole genome bisulfite sequencing (WGBS). Total runtime of TAPS and WGBS for 1 million simulated reads on one core of an Intel Xeon CPU. [Figure 18D] Improved sequencing quality of TAPS compared to whole genome bisulfite sequencing (WGBS). Percentage of all sequenced read pairs (after trimming) that were mapped to the genome. [Figure 18E] Improved sequencing quality of TAPS compared to whole genome bisulfite sequencing (WGBS). Sequencing quality scores per base in the first and second reads of all sequenced read pairs were recorded by Illumina BaseSpace. Top: TAPS. Bottom: WGBS. Figure 19. TAPS provided more uniform coverage than WGBS and fewer uncovered positions than WGBS. Comparison of coverage depth at (A) all bases and (B) CpG sites between WGBS and TAPS, calculated on both strands. For "TAPS (downsampled)", random reads taken from all mapped TAPS reads were selected to ensure that the median coverage matched the median coverage of WGBS. The last bin shows positions with >50× coverage. Figure 20: Distribution of modification levels across all chromosomes. The average modification levels in 100 kb windows across mouse chromosomes were weighted by CpG coverage and smoothed with a Gaussian weighted moving average filter with a window size of 10. (Figure 21A) Comparison of genome-wide methylome measurements by TAPS and WGBS. Mean sequencing coverage depth across all mouse CpG islands (binned into 20 windows) and 4 kbp flanking regions (binned into 50 equal-sized windows). To account for differences in sequencing depth, all mapped TAPS reads were downsampled to match the median number of mapped WGBS reads across the genome. FIG. 21B: Comparison of genome-wide methylome measurements by TAPS and WGBS. CpG sites covered by at least three reads by TAPS only, by both TAPS and WGBS, or by WGBS only. FIG. 21C: Comparison of genome-wide methylome measurements by TAPS and WGBS: Number of CpG sites with modification levels >0.1 that were covered by at least three reads and detected by TAPS alone, TAPS and WGBS, or WGBS alone. [Figure 21D] Comparison of genome-wide methylome measurements by TAPS and WGBS. Example of chromosomal distribution of modification levels (%) in TAPS and WGBS. The average percentage of modified CpGs per 100 kb window on mouse chromosome 4 was smoothed with a Gaussian weighted moving average filter with a window size of 10. FIG. 21E: Comparison of genome-wide methylome measurements by TAPS and WGBS. Heatmap showing the number of CpG sites covered by at least three reads in both TAPS and WGBS, categorized by modification level as measured by each method. To improve contrast, the first bin, which contains unmodified CpGs by both methods, is excluded from the color scale and indicated by an asterisk. Figure 22: Modification levels around CpG islands. Average modification levels in CpG islands (binned into 20 windows) and 4 kbp flanking regions (binned into 50 windows of equal size). Bins with coverage of less than 3 reads were ignored. Figure 23: TAPS has less coverage-modification bias than WGBS. All CpG sites were binned according to their coverage, and in each bin, the mean (●) and median (black triangle) modification values ​​are shown for WGBS (A) and TAPS (B). The last bin shows CpG sites covered by more than 100 reads. The lines represent linear fits through the data points. Figure 24. Low-input gDNA and cell-free DNA TAPS preparation using dsDNA and ssDNA library preparation kits. (A) Sequencing libraries were successfully constructed with as little as 1 ng of mouse embryonic stem cell (mESC) genomic DNA (gDNA) using the dsDNA library kit NEBNext Ultra II or KAPA HyperPrep kit. The amount of input DNA was further reduced to (B) 0.01 ng of mESC gDNA or (C) 1 ng of cell-free DNA using the ssDNA library kit Accel-NGS Methyl-Seq kit. Figure 25: TAPS libraries were prepared with low inputs of gDNA and cell-free DNA using the dsDNA KAPA HyperPrep Library Prep Kit. Sequencing libraries were successfully constructed with as little as 1 ng of (A) mESC gDNA and (B) cell-free DNA using the KAPA HyperPrep Kit. The cell-free DNA has a sharp length distribution of around 160 bp (nucleosome size) due to plasma nuclease digestion. After library construction, the DNA is around 300 bp, which is the sharp band in B. Figure 26: High-quality cell-free DNA TAPS. (A) 5mC conversion rate in cfDNA treated with TAPS. (B) False positive rate in cfDNA treated with TAPS. (C) Percentage of all sequenced read pairs that map uniquely to the genome. (D) Percentage of all sequenced read pairs that map uniquely to the genome after removing PCR duplicate reads. CHG and CHH are non-CpG contexts. [Figure 27] TAPS can detect genetic variants. Methylation (MOD, top row) and C→T SNP (bottom row) showed separate base distributions in the original top strand (OT) / original bottom strand (OB) (left column), as well as in the strand complementary to OT (CTOT) and the strand complementary to OB (CTOB) (right column). [Figure 28] Endonuclease cleavage of TAPS conversion products. (A) Digestion of mESC gDNA before and after TAPS conversion with different endonucleases. In TAPS conversion, DHU is introduced in place of methylated cytosine. Endo VIII is endonuclease VIII, Endo IV is endonuclease IV, and Tma Endo III is endonuclease III, Tth Endo IV is endonuclease IV, Nth Endo III is Nth endonuclease III, Endo V is endonuclease V. (B) Representative images of TAPS-treated mESC gDNA before USER digestion, after USER digestion, and after size selection. (C) Scatter plot showing methylation levels at all CpGs measured by both BS-seq and eeTAPS. Figure 29A: Endonuclease enrichment TAPS (eeTAPS). Schematic of eeTAPS (top) and computational measurements of CG methylation levels (bottom). First, 5-methylcytosine (mC) was converted to dihydrouracil (DHU) by TAPS and then enriched through USER digestion. Size-selected DNA fragments were then prepared into sequencing libraries and amplified by PCR. After alignment of the reads, CG methylation levels were calculated as the number of reads cleaved at each CpG site divided by the total number of reads cleaved at each CpG site or covering each CpG site. [Figure 29B] Validation of eeTAPS on a 4 kb model DNA. From top to bottom, the tracks show the methylation levels measured by bisulfite sequencing (BS-seq), eeTAPS, and the eeTAPS control. In the eeTAPS control, DNA was digested with USER enzyme without conversion by TAPS. FIG. 30A is a comparison of wgTAPS, eeTAPS, and rrTAPS with mESC DNA. A diagram showing the genomic fragmentation methods of wgTAPS, eeTAPS, and rrTAPS. In wgTAPS, genomic DNA is randomly fragmented, whereas fragmentation is specific at methylated CpG (mCG) sites in eeTAPS and at CCGG sites in rrTAPS. (B) Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. Bar plots showing the percentage of CpG sites covered by wgTAPS, eeTAPS, and rrTAPS overlaid with distinct chromatin features, as defined in a previous study (20). FIG. 30C: Comparison of wgTAPS, eeTAPS and rrTAPS in mESC DNA. Heatmap showing correlation of methylation levels at 1 CpG resolution by wgTAPS and eeTAPS. Methylation levels were divided into 16 groups in both wgTAPS and eeTAPS. Colors indicate the number of CpGs in a given interval. Only sites with wgTAPS coverage >5 were considered. Pearson's correlation coefficients are shown on top of the plots. FIG. 30D: Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. Venn plot showing overlap of detected mCpG sites in wgTAPS, rrTAPS, and eeTAPS. In both wgTAPS and eeTAPS, CpG sites with methylation levels above the first quartile of methylation levels were defined as methylated CpGs. The same methylation cutoff value was used in rrTAPS as in wgTAPS. (In wgTAPS and rrTAPS, CpG sites with methylation levels above 0.5 were defined as mCpGs, and in eeTAPS, CpG sites with methylation levels above 0.28 were defined as mCpGs.) FIG. 31. (A) Nucleotide frequency at the ends of sequenced fragments. (B) Bar plot showing the distribution of the distance between the cleavage site and the nearest CpG. (C) Heat map showing the correlation of methylation levels at 1 CpG resolution by wgTAPS and rrTAPS. Methylation levels were divided into 16 groups in both wgTAPS and rrTAPS. Colors indicate the number of CpGs in a given interval. Only sites with coverage >5 in wgTAPS and >5 in rrTAPS were considered. Pearson's correlation coefficient is 0.92. (D) Overlap of mCpG sites detected in eeTAPS replicates, where replicates were subsampled to the same depth to detect mCpGs. Figure 32. Methylation in different genomic features profiled with eeTAPS. (A) Methylation levels measured by both eeTAPS (top line) and wgTAPS (bottom line) on chromosome 1 of mESCs. A 100 kb window was used and moving averages were calculated by the movAvg2 function in R with bw=10. (B) Density plot showing correlation of methylation levels in chromosome bins between eeTAPS and wgTAPS. A 100 kb window was used to calculate the average methylation level in each bin. The Pearson correlation coefficient is shown on top of the plot. (C) Average methylation levels over CpG islands (CGIs) and 4 kb flanking regions in eeTAPS and wgTAPS. (D) Density plot showing correlation of methylation levels in CpG islands between eeTAPS and wgTAPS. The Pearson correlation coefficient is shown on top of the plot. (E) Density plot showing the correlation of methylation levels in different chromatin features in eeTAPS and wgTAPS, which were previously defined by histone markers (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol,36,809-819), also shown in (F). Pearson correlation coefficients are shown on top of the plots. (F) Box plots showing the distribution of methylation levels across all chromatin features as measured by eeTAPS (lower bars) and wgTAPS (upper bars). Figure 33: Average methylation distribution around transcription start sites (TSS) in wgTAPS and eeTAPS. Genes were sorted by their expression levels according to the GSE72855 dataset. Figure 34: eeTAPS analysis of low-input samples. (A) Number of mCpGs detected with eeTAPS (among those identified by wgTAPS) at 1ng, 10ng, 50ng, and 200ng mESC gDNA inputs. For 200ng mESCs, reads were downsampled by a factor of two to adapt sequencing depth to the low-input samples. A criterion of methylation level >0.28 was used to assign mCpGs; eeTAPS assigns breaks >1 as mCpGs, and wgTAPS assigns methylation levels >0.5 as mCpGs. The percentages shown above the bars are the percentages of mCpGs detected (mCpGs detected by wgTAPS are defined as true). (B) Heatmap showing methylation distribution measured by eeTAPS across the mouse genome using different input levels. Each chromosome was divided into 100 kb windows, which are represented by rows in the heatmap. Methylation levels were defined as the number of methylated CpG sites divided by the total number of CpG sites covered in each 100 kb window. (C) Density plot showing correlation of methylation among low input samples to the 200 ng input sample. Methylation levels were calculated across the entire mouse genome in 100 kb windows as shown in (B). Pearson's correlation coefficients are shown for each plot. Figure 35: eeTAPS sequencing depth analysis. (A) Number of methylated CpGs detected when reads were sampled at 1-10x sequencing depth. The percentages shown on top are the percentages of mCpGs detected by eeTAPS (mCpGs detected by wgTAPS are defined as true). (B) Correlation of methylation in the whole mouse genome (top line) and CpG islands (CGIs) (bottom line) in a 100kb window when reads were sampled at 1-10x sequencing depth. [Mode for carrying out the invention] The present disclosure provides a method for identifying cytosine modifications in target DNA in a DNA sample containing total genomic DNA at base-by-base resolution without the use of bisulfite. The method described herein includes improvements over the method described in PCT / US2019 / 012627 (hereby incorporated by reference in its entirety), which describes a method including a method for detecting 5mC and 5hmC in a sequence at base-by-base resolution without the use of bisulfite (referred to as TAPS). TAPS consists of mild enzymatic and chemical reactions for directly and quantitatively detecting 5mC and 5hmC at base-by-base resolution without affecting unmodified cytosine. The present disclosure also provides an improved method for detecting 5fC and 5caC at base-by-base resolution without affecting unmodified cytosine. That is, the method provided herein maps 5mC, 5hmC, 5fC, and 5caC, eliminating the problems of previous methods such as bisulfite sequencing.

[0032] [Table 1]

[0033] The method described herein is based on converting modified cytosines (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU), e.g., by Tet-assisted pyridine borane treatment, and then cleaving the DHU sites (e.g., by USER (Uracil-specific Removal Reagent)) to generate DNA fragments, which are then made into a sequencing library. Unfragmented genomic DNA cannot be sequenced directly. Only in the presence of modified cytosines that are converted to DHU can the DNA be cleaved into DNA fragments and then sequenced with each end of the fragment (indicating the position of the modified cytosine). Thus, for example, eeTAPS reduces the cost of whole genome TAPS (WGTAPS) by sequencing only the cleaved fragments due to the conversion of 5mC / 5hmC to DHU. Sequencing the cleaved fragments allows identification of methylated cytosines in the original DNA sample with base-by-base resolution.

[0034] How to identify 5mC or 5hmC (together) In another aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. modifying the DNA, which comprises the steps of: i. converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC; ii. converting the 5caC and / or 5fC to DHU to provide a modified DNA sample comprising the modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of a cleavage site provides a method that results in the location of either 5mC or 5hmC in the target DNA.

[0035] In an embodiment of the method for identifying 5mC or 5hmC in target DNA, the method provides a semi-quantitative measure of the frequency of 5mC or 5hmC modification in each position in target DNA where 5mC or 5hmC modification is found.The method for identifying 5mC or 5hmC provides the position of 5mC and 5hmC, but does not distinguish between these two cytosine modifications.Instead, both 5mC and 5hmC are converted into DHU.

[0036] How to identify 5mC In one aspect, the present disclosure provides a method for identifying 5-methylcytosine (5mC) in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. modifying the DNA, which comprises the steps of: i. adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the DNA sample; ii. converting 5mC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC); iii. converting the 5caC and / or 5fC to DHU to provide a modified DNA sample comprising the modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA, the presence of a cleavage site resulting in the location of a 5mC in the target DNA; The present invention provides a method comprising:

[0037] In an embodiment of the method for identifying 5mC in a target DNA, the method provides a semi-quantitative measure of the frequency of 5mC modifications at each position in the target DNA where 5mC modifications are found.

[0038] To identify 5mC in target DNA without including 5hmC, 5hmC in the sample is blocked to prevent 5hmC from being converted to 5caC and / or 5fC. In the disclosed method, 5hmC in sample DNA is rendered unreactive in the next step by adding a blocking group to 5hmC. In one embodiment, the blocking group is a sugar containing a modified sugar, such as glucose or 6-azido-glucose (6-azido-6-deoxy-D-glucose). The sugar blocking group is added to the hydroxymethyl group of 5hmC by contacting the DNA sample with a uridine diphosphate (UDP)-sugar in the presence of one or more glucosyltransferase enzymes.

[0039] In embodiments, the glucosyltransferase is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof. βGT is an enzyme that catalyzes the chemical reaction that transfers β-D-glucosyl (glucose) residues from UDP-glucose to 5-hydroxymethylcytosine residues in DNA.

[0040] The blocking group is, for example, glucose, which refers to the addition of a glucose moiety (e.g., a β-D-glucosyl residue) to 5hmC to yield glucosyl 5-hydroxymethylcytosine. The sugar blocking group can be any sugar or modified sugar that is a substrate for a glucosyltransferase enzyme and blocks the subsequent conversion of 5hmC to 5caC and / or 5fC. This is followed by a step of converting 5mC in the DNA sample to 5caC and / or 5fC by methods provided herein, such as by oxidation with a TET enzyme. The 5caC and / or 5fC are then converted to DHU by methods provided herein, such as by oxidation with borane.

[0041] How to identify 5mC and how to identify 5hmC The present disclosure provides a method for identifying 5mC and identifying 5hmC in a target DNA by (i) performing a method for identifying 5mC in a first DNA sample described herein, and (ii) performing a method for identifying 5mC or 5hmC in a second DNA sample described herein. (i) provides the position of 5mC. By comparing the results of (i) and (ii), the position of 5hmC in the target DNA is provided by the cleavage site that is present in (i) but not present in (ii). In an embodiment, the first and second DNA samples are derived from the same DNA sample. For example, the first and second samples may be separate aliquots taken from a sample containing the DNA to be analyzed.

