Compositions and methods for modulating hepatocyte nuclear factor 4-alpha (HNF4α) gene expression

Abstract

To provide an agent and a composition for modulating, e.g., enhancing or reducing the expression of a hepatocyte nuclear factor 4-alpha (HNF4α) gene by targeting the HNF4α expression control region, as well as a use method thereof for treating an HNF4α-associated disease, e.g., cirrhosis.SOLUTION: The HNF4α gene may be in a cell, e.g., a mammalian cell, such as a mammalian somatic cell, e.g., a human somatic cell. The present invention also provides methods of using the agents and compositions of the invention for modulating the expression of an HNF4α gene or for treating a subject who would benefit from modulating the expression of an HNF4α gene, e.g., a subject suffering or prone to suffering from an HNF4α-associated disease.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 62 / 904,178, filed September 23, 2019, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] Background of the Invention Master regulators are proteins, such as transcription factors, that can influence the expression of networks of genes that are linked by cell type, organ system, or response to a stimulus.

[0003] One example of a master regulator is the transcription factor hepatocyte nuclear factor 4-alpha (HNF4α). HNF4α is first expressed in terminally differentiated hepatocytes late in embryonic development. HNF4α controls the expression of proteins necessary for the normal function of hepatocytes and other cell types within the liver (Li, et al. (2000) Genes and Devel 14: 464-474). Furthermore, many of these proteins are secreted by liver cells and contribute to systemic health. For example, proteins such as albumin are necessary for the transport of nutrients, hormones, lipids, and small molecule drugs through the circulation. In fibrotic liver disease, HNF4α is dysregulated, resulting in significantly reduced or absent gene expression in its network (Guzman-Lepe, et al. (2018) Hepatol Comm 2 (5): 582). Dysregulation of this network contributes to the pathology of liver failure within the organ itself and to comorbidities throughout the patient.

[0004] Recently, Nishikawa et al. (2015) demonstrated that transgenic HNF4α expression in a rat model of cirrhosis restored gene expression throughout the HNF4α network, restored hepatocyte function, and improved the animal's health. The transgene was delivered using adeno-associated virus (AAV). However, AAV-delivered transgene expression does not allow for delicate control or transient modification of the expression of genes already present in the genome. When modified using AAV, affected cells lose their ability to respond quickly and physiologically meaningfully to changing conditions within the organ and body. Thus, there is a need in the art for transient, variable effectors that provide greater control and the ability to restore cells and tissues to a new, "normal" state, thus treating HNF4α-associated diseases such as fibrotic liver diseases, e.g., cirrhosis. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Li, et al. (2000) Genes and Devel 14: 464-474 [Non-patent document 2] Guzman-Lepe, et al. (2018) Hepatol Comm 2 (5): 582 Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention The present invention provides agents and compositions for modulating (e.g., enhancing or reducing) expression of the hepatocyte nuclear factor 4 alpha (HNF4α) gene by targeting the HNF4α expression control region. The HNF4α gene can be present in a cell, for example, a mammalian cell, for example, a mammalian somatic cell, for example, a human somatic cell. The present invention also provides methods of using the agents and compositions of the present invention to modulate expression of the HNF4α gene or to treat a subject in whom modulating expression of the HNF4α gene would be beneficial, for example, a subject suffering from or susceptible to an HNF4α-related disease.

[0007] Thus, in one aspect, the present invention provides a site-specific blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region.

[0008] In some embodiments, the site-specific HNF4α targeting component comprises a polymer molecule.

[0009] The polymer molecule may comprise a polyamide, a polynucleotide, a polynucleotide encoding a DNA-binding domain or a fragment thereof that specifically binds to the HNF4α expression control region, or a peptide nucleic acid (PNA).

[0010] In some embodiments, the expression control region comprises an HNF4α-specific transcription control element.

[0011] In some embodiments, the transcriptional control element comprises an HNF4α promoter, eg, the nucleotide sequence of HNF4α promoter 1 or a fragment thereof, or the nucleotide sequence of HNF4α promoter 2 or a fragment thereof.

[0012] In some embodiments, the transcriptional control element comprises a transcriptional enhancer.

[0013] In some embodiments, the transcriptional control element comprises a transcriptional repressor.

[0014] In some embodiments, a site-specific HNF4α blocking agent comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2, 3, 4, and 9.

[0015] In some embodiments, the site-specific HNF4α blocking agent comprises a polynucleotide encoding a DNA-binding domain or fragment thereof of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically binds to an HNF4α expression control region.

[0016] In one embodiment, the DNA-binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10. In one embodiment, the DNA-binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of ZF5.3. In one embodiment, the DNA-binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of ZF7. In one embodiment, the DNA-binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of ZF14. In one embodiment, the DNA binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of ZF15.

[0017] In some embodiments, the expression control region comprises one or more HNF4α-related anchor sequences within an anchor sequence-mediated junction comprising a first HNF4α-related anchor sequence and a second HNF4α-related anchor sequence.

[0018] In some embodiments, the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif.

[0019] In some embodiments, the anchor sequence-mediated junction comprises one or more transcriptional control elements internal to said junction.

[0020] In some embodiments, the anchor sequence-mediated junction includes one or more transcriptional control elements outside of said junction.

[0021] In some embodiments, the first anchor sequence and / or the second anchor sequence is located within about 500 kb of the transcriptional control element.

[0022] In some embodiments, the first anchor sequence and / or the second anchor sequence is located within 300 kb of the transcriptional control element.

[0023] In some embodiments, the site-specific HNF4α blocking agent comprises a nucleotide modification.

[0024] The present invention also provides vectors, such as viral expression vectors, and cells comprising the site-specific HNF4α blocking agents of the invention and the vectors of the invention.

[0025] In some embodiments, the site-specific HNF4α blocking agents of the present invention are present in a composition, such as a pharmaceutical composition.

[0026] In some embodiments, the pharmaceutical composition comprises a lipid formulation.

[0027] In some embodiments, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof.

[0028] In some embodiments, the pharmaceutical composition comprises lipid nanoparticles.

[0029] In another aspect, the present invention provides a site-specific HNF4α blocking agent comprising a nucleic acid molecule encoding a fusion protein comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule.

[0030] In some embodiments, the site-specific HNF4α targeting component comprises a polynucleotide or fragment thereof encoding the DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically binds to an HNF4α expression control region.

[0031] In one embodiment, the DNA binding domain of the TALE comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10.

[0032] In some embodiments, the effector molecule comprises a polypeptide or a nucleic acid molecule encoding a polypeptide.

[0033] In some embodiments, the fusion protein comprises a peptide-nucleic acid fusion.

[0034] In some embodiments, the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruitment factor, and an epigenetic CpG modifier, and any combination thereof.

[0035] In some embodiments, the effector comprises a CRISPR-associated protein (Cas) polypeptide or a nucleic acid molecule encoding a Cas polypeptide.

[0036] In some embodiments, the Cas polypeptide is an enzymatically inactive Cas polypeptide.

[0037] In some embodiments, the Cas polypeptide comprises the catalytically active domain of human exonuclease 1 (hEXO1).

[0038] In some embodiments, the epigenetic recruitment factor comprises a transcriptional enhancer or a transcriptional repressor.

[0039] In one embodiment, the transcription enhancer is VPR (VP64-p65-Rta).

[0040] In one embodiment, the VPR is [ka] The amino acid sequence of the present invention includes an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of

[0041] In one embodiment, the transcriptional enhancer comprises two, three, four, or five VPRs.

[0042] In one embodiment, the transcription enhancer is p300.

[0043] In one embodiment, p300 is [ka] [ka] The amino acid sequence of the present invention includes an amino acid sequence having at least about 85%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the entire amino acid sequence of

[0044] In some embodiments, the epigenetic CpG modifier comprises a DNA methylase, a DNA demethylase, a histone modifier, or a histone deacetylase.

[0045] In some embodiments, the effector molecule comprises a zinc finger polypeptide.

[0046] In some embodiments, the effector molecule comprises a transcription activator-like effector nuclease (TALEN) polypeptide.

[0047] In some embodiments, the site-specific HNF4α blocking agent further comprises a second nucleic acid molecule encoding a second fusion protein, the second fusion comprising a second site-specific HNF4α targeting component that targets a second HNF4α expression control region and a second effector molecule, wherein the second HNF4α expression control region is different from the HNF4α expression control region.

[0048] In one embodiment, the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG.

[0049] In one embodiment, the second effector is different from the first effector.

[0050] In one embodiment, the second effector is the same as the first effector.

[0051] In one embodiment, the fusion protein and the second fusion protein are operably linked.

[0052] In one embodiment, the fusion protein and the second fusion protein comprise an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF5.3-VPR-tPT2a-ZF7-VPR, ZF7-VPR-tPT2a-ZF5.3-VPR, ZF5.3-VPR-tPT2a-ZF7-p300, and ZF7-p300-tPT2a-ZF5.3-VPR.

[0053] In one embodiment, the fusion protein comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to the entire amino acid sequence of ZF5.3-VPR.

[0054] In one embodiment, the fusion protein is ZF5-VPR mRNA, ZF5.1-VPR and ZF5.1-VPR mRNA, ZF5.2-VPR mRNA, ZF5.3-VPR mRNA, ZF5.4-VPR mRNA, ZF5.5-VPR mRNA, and ZF5.6-VPR mRNA.

[0055] In one aspect, the present invention provides a site-specific HNF4α blocking agent, the blocking agent comprising a nucleic acid molecule encoding a fusion protein, wherein the fusion protein comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF1-VPR, ZF2-VPR, ZF3-VPR, ZF4-VPR, ZF5-VPR, ZF5.3-VPR, ZF6-VPR, ZF7-VPR, ZF8-VPR, ZF9-VPR, ZF10-VPR, ZF11-VPR, ZF12-VPR, ZF13-VPR, ZF14-VPR, and ZF15-VPR.

[0056] In one embodiment, the polypeptide is selected from the group consisting of ZF5-VPR, ZF5.3-VPR, ZF7-VPR, ZF10-VPR, ZF14-VPR, and ZF15-VPR.

[0057] In one embodiment, the polypeptide is ZF5.3-VPR.

[0058] The present invention also provides vectors, such as viral expression vectors, and cells comprising the site-specific HNF4α blocking agents of the invention and the vectors of the invention.

[0059] In some embodiments, the site-specific HNF4α blocking agents of the present invention are present in a composition, such as a pharmaceutical composition.

[0060] In some embodiments, the pharmaceutical composition comprises a lipid formulation.

[0061] In some embodiments, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof.

[0062] In some embodiments, the pharmaceutical composition comprises lipid nanoparticles.

[0063] In one aspect, the invention provides a method for modulating expression of hepatocyte nuclear factor 4 alpha (HNF4α) in a cell, comprising contacting the cell with a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby modulating expression of HNF4α in the cell.

[0064] The modulation of expression can be an increase in the expression of HNF4α in the cell or a decrease in the expression of HNF4α in the cell.

[0065] In some embodiments, the site-specific HNF4α targeting component comprises a polymer molecule.

[0066] The polymer molecules may include polyamides, polynucleotides, peptide nucleic acids (PNAs).

[0067] In some embodiments, the expression control region comprises an HNF4α-specific transcription control element.

[0068] In some embodiments, the transcriptional control element comprises an HNF4α promoter, eg, the nucleotide sequence of HNF4α promoter 1 or a fragment thereof, or the nucleotide sequence of HNF4α promoter 2 or a fragment thereof.

[0069] In some embodiments, the transcriptional control element comprises a transcriptional enhancer.

[0070] In some embodiments, the transcriptional control element comprises a transcriptional repressor.

[0071] In some embodiments, a site-specific HNF4α blocking agent comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2, 3, 4, and 9.

[0072] In some embodiments, the site-specific HNF4α blocking agent comprises a polynucleotide or fragment thereof encoding the DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically binds to an HNF4α expression control region.

[0073] In some embodiments, the DNA-binding domain of a TALE or ZNF comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10.

[0074] In some embodiments, the expression control region comprises one or more HNF4α-related anchor sequences within an anchor sequence-mediated junction comprising a first HNF4α-related anchor sequence and a second HNF4α-related anchor sequence.

[0075] In some embodiments, the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif.

[0076] In some embodiments, the anchor sequence-mediated junction comprises one or more transcriptional control elements internal to said junction.

[0077] In some embodiments, the anchor sequence-mediated junction includes one or more transcriptional control elements outside of said junction.

[0078] In some embodiments, the first anchor sequence and / or the second anchor sequence is located within about 500 kb of the transcriptional control element.

[0079] In some embodiments, the first anchor sequence and / or the second anchor sequence is located within 300 kb of the transcriptional control element.

[0080] In some embodiments, the site-specific HNF4α blocking agent comprises a nucleotide modification.

[0081] In some embodiments, the effector molecule comprises a polypeptide.

[0082] In some embodiments, the polypeptide comprises a nucleic acid molecule encoding a fusion protein comprising a site-specific HNF4α targeting component that targets an HNF4α expression regulatory region and an effector molecule.

[0083] In some embodiments, the fusion protein comprises a peptide-nucleic acid fusion molecule.

[0084] In some embodiments, the effector is selected from the group consisting of a nuclease, a physical blocker, an epigenetic recruitment factor, and an epigenetic CpG modifier, and any combination of the foregoing.

[0085] In some embodiments, the effector comprises a CRISPR-associated protein (Cas) polypeptide or a nucleic acid molecule encoding a Cas polypeptide.

[0086] In some embodiments, the Cas polypeptide is an enzymatically inactive Cas polypeptide.

[0087] In some embodiments, the Cas polypeptide further comprises a catalytically active domain of human exonuclease 1 (hEXO1).

[0088] In some embodiments, the epigenetic recruitment factor comprises a transcriptional enhancer or a transcriptional repressor.

[0089] In some embodiments, the transcription enhancer is a VPR.

[0090] In some embodiments, the VPR is [ka] The amino acid sequence of the present invention includes an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of

[0091] In some embodiments, the transcriptional enhancer comprises two, three, four, or five VPRs.

[0092] In some embodiments, the transcription enhancer is p300.

[0093] In some embodiments, p300 is [ka] and has an amino acid sequence that has at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of

[0094] In some embodiments, the epigenetic CpG modifier comprises a DNA methylase, a DNA demethylase, a histone modifier, or a histone deacetylase.

[0095] In some embodiments, the effector molecule comprises a zinc finger polypeptide.

[0096] In some embodiments, the effector molecule comprises a transcription activator-like effector nuclease (TALEN) polypeptide.

[0097] In some embodiments, the fusion protein comprises an enzymatically inactive Cas polypeptide and an epigenetic recruitment factor polypeptide.

[0098] In some embodiments, the fusion protein comprises an enzymatic Cas polypeptide and an epigenetic CpG modifier polypeptide.

[0099] In some embodiments, the site-specific HNF4α blocking agent comprises a second nucleic acid molecule encoding a second fusion protein, the second fusion protein comprising a second site-specific HNF4α targeting component that targets a second HNF4α expression control region and a second effector molecule, wherein the second HNF4α expression control region is different from the HNF4α expression control region.

[0100] In some embodiments, the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG.

[0101] In some embodiments, the second effector is different from the effector.

[0102] In some embodiments, the second effector is the same as the effector.

[0103] In some embodiments, the fusion protein and the second fusion protein are operably linked.

[0104] In some embodiments, the fusion protein and the second fusion protein comprise an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the entire amino acid sequence of a polypeptide selected from ZF5.3-VPR-tPT2a-ZF7-VPR protein, ZF7-VPR-tPT2a-ZF5.3-VPR protein, ZF5.3-VPR-tPT2a-ZF7-p300 protein, and ZF7-p300-tPT2a-ZF5.3-VPR protein.

[0105] In some embodiments, the fusion protein comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the entire amino acid sequence of the ZF5.3-VPR protein.

[0106] In some embodiments, the fusion proteins include ZF5-VPR mRNA, ZF5.1-VPR mRNA, ZF5.2-VPR mRNA, ZF5.3-VPR mRNA, ZF5.4-VPR mRNA, ZF5.5-VPR mRNA, and ZF5.6-VPR mRNA. and is encoded by a polynucleotide having a sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of mRNA.

[0107] In some embodiments, administration of a site-specific HNF4α blocking agent and a second site-specific HNF4α blocking agent has a synergistic effect in modulating expression of HNF4α.

[0108] In some embodiments, the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT, and the second HNF4α expression control region comprises a sequence selected from the ZF7 target sequence ACTGAACATCGGTGAGTTAGG, the ZF10 target sequence CCTGCAGCCCCGCCCAGCCTA, the ZF14 target sequence GGAGGGGTGGGGGTTAATGGT, and the ZF15 target sequence GAAGGGGTGGAGGCTCTGCCG.

[0109] In some embodiments, the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG.

[0110] In some embodiments, the fusion protein comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the entire amino acid sequence of ZF5-VPR, and the second fusion protein comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the entire amino acid sequence of a polypeptide selected from ZF7-VPR, ZF10-VPR, ZF14-VPR, and ZF15-VPR.

[0111] In some embodiments, the fusion protein comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF1-VPR, ZF2-VPR, ZF3-VPR, ZF4-VPR, ZF5-VPR, ZF5.3-VPR, ZF6-VPR, ZF7-VPR, ZF8-VPR, ZF9-VPR, ZF10-VPR, ZF11-VPR, ZF12-VPR, ZF13-VPR, ZF14-VPR, and ZF15-VPR.

[0112] In some embodiments, the polypeptide is selected from the group consisting of ZF5-VPR, ZF5.3-VPR, ZF7-VPR, ZF10-VPR, ZF14-VPR, and ZF15-VPR.

[0113] In some embodiments, the polypeptide is ZF5.3-VPR.

[0114] In some embodiments, the site-specific blocking agent, the effector, or both the site-specific blocking agent and the effector are present in a vector, such as a viral expression vector.

[0115] In some embodiments, the site-specific blocking agent and the effector are present in the same vector.

[0116] In some embodiments, the site-specific blocking agent and the effector are present in different vectors.

[0117] In some embodiments, a site-specific blocking agent, an effector, or both a site-specific blocking agent and an effector are present in the composition.

[0118] In some embodiments, the site-specific blocking agent and the effector are present in the same composition.

[0119] In some embodiments, the site-specific blocking agent and the effector are present in different compositions.

[0120] In some embodiments, the composition comprises a pharmaceutical composition.

[0121] In some embodiments, the pharmaceutical composition comprises a lipid formulation.

[0122] In some embodiments, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof.

[0123] In some embodiments, the pharmaceutical composition comprises lipid nanoparticles.

[0124] In some embodiments, the cell is a mammalian cell, such as a somatic cell or a primary cell.

[0125] In some embodiments, the contacting step is carried out in vitro.

[0126] In some embodiments, the contacting step is performed in vivo.

[0127] In some embodiments, the contacting step is performed ex vivo.

[0128] In some embodiments, the methods of the invention further comprise administering the cells to a subject.

[0129] In some embodiments, the cell is present in a subject.

[0130] In some embodiments, the subject has an HNF4α-associated disorder.

[0131] In some embodiments, the HNF4α-related disease is selected from the group consisting of fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, liver inflammation, hepatocellular necrosis, liver fibrosis, and non-alcoholic fatty liver disease (NAFLD), polycystic kidney disease, inflammatory bowel disease (IBD), and MODY I.

[0132] In another aspect, the present invention provides a method for treating a subject having an HNF4α-related disease, comprising administering to the subject a therapeutically effective amount of a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby treating the subject.

[0133] In some embodiments, the HNF4α-associated disease is hepatocellular carcinoma, and the site-specific HNF4α blocking agent reduces expression of HNF4α in the subject.

[0134] In some embodiments, the HNF4α-associated disease is selected from the group consisting of fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, liver inflammation, hepatocellular necrosis, liver fibrosis, and non-alcoholic fatty liver disease (NAFLD), and the site-specific HNF4α blocker enhances HNF4α expression in the subject.

[0135] In some embodiments, the site-specific HNF4α blocking agent and the effector molecule are administered to the subject together.

[0136] In some embodiments, the site-specific HNF4α blocking agent and the effector molecule are administered sequentially to the subject.

[0137] In some embodiments, the effector molecule is administered to the subject prior to administration of the site-specific HNF4α blocking agent.

[0138] In some embodiments, the site-specific HNF4α blocking agent is administered to the subject prior to administering the effector molecule.

[0139] In one aspect, the present invention provides a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region, wherein the HNFα expression control region comprises any one of the nucleotide sequences listed in column 3 of Table 1 or column 4 of Table 10.

[0140] In one embodiment, the site-specific HNF4α targeting component comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide identity to the entire nucleotide sequence of any of the nucleotide sequences in any one of Tables 2, 3, 4, and 9.

[0141] In one embodiment, the site-specific HNF4α targeting component comprises a polymer molecule comprising a polynucleotide or fragment thereof encoding the DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically binds to an HNF4α expression control region.

[0142] In one embodiment, the DNA-binding domain of a TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10.

[0143] In one embodiment, the HNFα expression control region comprises the nucleotide sequence of the ZF5 target sequence GGCGGGGGACCGATTAACCAT.

[0144] In one embodiment, the HNFα expression control region comprises the nucleotide sequence of the ZF7 target sequence ACTGAACATCGGTGAGTTAGG.

[0145] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF5-VPR comprising the amino acid sequence of

[0146] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF5.3-VPR, which comprises the amino acid sequence of

[0147] In yet another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF7-VPR, which comprises the amino acid sequence of

[0148] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF10-VPR, which comprises the amino acid sequence of

[0149] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF14-VPR, which comprises the amino acid sequence of

[0150] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF15-VPR, which comprises the amino acid sequence of

[0151] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] The present invention provides a bicistronic site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF5.3-VPR-tPT2a-ZF7-VPR comprising the amino acid sequence:

[0152] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] The present invention provides a bicistronic site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF7-VPR-tPT2a-ZF5.3-VPR comprising the amino acid sequence:

[0153] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] The present invention provides a bicistronic site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF5.3-VPR-tPT2a-ZF7-p300 comprising the amino acid sequence:

[0154] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a bicistronic site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF7-p300-tPT2a-ZF5.3-VPR comprising the amino acid sequence:

[0155] The present invention also provides vectors, such as viral expression vectors, and cells comprising the site-specific HNF4α blocking agents of the invention and the vectors of the invention.

[0156] In some embodiments, the site-specific HNF4α blocking agents of the present invention are present in a composition, such as a pharmaceutical composition.

[0157] In some embodiments, the pharmaceutical composition comprises a lipid formulation.

[0158] In some embodiments, the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof.

[0159] In some embodiments, the pharmaceutical composition comprises lipid nanoparticles.

[0160] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] The present invention provides a pharmaceutical composition comprising a site-specific HNF4α blocker comprising a polynucleotide encoding the amino acid sequence of ZF5.3-VPR, which comprises the amino acid sequence of: and lipid nanoparticles.

[0161] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] a site-specific HNF4α blocker comprising a polynucleotide encoding the amino acid sequence of ZF5.3-VPR comprising the amino acid sequence of

[0162] [ka] and a pharmaceutical composition comprising lipid nanoparticles.

[0163] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: [ka] [ka] and a pharmaceutical composition comprising lipid nanoparticles.

[0164] In one aspect, the invention provides a method for modulating expression of hepatocyte nuclear factor 4 alpha (HNF4α) in a cell, comprising contacting the cell with a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby modulating expression of HNF4α in the cell.

