Variant nucleic acid libraries for single domain antibodies

Abstract

To provide methods and compositions relating to variant nucleic acid libraries encoding for antibodies including single domain antibodies.SOLUTION: Libraries generated using methods described herein have improved characteristics including improved binding affinity. Libraries described herein include variegated libraries comprising nucleic acids each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence. Further described herein are protein libraries generated when the nucleic acid libraries are translated. Further described herein are cell libraries expressing variegated nucleic acid libraries described herein.SELECTED DRAWING: Figure 29D

Description

[Technical field]

[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 62 / 904,620, filed September 23, 2019, U.S. Provisional Patent Application No. 62 / 935,603, filed November 14, 2019, and U.S. Provisional Patent Application No. 62 / 945,761, filed December 9, 2019, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Antibodies have the ability to bind to biological targets with high specificity and affinity.However, due to the balance between the efficacy of immunological effects, designing therapeutic antibodies is difficult.Single domain antibodies such as VHH antibodies have several beneficial properties.Therefore, there is a need to develop compositions and methods for the generation of antibodies such as VHH antibodies for use in therapy.

[0003] Incorporation by Reference All publications, patents, and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Summary of the Invention

[0004] Provided herein is an antibody or antibody fragment comprising a CDRH1 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 152 or 155, a CDRH2 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 153 or 156, and a CDRH3 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 154 or 157. Further provided herein is an antibody or antibody fragment further comprising a CDRL1 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 158 or 161, a CDRL2 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 159 or 162, and a CDRL3 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 160 or 163.

[0005] Provided herein is a method of treating cancer comprising administering an antibody or antibody fragment described herein.

[0006] Provided herein is a method of treating a viral infection comprising administering an antibody or antibody fragment described herein.

[0007] Provided herein is a nucleic acid library comprising a plurality of sequences comprising nucleic acids that when translated encode an antibody or antibody fragment, wherein each sequence of the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a variable region of a heavy chain (VH), or a CDR1, CDR2, or CDR3 on a variable region of a light chain (VL), the library comprising at least 30,000 variant sequences, and the antibody or antibody fragment has a K of less than 100 nM. DFurther provided herein is a nucleic acid library, wherein the antibody is a single domain antibody. Further provided herein is a nucleic acid library, wherein the single domain antibody is a VHH antibody. Further provided herein is a nucleic acid library, wherein the antibody binds to TIGIT. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain, when translated, comprises an amino acid sequence that is at least about 90% identical to that set forth in SEQ ID NOs: 84-100. Further provided herein is a nucleic acid library, wherein the variable region of the light chain, when translated, comprises an amino acid sequence that is at least about 90% identical to that set forth in SEQ ID NOs: 101-117. Further provided herein is a nucleic acid library, wherein the CDR1, CDR2, or CDR3 on the variable region of the heavy chain comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 67-83 or 118-128. Further provided herein is a nucleic acid library, wherein CDR1, CDR2, or CDR3 on the variable region of the light chain comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 129-137. Further provided herein is a nucleic acid library, wherein the antibody binds to CD47. Further provided herein is a nucleic acid library, wherein the antibody binds to CD3 epsilon. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain, when translated, comprises an amino acid sequence that is at least about 90% identical to that set forth in SEQ ID NOs: 138-141. Further provided herein is a nucleic acid library, wherein the variable region of the light chain, when translated, comprises an amino acid sequence that is at least about 90% identical to that set forth in SEQ ID NOs: 142-145. Further provided herein is a nucleic acid library, comprising at least 50,000 variant sequences. Further provided herein is a nucleic acid library, comprising at least 100,000 variant sequences. Further provided herein is a nucleic acid library, comprising at least 10 56. The nucleic acid library of claim 5, comprising at least 10 non-identical nucleic acids. 9 It is a nucleic acid library that has a theoretical diversity of sequences.

[0008] Provided herein is a nucleic acid library comprising a plurality of sequences comprising nucleic acids that when translated encode a single domain antibody, wherein each sequence of the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a variable region of a heavy chain (VH), wherein the library comprises at least 30,000 variant sequences, and wherein the antibody or antibody fragment has a K of less than 100 nM. Dand binds to its antigen. Further provided herein is a nucleic acid library, wherein the VH has a length of about 90 to about 100 amino acids when translated. Further provided herein is a nucleic acid library, wherein the VH has a length of about 100 to about 400 amino acids when translated. Further provided herein is a nucleic acid library, wherein the VH has a length of about 270 to about 300 base pairs. Further provided herein is a nucleic acid library, wherein the VH has a length of about 300 to about 1200 base pairs. Further provided herein is a nucleic acid library, wherein the single domain antibody is a VHH antibody. Further provided herein is a nucleic acid library, wherein the antibody binds to TIGIT. Further provided herein is a nucleic acid library, wherein the CDR1, CDR2, or CDR3 comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs: 67-83 or 118-128. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 84-100. Further provided herein is a nucleic acid library, wherein a CDR3 on the variable region of the heavy chain comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 101-117. Further provided herein is a nucleic acid library, wherein the antibody binds to CD47. Further provided herein is a nucleic acid library, wherein the antibody binds to CD3 epsilon. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to that set forth in SEQ ID NOs: 138-141 ... comprises at least 50,000 variant sequences. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain comprises at least 100,000 variant sequences. Further provided herein is a nucleic acid library, wherein the variable region of the heavy chain comprises at least 100,000 variant sequences. 5 Further provided herein is a nucleic acid library comprising at least 10 non-identical nucleic acids.9 A nucleic acid library that has a theoretical diversity of sequences.

[0009] Provided herein is a method for generating a nucleic acid library encoding a single domain antibody, the method comprising: (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, wherein each polynucleotide of the first plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR1 on a heavy chain; ii. a second plurality of polynucleotides, wherein each polynucleotide of the second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on a heavy chain; and iii. a third plurality of polynucleotides, wherein each polynucleotide of the third plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR3 on a heavy chain; (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library of variant nucleic acids encoding a single domain antibody, wherein at least about 70% of the variant nucleic acids have a K of less than 100 nM. DThe method includes the step of encoding a single domain antibody that binds to its antigen at a heavy chain variable domain. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody comprises one heavy chain variable domain. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody is a VHH antibody. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody binds to TIGIT. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 84-100 or 138-141. Further provided herein is a method for generating a nucleic acid library, wherein the single domain antibody binds to CD47. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 50,000 variant sequences. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 100,000 variant sequences. Further provided herein is a method for generating a nucleic acid library, wherein the nucleic acid library comprises at least 10 5 Further provided herein is a method for generating a nucleic acid library comprising non-identical nucleic acids, the nucleic acid library having a K of less than 75 nM. D Further provided herein is a method for generating a nucleic acid library comprising at least one sequence encoding a single domain antibody that binds to an antigen at a K of less than 50 nM. D Further provided herein is a method for generating a nucleic acid library comprising at least one sequence encoding a single domain antibody that binds to an antigen at a K of less than 25 nM. DAlso provided herein is a method for generating a nucleic acid library comprising at least one sequence encoding a single domain antibody that binds to an antigen with a KD of less than 10 nM. Also provided herein is a method for generating a nucleic acid library comprising at least one sequence encoding a single domain antibody that binds to an antigen with a KD of less than 10 nM. Also provided herein is a method for generating a nucleic acid library comprising at least one sequence encoding a single domain antibody that binds to an antigen with a KD of less than 10 nM. 9 A method for generating nucleic acid libraries with theoretical diversity in sequences. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 presents a step diagram demonstrating an exemplary process workflow for gene synthesis as disclosed herein. [Diagram 2] 1 illustrates an example computer system. [Diagram 3] FIG. 1 is a block diagram illustrating the architecture of a computer system. [Figure 4] FIG. 1 is a diagram demonstrating a network configured to incorporate multiple computer systems, multiple mobile phones and personal data assistants, and network attached storage (NAS). [Diagram 5] FIG. 1 is a block diagram of a multi-processor computer system using a shared virtual address memory space. [Figure 6] Figures 6-7 show graphs of the TIGIT affinity distribution of the VHH library, showing either affinity thresholds from 20 to 4000 (Figure 6) or affinity thresholds from 20 to 1000 (Figure 7). Of the 140 VHH binders, 51 variants were <100 nM and 90 variants were <200 nM. [Figure 7] Figures 6-7 show graphs of the TIGIT affinity distribution of the VHH library, showing either affinity thresholds from 20 to 4000 (Figure 6) or affinity thresholds from 20 to 1000 (Figure 7). Of the 140 VHH binders, 51 variants were <100 nM and 90 variants were <200 nM. [Figure 8] A graph of CDR3 counts per length for the "VHH library", "VHH shuffled" library and "VHH hShwhle library" is shown. [Figure 9] Figure 1 shows a graph of the TIGIT:CD155 blocking assay for TIGIT VHH Fc binders. The concentration of TIGIT VHH Fc binder in nanomolar (nM) is on the x-axis and the relative HRP signal is on the y-axis. [Figure 10] A graph of CD47 affinity distribution of CD47 VHH Fc binders is shown. The affinity threshold (monovalent KD) is on the x-axis and counts are on the y-axis for the "VHH ratio" library (horizontal bars), the "VHH shuffle" library (black bars), and the "VHH hShuffle" library (dotted bars). [Figure 11] Figure 1 shows a graph of a CD47-SIRP alpha inhibition assay for CD47 VHH Fc binders, where the concentration of CD47 VHH Fc binders in nanomolar (nM) is on the x-axis and the relative HRP signal is on the y-axis. [Figure 12A] 12A-12B show a graph of the FACS analysis (FIG. 12A) and a graph of the dose curve and specificity of GLP1R-43-77 (FIG. 12B). [Figure 12B] 12A-12B show a graph of the FACS analysis (FIG. 12A) and a graph of the dose curve and specificity of GLP1R-43-77 (FIG. 12B). [Figure 13A] 13A-13B show a graph of the FACS analysis (FIG. 13A) and a graph of the dose curve and cAMP activity of CRTH2-41-51 (FIG. 13B). [Figure 13B] 13A-13B show a graph of the FACS analysis (FIG. 13A) and a graph of the dose curve and cAMP activity of CRTH2-41-51 (FIG. 13B). [Figure 14A] 14A-14B show graphs of the dose curve (FIG. 14A) and FACS analysis (FIG. 14B) of CRTH2-44-59. [Figure 14B] 14A-14B show graphs of the dose curve (FIG. 14A) and FACS analysis (FIG. 14B) of CRTH2-44-59. [Figure 15A] Figures 15A-15E show FACS analysis plots of mean fluorescence intensity (MFI) versus cell binding measured by eight-point titration with CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. [Figure 15B] Figures 15A-15E show FACS analysis plots of mean fluorescence intensity (MFI) versus cell binding measured by eight-point titration with CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. [Figure 15C] Figures 15A-15E show FACS analysis plots of mean fluorescence intensity (MFI) versus cell binding measured by eight-point titration with CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. [Figure 15D]Figures 15A-15E show FACS analysis plots of mean fluorescence intensity (MFI) versus cell binding measured by eight-point titration with CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. [Figure 15E] Figures 15A-15E show FACS analysis plots of mean fluorescence intensity (MFI) versus cell binding measured by eight-point titration with CRTH2R IgG using CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. [Figure 16A] 1 shows an exemplary gated dot plot showing CRTH2-27 binding at 100 nM. [Figure 16B] 1 shows an exemplary APC histogram showing CRTH2-27 binding at 100 nM. [Figure 17A] Binding analysis similar to that in the previous figure is shown using the comparator antibody gPCR-51. [Figure 17B] Binding analysis similar to that in the previous figure is shown using the comparator antibody gPCR-52. [Figure 18A] IgG binding curves with CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42 with functional effects in the cAMP assay are shown. [Figure 18B]IgG binding curves with CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42 with functional effects in the cAMP assay are shown. [Figure 19A] Shown are the results of the CRTH2R cAMP assay across all antibodies tested at 300, 100, and 33 nM. [Figure 19B] Shown are the results of the CRTH2R cAMP assay across all antibodies tested at 33 nM. [Figure 20] The negative allosteric effect seen in five CRTH2R IgGs (CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42). [Figure 21A] 21A-21C show allosteric modulator control experiments, demonstrating that comparator antibody 52 is a positive allosteric modulator. [Figure 21B] 21A-21C show allosteric modulator control experiments, demonstrating that comparator antibody 52 is a positive allosteric modulator. [Figure 21C] 21A-21C show allosteric modulator control experiments, demonstrating that comparator antibody 52 is a positive allosteric modulator. [Figure 22A] CRTH2R IgG activity of CRTH2R in a β-arrestin recruitment assay. [Figure 22B] CRTH2R IgG activity of CRTH2R in a β-arrestin recruitment assay. [Figure 22C] CRTH2R IgG activity of CRTH2R in a β-arrestin recruitment assay. [Figure 22D] CRTH2R IgG activity of CRTH2R in a β-arrestin recruitment assay. [Figure 23] 1 shows the schema of the library generated in the present invention. [Figure 24]1 shows a schema of the design of the phage-displayed hyperimmune library generated herein. [Figure 25A] Figures 25A-25B show the heavy chain CDR length distribution of the hyperimmune library as assessed by next generation sequencing. Figure 25A shows a graph of CDR3 counts by length. Figure 25B shows a graph of the lengths of CDRH1, CDRH2, and CDRH3. [Figure 25B] Figures 25A-25B show the heavy chain CDR length distribution of the hyperimmune library as assessed by next generation sequencing. Figure 25A shows a graph of CDR3 counts by length. Figure 25B shows a graph of the lengths of CDRH1, CDRH2, and CDRH3. [Figure 26] 1 shows a schema of the workflow for selection of soluble protein targets. [Figure 27A] 1 shows a graph of data from the hTIGIT ELISA after the third and fourth rounds of panning. [Figure 27B] 1 shows a graph of data from the hTIGIT ELISA after the third and fourth rounds of panning. [Figure 27C] 1 shows a graph of data from the hTIGIT ELISA after the third and fourth rounds of panning. [Figure 27D] 1 shows a graph of data from the hTIGIT ELISA after the third and fourth rounds of panning. [Figure 27E] A schematic of CDRH3 length, yield, and affinity (KD) for hTIGIT immunoglobulin is shown. [Figure 27F] A schematic of CDRH3 length, yield, and affinity (KD) for hTIGIT immunoglobulin is shown. [Figure 28A] Graphs of data from human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) ELISAs after the fourth and fifth rounds of panning are shown. [Figure 28B]Graphs of data from human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) ELISAs after the fourth and fifth rounds of panning are shown. [Figure 28C] Graphs of data from human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) ELISAs after the fourth and fifth rounds of panning are shown. [Figure 28D] Graphs of data from human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) ELISAs after the fourth and fifth rounds of panning are shown. [Figure 28E] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28F] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28G] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Fig. 28H] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28I] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28J] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28K] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 28L] Graph of cross-reactive human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins is shown. [Figure 29A]Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29B] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29C] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29D] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29E] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29F] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 29G] Graphs showing titration of human CD3 on CD8+, CD3+, and CD3- T cells are shown. [Figure 30A] Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 30B] Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTHH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 30C]Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 30D] Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 30E] Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 30F] Graphs of binding affinity for CRTH2R immunoglobulins CRTH2-48-03 (Figure 30A), CRTH2-48-21 (Figure 30B), and CRTH2-48-27 (Figure 30C), and graphs of cAMP assays for CRTH2-48-03 (Figure 30D), CRTH2-48-21 (Figure 30E), and CRTH2-48-27 (Figure 30F) are shown. [Figure 31A] A graph of the dose curve (Figure 31A) and FACS analysis (Figure 31B) of A2AR-90-007 is shown. [Figure 31B] A graph of the dose curve (Figure 31A) and FACS analysis (Figure 31B) of A2AR-90-007 is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Detailed Description The present disclosure employs, unless otherwise indicated, conventional molecular biology techniques that are within the skill of one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0012] definition Throughout this disclosure, various embodiments are presented in a range format. It should be understood that descriptions in range format are merely for convenience and brevity and should not be construed as inflexible limitations on the scope of any embodiment. Thus, the description of a range should be considered to specifically disclose all possible subranges and individual numerical values ​​to the tenth of the unit of the lower limit within that range, unless the context clearly dictates otherwise. For example, description of a range such as 1 to 6 should be considered to specifically disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and individual values ​​within that range (such as 1.1, 2, 2.3, 5, and 5.9). This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may be independently included in smaller ranges, which are also included in the disclosure, subject to any specifically excluded limits within the stated range. Where a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, unless the context clearly dictates otherwise.