[0042] Since 5mC and 5hmC (unblocked) are converted to 5fC and 5caC and then converted to DHU, all 5fC and 5caC present in the DNA sample will be detected as 5mC and / or 5hmC. However, considering that the levels of 5fC and 5caC in genomic DNA are very low under normal conditions, the above events will often be tolerated when analyzing methylation and hydroxymethylation in DNA samples. The signals of 5fC and 5caC can be removed by protecting 5fC and 5caC from being converted to DHU, for example, by binding hydroxylamine for 5fC and coupling EDC for 5caC.

[0043] The above method identifies the position of 5hmC in a target DNA through comparing the position of 5mC with the position of 5mC or 5hmC (combined). Alternatively, the modified position of 5hmC in a target DNA can be directly measured. That is, in one aspect, the present disclosure provides a method for identifying 5hmC in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. modifying the DNA, which comprises the steps of: i. converting 5hmC in the DNA sample to 5caC and / or 5fC ii. converting the 5caC and / or 5fC to DHU to provide a modified DNA sample comprising the modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5hmC in the target DNA.

[0044] In embodiments, the step of converting the 5hmC to 5fC comprises oxidizing the 5hmC to 5fC by contacting the DNA with, for example, potassium perruthenate (KRuO4) (as described in Science. 2012, 33, 934-937 and WO2013017853, which are incorporated herein by reference) or Cu(II) / TEMPO (copper(II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)) (as described in Chem. Commun., 2017, 53, 5756-5759 and WO2017039002, which are incorporated herein by reference). Other oxidizing agents that can be used are potassium ruthenate and / or manganese oxide. The 5fC in the DNA sample is then converted to DHU by methods disclosed herein, for example, by borane reaction.

[0045] How to identify 5caC or 5fC In one aspect, the present disclosure provides a method for identifying 5caC or 5fC in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. converting 5caC and / or 5fC to DHU to provide a modified DNA sample containing modified target DNA; f. cleaving the modified target DNA; g. adding an adaptor DNA molecule to the cleaved modified target DNA; h. detecting the sequence of the modified target DNA; Including, The presence of a cleavage site provides a method that results in the location of either 5caC or 5fC in the target DNA.

[0046] This method of identifying 5fC or 5caC yields the location of 5fC or 5caC, but does not distinguish between these two cytosine modifications. Rather, both 5fC and 5caC are converted to DHU, which is detected by the methods described herein.

[0047] How to identify 5caC In another aspect, the present disclosure provides a method for identifying 5caC in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. adding a blocking group to the 5fC in the DNA sample; c. converting the 5caC to DHU to provide a modified DNA sample containing modified target DNA; g. cleaving the modified target DNA; h. adding an adaptor DNA molecule to the cleaved modified target DNA; i. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5caC in the target DNA.

[0048] In an embodiment of the method for identifying 5caC in a target DNA, the method provides a semi-quantitative measure of the frequency of 5caC modifications at each position in the target DNA where 5caC modifications are found.

[0049] In this method, 5fC is blocked (5mC and 5hmC are not converted to DHU), allowing the identification of 5caC in the target DNA. In an embodiment, the step of adding a blocking group to 5fC in a DNA sample includes contacting the DNA with an aldehyde-reactive compound, including, for example, hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives. Hydroxylamine derivatives include hydroxylamine, hydroxylamine hydrochloride, sulfate of hydroxylammonium acid, hydroxylamine phosphate, O-methylhydroxylamine, O-hexylhydroxylamine, O-pentylhydroxylamine, O-benzylhydroxylamine, and in particular, O-ethylhydroxylamine (EtONH2), O-alkylated hydroxylamine, or O-arylated hydroxylamine, acids or salts thereof. Hydrazine derivatives include N-alkylhydrazine, N-arylhydrazine, N-benzylhydrazine, N,N-dialkylhydrazine, N,N-diarylhydrazine, N,N-dibenzylhydrazine, N,N-alkylbenzylhydrazine, N,N-arylbenzylhydrazine, and N,N-alkylarylhydrazine. Hydrazide derivatives include -toluenesulfonylhydrazide, N-acylhydrazide, N,N-alkylacylhydrazide, N,N-benzylacylhydrazide, N,N-arylacylhydrazide, N-sulfonylhydrazide, N,N-alkylsulfonylhydrazide, N,N-benzylsulfonylhydrazide, and N,N-arylsulfonylhydrazide.

[0050] How to identify 5fC In another aspect, the present disclosure provides a method for identifying 5fC in a DNA sample, comprising: a. providing a DNA sample containing target DNA; b. adding a blocking group to the 5caC in the DNA sample; c. converting the 5fC to DHU to provide a modified DNA sample comprising modified target DNA; d. cleaving the modified target DNA; e. adding an adaptor DNA molecule to the cleaved modified target DNA; f. detecting the sequence of the modified target DNA; Including, The presence of the cleavage site provides a method for obtaining the location of 5fC in the target DNA.

[0051] In an embodiment of the method for identifying 5fC in a target DNA, the method provides a semi-quantitative measure of the frequency of 5fC modifications at each position in the target DNA where 5fC modifications are found.

[0052] The step of adding a blocking group to 5caC in the DNA sample can be carried out by (i) contacting the DNA sample with a coupling agent, e.g., a carboxylic acid derivatizing reagent, such as a carbodiimide derivative, e.g., 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) or N,N'-dicyclohexylcarbodiimide (DCC), and (ii) contacting the DNA sample with an amine, hydrazine, or hydroxylamine compound. That is, for example, the DNA sample can be treated with EDC and then with benzylamine, ethylamine, or other amines to block 5caC, e.g., by forming an amide that blocks 5caC from being converted to DHU by pic-BH3. Methods for coupling 5caC by EDC catalysis are described in WO2014165770, which is incorporated herein by reference.

[0053] DNA sample / target DNA The disclosed methods utilize mild enzymatic and chemical reactions that avoid the extensive degradation associated with methods such as bisulfite sequencing, making the methods useful for analysis of low input samples, such as circulating cell-free DNA, and for single-cell analysis.

[0054] In an embodiment, the DNA sample comprises picogram amounts of DNA. In an embodiment, the DNA sample comprises about 1 pg to about 900 pg of DNA, about 1 pg to about 500 pg of DNA, about 1 pg to about 100 pg of DNA, about 1 pg to about 50 pg of DNA, about 1 to about 10 pg of DNA, less than about 200 pg of DNA, less than about 100 pg of DNA, less than about 50 pg of DNA, less than about 20 pg of DNA, and less than about 5 pg of DNA. In another embodiment, the DNA sample comprises nanogram amounts of DNA. The DNA of the samples used in the methods disclosed herein can be any amount, including DNA from a single cell or a bulk DNA sample. In embodiments, the methods of the invention can be performed with a DNA sample comprising about 1 to about 500 ng DNA, about 1 to about 200 ng DNA, about 1 to about 100 ng DNA, about 1 to about 50 ng DNA, about 1 to about 10 ng DNA, about 2 to about 5 ng DNA, less than about 100 ng DNA, less than about 50 ng DNA, less than 5 ng DNA, and less than 2 ng DNA. In embodiments, the DNA sample comprises microgram amounts of DNA.

[0055] Preparing a DNA sample, as used herein, refers to obtaining a DNA sample from any source, either directly or indirectly. The DNA sample used in the methods described herein may be derived from any source, including, for example, body fluids, tissue samples, organs, organelles, or single cells. In embodiments, the DNA sample is circulating cell-free DNA (cell-free DNA or cfDNA), which is DNA found in blood and not present within cells. cfDNA can be isolated from blood or plasma using methods known in the art. Commercially available kits are available for isolating cfDNA, including, for example, Circulating DNA Kit (Qiagen). The DNA sample may result from an enrichment process, including, but not limited to, antibody immunoprecipitation, chromatin immunoprecipitation, restriction enzyme digestion-based enrichment, hybridization-based enrichment, or chemical labeling-based enrichment.

[0056] The target DNA can be any DNA with cytosine modifications (i.e., 5mC, 5hmC, 5fC, and / or 5caC), including, but not limited to, DNA fragments or genomic DNA purified from tissues, organs, cells, and organelles. The target DNA can be a single DNA molecule in a sample, or the entire population of DNA molecules in a sample (or a subset thereof) with cytosine modifications. The target DNA can be native DNA from a source, or it can be pre-converted into a state that can be subjected to high-throughput sequencing, for example, by fragmentation, repair, and ligation with adaptors for sequencing. That is, the target DNA can include multiple DNA sequences, such that the methods described herein can be used to generate libraries of target DNA sequences that can be analyzed individually (e.g., by determining the sequence of individual targets) or analyzed in populations (e.g., by high-throughput or next-generation sequencing methods).

[0057] The DNA sample containing the target DNA can be obtained from organisms of the kingdoms Monera (bacteria), Protista, Fungi, Plantae and Animalia. The DNA sample may be obtained from a patient or subject, an environmental sample, or an organism of interest. In embodiments, the DNA sample is extracted, purified or removed from a cell, a group of cells, a body fluid, a tissue sample, an organ and / or an organelle. In a preferred embodiment, the sample DNA is total genomic DNA.

[0058] Conversion of 5mC and 5hmC to 5caC and / or 5fC Embodiments of the methods provided herein, such as the eeTAPS method described herein, include a step of converting 5mC and 5hmC (or only 5mC, in cases where 5hmC is blocked) to 5caC and / or 5fC. In embodiments, this step includes contacting the DNA sample with a ten-eleven translocation (TET) enzyme. TET enzymes are a family of enzymes that catalyze the transfer of an oxygen molecule to the N5 methyl group of 5mC, which results in the formation of 5-hydroxymethylcytosine (5hmC). TET further catalyzes the oxidation of 5hmC to 5fC and the oxidation of 5fC to form 5caC (see FIG. 5A). TET enzymes useful in the methods described herein include one or more of human TET1, human TET2, human TET3, mouse Tet1, mouse Tet2, mouse Tet3, Naegleria TET (NgTET), Coprinopsis cinerea (CcTET), and derivatives or analogs thereof. In an embodiment, the TET enzyme is NgTET or a derivative thereof. In another embodiment, the TET enzyme is human TET1 (hTET1) or a derivative thereof. In an embodiment, the TET enzyme is mouse Tet1 or a derivative thereof (mTet1CD). In another embodiment, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0059] Conversion of 5caC and / or 5fC to DHU The methods described herein include a step of converting 5caC and / or 5fC in a DNA sample to DHU. In embodiments, this step includes contacting the DNA sample with a reducing agent, including, for example, a borane reducing agent, such as pyridine borane, 2-picoline borane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In a preferred embodiment, the reducing agent is pyridine borane and / or pic-BH3.

[0060] Cleavage of the modified target DNA The methods described herein include cleaving modified target DNA containing DHU at positions where modified cytosines (5mC, 5hmC, 5fC and / or 5caC) were present in the DNA sample prior to the conversion step(s) (i.e., prior to one or more steps to convert the modified cytosines to DHU). The cleavage steps described herein specifically cleave modified target DNA containing DHU, while leaving DNA that does not contain DHU uncleaved or substantially uncleaved.

[0061] The step of cleaving the modified target DNA containing DHU can be carried out by contacting the modified target DNA containing DHU with one or more DNA endonucleases that specifically cleave the modified target DNA. In an embodiment, one or more of the DNA endonucleases is a bifunctional DNA endonuclease having DNA N-glycosylase activity and AP lyase activity, such as Tma endonuclease III, endonuclease VIII, formamidopyrimidine DNA glycosylase (Fpg) and / or hNEIL1. In an embodiment, the modified target DNA containing DHU is cleaved by a uracil specific removal reagent (USER). The USER enzyme comprises a combination of uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII. Other enzymes that can be used to cleave the modified target DNA are one or more of apurinic / apyrimidinic endonuclease 1 (APE1), endonuclease III (Endo III), Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg, and hNEIL1.

[0062] In embodiments, the step of cleaving the modified target DNA containing DHU comprises exposing the modified target DNA to acidic pH and / or heat conditions as described in House CH, Miller SL Hydrolysis of dihydrouridine and related compounds. Biochemistry. 1996;35(1):315-320. In embodiments, the cleavage step comprises exposing the modified target DNA to a temperature of at least 70° C., 75° C., 80° C., 85° C., 90° C., 95° C., 100° C., 105° C. or 110° C., and / or a pH of 7 or more, 7.5 or more, 8 or more, 8.5 or more, 9 or more, 9.5 or more, 10 or more, 10.5 or more, 11 or more, 11.5 or more, 12 or more, 12.5 or more or 13 or more.

[0063] Addition of an adaptor DNA molecule to the cleaved modified target DNA In an embodiment, the method described herein includes adding an adaptor DNA molecule to the modified target DNA cleaved, for example, by the USER enzyme. Adaptor DNA or DNA linker is a short, chemically synthesized, single-stranded or double-stranded oligonucleotide that can be ligated to one or both ends of another DNA molecule. Double-stranded adaptors can be synthesized such that each end of the adaptor has a blunt end or a 5' or 3' overhang (i.e., sticky end). The DNA adaptor is ligated to the cleaved modified target DNA to provide sequences for PCR amplification with complementary primers and / or for cloning and / or library generation (e.g., next-generation sequencing libraries).

[0064] Before ligating the adaptor to the cleaved target DNA, the ends of the cleaved DNA can be prepared for ligation, for example, by end repair to create blunt ends with 5' phosphate groups. The blunt ends can be used for ligation to the adaptor, or overhangs can be created before ligation, for example, by tailing reaction. Tailing is an enzymatic method of adding non-template nucleotides to the 3' end of blunt double-stranded DNA molecules. A tailing of the 3' end (i.e., adding dA to the 3' end) can be used to facilitate ligation of the adaptor to complementary dT overhangs.

[0065] In an embodiment, the size selection of the cleaved modified target DNA is performed either before or after the step of adding a DNA adaptor molecule to the cleaved modified target DNA. In an embodiment, the size selection is performed after adding a DNA adaptor to the cleaved target DNA. Size selection can be performed by methods known in the art, including but not limited to using solid phase reverse immobilization (SPRI) paramagnetic beads (e.g., using AMPure XP beads).

[0066] Amplification of the copy number of modified target DNA The methods described herein may optionally include amplifying (increasing) the copy number of the modified target DNA by methods known in the art. When the modified target DNA is DNA, its copy number can be increased, for example, by PCR, cloning and primer extension methods. The copy number of each target DNA can be amplified by PCR using primers specific to a particular target DNA sequence. Alternatively, multiple different modified target DNA sequences can be amplified by cloning into a DNA vector by standard techniques. In embodiments, the copy number of multiple different modified target DNA sequences is increased by PCR to create a library for next generation sequencing, for example, by ligating a double-stranded adapter DNA to the sample DNA (or modified sample DNA) in advance, and performing PCR using a primer complementary to the adapter DNA.

[0067] Next-generation sequencing library preparation Once the adaptor DNA molecules have been added to the cleaved modified target DNA, the number of copies of the modified target DNA can be amplified (e.g., by PCR) to generate library DNA sequences for next generation sequencing. Primers for PCR have sequences that correspond to (are complementary to) the adaptor DNA previously ligated to the cleaved target DNA. The methods provided herein (including reagents, steps, and their order) allow for the generation of libraries of DNA sequences that can be sequenced using high-throughput next generation sequencing methods.

[0068] Detection of cleavage sites in modified target DNA In an embodiment of the method disclosed herein, the method includes detecting the sequence of the cleaved modified target DNA. The modified target DNA contains DHU at the position where one or more of 5mC, 5hmC, 5fC, and 5caC were present in the unmodified target DNA. The modified target DNA containing DHU is cleaved by the method described herein, including digestion with a DHU-sensitive endonuclease. The cleaved fragments can then be converted into a sequencing library, with the start and end of each fragment corresponding to the site of a modified cytosine (5mC, 5hmC, 5fC, or 5caC). This allows genome-wide enrichment of methylated CpG sites while removing the majority of the genome that is unmethylated. Thus, the cytosine modification can be detected by any method known in the art that identifies the cleavage site. Such methods include sequencing methods such as Sanger sequencing, microarrays, and next-generation sequencing.