[0165] The modulation of expression can be an increase in the expression of HNF4α in the cell or a decrease in the expression of HNF4α in the cell. (Item 1) A site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets the HNF4α expression control region. (Item 2) 2. The site-specific HNF4α blocking agent of item 1, wherein the site-specific HNF4α targeting component comprises a polymer molecule. (Item 3) 3. The site-specific HNF4α blocking agent of item 2, wherein the polymer molecule comprises a polyamide. (Item 4) 3. The site-specific HNF4α blocking agent of item 2, wherein the polymer molecule comprises a polynucleotide. (Item 5) 2. The site-specific HNF4α blocking agent of item 1, wherein the expression control region comprises an HNF4α-specific transcription control element. (Item 6) 6. The site-specific HNF4α blocking agent of item 5, wherein the transcriptional control element comprises an HNF4α promoter. (Item 7) 7. The site-specific HNF4α blocking agent of item 6, wherein the HNF4α promoter comprises the nucleotide sequence of HNF4α promoter 1 or a fragment thereof. (Item 8) 7. The site-specific HNF4α blocking agent of item 6, wherein the HNF4α promoter comprises the nucleotide sequence of HNF4α promoter 2 or a fragment thereof. (Item 9) 6. The site-specific HNF4α blocking agent of item 5, wherein the transcriptional control element comprises a transcriptional enhancer. (Item 10) 6. The site-specific HNF4α blocking agent of item 5, wherein the transcriptional control element comprises a transcriptional repressor. (Item 11) 11. The site-specific HNF4α blocking agent of any one of items 1 to 10, comprising a nucleotide sequence having at least 85% nucleotide identity to the entire nucleotide sequence of any one of the nucleotide sequences in Tables 2, 3, 4, and 9. (Item 12) 3. The site-specific HNF4α blocking agent of item 2, wherein the polymer molecule comprises a polynucleotide or a fragment thereof encoding the DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide that specifically binds to the HNF4α expression control region. (Item 13) The site-specific HNF4α blocking agent of item 12, wherein the DNA binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10. (Item 14) The site-specific HNF4α blocking agent described in item 1, wherein the expression control region comprises one or more HNF4α-related anchor sequences within an anchor sequence-mediated connection comprising a first HNF4α-related anchor sequence and a second HNF4α-related anchor sequence. (Item 15) 15. The site-specific HNF4α blocking agent of item 14, wherein the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif. (Item 16) 16. The site-specific HNF4α blocking agent of item 14 or 15, wherein the anchor sequence-mediated connection comprises one or more transcriptional control elements inside the connection. (Item 17) 16. The site-specific HNF4α blocking agent of item 14 or 15, wherein the anchor sequence-mediated connection comprises one or more transcriptional control elements outside the connection. (Item 18) 18. The site-specific HNF4α blocking agent of any one of items 14 to 17, wherein the first anchor sequence and / or the second anchor sequence is located within about 500 kb of the transcriptional control element. (Item 19) Item 20. The site-specific HNF4α blocking agent according to Item 18, wherein the first anchor sequence and / or the second anchor sequence is located within 300 kb of the transcription control element. 20. The site-specific HNF4α blocking agent of any one of items 1 to 19, comprising a nucleotide modification. (Item 21) 3. The site-specific HNF4α blocking agent according to item 2, wherein the polymer molecule comprises a peptide nucleic acid (PNA). (Item 22) 22. A vector comprising the site-specific HNF4α blocking agent of any one of items 1 to 21. (Item 23) 23. The vector according to item 22, which is a viral expression vector. (Item 24) A cell comprising the site-specific HNF4α blocking agent of any one of items 1 to 21 or the vector of item 22 or 23. (Item 25) 22. A site-specific HNF4α blocking agent according to any one of items 1 to 21, which is present in a composition. (Item 26) 26. The site-specific HNF4α blocking agent according to item 25, wherein the composition comprises a pharmaceutical composition. (Item 27) Item 28. The site-specific HNF4α blocking agent according to Item 26, wherein the pharmaceutical composition comprises a lipid formulation. 28. The site-specific HNF4α blocking agent of item 27, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof. (Item 29) 28. The site-specific HNF4α blocking agent according to item 27, wherein the pharmaceutical composition comprises lipid nanoparticles. (Item 30) A site-specific HNF4α blocking agent comprising a nucleic acid molecule encoding a fusion protein comprising a site-specific HNF4α targeting component that targets the HNF4α expression control region and an effector molecule (Item 31). 31. The site-specific HNF4α blocking agent of Item 30, wherein the site-specific HNF4α targeting component comprises a polynucleotide encoding a DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide that specifically binds to the HNF4α expression control region. (Item 32) 32. The site-specific HNF4α blocking agent of Item 31, wherein the DNA-binding domain of the TALE or zinc finger polypeptide comprises an amino acid sequence having at least 85% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10. (Item 33) 31. The site-specific HNF4α blocking agent of item 30, wherein the effector molecule comprises a polypeptide or a nucleic acid molecule encoding the polypeptide. (Item 34) 31. The site-specific HNF4α blocking agent of item 30, wherein the fusion protein comprises a peptide-nucleic acid fusion. (Item 35) 35. The site-specific HNF4α blocking agent of any one of items 30 to 34, wherein the effector is selected from the group consisting of a nuclease, a physical blocking agent, an epigenetic recruitment agent, and an epigenetic CpG modifier, and any combination thereof. (Item 36) 36. The site-specific HNF4α blocking agent of item 35, wherein the effector comprises a CRISPR-associated protein (Cas) polypeptide or a nucleic acid molecule encoding the Cas polypeptide. (Item 37) 37. The site-specific HNF4α blocking agent of item 36, wherein the Cas polypeptide is an enzymatically inactive Cas polypeptide. (Item 38) 37. The site-specific HNF4α blocking agent of item 36, further comprising the catalytically active domain of human exonuclease 1 (hEXO1). (Item 39) 36. The site-specific HNF4α blocking agent of item 35, wherein the epigenetic recruitment factor comprises a transcriptional enhancer or a transcriptional repressor. (Item 40) 40. The site-specific HNF4α blocking agent of item 39, wherein the transcription enhancer is VPR (VP64-p65-Rta). (Item 41) The VPR is [ka] [ka] 41. The site-specific HNF4α blocking agent according to item 40, comprising an amino acid sequence having at least about 85% amino acid identity to the entire amino acid sequence of (Item 42) 42. The site-specific HNF4α blocking agent of item 40 or 41, wherein the transcription enhancer comprises two, three, four, or five VPRs. (Item 43) 40. The site-specific HNF4α blocking agent of item 39, wherein the transcription enhancer is p300. (Item 44) The p300 is [ka] 44. The site-specific HNF4α blocking agent according to Item 43, comprising an amino acid sequence having at least about 85% identity to the entire amino acid sequence of (Item 45) 36. The site-specific HNF4α blocking agent of item 35, wherein the epigenetic CpG modifier comprises a DNA methylase, a DNA demethylase, a histone modifier, or a histone deacetylase. (Item 46) 36. The site-specific HNF4α blocking agent of any one of items 30 to 35, wherein the effector molecule comprises a zinc finger polypeptide. (Item 47) 36. The site-specific HNF4α blocking agent of any one of items 30 to 35, wherein the effector molecule comprises a transcription activator-like effector nuclease (TALEN) polypeptide. (Item 48) 48. The site-specific HNF4α blocking agent of any one of items 30 to 47, further comprising a second nucleic acid molecule encoding a second fusion protein, wherein the second fusion protein comprises a second site-specific HNF4α targeting component that targets a second HNF4α expression control region and a second effector molecule, wherein the second HNF4α expression control region is different from the HNF4α expression control region. (Item 49) Item 50. The site-specific HNF4α blocking agent according to Item 48, wherein the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG. 50. The site-specific HNF4α blocking agent of item 49, wherein the second effector is different from the effector. (Item 51) 51. The site-specific HNF4α blocking agent of item 50, wherein the second effector is the same as the effector. (Item 52) 52. The site-specific HNF4α blocking agent of any one of items 49 to 51, wherein the fusion protein and the second fusion protein are operably linked. (Item 53) 53. The site-specific HNF4α blocking agent of Item 52, wherein the fusion protein and the second fusion protein comprise an amino acid sequence having at least about 85% amino acid sequence identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF5.3-VPR-tPT2a-ZF7-VPR (SEQ ID NO: 176); ZF7-VPR-tPT2a-ZF5.3-VPR (SEQ ID NO: 178); ZF5.3-VPR-tPT2a-ZF7-p300 (SEQ ID NO: 180); and ZF7-p300-tPT2a-ZF5.3-VPR (SEQ ID NO: 182). (Item 54) 54. The site-specific HNF4α blocking agent of any one of items 30 to 53, wherein the fusion protein comprises an amino acid sequence having at least about 85% amino acid sequence identity to the entire amino acid sequence of ZF5.3-VPR (sequence number 116). (Item 55) 55. The site-specific HNF4α blocking agent of Item 54, wherein the fusion protein is encoded by a polynucleotide comprising a nucleotide sequence having at least about 85% nucleotide sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of ZF5-VPR mRNA (SEQ ID NO: 117), ZF5.1-VPR mRNA (SEQ ID NO: 160), ZF5.2-VPR mRNA (SEQ ID NO: 161), ZF5.3-VPR mRNA (SEQ ID NO: 162), ZF5.4-VPR mRNA (SEQ ID NO: 163), ZF5.5-VPR mRNA (SEQ ID NO: 164), and ZF5.6-VPR mRNA (SEQ ID NO: 165). (Item 56) A site-specific HNF4α blocking agent comprising a nucleic acid molecule encoding a fusion protein, wherein the fusion protein is selected from the group consisting of ZF1-VPR (SEQ ID NO: 100), ZF2-VPR (SEQ ID NO: 104), ZF3-VPR (SEQ ID NO: 108), ZF4-VPR (SEQ ID NO: 112), ZF5-VPR (SEQ ID NO: 116), ZF5.3-VPR (SEQ ID NO: 116), ZF6-VPR (SEQ ID NO: 120), ZF7-VPR (SEQ ID NO: 124), and ZF8-VPR (SEQ ID NO: 128). , ZF9-VPR (SEQ ID NO: 132), ZF10-VPR (SEQ ID NO: 136), ZF11-VPR (SEQ ID NO: 140), ZF12-VPR (SEQ ID NO: 144), ZF13-VPR (SEQ ID NO: 148), ZF14-VPR (SEQ ID NO: 152), and ZF15-VPR (SEQ ID NO: 156). (Item 57) 57. The site-specific HNF4α blocking agent of item 56, wherein the polypeptide is selected from the group consisting of ZF5-VPR (SEQ ID NO: 116), ZF5.3-VPR, ZF7-VPR (SEQ ID NO: 124), ZF14-VPR (SEQ ID NO: 152), and ZF15-VPR (SEQ ID NO: 156). (Item 58) 58. The site-specific HNF4α blocking agent of item 57, wherein the polypeptide is ZF5.3-VPR (sequence number 116). (Item 59) 59. A vector comprising a nucleic acid molecule encoding the site-specific HNF4α blocking agent of any one of items 30 to 58. (Item 60) 60. The vector of item 59, which is a viral expression vector. (Item 61) A cell comprising the site-specific HNF4α blocking agent of any one of items 30 to 58 or the vector of item 59 or 60. (Item 62) 59. The site-specific HNF4α blocking agent according to any one of items 30 to 58, which is present in a composition. (Item 63) 63. The site-specific HNF4α blocking agent of item 62, wherein the composition comprises a pharmaceutical composition. (Item 64) Item 65. The site-specific HNF4α blocking agent according to Item 63, wherein the pharmaceutical composition comprises a lipid formulation. 65. The site-specific HNF4α blocking agent of item 64, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof. (Item 66) 65. The site-specific HNF4α blocking agent according to item 64, wherein the pharmaceutical composition comprises lipid nanoparticles. (Item 67) A method for modulating the expression of hepatocyte nuclear factor 4 alpha (HNF4α) in a cell, comprising contacting the cell with a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby modulating the expression of HNF4α in the cell. (Item 68) 68. The method of item 67, wherein the modulation of expression is enhancement of HNF4α expression in the cell. (Item 69) 68. The method of item 67, wherein the modulation of expression is a reduction in the expression of HNF4α in the cell. (Item 70) 68. The method of claim 67, wherein the site-specific HNF4α targeting component comprises a polymer molecule. (Item 71) 71. The method of claim 70, wherein the polymer molecules comprise polyamide. (Item 72) 72. The method of claim 71, wherein the polymer molecule comprises a polynucleotide. (Item 73) 71. The method of claim 70, wherein the expression control region comprises an HNF4α-specific transcription control element. (Item 74) Item 75. The method of Item 73, wherein the transcriptional control element comprises an HNF4α promoter. 75. The method of item 74, wherein the HNF4α promoter comprises the nucleotide sequence of HNF4α promoter 1 or a fragment thereof. (Item 76) 75. The method of item 74, wherein the HNF4α promoter comprises the nucleotide sequence of HNF4α promoter 2 or a fragment thereof. (Item 77) 74. The method of item 73, wherein the transcriptional control element comprises a transcriptional enhancer. (Item 78) 74. The method of claim 73, wherein the transcriptional control element comprises a transcriptional repressor. (Item 79) 79. The method of any one of items 67 to 78, wherein the site-specific HNF4α blocking agent comprises a nucleotide sequence having at least 85% nucleotide identity to the entire nucleotide sequence of any one of the nucleotide sequences in any one of Tables 2, 3, 4, and 9. (Item 80) 61. The method of any one of items 49 to 60, wherein the site-specific HNF4α blocking agent comprises a polynucleotide or a fragment thereof encoding a DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide that specifically binds to the HNF4α expression control region. (Item 81) The method of item 80, wherein the DNA binding domain of the TALE or ZNF comprises an amino acid sequence having at least 85% amino acid identity to the entire amino acid sequence of an amino acid sequence selected from the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10. (Item 82) 68. The method of item 67, wherein the expression control region comprises one or more HNF4α-related anchor sequences within an anchor sequence-mediated connection comprising a first HNF4α-related anchor sequence and a second HNF4α-related anchor sequence. (Item 83) 83. The method of claim 82, wherein the anchor sequence comprises a CCCTC-binding factor (CTCF) binding motif. (Item 84) 84. The method of claim 82 or 83, wherein the anchor sequence-mediated junction comprises one or more transcriptional control elements inside the junction. (Item 85) 84. The method of claim 82 or 83, wherein the anchor sequence-mediated connection comprises one or more transcriptional control elements outside the connection. (Item 86) 86. The method of any one of items 82 to 85, wherein the first anchor sequence and / or the second anchor sequence is located within about 500 kb of the transcriptional control element. (Item 87) 87. The method of item 86, wherein the first anchor sequence and / or the second anchor sequence is located within 300 kb of the transcriptional control element. (Item 88) 88. The method of any one of items 67 to 87, wherein the site-specific HNF4α blocking agent comprises a nucleotide modification. (Item 89) 72. The method of claim 71, wherein the polymer molecule comprises a peptide nucleic acid (PNA). (Item 90) 68. The method of claim 67, wherein the effector molecule comprises a polypeptide. (Item 91) 91. The method of claim 90, wherein the polypeptide comprises a nucleic acid molecule encoding a fusion protein comprising the site-specific HNF4α targeting component that targets an HNF4α expression regulatory region and the effector molecule. (Item 92) 92. The method of claim 91, wherein the fusion protein comprises a peptide-nucleic acid fusion molecule. (Item 93) 68. The method of claim 67, wherein the effector is selected from the group consisting of a nuclease, a physical blocking agent, an epigenetic recruitment agent, and an epigenetic CpG modifier, and any combination thereof. (Item 94) 94. The method of claim 93, wherein the effector comprises a CRISPR-associated protein (Cas) polypeptide or a nucleic acid molecule encoding the Cas polypeptide. (Item 95) 95. The method of claim 94, wherein the Cas polypeptide is an enzymatically inactive Cas polypeptide. (Item 96) 96. The method of item 95, further comprising the catalytically active domain of human exonuclease 1 (hEXO1). (Item 97) 94. The method of item 93, wherein the epigenetic recruitment factor comprises a transcriptional enhancer or a transcriptional repressor. (Item 98) Item 98. The method of item 97, wherein the transcription enhancer is VPR. (Item 99) The VPR is [ka] [ka] 99. The method of item 98, comprising an amino acid sequence having at least about 85% amino acid identity to the entire amino acid sequence of (Item 100) 99. The method of claim 98 or 99, wherein the transcription enhancer comprises two, three, four, or five VPRs. (Item 101) 98. The method of item 97, wherein the transcription enhancer is p300. (Item 102) The p300 is [ka] 102. The method of claim 101, wherein the amino acid sequence has at least about 85% amino acid identity to the entire amino acid sequence of (Item 103) 94. The method of claim 93, wherein the epigenetic CpG modifier comprises a DNA methylase, a DNA demethylase, a histone modifier, or a histone deacetylase. (Item 104) 94. The method of any one of items 90 to 93, wherein the effector molecule comprises a zinc finger polypeptide. (Item 105) 94. The method of any one of items 90 to 93, wherein the effector molecule comprises a transcription activator-like effector nuclease (TALEN) polypeptide. (Item 106) 92. The method of claim 91, wherein the fusion protein comprises an enzymatically inactive Cas polypeptide and an epigenetic recruitment factor polypeptide. (Item 107) 92. The method of claim 91, wherein the fusion protein comprises an enzymatic Cas polypeptide and an epigenetic CpG modifier polypeptide. (Item 108) 108. The method of any one of items 67 to 107, wherein the site-specific HNF4α blocking agent comprises a second nucleic acid molecule encoding a second fusion protein, the second fusion protein comprising a second site-specific HNF4α targeting component that targets a second HNF4α expression control region and a second effector molecule, the second HNF4α expression control region being different from the HNF4α expression control region. (Item 109) Item 109. The method of item 108, wherein the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG. (Item 110) Item 111. The method of item 108, wherein the second effector is different from the effector. 111. The method of claim 110, wherein the second effector is the same as the effector. (Item 112) 112. The method of any one of items 108 to 111, wherein the fusion protein and the second fusion protein are operably linked. (Item 113) 113. The method of claim 112, wherein the fusion protein and the second fusion protein comprise an amino acid sequence having at least about 85% identity to the entire amino acid sequence of a polypeptide selected from ZF5.3-VPR-tPT2a-ZF7-VPR protein (SEQ ID NO: 176); ZF7-VPR-tPT2a-ZF5.3-VPR protein (SEQ ID NO: 178); ZF5.3-VPR-tPT2a-ZF7-p300 protein (SEQ ID NO: 180); and ZF7-p300-tPT2a-ZF5.3-VPR protein (SEQ ID NO: 182). (Item 114) 114. The method of any one of items 67 to 113, wherein the fusion protein comprises an amino acid sequence having at least 85% identity to the entire amino acid sequence of ZF5.3-VPR protein (SEQ ID NO: 116). (Item 115) 115. The method of claim 114, wherein the fusion protein is encoded by a polynucleotide having a sequence that has at least about 85% sequence identity to the entire nucleotide sequence of a polynucleotide selected from the group consisting of ZF5-VPR mRNA (SEQ ID NO: 117), ZF5.1-VPR mRNA (SEQ ID NO: 160), ZF5.2-VPR mRNA (SEQ ID NO: 161), ZF5.3-VPR mRNA (SEQ ID NO: 162), ZF5.4-VPR mRNA (SEQ ID NO: 163), ZF5.5-VPR mRNA (SEQ ID NO: 164), and ZF5.6-VPR mRNA (SEQ ID NO: 165). (Item 116) 116. The method of any one of items 108 to 115, wherein administration of the site-specific HNF4α blocking agent and a second site-specific HNF4α blocking agent has a synergistic effect in modulating expression of HNF4α. (Item 117) 117. The method of any one of items 108 to 116, wherein the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT, and the second HNF4α expression control region comprises a sequence selected from the ZF7 target sequence ACTGAACATCGGTGAGTTAGG, the ZF10 target sequence CCTGCAGCCCCGCCCAGCCTA, the ZF14 target sequence GGAGGGGGTGGGGGTTAATGGT, and the ZF15 target sequence GAAGGGGTGGAGGCTCTGCCG. (Item 118) 118. The method of item 117, wherein the HNF4α expression control region comprises the ZF5 target sequence GGCGGGGGACCGATTAACCAT, and the second HNF4α expression control region comprises the ZF7 target sequence ACTGAACATCGGTGAGTTAGG. (Item 119) 118. The method of claim 117, wherein the fusion protein comprises a sequence having at least 85% sequence identity to the entire amino acid sequence of ZF5.3-VPR, and the second fusion protein comprises a sequence having at least 85% sequence identity to the entire amino acid sequence of a polypeptide selected from ZF7-VPR (SEQ ID NO: 124), ZF14-VPR (SEQ ID NO: 152), and ZF15-VPR (SEQ ID NO: 156). (Item 120) The fusion proteins are selected from the group consisting of ZF1-VPR (SEQ ID NO: 100), ZF2-VPR (SEQ ID NO: 104), ZF3-VPR (SEQ ID NO: 108), ZF4-VPR (SEQ ID NO: 112), ZF5-VPR (SEQ ID NO: 116), ZF5.3-VPR (SEQ ID NO: 116), ZF6-VPR (SEQ ID NO: 120), ZF7-VPR (SEQ ID NO: 124), ZF8-VPR (SEQ ID NO: 128), ZF9-VPR (SEQ ID NO: 132), 92. The method of claim 91, wherein the amino acid sequence comprises an amino acid sequence having at least about 85% identity to the entire amino acid sequence of a polypeptide selected from the group consisting of ZF10-VPR (SEQ ID NO: 136), ZF11-VPR (SEQ ID NO: 140), ZF12-VPR (SEQ ID NO: 144), ZF13-VPR (SEQ ID NO: 148), ZF14-VPR (SEQ ID NO: 152), and ZF15-VPR (SEQ ID NO: 156). (Item 121) 121. The method of claim 120, wherein the polypeptide is selected from the group consisting of ZF5-VPR (SEQ ID NO: 116), ZF5.3-VPR (SEQ ID NO: 116), ZF7-VPR (SEQ ID NO: 124), ZF14-VPR (SEQ ID NO: 152), and ZF15-VPR (SEQ ID NO: 156). (Item 122) Item 122. The method of item 121, wherein the polypeptide is ZF5.3-VPR (SEQ ID NO: 116). (Item 123) 123. The method of any one of items 67 to 122, wherein the site-specific blocking agent, the effector, or both the site-specific blocking agent and the effector are present in a vector. (Item 124) 124. The method of claim 123, wherein the site-specific blocking agent and the effector are present in the same vector. (Item 125) 124. The method of claim 123, wherein the site-specific blocking agent and the effector are present in different vectors. (Item 126) 126. The method of any one of items 123 to 125, wherein the vector is a viral expression vector. (Item 127) 123. The method of any one of items 67 to 122, wherein the site-specific blocking agent, the effector, or both the site-specific blocking agent and the effector are present in a composition. (Item 128) 128. The method of claim 127, wherein the site-specific blocking agent and the effector are present in the same composition. (Item 129) 128. The method of claim 127, wherein the site-specific blocking agent and the effector are present in different compositions. (Item 130) 130. The method of any one of items 127 to 129, wherein the composition comprises a pharmaceutical composition. (Item 131) 131. The method of claim 130, wherein the pharmaceutical composition comprises a lipid formulation. (Item 132) 132. The method of claim 131, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof. (Item 133) Item 131. The site-specific HNF4α blocking agent of item 130, wherein the pharmaceutical composition comprises lipid nanoparticles. (Item 134) Item 68. The method of item 67, wherein the cell is a mammalian cell. (Item 135) Item 135. The method of item 134, wherein the mammalian cell is a somatic cell. (Item 136) 135. The method of item 134, wherein the mammalian cells are primary cells. (Item 137) Item 138. The method of Item 67, wherein the contacting step is carried out in vitro. 68. The method of claim 67, wherein the contacting step is carried out in vivo. (Item 139) 68. The method of claim 67, wherein the contacting step is performed ex vivo. (Item 140) 140. The method of claim 139, further comprising administering the cells to a subject. (Item 141) 68. The method of item 67, wherein the cell is present in a subject. (Item 142) 142. The method of claim 140 or 141, wherein the subject has an HNF4α-associated disease. (Item 143) Item 143. The method of item 142, wherein the HNF4α-related disease is selected from the group consisting of fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, liver inflammation, hepatocellular necrosis, liver fibrosis, and non-alcoholic fatty liver disease (NAFLD), polycystic kidney disease, inflammatory bowel disease (IBD), and MODY I. (Item 144) A method for treating a subject having an HNF4α-related disease, comprising administering to the subject a therapeutically effective amount of a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby treating the subject. (Item 145) Item 145. The method of item 144, wherein the HNF4α-associated disease is hepatocellular carcinoma, and the site-specific HNF4α blocking agent reduces the expression of HNF4α in the subject. (Item 146) Item 146. The method of item 145, wherein the HNF4α-associated disease is selected from the group consisting of fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, liver inflammation, hepatocellular necrosis, liver fibrosis, and non-alcoholic fatty liver disease (NAFLD), and the site-specific HNF4α blocker enhances HNF4α expression in the subject. (Item 147) 147. The method of any one of items 144 to 146, wherein the site-specific HNF4α blocking agent and the effector molecule are administered to the subject in combination. (Item 148) 147. The method of any one of items 144 to 146, wherein the site-specific HNF4α blocking agent and the effector molecule are administered sequentially to the subject. (Item 149) Item 149. The method of item 148, wherein the effector molecule is administered to the subject prior to administration of the site-specific HNF4α blocking agent. (Item 150) Item 149. The method of item 149, wherein the site-specific HNF4α blocking agent is administered to the subject prior to administration of the effector molecule. (Item 151) A site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region, wherein the HNFα expression control region comprises any one of the nucleotide sequences listed in column 3 of Table 1 or column 1 of Table 10. (Item 152) 152. The site-specific HNF4α blocking agent of claim 151, wherein the site-specific HNF4α targeting component comprises a nucleotide sequence having at least 85% nucleotide identity to the entire nucleotide sequence of any one of the nucleotide sequences in any one of Tables 2, 3, 4, and 9. (Item 153) 152. The site-specific HNF4α blocking agent of Item 151, wherein the site-specific HNF4α targeting component comprises a polymer molecule comprising a polynucleotide or a fragment thereof encoding a DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide that specifically binds to the HNF4α expression control region. (Item 154) The site-specific HNF4α blocking agent of Item 153, wherein the DNA-binding domain of the TALE or ZNF polypeptide comprises an amino acid sequence having at least about 85% amino acid identity to the entire amino acid sequence of any one of the amino acid sequences listed in column 5 of Table 6A or column 4 of Table 10. (Item 155) 152. The site-specific HNF4α blocking agent of Item 151, wherein the HNFα expression control region comprises the nucleotide sequence of the ZF5 target sequence GGCGGGGGACCGATTAACCAT. (Item 156) 152. The site-specific HNF4α blocking agent of Item 151, wherein the HNFα expression control region comprises the nucleotide sequence of the ZF7 target sequence ACTGAACATCGGTGAGTTAGG. (Item 157) [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF5-VPR comprising the amino acid sequence of (Item 158) [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF5.3-VPR comprising the amino acid sequence of (Item 159) [ka] [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF7-VPR comprising the amino acid sequence of (Item 160) [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF10-VPR comprising the amino acid sequence of (Item 161) [ka] [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF14-VPR comprising the amino acid sequence of (Item 162) [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of ZF15-VPR comprising the amino acid sequence of (Item 163) [ka] [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of a bicistronic ZF5.3-VPR-tPT2a-ZF7-VPR comprising the amino acid sequence (Item 164). [ka] [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of a bicistronic ZF7-VPR-tPT2a-ZF5.3-VPR comprising the amino acid sequence (Item 165). [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF5.3-VPR-tPT2a-ZF7-p300 comprising the amino acid sequence: (Item 166) [ka] A site-specific HNF4α blocking agent comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF7-p300-tPT2a-ZF5.3-VPR comprising the amino acid sequence of (Item 167) 167. A vector comprising a nucleic acid molecule encoding the site-specific HNF4α blocking agent of any one of items 151 to 166. (Item 168) Item 168. The vector of item 167, which is a viral expression vector. (Item 169) A pharmaceutical composition comprising a site-specific HNF4α blocking agent according to any one of items 151 to 166, or a vector according to item 167 or 168. (Item 170) 169. The pharmaceutical composition according to item 169, comprising a lipid formulation. (Item 171) 171. The pharmaceutical composition of claim 170, wherein the lipid formulation comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, or one or more PEG-modified lipids, or any combination thereof. (Item 172) 171. The pharmaceutical composition according to item 170, comprising lipid nanoparticles. (Item 173) [ka] A pharmaceutical composition comprising a site-specific HNF4α blocker comprising a polynucleotide encoding the amino acid sequence of ZF5.3-VPR, the amino acid sequence of which comprises the amino acid sequence of: and lipid nanoparticles. (Item 174) [ka] [ka] A pharmaceutical composition comprising a site-specific HNF4α blocker comprising a polynucleotide encoding the amino acid sequence of ZF7-VPR, the amino acid sequence of which comprises the amino acid sequence of: and lipid nanoparticles. (Item 175) [ka] A pharmaceutical composition comprising a site-specific HNF4α blocker and lipid nanoparticles, the site-specific HNF4α blocker comprising a polynucleotide encoding the amino acid sequence of bicistronic ZF5.3-VPR-tPT2a-ZF7-VPR comprising the amino acid sequence of (Item 176) A cell comprising the site-specific HNF4α blocking agent of any one of items 151 to 166 or the vector of item 167 or 168. (Item 177) 166. A method for modulating expression of hepatocyte nuclear factor 4 alpha (HNF4α) in a cell, comprising contacting the cell with a site-specific HNF4α blocking agent according to any one of items 151 to 166, or a vector according to item 167 or 168, or a pharmaceutical composition according to any one of items 169 to 175. (Item 178) 178. The method of claim 177, wherein the modulation of expression is enhancement of expression of HNF4α in the cell. (Item 179) 178. The method of claim 177, wherein the modulation of expression is a reduction in the expression of HNF4α in the cell. [Brief explanation of the drawings]

[0166] [Figure 1] FIG. 1 shows a chromosomal diagram of part of the upstream region and coding sequence of HNF4α, and the location of guide RNAs and the pool of guide RNAs described herein.

[0167] [Figure 2] Figure 2 is a graph showing the percent of HNF4α mRNA remaining in HepG2 cells 72 hours after contacting the cells with the indicated pools of site-specific HNF4α targeting components and effector molecules, including dCas and KRAB, at the indicated doses.

[0168] [Figure 3] 3 is a graph showing the percent of HNF4α mRNA remaining in HepG2 cells 72 hours after contacting the cells with the indicated doses of either the indicated site-specific HNF4α targeting components and effector molecules comprising dCas and KRAB, or the indicated pool of HNF4α targeting components and effector molecules comprising dCas and KRAB. Untreated cells and cells contacted with dCas9 alone were used as controls.

[0169] [Figure 4A] Figure 4A is a graph showing the percent HNF4α mRNA measured in A549 cells 48 hours after contacting the cells with the indicated pools of HNF4α targeting components and effector molecules including dCas and VPR at the indicated doses. SH is an abbreviation for "safe harbor," a non-targeting guide control.

[0170] [Figure 4B] Figure 4B is a graph showing the percent HNF4α mRNA measured in LX-2 cells 48 hours after contacting the cells with the indicated pool of HNF4α targeting components and effector molecules including dCas and VPR at the indicated doses.

[0171] [Figure 5] Figure 5 is a graph showing activation of HNF4α by dCas9-VPR in LX-2 cells transfected with LNP formulations.

[0172] [Figure 6] Figure 6 is a graph showing activation of HNF4α by dCas9-VPR in HepG2 cells transfected using LNP formulations.

[0173] [Figure 7] Figure 7 shows immunohistochemical images showing that HNF4α protein induced by dCas9-VPR pool 1 is localized to the nucleus.

[0174] [Figure 8-1] FIG. 8 is a schematic diagram showing the structure of the human HNF4α promoter region and HNF4α isoforms. [Figure 8-2] FIG. 8 is a schematic diagram showing the structure of the human HNF4α promoter region and HNF4α isoforms.

[0175] [Figure 9]FIG. 9 shows a schematic representation of the localization of various site-specific HNF4α targeting components to the HNF4a promoter region.

[0176] [Figure 10] FIG. 10 shows a schematic representation of the structure of an exemplary zinc finger-VPR fusion protein of the invention.

[0177] [Figure 11] FIG. 11 is a graph showing activation of HNF4α in LX-2 cells using ZF-VPR mRNA.

[0178] [Figure 12] FIG. 12 is a graph showing activation of HNF4α in LX-2 cells using TAL-VPR and ZF-VPR.

[0179] [Figure 13] FIG. 13 is a graph showing activation of HNF4α in LX-2 cells using ATUM codon-optimized ZF5-VPR variants.

[0180] [Figure 14] FIG. 14 is a graph showing the persistence of VPR activation of HNF4α in K562 cells using ZF5-VPR, ZF5-p300, ZF5-VPR and ZF5-p300, and ZF5-VPR and ZF7-VPR.

[0181] [Figure 15] FIG. 15 is a graph showing the persistence of VPR activation of HNF4α in K562 cells using ZF5-VPR and ZF7-VPR.

[0182] [Figure 16] FIG. 16 is a graph showing the persistence of VPR activation of HNF4α in K562 cells using ZF5-VPR and ZF7-VPR, and ZF5.3-VPR and ZF7-VPR.

[0183] [Figure 17] Figure 17 is a graph showing changes in expression levels of downstream biomarkers of HNF4a after activation of HNF4α by dCas9-VPR in LX-2 cells.

[0184] [Figure 18] FIG. 18 is a graph showing changes in expression levels of HNF4a biomarkers after activation of HNF4α by ZF5-VPR, ZF5.3-VPR, ZF5-VPR and ZF7-VPR, and ZF5.3-VPR and ZF7-VPR in LX-2 cells.

[0185] [Figure 19] FIG. 19 is a graph showing the screening of ZF11, ZF13, and ZF14 in LX-2 cells and the synergistic effects of ZF5-VPR and ZF7-VPR, and ZF5.3-VPR and ZF7-VPR in activating HNF4α. [Figure 20] Figure 20 is a graph showing activation of HNF4α using dCas9-VPR3-pool1 and screening of ZF-VPR combinations.

[0186] [Figure 21] FIG. 21 is a graph showing HNF4α activation in FRG-KO mouse liver humanized hepatocytes (Yecuris human hepatocytes).