[0013] The terms used herein are for the purpose of describing particular embodiments only and are not intended to limit any embodiment. As used herein, the singular forms "a," "an," and "the" are intended to include the plural unless the context clearly indicates otherwise. Furthermore, it is understood that the terms "comprise" and / or "comprising," as used herein, specify the presence of the referenced features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0014] As used herein, unless specifically stated or clear from the context, the term "about" in reference to a number or range of numbers is understood to mean the number referred to and + / - 10% of that number, or 10% below the recited lower limit and 10% above the recited upper limit of the values ​​recited for the range.

[0015] Unless otherwise specified, the term "nucleic acid" as used herein encompasses double- or triple-stranded nucleic acids, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid sequences, when provided, are written in a 5'' to 3' direction unless otherwise specified. The methods described herein provide for the production of isolated nucleic acids. The methods described herein further provide for the production of isolated and purified nucleic acids. A "nucleic acid" as referred to herein can comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 or more bases in length. Further provided herein are methods for the synthesis of any number of polypeptide segments encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), non-ribosomal peptide synthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins such as antibodies, non-coding DNA or RNA, e.g., regulatory sequences such as promoters, transcription factors, enhancers, siRNAs, shRNAs, RNAi, miRNAs, small nucleolar RNAs derived from microRNAs, or polypeptide segments from other protein families that contain functional or structural DNA or RNA units of interest.The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci (lpcus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription or by amplification of messenger RNA (mRNA); DNA molecules produced by synthesis or amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The cDNA encoding the gene or gene fragment referred to herein may include at least one region encoding an exon sequence without any intervening intron sequence in the genomic equivalent sequence.

[0016] Antibody Library Provided herein are methods, compositions, and systems for generating antibodies. In some cases, the antibody is a single domain antibody. The methods, compositions, and systems described herein for optimizing an antibody include a ratio variant approach that reflects the natural diversity of antibody sequences. In some cases, the library of optimized antibodies includes variant antibody sequences. In some cases, variant antibody sequences containing variant CDR regions are designed. In some cases, variant antibody sequences containing variant CDR regions are generated by shuffling natural CDR sequences in a llama, humanized, or chimeric framework. In some cases, such libraries are synthesized, cloned into an expression vector, and the activity of the translation product (antibody) is evaluated. In some cases, fragments of the sequence are synthesized and subsequently assembled. In some cases, the expression vector is used to display and enrich the desired antibody, such as phage display. In some cases, the phage vector is a Fab phagemid vector. The selection pressures used during enrichment include, in some cases, binding affinity, toxicity, immunological tolerance, stability, or other factors. Such expression vectors allow antibodies with specific properties to be selected ("panning"), and subsequent propagation or amplification of such sequences enriches the library with these sequences. Panning rounds can be repeated any number of times, such as 1, 2, 3, 4, 5, 6, 7 rounds, or more than 7 rounds. In some cases, each round of panning includes multiple washes. In some cases, each round of panning includes at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 washes.

[0017] Described herein are methods and systems for in silico library design. The libraries described herein are designed based on a database that includes various antibody sequences in some cases. In some cases, the database includes multiple variant antibody sequences against various targets. In some cases, the database includes at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some cases, the database includes naive and memory B cell receptor sequences. In some cases, the naive and memory B cell receptor sequences are human, mouse, or primate sequences. In some cases, the naive and memory B cell receptor sequences are human sequences. In some cases, the database is analyzed for position-specific variation. In some cases, the antibodies described herein include position-specific variation in the CDR regions. In some cases, the CDR regions include multiple positions for variation.

[0018] Described herein is a library that includes variations of CDR regions. In some cases, the CDR is CDR1, CDR2, or CDR3 of a variable heavy chain. In some cases, the CDR is CDR1, CDR2, or CDR3 of a variable light chain. In some cases, the library includes multiple variants that code for CDR1, CDR2, or CDR3. In some cases, the library described herein codes for at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR1 sequences. In some cases, the libraries described herein encode at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR2 sequences. In some cases, the libraries described herein encode at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR3 sequences. In silico antibody libraries are in some cases synthesized, assembled, and enriched for desired sequences.

[0019] Following synthesis of the CDR1, CDR2, and CDR3 variants, in some cases, the CDR1, CDR2, and CDR3 variants are shuffled to generate a diverse library. In some cases, the diversity of the library generated by the methods described herein is at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 1016 , 10 17 , 10 18 , or 10 18 In some cases, the library has at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , or 10 18 The more sequences there are the more diverse the final library will be.

[0020] The germline sequence corresponding to the variant sequence can also be modified to generate a sequence in the library.For example, the sequence generated by the method described herein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 mutations from the germline sequence.In some cases, the generated sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 18 or less mutations from the germline sequence.In some cases, the generated sequence comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or about 18 mutations from the germline sequence.

[0021] Antibody Library Provided herein is a library generated from the method described herein. The antibodies described herein provide improved functional activity, structural stability, expression, specificity, or a combination thereof. In some cases, the antibody is a single domain antibody. In some cases, the single domain antibody comprises one heavy chain variable domain. In some cases, the single domain antibody is a VHH antibody.

[0022] As used herein, the term antibody is understood to include proteins having the characteristic two-armed Y-shape of a typical antibody molecule, as well as one or more fragments of an antibody that retain the ability to specifically bind to an antigen. Exemplary antibodies include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, grafted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single chain Fv (scFv) (including fragments in which the VL and VH are linked using recombinant methods with synthetic or natural linkers that allow the fragment to be made as a single protein chain, where the VL and VH regions are paired to form monovalent molecules including single chain Fab and scFab), single chain antibodies, Fab fragments (including monovalent fragments including the VL, VH, CL, and CH1 domains), F(ab')2 fragments (bivalent fragments including two Fab fragments linked by a disulfide bridge at the hinge region), and F(ab')2 fragments (bivalent fragments including two Fab fragments linked by a disulfide bridge at the hinge region). Examples of antibody fragments include, but are not limited to, Fv fragments, Fd fragments (including fragments containing a VH and CH1 fragment), Fv fragments (including fragments containing the VL and VH domains of a single arm of an antibody), single domain antibodies (dAbs or sdAbs) (including fragments containing a VH domain), isolated complementarity determining regions (CDRs), diabodies (including fragments containing a bivalent dimer such as two VL and VH domains that bind to each other and recognize two different antigens), fragments consisting of only a single monomeric variable domain, disulfide-linked Fvs (sdFvs), intrabodies, anti-idiotypic (anti-Id) antibodies, or ab antigen-binding fragments thereof. In some cases, the libraries disclosed herein include nucleic acids encoding antibodies, where the antibodies are Fv antibodies, including Fv antibodies consisting of the minimum antibody fragment containing a complete antigen recognition and binding site. In some embodiments, an Fv antibody consists of a dimer of one heavy and one light chain variable domain in tight, non-covalent association, with the three hypervariable regions of each variable domain interacting to define an antigen-binding site on the surface of the VH-VL dimer, hi some embodiments, the six hypervariable regions confer antigen-binding specificity to the antibody.In some embodiments, the single variable domain (or half of an Fv containing only three hypervariable regions specific for an antigen, including single domain antibodies isolated from camelids containing one heavy chain variable domain, such as VHH antibodies or nanobodies) has the ability to recognize and bind to the antigen. In some cases, the libraries disclosed herein contain nucleic acids encoding antibodies, where the antibodies are single chain Fvs or scFvs containing VH, VL, or antibody fragments containing both VH and VL domains, both domains being present in a single polypeptide chain. In some embodiments, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, allowing the scFv to form the desired structure for antigen binding. In some cases, the scFv is linked to an Fc fragment or the VHH is linked to an Fc fragment (including a minibody). In some cases, the antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, such as molecules containing an antigen binding site. Immunoglobulin molecules may be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass.

[0023] In some embodiments, the library comprises immunoglobulins adapted to the intended therapeutic target species. In general, these methods include "mammalization" and include methods to transfer donor antigen binding information to less immunogenic mammalian antibody receptors to generate useful therapeutic treatments. In some cases, the mammals are mice, rats, horses, sheep, cows, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, and humans. In some cases, provided herein are libraries and methods for feline-ization and canine-ization of antibodies.

[0024] A "humanized" form of a non-human antibody may be a chimeric antibody that contains minimal sequence derived from the non-human antibody. A humanized antibody is generally a human antibody (recipient antibody) in which residues from one or more CDRs have been replaced by residues from one or more CDRs of a non-human antibody (donor antibody). The donor antibody may be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody, with the desired specificity, affinity, or biological effect. In some cases, selected framework region residues of the recipient antibody are replaced by the corresponding framework region residues from the donor antibody. A humanized antibody may also contain residues that are not found in either the recipient antibody or the donor antibody. In some cases, these changes are made to further improve the performance of the antibody.

[0025] "Caninization" can include methods for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor to generate therapeutic agents useful as canine therapeutics. In some cases, the caninized forms of non-canine antibodies provided herein are chimeric antibodies that contain minimal sequences derived from the non-canine antibody. In some cases, the caninized antibody is a canine antibody sequence (the "acceptor" or "recipient" antibody) in which the recipient's hypervariable region residues have been replaced by hypervariable region residues from a non-canine species (the "donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequences with desired properties. In some cases, framework region (FR) residues of the canine antibody are replaced by the corresponding non-canine FR residues. In some cases, the caninized antibody includes residues that are not found in the recipient antibody or the donor antibody. In some cases, these modifications are made to further refine antibody performance. A caninized antibody may also contain at least a portion of the immunoglobulin constant region (Fc) of a canine antibody.

[0026] "Fenconization" can include methods for transferring non-feline antigen binding information from a donor antibody to a less immunogenic feline antibody acceptor to generate therapeutics useful as feline therapeutics. In some cases, the felineized versions of non-feline antibodies provided herein are chimeric antibodies that contain minimal sequences derived from the non-feline antibody. In some cases, the felineized antibody is a feline antibody sequence (the "acceptor" or "recipient" antibody) in which the recipient's hypervariable region residues have been replaced by hypervariable region residues from a non-feline species (the "donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequences with desired properties. In some cases, framework region (FR) residues of the feline antibody are replaced by the corresponding non-feline FR residues. In some cases, the felineized antibody includes residues that are not found in the recipient or donor antibody. In some cases, these modifications are made to further refine antibody performance. A felinized antibody may also contain at least a portion of the immunoglobulin constant region (Fc) of a feline antibody.

[0027] The methods provided herein can be used to generate libraries that code for non-immunoglobulins.In some cases, the antibody library includes antibody mimics.Exemplary antibody mimics include, but are not limited to, anticalins, affilins, affibody molecules, affimers, affitins, alphabodies, avimers, atrimers, DARPins, finomers, Kunitz domain-based proteins, monobodies, anticalins, knottins, armadillo repeat protein-based proteins, and bicyclic peptides.

[0028] The libraries described herein that contain nucleic acids encoding antibodies contain variations of at least one region of the antibody. Exemplary regions of the antibody for variation include, but are not limited to, the complementarity determining region (CDR), the variable domain, or the constant domain. In some cases, the CDR is CDR1, CDR2, or CDR3. In some cases, the CDR is a heavy chain domain, including, but not limited to, CDRH1, CDRH2, and CDRH3. In some cases, the CDR is a light chain domain, including, but not limited to, CDRL1, CDRL2, and CDRL3. In some cases, the variable domain is a variable domain, light chain (VL) or a variable domain, heavy chain (VH). In some cases, the CDR1, CDR2, or CDR3 is a variable domain, light chain (VL). The CDR1, CDR2, or CDR3 of the variable domain, light chain (VL) can be referred to as CDRL1, CDRL2, or CDRL3, respectively. The CDR1, CDR2, or CDR3 of the variable domain, heavy chain (VH), may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some cases, the VL domain comprises a kappa chain or a lambda chain. In some cases, the constant domain is a constant domain, light chain (CL) or a constant domain, heavy chain (CH).

[0029] Provided herein is a library comprising nucleic acids encoding antibodies comprising variations in at least one region of the antibody, the region being a CDR region. In some cases, the antibody is a single domain antibody comprising one heavy chain variable domain, such as a VHH antibody. In some cases, the VHH antibody comprises variations in one or more CDR regions. In some cases, the VHH library described herein comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000 sequences, or more than 3000 sequences of CDR1, CDR2, or CDR3. For example, the library comprises at least 2000 sequences of CDR1, at least 1200 sequences of CDR2, and at least 1600 sequences of CDR3. In some cases, the sequences are not identical.

