MAPK gene and application thereof in resisting fungal infection of poplar

Abstract

To provide: means for enhancing the fungal resistance of polar using genetic engineering means by exploring infections, disease-resistant genes and internal signal pathways related to poplar against S. musiva infection: and means for improving the disease resistance of poplar by exploring the related mechanisms.SOLUTION: A PtMAPK3-1 gene is a poplar MAPK cascade gene family member and plays an important role in stress resistance and a disease resistance process of poplar. According to the invention, it is discovered that through construction of an expression vector and agrobacterium tumefaciens transgenic overexpression MAPK3-1, accumulation of ROS in a poplar body after overexpression PagMAPK3-1 is infected by S.musiva provides nutrition for further infection and reproduction of pathogenic fungi in a plant body, and the PagMAPK3-1 in a K8 poplar plays a negative regulation role in poplar disease resistance reaction. The invention provides a molecular marker for screening disease-resistant poplar varieties, and also provides a regulation and control means for improving the disease resistance of poplar.SELECTED DRAWING: Figure 5

Description

[Technical field]

[0001] The present invention relates to the field of plant biology technology, and in particular to MAPK gene and its use in combating fungal infection of burdock. [Background technology]

[0002] As the economy and population grow, human demand for wood product resources and bioenergy raw materials is increasing, but rising temperatures, limited available water resources, and increasing probability of natural disasters limit the productivity of forest trees. As a result of its advantages of fast growth, strong adaptability, and short rotation period, poplar trees have always been widely cultivated worldwide for board and pulp materials. However, as poplar trees are cultivated over a large area for a long period of time, they may also face a large number of diseases and insect pests. Canker and leaf spot disease caused by Sphaerulinamusiva (S. musiva) can cause early defoliation, reduced photosynthetic area, and stem breakage of poplar trees, which not only reduces the annual production of timber, but also leads to the death of poplar trees and the failure of plantations. Poplar leaf spot disease is a fungal disease that mainly infects poplar and its relatives. Sphaerulina genus fungi are a kind of leaf spot disease pathogen, which can cause defoliation and rot of plants, with mild cases leading to reduced yields and severe cases leading to plant death. Sphaerulina musiva can cause leaf spot and canker disease of poplar trees. It is native to black poplar trees (Populus deltoides) in the eastern United States, and only causes the symptoms of leaf spot disease. In susceptible hybrid poplar trees, S. musiva can cause leaf necrosis, early defoliation, and canker on stems and branches, reducing the growth rate and making the tree more susceptible to microorganisms. Currently, there is no method to prevent the spread of S. musiva in poplar-growing areas, but once S. musiva spreads to an area, it is difficult to eliminate the fungus. Currently, chemical and biological control measures can significantly reduce the incidence of disease in poplar trees, and creating disease-resistant transgenic poplar trees is another effective means of controlling poplar disease. Chinese Patent No. CN202210837131.X proposed overexpression of PtoCXE06 gene in poplar tree to enhance the resistance of poplar tree to Poplar rot fungus. Chinese Patent No. CN202211588272.9 discovered an effect protein SmCSEP3 in S. musiva infection, and proposed to instantly express or overexpress SmCSEP3 in poplar tree to enhance the ability of poplar tree against S. musiva infection.Therefore, combining genetic engineering technology with plant disease resistance to carry out disease resistance research on poplar trees and explore the relevant control mechanisms of disease resistance is of great significance to improving the survival rate of poplar plantations, increasing timber production, and protecting the landscape ecology. Summary of the Invention

[0003] At present, there are relatively few studies on exploring the relevant infection, anti-disease genes and internal signal pathways of S. musiva infection in Yangshuo, and using genetic engineering methods to improve the anti-fungal ability of Yangshuo, and more in-depth research is needed.The purpose of the present invention is to explore the relevant mechanisms and propose more methods for improving the anti-disease ability of Yangshuo.

[0004] Based on this, the present invention proposes the following technical solution.

[0005] In one aspect of the present invention, the present invention provides a negative regulator gene of Yangshukangbing, the gene being PagMAPK3-1, the nucleic acid sequence of which is shown in SEQ ID NO.3.

[0006] In one aspect of the present invention, the present invention provides an expression vector comprising a PagMAPK3-1 gene, the sequence of which is shown in SEQ ID NO. 3. The expression vector may be a prokaryotic expression vector or a eukaryotic expression vector.

[0007] In one aspect, the present invention provides a genetically engineered bacterium comprising the expression vector as described above. Preferably, the genetically engineered bacterium is Escherichia coli, a species of Bacillus subtilis.