[0187] [Figure 22] FIG. 22 is a graph showing activation of HNF4α in LX-2 cells using bicistronic ZF5.3-VPR and ZF7-VPR.

[0188] [Figure 23] FIG. 23 is a graph showing the effect of repeated administration of various ZF-VPRs and ZF-p300 to Yecuris hepatocytes on HNF4α gene expression.

[0189] [Figure 24] FIG. 24 is a graph showing activation of HNF4α in Yecuris hepatocytes using bicistronic ZF-effector constructs.

[0190] [Figure 25] FIG. 25 is a graph showing the persistence of VPR activation of HNF4α in K562 cells over 10 days using bicistronic ZF-effector constructs. DETAILED DESCRIPTION OF THE INVENTION

[0191] Detailed Description of the Invention The present invention provides agents and compositions for modulating (e.g., enhancing or reducing) expression of the hepatocyte nuclear factor 4 alpha (HNF4α) gene by targeting the HNF4α expression control region. The HNF4α gene can be present in a cell, for example, a mammalian cell, for example, a mammalian somatic cell, for example, a human somatic cell. The present invention also provides methods of using the agents and compositions of the present invention to modulate expression of the HNF4α gene or to treat a subject in whom modulating expression of the HNF4α gene would be beneficial, for example, a subject suffering from or susceptible to an HNF4α-related disease.

[0192] The agents of the present invention are referred to herein as site-specific HNF4α blocking agents and are described in Section II below.

[0193] I. Definition In order that the present invention may be more readily understood, certain terms are first defined. Furthermore, it should be noted that whenever a value or range of values ​​for a parameter is listed, it is intended that values ​​and ranges intermediate to the listed values ​​are also part of the invention.

[0194] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0195] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise.

[0196] The term "about" is used herein to mean within typical tolerances in the art. For example, "about" can be understood as about two standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about precedes a series or range of numbers, it is understood that "about" can modify each of the numbers in the series or range.

[0197] The term "at least" before a number or a series of numbers is understood to include the number next to the term "at least" and all subsequent numbers or integers that may be logically included as apparent from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18 nucleotides, 19 nucleotides, 20 nucleotides, or 21 nucleotides have the indicated property. When at least precedes a series or range of numbers, it is understood that "at least" can modify each of the numbers in the series or range.

[0198] As used herein, "no more than" or "less than" is understood to refer to the value next to the phrase and, where logical from the context, to a logically smaller value or integer, up to zero. When "no more than" precedes a series or range of numbers, it is understood that "no more than" may modify each of the numbers in the series or range.

[0199] As used herein, the term "substantially" refers to the qualitative state of exhibiting the full extent or degree or nearly the full extent or degree of a desired characteristic or property. Those skilled in the art will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection, or achieve or avoid absolute results. Thus, the term "substantially" may be used in some embodiments herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0200] As used herein, the terms "hepatocyte nuclear factor 4 alpha," "HNF4α," and "HNF4A" are used interchangeably herein and refer to a gene and the well-known encoded protein, which is a nuclear transcription factor that binds to DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor that regulates the expression of several liver genes. HNF4α also plays a role in the development of the liver, kidney, and intestine. Reduced expression of this gene is associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type 1 (MODY I) and liver diseases such as cirrhosis. Dysregulation of this gene, such as increased expression, is associated with hepatocellular carcinoma. The nucleotide and amino acid sequences of HNF4α are known and are described, for example, in GenBank accession numbers NM_000457; NM_175914; NM_178849; NM_178850; NM_001030003; NM_001030004; NM_001258355; NM_001287182; NM_001287183; NM_00 1287184; XM_005260407; NP_000448.3; NP_787110.2; NP_849180.1; NP_849181.1; NP_001025174.1; NP_001025175.1; NP_001245284.1; NP_001274111.1; NP_001274112.1; NP_001274113.1; XP_005260464.1. The nucleotide sequence of the genomic region of chromosome 20 containing the endogenous promoter of HNF4α and the HNF4α coding sequence is also known and can be found in GenBank accession numbers NC_000020.10 (42984441...43061485).

[0201] The HNF4α gene is located on chromosome 20 and is transcriptionally regulated by two promoters (P1 and P2). Alternative splicing variants result in nine distinct isoforms (α1–α9) (Figure 8). The HNF4α locus is transcriptionally regulated by two distinct promoters physically separated by more than 45 kb. The isoform generated by the activity of the proximal promoter is designated P1, while the isoform generated by the second, more distal promoter is designated P2. The most common isoform in liver is expressed from promoter 1 (P1), while isoforms from P2 are most commonly found in fetal tissues and in adult kidney and small intestine.

[0202] HNF4α regulates the expression of proteins required for the normal function of hepatocytes and other cell types within the liver (Argemi J, et al. Defective HNF4αlpha-dependent gene expression as a driver of hepatocellular failure in alcoholic hepatitis. Nat Commun. 2019; 10 (1): 3126. doi: 10.1038 / s41467-019-11004-3; Nishikawa T, et al. Resetting the transcription factor network reverses terminal chronic hepatic failure. J Clin Invest. 2015; 125 (4): 1533-1544. doi: 10.1172 / JCI73137). Furthermore, many of these proteins are secreted by hepatocytes and contribute to systemic health. For example, proteins such as albumin are required for the transport of nutrients, hormones, lipids, and small molecule drugs through the circulation.

[0203] The term "site-specific HNF4α blocking agent," as used herein, refers to any agent that specifically binds to a target HNF4α expression control region and, for example, modulates expression of the HNF4α gene. Modulation of expression can be permanent or transient. The site-specific HNF4α blocking agent of the present invention can include a "site-specific HNF4α targeting component."

[0204] As used herein, the term "site-specific HNF4α targeting component" refers to a component that specifically binds to an HNF4α expression control region, e.g., a transcription control region of the HNF4α gene, e.g., a promoter, enhancer, or repressor; or an HNF4α-associated anchor sequence, e.g., one within an HNF4α-associated anchor sequence-mediated connection. Exemplary "site-specific HNF4α targeting components" include, but are not limited to, polyamides, nucleic acid molecules, e.g., RNA, DNA, or modified RNA or DNA, polypeptides, protein nucleic acid molecules, and fusion proteins.

[0205] As used herein, the terms "specific binding" or "specifically binds" refer to the ability to distinguish between potential binding partners in an environment in which binding occurs. In some embodiments, a blocking agent that interacts, e.g., preferentially interacts, with one particular target in the presence of other potential blocking agents is said to "specifically bind" to the target (i.e., expression control region) with which it interacts. In some embodiments, specific binding is assessed by detecting or determining the degree of association of the blocking agent with its target. In some embodiments, specific binding is assessed by detecting or determining the degree of dissociation of the blocking agent-target complex. In some embodiments, specific binding is assessed by detecting or determining the ability of a blocking agent to compete with an alternative interaction between its target and another entity. In some embodiments, specific binding is assessed by performing such detection or determination across a range of concentrations.

[0206] As used herein, the term "expression control region" or "expression control domain" refers to a region or domain present in genomic DNA that modulates the expression of a target gene in a cell. The functionality associated with an expression control region can directly affect the expression of a target gene, for example, by recruiting or blocking the recruitment of transcription factors that stimulate the expression of the target gene. The functionality associated with an expression control region can indirectly affect the expression of a target gene, for example, by introducing epigenetic modifications or recruiting other factors that introduce epigenetic modifications that induce changes in chromosomal topology that modulate the expression of the target gene. An expression control region can be upstream and / or downstream of the protein-coding sequence of a gene, and includes, for example, transcriptional control elements, such as promoters, enhancers, or repressors; as well as anchor sequences and anchor sequence-mediated connections.

[0207] The term "transcriptional control element," as used herein, refers to a nucleic acid sequence that controls the transcription of a gene. Transcriptional control elements include, for example, anchor sequences, anchor sequence-mediated connections, promoters, transcriptional enhancers, and transcriptional repressors.

[0208] A promoter is a region of DNA that is recognized by RNA polymerase to initiate transcription of a particular gene, and is generally located upstream of the 5' end of the transcription start site of the gene.

[0209] A "transcriptional enhancer" is one that increases gene transcription. A "transcriptional silencer" or "transcriptional repressor" is one that decreases gene transcription. Enhancement and silencing sequences can be about 50 to 3,500 base pairs in length and can affect gene transcription up to about 1 megabase away.

[0210] The term "gene," as used herein, refers to a sequence of nucleotides that encodes a molecule, such as a protein, that has a function. A gene contains transcribed sequences (e.g., 3'UTR), non-transcribed sequences (e.g., promoters), translated sequences (e.g., exons), and non-translated sequences (e.g., introns).

[0211] As used herein, the term "target gene" refers to an HNF4α gene targeted for modulation, e.g., increase or decrease, of its expression. In some embodiments, the HNF4α target gene is part of a targeted genome complex (e.g., an HNF4α gene having at least a portion of its genome sequence as part of the target genome complex, e.g., within an anchor sequence-mediated connection), and the genome complex is targeted by one or more site-specific blocking agents described herein. In some embodiments, modulation comprises inhibition of expression of the target gene. In some embodiments, the HNF4α gene is modulated by contacting the HNF4α gene or a transcriptional control element operably linked to the HNF4α gene with one or more site-specific blocking agents described herein. In some embodiments, the HNF4α gene is aberrantly expressed (e.g., overexpressed) in a cell, e.g., a cell in a subject (e.g., a subject with an HNF4α-associated disease). In some embodiments, the HNF4α gene is aberrantly expressed (e.g., underexpressed) in a cell, e.g., a cell in a subject (e.g., a subject with an HNF4α-associated disease).

[0212] The term "anchor sequence," as used herein, refers to a nucleic acid sequence recognized by an anchor sequence-mediated connection, e.g., a nucleating agent that binds sufficiently to form a complex. In some embodiments, the anchor sequence comprises one or more CTCF-binding motifs. In some embodiments, the anchor sequence is not located within a gene-coding region. In some embodiments, the anchor sequence is located within an intergenic region. In some embodiments, the anchor sequence is not located within an enhancer or promoter. In some embodiments, the anchor sequence is located at least 400 bp, at least 450 bp, at least 500 bp, at least 550 bp, at least 600 bp, at least 650 bp, at least 700 bp, at least 750 bp, at least 800 bp, at least 850 bp, at least 900 bp, at least 950 bp, or at least 1 kb away from any transcription start site. In some embodiments, the anchor sequence is located in a region not associated with genomic imprinting, monoallelic expression, and / or monoallelic epigenetic marks. In some embodiments, the anchor sequence has one or more functions selected from binding to an endogenous nucleation polypeptide (e.g., CTCF), interacting with a second anchor sequence to form an anchor sequence-mediated connection, or blocking an enhancer outside the anchor sequence-mediated connection. Some embodiments of the present invention provide techniques that can specifically target a particular anchor sequence(s) and not target other anchor sequences (e.g., sequences that may contain a nucleation agent (e.g., CTCF)-binding motif in a different context); such targeted anchor sequences can be referred to as "target anchor sequences." In some embodiments, the sequence and / or activity of the target anchor sequence is modulated, while the sequence and / or activity of one or more other anchor sequences that may be present in the same system (e.g., the same cell and / or in some embodiments, the same nucleic acid molecule, e.g., the same chromosome) as the other targeted anchor sequences is not modulated.In some embodiments, the anchor sequence comprises or is a nucleating polypeptide binding motif, hi some embodiments, the anchor sequence is adjacent to a nucleating polypeptide binding motif.

[0213] The term "anchor sequence-mediated connection," as used herein, refers to a DNA structure, in some cases a complex, that arises and / or is maintained by the physical interaction or association of at least two anchor sequences within the DNA with one or more polypeptides, such as nucleation polypeptides, or one or more proteins and / or nucleic acid entities (such as, for example, RNA or DNA), that bind to the anchor sequences and enable spatial proximity and functional linkage between the anchor sequences.

[0214] As used herein, the term "genomic complex" refers to a complex that brings together two genomic sequence elements spaced apart from one another on one or more chromosomes through interactions between and among multiple proteins and / or other components (potentially including the genomic sequence elements). In some embodiments, the genomic sequence elements are anchor sequences to which one or more protein components of the complex bind. In some embodiments, the genomic complex may comprise an anchor sequence-mediated connection. In some embodiments, the genomic sequence elements may be or comprise a CTCF-binding motif, a promoter, and / or an enhancer. In some embodiments, the genomic sequence elements comprise at least one or both of a promoter and / or a regulatory region (e.g., an enhancer). In some embodiments, complex formation is nucleated at the genomic sequence element(s) and / or by binding of one or more of the protein components to the genomic sequence element(s). As will be appreciated by those skilled in the art, in some embodiments, colocalization (e.g., connection) of genomic sites via complex formation alters DNA topology at or near, including in some embodiments between, the genomic sequence element(s). In some embodiments, the genome complex comprises an anchor sequence-mediated connection, and the anchor sequence-mediated connection comprises one or more loops. In some embodiments, the genome complex described herein is nucleated by a nucleation polypeptide, such as, for example, CTCF and / or cohesin. In some embodiments, the genome complex described herein may comprise one or more of, for example, CTCF, cohesin, non-coding RNA (e.g., eRNA), transcription machinery proteins (e.g., RNA polymerase, one or more transcription factors, e.g., selected from the group consisting of TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.), transcriptional regulators (e.g., Mediator, P300, enhancer-binding proteins, repressor-binding proteins, histone modifiers, etc.), etc.In some embodiments, the genome complexes described herein include one or more polypeptide components and / or one or more nucleic acid components (e.g., one or more RNA components), which, in some embodiments, can interact with each other and / or with one or more genome sequence elements (e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)) to constrain the stretch of genomic DNA into a topological configuration (e.g., a loop) that the stretch of genomic DNA would not adopt in the absence of complex formation.

[0215] "Effector molecule," as used herein, refers to a molecule capable of regulating a biological activity, such as an enzyme activity, gene expression, anchor sequence-mediated connectivity, or cell signaling. Exemplary effectors are described in Section II below, and in some embodiments include, for example, nucleases, physical blocking factors, epigenetic recruitment factors, such as transcriptional enhancers or transcriptional repressors, and epigenetic CpG modifiers, such as DNA methylases, DNA demethylases, histone modifiers, or histone deacetylases, as well as combinations of any of the foregoing.

[0216] II. Site-specific HNF4α Blockers of the Present Invention In one embodiment of the present invention, the present invention provides a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region. In another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule. As will be understood by those skilled in the art, such a blocking agent is site-specific and therefore specifically binds, for example, to an HNF4α expression control region in a cell (e.g., one or more transcription control elements and / or one or more target anchor sequences) and does not bind to non-targeted expression control regions (e.g., within the same cell).

[0217] The site-specific HNF4α blocking agent of the present invention comprises a site-specific HNF4α targeting component that targets an HNF4α expression control region. The expression control region targeted by the site-specific targeting component can be, for example, a transcription control element or an anchor sequence, such as an anchor sequence in an anchor-mediated connection.

[0218] Thus, the site-specific HNF4α blocking agents of the present invention can modulate the expression of a gene, i.e., HNF4α, for example, by modulating the expression of the gene from an endogenous promoter, enhancer, or repressor, can alter the methylation of a regulatory region, or can alter at least one anchor sequence; can alter at least one conjunction nucleating molecule binding site, for example, by altering the binding affinity for the conjunction nucleating molecule; and can alter the orientation of at least one common nucleotide sequence, such as a CTCF binding motif, for example, by substitution, addition, or deletion within at least one anchor sequence, such as a CTCF binding motif.

[0219] In certain embodiments, the site-specific blocking agents and compositions described herein target expression control regions comprising one or more HNF4α-specific transcriptional control elements to modulate expression in cells.HNF4α-specific transcriptional control elements that can be targeted include HNF4α-specific promoters, HNF4α-specific enhancers, and HNF4α-specific repressors.In one embodiment, the HNF4α-specific promoter substantially drives expression in liver cells, i.e., promoter 1.In one embodiment, the HNF4α-specific promoter substantially drives expression in pancreatic cells, i.e., promoter 2.The nucleotide sequences of HNF4α promoter 1 and promoter 2 are known and can be found, for example, in GenBank accession number NC_000020.10 (42984441...43061485).

[0220] For example, a site-specific blocking agent can include a site-specific targeting component, e.g., a nucleic acid molecule encoding the DNA-binding domain or fragment thereof of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically targets and binds to an HNF4α expression control region such as an HNF4α endogenous promoter region, e.g., promoter 1, and an effector molecule, e.g., an effector molecule comprising a transcription enhancer or transcription repressor that modulates, e.g., enhances or represses, expression of a target gene from an endogenous promoter to modulate gene expression. In one embodiment, the blocking agent is a "bicistronic nucleic acid molecule," i.e., two fusion proteins can be generated from a single messenger RNA molecule: a first site-specific targeting component and a second site-specific targeting component, e.g., a nucleic acid molecule encoding a DNA-binding domain or fragment thereof of a transcription activator-like effector (TALE) polypeptide or zinc finger (ZNF) polypeptide that specifically targets and binds to an HNF4α expression control region such as an HNF4α endogenous promoter region, e.g., promoter 1, and an effector molecule, e.g., a transcription enhancer or transcription repressor that modulates, e.g., enhances or represses, expression of a target gene from the endogenous promoter, thereby modulating gene expression.

[0221] In some embodiments of the present invention, the site-specific blocking agent may comprise a site-specific targeting component, e.g., a nucleic acid molecule such as a guide RNA that targets an HNF4α endogenous promoter region, e.g., promoter 1, and an effector molecule, e.g., an effector molecule comprising a transcription enhancer or transcription repressor that modulates, e.g., enhances or represses, expression of a target gene from the endogenous promoter to modulate gene expression.

[0222] In certain embodiments of the present invention, the site-specific blocking agents and compositions described herein target expression control regions comprising one or more HNF4α-related anchor sequences, e.g., comprising a first HNF4α-related anchor sequence and a second HNF4α-related anchor sequence within an anchor sequence-mediated connection, to alter two-dimensional chromatin structure (e.g., anchor sequence-mediated connection, e.g., to modulate expression in a cell, e.g., a cell in a subject, by modifying anchor sequence-mediated connections in DNA, e.g., genomic DNA).

[0223] In one aspect, the present invention includes a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region that includes one or more HNF4α-related anchor sequences within an anchor sequence-mediated junction. The blocking agent binds, e.g., specifically binds, to a particular anchor sequence-mediated junction and alters the topology of the anchor sequence-mediated junction, e.g., an anchor sequence-mediated junction having a physical interaction of two or more DNA loci bound by a nucleating molecule.

[0224] The formation of an anchor sequence-mediated connection can force the transcriptional control element to interact with the HNF4α gene, or can spatially constrain the activity of the transcriptional control element. Thus, by changing the anchor sequence-mediated connection, it becomes possible to modulate HNF4α expression without changing the coding sequence of the HNF4α gene to be modulated.

[0225] In some embodiments, the site-specific blocking agent and composition of the present invention modulate the expression of the HNF4α gene associated with anchor sequence-mediated connection by physically interfering with one or more anchor sequences and connection nucleation molecules. For example, DNA-binding small molecules (e.g., minor groove or major groove binders), peptides (e.g., zinc fingers, TALEs, novel or modified peptides), proteins (e.g., CTCF, modified CTCF with impaired CTCF binding and / or aggregation binding affinity), or nucleic acids (e.g., ssDNA, modified DNA or RNA, peptide-oligonucleotide conjugates, locked nucleic acids, bridged nucleic acids, polyamides, and / or triplex-forming oligonucleotides) can physically prevent connection nucleation molecules from interacting with one or more anchor sequences, thereby modulating HNF4α gene expression.

[0226] In some embodiments, the site-specific blocking agents and compositions of the present invention modulate the expression of the HNF4α gene associated with an anchor sequence-mediated junction by modifying the anchor sequence, for example, by epigenetic modification, such as modification of histone proteins, or by genomic editing. For example, one or more anchor sequences associated with an anchor sequence-mediated junction comprising the HNF4α gene can be targeted for methylation modification by DNA methyltransferase, for example, dCas9-methyltransferase fusion, for example, antisense oligonucleotide-enzyme fusion, to modulate the expression of the gene.

[0227] In some embodiments, the site-specific blocking agents and compositions of the present invention modulate expression of the HNF4α gene associated with anchor sequence-mediated junctions, e.g., activate or repress transcription, e.g., induce epigenetic changes to chromatin.

[0228] In some embodiments, the anchor sequence-mediated connection includes one or more anchor sequences, an HNF4α gene, and one or more transcriptional control elements, such as an enhancing element or a silencing element. In some embodiments, the transcriptional control elements are located within the anchor sequence-mediated connection, partially within the anchor sequence-mediated connection, or outside the anchor sequence-mediated connection.

[0229] In one embodiment, the anchor sequence-mediated connection comprises a loop, such as an intrachromosomal loop. In certain embodiments, the anchor sequence-mediated connection has multiple loops. One or more loops may comprise a first anchor sequence, a nucleic acid sequence, a transcriptional control element, and a second anchor sequence. In another embodiment, at least one loop comprises, in order, a first anchor sequence, a transcriptional control element, and a second anchor sequence; or a first anchor sequence, a nucleic acid sequence, and a second anchor sequence. In yet another embodiment, either one or both of the nucleic acid sequence and the transcriptional control element are located inside or outside the loop. In yet another embodiment, one or more of the loops comprise a transcriptional control element.

[0230] In some embodiments, the anchor sequence-mediated connection comprises a TATA box, a CAAT box, a GC box, or a CAP site.

[0231] In some embodiments, the anchor sequence-mediated connection comprises a plurality of loops, and the anchor sequence-mediated connection comprises at least one of an anchor sequence, a nucleic acid sequence, and a transcriptional control element in one or more of the loops.

[0232] In one aspect, the site-specific blocking agents and compositions of the present invention allow for targeted alterations to be introduced into anchor sequence-mediated junctions, allowing blocking agents that bind to anchor sequences to modulate expression of nucleic acid sequences. In some embodiments, the anchor sequence-mediated junction is altered by targeting one or more nucleotides within the anchor sequence-mediated junction for substitution, addition, or deletion.

[0233] In some embodiments, expression, e.g., transcription, is activated by including an activation loop or excluding an inhibitory loop. In one such embodiment, the anchor sequence-mediated connection includes a transcriptional control sequence that increases transcription of a nucleic acid sequence, e.g., a nucleic acid encoding HNF4α. In another such embodiment, the anchor sequence-mediated connection excludes a transcriptional control element that reduces expression, e.g., transcription, of a nucleic acid sequence, e.g., a nucleic acid encoding HNF4α.

[0234] In some embodiments, expression, e.g., transcription, is inhibited by including an inhibitory loop or excluding an activation loop. In one such embodiment, the anchor sequence-mediated connection includes a transcriptional control element that reduces expression, e.g., transcription, of a nucleic acid sequence, e.g., a nucleic acid sequence encoding HNF4α. In another such embodiment, the anchor sequence-mediated connection excludes a transcriptional control element that increases transcription of a nucleic acid sequence, e.g., a nucleic acid sequence encoding HNF4α.

[0235] Each anchor sequence-mediated connection comprises one or more, for example, multiple anchor sequences. The anchor sequence can be manipulated or modified to interrupt a naturally occurring loop or form a new loop (e.g., to form an exogenous loop or a non-naturally occurring loop with an exogenous or modified anchor sequence). Such modifications modulate HNF4α gene expression by changing the two-dimensional structure of the DNA containing all or part of the HNF4α gene, for example, by modulating the ability of the HNF4α gene to interact with transcriptional control elements (e.g., enhancer sequences and silencing / repressor sequences). In some embodiments, the chromatin structure is modified by substituting, adding, or deleting one or more nucleotides within the anchor sequence of the anchor sequence-mediated connection.

[0236] Anchor sequences do not have to be contiguous with one another. In embodiments using discontinuous anchor sequences, the first and second anchor sequences can be separated by about 500 bp to about 500 Mb, about 750 bp to about 200 Mb, about 1 kb to about 100 Mb, about 25 kb to about 50 Mb, about 50 kb to about 1 Mb, about 100 kb to about 750 kb, about 150 kb to about 500 kb, or about 175 kb to about 500 kb. In some embodiments, the first anchor sequence and the second anchor sequence are about 500bp, 600bp, 700bp, 800bp, 900bp, 1kb, 5kb, 10kb, 15kb, 20kb, 25kb, 30kb, 35kb, 40kb, 45kb, 50kb, 55kb, 60kb, 65kb, 70kb, 75kb, 80kb, 85kb, 90kb, 95kb, 100kb, 125kb, 150kb, 175kb, 200kb, 250kb, 350kb, 400kb, 450kb, 500kb, 550kb, 600kb, 650kb, 700kb, 750kb, 800kb, 850kb, 900kb, 950kb, 1000kb, 1250kb, 1500kb, 1750kb, 200kb, 250kb, 3 ... b, 225kb, 250kb, 275kb, 300kb, 350kb, 400kb, 500kb, 600kb, 700kb, 800kb, 900kb, 1Mb, 2Mb, 3Mb, 4Mb, 5Mb, 6Mb, 7Mb, 8Mb, 9Mb, 10Mb, 15Mb, 20Mb, 25Mb, 50Mb, 75Mb, 100Mb, 200Mb, 300Mb, 400Mb, 500Mb, or any size in between.

[0237] In one embodiment, the anchor sequence comprises a consensus nucleotide sequence, e.g., the CTCF binding motif: N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C) (SEQ ID NO: 64), where N is any nucleotide. The CTCF binding motif may also be in the reverse orientation, e.g., (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N (SEQ ID NO: 65).

[0238] In one embodiment, the anchor sequence comprises SEQ ID NO:64 or SEQ ID NO:65 or a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to either SEQ ID NO:64 or SEQ ID NO:65.

[0239] In some embodiments, the anchor sequence-mediated connection comprises at least a first anchor sequence and a second anchor sequence.The first anchor sequence and the second anchor sequence can each comprise a common nucleotide sequence, for example, each comprises a CTCF binding motif.In some embodiments, the first anchor sequence and the second anchor sequence comprise different sequences, for example, the first anchor sequence comprises a CTCF binding motif, and the second anchor sequence comprises an anchor sequence other than a CTCF binding motif.In some embodiments, each anchor sequence comprises a common nucleotide sequence and one or more adjacent nucleotides at one or both ends of the common nucleotide sequence.

[0240] Two CTCF-binding motifs (e.g., contiguous or non-contiguous CTCF-binding motifs) that can form a connection can be present in any orientation within the genome, e.g., in the same orientation (tandem), either 5' to 3' (left tandem, e.g., two CTCF-binding motifs comprising SEQ ID NO: 64) or 3' to 5' (right tandem, e.g., two CTCF-binding motifs comprising SEQ ID NO: 65), or in a converging orientation, where one CTCF-binding motif comprises SEQ ID NO: 64 and the other comprises SEQ ID NO: 65. CTCFBSDB 2.0: Database For CTCF binding motifs And Genome Organization (http: / / insulatordb.uthsc.edu / ) can be used to identify CTCF-binding motifs associated with target genes, e.g., HNF4α.

[0241] In some embodiments, anchor sequence-mediated connectivity is altered by changing the orientation of at least one common nucleotide sequence, for example, a connection nucleation molecule binding site.

[0242] In some embodiments, the anchor sequence comprises a connecting nucleation molecule binding site, e.g., a CTCF binding motif, and the site-specific blocking agent of the invention introduces an alteration of at least one connecting nucleation molecule binding site, e.g., an alteration of the binding affinity for the connecting nucleation molecule.

[0243] In some embodiments, the anchor sequence-mediated connection is altered by introducing an exogenous anchor sequence. The addition of a non-naturally occurring or exogenous anchor sequence creates or disrupts a naturally occurring anchor sequence-mediated connection, for example, by inducing the formation of a non-naturally occurring loop that alters transcription of the nucleic acid sequence.

[0244] In some embodiments, the anchor sequence-mediated connection comprises one HNF4α gene and one or more, eg, two, three, four, five, or other genes other than the HNF4α gene.

[0245] In some embodiments, the anchor sequence-mediated connection is associated with one or more, e.g., two, three, four, five, or more, transcriptional control elements. In some embodiments, the HNF4α gene is not contiguous with one or more of the transcriptional control elements. In some embodiments in which the HNF4α gene is not contiguous with the transcriptional control elements, the gene may be separated from one or more transcriptional control elements by about 100 bp to about 500 Mb, about 500 bp to about 200 Mb, about 1 kb to about 100 Mb, about 25 kb to about 50 Mb, about 50 kb to about 1 Mb, about 100 kb to about 750 kb, about 150 kb to about 500 kb, or about 175 kb to about 500 kb. In some embodiments, the gene is spaced apart from the transcriptional regulatory element by about 100 bp, 300 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 kb, 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 125 kb, 150 kb, 175 kb , 200kb, 225kb, 250kb, 275kb, 300kb, 350kb, 400kb, 500kb, 600kb, 700kb, 800kb, 900kb, 1Mb, 2Mb, 3Mb, 4Mb, 5Mb, 6Mb, 7Mb, 8Mb, 9Mb, 10Mb, 15Mb, 20Mb, 25Mb, 50Mb, 75Mb, 100Mb, 200Mb, 300Mb, 400Mb, 500Mb, or any size in between.