[0069] kit Additionally, the present disclosure provides kits for identifying 5mC and 5hmC in target DNA. Such kits include reagents for identifying 5mC and 5hmC by the methods described herein. The kits may also include reagents for identifying 5caC and reagents for identifying 5fC by the methods described herein. In embodiments, the kits include a TET enzyme, a borane reducing agent, and instructions for carrying out the methods of the invention. In further embodiments, the TET enzyme is TET1 or TET2 (or a derivative thereof), and the borane reducing agent is selected from one or more of the group consisting of pyridine borane, 2-picoline borane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In further embodiments, the TET1 enzyme is NgTet1, human TET1, or mouse Tet1, and the borane reducing agent is pyridine borane and / or pic-BH3. In another embodiment, the TET enzyme is mTET2 or a derivative thereof.

[0070] In embodiments, the kit further comprises a 5hmC blocking group and a glucosyltransferase enzyme. In further embodiments, the 5hmC blocking group is a uridine diphosphate (UDP)-sugar, the sugar is glucose or a glucose derivative, and the glucosyltransferase enzyme is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof.

[0071] In embodiments, the kit further comprises an oxidizing agent selected from one or more of potassium perruthenate (KRuO4), Cu(II) / TEMPO (copper(II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)), potassium ruthenate, and manganese oxide.

[0072] In an embodiment, the kit includes a reagent for blocking 5fC in a DNA sample. In an embodiment, the kit includes aldehyde-reactive compounds, including, for example, hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives, as described herein. In an embodiment, the kit includes a reagent for blocking 5caC, as described herein.

[0073] In an embodiment, the kit comprises the reagent for isolating DNA.In an embodiment, the kit comprises the reagent for isolating low-input DNA from sample, for example, for isolating cfDNA from blood, plasma or serum.In an embodiment, the kit comprises the reagent for isolating genomic DNA.

[0074] In an embodiment, the kit comprises one or more enzymes for cleaving the modified target DNA containing DHU, as described herein. In an embodiment, the kit comprises an adaptor DNA molecule, as described herein. In addition, the kit may comprise an enzyme for ligating the adaptor DNA molecule to the cleaved modified target DNA. [Example] Example 1: TAPS and WGTAPS method Preparation of model DNA DNA oligos for MALDI and HPLC-MS / MS tests: DNA oligonucleotides ("oligos") with C, 5mC and 5hmC were purchased from Integrated DNA Technologies (IDT). All sequences and modifications could be seen in Figure 6-1 and Figure 6-2 and Figure 7-1 and Figure 7-2. DNA oligos with 5fC were synthesized by the C-tailing method; that is, DNA oligos 5'-GTCGACCGGATC-3' and 5'-TTGGATCCGGTCGACTT-3' were annealed and then incubated with 5-formyl-2'-dCTP (Trilink Biotech) and Klenow fragment (3'→5' exonuclease activity-deficient mutant) (New England Biolabs) in NEBuffer2 for 2 hours at 37°C. The products were purified with Bio-Spin P-6 Gel Columns (Bio-Rad).

[0075] DNA oligos bearing 5caC were synthesized using standard phosphoramidites (Sigma) and 5-carboxy-dC-CE phosphoramidite (Glen Research) using an Expedite 8900 DNA Synthesis System. Subsequent deprotection and purification were performed using Glen-Pak Cartridges (Glen Research) according to the manufacturer's instructions. Purified oligonucleotides were characterized by MALDI-TOF (Matrix Assisted Laser Desorption Ionization Time of Flight) Biospectrometry Workstation.

[0076] 222-bp model DNA for conversion test: To prepare a 222-bp model DNA containing five CpG sites, bacteriophage λ DNA (Thermo Fisher) was PCR amplified using Taq DNA polymerase (New England Biolabs) and purified with AMPure XP beads (Beckman Coulter). The primer sequences were 5'-CCTGATGAAACAAGCATGTC-3' for the forward primer and 5'-CAUTACTCACUTCCCCACUT-3' for the reverse primer. The uracil bases in the reverse strand of the PCR product were amplified using USER enzyme (New England Biolabs). The PCR products were then removed using AMPure XP beads. 100 ng of the purified PCR products were then methylated in 20 μl of 1×NEBuffer2, 0.64 mM S-adenosylmethionine, and 20 U of M.SssI CpG methyltransferase (New England Biolabs) for 2 h at 37°C, followed by heat inactivation for 20 min at 65°C. The methylated 222 bp model DNA was purified using AMPure XP beads.

[0077] Model DNA for validation of TAPS, TAPSβ, and CAPS by Sanger sequencing: A 34 bp DNA oligo containing one 5mC site and one 5hmC site was annealed with other DNA oligos in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl, then ligated in a reaction containing 400 U of T4 ligase (NEB) at 25°C for 1 h and purified with 1.8× AMPure XP beads.

[0078] [Table 2]

[0079] After the ligation reaction, the uracil linker is removed by the USER enzyme. AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCGA m CGCATGATCTGTACTTGATCGAC hm The final product had the sequence CGTGCAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG (5'→3'). The PCR primers for amplifying this model DNA were 5'-AATGATACGGCGACCACCGAG-3' for the P5 primer and 5'-CAAGCAGAAGACGGCATACGAG-3' for the P7 primer.

[0080] Model DNA for polymerase test and Sanger sequencing: Model DNA for polymerase test and Sanger sequencing was prepared by the same ligation method as above, except that different DNA oligos were used.

[0081] [Table 3]

[0082] The sequence of the final product (5'→3') is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCT m CGATCAGCTG m CTACTGTA m CGTAGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG The PCR primers for amplifying the model DNA were the P5 and P7 primers shown above. The biotin-labeled primer sequence for primer extension was biotin linked to the 5' end of the P7 primer. The PCR primers for RT-PCR after transcription with T7 RNA polymerase were the P5 primer and the RT primer 5'-TGCTAGAGGCAGAGAGAGCAAG-3'.

[0083] Model DNA for PCR bias test: Model DNA for PCR bias test was prepared by the same ligation method as above, except that different DNA oligos were used.

[0084] [Table 4]

[0085] The sequence of the final product (5'→3') is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCTXGATCAGCTGCTACTGTACGT AGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG In this sequence, X is DHU, U, T or C. The PCR primers for amplifying this model DNA are the above-mentioned P5 primer and P7 primer.

[0086] Preparation of methylated bacteriophage λ genomic DNA Mg 2+1 μg of unmethylated bacteriophage λ DNA (Promega) was methylated for 2 h at 37° C. in a 50 μL reaction containing 0.64 mM SAM and 0.8 U / μl M.SssI enzyme in free buffer (10 mM Tris-Cl (pH 8.0), 50 mM NaCl, and 10 mM EDTA). Subsequently, 0.5 μL M.SssI enzyme and 1 μL SAM were added and the reaction was incubated for another 2 h at 37° C. The methylated DNA was then purified with 1× AMPure XP beads. To confirm complete methylation, the entire procedure was repeated in NEB Buffer 2. Subsequently, DNA methylation was verified with an HpaII digestion assay. 50 ng of methylated and unmethylated DNA were digested for 1 h at 37° C. in a 10 μL reaction containing 2 U HpaII enzyme (NEB) in CutSmart buffer (NEB). The digestion products were run on a 1% agarose gel along with an undigested λDNA control. After the assay, the unmethylated λDNA was digested, whereas the methylated λDNA remained intact, confirming complete and successful CpG methylation. The sequence of λDNA can be found in GenBank-EMBL Accession No. J02459.

[0087] Preparation of 2 kb unmodified spike-in control The 2 kb spike-in controls (2 kb-1, 2, 3) were PCR amplified from the pNIC28-Bsa4 plasmid (Addgene, catalog no. 26103) in a reaction containing 1 ng of DNA template, 0.5 μM primers, and 1 U of Phusion High-Fidelity DNA Polymerase (Thermo Fisher). PCR primer sequences are listed in Table 2.

[0088] [Table 5]

[0089] The PCR product was purified using a Zymo-Spin column. The 2 kb unmodified control sequence (5'→3') was as follows: Preparation of 120mer spike-in control A 120-mer spike-in control was generated by primer extension method. The oligo sequences and primers are listed in Table 3.

[0090] [Table 6]

[0091] Briefly, for the 120mer-1 spike-in, 3 μM oligos were annealed with 10 μM primers in annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. For the 120mer-2 spike-in, 5 μM oligos were annealed with 7.5 μM primers. Primer extension was performed for 1 h at 37°C in NEB buffer 2 containing 0.4 μM dNTPs (120mer-1: dATP / dGTP / dTTP / dhmCTP, 120mer-2: dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (New England Biolabs). After reaction, the spike-in controls were purified on Zymo-Spin columns (Zymo Research). The 120mer spike-in control was then methylated for 2 h at 37°C in a 50 μL reaction containing 0.64 mM SAM and 0.8 U / μl M.SssI enzyme in NEB buffer 2 and purified by Zymo-Spin column. All spike-in sequences used can be downloaded from https: / / figshare.com / s / 80c3ab713c261262494b.

[0092] Generating synthetic spike-ins with N5mCNN and N5hmCNN Synthetic oligos with the sequences of N5mCNN and N5hmCNN were generated by the annealing and extension method. The oligo sequences are listed in Table 4 below.

[0093] [Table 7]

[0094] Briefly, 10 μM N5mCNN and N5hmCNN oligos (IDT) were annealed together in annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. Extension was carried out for 1 h at 37 °C in NEB buffer 2 containing 0.4 mM dNTPs (dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (NEB). After reaction, the spike-in controls were purified on Zymo-Spin columns (Zymo Research).

[0095] Synthetic spike-in (5'→3') with N5mCNN and N5hmCNN: GAAGATGCAGAAGACAGGAAGGATGAAACACTCAGGCGCACGCTGGCATNmCNNGACAAACCACAAGAACAGGCTAGTGAGAATGAAGGGATATGTTTGTAAGATGGTCNNGNATCTTGGGTTGTGTGGTGGATGTTGGCGTTGGTGGGTTTCAGAGTTGG Complementary strand (5'→3'): CCAACTCTGAAACCCACCAACGCCAACATCCACCACACAACCCAAGATNhmCNNGACCATCTTACAAACATATCCCTTCATTCTCACTAGCCTGTTCTTGTGGTTTGTCNNGNATGCCAGCGTGCGCCTGAGTGTTTCATCCTTCCTGTCTTCTGCATCTTC DNA digestion and HPLC-MS / MS analysis DNA samples were digested with 2 U of Nuclease P1 (Sigma-Aldrich) and 10 nM of the deaminase inhibitor erythro-9-amino-β-hexyl-α-methyl-9H-purine-9-ethanol hydrochloride (Sigma-Aldrich). After overnight incubation at 37°C, the samples were further treated with 6 U of alkaline phosphatase (Sigma-Aldrich) and 0.5 U of phosphodiesterase I (Sigma-Aldrich) for 3 h at 37°C. The digested DNA solution was filtered through an Amicon Ultra-0.5 mL 10K centrifugal filter (Merck Millipore) to remove proteins and subjected to HPLC-MS / MS analysis.

[0096] HPLC-MS / MS analysis was performed on a 1290 Infinity LC System (Agilent) coupled to a 6495B Triple Quadrupole Mass Spectrometer (Agilent). A ZORBAX Eclipse Plus C18 column (2.1×150 mm, 1.8 micrometer, Agilent) was used. The column temperature was kept at 40° C., the solvent system was water containing 10 mM ammonium acetate (pH 6.0, solvent A) and water-acetonitrile (60 / 40 (v / v), solvent B), and the flow rate was 0.4 mL / min. The gradient was 0-5 min with 0% solvent B, 5-8 min with 0 → 5.63% solvent B, 8-9 min with 5.63% solvent B, 9-16 min with 5.63 → 13.66% solvent B, 16-17 min with 13.66 → 100% solvent B, 17-21 min with 100% solvent B, 21-24.3 min with 100 → 0% solvent B, and 24.3-25 min with 0% solvent B. For quantification, dynamic multiple reaction monitoring mode (dMRM) of the MS was used. The source-dependent parameters were gas temperature 230 °C, gas flux 14 L / min, nebulizer 40 psi, sheath gas temperature 400 °C, sheath gas flux 11 L / min, capillary voltage in positive ion mode 1500 V, nozzle voltage 0 V, high pressure RF 110 V and low pressure RF 80 V (all in positive ion mode). The fragmentor voltage was 380 V for all compounds and other compound-dependent parameters were as summarized in Table 5.

[0097] [Table 8]

[0098] Expression and purification of NgTET1 The pRSET-A plasmid encoding His-tagged NgTET1 protein (GG739552.1) was designed and purchased from Invitrogen. The protein was expressed in E. coli BL21(DE3) strain and purified as previously described with some modifications (JE Pais et al., Biochemical characterization of a Naegleria TET-like oxygenase and its application in single molecule sequencing of 5-methylcytosine. Proc. Natl. Acad. Sci. USA 112, 4316-4321 (2015). Incorporated herein by reference). Briefly, overnight small scale cultures of bacteria were grown in LB medium at 37°C and 200 rpm until OD600 reached 0.7-0.8 for protein expression. The cultures were then cooled to room temperature and expression of the target protein was induced with 0.2 mM isopropyl-β-d-1-thiogalactopyranoside (IPTG). The cells were maintained for an additional 18 hours at 18°C ​​and 180 rpm. The cells were then harvested and resuspended in a buffer containing 20 mM HEPES (pH 7.5), 500 mM NaCl, 1 mM DTT, 20 mM imidazole, 1 μg / mL leupeptin, 1 μg / mL pepstatin A, and 1 mM PMSF. The cells were disrupted with an EmulsiFlex-C5 high-pressure homogenizer and the lysate was clarified by centrifugation for 1 hour at 30,000×g and 4°C. The collected supernatant was loaded onto Ni-NTA resin, and NgTET1 protein was eluted with a buffer containing 20 mM HEPES (pH 7.5), 500 mM imidazole, 2 M NaCl, and 1 mM DTT. The collected fraction was then purified with HiLoad 16 / 60 Sdx 75 (20 mM HEPES (pH 7.5), 2 M NaCl, and 1 mM DTT). The fraction containing NgTET1 was then collected, buffer exchanged into a buffer containing 20 mM HEPES (pH 7.0), 10 mM NaCl, and 1 mM DTT, and loaded onto a HiTrap HP SP column.The pure protein was eluted with a salt gradient, collected, and buffer exchanged into a final buffer containing 20 mM Tris-Cl (pH 8.0), 150 mM NaCl, and 1 mM DTT. The protein was then concentrated to 130 μM, mixed with glycerol (30% (v / v)), and aliquots were stored at -80°C.

[0099] Expression and purification of mTET1CD The mTET1CD catalytic domain with an N-terminal Flag tag (NM_001253857.2, 4371–6392) was cloned into pcDNA3-Flag, between the KpnI and BamH1 restriction sites. For protein expression, 1 mg of plasmid was added to 1 L of Expi293F (Gibco) cell culture at 1 × 10 6Cells were transfected at a density of 10000 cells / mL and grown for 48 hours at 37°C, 170 rpm and 5% CO2. Cells were then harvested by centrifugation, resuspended in lysis buffer containing 50 mM Tris-Cl (pH=7.5), 500 mM NaCl, 1x cOmplete Protease Inhibitor Cocktail (Sigma), 1 mM PMSF, 1% Triton X-100 and incubated on ice for 20 minutes. Cell lysates were then clarified by centrifugation for 30 minutes at 30000xg and 4°C. The collected supernatant was purified with ANTI-FLAG M2 Affinity Gel (Sigma) and the pure protein was eluted with a buffer containing 20 mM HEPES (pH = 8.0), 150 mM NaCl, 0.1 mg / mL 3x Flag peptide (Sigma), 1x cOmplete Protease Inhibitor Cocktail (Sigma), and 1 mM PMSF. The collected fractions were concentrated and buffer exchanged into a final buffer containing 20 mM HEPES (pH = 8.0), 150 mM NaCl, and 1 mM DTT. The concentrated protein was mixed with glycerol (30% (v / v)), frozen in liquid nitrogen, and aliquots were stored at -80 °C. The activity and quality of the recombinant mTET1CD were examined by MALDI mass spectrometry analysis. Based on this assay, the recombinant mTET1CD was fully active and capable of catalyzing the oxidation of 5mC to 5caC. Some significant digestion of the model oligos tested was detected by MALDI, confirming that the protein was nuclease-free.