[0030] The libraries described herein may include CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, or combinations of these amino acids when translated, of various lengths. In some cases, the length of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, or combinations of these amino acids when translated is at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino acids, or more than 30 amino acids.

[0031] The library containing nucleic acids encoding antibodies with variant CDR sequences described herein, when translated, contains amino acids of various lengths. In some cases, the length of each of the amino acid fragments or the average length of the synthesized amino acids can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 amino acids, or more than 150 amino acids. In some cases, the length of the amino acids is about 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95 amino acids. In some cases, the length of the amino acids is about 22 amino acids to about 75 amino acids. In some cases, the antibody comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 amino acids, or more than 5000 amino acids. In some cases, the library is a VHH library. In some cases, the library is an antibody library.

[0032] The libraries described herein encoding VHH antibodies include at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 Array of items, or 10 18 In some cases, the library comprises variant CDR sequences that are shuffled to generate a library with a theoretical diversity of more than 10 sequences. 7 , 10 8 , 10 9 , 1010 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 Array of items, or 10 18 The final library diversity exceeds 10 sequences.

[0033] The antibody or immunoglobulin encoding libraries described herein comprise at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 Array of items, or 10 18 In some cases, the library comprises variant CDR sequences that are shuffled to generate a library with a theoretical diversity of more than 10 sequences. 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 Array of items, or 10 18 The final library diversity exceeds 10 sequences.

[0034] The methods described herein provide for the synthesis of libraries containing nucleic acids encoding antibodies or immunoglobulins, where each nucleic acid encodes a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding at least a single codon variation, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by standard translation processes. In some cases, the antibody library includes various nucleic acids that collectively encode variations at multiple positions. In some cases, the variant library includes sequences encoding at least a single codon variation of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library includes sequences encoding multiple codon variations of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library includes sequences encoding multiple codon variations of framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). Exemplary numbers of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0035] In some cases, at least one region of the antibody for variation is derived from a heavy chain V gene family, a heavy chain D gene family, a heavy chain J gene family, a light chain V gene family, or a light chain J gene family. In some cases, the light chain V gene family includes an immunoglobulin kappa (IGK) gene or an immunoglobulin lambda (IGL).

[0036] Provided herein is a library comprising nucleic acids encoding antibodies, the library is synthesized with a variety of fragments. In some cases, the fragments include CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the fragments include framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the antibody library is synthesized with at least or about 2 fragments, 3 fragments, 4 fragments, 5 fragments, or more than 5 fragments. The length or average length of each of the synthesized nucleic acid fragments can be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some cases, the length is about 50-600, 75-575, 100-550, 125-525, 150-500, 175-475, 200-450, 225-425, 250-400, 275-375, or 300-350 base pairs.

[0037] The library comprising nucleic acids encoding antibodies or immunoglobulins described herein comprises amino acids of various lengths when translated. In some cases, the length or average length of each of the synthesized amino acid fragments can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 amino acids, or more than 150 amino acids. In some cases, the length of the amino acids is about 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95 amino acids. In some cases, the length of the amino acids is about 22 amino acids to about 75 amino acids. In some cases, the antibody comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 amino acids, or more than 5000 amino acids.

[0038] Multiple variant sequences of at least one region of an antibody for variation are de novo synthesized using the methods described herein. In some cases, multiple variant sequences are de novo synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some cases, multiple variant sequences are de novo synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). The number of variant sequences can be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some cases, the number of variant sequences is at least or about 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000 sequences. In some cases, the number of variant sequences is about 10-500, 25-475, 50-450, 75-425, 100-400, 125-375, 150-350, 175-325, 200-300, 225-375, 250-350, or 275-325 sequences.

[0039] The variant sequence of at least one region of the antibody varies in length or sequence in some cases. In some cases, the at least one region that is de novo synthesized is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some cases, the at least one region that is de novo synthesized is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids compared to wild type. In some cases, the variant sequences contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some cases, the variant sequences contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids compared to the wild type. In some cases, the library contains at least or about 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or 10 10 Contains more than 100 variants.

[0040] Following synthesis of the antibody library, the antibody library may be used for screening and analysis. For example, the antibody library is assayed for displayability and panning of the library. In some cases, displayability is analyzed using a selectable tag. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some cases, the tag is histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. For example, as can be seen in FIG. 2B. In some cases, the antibody library is assayed by sequencing using a variety of methods, including, but not limited to, single molecule real-time (SMRT) sequencing, Polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis. In some cases, antibody libraries are displayed on the surface of cells or phage. In some cases, phage display is used to enrich antibody libraries for sequences with a desired activity.

[0041] In some cases, the antibody library is assayed for functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or a combination thereof. In some cases, the antibody library is assayed for antibodies that can fold. In some cases, regions of the antibody are assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof. For example, the VH region or the VL region is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.

[0042] The antibodies or IgGs generated by the methods described herein include improved binding affinities. In some cases, the antibodies have a binding affinity (e.g., K D In some cases, the antibody has a K of less than 400 nM, less than 350 nM, less than 300 nM, less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 15 nM, or less than 10 nM. D In some cases, the antibody has a K of less than 1 nM. D In some cases, the antibody has a K of less than 1.2 nM. D In some cases, the antibody has a K of less than 2 nM. D In some cases, the antibody has a K of less than 5 nM. D In some cases, the antibody has a K of less than 10 nM. D In some cases, the antibody has a K of less than 13.5 nM. D In some cases, the antibody has a K of less than 15 nM. D In some cases, the antibody has a K of less than 20 nM. D In some cases, the antibody has a K of less than 25 nM. D In some cases, the antibody has a K of less than 30 nM. D Includes.

[0043] In some cases, the affinity of the antibodies or IgGs generated by the methods described herein has improved binding affinity by at least or about 1.5-fold, 2.0-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, or more than 200-fold compared to a comparator antibody. In some cases, the affinity of the antibodies or IgGs generated by the methods described herein has improved function by at least or about 1.5-fold, 2.0-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, or more than 200-fold compared to a comparator antibody. In some cases, the comparator antibody is an antibody with a similar structure, sequence, or antigen target.

[0044] The methods described herein, in some cases, result in increased yields of antibodies or IgG. In some cases, the yield is at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 micrograms (μg), or greater than 80 micrograms (μg). In some cases, the yield is in the range of about 5 to about 80, about 10 to about 75, about 15 to about 60, about 20 to about 50, or about 30 to about 40 micrograms (μg).

[0045] Expression system Provided herein are libraries that contain nucleic acids encoding antibodies that contain binding domains, the libraries having improved specificity, stability, expression, folding, or downstream activity. In some cases, the libraries described herein are used for screening and analysis. in the microgram (μg) range.

[0046] Provided herein is a library comprising nucleic acids encoding antibodies comprising binding domains, where the nucleic acid library is used for screening and analysis. In some cases, the screening and analysis includes in vitro, in vivo, or ex vivo assays. The cells for screening include primary cells taken from a living subject or cell line. The cells can be derived from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, those from mice, rabbits, primates, and insects. In some cases, the cells for screening include cell lines including, but are not limited to, Chinese hamster ovary (CHO) cell lines, human embryonic kidney (HEK) cell lines, or baby hamster kidney (BHK) cell lines. In some cases, the nucleic acid library described herein can also be delivered to a multicellular organism. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0047] The nucleic acid library described herein can be screened for various pharmacological or pharmacokinetic properties.In some cases, the library is screened using in vitro assay, in vivo assay, or ex vivo assay.For example, the in vitro pharmacological or pharmacokinetic properties that are screened include, but are not limited to, binding affinity, binding specificity, and binding avidity.The exemplary in vivo pharmacological or pharmacokinetic properties that are screened for the library described herein include, but are not limited to, therapeutic effect, activity, preclinical toxicity properties, clinical efficacy properties, clinical toxicity properties, immunogenicity, efficacy, and clinical safety properties.

[0048] Provided herein are nucleic acid libraries, where the nucleic acid libraries can be expressed in vectors. Expression vectors for inserting the nucleic acid libraries disclosed herein can include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors include mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 Vector, pEF1a-tdTomato Vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; and yeast expression vectors: pTYB21 and pKLAC2, and insect vectors: pAc5.1 / V5-His A and pDEST8. In some cases, the vector is pcDNA3 or pcDNA3.1.

[0049] Described herein is a nucleic acid library that is expressed in a vector to generate a construct that comprises an antibody.In some cases, the size of the construct varies.In some cases, the construct comprises at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000 bases, or more than 10000 bases. In some cases, the construct may be from about 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,0 00~6,000, 1,000~7,000, 1,000~8,000, 1,000~9,000, 1,000~10,000, 2,000~3,000, 2,000~4,000, 2,000~5,000, 2,000~6,000, 2,000~7,000, 2,000~8,000, 2,000~9,000, 2,000~10,000, 3,000~4,000, 3,0 00~5,000, 3,000~6,000, 3,000~7,000, 3,000~8,000, 3,000~9,000, 3,000~10,000, 4,000~5,000, 4,000~6,000, 4,000~7,000, 4,000~8,000, 4,000~9,000, 4,000~10,000, 5,000~6,000, 5,000~7,000, 5,0 The ranges include 00-8,000, 5,000-9,000, 5,000-10,000, 6,000-7,000, 6,000-8,000, 6,000-9,000, 6,000-10,000, 7,000-8,000, 7,000-9,000, 7,000-10,000, 8,000-9,000, 8,000-10,000 bases, or 9,000-10,000 bases.

[0050] Provided herein is a library comprising nucleic acids encoding antibodies, wherein the nucleic acid library is expressed in cells.In some cases, the library is synthesized to express a reporter gene.Exemplary reporter genes include, but are not limited to, acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta-galactosidase (LacZ), beta-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), cerulean fluorescent protein, citrine fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), luciferase, and derivatives thereof. Methods for determining regulation of reporter genes are well known in the art and include, but are not limited to, fluorescent analysis methods (e.g., fluorescence spectroscopy, fluorescence activated cell sorting (FACS), fluorescence microscopy), and antibiotic resistance determination.

[0051] Diseases and Disorders Provided herein is a library comprising nucleic acids encoding antibodies or immunoglobulins, including VHH antibodies, that may have a therapeutic effect. In some cases, the antibodies or immunoglobulins, when translated, result in a protein that is used to treat a disease or disorder. Exemplary diseases include, but are not limited to, cancer, inflammatory disease or disorder, metabolic disease or disorder, cardiovascular disease or disorder, respiratory disease or disorder, pain, digestive disease or disorder, reproductive disease or disorder, endocrine disease or disorder, or neurological disease or disorder. In some cases, the cancer is a solid cancer or a blood cancer. In some cases, the subject is a mammal. In some cases, the subject is a mouse, rabbit, dog, or human. The subject treated by the methods described herein may be an infant, an adult, or a child. The pharmaceutical composition comprising the antibody or antibody fragment described herein may be administered intravenously or subcutaneously.

[0052] In some cases, the disease or disorder is associated with TIGIT dysfunction. In some cases, the disease or disorder is associated with abnormal signaling through TIGIT. In some cases, the disease or disorder is associated with CD3 dysfunction. In some cases, the disease or disorder is associated with abnormal signaling through CD3. In some cases, the disease or disorder is cancer. In some cases, the disease or disorder is a viral infection.

[0053] Protein Targets Provided herein is a library comprising nucleic acids encoding antibodies or immunoglobulins, including VHH antibodies, that can be designed for various protein targets. In some cases, the protein is an ion channel, a G protein-coupled receptor, a tyrosine kinase receptor, an immune receptor, a membrane protein, or a combination thereof. In some cases, the protein is a receptor. In some cases, the protein is a glucagon-like peptide 1 (GLP1) receptor. In some cases, the protein is a prostaglandin D2 receptor 2 (DP2 or CRTH2) receptor. In some cases, the protein is an adenosine A2A receptor. In some cases, the protein is a T cell immune receptor with Ig and ITIM domains (TIGIT). In some cases, the protein is Cluster of Differentiation 47 (CD47). In some cases, the protein is Cluster of Differentiation 3 epsilon (CD3ε).

[0054] Provided herein are antibodies or immunoglobulins, the antibodies or immunoglobulins comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-151. In some cases, the antibody or immunoglobulin sequence comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 1-151. In some cases, the antibody or immunoglobulin sequence comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 1-151. In some cases, the antibody or immunoglobulin sequence comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 1-151. In some cases, the antibody or immunoglobulin sequence comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 1-151. In some cases, the antibody or immunoglobulin sequence includes at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, of any one of SEQ ID NOs: 1-151.

[0055] In some embodiments, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising a sequence as set forth in Table 1A, Table 14B, Table 17, and Table 20. In some embodiments, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 46-83, 118-137, or 153-163. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising at least or about 95% homology to any one of SEQ ID NOs: 46-83, 118-137, or 153-163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that comprises at least or about 97% homology to any one of SEQ ID NOs: 46-83, 118-137, or 153-163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that comprises at least or about 99% homology to any one of SEQ ID NOs: 46-83, 118-137, or 153-163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) that comprises at least or about 100% homology to any one of SEQ ID NOs: 46-83, 118-137, or 153-163. In some cases, the antibody or immunoglobulin sequence comprises a complementarity determining region (CDR) comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of any one of SEQ ID NOs: 46-83, 118-137, or 153-163.

[0056] [Table 1]

[0057] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 118-120, 129-131, 152, 155, 158, or 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that comprises at least or about 95% homology to any one of SEQ ID NOs: 118-120, 129-131, 152, 155, 158, or 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that comprises at least or about 97% homology to any one of SEQ ID NOs: 118-120, 129-131, 152, 155, 158, or 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that comprises at least or about 99% homology to any one of SEQ ID NOs: 118-120, 152, 155, 158, or 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 that comprises 100% homology to any one of SEQ ID NOs: 118-120, 129-131, 152, 155, 158, or 161. In some cases, the antibody or immunoglobulin sequence comprises a CDR1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids of any one of SEQ ID NOs: 118-120, 129-131, 152, 155, 158, or 161.

[0058] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that comprises at least or about 95% homology to any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a CDR2 that comprises at least or about 97% homology to any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that comprises at least or about 99% homology to any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that comprises 100% homology to any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that comprises at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids of any one of SEQ ID NOs: 121-123, 132-134, 153, 156, 159, or 162.