[0246] In some embodiments, the type of anchor sequence mediated connection can be used to determine how to modulate gene expression by changing anchor sequence mediated connection, for example, to select site-specific targeting component.For example, some types of anchor sequence mediated connection contain one or more transcriptional control elements within anchor sequence mediated connection.By interrupting the formation of such anchor sequence mediated connection, for example, by changing one or more anchor sequences, the transcription of the HNF4α gene within anchor sequence mediated connection can be reduced.

[0247] In some embodiments, the expression of the HNF4α gene is regulated, modulated, or influenced by one or more transcriptional control elements associated with the anchor sequence-mediated connection. In some embodiments, the anchor sequence-mediated connection includes the HNF4α gene and one or more transcriptional control elements. For example, the HNF4α gene and one or more transcriptional control sequences are at least partially located within the anchor sequence-mediated connection, e.g., within a type 1 anchor sequence-mediated connection. The anchor sequence-mediated connection may also be referred to as "type 1, EP subtype." In some embodiments, the HNF4α gene has a defined expression state, e.g., in its native state, e.g., in a pathological state. For example, the HNF4α gene may have a high level of expression. By interrupting the anchor sequence-mediated connection, the expression of the HNF4α gene can be reduced, e.g., transcription can be reduced by changing the conformation of DNA within the anchor sequence-mediated connection that was previously open to transcription, e.g., transcription can be reduced by changing the conformation of DNA that creates additional distance between the HNF4α gene and the enhancing sequence. In one embodiment, both the relevant HNF4α gene and one or more transcriptional regulatory sequences, for example, reinforcement sequences, are present inside the anchor sequence-mediated connection.Disruption of the anchor sequence-mediated connection reduces the expression of the HNF4α gene.In one embodiment, the HNF4α gene associated with the anchor sequence-mediated connection is accessible to one or more transcriptional regulatory elements present at least partially inside the anchor sequence-mediated connection.

[0248] In some embodiments, the expression of the HNF4α gene is regulated, modulated, or affected by one or more transcriptional control elements that are related but inaccessible due to anchor sequence-mediated connections. For example, the anchor sequence-mediated connections associated with the HNF4α gene disrupt the ability of one or more transcriptional control elements to regulate, modulate, or affect the expression of the HNF4α gene. The transcriptional control sequence may be separated from the HNF4α gene, for example, located at least partially on the opposite side of the HNF4α gene, for example, inside or outside the anchor sequence-mediated connection; for example, the HNF4α gene is inaccessible to the transcriptional control element due to its proximity to the anchor sequence-mediated connection. In some embodiments, one or more reinforcement sequences are separated from the HNF4α gene by anchor sequence-mediated connections, for example, type 2 anchor sequence-mediated connections.

[0249] In some embodiments, the HNF4α gene is inaccessible to one or more transcriptional control elements due to the anchor sequence-mediated connection, and disruption of the anchor sequence-mediated connection allows the transcriptional control elements to regulate, modulate, or affect expression of the HNF4α gene. In one embodiment, the HNF4α gene is located both inside and outside the anchor sequence-mediated connection and is inaccessible to one or more transcriptional control elements. Disruption of the anchor sequence-mediated connection increases access to the transcriptional control elements to regulate, modulate, or affect expression of the HNF4α gene, for example, transcriptional control elements increase expression of the HNF4α gene. In one embodiment, the HNF4α gene is located inside the anchor sequence-mediated connection and is inaccessible to one or more transcriptional control elements that are at least partially outside the anchor sequence-mediated connection. Disruption of the anchor sequence-mediated connection increases expression of the HNF4α gene. In one embodiment, the HNF4α gene is located at least partially outside the anchor sequence-mediated connection and is inaccessible to one or more transcriptional control elements that are inside the anchor sequence-mediated connection. Disruption of anchor sequence-mediated connectivity increases HNF4α gene expression.

[0250] A.HNF4α site-specific targeting component The site-specific HNF4α targeting components of the present invention target the HNF4α expression control region and can comprise a polymer or polymer molecule, such as a polyamide (i.e., a molecule of repeat units linked by amide bonds, e.g., a polypeptide), a polymer of nucleotides (e.g., a nucleic acid molecule encoding a guide RNA, a TALE polypeptide, or a zinc finger polypeptide), a peptide nucleic acid (PNA), or a polymer of amino acids such as a peptide or polypeptide, e.g., a fusion protein, etc. Suitable site-specific HNF4α targeting components, compositions, and methods of using such agents and compositions are described below and in PCT Publication No. WO2018 / 049073, the entire contents of which are expressly incorporated herein by reference.

[0251] In one embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a nucleic acid molecule encoding a polypeptide such as a transcription activator-like effector (TALE) polypeptide or a DNA-binding domain of a zinc finger (ZNF) polypeptide, or a fragment thereof, engineered to specifically target the HNF4α expression control region and modulate expression of the HNF4α gene.

[0252] In another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a nucleic acid molecule such as a guide RNA (or gRNA), or a guide RNA and an effector or a fragment thereof, or a nucleic acid molecule encoding the effector or a fragment thereof.

[0253] In another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a polynucleotide such as a PNA, e.g., a nucleic acid gRNA linked to an effector polypeptide or a fragment thereof.

[0254] In another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a fusion molecule such as a DNA-binding domain of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide, or a fragment thereof, and a nucleic acid molecule encoding the effector.

[0255] In one embodiment, such a site-specific blocking agent comprises a second fusion protein, which comprises a second site-specific HNF4α targeting component that targets a second HNF4α expression control region and a second effector molecule, wherein the second HNF4α expression control region is different from the HNF4α expression control region.

[0256] In another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a Cas polypeptide and a fusion molecule, such as a nucleic acid molecule encoding a protein comprising an epigenetic recruitment factor or an epigenetic CpG modifier.

[0257] In yet another embodiment, the site-specific blocking agent of the present invention comprises a site-specific HNF4α targeting component comprising a fusion molecule, such as a fusion protein comprising a Cas polypeptide and, for example, an epigenetic recruitment factor or an epigenetic CpG modifier.

[0258] As used herein, in its broadest sense, the term "nucleic acid" refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a polynucleotide chain or a compound and / or substance that can be incorporated into a polynucleotide chain via a phosphodiester linkage. As will be clear from the context, in some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides); in some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" is or comprises RNA; in some embodiments, "nucleic acid" is or comprises DNA. In some embodiments, "nucleic acid" is a "mixmer," including locked nucleic acid molecules and deoxynucleic acid molecules. In some embodiments, a nucleic acid is, comprises, or consists of one or more naturally occurring nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, the nucleic acid is, comprises, or consists of one or more "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, and are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester linkages. In some embodiments, the nucleic acid is, comprises, or consists of one or more naturally occurring nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the nucleic acid comprises one or more sugars that are modified compared to those in naturally occurring nucleic acids (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose). In some embodiments, the nucleic acid has a nucleotide sequence that encodes a functional gene product such as RNA or a protein. In some embodiments, the nucleic acid comprises one or more introns. In some embodiments, the nucleic acid is prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), renaturation in a recombinant cell or system, and chemical synthesis. In some embodiments, the nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues in length. In some embodiments, the nucleic acid is partially or entirely single-stranded; in some embodiments, the nucleic acid is partially or entirely double-stranded.In some embodiments, the nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide, or is the complement of a sequence that encodes a polypeptide. In some embodiments, the nucleic acid has enzymatic activity.

[0259] As used herein, the terms "peptide," "polypeptide," and "protein" refer to compounds composed of amino acid residues covalently linked by peptide bonds or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may make up a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, commonly referred to in the art as proteins, of which many types exist.

[0260] In certain embodiments, a polypeptide may be or comprise a chimeric or "fusion protein." As used herein, a "chimeric protein" or "fusion protein" comprises all or a portion (preferably a biologically active portion) of a first protein operably linked to a heterologous second polypeptide (i.e., a polypeptide other than the first protein). Within the scope of a fusion protein, the term "operably linked" is intended to indicate that the first protein or a segment thereof and the heterologous polypeptide are fused in-frame to each other. The heterologous polypeptide can be fused to the amino or carboxyl terminus of the first protein or segment.

[0261] A "polyamide" is a polymer molecule having repeating units linked by amide bonds. Examples of naturally occurring polyamides are proteins. In some embodiments, polyamides include peptide nucleic acids (PNAs).

[0262] A "peptide nucleic acid" ("PNA") is a molecule in which one or more amino acid units within the PNA have an amide-containing backbone similar to a peptide backbone, e.g., aminoethyl-glycine, but have nucleic acid side chains instead of amino acid side chains. Peptide nucleic acids (PNAs) have been shown to hybridize with complementary DNA and RNA with higher affinity than their oligonucleotide counterparts. This property not only allows PNAs to form stable hybrids with nucleic acid side chains, but also provides hydrophobic units within the polypeptide due to the neutral backbone and hydrophobic side chains. Nucleic acid side chains include, but are not limited to, purine or pyrimidine side chains, such as adenine, cytosine, guanine, thymine, and uracil. In one embodiment, the nucleic acid side chains comprise a nucleoside analog as described herein.

[0263] In one embodiment, the site-specific HNF4α targeting component of the invention comprises a polyamide. Polyamides suitable for use in the agents and compositions of the invention are known in the art.

[0264] In one embodiment, the site-specific HNF4α targeting component of the present invention comprises a polynucleotide. In some embodiments, the nucleotide sequence of the polynucleotide encodes an HNF4α gene or an HNF4α expression product. In some embodiments, the nucleotide sequence of the polynucleotide does not comprise an HNF4α coding sequence or an HNF4α expression product. For example, in some embodiments, the site-specific HNF4α targeting component of the present invention comprises a polynucleotide that hybridizes with a target expression control region, such as a promoter or anchor sequence. In some embodiments, the nucleotide sequence of the polynucleotide is a complement of the target anchor sequence or has a sequence that is at least 80%, at least 85%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the complement of the target sequence.

[0265] Polynucleotides of the invention can include deoxynucleotides, ribonucleotides, modified deoxynucleotides, modified ribonucleotides (e.g., chemical modifications such as modifications that alter the backbone linkage, sugar moiety, and / or nucleobase), and artificial nucleic acids. In some embodiments, polynucleotides include, but are not limited to, genomic DNA, cDNA, peptide nucleic acid (PNA) or peptide-oligonucleotide conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex-forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mPvNA, rPvNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules.

[0266] In some embodiments, polynucleotides of the present invention have a length of about 2 to about 5000 nt, about 10 to about 100 nt, about 50 to about 150 nt, about 100 to about 200 nt, about 150 to about 250 nt, about 200 to about 300 nt, about 250 to about 350 nt, about 300 to about 500 nt, about 10 to about 1000 nt, about 50 to about 1000 nt, about 100 to about 1000 nt, about 1000 to about 2000 nt, about 2000 to about 3000 nt, about 3000 to about 4000 nt, about 4000 to about 5000 nt, or any range therebetween.

[0267] The polynucleotide of the present invention may contain nucleosides, such as purines or pyrimidines, such as adenine, cytosine, guanine, thymine, and uracil. In some embodiments, the polynucleotide contains one or more nucleoside analogs. Nucleoside analogs include, but are not limited to, nucleoside analogs such as 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 4-methylbenzimidazole, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, di- Hydrouridine, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta α-D-mannosylqueuosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxocine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl thyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, 2,6-diaminopurine, 3-nitropyrrole, inosine, thiouridine, queusine, wyosine, diaminopurine, isoguanine, isocytosine, diaminopyrimidine, 2,4-difluorotoluene, isoquinoline, pyrrolo[2,3-]pyridine, and any others capable of base pairing with a purine or pyrimidine side chain.

[0268] In some embodiments, the site-specific HNF4α targeting component of the present invention comprises a polynucleotide encoding a polypeptide comprising a zinc finger or TALE DNA binding domain (DBD) or a fragment thereof that has been engineered to specifically target the HNF4α expression control region and modulate expression of the HNF4α gene.

[0269] The design and preparation of zinc finger polypeptides that specifically bind to a target DNA region of interest, such as the HNF4α expression control region, is well known in the art. For example, zinc finger (ZNF) proteins contain a DNA-binding domain that specifically binds to a triplet of nucleotides. Therefore, to design and prepare the site-specific HNF4α targeting components of the present invention, a modular assembly process can be used, which involves combining separate zinc finger DNA-binding domains, each capable of recognizing a specific 3-base pair DNA sequence, to generate 3-finger, 4-, 5-, 6-, 7-, or 8-zinc finger polypeptides that recognize specific target sites ranging in length from 9 base pairs to 24 base pairs. Another suitable method can involve a 2-finger module to generate ZNF polynucleotides with up to six individual zinc fingers. For example, Shukla VK, et al., Nature. 459 (7245) 2009: 437-41; Dreier B, et al., JBC. 280 (42) 2005: 35588-97; Dreier B, et al, JBC 276 (31) 2001: 29466-78; Bae KH, See, et al., Nature Biotechnology. 21 (3) 2003: 275-80.

[0270] In some embodiments, the site-specific HNF4α targeting component of the present invention comprises a polynucleotide encoding a polypeptide comprising a zinc finger DNA-binding domain (DBD) or a fragment thereof, which has been engineered to specifically target the HNF4α expression control region and modulate expression of the HNF4α gene. Exemplary amino acid sequences encoding zinc fingers that bind to nucleotide triplets suitable for use in the present invention are provided in Table 1A below (see, e.g., Gersbach et al., Synthetic Zinc Finger Proteins: The Advent of Targeted Gene Regulation and Genome Modification Technologies). [Table 1A-1] [Table 1A-2]

[0271] A zinc finger DNA binding domain comprises an N-terminal region and a C-terminal region, with a "fingers" in between that bind to a target DNA sequence. The N-terminal region is generally 7 amino acids in length. The C-terminal region is generally 6 amino acids in length. Thus, the N-terminal region generally comprises the amino acid sequence X1X2X3X4X5X6X7 (SEQ ID NO: 1). "X" can be any amino acid. In some embodiments, the N-terminal region comprises the exemplary amino acid sequence LEPGEKP (SEQ ID NO: 1). "X" can be any amino acid. The C-terminal region generally comprises X 25 X 26 X 27 X 28 X 29 X 30 (SEQ ID NO: ). In certain embodiments, the C-terminal region comprises the exemplary amino acid sequence TGKKTS (SEQ ID NO: ).

[0272] Each finger in the DNA-binding domain is flanked by an N-terminal backbone located at the N-terminus of the finger and a C-terminal backbone located at the C-terminus of the finger. The N-terminal backbone of a finger is generally 11 amino acids long, with two conserved cysteines (C) at positions 3 and 6. Thus, the N-terminal backbone of a finger is generally X8X9CX. 10 X 11 CX 12 X 13 X 14 X 15 X 16 (SEQ ID NO: 1). "X" can be any amino acid. The C-terminal backbone of a finger is generally 5 amino acids long, with two conserved histidines (H) at positions 1 and 5. Thus, the C-terminal backbone of a finger is generally HX 17 X 18 X 19 H (SEQ ID NO: 61). "X" can be any amino acid. In some embodiments, the N-terminal scaffold comprises the exemplary amino acid sequence YKCPECGKSFS (SEQ ID NO: 61), and the C-terminal scaffold comprises the exemplary amino acid sequence HQRTH (SEQ ID NO: 62). The two "fingers" are connected via a linker. The linker is generally 5 amino acids long, and X 20 X 21 X 22 X 23 X 24 (SEQ ID NO: ). "X" can be any amino acid. In certain embodiments, the linker comprises the exemplary amino acid sequence TGEKP (SEQ ID NO: 63). Thus, the zinc finger of the site-specific HNF4α site-specific blocker has the following structure: (N-terminal backbone-finger-C-terminal backbone-linker)n, and the zinc finger DNA-binding domain of the site-specific HNF4α site-specific blocker has the following structure: [N-terminal region (N-terminal backbone-finger-C-terminal backbone-linker)nC-terminal region]. "N" represents the number of nucleotide triplets bound by the zinc finger DNA-binding domain, and thus by the HNF4α site-specific blocker.

[0273] When the "fingers" amino acid sequence for a four nucleotide triplet is unknown, but such a triplet has been identified within the target region of interest, two "linker span sequences"—linker span 1 and linker span 2—are useful to circumvent this problem. Linker span 1 is used to skip one base pair when the "fingers" amino acid sequence for the triplet is unavailable. Linker span 2 is used to skip two base pairs when the "fingers" amino acid sequence for the triplet is unavailable. Linker span 1 is generally 12 amino acids long. Linker span 2 is generally 16 amino acids long. Thus, linker span 1 is generally X 31 X 32 X 33 X 34 X 35 X 36 X 37 X 38 X 39 X 40 X 41 X 42 (SEQ ID NO: 1). Linker span 2 generally comprises the amino acid sequence of X 43 X 44 X 45 X 46 X 47 X 48 X 49 X 50 X 51 X 52 X 53 X 54 X 55 X 56 X 57 X 58 (SEQ ID NO:). In some embodiments, linker span 1 comprises the amino acid sequence of THPRAPIPKPFQ (SEQ ID NO:). In certain embodiments, linker span 2 comprises the amino acid sequence of TPNPHRRTDPSHKPFQ (SEQ ID NO:). When linker span 1 and / or linker span 2 are used, finger-linker span 1 / span 2-finger comprises the following structure: N-terminal backbone-finger-C-terminal backbone-linker span 1 / span 2-N-terminal backbone-finger-C-terminal backbone-linker.

[0274] Table 1B provides the amino acid sequence structures of exemplary zinc finger DNA-binding domains of blocking agents containing the zinc finger DNA-binding domains described in the Examples below (see Table 6A). Table 10 also provides the nucleotide sequences of suitable target sequences within expression control regions, the amino acid sequences of exemplary zinc finger DNA-binding domains suitable for use in blocking agents containing the zinc finger DNA-binding domains of the invention, and the amino acid sequence structures of exemplary zinc finger DNA-binding domains suitable for use in blocking agents containing the zinc finger DNA-binding domains of the invention. As used in Table 1B, "X" represents any amino acid.

[0275] In some embodiments, a zinc finger DNA-binding domain suitable for use in a blocking agent of the invention comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid identity to the entire amino acid sequence of any one of the zinc finger DNA-binding domains presented in any one of Tables 6A and 10. [Table 1B-1] [Table 1B-2] [Table 1B-3] [Table 1B-4]

[0276] Similarly, the design and preparation of such TALE polypeptides that specifically bind to a desired DNA target region, such as the HNF4α expression control region, is well known in the art. For example, the DNA-binding domain of TALEs contains a repeated, highly conserved 33-34 amino acid sequence, with divergence at positions 12 and 13. These two positions, termed repeat variable diresidues (RVDs), are highly variable and show a strong correlation with specific nucleotide recognition. This direct correlation between amino acid sequence and DNA recognition makes it possible to engineer specific DNA-binding domains by selecting combinations of repeat segments containing appropriate RVDs. See, for example, Boch J Nature Biotechnology. 29 (2) 2011: 135-6; Boch J, et al., Science. 326 (5959) 2009: 1509-12; Moscow MJ & Bogdanove AJ Science. 326 (5959) 2009: 1501.

[0277] In some embodiments, the site-specific HNF4α targeting component of the present invention, which comprises a polynucleotide, comprises a guide RNA (or gRNA) or a nucleic acid encoding the guide RNA. A gRNA is a short synthetic RNA molecule that includes a "scaffold" sequence, which may include, for example, a site-specific sequence of about 20 nucleotides that targets a genomic target sequence containing an HNF4α expression control element, necessary for directing an effector to the HNF4α expression control element.

[0278] Generally, guide RNA sequences are designed to have a length of about 17 to about 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and to be complementary to the target sequence. Custom gRNA generation devices and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric "single guide RNAs" ("sgRNAs"), which are engineered (synthetic) single RNA molecules that contain both tracrRNA (for binding to nucleases) and at least one crRNA (for guiding nucleases to the targeted sequence for editing), mimicking the naturally occurring crRNA-tracrRNA complex. Chemically modified sgRNAs have also been demonstrated to be effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991.

[0279] Exemplary site-specific HNF4α promoter 1 targeting components are provided below in Table 2. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the entire nucleotide sequence of any one of the nucleotide sequences in Table 2.

[0280] Exemplary site-specific HNF4α promoter 2 targeting components are provided below in Table 3. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the entire nucleotide sequence of any one of the nucleotide sequences in Table 3.

[0281] Exemplary site-specific HNF4α promoter targeting components are also provided below in Table 9. In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the entire nucleotide sequence of any one of the nucleotide sequences in Table 9.

[0282] Although the sequences in Tables 2, 3, 4, and 9 are described as modified (or unmodified), it will be understood that a nucleic acid molecule encompassed by the of the invention, e.g., a site-specific blocking agent, can also include any one of those sequences that is unmodified or modified differently from that described in any one of Tables 2, 3, 4, or 9. It will also be understood that while some of the sequences in Table 9 have "Ts," when used as an RNA molecule, such as a guide RNA, in a site-specific targeting component of the invention, the "Ts" can be replaced with "Us."

[0283] In some embodiments, a site-specific HNF4α targeting component comprising a polynucleotide, e.g., a gRNA, comprises a nucleotide sequence complementary to an anchor sequence. In one embodiment, the anchor sequence comprises a CTCF binding motif or consensus sequence: N(T / C / G)N(G / A / T)CC(A / T / G)(C / G)(C / T / A)AG(G / A)(G / T)GG(C / A / T)(G / A)(C / G)(C / T / A)(G / A / C) (SEQ ID NO: 64), where N is any nucleotide. The CTCF-binding motif or consensus sequence can also be in the reverse orientation, e.g., (G / A / C)(C / T / A)(C / G)(G / A)(C / A / T)GG(G / T)(G / A)GA(C / T / A)(C / G)(A / T / G)CC(G / A / T)N(T / C / G)N (SEQ ID NO: 65). In some embodiments, the nucleic acid sequence comprises a sequence complementary to a CTCF-binding motif or consensus sequence.

[0284] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the anchor sequence.

[0285] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a CTCF-binding motif or consensus sequence. In some embodiments, the polynucleotide is selected from the group consisting of a gRNA and a sequence that comprises a sequence complementary to an anchor sequence or a sequence that is at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an anchor sequence.

[0286] In some embodiments, the site-specific HNF4α targeting component comprising the polynucleotide of the present invention is an RNAi molecule. RNAi molecules generally contain 15-50 base pairs (e.g., about 18-25 base pairs) and comprise RNA or RNA-like structures with nucleobase sequences identical (complementary) or nearly identical (substantially complementary) to coding sequences in target genes expressed in cells. RNAi molecules include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), meroduplex, and Dicer substrates (U.S. Patent Nos. 8,084,599, 8,349,809, and 8,513,207). In one embodiment, the present invention includes compositions for inhibiting the expression of genes encoding polypeptides described herein, such as junction nucleation molecules.

[0287] RNAi molecules contain sequences that are substantially complementary or completely complementary to all or a fragment of a target gene. RNAi molecules can complement sequences at intron-exon boundaries to prevent newly generated nuclear RNA transcripts of a specific gene from maturing into mRNA for transcription. RNAi molecules complementary to a specific gene can hybridize with the mRNA of that gene and prevent its translation. Antisense molecules can be DNA, RNA, or derivatives or hybrids thereof. Examples of such derivative molecules include, but are not limited to, peptide nucleic acid (PNA) and phosphorothioate-based molecules such as deoxyribonucleic acid guanidine (DNG) or ribonucleic acid guanidine (RG).

[0288] RNAi molecules can be provided to cells either as "ready-to-use" RNA synthesized in vitro or as antisense genes transfected into cells that, when transcribed, produce the RNAi molecule. Hybridization with mRNA results in degradation of the hybridized molecule by RNAse H and / or inhibition of translation complex formation, both of which prevent production of the original gene's product.

[0289] The length of the RNAi molecule that hybridizes to the transcript of interest should be approximately 10 nucleotides, between about 15 and 30 nucleotides, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the antisense sequence to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0290] RNAi molecules may also contain overhangs, i.e., overhanging nucleotides that are generally unpaired and generally not directly involved in the double helix structure formed by the core sequences of the paired sense and antisense strands as defined herein. RNAi molecules may contain 3'- and / or 5'-overhangs of about 1 to 5 bases that are present independently on each of the sense and antisense strands. In one embodiment, both the sense and antisense strands contain 3'- and 5'-overhangs. In one embodiment, one or more 3'-overhanging nucleotides of one strand are base-paired with one or more 5'-overhanging nucleotides of the other strand. In another embodiment, one or more 3'-overhanging nucleotides of one strand are not base-paired with one or more 5'-overhanging nucleotides of the other strand. The sense and antisense strands of an RNAi molecule may or may not contain the same number of nucleotide bases. The antisense and sense strands can form a duplex in which only the 5' end is blunt, only the 3' end is blunt, both the 5' and 3' ends are blunt, or neither the 5' nor the 3' end is blunt. In another embodiment, one or more of the nucleotides in the overhang contain thiophosphates, phosphorothioates, deoxynucleotides, inverted (3'-3' linked) nucleotides, or are modified ribonucleotides or deoxynucleotides.

[0291] Small interfering RNA (siRNA) molecules contain a nucleotide sequence that is identical to about 15 to about 25 contiguous nucleotides of a target mRNA. In some embodiments, the siRNA sequence begins with the dinucleotide AA, contains about 30-70% (about 50-60%, about 40-60%, or about 45-55%) GC content, and does not share a high percentage of identity to any nucleotide sequence other than the target in the genome of the mammal into which it is introduced, as determined, for example, by a standard BLAST search.

[0292] siRNA and shRNA resemble intermediates in the processing pathway of endogenous microRNA (miRNA) genes (Bartel, Cell 116: 281-297, 2004). In some embodiments, siRNA can function as miRNA, or vice versa, miRNA can function as siRNA (Zeng et al., Mol Cell 9: 1327-1333, 2002; Doench et al., Genes Dev 17: 438-442, 2003). Like siRNA, microRNA uses RISC to downregulate target genes, but unlike siRNA, most animal miRNAs do not cleave mRNA. Instead, miRNA reduces protein output through translational repression or poly(A) removal and mRNA degradation (Wu et al., Proc Natl Acad Sci USA 103: 4034-4039, 2006). Known miRNA binding sites are located within the mRNA 3'UTR; miRNAs appear to target sites with near-perfect complementarity to nucleotides 2-8 from the 5' end of the miRNA (Rajewsky, Nat Genet 38 Suppl: S8-13, 2006; Lim et al., Nature 433: 769-773, 2005). This region is known as the seed region. Because siRNA and miRNA are interchangeable, exogenous siRNA downregulates mRNA with seed complementarity to the siRNA (Birmingham et al., Nat Methods 3: 199-204, 2006). Multiple target sites within the 3'UTR result in more potent downregulation (Doench et al., Genes Dev 17: 438-442, 2003).

[0293] Lists of known miRNA sequences can be found in databases maintained by research organizations such as the Wellcome Trust Sanger Institute, the Perm Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are easily designed and generated by techniques known in the art. Furthermore, computational tools exist that increase the likelihood of discovering effective and specific sequence motifs (Pei et al. 2006, Reynolds et al. 2004, Khvorova et al. 2003, Schwarz et al. 2003, Ui-Tei et al. 2004, Heale et al. 2005, Chalk et al. 2004, Amarzguioui et al. al. 2004).

[0294] RNAi molecules modulate the expression of the RNA encoded by genes.Since multiple genes may share a certain degree of sequence homology with each other, in some embodiments, RNAi molecules can be designed to target a class of genes that have sufficient sequence homology.In some embodiments, RNAi molecules can contain sequences that are shared between different gene targets or sequences that are complementary to sequences that are unique to specific gene targets.In some embodiments, RNAi molecules can be designed to target the conserved regions of RNA sequences that have homology between several genes, thereby targeting several genes within a gene family (for example, different gene isoforms, splice variants, mutant genes, etc.).In some embodiments, RNAi molecules can be designed to target sequences that are unique to the specific RNA sequence of a single gene.