[0008] In one aspect of the present invention, the present invention provides a use of MAPK3-1 gene as a screening marker for anti-S. musiva infection in poplar trees, preferably Populus trichocarpa or 84K poplar trees.

[0009] When the PagMAPK3-1 gene expression of the test variety of Yangshu is significantly higher than the expression level of wild-type Yangshu K8, the variety has poor resistance to S. musiva infection; when the PagMAPK3-1 gene expression of the test variety of Yangshu is significantly lower than the expression level of wild-type Yangshu K8, the variety has good resistance to S. musiva infection.

[0010] In one aspect of the present invention, the present invention provides a method for reducing the expression of MAPK3-1 gene in poplar trees by instantaneous or stable transfection, thereby improving the ability of poplar trees to resist S. musiva infection. Technical Effects

[0011] Genomic analysis revealed that PtMAPK3-1, PtMKK7, PtMKK9, and PtRaf23-1 showed obvious changes in transcription levels under various biotic and abiotic stresses, including salt, drought, and M. brunnea fungal stress, and PtMAPK3-1 in particular was found to be a new MAPK family member that can respond to multiple adverse effects.

[0012] After the overexpressing PagMAPK3-1 transgenic poplar trees were inoculated with S. musiva, both of the transgenic poplar trees showed more necrotic lesions, and physiological and biochemical indicators such as DAB staining, PAL activity, CAT activity, POD activity, and MDA content further demonstrated that PagMAPK3-1 played a negative regulatory role in the anti-disease response of poplar trees, providing a molecular marker for screening disease-resistant poplar tree varieties and a control measure for enhancing the disease-resistant ability of poplar trees. [Brief description of the drawings]

[0013] [Figure 1] Gel electrophoresis analysis after PCR amplification of the PagMAPK3-1 gene.

[0014] [Diagram 2]1 shows the PagMAPK3-1 gene sequence and conserved domain prediction, where (a) is the sequenced 84K Yangshu PagMAPK3-1 gene sequence, and (b) is the structural conserved domain prediction analysis of the PagMAPK3-1 gene.

[0015] [Diagram 3] PCR electrophoresis detection of transgenic Yangshuo genes, where lane M is DNA 2000 Marker, lane +, WT is the positive control and negative control, respectively, and lanes 1, 3, 4, 9, 10, and 11 correspond to transgenic Yangshuo positive plants OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11, respectively.

[0016] [Figure 4] Detection of the expression level of PagMAPK3-1 overexpressing recombinant Yangshuo gene.

[0017] [Diagram 5] Phenotypic analysis of PagMAPK3-1 transgenic poplar trees after inoculation with S. musiva, where (a) is a photograph of the lesions 4 days after inoculation of S. musiva spore suspension on the leaves of the wild-type control (WT) and PagMAPK3-1 transgenic poplar trees, and (b) is a statistical analysis of the lesion size 6 days after inoculation.

[0018] [Figure 6] Detection of physiological and biochemical indicators 2 days after inoculation of PagMAPK3-1 transgenic poplar trees with S. musiva, where (a) is the actual leaf image of WT, OE-1 and OE-3 plants 2 days after inoculation with S. musiva, and (b) is the measurement results of PAL, CAT, POD and MDA contents in WT, OE-1 and OE-3 leaves 2 days after inoculation with S. musiva. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] The plant material hybrid Yangshu 84K (Populus alba × Populus glandulosa) in the present invention was provided by Professor Wang Liuqiang of the Chinese Academy of Forestry. All other biological reagents, except for special instructions, are ordinary reagents obtained from commercial biological reagent companies. All relevant molecular biological operation methods, except for special instructions, refer to "Guidelines for Molecular Cloning Experiments" (edited by J. Sambrook and DW Russell, Science Press).