[0059] In some embodiments, the antibody or immunoglobulin sequence comprises a CDR3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 46-83, 124-128, 154, 157, 160, or 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that comprises at least or about 95% homology to any one of SEQ ID NOs: 46-83, 124-128, 125-137, 154, 157, 160, or 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that comprises at least or about 97% homology to any one of SEQ ID NOs: 46-83, 124-128, 125-137, 154, 157, 160, or 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that comprises at least or about 99% homology to any one of SEQ ID NOs: 46-83, 124-128, 125-137, 124-128, 154, 157, 160, or 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that comprises 100% homology to any one of SEQ ID NOs: 46-83, 124-128, 125-137, 124-128, 154, 157, 160, or 163. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids to any one of SEQ ID NOs: 46-83, 124-128, 125-137, 124-128, 154, 157, 160, or 163.

[0060] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:152; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:153; and a CDRH3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:154. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:152; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:153; and a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:154. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 152; a CDRH2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 153; and a CDRH3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 154.

[0061] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:155; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:156; and a CDRH3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:157. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:155; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:156; and a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:157. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 155; a CDRH2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 156; and a CDRH3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 157.

[0062] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:158; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:159; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:160. In some cases, the antibody or immunoglobulin sequence comprises a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:158; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:159; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:160. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 158; a CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 159; and a CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 160.

[0063] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:161; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:162; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:163. In some cases, the antibody or immunoglobulin sequence comprises a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:161; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:162; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:163. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a CDRL1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 161; a CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 162; and a CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 163.

[0064] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 152; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 153; and a CDRH3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 154. and a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:158; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:159; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:160. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:152; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:153; a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:154; a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:158; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:159; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:160.In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 152; a CDRH2 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 153; or a CDRH3 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 154. comprising a CDRH3 comprising a portion thereof; comprising a CDRL1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 158; comprising a CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 159; and comprising a CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 160.

[0065] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:152; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:153; and a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:154. and a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:161; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:162; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:163. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:152; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% sequence homology to SEQ ID NO:153; a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:154; a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:161; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:162; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:163.In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 152; a CDRH2 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 153; or a CDRH3 that includes at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 154. comprising a CDRH3 comprising a portion thereof; comprising a CDRL1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 161; comprising a CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 162; and comprising a CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 163.

[0066] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:155; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:156; and a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:157. and a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:158; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:159; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:160. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:155; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:156; a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:157; a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:158; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:159; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:160.In some cases, the antibody or immunoglobulin sequence is selected from the group consisting of: CDRH1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 155; CDRH2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 156; CDRH3 comprising a portion thereof; CDRL1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 158; CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 159; and CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 160.

[0067] In some embodiments, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 155; a CDRH2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 156; or a CDRH3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 157. and a CDRL1 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:161; a CDRL2 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:162; and a CDRL3 that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:163. In some cases, the antibody or immunoglobulin sequence comprises a CDRH1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:155; a CDRH2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:156; a CDRH3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:157; a CDRL1 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:161; a CDRL2 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:162; and a CDRL3 that comprises at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:163.In some cases, the antibody or immunoglobulin sequence is selected from the group consisting of: CDRH1 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 155; CDRH2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids of SEQ ID NO: 156; CDRH3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 161; CDRL2 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 162; and CDRL3 comprising at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 amino acids, or more than 16 amino acids, of SEQ ID NO: 163.

[0068] Described herein are, in some embodiments, antibodies or immunoglobulins that bind to CRTH2R. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-23 or 126-148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 1-23 or 126-148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 1-23 or 126-148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 1-23 or 126-148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 1-23 or 126-148. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a heavy chain variable domain comprising at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, of any one of SEQ ID NOs: 1-23 or 126-148.

[0069] In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 24-45 or 149-151. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 24-45 or 149-151. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 24-45 or 149-151. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 24-45 or 149-151. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 24-45 or 149-151. In some cases, the CRTH2R antibody or immunoglobulin sequence comprises a light chain variable domain comprising at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, of any one of SEQ ID NOs: 24-45 or 149-151.

[0070] Provided herein are antibodies or immunoglobulins against various protein targets. In some cases, the protein is TIGIT. Described herein are antibodies or immunoglobulins that, in some embodiments, bind to TIGIT. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 84-100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 84-100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 84-100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 84-100. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 84-100. In some cases, a TIGIT antibody or immunoglobulin sequence comprises a heavy chain variable domain that includes at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, to any one of SEQ ID NOs: 84-100.

[0071] In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 101-117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 101-117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 101-117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 101-117. In some cases, the TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 101-117. In some cases, a TIGIT antibody or immunoglobulin sequence comprises a light chain variable domain comprising at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, to any of SEQ ID NOs: 101-117.

[0072] In some cases, the protein is CD3 epsilon. Described herein are, in some embodiments, antibodies or immunoglobulins that bind to CD3. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 138-141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 138-141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 138-141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 138-141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 138-141. In some cases, the CD3 antibody or immunoglobulin sequence comprises a heavy chain variable domain comprising at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, to any of SEQ ID NOs: 138-141.

[0073] In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 142-145. In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 142-145. In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 97% sequence identity to any one of SEQ ID NOs: 142-145. In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 99% sequence identity to any one of SEQ ID NOs: 142-145. In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain that comprises at least or about 100% sequence identity to any one of SEQ ID NOs: 142-145. In some cases, the CD3 antibody or immunoglobulin sequence comprises a light chain variable domain comprising at least a portion having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 amino acids, or more than 400 amino acids, to any one of SEQ ID NOs: 142-145.

[0074] Variant Libraries Codon Variations The variant nucleic acid library described herein may comprise a plurality of nucleic acids, where each nucleic acid encodes a variant codon sequence compared to a reference nucleic acid sequence. In some cases, each nucleic acid of the first nucleic acid population comprises a variant at a single variant site. In some cases, the first nucleic acid population comprises multiple variants at a single variant site, such that the first nucleic acid population comprises multiple variants at the same variant site. The first nucleic acid population may comprise nucleic acids that collectively encode multiple codon variants at the same variant site. The first nucleic acid population may comprise nucleic acids that collectively encode up to 19 or more codons at the same position. The first nucleic acid population may comprise nucleic acids that collectively encode up to 60 variant triplets at the same position, or the first nucleic acid population may comprise nucleic acids that collectively encode up to 61 triplets of different codons at the same position. Each variant may encode a codon that produces a different amino acid during translation. Table 1B shows a list of each possible codon (and representative amino acid) at the variant site.

[0075] [Table 2]

[0076] A nucleic acid population may include perturbed nucleic acids that collectively encode up to 20 codon variations at multiple positions. In such cases, each nucleic acid in the population includes codon variations at more than one position in the same nucleic acid. In some cases, each nucleic acid in the population includes codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more codons in a single nucleic acid. In some cases, each variant length nucleic acid includes codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more codons in a single long nucleic acid. In some cases, the variant nucleic acid population comprises codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons in a single nucleic acid. In some cases, the variant nucleic acid population comprises codon variations at at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons in a single long nucleic acid.

[0077] Highly parallel nucleic acid synthesis Provided herein is a platform approach that utilizes miniaturization, parallelization, and vertical integration of end-to-end processes from polynucleotide synthesis to gene assembly on silicon and in nanowells to create an innovative synthesis platform. The devices described herein provide the same footprint as a 96-well plate, and the silicon synthesis platform is capable of up to 1,000-fold or greater increase in throughput compared to traditional synthesis methods, with the generation of up to about 1,000,000 or more polynucleotides, or 10,000 or more genes, in a single highly parallel run.

[0078] With the advent of next-generation sequencing, high-resolution genomic data has become a key enabler for research delving into the biological roles of various genes in both normal biology and disease pathogenesis. At the core of this research is the central dogma of molecular biology and the concept of "residue-by-residue transfer of sequence information." Genomic information encoded in DNA is transcribed into messages, which are translated into proteins, the active products within a given biological pathway.

[0079] Another exciting area of ​​research concerns the discovery, development, and production of therapeutic molecules focused on highly specific cellular targets. Highly diverse DNA sequence libraries are at the core of the development pipeline of targeted therapeutics. Gene variants are used to express proteins in the design, build, and test protein engineering cycle, ideally arriving at genes optimized for high expression of proteins with high affinity for the therapeutic target. As an example, consider the binding pocket of a receptor. The ability to simultaneously test all sequence permutations of all residues in the binding pocket allows for an exhaustive search and increases the probability of success. Saturation mutagenesis, in which researchers attempt to generate all possible mutations at a specific site in the receptor, represents one approach to this development challenge. Although costly, time-consuming, and laborious, this allows each variant to be introduced at every position. In contrast, combinatorial mutagenesis, in which a few selected positions or short stretches of DNA can be extensively modified, generates an incomplete repertoire of variants with biased representation.

[0080] To accelerate the drug development pipeline, libraries with the desired variants available at the correct locations and at the intended frequency available for testing, i.e., precision libraries, allow for reduced screening costs as well as turnaround time. Provided herein are methods for synthesizing nucleic acid synthetic variant libraries that provide precise introduction of each intended variant at the desired frequency. For the end user, this means not only can the sequence space be fully sampled, but these hypotheses can be queried in an efficient manner, reducing costs and screening time. Genome-wide editing can uncover important pathways, libraries where each variant and sequence permutation can be tested for optimal function, and entire pathways and genomes can be reconstructed using thousands of genes to redesign biological systems for drug discovery.

[0081] In the first instance, the drug itself can be optimized using the methods described herein. For example, to improve a particular function of the antibody, a variant polynucleotide library encoding a portion of the antibody is designed and synthesized. A variant nucleic acid library of the antibody can then be generated by the processes described herein (e.g., PCR mutagenesis followed by insertion into a vector). The antibody is then expressed in a production cell line and screened for enhanced activity. Examples of screening include examining binding affinity to the antigen, stability, or modulation of effector functions (e.g., ADCC, complement, or apoptosis). Exemplary regions for optimizing an antibody include the Fc region, the Fab region, the variable region of the Fab region, the constant region of the Fab region, the variable domains of the heavy or light chains (VH or VL), and the VH region. H or V L These include, but are not limited to, the specific complementarity determining regions (CDRs) of the

[0082] The nucleic acid library synthesized by the method described herein can be expressed in various cells related to disease state.Cells related to disease state include cell lines, tissue samples, primary cells from subjects, cultured cells expanded from subjects, or cells in model systems.Exemplary model systems include, but are not limited to, plant and animal models of disease state.

[0083] To identify variant molecules associated with the prevention, mitigation or treatment of a disease state, the variant nucleic acid library described herein is expressed in cells associated with a disease state or cells capable of inducing a disease state in cells. In some cases, an agent is used to induce a disease state in cells. Exemplary tools for disease state induction include, but are not limited to, the Cre / Lox recombination system, LPS inflammation induction, and streptozotocin to induce hypoglycemia. The cells associated with a disease state can be cells from a model system or cultured cells, as well as cells from a subject with a particular disease state. Exemplary disease states include bacterial, fungal, viral, autoimmune, or proliferative disorders (e.g., cancer). In some cases, the variant nucleic acid library is expressed in a model system, cell line, or primary cells derived from a subject and screened for changes in at least one cellular activity. Exemplary cellular activities include, but are not limited to, proliferation, cycle progression, cell death, adhesion, migration, reproduction, cell signaling, energy production, oxygen utilization, metabolic activity, and aging, response to free radical damage, or any combination thereof.

[0084] Base material The device used as a surface for polynucleotide synthesis can be in the form of a substrate, including, but not limited to, a homogenous array surface, a patterned array surface, a channel, a bead, a gel, and the like. Provided herein is a substrate comprising a plurality of clusters, each cluster comprising a plurality of loci supporting attachment and synthesis of polynucleotides. In some cases, the substrate comprises a homogenous array surface. For example, the homogenous array surface is a homogenous plate. The term "locus" as used herein refers to a structurally distinct region that provides support for a polynucleotide encoding a single predetermined sequence extending from the surface. In some cases, the locus is on a two-dimensional surface, e.g., a substantially planar surface. In some cases, the locus is on a three-dimensional surface, such as a well, a microwell, a channel, or a post. In some cases, the surface of the locus comprises a material that is actively functionalized to attach at least one nucleotide for polynucleotide synthesis, or preferably a population of identical nucleotides for synthesis of a population of polynucleotides. In some cases, polynucleotide refers to a population of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate comprises one or more surfaces of the substrate. The average error rate of polynucleotides synthesized in the libraries described herein using the systems and methods provided is often less than 1 in 1000, less than about 1 in 2000, less than about 1 in 3000, or even lower, often without error correction.

[0085] Provided herein are surfaces that support the parallel synthesis of multiple polynucleotides with different predetermined sequences at addressable locations on a common support. In some cases, the substrate may be 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, Provides support for the synthesis of over 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more non-identical polynucleotides. In some cases, the surface may be 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 100,000, 120,000, 140,0 ...00,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 100,000, 120,000, 1400, 1600, 1800, 200,000, 2 In some embodiments, the present invention provides support for the synthesis of polynucleotides encoding more than 00,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more distinct sequences. In some cases, at least some of the polynucleotides have the same sequence or are configured to be synthesized with the same sequence. In some cases, the substrate provides a surface environment for growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.

[0086] Provided herein is a method for polynucleotide synthesis at separate loci of a substrate, where each locus supports the synthesis of a population of polynucleotides. In some cases, each locus supports the synthesis of a population of polynucleotides with a sequence that is different from the population of polynucleotides grown at another locus. In some cases, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9, or more redundancies across different loci within the same cluster of loci on a surface for polynucleotide synthesis. In some cases, the loci of the substrate are located within multiple clusters. In some cases, the substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000, or more clusters. In some cases, the substrate may be 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2,000,000 , 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, or 10,000,000 or more distinct loci. In some cases, the substrate comprises about 10,000 distinct loci. The amount of loci in a single cluster varies in different cases.In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, or more loci. In some cases, each cluster includes about 50-500 loci. In some cases, each cluster includes about 100-200 loci. In some cases, each cluster includes about 100-150 loci. In some cases, each cluster includes about 109, 121, 130, or 137 loci. In some cases, each cluster includes about 19, 20, 61, 64, or more loci. Alternatively, or in combination, polynucleotide synthesis occurs on a homogenous array surface.