[0295] In some embodiments, the RNAi molecule is coupled to a junction nucleation molecule, such as CTCF, cohesin, USF1, YY1, TATA box-binding protein-associated factor 3 (TAF3), ZNF143, or another polypeptide that promotes the formation of anchor sequence-mediated junctions, or an epigenetic modifier, such as, but not limited to, DNA methylases (e.g., DNMT3a, DNMT3b, DNMTL), DNA demethylation (e.g., TET family enzymes catalyze the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine and higher oxidized derivatives), histone methyltransferases, histone deacetylases (e.g., HDL1, HDL2, HDL3), and / or ATPases (e.g., ATPases). The RNAi molecule targets sequences within enzymes involved in post-translational modifications, including sirtuins 1, 2, 3, 4, 5, 6, or 7 (HDAC1, HDAC2, HDAC3), sirtuins 1, 2, 3, 4, 5, 6, or 7, lysine-specific histone demethylase 1 (LSD1), histone-lysine N-methyltransferase (Setdb1), euchromatin histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), enhancer of zeste homolog 2 (EZH2), viral lysine methyltransferase (vSET), histone methyltransferase (SET2), protein-lysine N-methyltransferase (SMYD2), and the like. In one embodiment, the RNAi molecule targets a protein deacetylase, e.g., sirtuin 1, 2, 3, 4, 5, 6, or 7. In one embodiment, the invention includes a composition comprising an RNAi targeting a junction nucleating molecule, e.g., CTCF.

[0296] In some embodiments, the site-specific HNF4α targeting moiety comprises a peptide or protein moiety. In some embodiments, the site-specific blocking agent comprises a fusion protein. In some embodiments, the effector is a ca peptide or protein moiety. Peptide or protein moieties can include, but are not limited to, peptide ligands that bind to receptors such as extracellular receptors, antibody fragments, or targeting aptamers, neuropeptides, hormonal peptides, peptide drugs, toxic peptides, viral or microbial peptides, synthetic peptides, and agonist or antagonist peptides.

[0297] Exemplary peptides or proteins include DNA-binding proteins, CRISPR component proteins, junction nucleation molecules, dominant-negative junction nucleation molecules, epigenetic modifiers, or any combination thereof. In some embodiments, the peptides include nucleases, physical blockers, epigenetic recruitment factors, and epigenetic CpG modifiers, as well as fragments and combinations of any of the foregoing. In some embodiments, the peptides include DNA-binding domains of proteins such as helix-turn-helix motifs, leucine zippers, zinc finger domains, TATA box-binding proteins, and transcription factors.

[0298] The peptide or protein component can be linear or branched. The peptide or protein component can have a length of about 5 to about 200 amino acids, about 15 to about 150 amino acids, about 20 to about 125 amino acids, about 25 to about 100 amino acids, 20 to 70 amino acids, 20 to 80 amino acids, 20 to 90 amino acids, 30 to 100 amino acids, 30 to 60 amino acids, 30 to 80 amino acids, 35 to 85 amino acids, 40 to 100 amino acids, or 50 to 125 amino acids, or any range therebetween.

[0299] As noted above, in some embodiments, the site-specific HNF4α targeting components of the present invention comprise fusion proteins.

[0300] In some embodiments, the fusion proteins of the present invention comprise a site-specific HNF4α targeting component that targets the HNF4α expression control region and an effector molecule. In other embodiments, the fusion proteins of the present invention comprise an effector molecule. Exemplary effector molecules that can be included are described below, and in some embodiments include, for example, nucleases, physical blocking factors, epigenetic recruitment factors, such as transcription enhancers or transcription repressors, and epigenetic CpG modification factors, such as DNA methylases, DNA demethylases, histone modifiers, or histone deacetylases, and any combination thereof.

[0301] For example, the site-specific targeting component can include a gRNA and an effector, e.g., a nuclease, e.g., Cas9, e.g., wild-type Cas9, nickase Cas9 (e.g., Cas9 The nuclease may include a nuclease such as Cas9 (D10A), inactive Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, or a nucleic acid encoding such a nuclease. The choice of nuclease and gRNA(s) is determined by whether the targeted mutation is a deletion, substitution, or addition of nucleotides, for example, a deletion, substitution, or addition of nucleotides to the targeted sequence. Fusions of a catalytically inactive endonuclease, such as inactive Cas9 (dCas9, e.g., D10A; H840A), linked to all or a portion (e.g., biologically active portion) of one or more effector domains create chimeric proteins that can be linked to polypeptides to guide the composition to specific DNA sites via one or more RNA sequences (e.g., DNA recognition elements, including but not limited to, zinc finger arrays, sgRNAs, TAL arrays, peptide nucleic acids, as described herein) and modulate the activity and / or expression of one or more target nucleic acid sequences (e.g., methylate or demethylate DNA sequences).

[0302] In one embodiment, a fusion protein of the invention can comprise, for example, a CRISPR-associated protein (Cas) polypeptide or fragment thereof (e.g., a Cas9 polypeptide or fragment thereof) and an effector molecule comprising an epigenetic recruitment factor or an epigenetic CpG modifier. In one embodiment, a suitable Cas polypeptide is an enzymatically inactive Cas polypeptide, e.g., an "inactive Cas polypeptide" or "dCas" polypeptide.

[0303] Exemplary Cas polypeptides adaptable for use in the methods and compositions described herein are described below. Using methods known in the art, Cas polypeptides can be fused to any of the various agents and / or molecules described herein; the resulting fusion molecules can be useful in the various disclosed methods.

[0304] In one aspect, the invention includes a composition comprising a protein comprising a DNA-acting domain, e.g., an effector (e.g., a nuclease domain, e.g., a Cas9 domain, e.g., a dCas9 domain; a DNA methyltransferase, a demethylase, a deaminase), in combination with at least one guide RNA (gRNA) or antisense DNA oligonucleotide that targets the protein to a site-specific target sequence, wherein the composition is effective for altering expression of a target gene in a human cell. In some embodiments, the enzymatic domain is Cas9 or dCas9. In some embodiments, the protein comprises two enzymatic domains, e.g., a dCas9 domain and a methylase domain or a demethylase domain.

[0305] In one aspect, the present invention includes a composition comprising a protein comprising a domain, e.g., an effector, that includes a transcriptional control element (e.g., a nuclease domain, e.g., a Cas9 domain, e.g., a dCas9 domain; a transcriptional enhancer; or a transcriptional repressor) in combination with at least one guide RNA (gRNA) or antisense DNA oligonucleotide that targets the protein to a site-specific target sequence, wherein the composition is effective for altering expression of a target gene in a human cell. In some embodiments, the enzymatic domain is Cas9 or dCas9. In some embodiments, the protein comprises two enzymatic domains, e.g., a dCas9 domain and a transcriptional enhancer domain or a transcriptional repressor domain.

[0306] As used herein, a "biologically active portion of an effector domain" is a portion that maintains the function of the effector domain (e.g., completely, partially, minimally) (e.g., a "minimal" or "core" domain).

[0307] The chimeric proteins described herein can also include linkers, e.g., amino acid linkers. In some embodiments, the linker includes two or more amino acids, e.g., one or more GS sequences. In some embodiments, a fusion of Cas9 (e.g., dCas9) with two or more effector domains (e.g., DNA methylases or enzymes that play a role in DNA demethylation or protein acetyltransferases or deacetylases) includes one or more linkers (e.g., GS linkers) interspersed between the domains. In some embodiments, dCas9 is fused to two to five effector domains using interspersed linkers.

[0308] In some embodiments, the site-specific HNF4α targeting component comprises a connecting nucleation molecule, a nucleic acid encoding a connecting nucleation molecule, or a combination thereof. In some embodiments, the anchor sequence-mediated connection is mediated by a first connecting nucleation molecule bound to a first anchor sequence, a second connecting nucleation molecule bound to a discontinuous second anchor sequence, and the association of the first connecting nucleation molecule with the second connecting nucleation molecule. In some embodiments, the connecting nucleation molecule can disrupt the binding of an endogenous connecting nucleation molecule to its binding site, for example, by competitive binding.

[0309] The connection nucleation molecule can be, for example, CTCF, cohesin, USF1, YY1, TATA box-binding protein-associated factor 3 (TAF3), ZNF143-binding motif, or another polypeptide that promotes the formation of anchor sequence-mediated connections. The connection nucleation molecule can be an endogenous polypeptide or other protein, such as a transcription factor, such as autoimmune regulatory factor (AIRE), another factor, such as X-inactivation specific transcript (XIST), or an engineered polypeptide engineered to recognize a specific DNA sequence of interest, for example, with a zinc finger, leucine zipper, or bHLH domain for sequence recognition. The connection nucleation molecule can modulate DNA interactions within or around the anchor sequence-mediated connection. For example, the connection nucleation molecule can recruit other factors to the anchor sequence that alter the formation or disruption of the anchor sequence-mediated connection.

[0310] The connection nucleation molecule may also have a dimerization domain for homodimerization or heterodimerization. One or more connection nucleation molecules, for example, endogenous and engineered ones, can interact to form an anchor sequence-mediated connection. In some embodiments, the connection nucleation molecule is engineered to further include a stabilization domain, for example, an aggregation interaction domain, to stabilize the anchor sequence-mediated connection. In some embodiments, the connection nucleation molecule is engineered to bind a target sequence, for example, to modulate its binding affinity with the target sequence. In some embodiments, a connection nucleation molecule with a selected binding affinity for the anchor sequence in the anchor sequence-mediated connection is selected or engineered. Connection nucleation molecules and their corresponding anchor sequences can be identified by examining topological interactions between topologically related domains, for example, distal DNA regions or loci, in the absence of CTCF using cells with inactivating mutations in CTCF and chromosome conformation capture or 3C-based methods, such as Hi-C or high-throughput sequencing. Long-range DNA interactions can also be identified. Additional analyses may include ChlA-PET analysis using baits such as cohesin, YY1 or USF1, ZNF143 binding motifs, and MS to identify complexes associated with the bait.

[0311] B. Effector molecules Effector molecules for use in the compositions and methods of the present invention include those that modulate biological activity, such as increasing or decreasing enzyme activity, gene expression, cell signaling, and cell or organ function. Preferred effector molecules of the present invention are nucleases, physical blocking factors, epigenetic recruitment factors, such as transcription enhancers or transcription repressors, and epigenetic CpG modifiers, such as DNA methylases, DNA demethylases, histone modifiers, or histone deacetylases, and any combination thereof.

[0312] Additional effector activity of the effector molecules of the present invention can also include binding regulatory proteins to modulate the activity of regulatory factors, such as transcription or translation. Effector molecules can also have activator or inhibitor (or "negative effector") functions as described herein. For example, effector molecules can inhibit the binding of substrates to receptors and inhibit their activation; for example, naltrexone and naloxone bind to opioid receptors without activating them, blocking the receptor's ability to bind opioids. Effector molecules can also modulate protein stability / degradation and / or transcript stability / degradation. For example, proteins can be targeted for degradation by marking them for degradation with the polypeptide cofactor ubiquitin. In another example, effector molecules inhibit enzyme activity by blocking the enzyme's active site. For example, methotrexate is a structural analogue of tetrahydrofolate, the coenzyme of the enzyme dihydrofolate reductase, that binds 1000 times more tightly to dihydrofolate reductase than the natural substrate, inhibiting nucleotide base synthesis.

[0313] In some embodiments, the effector molecule is a chemical, e.g., a chemical that modulates cytosine (C) or adenine (A) (e.g., sodium bisulfite, ammonium bisulfite). In some embodiments, the effector molecule has enzymatic activity (methyltransferase, demethylase, nuclease (e.g., Cas9), deaminase). In some embodiments, the effector molecule sterically interferes with the formation of an anchor sequence-mediated connection or the binding of RNA polymerase to the promoter.

[0314] The effector molecule having effector activity can be any one of a small molecule, peptide, fusion protein, nucleic acid, nanoparticle, aptamer, or pharmacoagent with low PK / PD as described herein.

[0315] In some embodiments, the effector molecule is an inhibitor or "negative effector molecule." With respect to negative effector molecules that modulate the formation of anchor sequence-mediated connections, in some embodiments, the negative effector molecule is characterized in that the presence of the negative effector molecule reduces dimerization of the endogenous nucleation polypeptide compared to its absence. For example, in some embodiments, the negative effector molecule is or comprises a variant of the dimerization domain or dimerization portion thereof of the endogenous nucleation polypeptide.

[0316] For example, in certain embodiments, anchor sequence-mediated connections are altered (e.g., disrupted) by using dominant-negative effectors, e.g., proteins that recognize and bind to anchor sequences (e.g., CTCF-binding motifs) but have inactive (e.g., mutated) dimerization domains, e.g., dimerization domains that are unable to form functional anchor sequence-mediated connections. For example, the zinc finger domain of CTCF can be altered to bind to specific anchor sequences (by adding zinc fingers that recognize adjacent nucleic acids), while the homodimerization domain is altered to prevent interaction between the engineered CTCF and endogenous forms of CTCF.

[0317] In some embodiments, the effector molecule comprises a synthetic connection nucleating molecule having a selected binding affinity for an anchor sequence within the target anchor sequence-mediated connection (the binding affinity can be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more higher or lower than the affinity of the endogenous connection nucleating molecule associated with the target anchor sequence. The synthetic connection nucleating molecule can have 30-90%, 30-85%, 30-80%, 30-70%, 50-80%, 50-90% amino acid sequence identity to the endogenous connection nucleating molecule). The connection nucleating molecule can disrupt binding of the endogenous connection nucleating molecule to its anchor sequence, for example, through competitive binding. In some further embodiments, the connection nucleation molecule is engineered to bind to a novel anchor sequence within the anchor sequence-mediated connection.

[0318] In some embodiments, dominant-negative effector molecules have a domain that recognizes a specific DNA sequence (e.g., an anchor sequence, a CTCF anchor sequence, flanked by sequences that confer sequence specificity), and a second domain that provides a steric presence near the anchoring sequence. The second domain can comprise a dominant-negative conjugated nucleating molecule or fragment thereof, a polypeptide that interferes with conjugated nucleating molecule sequence recognition (e.g., the amino acid backbone of a peptide / nucleic acid or PNA), a nucleic acid sequence ligated with a small molecule that confers steric interference, or any other combination of a DNA recognition element and a steric blocker.

[0319] In some embodiments, the effector molecule is an epigenetic modifier.Epigenetic modifiers useful in the methods and compositions described herein include, for example, agents that affect DNA methylation, histone acetylation, and RNA-associated silencing.In some embodiments, the effector targets epigenetic enzymes (for example, enzymes that create or remove epigenetic marks, such as acetylation and / or methylation) in a sequence-specific manner.Exemplary epigenetic effectors can target, for example, transcriptional control elements or expression control regions that include anchor sequences, by site-specific blocking agents that include site-specific targeting components.

[0320] In some embodiments, effector molecule comprises one or more components of gene editing system.The components of gene editing system can be used in various situations, including but not limited to gene editing.For example, such components can be used to target the agent that physically modifies, genetically modifies, and / or epigenetically modifies HNF4α sequence.

[0321] Exemplary gene editing systems include the clustered regularly interspaced short palindromic repeats (CRISPR) system, zinc finger nucleases (ZFNs), and transcription activator-like effector-based nucleases (TALENs). ZFN-, TALEN-, and CRISPR-based methods are described, for example, in Gaj et al. Trends Biotechnol. 31.7 (2013): 397-405; CRISPR methods of gene editing are described, for example, in Guan et al., Application of CRISPR-Cas system in gene therapy: Pre-clinical progress in animal models. DNA Repair 2016 July 30 [Epub ahead of print]; Zheng et al, Precise gene deletion and replacement using the CRISPR / Cas9 system in human cells. BioTechniques, Vol. 57, No. 3, September 2014, pp. 115-124;

[0322] The CRISPR system is an adaptive defense system initially discovered in bacteria and archaea. In CRISPR systems, RNA-guided nucleases (e.g., Cas9 or Cpf1), termed CRISPR-associated endonucleases or "Cas" endonucleases, are used to cleave foreign DNA. In a typical CRISPR / Cas system, a sequence-specific non-coding "guide RNA" that targets single- or double-stranded DNA sequences directs the endonuclease to the target nucleotide sequence (e.g., the site in the genome where the sequence is to be edited). Three classes (I-III) of CRISPR systems have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). A Class II CRISPR system includes a type II Cas endonuclease, such as Cas9, a CRISPR RNA ("crRNA"), and a trans-activating crRNA ("tracrRNA"). The crRNA contains a "guide RNA," an RNA sequence of typically about 20 nucleotides, that corresponds to the target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure, which is cleaved by RNase III, resulting in a crRNA / tracrRNA hybrid. The crRNA / tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a "protospacer adjacent motif" ("PAM") that is specific for a given Cas endonuclease; however, PAM sequences occur throughout a given genome. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; example PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), and 5'-NNNGATT (Neisseria meningiditis).Some endonucleases, such as the Cas9 endonuclease, associate with G-rich PAM sites, such as 5'-NGG, and blunt-end cleave target DNA three nucleotides upstream (5') of the PAM site. Another class II CRISPR system includes the V-type endonuclease Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). Cpf1-associated CRISPR arrays are processed into mature crRNA without the need for tracrRNA; in other words, the Cpf1 system requires only the Cpf1 nuclease and crRNA to cleave the target DNA sequence. The Cpf1 endonuclease associates with T-rich PAM sites, such as 5'-TTN. Cpf1 also recognizes the 5'-CTA PAM motif. Cpf1 cleaves target DNA by introducing offset or staggered double-strand breaks with 4- or 5-nucleotide 5' overhangs, for example, cleaving target DNA at 5-nucleotide offset or staggered breaks located 18 nucleotides downstream (3') of the PAM site on the coding strand and 23 nucleotides downstream of the PAM site on the complementary strand; the 5-nucleotide overhang resulting from such offset cleavage allows for more precise genome editing by DNA insertion via homologous recombination than by insertion into blunt-end cut DNA. See, for example, Zetsche et al. (2015) Cell, 163: 759-771.

[0323] A variety of CRISPR-associated (Cas) genes or proteins can be used in the present invention, with the choice of Cas protein depending on the particular requirements of the method.

[0324] Specific examples of Cas proteins include class II systems, including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cpf1, C2C1, or C2C3. In some embodiments, the Cas protein, e.g., the Cas9 protein, can be derived from any of a variety of prokaryotic species. In some embodiments, a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer adjacent motif (PAM) sequence. In some embodiments, the site-specific targeting component comprises a sequence that targets a polypeptide, e.g., an enzyme, e.g., Cas9. In certain embodiments, the Cas protein, e.g., the Cas9 protein, can be obtained from bacteria or archaea or synthesized using known methods. In certain embodiments, the Cas protein can be derived from Gram-positive or Gram-negative bacteria. In certain embodiments, the Cas proteins may be from Streptococcus (e.g., S. pyogenes, S. thermophilus), Cryptococcus, Corynebacterium, Haemophilus, Eubacterium, Pasteurella, Prevotella, Veillonella, or Marinobacter. In some embodiments, two or more different Cas proteins or nucleic acids encoding two or more Cas proteins can be introduced into a cell, zygote, embryo, or animal, e.g., to allow recognition and modification of sites containing the same, similar, or different PAM motifs.In some embodiments, the Cas proteins are engineered to inactivate nucleases, e.g., nuclease-deficient Cas9, and to recruit transcriptional activators or repressors, e.g., the co-subunit of E. coli Pol, VP64, the activation domain of p65, KRAB, or SID4X; or to induce epigenetic modifications, e.g., histone acetyltransferases, histone methyltransferases and demethylases, DNA methyltransferases, and enzymes that play a role in DNA demethylation (e.g., the TET family enzymes catalyze the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine and higher oxidized derivatives).

[0325] For gene editing, CRISPR arrays can be designed to contain one or more guide RNA sequences that correspond to the desired target DNA sequence; for example, Cong et al. (2013) Science, 339:819-823; (2013) Nature Protocols, 8:2281-2308. Cas9 requires a gRNA sequence of at least about 16 or 17 nucleotides to produce DNA cleavage, and Cpf1 requires a gRNA sequence of at least about 16 nucleotides to achieve detectable DNA cleavage.

[0326] While wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by gRNAs, several CRISPR endonucleases with altered functionality are available. For example, "nickase" versions of Cas9 generate only single-strand breaks, and catalytically inactive Cas9 ("dCas9") does not cut target DNA but interferes with transcription through steric hindrance. dCas9 can also be fused to heterologous effectors to silence (CRISPRi) or activate (CRISPRa) target gene expression. For example, Cas9 can be fused to a transcriptional silencer (e.g., a KRAB domain) or a transcriptional activator (e.g., a dCas9-VP64 fusion). Catalytically inactive Cas9 (dCas9) fused to FokI nuclease ("dCas9-FokI") can be used to generate DSBs at target sequences homologous to two gRNAs. See, for example, the numerous publicly available CRISPR / Cas9 plasmids disclosed in the Addgene repository (Addgene, 75 Sidney St., Suite 550A, Cambridge, MA 02139; addgene.org / crispr). A "double nickase" Cas9, which introduces two separate double-strand breaks, each directed by a separate guide RNA, has been described in Ran et al. (2013) Cell, 154: 1380-1389 as providing more precise genome editing.

[0327] CRISPR technology for editing eukaryotic genes is disclosed in U.S. Patent Application Publication Nos. 2016 / 0138008A1 and US2015 / 0344912A1, and U.S. Patent Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. The Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication No. 2016 / 0208243 A1.

[0328] In some embodiments, the effector comprises one or more components of a CRISPR system as described herein above.

[0329] In some embodiments, suitable effectors for use in the agents, compositions, and methods of the invention include, for example, nucleases, physical blocking factors, epigenetic recruitment factors, such as transcriptional enhancers or transcriptional repressors, and epigenetic CpG modifiers, such as DNA methylases, DNA demethylases, histone modifiers, or histone deacetylases, and combinations of any of the foregoing.

[0330] Suitable effectors include polypeptides or variants thereof. The term "variant" as used herein refers to a polypeptide obtained by incorporating one or more amino acid insertions, substitutions, or deletions into a precursor polypeptide (e.g., a "parent" polypeptide). In certain embodiments, the variant polypeptide has at least about 85% amino acid sequence identity with the entire amino acid sequence of the parent polypeptide, for example, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% amino acid sequence identity.

[0331] The term " sequence identity " as used herein refers to the comparison between pairs of nucleic acid or amino acid molecules, that is, the relationship between two amino acid sequences or two nucleotide sequences.Generally, the sequences are aligned so as to obtain the highest degree of matching.The method for determining sequence identity is known, and can be determined by commercially available computer programs, which can calculate the percentage of identity between two or more sequences.The typical example of such computer program is CLUSTAL.

[0332] Exemplary effectors include bicyclic peptides such as ubiquitin, ubiquitin ligase inhibitors, transcription factors, DNA and protein modifying enzymes, e.g., topoisomerases, topoisomerase inhibitors such as topotecan, DNA methyltransferases such as those of the DNMT family (e.g., DNMT3a, DNMT3b, DNMTL), protein methyltransferases (e.g., viral lysine methyltransferase (vSET), protein-lysine N-methyltransferase (SMYD2), deaminases (e.g., APOBEC, U G1), histone methyltransferases, e.g., enhancer of zeste homolog 2 (EZH2), PRMT1, histone-lysine-N-methyltransferase (Setdb1), histone methyltransferase (SET2), euchromatin histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), and G9a), histone deacetylases (e.g., HDAC1, HDAC2, HDAC3), enzymes that play a role in DNA demethylation (e.g., TET family Protein demethylases such as lysine-specific histone demethylase 1 (LSD1), helicases such as DHX9, acetyltransferases, deacetylases (e.g., sirtuins 1, 2, 3, 4, 5, 6, or 7), kinases, phosphatases, DNA intercalators such as ethidium bromide, Sybr Green, and proflavine, peptidomimetics like phenylalanine arginyl-naphthylamide, or quinoline derivatives, are also involved. conductors, efflux pump inhibitors such as nuclear receptor activators and inhibitors, proteasome inhibitors, competitive inhibitors of enzymes such as those involved in lysosomal storage diseases, zinc finger proteins, TALENs, specific domains from proteins such as KRAB domains, VP64 domains, p300 domains (e.g., p300 core domain), MeCP2 domains, MQ1 domains, DNMT3a-3L domains, TET1 domains, and TET2 domains, protein synthesis inhibitors, nucleases (e.g., Cpf1, Cas9, zinc finger nucleases),These include one or more fusions (e.g., dCas9-DNMT, dCas9-APOBEC, dCas9-UG1, dCas9-VP64, dCas9-p300 core, dCas9-KRAB, dCas9-KRAB-MeCP2, dCas9-MQ1, dCas9-DNMT3a-3L, dCAS9-TET1, dCAS9-TET2, and dCas9-MC / MN).

[0333] In some embodiments, a suitable nuclease for use in the agents, compositions, and methods of the present invention comprises a Cas9 polypeptide or an enzymatically active portion thereof. In one embodiment, the Cas9 polypeptide or an enzymatically active portion thereof further comprises a catalytically active domain of human exonuclease 1 (hEXO1), e.g., 5' to 3' exonuclease activity and / or RNase H activity. In other embodiments, a suitable nuclease comprises a transcription activator-like effector nuclease (TALEN). In yet other embodiments, a suitable nuclease comprises a zinc finger protein.

[0334] The term TALEN as used herein is broad and includes monomeric TALEN that can cut double-stranded DNA without the assistance of another TALEN.The term TALEN can also be used to refer to one or both members of a pair of engineered TALENs that work together to cut DNA at the same site.TALENs that work together can be referred to as left-handed TALENs and right-handed TALENs, which refers to the handedness of DNA.See USSN12 / 965,590; USSN13 / 426,991 (US8,450,471); USSN13 / 427,040 (US8,440,431); USSN13 / 427,137 (US8,440,432); and USSN13 / 738,381, all of which are incorporated herein by reference in their entirety.

[0335] TAL effectors are proteins secreted by Xanthomonas bacteria. The DNA-binding domain contains a highly conserved sequence of 33–34 amino acids, with the exception of the 12th and 13th amino acids. These two positions are highly variable (repeated variable dinucleotides (RVDs)) and show a strong correlation with specific nucleotide recognition. This simple correlation between amino acid sequence and DNA recognition makes it possible to engineer specific DNA-binding domains by selecting combinations of repeat segments containing the appropriate RVDs.

[0336] A nonspecific DNA cleavage domain derived from the end of the FokI endonuclease can be used to construct hybrid nucleases active in yeast assays. These reagents are also active in plant and animal cells. Initial TALEN studies used wild-type FokI cleavage domains, but some subsequent TALEN studies also used FokI cleavage domain variants with mutations designed to improve cleavage specificity and activity. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome, oriented and spaced appropriately. The number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain and the number of bases between two individual TALEN binding sites are both parameters related to achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the FokI cleavage domain can be modified by introducing a spacer (separate from the spacer sequence) between multiple TAL effector repeat sequences and the FokI endonuclease domain. The spacer sequence can be between 12 and 30 nucleotides.

[0337] The link between amino acid sequence and DNA recognition by TALEN binding domains allows for designable proteins. In this case, artificial gene synthesis is problematic due to improper annealing of repetitive sequences within the TALE binding domain. One solution to this problem is to use a publicly available software program (DNAWorks) to perform two-step PCR; oligonucleotide assembly; and subsequent calculation of suitable oligonucleotides for assembly in whole-gene amplification. Several modular assembly schemes for generating engineered TALE constructs have also been reported. Both methods provide a systematic approach for engineering DNA-binding domains that are conceptually similar to the modular assembly method for generating zinc finger DNA recognition domains.

[0338] Once TALEN genes are assembled, they are inserted into a plasmid; then the plasmid is used to transfect target cells, where the gene product is expressed and enters the nucleus to access the genome. TALEN can be used to edit genomes by inducing double-strand breaks (DSBs), which cells respond to with repair mechanisms. In this way, TALEN can be used, for example, to correct mutations in genomes that cause disease.

[0339] As used herein, a "zinc finger polypeptide" or "zinc finger protein" is a protein that binds to DNA, RNA, and / or proteins in a sequence-specific manner via a metal-stabilized domain known as a zinc finger. A zinc finger protein is a nuclease that has a DNA cleavage domain and a DNA-binding zinc finger domain. A zinc finger polypeptide can be created by fusing the non-specific DNA cleavage domain of an endonuclease with a site-specific DNA-binding zinc finger domain. Such nucleases are powerful tools for gene editing and can be assembled to site-specifically induce double-strand breaks (DSBs) in genomic DNA. ZFNs enable specific gene disruption during DNA repair, disrupting targeted genes by mutagenic non-homologous end joining (NHEJ) or, when a closely related DNA template is provided, modifying them by homologous recombination (HR).

[0340] Zinc finger nucleases are chimeric enzymes created by fusing the nonspecific DNA cleavage domain of the endonuclease FokI with a site-specific DNA-binding zinc finger domain. Due to the flexible nature of zinc finger proteins (ZFPs), ZFNs can be assembled to site-specifically induce double-strand breaks (DSBs) within genomic DNA. ZFNs enable specific gene disruption during DNA repair, disrupting targeted genes by mutagenic non-homologous end joining (NHEJ) or, when a closely related DNA template is provided, modifying them by homologous recombination (HR).

[0341] In some embodiments, suitable physical blocking elements for use in the agents, compositions, and methods of the present invention include gRNAs, antisense DNA, or triplex-forming oligonucleotides (which may target expression control units) that sterically block transcriptional control elements or anchoring sequences. The gRNAs recognize specific DNA sequences and further include sequences that act as steric blocking agents, for example, by interfering with the connecting nucleation molecule sequence. In some embodiments, the gRNAs are combined with one or more peptides that act as steric blocking agents, such as S-adenosylmethionine (SAM). In other embodiments, the physical blocking element comprises an enzymatically inactive Cas9 polypeptide or a fragment thereof (e.g., dCas9).