[0100] Oxidation by TET Oxidation by NgTET1: To oxidize the 222 bp model DNA oligo with Tet, 100 ng of 222 bp DNA was incubated for 1 h at 37° C. in 20 μl of a solution containing 50 mM MOPS buffer (pH 6.9), 100 mM ammonium iron(II) sulfate, 1 mM a-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol (DTT), 50 mM NaCl, and 5 μM NgTET. Then, 0.4 U of proteinase K (New England Biolabs) was added to the reaction mixture and incubated for 30 min at 37° C. The product was purified by Zymo-Spin column (Zymo Research) according to the manufacturer's instructions.

[0101] To oxidize genomic DNA with NgTET1, 500 ng of genomic DNA was incubated for 1 h at 37° C. in 50 μl of a solution containing 50 mM MOPS buffer (pH 6.9), 100 mM ammonium iron(II) sulfate, 1 mM a-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 50 mM NaCl, and 5 μM NgTET1. Then, 4 U of proteinase K (New England Biolabs) was added to the reaction mixture and incubated for 30 min at 37° C. The product was purified with 1.8× Ampure beads according to the manufacturer's instructions.

[0102] Oxidation by mTET1: 100 ng of genomic DNA was incubated for 80 min at 37°C in a 50 μl reaction solution containing 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron(II) sulfate, 1 mM a-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTET1CD. 0.8 U of proteinase K (New England Biolabs) was then added to the reaction mixture and incubated for 1 h at 50°C. The product was purified with a Bio-Spin P-30 Gel Column (Bio-Rad) and 1.8× AMPure XP beads according to the manufacturer's instructions.

[0103] Reduction with borane Reduction with Pic-BH3: 25 μL of 5 M α-picoline-borane in MeOH (pic-BH3, Sigma-Aldrich) and 5 μL of 3 M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 20 μL of DNA sample and incubated for 1 h at 60° C. The products were purified by Zymo-Spin columns (Zymo Research) for 222 bp according to the manufacturer's instructions or Micro Bio-Spin 6 Columns (Bio-Rad) for oligos according to the manufacturer's instructions.

[0104] Alternatively, 100 mg of 2-picoline-borane (pic-borane, Sigma-Aldrich) was dissolved in 187 μL of DMSO to obtain a solution of approximately 3.26 M. For each reaction, 25 μL of pic-borane solution and 3 M sodium acetate solution (pH 5.2, Thermo Scientific) were added. Five microliters of 100-fold diluted 100-fold dilution (Fisher) was added to 20 μL of DNA sample and incubated for 3 h at 70° C. The products were purified by Zymo-Spin columns for genomic DNA and Micro Bio-Spin 6 Columns (Bio-Rad) for DNA oligos according to the manufacturer's instructions.

[0105] Reduction with pyridine borane: 50-100 ng of oxidized DNA in 35 μL of water was reduced in a 50 μL reaction solution containing 600 mM sodium acetate solution (pH=4.3) and 1 M pyridine borane at 37°C and 850 rpm in an Eppendorf ThermoMixer for 16 h. The product was purified by Zymo-Spin column.

[0106] Pic-borane reaction of single nucleosides: 500 μL of 3.26 M 2-picoline-borane (pic-borane, Sigma-Aldrich) in MeOH and 500 μL of 3 M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 10 mg of 2'-deoxycytidine-5-carboxylic acid sodium salt (Berry & Associates). The mixture was stirred for 1 h at 60°C. The product was purified by HPLC to give the pure compound as a white foam. High resolution MS (Q-TOF) m / z [M + Na]+ CH 14 Calculated for N2O5Na: 253.0800; Found: 253.0789. Blocking 5hmC Blocking of 5hmC was performed in 20 μl of a solution containing 50 mM HEPES buffer (pH 8), 25 mM MgCl2, 200 μM uridine diphosphate glucose (UDP-Glc, New England Biolabs), 10 U βGT (Thermo Fisher) and 10 μM 5hmC DNA oligo for 1 h at 37° C. The product was purified by Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions.

[0107] Block of 5fC Blocking of 5fC was performed for 2 hours at 37°C in 100 mM MES buffer (pH 5.0), 10 mM O-ethylhydroxylamine (Sigma-Aldrich) and 10 μM 5fC DNA oligo. The product was purified using a Micro Bio-Spin 6 The product was purified using Columns (Bio-Rad) according to the manufacturer's instructions.

[0108] 5caC block Blocking of 5caC was performed for 0.5 h at 37°C in 75 mM MES buffer (pH 5.0), 20 mM N-hydroxysuccinimide (NHS, Sigma-Aldrich), 20 mM 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC, Fluorochem), and 10 μM 5caC DNA oligo. The buffer was then exchanged into 100 mM sodium phosphate (pH 7.5), 150 mM NaCl using Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions. 10 mM ethylamine (Sigma-Aldrich) was added to the oligo and incubated for 1 h at 37°C. The product was purified by Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions.

[0109] Oxidation of 5hmC 46 μL of 5hmC DNA oligo was denatured with 2.5 μL of 1M NaOH for 30 min at 37°C in a shaking incubator and then oxidized with 1.5 μL of a solution containing 50 mM NaOH and 15 mM potassium perruthenate (KRuO4, Sigma-Aldrich) for 1 h on ice. The product was purified by Micro Bio-Spin 6 Columns according to the manufacturer's instructions.

[0110] Verification of TAPS conversion by TaqαI assay We tested the conversion of 5mC after TAPS by PCR amplification of the target region containing a TaqαI restriction site (TCGA) followed by TaqαI digestion. For example, the conversion of 5mC in our TAPS library can be tested based on a 194 bp amplicon containing a single TaqαI restriction site amplified from a CpG-methylated λ DNA spike-in control. The PCR product amplified from the 194 bp amplicon is digested with TaqαI restriction enzyme and the digestion products are examined on a 2% agarose gel. The PCR product amplified with unconverted control DNA is digested with TaqαI and shows two bands on the gel. In the TAPS-converted sample, the restriction site is lost due to the C to T conversion, so the 194 bp amplicon remains intact. The overall conversion level can be assessed based on quantification of digested and undigested gel bands and should be greater than 95% in a successful TAPS sample.

[0111] Briefly, the corresponding primers were used to prepare the PCR products using Taq DNA polymerase (New The converted DNA samples were PCR amplified by PCR using a PCR kit (New England Biolabs) and the PCR products were incubated with 4 units of TaqαI restriction enzyme (New England Biolabs) in 1× CutSmart buffer (New England Biolabs) for 30 min at 65° C. and examined by 2% agarose gel electrophoresis.

[0112] Quantitative polymerase chain reaction (qPCR) To compare the amplification and melting curves between the model DNA before and after TAPS (Figure 11), 1 ng of DNA sample was added to 19 μL of PCR master mix containing 1× LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics Corporation), 250 nM primers (forward primer: CCTGATGAAACAAGCATGTC and reverse primer: CATTACTCACTTCCCCACTT), and 3 mM MgSO4. For PCR amplification, an initial denaturation step was performed for 10 min at 95°C, followed by 40 cycles of 5 min denaturation at 95°C, 5 min annealing at a customized annealing temperature, and 5 min extension at 72°C. The final step included 1 min at 95°C and 1 min at 70°C, and the melting curves (in 0.02°C increments, with a 5 min pause before each acquisition) were from 65°C to 95°C.

[0113] For other assays, qPCR was performed using 1x Fast SYBR Green Master PCR amplification was performed by adding the required amount of DNA sample to 19 μL of PCR master mix containing the PCR Master Mix (Thermo Fisher Scientific), 200 nM forward and reverse primers, and 200 nM of the PCR primers. For PCR amplification, an initial denaturation step was performed at 95°C for 20 s, followed by 40 cycles of denaturation at 95°C for 3 s, annealing for 20 s, and extension at 60°C.

[0114] HpaII-qPCR assay of C in mESC gDNA m Verification of CGG methylation levels One μg of mESC gDNA was incubated with 50 units of HpaII (NEB, 50 units / μL) and 1× CutSmart buffer in a 50 μL reaction for 16 hours at 37° C. No HpaII was added to the control reaction. One μL of proteinase K was added to the reaction and incubated at 40° C. for 30 minutes, after which the proteinase K was inactivated at 95° C. for 10 minutes. Ct values ​​of HpaII-digested or control samples were measured by qPCR assay as described above using the corresponding primer sets (listed in Table 9) for specific CCGG positions.

[0115] Sanger sequencing Exonuclease I and shrimp alkaline phosphatase (New England PCR products were purified by PCR amplification using PCR products from Biolabs) or Zymo-Spin columns and processed for Sanger sequencing.

[0116] DNA damage assay for fragments of different lengths mESC genomic DNA was spiked with 0.5% CpG methylated λ DNA, either left unfragmented or sonicated in a Covaris M220 instrument, and size-selected with AMPure XP beads at 500–1 kb or 1–3 kb. 200 ng of DNA was oxidized once with mTET1CD and reduced with pyridine borane complex as above, or converted using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer's protocol. 10 ng of DNA before and after TAPS and bisulfite conversion was run on a 1% agarose gel. For visualization, the bisulfite-converted gel was chilled in an ice bath for 10 min. Conversion of 5mC in TAPS samples was tested by TaqαI digestion assay as described above.

[0117] Culture of mESCs and isolation of genomic DNA Mouse ESCs (mESCs) E14 were cultured in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 15% FBS (Gibco), 2 mM L-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1000 units / mL LIF (Millipore), 1 μM PD0325901 (Stemgent) and 3 μM CHIR99021 (Stemgent) on gelatin-coated plates. Cultures were maintained at 37°C and 5% CO2 and passaged every 2 days.

[0118] For isolation of genomic DNA, cells were harvested by centrifugation for 5 min at 1000×g and room temperature. DNA was extracted using the Quick-DNA Plus Kit (Zymo Research) according to the manufacturer's protocol.

[0119] Preparation of mESC gDNA for TAPS and WGBS For whole genome bisulfite sequencing (WGBS), mESC gDNA was spiked with 0.5% unmethylated λ DNA. For whole genome TAPS, mESC gDNA was spiked with 0.5% methylated lambda DNA and 0.025% 2 kb unmodified spike-in control. DNA samples were sheared using a Covaris M220 instrument and size-selected at 200-400 bp with AMPure XP beads. In addition, 0.25% N5mCNN and N5hmCNN control oligos were spiked into the TAPS DNA after size selection with AMPure XP beads.

[0120] Whole-genome bisulfite sequencing For whole genome bisulfite sequencing (WGBS), 200 ng of fragmented mESC gDNA spiked with 0.5% unmethylated bacteriophage λ DNA was used. End repair and A-tailing reactions, as well as ligation of methylated adapters (NextFlex) were performed using the KAPA HyperPrep Kit (Kapa Biosystems) according to the manufacturer's protocol. The DNA was then bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) according to the Illumina protocol. The final library was amplified for six cycles using Uracil Plus Polymerase (Kapa Biosystems) and purified with 1x Ampure beads. WGBS sequencing libraries were subjected to 80 bp paired-end sequencing on a NextSeq500 sequencer (Illumina) using the NextSeq High Output Kit with a 15% PhiX control library spike-in.

[0121] Whole-genome TAPS For whole genome TAPS, 100 ng of fragmented mESC gDNA spiked in with 0.5% methylated lambda DNA and 0.025% 2 kb unmodified spike-in control was used. End repair and A-tailing reactions, as well as ligation of Illumina Multiplexing adapters, were performed using the KAPA HyperPrep kit according to the manufacturer's protocol. The ligated DNA was oxidized twice with mTET1CD and reduced with pyridine borane according to the protocol above. The final sequencing library was amplified for 5 cycles using KAPA Hifi Uracil Plus Polymerase and purified with 1x Ampure beads. 80 bp paired-end sequencing was performed on the whole genome TAPS sequencing library with 1% PhiX control library spike-in using one NextSeq High Output kit on a NextSeq500 sequencer (Illumina).

[0122] Low-input whole-genome TAPS using a dsDNA library preparation kit mESC gDNA prepared for whole-genome TAPS as described above was used for low-input whole-genome TAPS. Briefly, samples containing 100 ng, 10 ng, and 1 ng of mESC gDNA were oxidized using one round of NgTET1 according to the protocol above. End-repair and A-tailing reactions, as well as ligation, were performed using the NEBNext Ultra II (New England Biolabs) or KAPA HyperPrep kit according to the manufacturer's protocol. The DNA was then subjected to a pic-borane reaction as described above. KAPA Hifi The converted library was amplified using Uracil Plus Polymerase and purified with 1x Ampure beads.

[0123] Low-input whole-genome TAPS using ssDNA library preparation kit mESC gDNA prepared for whole-genome TAPS as described above was used for low-input whole-genome TAPS. Briefly, samples containing 100 ng, 10 ng, 1 ng, 100 pg, and 10 pg of mESC gDNA were oxidized once with NgTET1 and reduced with pic-borane as described above. Accel-NGS Methyl-Seq Sequencing libraries were prepared using a DNA Library Kit (Swift Biosciences) according to the manufacturer's protocol. The final libraries were amplified for 6 cycles (100 ng), 9 cycles (10 ng), 13 cycles (1 ng), 16 cycles (100 pg), and 21 cycles (10 pg) using KAPA Hifi Uracil Plus Polymerase and purified with 0.85× Ampure beads.

[0124] In a separate experiment, mESC gDNA prepared for whole genome TAPS as described above was used for low-input whole genome TAPS. Briefly, samples containing 100 ng, 10 ng, and 1 ng of mESC gDNA were used in end-repair and A-tailing reactions and ligated to Illumina Multiplexing adapters using the KAPA HyperPrep kit according to the manufacturer's protocol. The ligated samples were then oxidized once with mTET1CD and reduced with pyridine borane according to the protocol described above. The converted libraries were amplified for 5 cycles (100 ng), 8 cycles (10 ng), and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 1x AMPure XP beads.

[0125] Cell-free DNA TAPS Cell-free DNA TAPS samples were prepared from 10 ng and 1 ng cell-free DNA samples. Briefly, samples were oxidized once with NgTET1 and reduced with pic-borane as described above. Sequencing libraries were prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences) according to the manufacturer's protocol. The final libraries were amplified for 9 cycles (10 ng) and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 0.85x Ampure beads.

[0126] In a separate experiment, cell-free DNA TAPS samples were prepared from 10 ng and 1 ng cell-free DNA samples as described above for whole genome TAPS. Briefly, cell-free DNA samples were used in end-repair and A-tailing reactions and ligated to Illumina Multiplexing adapters using the KAPA HyperPrep kit according to the manufacturer's protocol. The ligated samples were then oxidized once with mTET1CD and reduced with pyridine borane according to the protocol above. The converted libraries were amplified for 7 cycles (10 ng) and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 1x AMPure XP beads.