[0087] In some cases, the number of distinct polynucleotides synthesized on a substrate depends on the number of distinct loci available on the substrate. In some cases, the density of loci within a cluster or surface of a substrate is less than 1 mm 2 In some cases, the substrate may have at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000, or more loci per 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm 2In some cases, the distance between the centers of two adjacent loci within a cluster or surface is about 10-500, about 10-200, or about 10-100 μm. In some cases, the distance between the centers of two adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the width of each locus is about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the width of each locus is about 0.5-100, 0.5-50, 10-75, or 0.5-50 μm.

[0088] In some cases, the density of clusters within the substrate is at least or about 100 mm 2 1 cluster per 10mm 2 1 cluster per 5mm 2 1 cluster per 4mm 2 1 cluster per 3mm 2 1 cluster per 2mm 2 1 cluster per 1mm 2 1 cluster per 1mm 2 2 clusters per 1mm 2 3 clusters per 1mm 2 4 clusters per 1mm 2 5 clusters per 1mm 2 10 clusters per 1mm 2 In some cases, the substrate has 50 clusters per 10 mm 2 Approximately 1 cluster to 1 mm per 2In some cases, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is about 50-100, 50-200, 50-300, 50-500, and 100-2000 μm. In some cases, the distance between the centers of two adjacent clusters is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross-section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm. In some cases, the cross-sectional area of ​​each cluster is about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some cases, the internal cross-section of each cluster is about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0089] In some cases, the substrate is approximately the size of a standard 96-well plate, e.g., about 100 to about 200 mm by about 50 to about 150 mm. In some cases, the substrate has a diameter of about 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm or less. In some cases, the substrate has a diameter of between about 25 to 1000, 25 to 800, 25 to 600, 25 to 500, 25 to 400, 25 to 300, or 25 to 200 mm. In some cases, the substrate has a diameter of at least about 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, 50,000 mm. 2In some cases, the thickness of the substrate is between about 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

[0090] surface material The substrates, devices, and reactors provided herein are fabricated from any of a variety of materials suitable for the methods, compositions, and systems described herein. In certain examples, the substrate material is fabricated to exhibit low levels of nucleotide binding. In some cases, the substrate material is modified to generate distinct surfaces that exhibit high levels of nucleotide binding. In some cases, the substrate material is transparent to visible and / or UV light. In some cases, the substrate material is sufficiently conductive, e.g., capable of forming a uniform electric field across all or a portion of the substrate. In some cases, the conductive material is connected to an electrical ground. In some cases, the substrate is thermally conductive or thermally insulating. In some cases, the material is chemically and heat resistant to support chemical or biochemical reactions, e.g., polynucleotide synthesis reaction processes. In some cases, the substrate comprises a flexible material. In the case of a flexible material, the material includes, but is not limited to, nylon, nitrocellulose, polypropylene, and the like, both modified and unmodified. In some cases, the substrate comprises a rigid material. For rigid materials, the materials may include, but are not limited to, glass, fused silica, silicon, plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, etc.), metals (e.g., gold, platinum, etc.). The substrate, solid support, or reactor may be made from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. The substrate / solid support or microstructures therein, reactor may be made from a combination of materials listed herein or any other suitable materials known in the art.

[0091] surface structure Provided herein are substrates for the methods, compositions, and systems described herein, the substrates having a surface structure suitable for the methods, compositions, and systems described herein. In some cases, the substrates include raised and / or depressed features. One advantage of having such features is an increase in surface area for supporting polynucleotide synthesis. In some cases, substrates with raised and / or depressed features are referred to as three-dimensional substrates. In some cases, the three-dimensional substrates include one or more channels. In some cases, one or more loci constitute the channels. In some cases, the channels are accessible for reagent deposition via a deposition device, such as a material deposition device. In some cases, reagents and / or fluids are collected in a larger well of one or more channels in fluid communication. For example, the substrate includes multiple channels corresponding to multiple loci with a cluster, the multiple channels being in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized in a cluster of multiple loci.

[0092] Provided herein are substrates for the methods, compositions, and systems described herein, where the substrates are configured for polynucleotide synthesis. In some cases, the structure is configured to allow controlled flow and mass transfer pathways for polynucleotide synthesis on the surface. In some cases, the substrate configuration allows for controlled and uniform distribution of mass transfer pathways, chemical exposure time, and / or washing efficiency during polynucleotide synthesis. In some cases, the substrate configuration allows for increased sweep efficiency, for example, by providing sufficient volume for growing polynucleotides such that the volume displaced by growing polynucleotides is no more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less of the initial available volume available or suitable for growing polynucleotides. In some cases, the three-dimensional structure allows for managed flow of fluids, allowing for rapid exchange of chemical exposure.

[0093] Provided herein are substrates for the methods, compositions, and systems described herein, which include structures suitable for the methods, compositions, and systems described herein. In some cases, separation is achieved by physical structures. In some cases, separation is achieved by differential functionalization of the surface to create active and passive areas for polynucleotide synthesis. In some cases, differential functionalization is achieved by alternating hydrophobicity across the substrate surface, thereby creating a water contact angle effect that causes beading or wetting of the deposited reagents. Larger structures can be employed to reduce splashing and cross-contamination of separate polynucleotide synthesis locations by reagents from adjacent spots. In some cases, a device such as a material deposition device is used to deposit reagents at separate polynucleotide synthesis locations. Substrates with three-dimensional features are configured to allow synthesis of a large number of polynucleotides (e.g., greater than about 10,000) with low error rates (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some cases, the substrates have about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 features / mm 2 The feature has a density of .

[0094] A well in the substrate may have the same or different width, height, and / or volume as another well in the substrate. A channel in the substrate may have the same or different width, height, and / or volume as another channel in the substrate. In some cases, the diameter of the cluster or the diameter of the well containing the cluster, or both, is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, the diameter of the clusters and / or wells is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some cases, the diameter of the clusters and / or wells is about 1.0-1.3 mm. In some cases, the diameter of the clusters and / or wells is about 1.150 mm. In some cases, the diameter of the clusters and / or wells is about 0.08 mm. The diameter of the clusters refers to the clusters within a two-dimensional or three-dimensional substrate.

[0095] In some cases, the height of the wells is about 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 μm. In some cases, the height of the wells is less than about 1000, 900, 800, 700, or 600 μm.

[0096] In some cases, the substrate includes a plurality of channels corresponding to a plurality of loci in the cluster, and the height or depth of the channels is between 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 μm. In some cases, the height of the channels is less than 100, 80, 60, 40, or 20 μm.

[0097] In some cases, the diameter of a channel, locus (e.g., in a substantially planar substrate), or both the channel and locus (e.g., in a three-dimensional substrate where the locus corresponds to a channel) is about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 μm, e.g., about 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the diameter of a channel, locus, or both the channel and locus is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the distance between the centers of two adjacent channels, loci, or channels and loci is about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, e.g., about 20 μm.

[0098] surface modification Provided herein are methods for polynucleotide synthesis on a surface, where the surface comprises various surface modifications. In some cases, surface modifications are used to chemically and / or physically modify a surface by additive or subtractive processes to modify one or more chemical and / or physical properties of the substrate surface, or selected sites or regions of the substrate surface. For example, surface modifications include, but are not limited to, (1) modifying the wetting properties of the surface; (2) functionalizing the surface, i.e., providing, modifying, or replacing surface functional groups; (3) defunctionalizing the surface, i.e., removing surface functional groups; (4) otherwise altering the chemical composition of the surface, for example, through etching; (5) increasing or decreasing surface roughness; (6) providing a coating on the surface, for example, providing a coating that exhibits different wetting properties from the wetting properties of the surface; and / or (7) depositing particles on the surface.

[0099] In some cases, the addition of a chemical layer on top of the surface (referred to as an adhesion promoter) facilitates structured patterning of loci on the surface of the substrate. Exemplary surfaces for applying adhesion promoters include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some cases, a second chemical layer is deposited on the surface of the substrate. In some cases, the second chemical layer has a low surface energy. In some cases, the surface energy of the chemical layer coated on the surface supports localization of the droplets on the surface. Depending on the pattern arrangement selected, the proximity of the loci and / or the area of ​​fluid contact at the loci can be altered.

[0100] In some cases, the substrate surface or resolved locus on which nucleic acids or other moieties are deposited, for example for polynucleotide synthesis, is smooth or substantially planar (e.g., two-dimensional), or has irregularities such as raised or depressed features (e.g., three-dimensional features). In some cases, the substrate surface is modified with one or more distinct layers of compounds. Such modified layers of interest include, but are not limited to, inorganic and organic layers, such as metals, metal oxides, polymers, and organic small molecules.

[0101] In some cases, the decomposed loci of the substrate are functionalized with one or more moieties that increase and / or decrease the surface energy. In some cases, the moieties are chemically inert. In some cases, the moieties are configured to support one or more processes in a desired chemical reaction, such as a polynucleotide synthesis reaction. The surface energy, or hydrophobicity, of the surface is a factor in determining the affinity of nucleotides to attach to the surface. In some cases, a method for functionalizing a substrate includes (a) providing a substrate having a surface comprising silicon dioxide, and (b) silanizing the surface using a suitable silanizing agent, such as an organofunctional alkoxysilane molecule, described herein or otherwise known in the art. Methods and functionalizing agents are described in U.S. Pat. No. 5,474,796, the entirety of which is incorporated herein by reference.

[0102] In some cases, the substrate surface is functionalized by contact with a derivatization composition comprising a mixture of silanes under reaction conditions effective to bond the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface.Silanization generally involves coating the surface by self-assembly with organofunctional alkoxysilane molecules.Various siloxane functionalization reagents can further be used as currently known in the art, for example, to lower or increase surface energy.Organofunctional alkoxysilanes are classified according to their organic functionality.

[0103] Polynucleotide Synthesis The currently disclosed method for polynucleotide synthesis may include a process that includes phosphoramidite chemistry. In some cases, polynucleotide synthesis includes coupling a base with a phosphoramidite. Polynucleotide synthesis may include coupling of a base by deposition of a phosphoramidite under coupling conditions, where the same base is optionally deposited more than once with the phosphoramidite, i.e., double coupling. Polynucleotide synthesis may include capping of unreacted sites. In some cases, capping is optional. Polynucleotide synthesis may also include oxidation or an oxidation step or multiple oxidation steps. Polynucleotide synthesis may include deblocking, detritylation, and sulfurization. In some cases, polynucleotide synthesis includes either oxidation or sulfurization. In some cases, the device is washed between one or each step during the polynucleotide synthesis reaction, for example, using tetrazole or acetonitrile. The time frame for any one step of the phosphoramidite synthesis method can be less than about 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds, and 10 seconds.

[0104] Polynucleotide synthesis using the phosphoramidite method may include the subsequent addition of phosphoramidite building blocks (e.g., nucleoside phosphoramidites) to a growing polynucleotide chain for the formation of a phosphite triester bond. Phosphoramidite polynucleotide synthesis proceeds in the 3' to 5' direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some cases, each synthesis cycle includes a coupling step. Phosphoramidite coupling involves the formation of a phosphite triester bond between an activated nucleoside phosphoramidite and a nucleoside bound to a substrate, for example, via a linker. In some cases, the nucleoside phosphoramidite is provided to an activated device. In some cases, the nucleoside phosphoramidite is provided to a device with an activator. In some cases, the nucleoside phosphoramidite is provided to the device in 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 times or more excess of the nucleoside bound to the substrate. In some cases, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment, for example, in anhydrous acetonitrile. Following the addition of the nucleoside phosphoramidite, the device is optionally washed. In some cases, the coupling step is repeated one or more times, optionally with a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some cases, the polynucleotide synthesis method used herein comprises one, two, three, or more consecutive coupling steps. Prior to coupling, the device-bound nucleoside is often deprotected by removal of a protecting group, which serves to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).

[0105] Following coupling, the phosphoramidite polynucleotide synthesis method optionally includes a capping step, in which the growing polynucleotide is treated with a capping agent. The capping step serves to block unreacted substrate-bound 5'-OH groups after coupling to prevent the formation of polynucleotides with internal base deletions. In addition, 1H-tetrazole-activated phosphoramidites may react slightly with the O6 position of guanosine. Without being bound by theory, this by-product may undergo depurination, possibly via O6-N7 migration, upon oxidation with I2 / water. During the final deprotection of the polynucleotide, the site of the apurinated base may be cleaved, reducing the yield of the full-length product. The O6 modification may be removed by treatment with a capping reagent prior to oxidation with I2 / water. In some cases, the inclusion of a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. In one example, the capping step involves treating the substrate-bound polynucleotides with a mixture of acetic anhydride and 1-methylimidazole.Following the capping step, the device is optionally washed.

[0106] In some cases, after addition of nucleoside phosphoramidites, and optionally after capping and one or more washing steps, the growing nucleic acid bound to the device is oxidized. The oxidation step involves oxidation of the phosphite triester to a tetracoordinate phosphate triester, which is a protected precursor of the naturally occurring phosphodiester internucleoside linkage. In some cases, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be performed under anhydrous conditions, for example, using tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, oxidation is followed by a capping step. A second capping step allows drying of the device, since residual water from possible continued oxidation may inhibit subsequent coupling. Following oxidation, the device and the growing polynucleotide are optionally washed. In some cases, the oxidation step is replaced by a sulfurization step to obtain polynucleotide phosphorothioates, where an optional capping step can be performed after sulfurization. Many reagents are capable of efficient sulfur transfer, including but not limited to 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, also known as Beaucage reagent, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, and N,N,N',N'-tetraethylthiuram disulfide (TETD).

[0107] For the next cycle of nucleoside incorporation via coupling to occur, the protected 5' end of the growing polynucleotide bound to the device is removed, resulting in the primary hydroxyl group reacting with the next nucleoside phosphoramidite. In some cases, the protecting group is DMT, and deblocking occurs with trichloroacetic acid in dichloromethane. Longer times or stronger than recommended acid solutions for detritylation can result in increased depurination of the polynucleotide bound to the solid support, thus reducing the yield of the desired full-length product. The disclosed methods and compositions described herein provide controlled deblocking conditions that limit undesired depurination reactions. In some cases, the polynucleotide bound to the device is washed after deblocking. In some cases, efficient washing after deblocking contributes to the synthesis of polynucleotides with low error rates.