[0342] In one embodiment, the epigenetic recruitment factor activates or enhances transcription of the target gene. In some embodiments, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the invention comprise a VP64 domain or a p300 core domain.

[0343] In one embodiment, the epigenetic recruitment factor silences or represses the transcription of the target gene. In some embodiments, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the present invention comprise a KRAB domain or an MeCP2 domain.

[0344] In one embodiment, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the invention include a dCas9-VP64 fusion, a dCas9-p300 core fusion, a dCas9-KRAB fusion, or a dCas9-KRAB-MeCP2 fusion.

[0345] As used herein, "VP64" refers to VP16 (herpes simplex virus protein 16, amino acids 437-447) linked with a glycine-serine (GS) linker. *VP64 is a transcriptional activator composed of four tandem copies of the transcription factors p65 (RelA) and Rta (DALDFDLDML). In one embodiment, VP64 further comprises the transcription factors p65 (RelA) and Rta at the C-terminus. An effector comprising VP64, p65, and Rta is referred to as "VPR." The GenBank accession number for VP64 is ADD60007.1, the GenBank accession number for p65 is NP_001138610.1, and the GenBank accession number for Rta is AAA66528.1.

[0346] An exemplary amino acid sequence of VPR is as follows: [ka]

[0347] As used herein, "p300 core domain" refers to the catalytic core of human acetyltransferase p300. The GenBank accession number for the protein that comprises p300 is NP_001420.2.

[0348] An exemplary amino acid sequence of p300 is as follows: [ka]

[0349] As used herein, "KRAB" refers to the Krüppel-associated box (KRAB) transcriptional repression domain present in human zinc finger protein-based transcription factors (KRAB zinc finger proteins).

[0350] As used herein, "MeCp2" refers to methyl-CpG binding protein 2, which represses transcription by binding, for example, to promoters containing methylated DNA.

[0351] In one embodiment, epigenetic CpG modifiers methylate DNA to inactivate or silence transcription. In some embodiments, suitable epigenetic CpG modifiers for use in the agents, compositions, and methods of the invention comprise an MQ1 domain or a DNMT3a-3L domain.

[0352] In one embodiment, epigenetic CpG modifiers demethylate DNA and activate or stimulate transcription. In some embodiments, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the invention comprise a TET1 or TET2 domain.

[0353] As used herein, "TET1" refers to "10-11 translocation methylcytosine dioxygenase 1," a member of the TET family of enzymes encoded by the TET1 gene. TET1 is a dioxygenase that catalyzes the conversion of the modified DNA base 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by iron- and alpha-ketoglutarate-dependent oxidation of 5-mC, the first step in active DNA demethylation in mammals. Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome that plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, it plays a more general role in chromatin regulation. It preferentially binds to CpG-rich sequences in the promoters of both transcriptionally active and Polycomb-repressed genes. It is involved in the recruitment of the O-GlcNAc transferase OGT to the CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT.

[0354] As used herein, "TET2" refers to "ten-eleven translocation 2 (TET2)," a member of the TET family of enzymes encoded by the TET1 gene. Like TET1, TET2 is a dioxygenase that catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), playing a key role in active DNA demethylation. TET2 prefers 5-hydroxymethylcytosine within CpG motifs. TET2 also mediates the subsequent conversion of 5hmC to 5-formylcytosine (5fC) and 5fC to 5-carboxylcytosine (5caC). The conversion of 5mC to 5hmC, 5fC, and 5caC likely constitutes the first step in cytosine demethylation. Methylation at the C5 position of cytosine bases is an epigenetic modification of mammalian genomes that plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, it is also involved in recruiting the O-GlcNAc transferase OGT to the CpG-rich transcription start sites of active genes, thereby facilitating histone H2B GlcNAcylation by OGT.

[0355] As used herein, "DNMT3a-3L" refers to a fusion of Dnmt3a, a DNA methyltransferase, and Dnmt3L, which is catalytically inactive but interacts directly with the catalytic domain of Dnmt3a.

[0356] In some embodiments, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the invention comprise an MQ1 domain, a DNMT3a-3L domain, a TET1 domain, or a TET2 domain. In one embodiment, suitable epigenetic recruitment factors for use in the agents, compositions, and methods of the invention comprise a dCas9-MQ1 fusion, a dCas9-DNMT3a-3L fusion, a dCas9-TET1 fusion, or a dCas9-TET2 fusion.

[0357] III. Delivery of Site-Specific HNF4α Blocking Agents of the Invention and Compositions Comprising Site-Specific HNF4α Blocking Agents of the Invention The delivery of the blocking agent of the present invention to cells, for example, cells in a subject, such as a human subject (e.g., a subject in need thereof, such as a subject with an HNF4α-related disorder, e.g., cirrhosis), can be achieved in several different ways. For example, delivery can be achieved by contacting cells with the blocking agent of the present invention either in vitro, ex vivo, or in vivo. In vivo delivery can be achieved directly by administering a composition, such as a lipid composition, containing the blocking agent to the subject. Alternatively, in vivo delivery can be achieved indirectly by administering one or more vectors that encode and direct the expression of the blocking agent. These alternatives will be further discussed below.

[0358] In some embodiments, the blocking agent comprises a nucleic acid molecule encoding a fusion protein, the fusion protein comprising a site-specific HNF4α targeting component, such as a polynucleotide encoding a DNA-binding domain or fragment thereof of a transcription activator-like effector (TALE) polypeptide or a zinc finger (ZNF) polypeptide that specifically targets and binds to the HNF4α expression control region, and an effector molecule, such as a VPR.

[0359] In other embodiments, the blocking agent comprises a guide RNA and an mRNA encoding the effector molecule. The ratio of guide RNA to mRNA can be about 100:1 to about 1:100 (wt:wt).

[0360] Generally, any method for delivering the site-specific HNF4α blocking agent of the present invention (in vitro, ex vivo, or in vivo) can be adapted for use with the blocking agent of the present invention (see, for example, Akhtar S. and Julian R.L., (1992) Trends Cell. Biol. 2 (5): 139-144 and WO94 / 02595, the entire contents of which are incorporated herein by reference). With regard to in vivo delivery, factors to consider for the delivery of the site-specific HNF4α blocking agent of the present invention include, for example, the biological stability of the blocking agent, prevention of nonspecific effects, and accumulation of the blocking agent in the target tissue. Nonspecific effects of the blocking agent can be minimized by local administration, for example, by direct injection or implantation into the tissue, or by local administration of a composition containing the blocking agent. Local administration to the treatment site maximizes the local concentration of the blocking agent, limits exposure of the blocking agent to systemic tissues that may otherwise be harmed by or degrade the blocking agent, and allows for a lower total dose of the blocking agent to be administered.

[0361] Regarding the systemic administration of site-specific HNF4α blocking agents for treating diseases such as HNF4α-related diseases, blocking agents, for example, blocking agents comprising site-specific targeting components containing nucleic acid molecules, can be modified or delivered using drug delivery systems; either method acts to prevent site-specific targeting components containing nucleic acid molecules from being rapidly degraded by endonucleases and exonucleases in vivo.Modifying blocking agents or pharmaceutical carriers comprising site-specific targeting components containing nucleic acid molecules also makes it possible to target blocking agents to target tissues and avoid undesirable off-target effects.For example, the blocking agents of the present invention can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.

[0362] Alternatively, the blocking agent of the present invention can be delivered using a drug delivery system such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of blocking agents (e.g., negatively charged molecules) and also enhance their interaction with negatively charged cell membranes, allowing for efficient cellular uptake of the blocking agent. Cationic lipids, dendrimers, or polymers can be conjugated with blocking agents or induced to form vesicles or micelles that encapsulate the blocking agent (see, for example, Kim SH. et al., (2008) Journal of Controlled Release 129 (2): 107-116). The formation of vesicles or micelles also prevents the degradation of blocking agents when administered systemically. Methods for making and administering cationic complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen, D.R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U.N. et al. (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A.S. et al. (2007) J. Hypertens. 25:197-205, which are incorporated by reference in their entireties.) Some non-limiting examples of drug delivery systems useful for systemic delivery of the blocking agents of the present invention include DOTAP (Sorensen, D.R., et al. (2003), supra; Verma, U.N. et al. (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS. et al., (2006) Nature 441: 111-114), cardiolipin (Chien, PY. et al., (2005) Cancer Gene Ther. 12: 321-328; Pal, A. et al., (2005) Int J. Oncol. 26: 1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S. (2006) Mol. Pharm. 3: 472-487), and polyamidoamine (Tomalia, D. A. et al., (2007) Biochem. Soc. Trans. 35: 61-67; Yoo, H. et al., (1999) Pharm. Res. 16: 1799-1804). In some embodiments, the blocking agent (e.g., gRNA, or mRNA) is complexed with cyclodextrin for systemic administration. Methods for administering cyclodextrin and pharmaceutical compositions containing cyclodextrin can be found in U.S. Patent No. 7,427,605, the entire contents of which are incorporated herein by reference.

[0363] The blocking agent of the present invention can be incorporated into a pharmaceutical composition suitable for administration. Such compositions generally contain one or more blocking agents and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0364] The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (ophthalmic, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal, or intramuscular injection, or intrathecal or intraventricular administration.

[0365] The route and site of administration can be selected to enhance the delivery or targeting of the blocking agent containing the site-specific targeting component to a specific location. For example, intravenous injection can be used to target liver cells. Lung cells can be targeted by administering the blocking agent in aerosol form. Jejunal cells can be targeted by administering the blocking agent to the anus.

[0366] Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful.

[0367] Compositions for oral administration include powders or granules, aqueous suspensions or solutions, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches. For tablets, carriers that can be used include lactose, sodium citrate, and salts of phosphoric acid. Various disintegrants, such as starch, and lubricants such as magnesium stearate, sodium lauryl sulfate, and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high-molecular-weight polyethylene glycol. When aqueous suspensions are required for oral use, the nucleic acid composition can be combined with emulsifying and suspending agents. If desired, certain sweeteners or flavoring agents can be added.

[0368] Compositions for intravenous administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.

[0369] Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives. For intravenous use, the total concentration of solutes may be controlled to render the preparation isotonic.

[0370] In one embodiment, administration of the blocking agent composition of the present invention is parenteral, e.g., intravenous (e.g., as a bolus or as a diffuse infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary, intranasal, urethral, ​​or ocular. Administration can be provided by the subject or by another person, e.g., a health care provider. The composition can be provided in a precisely measured dose or in a dispenser that delivers a precisely measured dose. Selected modes of delivery are discussed in more detail below.

[0371] In certain embodiments, the blocking agents of the present invention are polynucleotides, such as mRNA, and are formulated as lipid nanoparticles (LNPs).

[0372] A. Compositions Comprising Site-Specific HNF4α Blockers of the Invention The site-specific HNF4α blocking agents of the present invention can be formulated into compositions, such as pharmaceutical compositions, using one or more excipients to (1) increase stability; (2) increase cell transfection; (3) enable sustained or delayed release (e.g., from a depot formulation); (4) modify biodistribution (e.g., target the blocking agent to a specific tissue or cell type); (5) increase in vivo translation of the encoded protein; and / or (6) modify the in vivo release profile of the encoded protein. In addition to conventional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, tonicity agents, thickening or emulsifying agents, preservatives, excipients for use in the compositions of the present invention include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, nucleic acid molecules, modified nucleic acid molecules, or RNA-transfected cells (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof. Thus, the pharmaceutical compositions of the present invention may contain one or more excipients in amounts that, together, increase the stability of the blocking agent, increase cell transfection by the blocking agent, increase expression of the protein encoded by the modified nucleic acid or mRNA, and / or modify the release profile of the blocking agent. Additionally, the blocking agents of the present invention can be formulated using self-assembling nucleic acid nanoparticles (see, e.g., U.S. Patent Application Publication No. 2016 / 0038612A1, which is incorporated by reference in its entirety).

[0373] i. Lipidoid The synthesis of lipidoids has been extensively described, and formulations containing these compounds are particularly suitable for delivery of blocking agents of the invention, such as blocking agents comprising site-specific HNF4α targeting moieties, including nucleic acid molecules, e.g., modified nucleic acid molecules or mRNA (Mahon et al., Bioconjug Chem. 2010 21: 1448-1454; Schroeder et al., all of which are incorporated herein in their entireties). al., J Intern Med. 2010 267: 9-21; Akinc et al., Nat Biotechnol. 2008 26: 561-569; Love et al., Proc Natl Acad Sci USA. 201 0 107: 1864-1869; Siegwart et al., Proc Natl Acad Sci USA. 2011108: 12996-3001).

[0374] For example, lipidoids have been used to effectively deliver double-stranded small interfering RNA molecules, single-stranded nucleic acid molecules, modified nucleic acid molecules, or modified mRNA (see, for example, U.S. Patent Publication No. 2016 / 0038612A1). Complexes, micelles, liposomes, or particles containing these lipidoids can be prepared, thereby resulting in the effective delivery of site-specific HNF4α targeting components containing nucleic acid molecules, as determined by the production of encoded proteins after administration of the lipidoid formulation, for example, by local and / or systemic administration. The lipidoid complexes can be administered by various means, including, but not limited to, intravenous, intramuscular, intradermal, intraperitoneal, or subcutaneous routes.

[0375] For example, the in vivo delivery of site-specific HNF4α targeting components, including nucleic acid molecules, can be affected by many parameters, including but not limited to, formulation composition, particle PEGylation nature, loading degree, polynucleotide to lipid ratio, and biophysical parameters such as but not limited to, particle size (Akinc et al., Mol Ther. 2009 17: 872-879; its entirety is incorporated herein by reference).For example, small changes in the anchor chain length of poly(ethylene glycol) (PEG) lipid can have a significant effect on in vivo efficacy. Formulations with different lipidoids can be used, including, but not limited to, penta[3-(1-laurylaminopropionyl I)]-triethylenetetramine hydrochloride (TETA-5LAP; also known as 98NI2-5, see Murugaiah et al., Analytical Biochemistry, 401: 61 (2010), the entire contents of which are incorporated herein by reference), C12-200 (including derivatives and variants), and MD1.

[0376] In one embodiment, a blocking agent comprising a site-specific HNF4α targeting component comprising a nucleic acid molecule is formulated with lipidoid for systemic intravenous administration to target liver cells. For example, a final optimized intravenous formulation comprising a blocking agent comprising a site-specific HNF4α targeting component comprising a nucleic acid molecule and a lipid with a molar composition of 42% 98NI2-5, 48% cholesterol, and 10% PEG-lipid, with a total lipid to nucleic acid molecule weight ratio of about 7.5:1, the alkyl chain length on the PEG lipid is C14, and the average particle size is approximately 50-60 nm, can achieve distribution of more than 90% of the formulation to the liver (see Akinc et al., Mol Ther. 2009 17: 872-879, the entire contents of which are incorporated herein by reference). In another example, an intravenous formulation using C12-200 lipidoid (see, e.g., PCT Publication No. WO2010 / 129709, incorporated herein by reference in its entirety) having a molar ratio of C12-200 / disteroylphosphatidylcholine / cholesterol / PEG-DMG of 50 / 10 / 38.5 / 1.5, a total lipid to nucleic acid molecule weight ratio of 7:1, and an average particle size of 80 nm can be used to deliver a blocking agent comprising a site-specific HNF4α targeting component comprising a nucleic acid molecule to hepatocytes (Love et al., Proc Natl Acad Sci USA, the entire contents of which are incorporated herein by reference). 2010 107: 1864-1869). In another embodiment, a formulation containing MD1 lipidoid can be used to effectively deliver a blocking agent containing a site-specific HNF4α targeting component, including a nucleic acid molecule, to hepatocytes in vivo. The characteristics of optimized lipidoid formulations for intramuscular or subcutaneous routes can vary significantly depending on the target cell type and the formulation's ability to diffuse through the extracellular matrix into the bloodstream. For effective delivery to hepatocytes, a particle size of less than 150 nm may be desirable due to the size of the endothelial fenestra (see Akinc et al., Mol Ther. 2009 17: 872-879, the entire contents of which are incorporated herein by reference), although the use of lipidoid-formulated nucleic acid molecules to deliver formulations to other cell types, including, but not limited to, endothelial cells, myeloid cells, and muscle cells, may not be similarly size-limited. The use of lipidoid preparations has been reported for the delivery of siRNA to other non-hepatic cells, such as myeloid cells and endothelial cells in vivo (see Akinc et al., Nat Biotechnol. 200826: 561-569; Leuschner et al., Nat Biotechnol. 2011 29: 1005-101 0; Cho et al. Adv. Funct. Mater. 2009 19: 3112-3118; 8th International Judah Folkman Conference, Cambridge, Mass. Oct. 8-9, 2010, the entire contents of each of which are incorporated herein by reference).For delivery to myeloid cells, such as monocytes, lipidoid preparations can have the same molar ratio of components. Different ratios of lipidoid and other components, including but not limited to, disteroylphosphatidylcholine, cholesterol and PEG-DMG, can be used to optimize the formulation for delivery to different cell types, including but not limited to, hepatocytes, myeloid cells, muscle cells, etc.For example, component molar ratios can include, but are not limited to, 50% CI2-200, 10% disteroylphosphatidylcholine, 38.5% cholesterol, and 1.5% PEG-DMG (see Leuschner et al., Nat Biotechnol 2011 29: 1005-1010, the entire contents of which are incorporated herein by reference). When using lipidoid formulations for localized delivery to cells (such as, but not limited to, fat cells and muscle cells) via either subcutaneous, intradermal, or intramuscular delivery, not all of the components of the desired formulation may be required for systemic delivery, and thus may include only a lipidoid and a blocking agent, including a site-specific HNF4α targeting component, such as a nucleic acid molecule, as described herein.

[0377] Combinations of different lipidoids can be used to improve the efficacy of the formulation by increasing cell transfection and / or translation of the encoded protein contained therein (see Whitehead et al., Mol. Ther. 2011, 19: 1688-1694, the entire contents of which are incorporated herein by reference).

[0378] In one embodiment, the lipidoid can be prepared by the conjugate addition of an alklamine to an acrylate. As a non-limiting example, the lipidoid can be prepared by the method described in PCT Patent Application Publication No. WO2014 / 028487, the entire contents of which are incorporated herein by reference. In one embodiment, the lipidoid can include a compound having Formula (I), Formula (II), Formula (III), Formula (IV), or Formula (V), as described in PCT Patent Application Publication No. WO2014 / 028487, the entire contents of which are incorporated herein by reference. In one embodiment, the lipidoid can be biodegradable.

[0379] ii. Liposomes, lipoplexes, and lipid nanoparticles The blocking agents of the present invention can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. In one embodiment, the pharmaceutical composition of the present invention comprises liposomes. Liposomes are artificially prepared vesicles composed primarily of lipid bilayers and can be used as delivery vehicles for administering nutrients and pharmaceutical formulations. Liposomes can vary in size, including, but not limited to, multilamellar vesicles (MLVs), which can be hundreds of nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments; small unicellular vesicles (SUVs), which can be smaller than 50 nm in diameter; and large unilamellar vesicles (LUVs), which can be between 50 and 500 nm in diameter. Liposome designs can include, but are not limited to, opsonins or ligands to improve liposome attachment to unhealthy tissues or to activate events such as, but not limited to, endocytosis. Liposomes can contain a low or high pH to improve delivery of pharmaceutical formulations. Liposome formation may depend on, but is not limited to, the physicochemical characteristics of the encapsulated pharmaceutical agent and liposome components, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the encapsulated substance and its potential toxicity, any additional processes involved in the application and / or delivery of the vesicles, optimization of the size, polydispersity and shelf life of the vesicles for the intended application, and the possibility of batch-to-batch reproducibility and safe and efficient large-scale production of the liposome product.

[0380] By way of non-limiting example, liposomes, such as synthetic membrane vesicles, can be prepared by the methods, instruments, and devices described in U.S. Patent Application Publication Nos. 2013 / 0177638, 2013 / 0177637, 2013 / 0177636, 201 / 30177635, 2013 / 0177634, 2013 / 0177633, 2013 / 0183375, 2013 / 0183373, 2013 / 0183372, and 2016 / 0038612, the entire contents of each of which are incorporated herein by reference, and PCT Patent Application Publication No. WO2008 / 042973.

[0381] In one embodiment, the pharmaceutical compositions described herein may include, without limitation, liposomes capable of delivering small molecule drugs, such as those formed from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; incorporated herein by reference in its entirety), and DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).In one embodiment, the pharmaceutical compositions described herein can include, without limitation, liposomes such as those formed by the synthesis of stabilized plasmid-lipid particles (SPLPs) or stabilized nucleic acid-lipid particles (SNALPs), which have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (Wheeler et al. Gene Therapy. 1999 6: 271-281; ​​Zhang et al. Gene Therapy. 19996: 1438-1447; Jeffs et al. Pharm Res. 2005 22: 362-372; Morrissey et al., Nat Biotechnol. 2005 2: 1002-1007; Zimmermann et al., Nature. 2006 441: 111-114; Heyes et al. J Contr Rel. 2005 107, each of which is incorporated herein in its entirety). (See, for example, Semple et al. Nature Biotech. 2010 28: 172-176; Judge et al. J Clin Invest. 2009 119: 661-673; deFougerolles Hum Gene Ther. 2008 19: 125-132; U.S. Patent Application Publication Nos. 2013 / 0122104, 2013 / 0303587, and 2016 / 0038612.) The original manufacturing method by Wheeler et al. was a detergent dialysis method, which was later improved by Jeffs et al. and is referred to as the spontaneous vesicle formation method. The liposome formulations of the present invention may be composed of three to four lipid components in addition to a blocking agent containing a site-specific HNF4α targeting component. By way of example, and not limitation, liposomes of the present invention may contain 55% cholesterol, 20% disteroylphosphatidylcholine (DSPC), 10% PEG-SDSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al.As another example, a liposome formulation of the present invention may contain, but is not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, as described by Heyes et al., where the cationic lipid may be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA). In some embodiments, the liposome formulation may contain about 25.0% cholesterol to about 40.0% cholesterol, about 30.0% cholesterol to about 45.0% cholesterol, about 35.0% cholesterol to about 50.0% cholesterol, and / or about 48.5% cholesterol to about 60% cholesterol. In another embodiment, the formulations of the present invention may contain a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, and 43.5%. In some embodiments, the liposome formulations of the present invention may contain about 5.0% to about 10.0% DSPC and / or about 7.0% to about 15.0% DSPC.

[0382] In one embodiment, the pharmaceutical composition may comprise liposomes that can be formed to deliver the blocking agent of the present invention. The blocking agent, including the site-specific HNF4α targeting component, can be encapsulated in the liposome and / or can be contained in an aqueous core that can be encapsulated in the liposome (see, for example, PCT Patent Application Publication Nos. WO2012 / 031046, WO2012 / 031043, WO2012 / 030901, and WO2012 / 006378, and U.S. Patent Application Publication Nos. 2013 / 0189351, 2013 / 0195969, and 201 / 30202684, the contents of each of which are incorporated herein by reference in their entirety).

[0383] In another embodiment, the liposome for use in the present invention can be formulated for targeted delivery.For example, the liposome can be formulated for targeted delivery to the liver.Such liposome can include but is not limited to the liposome described in US Patent Application Publication No. 2013 / 0195967, the entirety of which is incorporated herein by reference.

[0384] In one embodiment, the formulation comprising the liposome and blocking agent can be administered intramuscularly, intradermally, or intravenously.

[0385] In another embodiment, the lipid formulation of the present invention may comprise at least one cationic lipid, a transfection-enhancing lipid, and at least one lipid containing a hydrophilic head group linked to the lipid moiety (International Patent Publication No. WO2011076807 and US Patent Application Publication No. 20110200582; the contents of each are incorporated herein by reference in their entirety). In another embodiment, the lipid formulation of the present invention is a lipid vesicle that may have crosslinks between functionalized lipid bilayers (see US Patent Application Publication No. 2012 / 0177724, the contents of which are incorporated herein by reference in their entirety).

[0386] In one embodiment, the formulation containing the blocking agent is a lipid nanoparticle (LNP), which may contain at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98NI2-5, CI2-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and aminoalcohol lipids. In another embodiment, the lipid may be a cationic lipid, such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and aminoalcohol lipids. The aminoalcohol cationic lipid may be a lipid described in U.S. Patent Application Publication No. 2013 / 0150625 and / or may be prepared by the method described therein.

[0387] In one embodiment, the cationic lipids are those disclosed in PCT Publication Nos. WO2012 / 040184, WO2011 / 153120, WO2011 / 149733, WO2011 / 090965, WO2011 / 043913, WO2011 / 022460, WO2012 / 061259, WO2012 / 054365, WO2012 / 044638, WO2010 / 080724, WO2010 / 21865, WO2008 / 103276 ...90965, WO2011 / 090965, WO201 The cationic lipids may be selected from those described in WO2013 / 086373 and WO2013 / 086354, U.S. Patent Nos. 7,893,302, 7,404,969, 8,283,333, 8,466,122 and 8,569,256, and U.S. Patent Application Publication Nos. 2010 / 0036115, 2012 / 0202871, 2013 / 0064894, 2013 / 0129785, 2013 / 0150625, 2013 / 0178541, 2013 / 0225836 and 2014 / 0039032. In another embodiment, the cationic lipid can be selected from Formula A, including but not limited to, those described in PCT Publication Nos. WO2012 / 040184, WO0111 / 53120, WO2011 / 149733, WO2011 / 090965, WO2011 / 043913, WO2011 / 022460, WO2012 / 061259, WO2012 / 054365, WO2012 / 044638, and WO2013 / 116126, or U.S. Patent Application Publication Nos. 2013 / 0178541 and 2013 / 0225836, the contents of each of which are incorporated by reference in their entirety.In yet another embodiment, the cationic lipid can be selected from, but is not limited to, formulas CLI-CLXXIX of PCT Publication No. WO2008 / 103276, formula CLICLXXIX of U.S. Pat. No. 7,893,302, formula CLICLXXXXII of U.S. Pat. No. 7,404,969, and formulas I-VI of U.S. Patent Application Publication No. 2010 / 0036115, and formula I of U.S. Patent Application Publication No. 2013 / 0123338, each of which is incorporated by reference in its entirety.

[0388] In one embodiment, the cationic lipids may be prepared by methods known in the art and / or by methods described in PCT Publication Nos. WO2012 / 040184, WO2011 / 153120, WO2011 / 149733, WO2011 / 090965, WO2011 / 043913, WO2011 / 0 22460, WO2012 / 061259, WO2012 / 054365, WO2012 / 044638, WO2010 / 080724, WO2010 / 21865, WO2013 / 126803, WO2013 / 086373, and WO2013 / 086354.

[0389] In one embodiment, the lipid that can be used for formulating and / or delivering the blocking agent described herein can be cleavable lipid.Non-limiting examples include cleavable lipids and / or pharmaceutical compositions comprising cleavable lipids, which are described in PCT Patent Application Publication No. WO2012 / 170889, the entire contents of which are incorporated herein by reference.In another non-limiting example, cleavable lipids can be HGT4001, HGT4002, HGT4003, HGT4004 and / or HGT4005, which are described in PCT Patent Application Publication No. WO2012 / 170889, the entire contents of which are incorporated herein by reference.

[0390] In one embodiment, polymers that can be used to formulate and / or deliver the blocking agents described herein include, but are not limited to, poly(ethylene) glycol (PEG), polyethyleneimine (PEI), dithiobis(succinimidyl propionate) (DSP), dimethyl-3,3'-dithiobispropionimidate (DTBP), poly(ethyleneimine) biscarbamate (PEIC), poly(L-lysine) (PLL), histidine-modified PLL, poly(N-vinylpyrrolidone (vin Poly(hydroxypropylpyrrohdone) (PVP), poly(propylenimine) (PPI), poly(amidoamine) (PAMAM), poly(amidoethylenimine) (SS-PAEI), triethylenetetramine (TETA), poly(β-amino ester), poly(4-hydroxy-L-proline ester) (PHP), poly(allylamine), poly(α-[4-aminobutyl]-L-glycolic acid) (PAGA), poly(D,L-lactic acid copolymer (PLGA)) ), poly(N-ethyl-4-vinylpyridinium bromide), poly(phosphazene) (PPZ), poly(phosphate ester) (PPE), poly(phosphoramidate) (PPA), poly(N-2-hydroxypropyl methacrylamide) (pHPMA), poly(2-(dimethylamino)ethyl methacrylate) (pDMAEMA), poly(2-aminoethylpropylene phosphate) (PPE_EA), chitosan, galactosylated chitosan, N-dodecylated chitosan, histone, collagen, and dextran. Examples of suitable polymers include permine. In one embodiment, the polymer may be an inert polymer such as, but not limited to, PEG. In one embodiment, the polymer may be a cationic polymer such as, but not limited to, PEI, PLL, TETA, poly(allylamine), poly(N-ethyl-4-vinylpyridinium bromide), pHPMA, and pDMAEMA. In one embodiment, the polymer may be a biodegradable polymer such as, but not limited to, DSP, DTBP, and PEIC.In one embodiment, the polymer may be biodegradable, including but not limited to, histine-modified PLL SSPAEI, poly(β-amino ester), PHP, PAGA, PLGA, PPZ, PPE, PPA, and PPE-EA.