[0127] WGBS data processing Paired-end reads were downloaded from Illumina BaseSpace as FASTQs and then quality trimmed with Trim Galore! v0.4.4 (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). After trimming, read pairs with at least one read shorter than 35 bp were removed. Trimmed reads were mapped to the combined genome of mm9 version of mouse genome, lambda phage and PhiX (sequence from Illumina iGENOMES) using Bismark v0.19 (F. Krueger, SR Andrews, Bismark: Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 27, 1571-1572 (2011), incorporated herein by reference) with the --no_overlap option. Reads with extreme non-conversion rates were removed using the "three-C" filter. PCR duplicates were called using MarkDuplicates in Picard v1.119 (http: / / broadinstitute.github.io / picard / ). Regions known to be prone to mapping artifacts were downloaded (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) and excluded from further analysis (EPConsortium, An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012), incorporated herein by reference).

[0128] Preprocessing of TAPS data Paired-end reads were downloaded from Illumina BaseSpace and then quality trimmed with Trim Galore! v0.4.4. After trimming, read pairs with at least one read shorter than 35 bp were removed. BWA Trimmed reads were mapped to the genome using mem v.0.7.15 (H. Li, R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. transform. Bioinformatics 25, 1754-1760 (2009). Incorporated herein by reference) with default parameters. Regions known to be prone to mapping artifacts were downloaded (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) and excluded from further analysis (EP Consortium, Nature 489, 57-74 (2012)).

[0129] Detection of converted bases in TAPS Aligned reads were split into original top strand (OT) and original bottom strand (OB) using a custom python3 script (MF-filter.py). PCR duplicates were then removed using Picard MarkDuplicates for OT and OB separately. Overlapping segments in read pairs were removed using BamUtil clipOverlap (https: / / github.com / statgen / bamUtil) for de-duplicated mapped OT and OB reads separately. Modified bases were then detected using samtools mpileup and a custom python3 script (MF-caller_MOD.py).

[0130] TAPS and WGBS sequencing quality analysis A python3 script (MF-phredder.py) extracted quality score statistics for each nucleotide type from the original FASTQ files as downloaded from Illumina BaseSpace.

[0131] TAPS and WGBS coverage analysis Base-by-base genome coverage files were generated with Bedtools v2.25 genomecov (AR Quinlan, I M Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010), incorporated herein by reference). To compare relative coverage distributions between TAPS and WGBS, TAPS reads were subsampled to the corresponding median coverage in WGBS using the -s option in samtools view. For analyses comparing coverage in WGBS and subsampled TAPS, clipOverlap was used on both TAPS and WGBS bam files.

[0132] Analysis of cytosine modifications measured by TAPS and WGBS The proportion of modified reads per base was calculated from the Bismark and MF-caller_MOD.py outputs, respectively. Intersections were calculated using Bedtools intersect, and statistical analyses and figures were generated in R and Matlab. Genomic regions were visualized using IGV v2.4.6 (JT Robinson et al., Integrative genomics viewer. Nat. Biotechnol. 29, 24-26 (2011), incorporated herein by reference). To plot coverage and modification levels around CGIs, all CGI coordinates in mm9 were downloaded from the UCSC genome browser and binned into 20 windows, extending by up to 50 windows of 80 bp size on each side (provided that no window reaches half the distance to the next CGI). The average modification level (at CpGs) and coverage (at all bases, on both strands) were calculated for each bin using Bedtools map. The values ​​for each bin were again averaged and then plotted in Matlab.

[0133] Simulation of data processing time Synthetic paired-end sequencing reads were simulated using ART42 based on the phage lambda genome (with the following parameters: -p -ss NS50 --errfree --minQ 15 -k 0 -nf 0 -l 75 -c 1000000 -m 240 -s 0 -ir 0 -ir2 0 -dr 0 -dr2 0 -sam -rs 10). Then, 50% of all CpG positions were marked as modified and two libraries were generated as either TAPS (to convert modified bases) or WGBS (to convert unmodified bases) using a custom python3 script. The reads were then processed according to the pipeline used for each method in this paper. Processing times were measured by Linux command times. All analysis steps were performed in single-thread mode using one Intel Xeon CPU and 250 GB memory.

[0134] Results and Discussion It was found that pic-BH3 can easily convert 5fC and 5caC to DHU by a previously unknown reductive decarboxylation / deamination reaction (Figure 4). The reaction was shown to be quantitative using MALDI for both single nucleosides and multiple oligonucleotides (Figures 2-3 and 6-1-7-2).

[0135] Using an 11-mer 5caC-containing DNA oligo as a model, we screened for chemicals that could react with 5caC (monitored by matrix-assisted laser desorption / ionization mass spectrometry (MALDI)). We found that certain borane-containing compounds reacted efficiently with the 5caC oligo, resulting in a 41 Da reduction in molecular weight (Figures 1 and 2). Pyridine borane and its derivative 2-picoline borane (pic-borane) were selected for further testing because they are commercially available and environmentally friendly reducing agents.

[0136] Repeating the reaction with a single 5caC nucleoside, we confirmed that pyridine borane and pic-borane convert 5caC to dihydrouracil (DHU) (Fig. 3, 4B). Interestingly, pyridine borane and pic-borane also convert 5fC to DHU, apparently through a reductive decarboxylation / deamination-like mechanism (Fig. 4C, 6-1 and 6-2). The detailed mechanism of both reactions remains to be elucidated. Quantitative analysis of the borane reaction with the DNA oligo by HPLC-MS / MS confirms that pic-borane converts 5caC and 5fC to DHU with around 98% efficiency, while having no activity towards unmethylated cytosine, 5mC or 5hmC (Fig. 2B).

[0137] As a uracil derivative, DHU can be recognized as thymine by both DNA and RNA polymerases. Thus, borane reduction can be used to induce both the conversion of 5caC to T and the conversion of 5fC to T, and can be used to sequence 5fC and 5caC with base-by-base resolution, which we have termed pyridine borane sequencing ("PS") (Table 6). The reduction of 5fCT to T by borane can be blocked through the conjugation of hydroxylamine (CXSong et al., Genome-wide profiling of 5-formylcytosine reveals its roles in epigenetic priming. Cell 153, 678-691 (2013). Incorporated herein by reference), and the reduction of 5caC to T by borane can be blocked through the coupling of EDC (X. Lu et al., Chemical modification-assisted bisulfite sequencing (CAB-Seq) for 5-carboxylcytosine detection in DNA. J. Am. Chem. Soc. 135, 9315-9317 (2013). Incorporated herein by reference) (Figures 6-1 and 6-2). This blocking allows for the specific sequencing of 5fC or 5caC using PS (Table 6).

[0138] [Table 9]

[0139] Furthermore, in a process of the present invention, Tet-assisted pyridine borane sequencing ("TAPS"), TET enzyme can be used to oxidize 5mC and 5hmC to 5caC, which can then be reduced by borane (Figure 5A-B, Table 1). TAPS can induce C->T conversion of 5mC and 5hmC, and can therefore be used to detect 5mC and 5hmC with base-by-base resolution.

[0140] In addition, in a process referred to herein as TAPSβ, β-glucosyltransferase (βGT) prevents 5hmC from being oxidized by TET by labeling it with glucose (M. Yu et al., Base-resolution analysis of 5-hydroxymethylcytosine in the mammalian genome.Cell 149, 1368-1380(2012)) and can be protected from reduction by borane (Figure 7-1 and Figure 7-2), allowing selective sequencing of only 5mC (Figure 5B, Table 1). 5hmC sites can then be estimated by subtracting the results of TAPSβ from those of TAPS. Alternatively, instead of TET, potassium perruthenate (KRuO4), a reagent previously used in oxidative bisulfite phytosequencing (oxBS) (MJBooth et al., Quantitative Sequencing of 5-Methylcytosine and 5-Hydroxymethylcytosine at Single-Base Resolution. Science 336, 934-937 (2012)), can be used as a chemical oxidant to specifically oxidize 5hmC to 5fC (Figures 7-1 and 7-2). This approach, referred to herein as chemically assisted pyridine borane sequencing ("CAPS"), can be used to specifically sequence 5hmC (Figure 5B, Table 1). Thus, TAPS and related methods can in principle provide a comprehensive system for sequencing all four epigenetic modifications of cytosine (Figure 5B, Table 1, Table 6).

[0141] TAPS alone will also detect existing 5fC and 5caC in the genome. However, under normal conditions, the above phenomenon will be acceptable, considering that the levels of 5fC and 5caC in genomic DNA are very low. If it is desired to completely remove the signals of 5fC and 5caC under certain conditions, they can be easily removed by protecting 5fC by binding hydroxylamine and 5caC by coupling EDC to prevent conversion to DHU.

[0142] We evaluated the performance of TAPS in comparison with bisulfite sequencing, the current standard and most widely used method for mapping 5mC and 5hmC at base-by-base resolution. Naegleria TET-like oxygenase (NgTET1) and mouse Tet1 (mTet1) were used because both can efficiently oxidize 5mC to 5caC in vitro. To confirm the conversion of 5mC to T, we applied TAPS to a model DNA containing a fully methylated CpG site, which showed that TAPS could effectively convert 5mC to T, as demonstrated by restriction enzyme digestion (Figures 8A-B) and Sanger sequencing (Figure 9A). TAPSβ and CAPS were also validated by Sanger sequencing (Figure 12).

[0143] TAPS was also applied to genomic DNA (gDNA) derived from mouse embryonic stem cells (mESCs). Quantification by HPLC-MS / MS showed that, as expected, 5mC accounted for 98.5% of the cytosine modifications in mESC gDNA, with the remainder consisting of 5hmC (1.5%) and traces of 5fC and 5caC, with no DHU (Figure 9B). After oxidation with TET, approximately 96% of the cytosine modifications were oxidized to 5caC and 3% were oxidized to 5fC (Figure 9B). After reduction with borane, more than 99% of the cytosine modifications were converted to DHU (Figure 9B). These results indicate that both TET oxidation and borane reduction work efficiently on genomic DNA.

[0144] Both oxidation by TET and reduction by borane are mild reactions and do not result in significant DNA degradation compared to bisulfite (Figure 10A-D), which results in higher DNA recovery. Another notable advantage over bisulfite sequencing is that TAPS is non-destructive and preserves DNA up to 10 kb in length (Figure 10C). Furthermore, DNA remains double-stranded after TAPS (Figure 10A-C) and its conversion is not affected by DNA length (Figure 15A-B).

[0145] In addition, since DHU is close to natural bases, it is compatible with various DNA polymerases and isothermal DNA or RNA polymerases (Figures 13A-B), and no bias is observed compared to T / C during PCR (Figure 14).

[0146] Whole genome sequencing was performed on two samples of mESC gDNA; for comparison, one was converted using TAPS and the other was converted using standard whole genome bisulfite sequencing (WGBS).

[0147] To assess the accuracy of TAPS, we added spike-ins of different lengths that were either completely unmodified or in vitro methylated with CpG methyltransferase (M.SssI) or GpC methyltransferase (M.CviPI) (using the methods described above). For short spike-ins (120mer-1 and 120mer-2) containing 5mC and 5hmC, near complete conversion was observed for both modifications on both strands in both CpG and non-CpG contexts (Figure 17A-B).

[0148] 100 ng of gDNA was used for TAPS, compared to 200 ng of gDNA for WGBS. Three different types of spike-in controls were added to evaluate the accuracy of TAPS. Lambda DNA with all CpGs fully methylated was used to estimate the false negative rate (non-conversion rate of 5mC), a 2 kb unmodified amplicon was used to estimate the false positive rate (conversion rate of unmodified C), and synthetic oligo spike-ins containing both methylated and hydroxymethylated C surrounded by any other base (N5mCNN for methylated C and N5hmCNN for hydroxymethylated C) were used to compare the conversion rates of 5mC and 5hmC in different sequence contexts. The combination of mTet1 and pyridine borane resulted in the highest 5mC conversion rate (96.5% for Lambda spike-in and 97.3% for synthetic spike-in) and the lowest conversion rate of unmodified C (0.23%) (Figures 18A-B and 16). The false negative rate of 2.7%-3.5% and the false positive rate of only 0.23% are comparable to bisulfite sequencing, and in a recent study, the average false negative rate of nine commercially available bisulfite kits was 1.7% and the false positive rate was 0.6% (Holmes, EE et al. Performance evaluation of kits for bisulfite-conversion of DNA from tissues, cell lines, FFPE tissues, aspirates, lavages, effusions, plasma, serum, and urine. PLoS One 9, e93933 (2014)). Synthetic spike-in suggests that TAPS works well for both 5mC and 5hmC, and that TAPS is only somewhat inferior in non-CpG contexts. Conversion in 5hmC is 8.2% lower than in 5mC, and conversion in non-CpG contexts is 11.4% lower than in CpG contexts (Figure 18A).

[0149] WGBS data requires specialized software for both the alignment and modification calling steps. In contrast, our processing pipeline uses a standard genome aligner (bwa) followed by a custom modification calling tool that we call "asTair". Processing simulated WGBS and TAPS reads (derived from the same partially methylated source sequence), TAPS / asTair was 3x faster than WGBS / Bismark (Figure 18C).

[0150] With nearly all cytosines converted to thymines, WGBS libraries feature highly skewed nucleotide composition, which can adversely affect Illumina sequencing. As a result, WGBS reads showed substantially lower sequencing quality scores for cytosine / guanine base pairs compared to TAPS (Figure 18E). To offset nucleotide composition bias, at least 10-20% PhiX DNA (base-balanced control library) is typically added to WGBS libraries (see, e.g., Illumina's Whole-Genome Bisulfite Sequencing on the HiSeq 3000 / HiSeq 4000 Systems). Therefore, we added 15% PhiX to WGBS libraries. This, combined with the reduced information content of BS-converted reads and DNA degradation due to bisulfite treatment, resulted in a significantly reduced mapping rate in WGBS compared to TAPS (Figure 18D and Table 7).

[0151] [Table 10]

[0152] That is, at the same sequencing cost (one run with NextSeq High Output), the average depth of TAPS exceeded that of WGBS (21x for TAPS vs. 13.1x for WGBS; Table 8). Furthermore, TAPS had fewer uncovered regions and an overall more uniform coverage distribution even after downsampling to the same sequencing depth as WGBS (interquartile range: 9 for TAPS vs. 11 for WGBS; Figure 19A and Table 8).

[0153] [Table 11]

[0154] For example, CpG islands (CGIs) in particular were generally better covered by TAPS, even when adjusting for differences in sequencing depth between WGBS and TAPS (Figure 21A), while demethylation within CGIs was comparable in both (Figure 22). Furthermore, while WGBS showed a slight bias toward lower modification levels at highly covered CpG sites (Figure 23A), our results suggest that TAPS exhibits only a small modification-coverage bias (Figure 23B). These results indicate that TAPS dramatically improves sequencing quality compared to WGBS, while effectively halving sequencing costs.

[0155] The improved and uniform genome coverage of TAPS increased the number of CpG sites covered by at least three reads. TAPS covered 88.3% of the total 43,205,316 CpG sites in the mouse genome at this level, compared with only 77.5% for WGBS (Figures 21B and 19B). Methylation measurements were highly correlated across chromosomal regions in TAPS and WGBS (Figures 21D and 20). On a nucleotide-by-nucleotide basis, 32,755,271 CpG positions were covered by at least three reads for both methods (Figure 21B). Within these sites, we defined “modified CpGs” as all CpG positions with modification levels of at least 10% (L.Wen et al.,Whole-genome analysis of 5-hydroxymethylcytosine and 5-methylcytosine at base resolution in the human brain.Genome Biology 15,49(2014)). Using this threshold, the modification status of 95.8% of CpGs was concordant between TAPS and WGBS. 98.5% of all CpGs covered by at least three reads and found to be modified in WGBS were recalled as modified by TAPS, indicating good concordance between WGBS and TAPS (Figure 21C). When comparing the modification levels for each CpG covered by at least three reads in both WGBS and TAPS, a good correlation was observed between TAPS and WGBS (Pearson's r=0.63, p<2e-16, Figure 21E). Notably, TAPS identified a subset of highly modified CpG positions that were missed by WGBS (Figure 21E, bottom right corner). We further validated seven of these CpGs using orthogonal restriction digestion and real-time PCR assays and confirmed that all of them were fully methylated and / or hydroxymethylated (Table 9).