[0020] Example 1: Identification of Yangshu MAPK cascade gene family members

[0021] We obtained gene set data for the assembly versions v1.0 and v3.0 of the Poppy seedling gene set from the PhycoCosm database (http: / / genome.jgi-psf.org / Poptr1 / Poptr1.home.html) and the Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html). In our previous study, we obtained protein sequences of 21 PtMAPKs and 11 PtMAPKKs in the Poppy seedling gene set v1.0 (Hamel LP, Nicole MC, Sritubtim S, et al. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families [J]. Trends in plant science, 2006, 11(4): 192- 198). Using the 32 protein sequences as query sequences, the gene IDs of PtMAPKs (i.e. MAPKs in PtMAPKKs) and PtMAPKKs were obtained from the protein library of PtMAPKKs v3.0 version by the BLAST tool in TBtools. To identify potential members of the PtMAPKKK gene family, the gene sequence and protein sequence of PtMAPKKs were downloaded from the plant gene database (https: / / phytozome.jgi.doe.gov / pz / portal.html). The protein sequences of the retrieved MAPKKKs from mustard, jujube, basil, and kiwi fruit were used as query sequences to perform a BLAST search of the PtMAPKKs protein database. Then, a crypto-Markov model (HMM) was used to search for genes containing serine / threonine protein kinase domains (PF00069) in PtMAPKKs. The genes obtained by the BLAST search and the HMM search were compared to eliminate genes that could not simultaneously satisfy both conditions, and redundant transcripts were removed. Finally, the gene numbers of 21 new versions of PtMAPKs and 11 new versions of PtMAPKKs were obtained.In order to better understand the gene expression levels of MAPK cascade genes in response to adverse conditions, the present invention obtained the transcriptome data of Yangshuo and abiotic stress (drought and salt) and biotic stress (Marssoninabrunnea infection) from NCBI GEO database, and found that after pathogen infection, PtMPK3-1, PtMKK9, PtMKK7, and PtRaf23-1 were significantly increased, and PtMAPK3-1 responded to various stresses. Based on this, MAPK3-1 gene is an important candidate gene for anti-adverse and anti-disease in Yangshuo.

[0022] Example 2: Cloning and analysis of Yangshu MAPK cascade gene family member PagMAPK3-1 gene

[0023] Maoguoyang is mainly a foreign poplar tree variety. Based on the results of the Maoguoyang gene group analysis in Example 1, the inventors studied the correlation situation of MAPK3-1 gene in Chinese poplar tree variety 84K poplar.

[0024] The full-length cDNA of 84K Yangshu was used as a template to clone PagMAPK3-1 (ie, 84K Yangshu MAPK3-1 gene), and the relevant primers used in the PCR test were as follows: PagMAPK3-1-F:ATGGCGAATTATGCACAGGGAAATG(SEQ ID NO.1) PagMAPK3-1-R:CTAGCATGCATATTCTGGATTAAGTGC(SEQ ID NO.2)

[0025] The PCR product gum was collected, and the collected PCR product was ligated into the clone carrier pEasy-BluntSimple and transformed into E. coli.

[0026] Results analysis: The PCR products were purified and separated by 1% agarose gel electrophoresis, and the results showed that there was a bright single strip between 2000bp and 1000bp (Figure 1). The gene sequence annotation showed the PagMAPK3-1 gene size of 1116bp, which rudimentarily explained the successful amplification of the PagMAPK3-1 gene. The bright rubber block was cut to recover the rubber, then connected to a clone carrier and sent to a sequencing company for sequencing. The sequencing results were compared by DNAMAN software, and the results showed that the sequences were consistent, proving that the desired gene clone was successful. By comparing the PagMAPK3-1 and PtMAPK3-1 sequences, it was found that the CDS sequence of MAPK3-1 in Maoguo Yang and 84K Yangshu differed by 8 bases, and there were 3 amino acid differences when translated into protein.

[0027] The sequence of the sequenced 84K Yangshu PagMAPK3-1 gene is shown in SEQ ID NO.3. The size of the PagMAPK3-1 gene is 1116 bp as shown in FIG. 2(a). The structural conserved domain prediction analysis of the PagMAPK3-1 gene is shown in FIG. 2(b).

[0028] Example 3: Identification of disease resistance functions of overexpressed transgenic poplar

[0029] 3.1 Obtaining overexpressing recombinant strains

[0030] (1) Career Development

[0031] The PagMAPK3-1 overexpression vector is constructed using Gateway technology.

[0032] a. A gateway splice was added to the F and R ends of the PagMAPK3-1 gene clone primer, and the primer was cloned using the PagMAPK3-1 clone carrier constructed in Example 2 as a template. The splice primer sequence was added as shown in Table 1 below.

[0033] JPEG2025058903000002.jpg40119

[0034] Then, the PCR product gum is recovered.

[0035] b. The PCR product above was cloned into intermediate carrier pDONR207 by BP reaction, and the reaction system is shown in Table 2. JPEG2025058903000003.jpg4591

[0036] The ligation was carried out at 25°C for 6 hours, after which the PCR products were collected, transformed, and sequenced.

[0037] c. Construction of the intermediate carrier in the previous step After the sequencing was correct, the two genes were constructed into the overexpression vector pMDC32 using LR reaction, and the reaction system is shown in Table 3.

[0038] JPEG2025058903000004.jpg4293

[0039] The mixture was incubated at 25°C for 6 hours, after which the PCR product was collected, transformed, sequenced, and extracted, and finally introduced into the recipient cell GV3101 of Bacillus subtilis.