[0108] Methods for the synthesis of polynucleotides typically involve a repeated sequence of the following steps: application of a protected monomer to an active functionalized surface (e.g., locus) for linking with either an activated surface, a linker, or a previously deprotected monomer; deprotection of the applied monomer to react with a later applied protected monomer; and application of another protected monomer for conjugation. One or more intermediate steps include oxidation or sulfurization. In some cases, one or all of the steps are preceded or followed by one or more washing steps.

[0109] Methods for phosphoramidite-based polynucleotide synthesis include a series of chemical steps. In some cases, one or more steps of the synthesis method include reagent cycling, which involves applying a reagent useful for that step to the device. For example, the reagent is cycled through a series of liquid deposition and vacuum drying steps. In the case of substrates that include three-dimensional features such as wells, microwells, channels, etc., the reagent is optionally passed through one or more regions of the device via the wells and / or channels.

[0110] The method and system described herein relates to a polynucleotide synthesis device for synthesizing polynucleotides.Synthesis can be performed in parallel.For example, at least or about at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel can be 2-100000, 3-50000, 4-10000, 5-1000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, 30-35. Those skilled in the art will appreciate that the total number of polynucleotides synthesized in parallel can fall within any range bounded by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel can fall within any range defined by any of the values ​​that serve as the endpoints of the range. The total molar mass of the polynucleotides synthesized in the device or the molar mass of each polynucleotide can be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles or more. The length of each polynucleotide or the average length of the polynucleotides in the device can be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.The length of each polynucleotide or the average length of the polynucleotides in the device can be at most, or at most, about 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each polynucleotide or the average length of the polynucleotides in the device can be in the range of 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. One of skill in the art will appreciate that the length of each polynucleotide or the average length of the polynucleotides in the device can fall within any range bounded by any of these values, e.g., 100-300. The length of each polynucleotide or the average length of the polynucleotides in the device can fall within any range defined by either of the values ​​serving as the endpoints of the range.

[0111] The method for synthesizing polynucleotides on a surface provided herein allows for high-speed synthesis. For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides or more are synthesized per hour. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs / modified versions thereof. In some cases, libraries of polynucleotides are synthesized in parallel on a substrate. For example, a device containing about or at least about 100, 1,000, 10,000, 30,000, 75,000, 100,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, or 5,000,000 decomposed loci can support the synthesis of at least as many distinct polynucleotides, where polynucleotides encoding distinct sequences are synthesized on the decomposed loci. In some cases, a library of polynucleotides is synthesized within about 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less on a low error rate device described herein. In some cases, larger nucleic acids assembled from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein are prepared within about 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less.

[0112] In some examples, the methods described herein provide for the generation of a library of nucleic acids that include variant nucleic acids that differ at multiple codon sites. In some cases, the nucleic acids can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or more variant codon sites.

[0113] In some cases, one or more of the variant codon sites may be contiguous. In some cases, one or more of the variant codon sites may not be contiguous and separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.

[0114] In some cases, a nucleic acid may contain multiple sites of a variant codon site, where all the variant codon sites are adjacent to each other, forming a stretch of variant codon sites. In some cases, a nucleic acid may contain multiple sites of a variant codon site, where none of the variant codon sites are adjacent to each other. In some cases, a nucleic acid may contain multiple sites of a variant codon site, where some variant codon sites are adjacent to each other, forming a stretch of variant codon sites, and some variant codon sites are not adjacent to each other.

[0115] Referring to the drawings, Figure 7 shows an exemplary process workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids. The workflow is generally divided into phases: (1) de novo synthesis of single-stranded nucleic acid libraries, (2) joining nucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) shipping. Prior to de novo synthesis, a nucleic acid sequence or group of nucleic acid sequences of interest is preselected. For example, a group of genes is preselected for production.

[0116] Once a large nucleic acid is selected for production, a given nucleic acid library is designed for de novo synthesis. Various suitable methods are known for generating high density polynucleotide arrays. In the example workflow, a surface layer of the device is provided. In this example, the chemistry of the surface is modified to improve the polynucleotide synthesis process. Areas of low surface energy are generated to repel liquids, and areas of high surface energy are generated to attract liquids. The surface itself can be in the form of a flat surface, or can include geometric variations such as protrusions or microwells that increase the surface area. In the example workflow, the selected high surface energy molecules serve a dual function of supporting DNA chemistry, as disclosed in International Patent Application Publication WO / 2015 / 021080, the entirety of which is incorporated herein by reference.

[0117] In situ preparation of polynucleotide arrays is generated on a solid support and utilizes a single nucleotide extension process to extend multiple oligomers in parallel. A deposition device, such as a material deposition device, is designed to release reagents in a stepwise manner so that multiple polynucleotides are extended in parallel one residue at a time to generate oligomers with a predetermined nucleic acid sequence 102. In some cases, the polynucleotides are cleaved from the surface at this stage. Cleavage includes, for example, gas cleavage with ammonia or methylamine.

[0118] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also called a "nanoreactor") is a silicon-coated well containing PCR reagents and lowered over the polynucleotide library 103. Reagents are added to release the polynucleotides from the substrate before or after sealing 104 of the polynucleotides. In the exemplary workflow, the polynucleotides are released following sealing of the nanoreactor 105. Once released, fragments of single-stranded polynucleotides hybridize to span the entire long-range sequence of DNA. Partial hybridization 105 is possible because each synthesized polynucleotide is designed to have a small portion that overlaps with at least one other polynucleotide in the pool.

[0119] After hybridization, the PCA reaction is initiated. During polymerase cycles, polynucleotides anneal to complementary fragments and gaps are filled by the polymerase. Each cycle randomly increases the length of the various fragments, depending on which polynucleotides find each other. Complementarity between the fragments allows the formation of a completely large span of double-stranded DNA106.

[0120] After PCA is complete, the nanoreactors are separated from the device 107 and positioned for interaction with a device with primers for PCR 108. After sealing, the nanoreactors are subjected to PCR 109 to amplify larger nucleic acids. After PCR 110, the nanochambers are opened 111, error correction reagents are added 112, the chambers are sealed 113, and an error correction reaction occurs to remove mismatched base pairs and / or less complementary strands from the double-stranded PCR amplification products 114. The nanoreactors are opened and separated 115. The error-corrected products are then subject to additional processing steps such as PCR and molecular barcoding and packaged 122 for shipping 123.

[0121] In some cases, quality control measures are taken. After error correction, quality control steps include, for example, interacting the wafer with sequencing primers for amplification of the error-corrected product 116, sealing the wafer into a chamber containing the error-corrected amplification product 117, and performing an additional round of amplification 118. The nanoreactors are opened 119, the products are pooled 120, and sequenced 121. After an acceptable quality control decision is made, the packaged product 122 is approved for shipment 123.

[0122] In some cases, nucleic acids generated by a workflow such as that of Figure 1 are subjected to mutagenesis using overlapping primers as disclosed herein. In some cases, a library of primers is generated by in situ preparation on a solid support and a single nucleotide extension process is utilized to extend multiple oligomers in parallel. A deposition apparatus, such as a material deposition apparatus, is designed to release reagents in a stepwise manner such that multiple polynucleotides are extended in parallel one residue at a time to generate oligomers having a predetermined nucleic acid sequence 102.

[0123] Computer Systems Any of the systems described herein may be operably linked to a computer and automated via a computer, either locally or remotely. In various examples, the methods and systems of the present disclosure may further include software programs on a computer system and their use. Thus, computer control for synchronization of dispense / vacuum / replenishment functions, such as coordination and synchronization of material deposition device movement, dispense operations, and vacuum operation, is within the scope of the present disclosure. The computer system can be programmed to interface between the user-specified base sequence and the location of the material deposition device to deliver the correct reagent to the designated area of ​​the substrate.

[0124] The computer system 200 illustrated in FIG. 2 can be understood as a logical device that can read instructions from a medium 211 and / or a network port 205, which can be optionally connected to a server 209 having a fixed medium 212. A system as illustrated in FIG. 2 can include a CPU 201, a disk drive 203, optional input devices such as a keyboard 215 and / or a mouse 216, and an optional monitor 207. Data communication can be achieved to a server at a local or remote location via the illustrated communication medium. The communication medium can include any means of transmitting and / or receiving data. For example, the communication medium can be a network connection, a wireless connection, or an Internet connection. Such a connection can provide communication via the World Wide Web. It is envisioned that data related to the present disclosure can be transmitted via such a network or connection for receipt and / or review by a party 222 as illustrated in FIG. 2.

[0125] As shown in FIG. 3, a high speed cache 304 may be connected to or incorporated into the processor 302 to provide high speed memory for instructions or data recently or frequently used by the processor 302. The processor 302 is connected to a north bridge 306 by a processor bus 308. The north bridge 306 is connected to a random access memory (RAM) 310 by a memory bus 312 and manages access to the RAM 310 by the processor 302. The north bridge 306 is also connected to a south bridge 314 by a chipset bus 316. The south bridge 314 is in turn connected to a peripheral bus 318. The peripheral bus may be, for example, a PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as the processor chipset and manage data transfers between the processor, RAM, and peripheral components on the peripheral bus 318. In some alternative architectures, instead of using a separate north bridge chip, the functionality of the north bridge may be incorporated into the processor. In some cases, the system 300 may include an accelerator card 322 connected to the peripheral bus 318. An accelerator may include a field programmable gate array (FPGA) or other hardware for accelerating a particular process. For example, an accelerator may be used for adaptive data reconstruction or evaluation of algebraic expressions used in extended set processing.

[0126] Software and data may be stored on external storage 324 and loaded into RAM 310 and / or cache 304 for use by the processor. System 300 includes an operating system for managing system resources, non-limiting examples of which include Linux, Windows, MACOS, BlackBerry OS, iOS, and other functionally equivalent operating systems, as well as application software running on the operating system for managing data storage and optimization according to examples of the present disclosure. In this example, system 300 also includes network interface cards (NICs) 320 and 321 connected to the peripheral bus to provide a network interface to external storage, such as network attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0127] FIG. 4 illustrates a network 400 with multiple computer systems 402a and 402b, multiple mobile phones and personal data assistants 402c, and network attached storage (NAS) 404a and 404b. In an exemplary case, systems 402a, 402b, and 402c can manage data storage and optimize data access for data stored in network attached storage (NAS) 404a and 404b. Mathematical models can be used on the data and evaluated using distributed parallel processing across computer systems 402a and 402b and mobile phone and personal digital assistant system 402c. Computer systems 402a and 402b and mobile phone and personal digital assistant system 402c can also provide parallel processing for adaptive data reconstruction of data stored in network attached storage (NAS) 404a and 404b. FIG. 4 illustrates only one example, and a wide variety of other computer architectures and systems can be used in conjunction with various examples of the present disclosure. For example, blade servers can be used to provide parallel processing. Processor blades can be connected through a backplane to provide parallel processing. Storage can be connected to the backplane or through another network interface as network attached storage (NAS). In some cases, processors can maintain separate memory spaces and send data through a network interface, backplane, or other connector for parallel processing by other processors. In other examples, some or all processors can use a shared virtual address memory space.

[0128] FIG. 5 is a block diagram of a multiprocessor computer system 500 using a shared virtual address memory space, according to an exemplary case. The system includes multiple processors 502a-f that can access a shared memory subsystem 504. The system incorporates multiple programmable hardware memory algorithm processors (MAPs) 506a-f in the memory subsystem 504. Each MAP 506a-f can include a memory 508a-f and one or more field programmable gate arrays (FPGAs) 510a-f. The MAPs provide configurable functional units that can provide specific algorithms or parts of algorithms to the FPGAs 510a-f for processing in close cooperation with the respective processors. For example, the MAPs can be used to evaluate algebraic expressions over a data model or to perform adaptive data restructuring in an exemplary case. In this example, for these purposes, all processors have global access to each MAP. In one configuration, each MAP can access the associated memory 508a-f using direct memory access (DMA), allowing it to perform tasks independently and asynchronously from the respective microprocessors 502a-f. In this configuration, a MAP can feed its results directly into another MAP for algorithm pipelining and parallel execution.

[0129] The above computer architectures and systems are merely examples, and a wide variety of other computer, mobile phone, and personal digital assistant architectures and systems can be used in connection with the exemplary cases, including systems that use general processors, coprocessors, FPGAs and other programmable logic devices, systems on a chip (SOC), application specific integrated circuits (ASICs), and any combination of other processing and logic elements. In some cases, all or part of the computer system can be implemented in software or hardware. Any of a variety of data storage media can be used in connection with the exemplary cases, including random access memory, hard drives, flash memory, tape drives, disk arrays, network attached storage (NAS), and other local or distributed data storage devices and systems.

[0130] In an exemplary case, the computer system may be implemented using software modules executing on any of the above or other computer architectures and systems. In other examples, the functionality of the system may be implemented partially or fully in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in FIG. 3, systems on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements. For example, the set processor and optimizer may be implemented with hardware acceleration by using a hardware accelerator card such as accelerator card 322 illustrated in FIG. 3.

[0131] The following examples are presented to more clearly illustrate to those skilled in the art the principles and practice of the embodiments disclosed herein, and should not be construed as limiting the scope of the claimed embodiments. Unless otherwise specified, all parts and percentages are by weight. EXAMPLES

[0132] The following examples are provided for the purpose of illustrating various embodiments of the present disclosure, and are not meant to limit the present disclosure in any manner. The examples, together with the methods described herein, are representative of currently preferred embodiments, are exemplary, and are not intended to limit the scope of the present disclosure. Those skilled in the art will appreciate that modifications therein and other uses fall within the spirit of the disclosure as defined by the scope of the claims.

[0133] Example 1: Functionalization of the device surface The device was functionalized to support the attachment and synthesis of libraries of polynucleotides. The surface of the device was first wet cleaned using a piranha solution containing 90% H2SO4 and 10% H2O2 for 20 min. The device was rinsed with DI water in several beakers, held under a DI water tap for 5 min, and dried with N2. The device was subsequently immersed in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a hand gun, immersed in three successive beakers with DI water for 1 min each, and then rinsed again with DI water using a hand gun. The device was then plasma cleaned by exposing the surface of the device to O2. O2 plasma etching was performed using a SAMCO PC-300 instrument in downstream mode at 250 watts for 1 min.