[0156] [Table 12]

[0157] Taken together, these results indicate that TAPS can directly replace WGBS and, in fact, provides a more comprehensive interrogation of the methylome than WGBS.

[0158] Finally, we tested TAPS with low DNA input, showing that TAPS works with as little as 1 ng of gDNA and in some cases down to 10 pg of gDNA, close to single-cell levels. TAPS also works effectively with 1 ng of circulating cell-free DNA. These results demonstrate the potential of TAPS for low DNA input and clinical applications (Figures 24A-C, 25A-B).

[0159] TAPS was tested on three circulating cell-free DNA samples (cfDNA) from one healthy sample, one Barrett's esophagus (Barrett's) sample, and one pancreatic cancer sample, collected from 1-2 ml of plasma. The standard TAPS protocol was as follows, and each sample was sequenced at approximately 10x coverage. Analysis of the cfDNA TAPS results showed that TAPS delivers the same high-quality methylome sequencing from low-input cfDNA as bulk genomic DNA, including high 5mC conversion rates (Figure 26A), low false positive rates (conversion of unmodified cytosines, Figure 26B), high mapping rates (Figure 26C), and low PCR duplication rates (Figure 26D). These results demonstrate the power of TAPS for disease diagnosis from cfDNA.

[0160] TAPS can also distinguish methylation from C→T genetic variants or single nucleotide polymorphisms (SNPs), thus detecting genetic variants. In TAPS, methylation and C→T SNPs yield different patterns; that is, methylation yields T / G reads in the original top strand (OT) / original bottom strand (OB) and A / C reads in the strand complementary to OT (CTOT) and the strand complementary to OB (CTOB), whereas C→T SNPs yield T / A reads in OT / OB and (CTOB / CTOT) (Figure 27). This further enhances the utility of TAPS in obtaining both methylation information and genetic variants, i.e., mutations, in a single experiment and sequencing run. This capability of the TAPS method disclosed herein integrates genomic and epigenic analysis, substantially reducing sequencing costs by eliminating the need for standard whole genome sequencing (WGS).

[0161] In summary, we have developed a set of PS-derived methods for sequencing epigenic cytosine modifications at base-level resolution without using bisulfite and demonstrated the utility of TAPS for whole methylome sequencing. TAPS is superior to bisulfite sequencing in that it provides a higher quality and more complete methylome at half the sequencing cost by directly detecting 5mC and 5hmC at base-level resolution, with high sensitivity and specificity, and without affecting unmodified cytosines, using mild enzymatic and chemical reactions. Therefore, TAPS has the potential to replace bisulfite sequencing as the new standard for the analysis of DNA methylcytosines and hydroxymethylcytosines. Recently reported bisulfite-free 5fC sequencing methods (B. Xia et al., Bisulfite-free, base-resolution analysis of 5-formylcytosine at the genome scale. Nat. Methods 12,1047-1050(2015); C.Zhu et al.,Single-Cell 5-Formylcytosine Landscapes of Mammalian Early Embryos and ESCs at Single-Base Resolution.Cell Stem Cell 20,720-731(2017)), TAPS converts modified cytosine to DHU, which is closer to the natural base, and can be "read" as T by common polymerases, making TAPS compatible with PCR-free DNA sequencing. TAPS is compatible with a variety of downstream analyses, including but not limited to pyrosequencing, methylation-sensitive PCR, restriction digestion, MALDI mass spectrometry, microarrays, and whole genome sequencing. TAPS can retain long DNA, which can be extremely useful when combined with long-read sequencing technologies such as SMRT sequencing and nanopore sequencing to investigate specific regions that are difficult to map. Pull-down methods can be combined with TAPS to further reduce sequencing costs and add base-by-base resolution information to low-resolution affinity-based maps. This example shows that TAPS has the potential to directly replace WGBS in routine applications while reducing the cost, complexity, and time required for analysis. This will allow epigenetic analysis to be more widely adopted in academic research and clinical diagnosis.

[0162] Example 2: Endonuclease-enriched TAPS (eeTAPS) method Preparation of spike-in controls A 4 kb spike-in control was prepared by PCR amplifying the pNIC28-Bsa4 plasmid (Addgene, Cat. No. 26103) in a reaction containing 1 ng DNA template, 0.5 μM primers, and 1× Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific). Primer sequences are listed in Table 10. The PCR product was purified with a Zymo-IC column (Zymo Research) and methylated with HpaII Methyltransferase (New England Biolabs) in a 50 μL reaction for 2 hours at 37° C. The methylated product was purified using 1× AMPure XP beads (Beckman Coulter) according to the manufacturer's protocol. Fully CpG-methylated λ-DNA was prepared by methylating unmethylated λ-DNA (Promega) with M.SssI enzyme (New England Biolabs) as previously described (Wu, H., Wu, X., J. and Zhang, Y. (2016) Base-resolution profiling of active DNA demethylation using MAB-seq and caMAB-seq. Nat Protoc, 11:1081-1100).

[0163] Preparation of carrier DNA Carrier DNA was prepared by PCR amplification of pNIC28-Bsa4 plasmid (Addgene, Cat. No. 26103) in a reaction containing 1 ng DNA template, 0.5 μM primers, and 1× Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific). Primer sequences are listed in Table 10. The PCR products were purified with a Zymo-IC column (Zymo Research), fragmented with a Covaris M220, purified with 0.9× AMPure XP beads, and selected for fragments of 200-500 bp.

[0164] [Table 13]

[0165] Culture of mESCs and isolation of genomic DNA E14 mESCs were cultured in DMEM (Invitrogen) supplemented with 15% FBS (Gibco), 2 mM l-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1,000 units ml-1 leukemia inhibitory factor (Millipore), 1 μM PD0325901 (Stemgent) and 3 μM CHIR99021 (Stemgent) on gelatin-coated plates. Cultures were maintained at 37°C and 5% CO2 and passaged every 2 days. For isolation of genomic DNA, cells were harvested by centrifugation for 5 min at 1000 g and room temperature. DNA was extracted using the Quick-DNA Plus Kit (Zymo Research) according to the manufacturer's protocol.

[0166] Expression and purification of mTet1CD Expression and purification of the mTet1 catalytic domain (mTet1CD) was performed as described above.

[0167] Oxidation by mTet1CD 200 ng of mESC gDNA spiked with 0.5% methylated λ-DNA and 0.025% 2 kb unmodified DNA control was oxidized for 80 min at 37°C in a 50 μl reaction containing 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron(II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTet1CD. 0.8 U of proteinase K (New England Biolabs) was then added to the reaction mixture and incubated for 1 h at 50°C. The product was purified with Bio-Spin P-30 Gel Column (Bio-Rad) and 1.8× AMPure XP beads according to the manufacturer's instructions.

[0168] Screening for endonucleases that digest DHU 1 μg of mESC gDNA was enzymatically oxidized by mTet1CD as described above. The oxidized DNA was then reduced in 50 μl of reaction solution containing 600 mM sodium acetate solution (pH 4.3) and 1 M pyridine borane in 35 μl of water for 16 h at 37° C. and 850 rpm in an Eppendorf ThermoMixer. The product was purified using a Zymo-Spin column. Subsequently, 40 ng of TAPS-converted or unconverted DNA was digested with the following enzymes (all from New England Biolabs) according to the manufacturer's protocol: USER (Cat. No. M5505S), Endonuclease IV (Cat. No. M0304S), Tma Endonuclease III (Cat. No. M0291S), Endonuclease V (Cat. No. M0305S), UDG (Cat. No. M0280S), Tth Endonuclease IV (Cat. No. M0294S), Fpg (Cat. No. M0240S), Endonuclease III (Nth) (Cat. No. M0268S), Endonuclease VIII (Cat. No. M0299S), and APE1 (Cat. No. M0282S). The digestion products were purified with 1.8× AMPure XP beads according to the manufacturer's instructions, and 10 ng of each product was run on a 2% agarose gel.

[0169] eeTAPS mESC genomic DNA (200ng, 50ng, 10ng or 1ng) was spiked with 0.05% control of 4kb methylated in CCGG sequence context and oxidized by mTet1CD as described above. The oxidized DNA samples in 35μl water were then reduced in a 50μl reaction solution containing 600mM sodium acetate solution (pH 4.3) and 1M pyridine borane at 37°C and 850rpm in an Eppendorf ThermoMixer for 16h. The products were purified using Zymo-Spin columns. 2U of USER enzyme (New Converted samples were digested in 20 μL reactions containing USER Enzyme (England Biolabs) for 1 h at 37 °C and size-selected with 0.35 × to 1 × AMPure XP beads. End-repair and A-tailing reactions, as well as ligation of Illumina Multiplexing adapters, were performed using the KAPA HyperPrep Kit according to the manufacturer's protocol. To prepare control libraries, 200 ng of unconverted mESC gDNA including spike-in controls was digested with USER Enzyme, size-selected, and used for library construction as described above. Final sequencing libraries were amplified for 6 (for 200 ng input), 8 (for 50 ng input), 10 (for 10 ng input), or 14 cycles (for 1 ng input) using KAPA HiFi HotStart ReadyMix and size-selected with 0.35 × to 1 × AMPure XP beads. The final library was subjected to 80-bp paired-end sequencing along with other sequencing libraries on a NextSeq500 sequencer (Illumina).

[0170] rrTAPS One microgram of mESC gDNA was spiked with 1% CpG-methylated λ and digested with Fast digest Msp1 enzyme (Thermo Scientific) in a 50-μL reaction for 30 min at 37°C. The digested DNA was purified by phenol / chloroform precipitation. End-repair and A-tailing reactions, as well as ligation of Illumina Multiplexing adapters, were performed using the NEBNext® Ultra™ II DNA Library Prep Kit according to the manufacturer's protocol. The ligated library was then purified with 1.6× AMPure XP beads and run on a 1% agarose gel. DNA fragments of 100-400 bp were excised and purified with the Monarch® DNA Gel Extraction Kit according to the manufacturer's protocol. The adapter-ligated samples were spiked into 100 ng of carrier DNA and double-oxidized with mTet1CD as described above. Oxidized DNA in 35 μl water was reduced in a 50 μl reaction solution containing 600 mM sodium acetate solution (pH 4.3) and 1 M pyridine borane in an Eppendorf ThermoMixer for 16 h at 37 °C and 850 rpm. The product was purified using Zymo-Spin columns. The final sequencing library was amplified with KAPA HiFi Uracil (+) Master Mix for 6 cycles and purified with 1x AMPure XP beads. NextSeq The final library was subjected to 80-bp paired-end sequencing along with other sequencing libraries on a 500 sequencer (Illumina).

[0171] eeTAPS Data Analysis Raw sequencing reads were processed with TrimGalore (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ) for adapter and quality trimming with parameters --paired--length35. Cleaned reads were aligned using bwa mem 0.7.17-r1188 (Li, H. and Durbin, R. (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25, 1754-1760) with default parameters. For 4 kb model DNA, pNIC28-Bsa4 sequence from 2,627 to 6,911 was used as reference. For mESC gDNA, mm9 genome was used as reference. Only properly mapped read pairs (reads with flags assigned as 83 or 99) were extracted and coverage was calculated for both end-point and read-through of the entire fragment using bedtools v2.27.1 (Quinlan, ARand Hall, IM (2010) BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics, 26, 841-842), taking into account non-cut sites when calculating the percentage of cuts. A detailed computational pipeline for analyzing eeTAPS can be found at https: / / gitlab.com / jfeicheng / userenrich. Two technical replicates were sequenced in eeTAPS.When analyzing the effect of sequencing depth on eeTAPS, alignment files from the two replicates were merged and then subsampled by a factor of 0.1–1 using samtools view (Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. and Genome Project Data Processing, S. (2009) The Sequence Alignment / Map format and SAMtools. Bioinformatics, 25, 2078-2079).

[0172] rrTAPS data analysis Raw sequencing reads were processed with trimfq -b 2 in seqtk (https: / / github.com / lh3 / seqtk) to trim 2 bp from the left of each read. rrTAPS was processed using Astair 3.2.7 (8). Cleaned reads were aligned using astair align using the mm9 genome as a reference. Methylated CpGs were extracted by astair calling.

[0173] Comparison of wgTAPS, eeTAPS and rrTAPS in mESCs wgTAPS data were downloaded from GSE112520 (Liu, YB, Siejka-Zielinska, P., Velikova, G., Bi, Y., Yuan, F., Tomkova, M., Bai, C.S., Chen, L., Schuster-Bockler, B. and Song, C.X. (2019) Bisulfite-free direct detection of 5-methylcytosine and 5-hydroxymethylcytosine at base resolution. Nat Biotechnol, 37, 424-429). Only CpG sites covered by at least four reads were considered as covered CpG sites. The number of methylated CpG sites was defined according to the criterion that the CpG methylation level was higher than the first quartile of all CpG methylation levels (0.5 for wgTAPS and 0.28 for eeTAPS). The genome was divided into non-overlapping 100 kb windows using bedtools. CpG island tracks were downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / cpgIslandExt.txt.gz. Gene annotation files were downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / refGene.txt.gz. In wgTAPS, the average methylation value was used to assign methylation in each window. In eeTAPS, CpG sites with a cleavage fraction >0.28 were considered methylated, sites below this cutoff were considered unmethylated, and the methylation level of each bin was measured as number of methylated CpGs / (number of methylated CpGs + number of unmethylated CpGs).Expression data for the e14 mESC cell line was obtained from GEO entry GSE72855 (Neri, F., Rapelli, S., Krepelova, A., Incarnato, D., Parlato, C., Basile, G., Maldotti, M., Anselmi, F. and Oliviero, S. (2017) Intragenic DNA methylation prevents spurious transcription initiation. Nature, 543, 72-77) and used to separate genes into four groups according to their expression levels.

[0174] result Development of eeTAPS To enrich methylated CpG sites for sequencing after the TAPS reaction, we identified endonucleases that specifically cleave TAPS products, including DHU. We tested 10 commercially available endonucleases with known ability to digest DHU or structurally similar nucleotides (uracil, 5-hydroxymethyluracil, dihydrothymine). Nucleases including USER, endonuclease VIII, endonuclease III, and Fpg cleaved TAPS-converted DNA, whereas other nucleases such as APE1 and UDG did not substantially cleave TAPS-converted DNA (Figure 28A). USER was selected because it had the highest cleavage efficiency of TAPS-converted DNA and the least effect on unconverted DNA (Figure 28A).

[0175] TAPS conversion was then combined with USER digestion to enrich for methylated sequences. First, unfragmented genomic DNA (gDNA) derived from mouse embryonic stem cells (mESCs) was converted with TAPS and digested with USER. Cleavage yielded DNA fragments ranging from 100 bp to 10 kb (Figure 28B). Apparently, shorter fragments correspond to densely methylated regions, while longer fragments correspond to sparsely methylated parts of the genome. The fragmented DNA was size-selected to retain fragments between 200 bp and 1 kb with moderate methylation status, and an Illumina sequencing library was prepared (Figure 29A, Figure 28B). A computational pipeline was created to identify and quantify methylated CpG sites. Methylation levels were calculated as the number of reads cleaved at each CpG site divided by the total number of reads cleaved at or covering each CpG site (Figure 29A).

[0176] To evaluate the performance of eeTAPS, a 4 kb spike-in model DNA was prepared with all CpGs at CCGG sites methylated by HpaII methyltransferase, which also methylated CpGs at off-target non-CCGG sites at somewhat lower levels. The excellent concordance between eeTAPS- and bisulfite-induced methylation in the model DNA (Pearson's correlation coefficient (r) = 0.98) (Figure 28C) supports the detection power of eeTAPS in quantifying DNA methylation levels (Figure 29B). On the other hand, no CpGs with significant methylation were detected in a control sample where 4 kb of model DNA not converted by TAPS was digested with USER enzyme (Figure 29B), demonstrating the high specificity of eeTAPS in detecting methylation. Taken together, these results demonstrate that eeTAPS can accurately derive DNA methylation status in the 4 kb model DNA.