[0391] In one embodiment, the LNP formulations of the present invention can be prepared according to the methods described in PCT Publication No. WO2011 / 127255 or PCT Publication No. WO2008 / 103276, the entire contents of each of which are incorporated herein by reference. As a non-limiting example, a blocking agent comprising a site-specific HNF4α targeting component can be encapsulated in an LNP formulation as described in PCT Publication No. WO2011 / 127255 and / or PCT Publication No. WO2008 / 103276, the entire contents of each of which are incorporated herein by reference. As another non-limiting example, a blocking agent comprising a site-specific HNF4α targeting component described herein can be formulated as nanoparticles delivered by parenteral routes, as described in U.S. Patent Application Publication No. 2012 / 0207845 and PCT Publication No. WO2014 / 008334, the entire contents of each of which are incorporated herein by reference.

[0392] In one embodiment, the LNP formulations described herein can be administered intramuscularly. The LNP formulations can include cationic lipids described herein, such as, but not limited to, DLin-DMA, DLin-KC2-DMA, DLin-MC3-DMA, DODMA, and C12-200.

[0393] In one embodiment, the LNP formulations described herein containing a blocking agent described herein can be administered intradermally. The LNP formulations can include cationic lipids described herein, such as, but not limited to, DLin-DMA, DLin-KC2-DMA, DLin-MC3-DMA, DODMA, and C12-200.

[0394] Nanoparticle formulations may include conjugates such as phosphate conjugates, polymer conjugates, conjugates that enhance delivery of nanoparticles, etc., as described in U.S. Patent Application Publication No. US20160038612A1.

[0395] In one embodiment, the lipid nanoparticle formulation comprises DLin-MC3-DMA, which is described in US Patent Application Publication No. US20100324120.

[0396] In one embodiment, the lipid nanoparticles are prepared using methods described in U.S. Pat. No. US10723692B2, U.S. Patent Application Publication Nos. US20200172472A1, US20200163878A1, US20200046838A1, US20190359556A1, US20190314524A1, US20190274968A1, US20190022247A1, US20180303925A1, and US20190359556A1, the contents of each of which are incorporated herein by reference in their entirety. No. 0180185516A1, No. US20160317676A1, International Patent Publication Nos. WO20200146805A1, WO2020081938A1, WO2019089828A1, WO2019036030A1, WO2019036028A1, WO2019036008A1, WO2018200943A1, WO2018191719A1, WO2018107026A1, WO2018081480A1 (Acuitas The present invention also includes lipid compounds described in US Pat. No. 6,139,999, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, or lipid nanoparticle formulations thereof, as described in US Pat. No. 6,139,999, or a pharmaceutically acceptable salt, tautomer or stereoisomer ... or a lipid nanoparticle formulation thereof.

[0397] In one embodiment, the lipid nanoparticles are commercially available from Tekmira Pharmaceuticals and US Patent Application Publication No. US20110117125A1, the entire contents of each of which are incorporated herein by reference. In one particular example, the compound described in US9139554B2 is DLin-kC2-DMA.

[0398] In one embodiment, the lipid nanoparticles comprise an amino lipid, or a pharmaceutically acceptable salt, tautomer or stereoisomer, or lipid nanoparticle formulation thereof, as described in US10561732B2, US9938236B2, US9687550B2, U.S. Patent Application Publication Nos. US20190240354A1, US20170027658A1, WO2020097493A1, WO2020097520A1, WO2020097540A1, WO2020097548A1, by Arbutus Biopharma Corp., the entire contents of each of which are incorporated herein by reference.

[0399] Lipid nanoparticles can be engineered to alter their surface properties to allow them to penetrate mucosal barriers. Mucus is found in mucosal tissues, including, but not limited to, the oral cavity (e.g., the membranes of the cheeks and esophagus and tonsillar tissue), eyes, gastrointestinal (e.g., the stomach, small intestine, large intestine, colon, and rectum), nasal, respiratory (e.g., membranes of the nose, pharynx, trachea, and bronchi), and reproductive (e.g., membranes of the vagina, cervix, and urethra). Nanoparticles larger than 10-200 nm, which are preferred for their ability to provide higher drug encapsulation efficiency and sustained delivery for a wide range of drugs, are considered too large to rapidly diffuse through mucosal barriers. Mucus is constantly secreted, excreted, discarded, or digested and recycled; therefore, the majority of trapped particles can be removed from mucosal tissue within seconds or hours. Large polymer nanoparticles (200-500 nm diameter) densely coated with low-molecular-weight polyethylene glycol (PEG) diffused through mucus only 4-6 times slower than the same particles diffused in water (Lai et al. PNAS 2007 104(5): 1482-487; Lai et al. Adv Drug Deliv Rev. 2009 61(2): 158-171; the entire contents of each are incorporated herein by reference). Nanoparticle transport can be determined using permeation kinetics and / or fluorescence microscopy techniques, including, but not limited to, fluorescence recovery after photobleaching (FRAP) and high-resolution multiparticle tracking (MPT). As a non-limiting example, compositions capable of penetrating mucosal barriers can be prepared as described in U.S. Pat. No. 8,241,670 or International Patent Publication No. WO2013110028, the entire contents of each of which are incorporated herein by reference.

[0400] In one embodiment, blocking agents comprising site-specific HNF4α targeting components described herein are formulated as lipoplexes, including, but not limited to, the ATUPLEX™ system, DACC system, DBTC system and other siRNA lipoplex technologies from Silence Therapeutics (London, United Kingdom), STEMFECFM from STEMGENT® (Cambridge, Mass.), and targeted and non-targeted delivery of polyethylenimine (PEI) or protamine-based nucleic acids (nucleic acids) (Aleku et al. Cancer Res. 2008 68: 9788-9798; Strumberg et al. Int J Clin Pharmacol Ther. 2012 50: 76-78;Santel et al., Gene Ther 2006 13: 1222-1234;Santel et al., Gene Ther 200613: 1360-1370;Gutbier et al., PulmPharmacol. Ther. 201023: 334-344;Kaufmann et al. Microvasc Res 2010 80: 286-293;Weide et al. J Immunother. 2009 32: 498-507;Weide et al. J Immunother. 2008 31: 180-188;Pascolo Expert Opin. Biol. Ther. 4: 1285-1294;Fotin-Mleczek et al., 2011 J. Immunother. 34: 1-15;Song et al., Nature Biotechnol. 2005, 23: 709-717; Peer et al., Proc NatlAcad Sci USA. 2007 6; 104: 4095-4100; deFougerolles Hum Gene Ther. 2008 19: 125-132; all incorporated herein by reference in their entireties).

[0401] In one embodiment, such formulations can also be constructed or modified to passively or actively target different cell types in vivo, including, but not limited to, hepatocytes, immune cells, tumor cells, endothelial cells, antigen-presenting cells, and leukocytes (Akinc et al. Mol Ther. 2010 18: 1357-1364; Song et al., Nat Biotechnol. 2005 23: 709-717; Judge et al., J Clinlnvest. 2009 119: 661-673; Kaufmann et al., Microvasc Res 2010 80: 286-293; Santel et al., Gene Ther 200613: 1222-1234;Santel et al., Gene Ther 2006 13: 1360-1370;Gutbier et al., Pulm Pharmacol. Ther. 2010 23: 334-344;Basha et al., Mol. Ther. 2011 19: 2186-2200;Fenske and Cullis, Expert Opin Drug Deliv. 20085: 25-44;Peer et al., Science. 2008 319: 627-630; Peer and Lieberman, Gene Ther. 2011 18: 1127-1133; all of which are incorporated herein by reference in their entirety). One example of passive targeting of formulations to hepatocytes includes lipid nanoparticle formulations based on DLin-DMA, DLin-KC2-DMA and DLin-MC3-DMA, which have been shown to bind to apolipoprotein E and promote the binding and uptake of these formulations into hepatocytes in vivo (Akinc et al. Mol Ther. 2010 18: 1357-1364; the entire contents of which are incorporated herein by reference). Formulations can also be selectively targeted by expressing different ligands on the surface, exemplified by, but not limited to, folate, transferrin, N-acetylgalactosamine (GaINAc), and antibody targeting approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8: 197-206;Musacchio and Torchilin, Front Biosci. 201116: 1388-1412;Yu et al., Mol Membr BioI. 2010 27: 286-298;Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25: 1-61;Benoit et al., Biomacromolecules. 2011 12: 2708-2714;Zhao et al., Expert Opin Drug Deliv. 2008 5: 309-319;Akinc et al., Mol Ther. 2010 18: 1357-1364;Srinivasan et al., Methods Mol BioI. 2012 820: 105-116;Ben-Arie et al., Methods Mol Biol. 2012 757: 497-507;Peer 2010 J Control Release. 20: 63-68; Peer et al., Proc Natl Acad Sci USA. 2007 104: 4095-4100; Kim et al., Methods Mol Biol. 2011 721: 339-353; Subramanya et al., Mol Ther. 2010 18: 2028-2037; Song et al., Nat Biotechnol. 2005 23: 709-717; Peer et al., Science. 2008 319: 627-630; Peer and Lieberman, Gene Ther. 2011 18: 1127-1133; all of which are incorporated herein by reference in their entireties).

[0402] In one embodiment, the blocking agent containing the site-specific HNF4α targeting component of the present invention can be formulated as a solid lipid nanoparticle. The solid lipid nanoparticle (SLN) can be spherical with an average diameter between 10 nm and 1000 nm. The SLN has a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized using surfactants and / or emulsifiers. In a further embodiment, the lipid nanoparticle can be a self-assembled lipid-polymer nanoparticle (see Zhang et al., ACS Nano, 2008, 2 (8), pp. 1696-1702, the entire contents of which are incorporated herein by reference). As a non-limiting example, the SLN can be the SLN described in PCT Publication No. WO2013 / 105101, the entire contents of which are incorporated herein by reference. As another non-limiting example, the SLN can be prepared by the method or process described in PCT Publication No. WO2013 / 105101, the entire contents of which are incorporated herein by reference.

[0403] Because liposomes, lipoplexes, or lipid nanoparticles can increase cell transfection with nucleic acid molecules and / or increase translation of the encoded protein (e.g., the effector of the present invention), these formulations can be used to improve the efficacy of blocking agents containing site-specific HNF4α targeting components containing nucleic acid molecules to direct protein production. One such example involves the use of lipid encapsulation, which enables effective systemic delivery of polyplexed plasmid DNA (Heyes et al., Mol Ther. 2007 15: 713-720; the entire contents of which are incorporated herein by reference). The liposomes, lipoplexes, or lipid nanoparticles of the present invention can also increase the stability of blocking agents containing site-specific HNF4α targeting components containing nucleic acid molecules. Liposomes, lipoplexes, or lipid nanoparticles are described in U.S. Patent Application Publication No. 2016 / 0038612, the entire contents of which are incorporated herein by reference.

[0404] In one embodiment, a blocking agent comprising a site-specific HNF4α targeting component can be formulated for controlled release and / or targeted delivery. As used herein, "controlled release" refers to a pharmaceutical composition or compound release profile that follows a specific release pattern to produce a therapeutic outcome. In one embodiment, a blocking agent comprising a site-specific HNF4α targeting component described herein can be encapsulated with a delivery agent described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term "encapsulate" means to enclose, surround, or encase. When it comes to formulating the compounds of the present invention, encapsulation can be substantial, complete, or partial. The term "substantially encapsulated" means that at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9%, at least 99.9%, or at least 99.999% of the pharmaceutical composition or blocking agent of the present invention may be encapsulated, surrounded, or enclosed within the delivery agent. "Partial encapsulation" or "partially encapsulated" means that less than 10%, less than 10%, less than 20%, less than 30%, less than 40%, less than 50%, or less of the pharmaceutical composition or blocking agent of the present invention may be encapsulated, surrounded, or enclosed within the delivery agent. Advantageously, encapsulation can be determined by measuring escape or activity of the pharmaceutical composition or compound of the present invention using fluorescence and / or electron microscopy. For example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or greater than 99.99% of the pharmaceutical composition or blocking agent of the present invention is encapsulated in the delivery agent.

[0405] In one embodiment, blocking agents comprising site-specific HNF4α targeting moieties, including those described herein, can be encapsulated in therapeutic nanoparticles (e.g., therapeutic nanoparticles from BIND Therapeutics). Therapeutic nanoparticles include those described in, but not limited to, PCT Publication Nos. WO2010 / 005740, WO2010 / 030763, WO2010 / 005721, WO2010 / 005723, WO2012 / 054923, U.S. Pat. No. 6,229,114, the entire contents of each of which are incorporated herein by reference; Patent application publication numbers 2201 / 10262491, 2010 / 0104645, 2010 / 0087337, 2010 / 0068285, 2011 / 0274759, 2010 / 0068286, 2012 / 0288541, 2013 / 0123351, 2013 / 0 and 2013 / 0251757, and U.S. Patent Nos. 8,206,747, 8,293,276, 8,318,208, 8,318,211, 8,623,417, 8,617,608, 8,613,954, 8,613,951, 8,609,142, 8,603,534, and 8,563,041. In another embodiment, therapeutic polymeric nanoparticles can be prepared by the methods described in U.S. Patent Application Publication No. 2012 / 0140790, the entire contents of which are incorporated herein by reference. As a non-limiting example, therapeutic nanoparticles can comprise about 4 to about 25 weight percent of a blocking agent and about 10 to about 99 weight percent of a diblock poly(lactic acid)-poly(ethylene) glycol copolymer comprising poly(lactic acid), as described in U.S. Patent Application Publication No. 2013 / 0236500 (Bind), the entire contents of which are incorporated herein by reference.As another non-limiting example, the nanoparticles can comprise about 0.2 to about 35 weight percent of a blocking agent and about 10 to about 99 weight percent of a diblock poly(lactic acid)-poly(ethylene) glycol copolymer, as described in U.S. Patent Application Publication Nos. 2013 / 0280339 (Bind) and 2010251757 and U.S. Patent No. 8,652,528, the contents of each of which are incorporated herein by reference in their entirety.

[0406] In one embodiment, the blocking agent formulated as a therapeutic nanoparticle can be administered intramuscularly, intrademrally, or intravenously.

[0407] In one embodiment, the blocking agent formulated as ACCURINS™ nanoparticles can be administered intramuscularly, intrademrally, or intravenously.

[0408] In one embodiment, the blocking agent can be delivered as a therapeutic nanoparticle with a high glass transition temperature, such as, but not limited to, the nanoparticles described in U.S. Patent Application Publication Nos. 2014 / 0030351 and 2011 / 0294717, the contents of each of which are incorporated by reference herein in their entirety.

[0409] In one embodiment, therapeutic nanoparticles can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that follows a release rate over a specific period of time. The period can include, but is not limited to, hours, days, weeks, months, and years. As a non-limiting example, sustained release nanoparticles can include the polymers and blocking agents of the present invention (see PCT Publication No. WO2010075072 and U.S. Patent Application Publication Nos. 2010 / 0216804, 2011 / 0217377, 2012 / 0201859, 2013 / 0243848, and 2013 / 0243827, each of which is incorporated herein by reference in its entirety).

[0410] In one embodiment, the blocking agents of the present invention can be encapsulated, linked to, and / or associated with synthetic nanocarriers, including, but not limited to, those disclosed in PCT Publication Nos. WO2010 / 005740, WO2010 / 030763, WO2012 / 13501, WO2012 / 149252, WO2012149255, WO2012149259, WO2012149265, WO2012149268, WO2012149282, and WO2012149292, each of which is incorporated by reference in its entirety. Examples include those described in WO2012149301, WO2012149393, WO2012149405, WO2012149411, and WO2012149454, as well as U.S. Patent Application Publication Nos. 20110262491, 20100104645, 20100087337, 20120244222, and US20130236533, and U.S. Patent No. 8,652,487. Synthetic nanocarriers can be formulated using methods known in the art and / or described herein. As a non-limiting example, synthetic nanocarriers can be formulated by the methods described in PCT Publication Nos. WO2010005740, WO2010030763, and WO201213501, and U.S. Patent Application Publication Nos. 20110262491, 20100104645, 20100087337, and 20120244222, each of which is incorporated herein by reference in its entirety. In another embodiment, synthetic nanocarrier formulations can be lyophilized by the methods described in PCT Publication No. WO2011072218 and U.S. Patent No. 8,211,473, the contents of each of which are incorporated herein by reference in their entirety. In yet another embodiment, formulations of the present invention, including but not limited to synthetic nanocarriers, can be lyophilized or reconstituted by the methods described in U.S. Patent Application Publication No. 20130230568, the contents of which are incorporated herein by reference in their entirety.

[0411] In one embodiment, the synthetic nanocarriers comprising the blocking agent may be administered intramuscularly, intradermally, or intravenously.

[0412] In some embodiments, the blocking agent can be formulated for delivery using smaller LNPs. Such particles can range from less than 0.1 μm up to 1000 μm, for example, but not limited to, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 μm, less than 60 μm, less than 65 μm, less than 70 μm, less than 75 μm, less than 80 μm, less than 85 μm, less than 90 μm, less than 95 μm, less than 100 μm, less than 125 μm, less than 150 μm, less than 175 μm, less than 200 μm, less than 225 μm, less than 250 μm. Diameters may include less than 275 μm, less than 300 μm, less than 325 μm, less than 350 μm, less than 375 μm, less than 400 μm, less than 425 μm, less than 450 μm, less than 475 μm, less than 500 μm, less than 525 μm, less than 550 μm, less than 575 μm, less than 600 μm, less than 625 μm, less than 650 μm, less than 675 μm, less than 700 μm, less than 725 μm, less than 750 μm, less than 775 μm, less than 800 μm, less than 825 μm, less than 850 μm, less than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm, and less than 975 μm.

[0413] In another embodiment, the blocking agent is from about 1 nm to about 100 nm, from about 1 nm to about 10 nm, from about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about 100 nm (from about 5 nm to about 100 nm), about 5 nm to about 10 nm, about 5 nm to about 20 nm, about 5 nm to about 30 nm, about 5 nm to about 40 nm, about 5 nm to about 50 nm, about 5 nm to about 60 nm, about 5 nm to about 70 nm, about 5 nm to about 80 nm, about 5 nm to about 90 nm, about 10 nm to about 50 nm, about 20 nm to about 50 nm, about 30 nm to about 50 nm, about 40 nm to about 50 nm, about 20 nm to about 60 nm, about 30 nm to about 60 nm, about 40 nm to about 60 nm, about 20 nm to about 70 nm, about 30 nm to about Smaller LNPs can be formulated for delivery using smaller LNPs that may comprise diameters of up to 70 nm, about 40 nm to about 70 nm, about 50 nm to about 70 nm, about 60 nm to about 70 nm, about 20 nm to about 80 nm, about 30 nm to about 80 nm, about 40 nm to about 80 nm, about 50 nm to about 80 nm, about 60 nm to about 80 nm, about 20 nm to about 90 nm, about 30 nm to about 90 nm, about 40 nm to about 90 nm, about 50 nm to about 90 nm, about 60 nm to about 90 nm and / or about 70 nm to about 90 nm.

[0414] In one embodiment, the blocking agent can be formulated as smaller LNPs and administered intramuscularly, intrademrally, or intravenously.

[0415] In one embodiment, the blocking agents can be formulated for delivery using drug-encapsulated microspheres as described in PCT Patent Application Publication No. WO2013063468 or U.S. Patent No. 8,440,614, each of which is incorporated herein by reference in its entirety. In another aspect, amino acids, peptides, polypeptides, lipids (APPLs) are useful in delivering the blocking agents of the invention to cells (see PCT Patent Application Publication No. WO2013063468, which is incorporated herein by reference in its entirety).

[0416] In one embodiment, the lipid nanoparticles may be the critical size lipid nanoparticles described in PCT Patent Application Publication No. WO2013059922, the entirety of which is incorporated herein by reference. Critical size lipid nanoparticles may comprise a lipid bilayer surrounding an aqueous or hydrophobic core; the lipid bilayer may comprise phospholipids such as, but not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, cerebroside, C8-C20 fatty acid diacylphosphatidylcholine, and 1-palmitoyl-2-oleoylphosphatidylcholine (POPC). In another embodiment, the critical size lipid nanoparticles may comprise polyethylene glycol-lipids such as, but not limited to, DLPEPEG, DMPE-PEG, DPPC-PEG, and DSPE-PEG.

[0417] In one embodiment, the blocking agent of the present invention can be delivered, localized, and / or concentrated at a specific location using the delivery method described in PCT Patent Application Publication No. WO2013063530, the entire contents of which are incorporated herein by reference. As a non-limiting example, empty polymer particles can be administered to a subject before, simultaneously with, or after delivery of a blocking agent to the subject. Upon contact with the subject, the empty polymer particles change volume and become lodged, embedded, fixed, or encapsulated at a specific location in the subject.

[0418] In one embodiment, the blocking agent can be formulated as an active agent release system (see, e.g., U.S. Patent Application Publication No. 20130102545, which is incorporated herein by reference in its entirety). The active agent release system can include a compound conjugated to 1) at least one nanoparticle coupled to an oligonucleotide inhibitor strand that hybridizes to a catalytically active nucleic acid, and 2) at least one substrate molecule coupled to a therapeutically active agent (e.g., a blocking agent of the invention), wherein cleavage of the substrate molecule by the catalytically active nucleic acid releases the therapeutically active agent.

[0419] In one embodiment, the nanoparticles of the present invention may be water-soluble nanoparticles, such as, but not limited to, those described in PCT Publication No. WO2013090601, the entire contents of which are incorporated herein by reference. The nanoparticles may be inorganic nanoparticles with compact zwitterionic ligands to exhibit good water solubility. The nanoparticles may also have a small hydrodynamic diameter (HD), stability over time, pH, and salinity, and low levels of nonspecific protein binding.

[0420] In one embodiment, the nanoparticles of the present invention are stealth nanoparticles or target-specific stealth nanoparticles, such as, but not limited to, those described in U.S. Patent Application Publication Nos. 20130172406 (Bind), 20130251817 (Bind), 2013251816 (Bind), and 20130251766 (Bind), the entire contents of each of which are incorporated herein by reference. The stealth nanoparticles may comprise a diblock copolymer and a chemotherapeutic agent. These stealth nanoparticles can be made by the methods described in U.S. Patent Application Publication Nos. 20130172406, 20130251817, 2013251816, and 20130251766, the entire contents of each of which are incorporated herein by reference. As a non-limiting example, stealth nanoparticles can be targeted to cancer cells, such as the nanoparticles described in U.S. Patent Application Publication Nos. 20130172406, 20130251817, 2013251816, and 20130251766, the entire contents of each of which are incorporated herein by reference.

[0421] In one embodiment, stealth nanoparticles comprising a blocking agent of the present invention can be administered intramuscularly, intradermally, or intravenously.

[0422] In one embodiment, the blocking agent of the present invention can be formulated and / or delivered as lipid nanoparticles comprising multiple cationic lipids, such as, but not limited to, those described in U.S. Patent Application Publication No. 20130017223, the entire contents of which are incorporated herein by reference. As a non-limiting example, the LNP formulation can comprise a first cationic lipid and a second cationic lipid. As another non-limiting example, the LNP formulation can comprise DLin-MC2-DMA and DLinMC4-DMA. As yet another non-limiting example, the LNP formulation can comprise DLin-MC3-DMA and CI2-200. In one embodiment, LNP formulations comprising multiple cationic lipids (such as, but not limited to, those described in U.S. Patent Application Publication No. US20130017223, the entire contents of which are incorporated herein by reference) can be administered intramuscularly, intradermally, or intravenously.

[0423] In one embodiment, the blocking agents described herein can be formulated and / or delivered as lipid nanoparticles containing the cationic lipid DLin-MC3-DMA and the neutral lipid DOPE. The lipid nanoparticles may also contain a PEG-based lipid and cholesterol or an antioxidant. These lipid nanoparticle formulations containing DLin-MC3-DMA, DOPE, and a blocking agent can be administered intramuscularly, intradermally, or intravenously.

[0424] In one embodiment, lipid nanoparticles comprising DLin-MC3-DMA and DOPE may comprise PEG lipids such as, but not limited to, pentaerythritol PEG ester tetrasuccinimidyl and pentaerythritol PEG ether tetra-thiol, PEGc-DOMG, PEG-DMG (1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DSA (PEG coupled with 1,2-distearyloxypropyl-3-amine), PEG-DMA (PEG coupled with 1,2-dimyristyloxypropyl-3-amine), PEG-c-DNA, PEG-c-DMA, PEG-S-DSG, PEG-c-DMA, PEG-DPG, PEG-DMG 2000, and those described herein and / or known in the art.

[0425] In one embodiment, lipid nanoparticles comprising DLin-MC3-DMA and DOPE may contain PEG lipids at a lipid molar ratio of 0.5% to about 3.0%, about 1.0% to about 3.5%, about 1.5% to about 4.0%, about 2.0% to about 4.5%, about 2.5% to about 5.0%, and / or about 3.0% to about 6.0%.

[0426] In one embodiment, lipid nanoparticles comprising DLin-MC3-DMA and DOPE may contain 25.0% to about 50.0% cholesterol, about 30.0% to about 45.0% cholesterol, about 35.0% to about 50.0% cholesterol, and / or about 48.5% to about 60% cholesterol. In one embodiment, the formulation may contain a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, 43.5%, and 48.5%.

[0427] In one embodiment, lipid nanoparticles comprising DLin-MC3-DMA and DOPE may contain 25.0% antioxidant to about 50.0% antioxidant, about 30.0% antioxidant to about 45.0% antioxidant, about 35.0% antioxidant to about 50.0% antioxidant, and / or about 48.5% antioxidant to about 60% antioxidant. In one embodiment, the formulation may contain a percentage of antioxidant selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, 43.5%, and 48.5%.

[0428] The blocking agents of the present invention can be formulated using natural and / or synthetic polymers. Non-limiting examples of polymers that can be used for delivery include, but are not limited to, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena, Calif.) formulations from MIRUS® Bio (Madison, Wis.) and Roche Madison (Madison, Wis.), PHASERX™ polymer formulations such as, but not limited to, SMARTT POLYMER TECHNOLOGY™ (Seattle, Wash.), DMRIIDOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, Calif.), chitosan, cyclodextrins, dendrimers, and poly(lactic-co-glycolic acid) (PLGA) polymers from Calando Pharmaceuticals (Pasadena, Calif.), RONDEL™ (RNAi / Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corp., Pasadena, Calif.). Research Corporation, Pasadena, Calif.), and pH-responsive co-block polymers such as, but not limited to, PHASERX™ (Seattle, Wash.).

[0429] Polymer formulations can allow for sustained or delayed release of the blocking agent (e.g., after intramuscular, intradermal, or subcutaneous injection). Altering the release profile of the blocking agent can result in, for example, prolonged translation of the encoded protein. Polymer formulations can also be used to increase the stability of the blocking agent. For example, biodegradable polymers have previously been used to protect nucleic acids other than modified mRNA from degradation and have been shown to result in sustained release of the payload in vivo (Rozema et al., Proc Natl Acad Sci USA. 2007 104: 12982-12887;Sullivan et al., Expert Opin Drug Deliv. 2010 7: 1433-1446;Convertine et al., Biomacromolecules. 2010 Oct. 1;Chu et al., Acc Chern Res. 2012 Jan. 13;Manganiello et al., Biomaterials. 2012 33: 2301-2309;Benoit et al., Biomacromolecules. 2011 12: 2708-2714;Singha et al., Nucleic Acid Ther. 2011 2: 133-147;deFougerolles Hnm Gene Ther. 2008 19: 125-132;Schaffert and Wagner, Gene Ther. 2008 16: 1131-1138; Chaturvedi et al., Expert Opin Drug Deliv. 2011 8: 1455-1468; Davis, Mol Pharm. 2009 6: 659-668; Davis, Nature 201 0464: 1067-1070; each of which is incorporated herein by reference in its entirety).

[0430] In one embodiment, the pharmaceutical composition can be a sustained-release formulation. In a further embodiment, the sustained-release formulation can be for subcutaneous delivery. The sustained-release formulation can include, but is not limited to, PLGA microspheres, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, Fla.), HYLENEX® (Halozyme Therapeutics, San Diego, Calif.), surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, Ga.), TISSELL® (Baxter International, Inc. Deerfield, Ill.), PEG-based sealants, and COSEAL® (Baxter International, Inc. Deerfield, Ill.).