[0134] The cleaned device surfaces were actively functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P deposition oven system with the following parameters: 0.5-1 torr, 60 min, 70 °C, evaporator at 135 °C. The device surfaces were resist coated using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin coated onto the devices at 2500 rpm for 40 s. The devices were pre-baked at 90 °C for 30 min on a Brewer hotplate. The devices were subjected to photolithography using a Kurl Sus MA6 mask aligner tool. The devices were exposed for 2.2 s and developed with MSF 26A for 1 min. The remaining developer was washed off with a hand gun and the devices were immersed in water for 5 min. The devices were baked in an oven at 100 °C for 30 min and then visually inspected for lithographic defects using a Nikon L200. The descum process was used to remove residual resist using a SAMCO PC-300 instrument and O2 plasma etched at 250 watts for 1 min.

[0135] The device surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL of light mineral oil. The device was placed in a chamber and pumped for 10 min, after which the valve was closed to the pump and left for 10 min. The chamber was vented to air. Resist stripping of the device was performed by immersing it twice in 500 mL nMP at 70 °C for 5 min using sonication at maximum power (9 on the Crest system). The device was then immersed in 500 mL isopropanol at room temperature for 5 min and sonicated at maximum power. The device was then immersed in 300 mL 200 proof ethanol and blown dry with N2. The functionalized surface was then activated to serve as a support for polynucleotide synthesis.

[0136] Example 2: Synthesis of 50-mer sequences on an oligonucleotide synthesis device The two-dimensional oligonucleotide synthesis device was assembled into a flow cell, which was connected to a flow cell (Applied Biosystems (ABI394 DNA synthesizer)). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest) and used to synthesize an exemplary polynucleotide of 50 bp ("50-mer polynucleotide") using the polynucleotide synthesis methods described herein.

[0137] The sequence of the 50-mer was as set forth in SEQ ID NO:2. 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO: 2), where # indicates thymidine-succinylhexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows release of the oligo from the surface during deprotection.

[0138] The synthesis was carried out using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocols in Table 3 and on an ABI synthesizer.

[0139] [Table 3] JPEG2025037968000005.jpg186148

[0140] The phosphoramidite / activator combination was delivered similarly to the delivery of bulk reagents through the flow cell: no drying step was performed since the environment was always "wet" with reagents.

[0141] To allow for faster flows, the flow restrictor was removed from the ABI 394 synthesizer. Without the flow restrictor, the flow rates were approximately ~100 μL / sec for amidites (0.1 M in ACN), activator (0.25 M benzoylthiotetrazole ("BTT"; 30-3070-xx from GlenResearch) in ACN, and Ox (0.02 M I2 in 20% pyridine, 10% water and 70% THF), acetonitrile ("ACN") and capping reagent (a 1:1 mix of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% in THF). For Oxidant (1-methylimidizole), it was approximately ∼200 μL / sec, and for Deblock (3% dichloroacetic acid in toluene), it was approximately ∼300 μL / sec (compared to ∼50 μL / sec for all reagents with flow restrictors). The time to fully pump out the oxidizer was observed and the timing of the chemical flow times was adjusted accordingly, and additional ACN washes were introduced between the different chemicals. After polynucleotide synthesis, the chip was deprotected with gaseous ammonia at 75 psi overnight. To recover the polynucleotides, five drops of water were applied to the surface. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip.

[0142] Example 3: Synthesis of 100-mer sequences on an oligonucleotide synthesis device The same process described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer polynucleotide ("100-mer polynucleotide"; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3'), where # indicates thymidine-succinylhexamide CED phosphoramidite (CLP-2244 from ChemGenes, SEQ ID NO: 105) on two different silicon chips, the first functionalized uniformly with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide and the second functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotide extracted from the surface was analyzed on a BioAnalyzer instrument.

[0143] All 10 samples from the two chips were run using the forward (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO: 106) and reverse (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO: 107) primers in 50 μL PCR mix (25 μL NEB Q5 master mix, 2.5 μL 10 μM forward primer, 2.5 μL 10 μM reverse primer, 1 μL polynucleotide extracted from the surface, and up to 50 μL water) with the following thermal cycling program: 98℃, 30 seconds 98℃, 10 sec; 63℃, 10 sec; 72℃, 10 sec; repeat 12 cycles 72℃, 2 minutes. was used for further PCR amplification.

[0144] The PCR products were also run on a BioAnalyzer and showed a sharp peak at the 100-mer position. The PCR amplified samples were then cloned and Sanger sequenced. Table 3 summarizes the results of Sanger sequencing for samples taken from spots 1-5 from chip 1 and spots 6-10 from chip 2.

[0145] [Table 4]

[0146] Thus, the high quality and uniformity of the synthesized polynucleotides was replicated on two chips with different surface chemistry features. Overall, 89% of the sequenced 100-mers were error-free perfect sequences, representing 233 out of 262.

[0147] Table 4 summarizes the error characteristics of sequences obtained from polynucleotide samples from spots 1 to 10.

[0148] [Table 5] JPEG2025037968000008.jpg66170

[0149] Example 4: VHH library Synthetic VHH libraries were developed. For the "VHH Ratio" library with adjusted CDR diversity, 2391 VHH sequences (iCAN database) were aligned using Clustal Omega, a consensus at each position was determined, and frameworks were derived from the consensus at each position. All CDRs of the 2391 sequences were analyzed for position-specific variation, and this diversity was introduced into the library design. For the "VHH Shuffle" library with shuffled CDR diversity, the iCAN database was scanned for unique CDRs within the nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, and frameworks were derived from the consensus at each framework position within the 2391 sequences of the iCAN database. Each of the unique CDRs was individually synthesized and shuffled in the consensus framework, generating a library with a theoretical diversity of 3.2×10^9. The library was then cloned into a phagemid vector using restriction enzyme digestion. For the "VHH hShuffle" library (a synthetic "human" VHH library with shuffled CDR diversity), the iCAN database was scanned for unique CDRs within the nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, with frameworks 1, 3, and 4 derived from the human germline DP-47 framework. Framework 2 was derived from a consensus at each framework position within 2391 sequences in the iCAN database. Each unique CDR was individually synthesized and shuffled in a partially humanized framework using the NΜGE tool, generating a library with a theoretical diversity of 3.2×10^9. The library was then cloned into a phagemid vector using the NΜGE tool.

[0150] The binding affinity and affinity distribution of VHH-Fc variants were assessed using the Carterra SPR system (data not shown). Table 5A shows the binding affinity and affinity distribution of VHH-Fc variants by ELISA, Protein A (mg / ml), and K D Specific values ​​of VHH-Fc clones in terms of affinity (nM) are provided. Figures 7A and 7B show the TIGIT affinity distribution of the VHH library across affinity thresholds of 20-4000 (Figure 7A; monovalent KD) and 20-1000 (Figure 7B; monovalent KD). Of the 140 VHH binders tested, 51 variants had affinities below 100 nM and 90 variants had affinities below 200 nM. Figure 8 shows the data of CDR3 counts per length for the "VHH ratio" library, the "VHH shuffle library" and the "VHH hShuffle library". Table 5B shows the number of TIGIT unique clones and TIGIT binders for the "VHH ratio" library, the "VHH Shuffle library" and the "VHH hShuffle library".

[0151] [Table 6] JPEG2025037968000010.jpg47170

[0152] Thermostability and competition analysis of VHH-Fc TIGIT clones can be seen in Figure 9 and Table 6. For competition assays, 4 μg / mL TIGIT was immobilized and incubated with 0.05–100 nM VHH-Fc, followed by incubation with 2 μg / mL biotin-CD155 and 1:5000 streptavidin-HRP.

[0153] [Table 7]

[0154] CD47 VHH variants were also generated and analyzed. Figure 10 shows the CD47 affinity distribution. Table 7 shows the number of CD47-specific clones and TIGIT binders in the "VHH ratio" library, the "VHH shuffle library," and the "VHH hShuffle library." Table 8 shows the binding affinity of the CD47 VHH variants. As seen in Table 8, eight CD47VHH binders had affinities less than 100 nM for hCD47 and six CD47VHH binders had affinities less than 100 nM for cCD47.

[0155] [Table 8]

[0156] [Table 9]

[0157] Inhibition and thermostability analysis of VHH-Fc CD47 clones can be seen in Figure 11 and Table 9. For inhibition assays, 3 μg / mL CD47 was immobilized and incubated with 0.3-132 nM VHH-Fc, followed by incubation with 0.25 μg / mL biotin-SIRP alpha and 1:5000 streptavidin-HRP.

[0158] [Table 10]

[0159] Example 5. VHH library for GLP1R A VHH library for GLP1R was developed similarly to the method described in Example 4. Briefly, stable cell lines expressing GLP1R were generated and target expression was confirmed by FACS. Cells expressing more than 80% of the target were then used for cell-based selection. Five rounds of cell-based selection were performed on cells stably overexpressing the target of interest. Each round of selection included 10 8 10 cells were used. Phages from each round were first diluted with 10 8 The clones were depleted with 1000 CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. Then, trypsin was used to elute the cells from the phages, which were amplified for the next round of panning. A total of 1000 clones from rounds 4 and 5 were sequenced by NGS to identify unique clones for reformatting as VHH-Fc.

[0160] 53 of the 156 unique GLP1R VHH Fc binders had target cell mean fluorescence intensity (MFI) values ​​that were 2-fold higher than the parental cells. Data for variant GLP1R-43-77 are shown in Figures 12A-12B and Tables 10-11. Table 11 shows flow cytometry data detected in the RL1-A channel.

[0161] [Table 11]

[0162] [Table 12]

[0163] Example 6. VHH library for CRTH2R A VHH library for CRTH2R was developed similarly to the method described in Example 4. Briefly, stable cell lines expressing CRTH2R were generated and target expression was confirmed by FACS. Cells expressing more than 80% of the target were then used for cell-based selection. Five rounds of cell-based selection were performed on cells stably overexpressing the target of interest. Each round of selection included 10 8 10 cells were used. Phages from each round were first diluted with 10 8 The clones were depleted with 1000 CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. Then, trypsin was used to elute the cells from the phages, which were amplified for the next panning round. A total of 1000 clones from rounds 4 and 5 were sequenced by NGS to identify unique clones for reformatting as VHH-Fc.

[0164] 26 of the 175 unique CRTH2R VHH Fc binders had target cell mean fluorescence intensity (MFI) values ​​that were twice that of the parental cells. Data for variant CRTH2-41-51 are shown in Figures 13A-13B and Tables 12-13. Table 13 shows the flow cytometry data detected in the RL1-A channel. Data for variant CRTH2-44-59 are seen in Figures 14A-14D.

[0165] [Table 13]

[0166] [Table 14]

[0167] Example 7. Identification of IgG for CRTH2R Anti-CRTH2R antibody cell binding was determined by testing CHO CRTH2R positive cells (GFP+) and parental CHO cells (GFP-) and comparing parental negative cells with target positive cells to exclude false positives. Antibodies listed in Table 14A were titrated 3-fold starting at 100 nM (15 μg / mL) for a total of 8 points. The heavy and light chain sequences of CRTH2R IgG antibodies are shown in Table 14B. Binding detected by mean fluorescence intensity (MFI) by concentration is shown in Figures 15A-15E. Exemplary gated dot plots and APC histograms at 100 nM with CRTH2-27 are shown in Figures 16A-16B. Two antibodies (gPCR-51 and gPCR-52) were used as positive controls. The binding profiles of the two positive controls are shown in Figures 17A-17B.

[0168] [Table 15] JPEG2025037968000020.jpg240170 JPEG2025037968000021.jpg240170 JPEG2025037968000022.jpg119170

[0169] In the examples that follow, five antibodies, CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42, were shown to have a functional effect in the cAMP assay, and the binding curves for these antibodies are compared in Figures 18A-18B.

[0170] Example 8. Antagonist activity using the cAMP assay A library of CRTH2R IgG antibodies was assayed to determine their antagonistic function in PGD2-induced cAMP signaling. Briefly, cells were preincubated with IgG (titration 1:3) for 1 h at room temperature. Subsequently, CRTH2R was activated by Gα i As conjugated, cells were stimulated with PGD2 (0.59 nM) in the presence of forskolin at 37°C for 30 min.

[0171] The effect of antibodies on the signal detected in relative light units (rlu) was determined (data not shown). At the highest concentration tested (300 nM), several CRTH2R IgGs caused an up-deflection of the signal, indicating inhibition of the cAMP signal induced by PGD2 stimulation. For comparison, a bar graph showing the ratio of IgG treatment versus control treated for the three highest IgG concentrations tested is shown in FIG. 19A. The antibodies shown in FIG. 19B show CRTH2R IgG antibodies that resulted in more than 20% antagonist activity at 33 nM, specifically CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-19, CRTH2-45, CRTH2-9, CRTH2-8, CRTH2-15, CRTH2-42, CRTH2-60, and CRTH2-70.

[0172] Example 9. Allosteric regulation of PGD2-induced cAMP signal CRTH2R IgG antibodies were assayed for allosteric activity. Allosteric regulation was determined by assaying CRTH2R IgG antibodies in PGD2-induced cAMP signals. Briefly, cells were re-incubated without or with 100 nM CRTH2R IgG antibodies. Subsequently, cells were stimulated with various concentrations of PGD2 in the presence of forskolin, followed by assaying cAMP activity.

[0173] The results of the cAMP assay are seen in Figure 20. A rightward shift in the PGD2 dose-response curve (and an increase in the IC50 value) indicates a negative allosteric effect. As shown in Figure 20, five of the CRTH2R IgGs (CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, and CRTH2-42) caused an IC50-fold difference of >2.0 compared to PGD2 alone, suggesting that they are negative allosteric modulators.

[0174] Example 10. Agonist activity of PGD2-induced cAMP signal CRTH2R IgG antibodies were assayed for agonist function. Agonist activity was determined by assaying the CRTH2R IgG antibodies described in Example 7 on PGD2-induced cAMP signal.

[0175] Briefly, cells were treated with both PGD2 or CRTH2R IgG antibodies in the presence of forskolin. CRTH2R IgG antibodies included CRTH2-74, CRTH2-24, CRTH2-28, CRTH2-39, CRTH2-19, CRTH2-9, CRTH2-8, CRTH2-27, CRTH2-45, CRTH2-35, CRTH2-50, CRTH2-66, CRTH2-57, CRTH2-32, CRTH2-15, CRTH2-25, CRTH2-42, CRTH2-55, CRTH2-60, and CRTH2-70. Therapeutic stimulation was performed at 37°C for 30 minutes. Then, cAMP assay was performed (data not shown).