[0177] eeTAPS in mESCs Having demonstrated the capability of eeTAPS on model DNA, we used it to profile CpG methylation in mESC gDNA (Table 11). eeTAPS is proposed to be a cost-effective method since it will enrich for methylated CpGs. Indeed, we found that 84.6% of the fragments in eeTAPS were C / G (Figure 31A). Further analysis of the distance between the cleavage site and the nearest CpG identified that 72.7% of the cleavage events occurred at CpGs (Figure 31B).

[0178] To further illustrate this point, we compared eeTAPS with wgTAPS and rrTAPS (Fig. 30A, Table 11). First, we compared the number of CpG sites covered by all three methods (CpGs with coverage > 3 were considered as covered CpGs). wgTAPS and eeTAPS covered the majority of CpG sites (19.3M sites, 92.1% of total CpGs for wgTAPS and 15.2M sites, 74.2% of total CpGs for eeTAPS), whereas rrTAPS covered only about 1.5M sites (7.2% of total CpGs) (Fig. 30B). To further compare the genomic regions covered by these assays, we mapped the covered sites to various genomic regions (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819). Intergenic methylation, such as methylation at distal regulatory elements, is also known to be important for gene regulation. We found that wgTAPS and eeTAPS share a similar broad feature distribution, with the majority of covered CpG sites located in heterochromatin (65.6% in wgTAPS and 71% in eeTAPS), whereas rrTAPS is biased towards promoter regions (46% of covered CpGs) (Figure 30B). At 1 CpG resolution, good correlation was observed between eeTAPS and wgTAPS (r = 0.56, Fig. 30C), whereas very high correlation was observed between rrTAPS and wgTAPS (r = 0.92, Fig. 31C). Methylation was overestimated in eeTAPS, likely because DNA fragments with unmethylated CpGs are longer and therefore less well amplified.

[0179] [Table 14]

[0180] Next, we compared the methylated CpG sites covered by the different assays. eeTAPS and wgTAPS show high concordance for sites defined as methylated CpG (mCpG) sites (82.4% of mCpG sites detected by wgTAPS are also detected by eeTAPS, Figure 30D), whereas rrTAPS only detects approximately 20.0% of mCpGs (Figure 30D). Furthermore, eeTAPS shows high reproducibility, with 81% of mCpGs observed in replicates (Figure 31D). Taken together, these analyses support that eeTAPS can accurately and reliably detect mCpG sites on a genome-wide scale and may be a powerful semi-quantitative tool for measuring methylation at 1 CpG resolution.

[0181] Comparison of eeTAPS and wgTAPS in genomic organization We compared methylation patterns across different genomic mechanisms between eeTAPS and wgTAPS. To quantify methylation levels within a region, we used the average methylation value in wgTAPS and the percentage of methylated CpGs relative to the total number of detected CpG sites in eeTAPS. We found highly correlated chromosome-wide methylation patterns in eeTAPS and wgTAPS, but eeTAPS overestimated methylation levels (Figure 32A,B). CpG islands (CGIs) are known to have very low DNA methylation, and these are reflected in both eeTAPS and wgTAPS (Figure 32C). The correlation between methylation levels at CGIs measured using eeTAPS and wgTAPS was 0.81, further indicating that eeTAPS can accurately capture the methylation status of CpGs across different mechanisms (Figure 32D).

[0182] Previous studies have revealed that DNA methylation in promoter regions generally correlates inversely with gene expression. We divided genes into four groups according to their expression levels and plotted the average methylation from 4 kb upstream to 4 kb downstream of the transcription start site (TSS). Using both eeTAPS and wgTAPS, we found that highly expressed genes tended to have low methylation levels, and low expressed genes had high methylation levels (Figure 33). We used the methylation profiles of genes in the 4 groups as previously defined (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long We also compared the methylation distribution in different chromatin features (Fig. 32E, F). Consistent with previous studies, heterochromatic regions are highly methylated, whereas promoter regions in euchromatin are mostly under-methylated at CG positions (Fig. 32F).

[0183] Application of eeTAPS to low input samples To evaluate the performance of eeTAPS with low-input samples, we applied 1 ng, 10 ng, and 50 ng mESC gDNA to eeTAPS, respectively. For the 200 ng mESC DNA sample, the sequencing reads were downsampled by a factor of two to match the sequencing depth of the low-input samples. We found that 27% of the mCpG sites identified by wgTAPS were recapitulated using 1 ng DNA in eeTAPS. When 50 ng mESC DNA was used, the percentage increased to 47% (Figure 34A). To further compare the whole-genome methylation profiles with these low-input samples, we binned the genome into 100 kb windows and calculated the average methylation level in each bin (Figure 34B). Highly consistent methylation profiles were observed among these low-input samples (r = 0.88 at 1 ng, r = 0.92 at 20 ng, and r = 0.95 at 50 ng compared to half the eeTAPS at 200 ng; Figure 34C), further demonstrating the feasibility of applying eeTAPS to low-input DNA samples.

[0184] Effect of sequencing depth on eeTAPS To evaluate the effect of sequencing depth on the total number of detectable mCpG sites, we downsampled eeTAPS and evaluated its performance. The total number of detected mCpG sites increased with increasing sequencing depth (Figure 35A). However, at a sequencing depth of 4× (70M reads), we were able to successfully detect 74% of mCpG sites (10.9M sites were defined as mCpG in 4× eeTAPS out of 14.9M mCpG sites detected by wgTAPS). A similar trend was observed in terms of methylation correlation across chromosomes and CGIs (Figure 35B), with the Pearson correlation coefficient for CGIs reaching 0.83 at 4× coverage (Figure 35B). Thus, we demonstrated that eeTAPS can accurately provide global methylation profiles at a lower sequencing cost compared to WGBS.

[0185] Investigation wgTAPS was able to perform the most comprehensive quantitative, base-by-base resolution whole genome methylation analysis. However, the high cost of whole genome sequencing and the large amount of processed data still limit the widespread application of methylation analysis in many projects. Because methylated CpG sites represent only a small fraction of mammalian genomes, whole genome sequencing is not the most data-efficient approach to investigate methylation status. A cost-effective approach would be to specifically select only regions containing methylated CpGs for further analysis by sequencing. Reduced-Representation Sequencing based on restriction enzyme digestion enrichment of CpG-rich regions followed by bisulfite sequencing is a cost-effective approach to methylome analysis, but this method covers only a small fraction of the CpG sites in the genome (Meissner, A., Gnirke, A., Bell, GW, Ramsahoye, B., Lander, ES and Jaenisch, R. (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res, 33, 5868-5877). TAPS is compatible with the Reduced-Representation approach, and we have demonstrated that rrTAPS can accurately quantify methylation in a subset of the genome, especially in CGIs. In addition to the well-established biological significance of CpG methylation in gene promoters, intergenic DNA methylation has attracted extensive research attention due to its possible involvement in cell fate determination and tumorigenesis. To extend the enrichment approach to genome-wide CpG sites, we further took advantage of TAPS to directly convert 5mC to DHU, thereby enabling cleavage at these specific modified bases upon induction by a DHU-sensitive endonuclease.Through selective enrichment of these fragments combined with sequencing, we demonstrate that eeTAPS enables the detection of CpG methylation on a genome-wide scale. This strategy is possible because TAPS directly detects methylated cytosines. Unlike traditional antibody-based enrichment methods, eeTAPS offers the possibility of direct methylation detection at single CpG resolution.

[0186] We demonstrated that eeTAPS can be used to capture genome-wide methylation signatures at 1 CpG resolution in a cost-effective format, thereby bridging the gap between rrTAPS and wgTAPS. Methylation profiles from eeTAPS across multiple different genomic mechanisms correlated well with those obtained using wgTAPS. Furthermore, eeTAPS can detect 74% of the methylated CpGs detected by wgTAPS with as few as 70M reads. A possible limitation of eeTAPS (due to the variability in the spacing of methylated CpG sites) may be its semi-quantitative measurement of methylation levels at single CpG sites. In this study, we selected fragments of 200 bp to 1 kb as a proof of concept. However, the correlation coefficient between wgTAPS and eeTAPS is still as good as 0.56. Furthermore, building on the mild nature of the TAPS reaction, we also showed that eeTAPS is a promising cost-effective protocol for detecting methylation in low-input DNA samples. [Brief description of the drawings]