[0431] B. Site-specific HNF4α Blockers of the Invention Encoded by Vectors Blocking agents, including site-specific HNF4α targeting components, for example, nucleic acid molecules, can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12: 5-10; WO00 / 22113, WO00 / 22114, and US6,054,299). In some embodiments, expression persists (for several months or longer) depending on the particular construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative vectors. Transgenes can also be constructed to be inherited as extrachromosomal plasmids (Gassmann, (Eds., et al., (1995) Proc. Natl. Acad. Sci. USA 92: 1292). Different components of the blocking agent, e.g., gRNA and effector, can be located on separate expression vectors, which can be co-introduced into target cells (e.g., by transfection or infection). Alternatively, each individual component can be transcribed by a promoter that is both located on the same expression plasmid.

[0432] Delivery of the vector expressing the blocking agent can be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from the patient and then reintroducing the target cells into the patient, or by any other means that allows for introduction into the desired target cells.

[0433] In certain embodiments, a nucleic acid described herein or a nucleic acid encoding a protein described herein, e.g., an effector, is incorporated into a vector, e.g., a viral vector.

[0434] Individual strands or multiple strands of a blocking agent containing a site-specific HNF4α targeting component containing nucleic acid molecule can be transcribed from promoters within an expression vector. For example, if two separate strands are to be expressed to generate dsRNA, two separate expression vectors can be co-introduced into target cells (e.g., by transfection or infection). Alternatively, each of the individual strands of the nucleic acid molecule can be transcribed by a promoter located on the same expression plasmid. In one embodiment, the nucleic acid molecule is expressed as an inverted repeat polynucleotide joined by a linker polynucleotide sequence, thus forming a stem-loop structure.

[0435] Expression vector is generally DNA plasmid or virus vector.The expression vector that is compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate the recombinant construct for expressing the blocking agent described herein.

[0436] Constructs for the recombinant expression of blocking agents generally require regulatory elements, such as promoters, enhancers, etc., to ensure expression of the blocking agent in the target cells.

[0437] Expression of natural or synthetic nucleic acids is generally achieved by operably linking a nucleic acid encoding the nucleic acid of interest to a regulatory region such as a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration in eukaryotes.

[0438] Regulatory regions, such as promoters, suitable for operably linking to nucleic acid molecules can be operably linked to regulatory regions, such as promoters, and can be derived from any species. Any type of promoter can be operably linked to a nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, and promoters that are responsive or unresponsive to specific stimuli (e.g., inducible promoters). Additional promoter elements, such as enhancer sequences, regulate the frequency of transcription initiation. These are typically located 30 to 110 bp upstream of the start site, although it has recently been shown that some promoters also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible, and thus promoter function is preserved even when elements are inverted or moved relative to each other. In the thymidine kinase (TK) promoter, the spacing between promoter elements can be increased to 50 bp before activity begins to decline. Depending on the promoter, individual elements may function cooperatively or independently to activate transcription.

[0439] One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operatively linked to it. Another example of a suitable promoter is the elongation growth factor-1a (EF-1a) promoter. However, other constitutive promoter sequences can also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate-early promoter, Rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter.

[0440] Furthermore, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on expression of a polynucleotide sequence operably linked to the promoter when such expression is desired, or turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0441] Additional regulatory regions that may be useful in nucleic acid constructs include, but are not limited to, transcription and translation terminators, initiation sequences, polyadenylation sequences, translation control sequences (e.g., internal ribosome entry segments, IRES), enhancers, inducible elements, or introns. While such regulatory regions may not be necessary, they can increase expression by affecting transcription, mRNA stability, translation efficiency, and the like. Such regulatory regions can be included in the nucleic acid construct as desired to obtain optimal expression of the nucleic acid in a cell(s). However, sometimes sufficient expression can be obtained without such additional elements.

[0442] The introduced expression vector may contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a population of cells intended to be transfected or infected via a viral vector. In other embodiments, the selectable marker can carry another piece of DNA and be used in a cotransfection procedure. Both the selectable marker and the reporter gene can be flanked by appropriate transcriptional regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes such as neo. Non-limiting examples of selectable markers include puromycin, gancyclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin B-phosphotransferase, thymidine kinase (TK), and xanthine-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture. Other selectable markers include fluorescent polypeptides such as green fluorescent protein or yellow fluorescent protein.

[0443] A signal peptide can also be included and used to target the encoded polypeptide to a particular location in the cell (eg, the cell surface).

[0444] Reporter genes can be used to identify potentially transfected cells and evaluate the functionality of transcriptional regulatory sequences. Generally, reporter genes are genes that encode polypeptides that are not present in or expressed by the recipient source and whose expression is manifested by some easily detectable property, such as enzymatic activity. Expression of the reporter gene is assayed at an appropriate time after DNA is introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and can be prepared using known techniques or commercially available. Generally, the construct with the smallest 5'-flanking region that exhibits the highest level of reporter gene expression is identified as the promoter. Such promoter regions can be linked to a reporter gene and used to evaluate agents for their ability to modulate promoter-driven transcription.

[0445] Other aspects to consider regarding vectors and constructs are known in the art.

[0446] In some embodiments, a vector, eg, a viral vector, comprises a blocking agent that includes a site-specific HNF4α targeting component that comprises a nucleic acid molecule.

[0447] Viral vector systems that can be utilized in the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors (e.g., Ad5 / F35 vectors); (b) retroviral vectors, including, but not limited to, lentiviral vectors (including integration-competent or integration-deficient lentiviral vectors), Moloney murine leukemia virus, and the like; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) poxvirus vectors, such as orthopox, e.g., vaccinia virus vectors, or avipox, e.g., canarypox or fowlpox; and (j) helper-dependent or gutless adenoviruses. Replication-deficient viruses may also be advantageous. Various vectors may or may not integrate into the genome of a cell. The construct may include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into a vector capable of episomal replication (e.g., EPV and EBV vectors). See, for example, U.S. Patent Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, the entire contents of each of which are incorporated herein by reference.

[0448] Vectors, including those derived from retroviruses such as adenovirus and adeno-associated virus, and lentivirus, allow transgenes to be integrated stably for a long period of time and propagate in daughter cells, making them suitable tools for achieving long-term gene transfer.Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.Expression vectors can be provided to cells in the form of viral vectors.Viral vector technology is well known in the art and is described in various virology and molecular biology manuals.

[0449] In one embodiment, a suitable viral vector for use in the present invention is an adeno-associated viral vector, such as a recombinant adeno-associated viral vector.

[0450] Recombinant adeno-associated viral vectors (rAAV) are gene delivery systems based on the defective and non-pathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from plasmids that carry only the AAV 145 bp inverted terminal repeat sequences flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genome of transduced cells are key features of this vector system (Wagner et al., Lancet 351: 9117 1702-3 (1998), Kearns et al., Gene Ther. 9: 748-55 (1996)). AAV serotypes can be used in accordance with the present invention, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9.

[0451] Replication-defective recombinant adenoviral vectors (Ad) can be produced at high titers and readily infect several different cell types. Most adenoviral vectors are engineered to replace the Ad E1a, E1b, and / or E3 genes with a transgene; the replication-defective vector is then propagated in human 293 cells, which supply the deleted gene function in trans. Ad vectors can transduce multiple types of tissue in vivo, including non-dividing, differentiated cells such as those found in liver, kidney, and muscle. Conventional Ad vectors have a large carrying capacity. An example of the use of Ad vectors in clinical trials involved polynucleotide therapy for anti-tumor immunization using intramuscular injection (Sterman et al., Hum. Gene Ther. 7: 1083-9 (1998)). Further examples of the use of adenoviral vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24: 1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9: 7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2: 205-18 (1995); Alvarez et al., Hum. Gene Ther. 5: 597-613 (1997); Topf et al., Gene Ther. 5: 507-513 (1998); Sterman et al., Hum. Gene Ther. 7: 1083-1089 (1998).

[0452] Packaging cells are used to form viral particles capable of infecting host cells. Examples of such cells include 293 cells, which package adenovirus, and ψ2 or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are typically generated by producer cell lines that package nucleic acid vectors into viral particles. The vectors generally contain minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy generally contain only the inverted terminal repeat (ITR) sequences from the AAV genome required for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing a helper plasmid encoding other AAV genes, namely rep and cap, but lacking the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in significant amounts because it lacks ITR sequences. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV.

[0453] IV. Methods of the Invention The present invention also provides methods of using the agents and compositions described herein to modulate the expression of hepatocyte nuclear factor 4 alpha (HNF4α) in cells. The methods include contacting cells with a site-specific HNF4α blocking agent comprising a site-specific HNF4α targeting component that targets an HNF4α expression control region and an effector molecule, thereby modulating HNF4α expression in the cells. The site-specific blocking agent, the effector, or both the site-specific blocking agent and the effector can be present in a composition such as the compositions described above. In some embodiments, the site-specific blocking agent and the effector are present in the same composition. In other embodiments, the site-specific blocking agent and the effector are present in different compositions. In some embodiments, the methods of the present invention include contacting cells with two site-specific HNF4α blocking agents (a first agent and a second agent). The two site-specific HNF4α blocking agents can be present in the same composition, e.g., a pharmaceutical composition, e.g., a pharmaceutical composition containing LNPs, or in separate compositions, e.g., a pharmaceutical composition, e.g., a pharmaceutical composition containing LNPs. The cells can be contacted with a first site-specific HNF4α blocking agent at one time point and a second site-specific HNF4α blocking agent at a second time point, or the cells can be contacted with both agents simultaneously.

[0454] As mentioned above, in fibrotic liver disease, HNF4α is dysregulated, resulting in a significant reduction or cessation of gene expression in the network. Guzman-Lepe (Guzman-Lepe J, et al. Liver-enriched transcription factor expression relates to chronic hepatic failure in humans. Hepatol Commun. 2018; 2 (5) : 582-594. doi: As reported by the 10.1002 / hep4.1172 study, HNF4α expression was downregulated and correlated well with the degree of liver dysfunction (P = 0.001), stage of fibrosis (P = 0.0005), and serum levels of total bilirubin (P = 0.009; r = 0.35), albumin (P < 0.001; r = 0.52), and prothrombin time activity (P = 0.002; r = 0.41). HNF4α expression also correlated with CYP3A4, ornithine transcarbamylase (OTC), and F7, as well as CDH1 RNA levels. Dysregulation of this network contributes to the pathology of liver failure within the organ itself and to comorbidities across patients. In addition to suppressing proteins associated with a healthy liver (eg, albumin and CYP3A enzyme production), proteins that contribute to the production of fibrosis are activated, including COL1a1 and αSMA.

[0455] Several studies have established proof-of-principle that increased expression of HNF4α can restore normal function to senescent, irreversibly dysfunctional hepatocytes from terminal rodent liver (Nishikawa, supra; Scholten D, Trebicka J, Liedtke C, Weiskirchen R. The carbon tetrachloride model in mice. Lab Anim. 2015; 49 (1 Suppl): 4-11. doi: 10.1177 / 0023677215571192; Varga J, Brenner DA, Phan SH, eds. Fibrosis Research: Methods and Protocols. Humana Press; 2005. doi: 10.1385 / 1592599400). Interestingly, as reported by Nishikawa et al. (Nishikawa, supra), reversal of distorted extracellular matrix is ​​not absolutely necessary to reverse liver failure in degenerative liver disease, since histological examination found only minimal resolution of fibrosis 2 weeks after forced reexpression of HNF4α, well after improvement in liver function had been demonstrated. However, significant improvement in histology was observed by 100 days. Furthermore, long-term correction occurred despite forced reexpression resulting in only 0.01% of endogenous HNF4α levels. Thus, in end-stage degenerative disease, increased expression of HNF4α in a relatively small number of hepatocytes may be necessary to improve liver function.

[0456] Recently, Huang et al. Activation of Hepatocellular Nuclear Factor-4α by Small Activating RNA Rescues Dyslipidemia and Improves Metabolic Profile. Mol Ther Nucleic Acids. 2019; 19: 361-370. doi:10.1016 / j.omtn.2019.10.044) also observed that stimulating HNF4α expression with small activating RNA restored metabolic regulation and improved lipid profile in a rat model of nonalcoholic fatty liver disease (NAFLD).

[0457] As demonstrated in the examples below, one embodiment of the present invention is to increase HNF4α gene expression by delivering engineered transcription factors to pathologically dysregulated genes. The transcriptional activator VPR (Chavez A, et al. Highly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015; 12 (4): 326-328. doi: 10.1038 / nmeth.3312) is a concatemer of the HSV transcriptional activator VP16, the nuclear factor NF-kappa-B p65 subunit, and the EBV R transactivator. Each of these transcription factors individually can trigger the cellular machinery of transcription, resulting in upregulated RNA production from target gene loci. As a group, their synergistic cooperation results in physiological or supraphysiological target gene expression.

[0458] For example, compared with the cell that is not contacted with site-specific HNF4α blocking agent, the expression of HNF4α can be enhanced or reduced.The modulation of gene expression can be evaluated by any method known in the art.For example, the modulation of expression can be determined by, for example, using Northern blotting, qRT-PCR to determine the mRNA expression level of gene in cell, a plurality of cells and / or tissue samples, which are conventional methods for those skilled in the art;By using Western blotting, immunological techniques and other methods to determine the protein level of gene, which are conventional methods for those skilled in the art.

[0459] The term "reduced" refers to the level of HNF4α gene expression or HNF4α protein production in a subject, or, in the case of a disease marker or symptom, a statistically significant decrease in such level. A decrease can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the detection level of a detection method. In certain embodiments, target expression normalizes, i.e., decreases toward or to a level that is accepted as within the normal range for individuals without such a disorder. As used herein, "lower" in a subject may refer to a decrease in gene expression or protein production in a subject's cells that does not require a decrease in expression in all cells or tissues of the subject. For example, as used herein, a decrease in a subject can include a decrease in gene expression or protein production in the subject's liver.

[0460] The term "decreased / reduced" can also be used in relation to the normalization of symptoms of a disease or condition, i.e., a decrease in the difference between the level in a subject suffering from an HNF4α-related disease toward or to the level in a normal subject not suffering from an HNF4α-related disease. As used herein, when a disease is associated with an elevated value for a symptom, "normal" is considered the upper limit of normal. When a disease is associated with a decreased value for a symptom, "normal" is considered the lower limit of normal.

[0461] The term "enhanced" refers to a statistically significant increase in the level of HNF4α gene expression or HNF4α protein production in a subject, or in the case of a disease marker or symptom, such a level. The increase can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or greater than the detection level of a detection method. In certain embodiments, target expression is normalized, i.e., increased toward or to a level that is accepted as within the normal range for individuals without such a disorder. As used herein, "higher" in a subject may refer to the fact that increased gene expression or protein production in a subject's cells does not necessarily require increased expression in all cells or tissues of the subject. For example, as used herein, increased in a subject may include increased gene expression or protein production in the subject's liver.

[0462] The term "enhancement" can also be used in relation to the normalization of symptoms of a disease or condition, i.e., the difference between the level in a subject suffering from an HNF4α-related disease and the level in a normal subject not suffering from an HNF4α-related disease is increased toward or to the level. As used herein, when a disease is associated with an elevated value for a symptom, "normal" is considered to be the upper limit of normal. When a disease is associated with a decreased value for a symptom, "normal" is considered to be the lower limit of normal.

[0463] In some embodiments, the cells suitable for use in the methods of the present invention are mammalian cells. In some embodiments, the cells are somatic cells. In some embodiments, the cells are primary cells. For example, in some embodiments, the cells are mammalian somatic cells. In some embodiments, the mammalian somatic cells are primary cells. In some embodiments, the mammalian somatic cells are non-embryonic cells.

[0464] The contacting step can be performed in vitro, in vivo (i.e., the cells can be present within a subject), or ex vivo. In some embodiments, the contacting step is performed ex vivo, and the method further comprises removing the cells (e.g., mammalian cells) from the subject prior to the contacting step. In some embodiments, the method further comprises (b) administering the cells (e.g., mammalian cells) to the subject after the contacting step.

[0465] The in vivo methods of the invention can include administering to a subject an agent or composition of the invention.

[0466] The term "subject," as used herein, refers to an organism, e.g., a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, a laboratory animal, a mouse, a rat, a hamster, a gerbil, a cat, or a dog). In some embodiments, the human subject is an adult subject, an adolescent subject, or a pediatric subject. In some embodiments, the subject has had a disease or condition. In some embodiments, the subject is afflicted with a disease, disorder, or condition, e.g., a disease, disorder, or condition that can be treated as provided herein. In some embodiments, the subject is predisposed to a disease, disorder, or condition; in some embodiments, a predisposed subject is predisposed to and / or exhibits an increased risk of developing a disease, disorder, or condition (compared to the average risk observed in a reference subject or population). In some embodiments, the subject exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, the subject does not exhibit specific symptoms (e.g., clinical manifestations of the disease) or characteristics of a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual for whom and / or to whom a diagnosis and / or treatment is to be administered.

[0467] Subjects who may benefit from the methods of the present invention include those who have or are at risk for an "HNF4α-associated disorder." Therefore, the present invention further provides a method for treating a subject in need thereof. The treatment method of the present invention comprises administering a therapeutically effective amount of an agent or composition of the present invention to a subject, for example, a subject who would benefit from modulation of HNF4α expression, such as a subject with an HNF4α-related disease. In some embodiments, the method of the present invention comprises administering two site-specific HNF4α blocking agents (a first agent and a second agent) to a subject. The two site-specific HNF4α blocking agents can be present in the same composition, for example, a pharmaceutical composition, for example, a pharmaceutical composition containing LNPs, or can be present in separate compositions, for example, a pharmaceutical composition, for example, a pharmaceutical composition containing LNPs. The first site-specific HNF4α blocking agent can be administered to a subject at one time point and the second site-specific HNF4α blocking agent can be administered at a second time point, or both agents can be administered to a subject simultaneously.

[0468] Furthermore, the present invention provides a method for preventing at least one symptom in a subject in which modulation of HNF4α expression would be beneficial, such as a subject having an HNF4α-associated disease, by administering to the subject an agent or composition of the present invention in a prophylactically effective amount.

[0469] As used herein, a "therapeutically effective amount" includes an amount of an agent or composition that, when administered to a patient for treating a subject with an HNF4α-related disease, is sufficient to effect treatment of the disease (e.g., by attenuating, reversing, or maintaining the existing disease or one or more symptoms of the disease or its associated co-morbidities). A "therapeutically effective amount" may vary depending on the agent or composition, the manner of administration, the disease and its severity, and the medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by HNF4α gene expression, type of prior or concomitant treatment, if any, and other individual characteristics of the patient being treated.

[0470] As used herein, a "prophylactically effective amount" includes an amount of an agent or composition that, when administered to a subject who has not yet experienced or exhibited symptoms of an HNF4α-related disease but may be predisposed to an HNF4α-related disease, is sufficient to prevent or delay the onset or progression of the disease or one or more symptoms of the disease for a clinically significant period of time. The "prophylactically effective amount" may vary depending on the agent or composition, the manner of administration, the degree of risk of the disease, and the patient's medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other individual characteristics.

[0471] As used herein, "prevention" or "preventing," when used in reference to a disease, disorder, or condition in which reducing expression of the HNF4α gene or production of HNF4α protein would be beneficial, refers to a reduction in the likelihood that a symptom associated with such disease, disorder, or condition, e.g., a sign or symptom of HNF4α gene expression or HNF4α activity, will occur in a subject.

[0472] A "therapeutically effective amount" or "prophylactically effective amount" also includes that amount of an agent or composition that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The agents and compositions used in the methods of the invention can be administered in amounts sufficient to produce a reasonable benefit / risk ratio applicable to such treatment. In some embodiments, a therapeutically or prophylactically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver the therapeutically or prophylactically effective amount.

[0473] As used herein, the phrase "reducing symptoms" can be used when the magnitude (e.g., intensity, severity, etc.) and / or frequency of one or more symptoms of a particular disease, disorder, or condition is reduced. In some embodiments, delaying the onset of a particular symptom is considered a form of reducing the frequency of that symptom.

[0474] When the subject to be treated is a mammal such as a human, the composition can be administered by any means known in the art, including but not limited to intracranial (for example, intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and oral (including buccal and sublingual) administration, intraperitoneal, or parenteral route.In certain embodiments, the composition is administered by intravenous infusion or intravenous injection.In certain embodiments, the composition is administered by subcutaneous injection.

[0475] As used herein, the term "HNF4α-associated disease" refers to a disease or disorder caused by or associated with HNF4α gene expression or HNF4α protein production. The term "HNF4α-associated disease" includes diseases, disorders, or conditions in which reduced HNF4α gene expression, replication, or protein activity would be beneficial. Non-limiting examples of HNF4α-associated diseases include, for example, liver disease (e.g., fatty liver, steatohepatitis including non-alcoholic steatohepatitis (NASH)), inflammatory bowel disease (IBD), hepatocellular carcinoma, MODY I, polycystic kidney disease, dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance not associated with an immune response to insulin, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney injury, tubular dysfunction, pro-inflammatory changes to the proximal tubule, chronic kidney disease), metabolic syndrome, diseases or dysfunctions of lipid deposition (e.g., adipocyte dysfunction, visceral fat deposition, obesity), diseases of elevated uric acid (e.g., hyperuricemia, gout), and eating disorders such as excessive sugar craving. Details regarding the signs and symptoms of various diseases or conditions are well known in the art.

[0476] In one embodiment, the HNF4α-related disease is selected from the group consisting of fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, liver inflammation, hepatocellular necrosis, liver fibrosis, and non-alcoholic fatty liver disease (NAFLD), polycystic kidney disease, inflammatory bowel disease (IBD), and MODY I.

[0477] Administration of an agent or composition according to the methods of the present invention to a patient with an HNF4α-related disease or disorder can result in a reduction in the severity, signs, symptoms, or markers of the HNF4α-related disease or disorder. "Reduction" in this context refers to a statistically significant reduction in such levels. The reduction (absolute reduction, or reduction in the difference between elevated levels and normal levels in a subject) can be, for example, at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the detection level of the assay used.

[0478] Administration of an agent or composition according to the methods of the invention can stably or transiently modulate expression of a target gene, hi some embodiments, modulation of expression persists for at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or longer, or any time in between. In some other embodiments, the modulation of expression lasts for about 30 minutes to about 7 days or less, or for about 1 hour or less, about 2 hours or less, about 3 hours or less, about 4 hours or less, about 5 hours or less, about 6 hours or less, about 7 hours or less, about 8 hours or less, about 9 hours or less, about 10 hours or less, about 11 hours or less, about 12 hours or less, about 13 hours or less, about 14 hours or less, about 15 hours or less, about 16 hours or less, about 17 hours or less, about 18 hours or less, about 19 hours or less, about 20 hours or less, about 21 hours or less, about 22 hours or less, about 24 hours or less, about 36 hours or less, about 48 hours or less, about 60 hours or less, about 72 hours or less, about 4 days or less, about 5 days or less, about 6 days or less, about 7 days or less, or any time in between.

[0479] The active agent or composition can be administered to the subject once, or can be administered multiple times over a period of time.For example, during one treatment or over a period of time, the subject can be administered 2, 3, 4, 5 or more times.In some embodiments, during one treatment or over a period of time, the subject can be administered 6, 8, 10, 12, 15 or 20 or more times according to the treatment regimen.

[0480] In some embodiments, administration can be carried out as needed, for example, as long as the symptoms associated with disease, disorder or condition persist.In some embodiments, repeated administration may be required throughout the remaining life of the subject.The duration of treatment can vary, for example, 1 day, 2 days, 3 days, 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 1 year or longer.

[0481] The effectiveness of disease treatment or prevention can be evaluated by, for example, measuring the progression of disease, the remission of disease, the severity of symptoms, the reduction of pain, quality of life, the dose of drug application required to maintain the treatment effect, the level of disease marker, or any other measurable parameter that is suitable for the given disease that is treated or targeted for prevention.It is well within the ability of those skilled in the art to monitor the effectiveness of treatment or prevention by measuring any one of these parameters or any combination of parameters.As discussed herein, the specific parameter that is measured depends on the HNF4α-related disease that the subject suffers from.

[0482] Comparing the subsequent reading with the initial reading provides the physician with an indication of whether the treatment is effective. Monitoring the effectiveness of treatment or prevention by measuring any one or any combination of such parameters is well within the capabilities of one skilled in the art. With respect to the administration of an agent or composition, "effective against" HNF4α-associated disorders indicates that administration in a clinically appropriate manner will result in a beneficial effect in at least a statistically significant proportion of patients, such as improvement of symptoms, cure, reduction of disease, prolongation of life, improvement in quality of life, or other effect generally recognized as beneficial by physicians familiar with the treatment of HNF4α-associated disorders.

[0483] Treatment or prevention effect is evident when there is a statistically significant improvement in one or more parameters of the disease state, or when the symptoms do not worsen or occur as would otherwise be expected.For example, effective treatment can be indicated by a favorable change of at least 10%, and preferably at least 20%, 30%, 40%, 50% or more, in measurable disease parameters.The effectiveness of a given agent or composition can also be determined using an experimental animal model of a given disease known in the art.When using an experimental animal model, the effectiveness of treatment is proven when a statistically significant reduction in markers or symptoms is observed.

[0484] Alternatively, efficacy can be measured by a reduction in disease severity as determined by one skilled in the art of diagnosis based on a clinically accepted grading scale for disease severity. Any beneficial change resulting in a reduction in disease severity, e.g., as measured using an appropriate scale, indicates that treatment with an agent or composition described herein is sufficient.

[0485] As used herein, the terms "treating" or "treatment" refer to a beneficial or desired result, including, but not limited to, alleviating or reversing one or more signs or symptoms associated with HNF4α gene expression or HNF4α protein production. "Treatment" can also mean prolonging survival as compared to expected survival if not treated.

[0486] The present invention will now be illustrated by the following examples. However, the use of these and other examples anywhere in this specification is merely illustrative and in no way limits the scope and meaning of the invention or any exemplified form. The present invention is not limited to any of the specific preferred embodiments described herein. Many modifications and variations of the present invention will be apparent to those skilled in the art and can be made without departing from the spirit and scope of the invention. The contents of all references, patents and published patent applications cited throughout this application, including the figures and informal sequence listing, are hereby incorporated by reference. [Example]

[0487] Example 1 Modulation of HNF4α expression This example describes the silencing of HNF4α expression using a site-specific HNF4α blocker that includes a site-specific HNF4α targeting component, i.e., a guide RNA, that targets the HNF4α expression control region, and an effector that includes a fusion molecule comprising dCAS9 and KRAB.

[0488] Guide RNAs were designed to site-specifically target the transcriptional regulatory region, including promoter 1 (near the transcription start site) of the HNF4α gene (see, e.g., Figure 1 ), and were synthesized according to standard methods for oligonucleotide synthesis. The nucleotide sequences of the guide RNAs are presented in Table 2 below. Exemplary guide RNAs designed to site-specifically target the transcriptional regulatory region, including promoter 2 (near the transcription start site) of the HNF4α gene, were also designed and presented in Table 3 below. Additional exemplary guide RNAs designed to site-specifically target the transcriptional regulatory region, including promoter 2 (near the transcription start site) of the HNF4α gene, were also designed and presented in Table 9 below. Table 4 below includes the unmodified nucleotide sequences, reverse complementary nucleotide sequences, and chromosomal coordinates of the targeting portions of the guide RNAs in Tables 2 and 3.

[0489] HepG2 cells were plated in a 96-well plate (3 x 10 cells per well) 24 h before transfection. 4 Cells were seeded in appropriate medium at a density of 1000 cells / well. Cells were transfected with SSOP lipid nanoparticles (LNPs) containing mRNA (MR_28122) encoding a dCAS9-KRAB fusion protein and guide RNA (sgRNA) according to standard methods (see, e.g., Akita, et al. (Advanced Healthcare Materials (2013) 2: 8: 1120-1125)).

[0490] LNP formulations prepared using individual sgRNAs or pools of sgRNAs (see Figure 1) were added to cells at final concentrations of 5.0 μg / ml, 2.5 μg / ml, 1.25 μg / ml, or 0.625 μg / ml. Experiments were terminated after 72 hours by lysing and freezing cells in RLT buffer for downstream mRNA purification or treatment with Cell Titer Glo 2 reagent to quantify final cell number. qPCR was performed using HNF4α and ACTB probes to quantify relative HNF4α RNA transcription.

[0491] Figure 2 demonstrates that the combination of Pool 1 or Pool 2 guides with the effector dCAS-KRAB inhibited HNF4α expression in a dose-dependent manner compared to dCAS alone, SH-KRAB, and no treatment. dCAS alone affected transcription in some cases, and without wishing to be bound by theory, the inhibition may be the result of dCAS interfering with polymerase binding.

[0492] Furthermore, as demonstrated in Figure 3, Pool 1 at the highest concentration had the strongest silencing activity, and guide RNAs GD-28432 and GD-28433 each had strong silencing activity alone, even at the lowest concentrations.

[0493] Example 2 Modulation of HNF4α expression This example describes the activation of HNF4α expression using a site-specific HNF4α blocking agent that includes a site-specific HNF4α targeting component, i.e., a guide RNA, that targets the HNF4α expression control region, and an effe...

Claims

[Claim 1] The invention described in the specification.

Images