[0040] (2) Genetic transformation of Yang tree:

[0041] a. Add the agrobacterium obtained in (1) above to LB medium containing the corresponding Kan and Rif and amplify it so that its OD600 value becomes about 0.6.

[0042] b. On the ultra-clean table, place the cut and damaged 84K poplar leaves in the bacterial liquid from the previous process and rock them at a low speed for about 20 minutes.

[0043] c. After aspirating off excess bacterial liquid from the soaked leaves, place them in differentiation medium and incubate in the dark at 24°C for 2 days.

[0044] d. After 2 days of dark culture, the leaves are transferred to screening medium containing chomycin and temetin for screening, and resistant shoots generally appear after about 20 days.

[0045] e. Resistant seedlings are cut off and transferred to a live root medium containing the same resistance, and after the roots are grown, the genes are amplified and the expression level is detected.

[0046] The composition of differentiation medium 1L is shown in Table 4.

[0047] JPEG2025058903000005.jpg6887

[0048] Screening medium system 1L: Differentiation medium 1L, sterilized and cooled to 50°C, and added chomycin (0.0003 g / L) and temetin (0.2 g / L) to the ultra-clean table.

[0049] The composition of 1 L of the live root medium is shown in Table 5.

[0050] JPEG2025058903000006.jpg7293

[0051] After sterilization, the mixture was cooled to 50°C and chomycin (0.0003 g / L) and temetin (0.2 g / L) were added to the ultraclean table.

[0052] (3) Gene group PCR verification:

[0053] The gene set of Yangshuo was extracted by CTAB method, and then PCR test was performed using the extracted gene set as template to detect PagMAPK3-1 gene. The overexpression vector particles were used as positive control. After the PCR reaction was completed, gel electrophoresis detection was performed, and if there was a plant with a PCR strip at the corresponding position of the positive control, it was a positive plant. Referring to Figure 3, the PCR test detection results of the six positive plants for the subsequent experiment are shown, and the six positive transgenic plants were named OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11, respectively.

[0054] (4) Relative expression level analysis of positive strains: RNA was extracted from each of the positive plants (OE-1, OE-3, OE-4, OE-9, OE-10, and OE-11), and reverse-transcribed using a reverse transcription kit (TSK302M) from Beijing Tsingke Biotechnology Co., Ltd. to obtain cDNA. The obtained cDNA was used as a template for qRT-PCR testing to detect the relative expression level of the target gene in each lineage (qRT-PCR testing was performed using the Green qPCR Super Mix kit from Beijing Tsingke Biotechnology Co., Ltd.). Results: In the PagMAPK3-1 overexpressing recombinant strains, the expression levels of the PagMAPK3-1 gene in OE-1 and OE-3 reached more than 20 times (see Figure 4), so these two strains were selected for further analysis.

[0055] Example 4: Disease resistance study of PagMAPK3-1 transgenic poplar tree

[0056] 4.1S. musiva infection

[0057] S. musiva was cultured on PDA medium by isolating poplar leaves with leaf spot disease, scraping off the mycelium with a gun head or a seeding needle, and dissolving it in a sterile 0.05% Touan 80 aqueous solution to adjust the number of spores in the spore suspension. Healthy leaves of poplar transplants were taken and placed on a culture dish covered with moist gauze, with the dorsal side of the leaf facing up. 25μl of the prepared spore suspension was dropped on both sides of the leaf, avoiding the veins. The culture dish was placed in a culture box at 25℃ for dark culture, and the disease development was observed every day.

[0058] Results: The lesions of 84K (WT) and PagMAPK3-1 transgenic plants were observed 4 days after inoculation with S. musiva spores. The lesions were as shown in Figure 5(a). 84K leaves showed slight lesions 6 days after inoculation with S. musiva, while the necrotic areas of PagMAPK3-1 transgenic plants were larger than those of WT. Statistical analysis of lesion sizes 6 days after inoculation showed that the lesion sizes of OE-1 and OE-3 were significantly larger than those of WT (Figure 5(b)). These results indicate that overexpression of PagMAPK3-1 reduced the resistance of plants to S. musiva.

[0059] 4.2 Physiological and biochemical index measurements

[0060] When plants are threatened by pathogens, they rapidly accumulate reactive oxygen species (ROS), and the accumulation of large amounts of reactive oxygen species leads to the death of plant cells. Therefore, plants activate antioxidant enzymes in their bodies, such as hydrogen peroxide enzyme (CAT), peroxidase enzyme (POD), and PAL (phenylalanine enzyme), to remove excess ROS. Malonaldehyde (MDA) is one of the commonly used indicators to measure the degree of oxidative stress in plants, and can reflect the degree of peroxidation of plant membrane lipids. The accumulation of ROS, i.e., H2O2, in plants can be detected by DAB staining of WT, OE-1, and OE-3 plant leaves on the second day after inoculation with S. musiva.