[0187] [Figure 1]Screening of borane-containing compounds. Borane-containing compounds were screened for the conversion of 5caC to DHU in 11-mer oligonucleotides ("oligos") and the conversion was estimated by MALDI. 2-picoline borane (pic-borane), borane pyridine and tert-butylamine borane were able to completely convert 5caC to DHU, whereas the conversion was around 30% for ethylenediamine borane and dimethylamine borane. No detectable products were measured (not detected) for dicyclohexylamine borane, morpholine borane, 4-methylmorpholine borane and trimethylamine borane. Other reducing agents such as sodium borohydride and sodium tri(acetoxy)borohydride were rapidly decomposed in acidic medium leading to incomplete conversion. Sodium cyanoborohydride was not used due to the possible formation of hydrogen cyanide under acidic conditions. Pic-borane and pyridine borane were chosen due to their complete conversion, low toxicity and high stability. [Diagram 2] Pic-borane reaction of DNA oligos. (A) A model DNA 11mer containing 5caC was treated with pic-borane and characterized by MALDI. Calculated masses (m / z) are shown above each graph, and observed masses are shown to the left of the peaks. (B) Conversion of dC and various cytosine derivatives was quantified by HPLC-MS / MS. Data are presented as the mean ± standard deviation of three replicates. [Figure 3A]pic-borane reaction of a single nucleoside. The 1H NMR results are in accordance with previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). 1H NMR (MeOH-d4, 400MHz) chart of the pic-borane reaction product of a single nucleoside. δ ppm: 6.28 (t, 1H, J = 7 Hz), 4.30 (m, 1H), 3.81 (m, 1H), 3.63 (m, 2H), 3.46 (m, 2H), 2.65 (t, 2H, J = 6 Hz), 2.20 (m, 1H), 2.03 (m, 1H). [Figure 3B] This is pic-borane reaction of a single nucleoside. The 13C NMR results are in accordance with previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). This is a 13C NMR (MeOH-d4, 400 MHz) chart of the pic-borane reaction product of a single nucleoside. δ ppm: 171.56 (CO), 153.54 (CO), 85.97 (CH), 83.86 (CH), 70.99 (CH), 61.92 (CH2), 36.04 (CH2), 35.46 (CH2), 30.49 (CH2). [Figure 4A] FIG. 1 shows the conversion of 5caC to DHU by borane and a proposed mechanism for the borane reaction of 5caC to DHU. [Figure 4B] FIG. 1 shows the conversion of 5fC to DHU by borane and a proposed mechanism for the borane reaction of 5fC to DHU. [Diagram 5] (A) The TAPS method converts both 5mC and 5hmC to DHU, which functions as thymine during replication. (B) Overview of the TAPS, TAPSβ, and CAPS methods. [Figure 6-1]Model DNA oligos containing 5fC and 5caC were characterized by MALDI after treatment with pic-borane with or without blocking of 5fC and 5caC. 5fC and 5caC were converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked with hydroxylamine derivatives such as O-ethylhydroxylamine (EtONH2), which form oximes that prevent conversion by pic-borane. 5caC was blocked with ethylamine via EDC linkage to convert it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) is shown above each graph, and observed MS is shown to the left of the peak. [Figure 6-2] Model DNA oligos containing 5fC and 5caC were characterized by MALDI after treatment with pic-borane with or without blocking of 5fC and 5caC. 5fC and 5caC were converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked with hydroxylamine derivatives such as O-ethylhydroxylamine (EtONH2), which form oximes that prevent conversion by pic-borane. 5caC was blocked with ethylamine via EDC linkage to convert it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) is shown above each graph, and observed MS is shown to the left of the peak. [Figure 7-1] Model DNA oligos containing 5mC and 5hmC were characterized by MALDI after treatment with KRuO4 and pic-borane with or without blocking of 5hmC. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC and 5gmC could not be converted by pic-borane. 5hmC could be oxidized to 5fC by KRuO4 and then converted to DHU by pic-borane. Calculated MS (m / z) is shown above each graph and observed MS is shown to the left of the peak. [Figure 7-2] Model DNA oligos containing 5mC and 5hmC were characterized by MALDI after treatment with KRuO4 and pic-borane with or without blocking of 5hmC. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC and 5gmC could not be converted by pic-borane. 5hmC could be oxidized to 5fC by KRuO4 and then converted to DHU by pic-borane. Calculated MS (m / z) is shown above each graph and observed MS is shown to the left of the peak. [Figure 8] Restriction enzyme digestion showed that TAPS can effectively convert 5mC to T. (A) Diagram of restriction enzyme digestion assay to confirm sequence change by TAPS. (B) TaqαI digestion test to confirm C to T conversion by TAPS. TAPS was performed on a 222-bp model DNA containing a TaqαI restriction site and five fully methylated CpG sites (5mC) and its unmethylated control (C). As shown in 5mC, C, and C TAPS, the PCR-amplified 222-bp model DNA can be cleaved into approximately 160-bp and approximately 60-bp fragments by TaqαI. As shown in the 5mC-TAPS lane, after TAPS was performed on the methylated DNA, the T(mC)GA sequence was converted to TTGA and was no longer cleaved by TaqαI digestion. [Figure 9] TAPS on 222 bp model DNA and mESC gDNA. (A) Sanger sequencing of 222 bp model DNA containing five fully methylated CpG sites and its unmethylated control before (5mC, C) and after TAPS (5mC TAPS, C TAPS). Only 5mC is converted to T by the TAPS method. (B) Quantification by HPLC-MS / MS of the relative modification levels in mESC gDNA control after oxidation with NgTET1 and reduction with pic-borane. Data are presented as the mean ± standard deviation of three replicates. [Figure 10A] TAPS does not result in significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp unmethylated DNA, 222 bp methylated DNA, and mESC gDNA before cooling in an ice bath. After TAPS, no detectable DNA degradation was observed and the DNA remained double stranded and visible without cooling. With bisulfite conversion, degradation occurred and the DNA became single stranded and was only visible after cooling on ice. [Figure 10B] TAPS does not result in significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp unmethylated DNA, 222 bp methylated DNA, and mESC gDNA after cooling in an ice bath (B). After TAPS, no detectable DNA degradation was observed and the DNA remained double stranded and visible without cooling. With bisulfite conversion, degradation occurred and the DNA became single stranded and was visible only after cooling on ice. [Figure 10C] TAPS does not cause significant DNA degradation compared to bisulfite. Agarose gel images of mESC gDNA of various fragment lengths treated with TAPS and bisulfite before (left panel) and after chilling on ice (right panel). After TAPS, the DNA remained double stranded and was directly visible on the gel. Bisulfite treatment caused more damage and fragmentation of the samples, with the DNA becoming single stranded and only visible after chilling on ice. As shown in Figure 15, conversion by TAPS was complete for all gDNA fragments, regardless of fragment length. [Figure 10D] TAPS does not cause significant DNA degradation compared to bisulfite. Agarose gel images of a 222 bp model DNA before and after TAPS (replicated three times independently), showing no detectable degradation after the reaction. [Figure 11]Comparison of amplification and melting curves between model DNA before and after TAPS. qPCR assay showed small differences in the amplification curves of model DNA before and after TAPS. The melting curve of methylated DNA (5mC) shifted to lower temperatures after TAPS, indicating a decrease in Tm and possible C to T conversion, but no shift was observed for unmethylated DNA (C). [Figure 12] As shown by Sanger sequencing, complete conversion of C to T was induced after TAPS, TAPSβ, and CAPS. Model DNA containing one methylated and one hydroxymethylated CpG site was prepared as described herein. Conversion by TAPS was performed according to the protocol of oxidation by NgTET1 and reduction by pyridine borane as described herein. Conversion by TAPSβ was performed according to the protocol of blocking 5hmC, oxidation by NgTET1, and reduction by pyridine borane. Conversion by CAPS was performed according to the protocol of oxidation of 5hmC and reduction by pyridine borane. After conversion, 1 ng of the converted DNA sample was PCR amplified by Taq DNA polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC, whereas CAPS selectively converted 5hmC. Unmodified cytosine and other bases were not converted by any of these three methods. [Figure 13A]TAPS is compatible with a variety of DNA and RNA polymerases and induces complete conversion of C to T as shown by Sanger sequencing. Model DNA containing methylated CpG sites and primer sequences for polymerase testing are described herein. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase, Taq polymerase, and Vent exopolymerase read DHU as T, thus inducing complete conversion of C to T after PCR. Alternatively, primer extension was performed with biotin-labeled primers and isothermal polymerases, including Klenow fragment, Bst DNA polymerase, and phi29 DNA polymerase. The newly synthesized DNA strands were separated by Dynabeads MyOne Streptavidin C1, then amplified by PCR with Taq polymerase and processed for Sanger sequencing. T7 RNA polymerase could efficiently bypass DHU and insert an adenine opposite the DHU site, as demonstrated by RT-PCR and Sanger sequencing. [Figure 13B] Certain other commercially available polymerases did not efficiently amplify DNA containing DHU. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase and Taq polymerase read DHU as T, leading to complete conversion of C to T. Low or no conversion of C to T was observed with certain other commercially available polymerases, including KAPA HiFi polymerase, Pfu polymerase, Phusion polymerase, and NEB Q5 polymerase (not shown). [Figure 14]DHU does not show any PCR bias compared to T and C. Model DNAs containing one DHU / U / T / C modification were synthesized using the corresponding DNA oligos as described herein. Based on the qPCR reactions, standard curves of each model DNA with DHU / U / T / C modifications were plotted, and the model DNA input was serially diluted 1:10 (0.1 pg to 1 ng. All qPCR experiments were performed in triplicate). The slope of the regression between the log concentration (ng) values ​​and the mean Ct values ​​was calculated by the SLOPE function in Excel. PCR efficiency was calculated using the formula: Efficiency (%) = (10^(-1 / slope)-1) × 100%. Amplification factor was calculated using the formula: Amplification factor = 10^(-1 / slope). The PCR efficiency for model DNAs with DHU, T, or C modifications was almost the same, indicating that DHU can be read as a normal base and does not appear to cause PCR bias. [Figure 15] TAPS completely converted 5mC to T, regardless of DNA fragment length. (A) Agarose gel image of TaqαI-digestion assay confirmed complete conversion of 5mC to T in all samples, regardless of DNA fragment length. After TAPS, a 194 bp model sequence from the lambda genome was PCR amplified and digested with TaqαI enzyme. PCR products amplified from unconverted samples could be cleaved, whereas products amplified from TAPS-treated samples remained intact, suggesting loss of the restriction site, i.e., complete conversion of 5mC to T. (B) Quantification of gel bands estimated the C to T conversion percentage, which was 100% for all DNA fragment lengths tested. [Figure 16] Conversion and false positives under different TAPS conditions. The combination of mTet1 and pyridine borane resulted in the highest conversion of methylated C (96.5%, calculated on fully CpG-methylated lambda DNA) and the lowest conversion of unmodified C (0.23%, calculated on a 2 kb unmodified spike-in) compared to other conditions using NgTET1 or pic-borane. Shown above the bars are the conversion rates ± standard error for all cytosine sites tested. [Figure 17] Conversion rates for short spike-ins: (A) 120mer-1 and (B) 120mer-2 containing 5mC and 5hmC. Near complete conversion occurred at the 5mC and 5hmC sites in both strands. The actual sequences are shown above and below, along with the modification status. [Figure 18A] Improved sequencing quality of TAPS over whole genome bisulfite sequencing (WGBS). Conversion rates of 5mC and 5hmC in DNA treated with TAPS. Left: Synthetic spike-ins methylated or hydroxymethylated at known positions (CpN). [Figure 18B] Improved sequencing quality of TAPS compared to whole genome bisulfite sequencing (WGBS). False positive rate of TAPS obtained from an unmodified 2 kb spike-in. [Figure 18C] Improved sequencing quality of TAPS compared to whole genome bisulfite sequencing (WGBS). Total runtime of TAPS and WGBS on one core of one Intel Xeon CPU for 1 million simulated reads. [Figure 18D] TAPS sequencing quality is improved over whole genome bisulfite sequencing (WGBS). The percentage of all sequenced read pairs (after trimming) that map to the genome. [Figure 18E] TAPS improved sequencing quality over whole genome bisulfite sequencing (WGBS). Sequencing quality scores per base in the first and second reads of all read pairs sequenced were recorded by Illumina BaseSpace. Top: TAPS. Bottom: WGBS. [Figure 19]TAPS provided more uniform coverage than WGBS and fewer uncovered positions than WGBS. Comparison of coverage depth at (A) all bases and (B) CpG sites between WGBS and TAPS, calculated on both strands. For "TAPS (downsampled)", random reads taken from all mapped TAPS reads were selected to ensure that the median coverage matched the median coverage of WGBS. The last bin shows positions with >50× coverage. [Figure 20] Distribution of modification levels across all chromosomes. Modification levels were averaged in 100 kb windows across mouse chromosomes, weighted by CpG coverage, and smoothed with a Gaussian weighted moving average filter with a window size of 10. [Figure 21A] Comparison of genome-wide methylome measurements by TAPS and WGBS. Mean sequencing coverage depth over all mouse CpG islands (binned into 20 windows) and 4 kbp flanking regions (binned into 50 equal-sized windows). To account for differences in sequencing depth, all mapped TAPS reads were downsampled to match the median number of mapped WGBS reads across the genome. [Figure 21B] Comparison of genome-wide methylome measurements by TAPS and WGBS. CpG sites covered by at least three reads by TAPS only, by both TAPS and WGBS, or by WGBS only. [Figure 21C] Comparison of genome-wide methylome measurements by TAPS and WGBS. Number of CpG sites with modification levels >0.1 that were covered by at least three reads and detected by TAPS only, TAPS and WGBS, or WGBS only. [Figure 21D]Comparison of genome-wide methylome measurements by TAPS and WGBS. Example of chromosomal distribution of modification levels (%) in TAPS and WGBS. The average percentage of modified CpGs per 100 kb window on mouse chromosome 4 was smoothed with a Gaussian weighted moving average filter with a window size of 10. [Figure 21E] Comparison of genome-wide methylome measurements by TAPS and WGBS. Heatmap showing the number of CpG sites covered by at least three reads in both TAPS and WGBS, categorized by modification level as measured by each method. To improve contrast, the first bin containing unmodified CpGs by both methods is excluded from the color scale and indicated by an asterisk. [Figure 22] Modification levels around CpG islands. Average modification levels in CpG islands (binned into 20 windows) and 4 kbp flanking regions (binned into 50 windows of equal size). Bins with coverage of less than 3 reads were ignored. [Figure 23] TAPS has a smaller coverage-modification bias than WGBS. All CpG sites were binned according to their coverage, and in each bin, the mean (●) and median (black triangle) modification values ​​are shown for WGBS (A) and TAPS (B). The last bin shows CpG sites covered by more than 100 reads. The lines represent linear fits through the data points. [Figure 24]Low-input gDNA and cell-free DNA TAPS were prepared using dsDNA and ssDNA library preparation kits. (A) Sequencing libraries were successfully constructed with as little as 1 ng of mouse embryonic stem cell (mESC) genomic DNA (gDNA) using the dsDNA library kit NEBNext Ultra II or KAPA HyperPrep kit. The input DNA amount was further reduced to (B) 0.01 ng of mESC gDNA or (C) 1 ng of cell-free DNA using the ssDNA library kit Accel-NGS Methyl-Seq kit. [Diagram 25] TAPS libraries were prepared with low inputs of gDNA and cell-free DNA using the dsDNA KAPA HyperPrep Library Prep Kit. Sequencing libraries were successfully constructed with as little as 1 ng of (A) mESC gDNA and (B) cell-free DNA using the KAPA HyperPrep Kit. The cell-free DNA has a sharp length distribution of around 160 bp (nucleosome size) due to plasma nuclease digestion. After library construction, the DNA is approximately 300 bp, which is the sharp band in B. [Figure 26] High-quality cell-free DNA TAPS. (A) 5mC conversion rate in TAPS-treated cfDNA. (B) False positive rate in TAPS-treated cfDNA. (C) Percentage of all sequenced read pairs that map uniquely to the genome. (D) Percentage of all sequenced read pairs that map uniquely to the genome after removing PCR duplicate reads. CHG and CHH are non-CpG contexts. [Figure 27] TAPS can detect genetic variants: methylation (MOD, top row) and C→T SNPs (bottom row) showed distinct base distributions in the original top strand (OT) / original bottom strand (OB) (left column), as well as in the strand complementary to OT (CTOT) and the strand complementary to OB (CTOB) (right column). [Figure 28]Endonuclease cleavage of TAPS conversion products. (A) Digestion of mESC gDNA before and after TAPS conversion with different endonucleases. TAPS conversion introduces DHU in place of methylated cytosines. Endo VIII, Endo IV, Endonuclease IV, Tma Endo III, Endonuclease III, Tth Endo IV, Endonuclease IV, Nth Endo III, Nth Endonuclease III, and Endo V, Endonuclease V. (B) Representative images of TAPS-treated mESC gDNA before USER digestion, after USER digestion, and after size selection. (C) Scatter plot showing methylation levels at all CpGs measured by both BS-seq and eeTAPS. [Figure 29A] Endonuclease enrichment TAPS (eeTAPS). Schematic of eeTAPS (top) and computational measurements of CG methylation levels (bottom). First, 5-methylcytosine (mC) was converted to dihydrouracil (DHU) by TAPS and then enriched through USER digestion. Size-selected DNA fragments were then prepared into sequencing libraries and amplified by PCR. After alignment of the reads, CG methylation levels were calculated as the number of reads cleaved at each CpG site divided by the total number of reads cleaved at each CpG site or the total number of reads covering each CpG site. [Figure 29B] Validation of eeTAPS on a 4 kb model DNA. From top to bottom, the tracks show methylation levels measured by bisulfite sequencing (BS-seq), eeTAPS, and the eeTAPS control, where DNA was digested with USER enzyme without conversion by TAPS. [Figure 30A]Comparison of wgTAPS, eeTAPS and rrTAPS with mESC DNA. Diagram showing the genomic fragmentation methods of wgTAPS, eeTAPS and rrTAPS. In wgTAPS, genomic DNA is randomly fragmented, whereas fragmentation is specific at methylated CpG (mCG) sites in eeTAPS and at CCGG sites in rrTAPS. [Figure 30B] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. Bar plots showing the percentage of CpG sites covered by wgTAPS, eeTAPS, and rrTAPS overlaid with distinct chromatin features. These chromatin features have been defined in a previous study (20). [Figure 30C] Comparison of wgTAPS, eeTAPS and rrTAPS in mESC DNA. Heatmap showing correlation of methylation levels at 1 CpG resolution by wgTAPS and eeTAPS. Methylation levels were divided into 16 groups in both wgTAPS and eeTAPS. Colors indicate the number of CpGs in a given interval. Only sites with wgTAPS coverage >5 were considered. Pearson's correlation coefficients are shown on top of the plots. [Figure 30D] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. Venn plot showing overlap of detected mCpG sites in wgTAPS, rrTAPS, and eeTAPS. In both wgTAPS and eeTAPS, CpG sites with methylation levels above the first quartile of methylation levels were defined as methylated CpGs. The same methylation cutoff value was used in rrTAPS as in wgTAPS. (In wgTAPS and rrTAPS, CpG sites with methylation levels above 0.5 were defined as mCpGs, and in eeTAPS, CpG sites with methylation levels above 0.28 were defined as mCpGs.) [Diagram 31](A) Nucleotide frequency at the ends of sequenced fragments. (B) Bar plot showing the distribution of the distance between the cleavage site and the nearest CpG. (C) Heat map showing the correlation of methylation levels at 1 CpG resolution by wgTAPS and rrTAPS. Methylation levels were divided into 16 groups in both wgTAPS and rrTAPS. Colors indicate the number of CpGs in a given interval. Only sites with coverage >5 in wgTAPS and >5 in rrTAPS were considered. Pearson's correlation coefficient is 0.92. (D) Overlap of mCpG sites detected in eeTAPS replicates, where replicates were subsampled to the same depth to detect mCpGs. [Diagram 32]Methylation in different genomic features was profiled with eeTAPS. (A) Methylation levels measured by both eeTAPS (top line) and wgTAPS (bottom line) on chromosome 1 of mESCs. A 100 kb window was used and moving averages were calculated by the movAvg2 function in R with bw=10. (B) Density plot showing correlation of methylation levels in chromosome bins between eeTAPS and wgTAPS. A 100 kb window was used to calculate the average methylation level in each bin. The Pearson correlation coefficient is shown on top of the plot. (C) Average methylation levels over CpG islands (CGIs) and 4 kb of flanking regions in eeTAPS and wgTAPS. (D) Density plot showing correlation of methylation levels in CpG islands between eeTAPS and wgTAPS. The Pearson correlation coefficient is shown on top of the plot. (E) Density plot showing correlation of methylation levels across different chromatin features in eeTAPS and wgTAPS. These chromatin features were previously defined by histone markers (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819) and are also shown in (F). Pearson's correlation coefficients are shown on top of the plots. (F) Box plot showing distribution of methylation levels across all chromatin features measured by eeTAPS (lower bar) and wgTAPS (upper bar). [Diagram 33] Average methylation distribution around transcription start sites (TSSs) in wgTAPS and eeTAPS. Genes were sorted by their expression levels according to the GSE72855 dataset. [Diagram 34]eeTAPS analysis of low-input samples. (A) Number of mCpGs detected with eeTAPS (among those identified by wgTAPS) at 1ng, 10ng, 50ng, and 200ng mESC gDNA inputs. For 200ng mESCs, reads were downsampled by a factor of two to adapt sequencing depth to the low-input samples. A criterion of methylation level >0.28 was used to assign mCpGs; eeTAPS assigns breaks >1 as mCpGs, and wgTAPS assigns methylation levels >0.5 as mCpGs. The percentages shown above the bars are the percentage of mCpGs detected (mCpGs detected by wgTAPS are defined as true). (B) Heatmap showing methylation distribution measured by eeTAPS across the mouse genome using different input levels. Each chromosome was divided into 100 kb windows, which are represented by rows in the heatmap. Methylation levels were defined as the number of methylated CpG sites divided by the total number of CpG sites covered in each 100 kb window. (C) Density plot showing correlation of methylation among low input samples to the 200 ng input sample. Methylation levels were calculated across the entire mouse genome in 100 kb windows as shown in (B). Pearson's correlation coefficients are shown for each plot. [Diagram 35] eeTAPS sequencing depth analysis. (A) Number of methylated CpGs detected when reads were sampled at 1–10× sequencing depth. The percentages shown on top are the percentages of mCpGs detected by eeTAPS (mCpGs detected by wgTAPS are defined as true). (B) Correlation of methylation in the whole mouse genome (top line) and CpG islands (CGIs) (bottom line) in 100 kb windows when reads were sampled at 1–10× sequencing depth.

Claims

[Claim 1] 1. A method for identifying 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) in a DNA sample, comprising: a. providing a DNA sample containing target DNA having 5mC and / or 5hmC; b. modifying the DNA sample, comprising the steps of: i. converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC); ii. Converting the 5caC and / or 5fC to dihydrouracil (DHU) to provide a modified DNA sample containing modified target DNA. c. cleaving the modified target DNA; d. adding an adaptor DNA molecule to the cleaved modified target DNA; e. detecting the sequence of the modified target DNA; Including, The method, wherein the presence of a cleavage site results in the location of either 5mC or 5hmC in the target DNA.

Images