[0176] Example 11. Control experiments demonstrating allosteric modulators Allosteric regulation was determined for a known CRTH2R antagonist (small molecule OC000459) and two control antibodies. Experiments were performed similarly to those described in Example 9. Briefly, cells were treated with OC000459, comparator CRTH2R AB51 antibody, or comparator CRTH2R AB52 antibody. Cells were then stimulated with PGD2 in the presence of forskolin.

[0177] The results are shown in Figures 21A-21C. OC000459 causes a strong rightward shift of the curve and a 459-fold increase in the IC50 value (Figure 21A). Incubation with CRTH2R AB51 did not cause a change in the IC50 value (Figure 21B). Incubation with the comparator antibody #52 caused a 3.5-fold decrease in the IC50 value, indicating that it is a positive allosteric modulator, i.e., has an agonistic effect (Figure 21C).

[0178] Example 12. CRTH2R β-arrestin recruitment assay for antagonist modulation Antagonistic regulation by nine CRTH2R IgG antibodies was determined. The nine CRTH2R IgG antibodies included CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, CRTH2-42, CRTH2-74, CRTH2-55, CRTH2-28, and CRTH2-39. The antagonistic function of these nine antibodies compared to OC000459 was determined using PGD2-induced β-arrestin recruitment. Results including a positive control using the small molecule OC000459 are shown in Figures 22A-22D.

[0179] Example 13. CRTH2R β-arrestin recruitment assay for allosteric regulation Allosteric regulation by nine CRTH2R IgGs was determined. The nine CRTH2R IgGs included CRTH2-9, CRTH2-27, CRTH2-50, CRTH2-32, CRTH2-42, CRTH2-74, CRTH2-55, CRTH2-28, and CRTH2-39. Allosteric regulation of these nine antibodies compared to OC000459 was determined using PGD2-induced β-arrestin recruitment.

[0180] Briefly, cells were preincubated with IgG (100 nM) for 1 h at room temperature followed by PGD2 stimulation for 90 min at 37° C. Data were normalized to the first data point on each graph (lowest PGD2 and zero Ab).

[0181] Example 14. Hyperimmune Immunoglobulin Library A hyperimmune immunoglobulin (IgG) library was generated using a method similar to that described in Example 4. Briefly, the hyperimmune IgG library was generated from the analysis of a database of human naive and memory B cell receptor sequences consisting of over 37 million unique IgH sequences from each of three healthy donors. Over 2 million CDRH3 sequences were collected from this analysis and individually constructed using a method similar to that in Examples 1-3. Duplicate CDRH3 and liability motifs that may frequently cause problems in development were removed in the library synthesis step. The diversity of these CDRH3 sequences was then combinatorially assembled and incorporated into the DP47 human framework to generate a 1 × 10 10 A highly functional antibody Fab library of 100-fold was constructed and a schematic of the design can be seen in Figure 24.

[0182] The heavy chain CDR length distribution of the hyperimmune antibody library was assessed by next generation sequencing (NGS). The CDR length distribution data is shown in Figure 25A-25B. In general, the selection of soluble protein targets undergoes 5 rounds of selection, including 3 PBST washes in round 1, 5 PBST washes in round 2, 7 PBST washes in round 3, 9 PBST washes in round 4, and 12 PBST washes in round 5. A skim milk block was used. See Figure 26.

[0183] For human TIGIT (hTIGIT), 1 μM of biotinylated antigen was mixed with 300 μl of Dynabead M-280 at 10 mg / mL to yield a concentration of 100 pmol per 100 μl. Details of the different selection rounds can be found in Table 15.

[0184] [Table 16]

[0185] After various rounds of selection, hTIGIT IgG was analyzed. The data can be seen in Figures 27A-27F and Table 16. Figures 27A-27D show the ELISA data from rounds 3 and 4. Figures 27E-27F show the CDRH3 length, yield (μg), and K of the analyzed hTIGIT IgG. D Data shown are in nM.

[0186] [Table 17]

[0187] Seventeen non-identical hTIGIT immunoglobulins were identified with monovalent affinities ranging from 16 nM to >300 nM. Most of these immunoglobulins expressed well, yielding >20 μg of purified protein in an expression volume of 1 ml. The sequences of the hTIGIT immunoglobulins are shown in Table 17.

[0188] [Table 18] JPEG2025037968000026.jpg245170 JPEG2025037968000027.jpg164170

[0189] Identification of human CD3 epsilon (hCD3) and cyno CD3 epsilon (cCD3) immunoglobulins was performed. Details of the different selection rounds are shown in Table 18.

[0190] [Table 19]

[0191] After various rounds of selection, CD3 epsilon (CD3ε) IgG was analyzed. Data can be seen in Figures 28A-28L and Tables 19A-19B. Figures 28A-28F show ELISA data from rounds 4 and 5. Figures 28G-28L show cross-reactivity data of human CD3 epsilon and cyno CD3 epsilon immunoglobulin.

[0192] [Table 20]

[0193] Nineteen non-identical hCD3 epsilon and cyno CD3 epsilon immunoglobulins were identified, including five that are human / cyno CD3 epsilon cross-reactive immunoglobulins. One of the human / cyno CD3 epsilon cross-reactive antibodies, CD3-56-05, binds to human and cyno CD3 epsilon with an affinity of 67 and 107 nM, respectively. The sequences of the hCD3 epsilon and cCD3 epsilon immunoglobulins are shown in Table 20.

[0194] [Table 21] JPEG2025037968000031.jpg34170

[0195] A CRTH2R hyperimmune immunoglobulin library was generated. Briefly, five rounds of cell-based selection were performed on cells stably overexpressing the target of interest. Each round of selection included 10 8 10 cells were used. Phages from each round were first diluted with 10 8 The cells were depleted with 1000 CHO background cells. The stringency of selection was increased by increasing the number of washes in subsequent rounds of selection. The cells were then eluted from the phages using trypsin and the phages were amplified for the next panning round.

[0196] CRTH2R immunoglobulins were evaluated for their binding affinity and allosteric modulator function of PGD2-induced cAMP.As shown in Figure 30A-30F, three specific CRTH2R immunoglobulins were identified with sub-nanomolar to single-digit nanomolar cell binding affinity to hCRTH2R and showed inhibitory activity in allosteric cAMP assay.The sequences of the three CRTH2R immunoglobulins, CRTH2-48-3, CRTH2-48-21, and CRTH2-48-27, are shown in Table 21.

[0197] [Table 22]

[0198] Example 15. Hyperimmune Immunoglobulin Library for A2A Receptors A hyperimmune immunoglobulin (IgG) library was created using methods similar to those described in Examples 4 and 14. Briefly, the hyperimmune IgG library was generated from the analysis of a database of human naive and memory B cell receptor sequences consisting of over 37 million unique IgH sequences from each of three healthy donors. Over 2 million CDRH3 sequences were collected from the analysis and individually constructed using methods similar to those in Examples 1-3. The CDRH3 sequences were incorporated into the VHH hShuffle library described in Example 4. The final library diversity was 1.3×10 10 It was determined that.

[0199] 73 of 88 unique clones had target cell MFI values ​​that were twice as high as the parental cells. 15 of 88 unique clones had target cell MFI values ​​that were 20 times higher than the parental cells. Data for the adenosine A2A receptor variant A2AR-90-007 are shown in Figures 31A-31B.

[0200] This example demonstrates high affinity and K in the subnanomolar range. D 1 shows the generation of a VHH library for A2AR with values.

[0201] Although preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be used in the practice of the present disclosure. The following claims define the scope of the disclosure, and it is intended that methods and structures within the scope of these claims, and their equivalents, be covered thereby.

Claims

1. An antibody or antibody fragment comprising a CDRH1 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 152 or 155, a CDRH2 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 153 or 156, and a CDRH3 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 154 or 157.

2. The antibody or antibody fragment of claim 1, further comprising a CDRL1 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 158 or 161, a CDRL2 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 159 or 162, and a CDRL3 comprising an amino acid sequence at least about 90% identical to that set forth in SEQ ID NO: 160 or 163.

3. A method of treating cancer comprising administering an antibody or antibody fragment according to any one of claims 1-2.

4. A method of treating a viral infection comprising administering an antibody or antibody fragment according to any one of claims 1-2.

5. A nucleic acid library comprising a plurality of sequences comprising nucleic acids that when translated encode an antibody or antibody fragment, wherein each sequence of the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a variable region of a heavy chain (VH), or a CDR1, CDR2, or CDR3 on a variable region of a light chain (VL), said nucleic acid library comprising at least 30,000 variant sequences, said antibody or antibody fragment having a K of less than 100 nM. Ｄ A nucleic acid library that binds to the antigen.

6. The nucleic acid library of claim 5 , wherein the antibody is a single domain antibody.

7. The nucleic acid library of claim 6, wherein the single domain antibody is a VHH antibody.

8. The nucleic acid library of claim 5 , wherein the antibody binds to TIGIT.

9. The nucleic acid library of claim 5, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to any of SEQ ID NOs:84-100.

10. The nucleic acid library of claim 5, wherein the variable region of the light chain when translated comprises an amino acid sequence that is at least about 90% identical to any of SEQ ID NOs: 101-117.

11. The nucleic acid library of claim 5, wherein CDR1, CDR2, or CDR3 on the variable region of the heavy chain comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs:67-83 or 118-128.

12. The nucleic acid library of claim 5, wherein CDR1, CDR2, or CDR3 on the variable region of the light chain comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs: 129-137.

13. The nucleic acid library of claim 5 , wherein the antibody binds to CD47.

14. The nucleic acid library of claim 5, wherein the antibody binds to CD3 epsilon.

15. The nucleic acid library of claim 5, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to any of SEQ ID NOs: 138-141.

16. The nucleic acid library of claim 5, wherein the variable region of the light chain when translated comprises an amino acid sequence that is at least about 90% identical to any of SEQ ID NOs:142-145.

17. 6. The nucleic acid library of claim 5, comprising at least 50,000 variant sequences.

18. 6. The nucleic acid library of claim 5, comprising at least 100,000 variant sequences.

19. At least 10 ５ The nucleic acid library of claim 5, comprising non-identical nucleic acids.

20. At least 10 ９ The nucleic acid library of claim 5 having theoretical sequence diversity.

21. A nucleic acid library comprising a plurality of sequences comprising nucleic acids that when translated encode a single domain antibody, wherein each sequence of the plurality of sequences comprises a variant sequence encoding a CDR1, CDR2, or CDR3 on a variable region of a heavy chain (VH), wherein the nucleic acid library comprises at least 30,000 variant sequences, and wherein the antibody or antibody fragment has a K of less than 100 nM. Ｄ A nucleic acid library that binds to the antigen.

22. The nucleic acid library of claim 21, wherein the length of the VH when translated is about 90 to about 100 amino acids.

23. The nucleic acid library of claim 21, wherein the length of the VH when translated is from about 100 to about 400 amino acids.

24. The nucleic acid library of claim 21, wherein the VH is from about 270 to about 300 base pairs in length.

25. The nucleic acid library of claim 21, wherein the VH is from about 300 to about 1200 base pairs in length.

26. The nucleic acid library of claim 21 , wherein the single domain antibody is a VHH antibody.

27. The nucleic acid library of claim 21 , wherein the antibody binds to TIGIT.

28. 22. The nucleic acid library of claim 21, wherein the CDR1, CDR2, or CDR3 comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs:67-83 or 118-128.

29. The nucleic acid library of claim 21, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs: 84-100.

30. The nucleic acid library of claim 21, wherein the CDR3 on the variable region of the heavy chain comprises an amino acid sequence that is at least about 90% identical to any one of SEQ ID NOs: 101-117.

31. The nucleic acid library of claim 21 , wherein the antibody binds to CD47.

32. The nucleic acid library of claim 21 , wherein the antibody binds to CD3 epsilon.

33. 22. The nucleic acid library of claim 21, wherein the variable region of the heavy chain when translated comprises an amino acid sequence that is at least about 90% identical to any of SEQ ID NOs: 138-141.

34. 22. The nucleic acid library of claim 21, comprising at least 50,000 variant sequences.

35. 22. The nucleic acid library of claim 21, comprising at least 100,000 variant sequences.

36. At least 10 ５ 22. The nucleic acid library of claim 21, comprising non-identical nucleic acids.

37. At least 10 ９ 22. The nucleic acid library of claim 21 having theoretical sequence diversity.

38. 1. A method for generating a nucleic acid library encoding a single domain antibody, the method comprising: (a) providing a predetermined sequence, said predetermined sequence comprising: i. a first plurality of polynucleotides, each polynucleotide of said first plurality of polynucleotides encoding at least 1000 variant sequences encoding CDR1 on a heavy chain; ii. a second plurality of polynucleotides, wherein each polynucleotide of said second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on a heavy chain; iii. a third plurality of polynucleotides, wherein each polynucleotide of the third plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR3 on a heavy chain. Providing a predetermined sequence encoding (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library of variant nucleic acids encoding single domain antibodies, wherein at least about 70% of the variant nucleic acids have a K of less than 100 nM. Ｄ and encoding a single domain antibody that binds to the antigen. A method comprising:

39. 39. The method of claim 38, wherein the single domain antibody comprises one heavy chain variable domain.

40. The method of claim 38, wherein the single domain antibody is a VHH antibody.

41. The method of claim 38, wherein the single domain antibody binds to TIGIT.

42. 39. The method of claim 38, wherein the single domain antibody comprises an amino acid sequence that is at least about 90% identical to that set forth in any one of SEQ ID NOs: 84-100 or 138-141.

43. The method of claim 38, wherein the single domain antibody binds to CD47.

44. 39. The method of claim 38, wherein the nucleic acid library comprises at least 50,000 variant sequences.

45. 39. The method of claim 38, wherein the nucleic acid library comprises at least 100,000 variant sequences.

46. The nucleic acid library comprises at least 10 ５ 39. The method of claim 38, comprising non-identical nucleic acids.

47. The nucleic acid library has a K Ｄ 40. The method of claim 38, comprising at least one sequence encoding a single domain antibody that binds to an antigen at

48. The nucleic acid library has a K Ｄ 40. The method of claim 38, comprising at least one sequence encoding a single domain antibody that binds to an antigen at

49. The nucleic acid library has a K Ｄ 40. The method of claim 38, comprising at least one sequence encoding a single domain antibody that binds to an antigen at

50. The nucleic acid library has a K Ｄ 40. The method of claim 38, comprising at least one sequence encoding a single domain antibody that binds to an antigen at

51. The nucleic acid library comprises at least 10 ９ 39. The method of claim 38, having theoretical diversity of sequences.

Images