[0061] (1) Measurement of CAT (hydrogen peroxidase), POD (peroxidase) activity, PAL (phenylalanine enzyme), where the POD and CAT detection methods are described in Maehly AC, Chance B. The assay of catalases and peroxidases [J]. Methods of Biochemical Analysis, 1954, 1: 357-424, and the PAL detection method is described in Beaudoin-Eagan LD, Thorpe TA. Tyrosine and phenylalanine Ammonia Lyase activities during shoot initiation in tobacco callus cultures. Plant Physiol. 1985, 78: 438-41.

[0062] (2) Measurement of MDA content: The thiobarbituric acid method was used to measure the malonaldehyde content. The specific experimental method was based on the “Experimental Course of Plant Physiology” edited by Wang Sangen and published by Science Publishing House in 2017.

[0063] (3) DAB staining: Put the infected area of ​​poplar leaves into a 50 ml centrifuge tube, add DAB staining solution to immerse the leaves, and shake at 25-28°C and 80 r / min for 4-7 hours under dark conditions. After discarding the staining solution, add decolorizing solution (preparation of decolorizing solution: ethanol: acetic acid: glycerin = 3:1:1), and transfer the centrifuge tube to a thermostatic water bath (95°C) for 15 minutes to decolorize. The decolorizing solution can be changed 1-2 times during the period.

[0064] For each of the above indexes, leaves from the diseased areas were collected, and each sample was repeated three times. Histograms and ANOVA difference significance analysis (*p<0.05, **p<0.01) were presented using GraphPad Prism5 software.

[0065] Results: As shown in Figure 6(b), the measurement of PAL, CAT and POD activities showed that the PAL and CAT activities of wild-type Yangshuo (WT) increased, while the PAL and CAT activities of Yangshuo overexpressing PagMAPK3-1 decreased, significantly lower than that of WT. The POD activity of WT increased on the second day after sowing, while the POD activity of Yangshuo overexpressing PagMAPK3-1 decreased, significantly lower than that of WT.

[0066] As shown in Figure 6(b), after pathogen treatment, the MDA content of the transgenic lines was obviously higher than that of the WT plants.

[0067] As shown in Figure 6(a), on the second day after inoculation with S. musiva, brownish yellow precipitates appeared in the leaves of WT, OE-1, and OE-3 plants, indicating that S. musiva can induce the accumulation of reactive oxygen species in plants after invading the plants. The precipitates in the WT leaves were less than those in the two transgenic plants, indicating that the PagMAPK3-1 transgenic plants caused more cell death and H2O2 accumulation after invading S. musiva, providing nutrients for the pathogenic fungus to further invade and reproduce in the plants.

[0068] The above describes the present invention in more detail based on specific embodiments, and the specific implementation of the present invention cannot be deemed to be limited to these descriptions. Those skilled in the art can make some simple inferences or substitutions without departing from the concept of the present invention, and all of them should be considered to belong to the scope of protection defined by the claims submitted by the present invention.

Claims

1. The negative regulator gene of Yangshu Antibacterial Agent is PagMAPK3-1, the nucleic acid sequence of which is shown in SEQ ID NO.

3.

2. The PagMAPK3-1 gene is included, The sequence of the PagMAPK3-1 gene is shown in SEQ ID NO.

3.

3. A genetically engineered bacterium comprising the expression vector of claim 2.

4. The genetically engineered fungus of claim 3, wherein the engineered fungus is a root-cancer bacillus.

5. 2. The use of the gene according to claim 1 as a screening marker for anti-S. musiva infection in Yangshuo.

6. The use according to claim 5, characterized in that the Angelica dahurica is Angelica dahurica or 84K Angelica dahurica.

7. If the expression level of the PagMAPK3-1 gene in the test variety of Yang Xiaoming is significantly higher than that of the wild-type Yang Xiaoming K8, the variety has poor resistance to S. musiva infection; The use according to claim 5 or 6, characterized in that, when the expression level of PagMAPK3-1 gene of the test variety of Yang Xiaoming is significantly lower than that of wild type Yang Xiaoming K8, the variety has good resistance to S. musiva infection.

8. A method for improving the ability of poplar trees to resist S. musiva infection by reducing the expression of MAPK3-1 gene in the poplar tree by instantaneous or stable transfection.

9. The method according to claim 8, characterized in that the Angelica dahurica is Angelica dahurica or 84K Angelica dahurica.

Images