Linker

Abstract

To provide conjugates to deliver therapeutic molecules that exhibit reduced toxicity when administered systemically to patients while maintaining therapeutic effectiveness.SOLUTION: The present invention relates to linkers for connecting a carrier molecule to a therapeutic molecule to form a conjugate, in particular linkers formed of amino acids such as glutamic acid, succinic acid, and γ-aminobutyric acid. The present invention further relates to a conjugate comprising a linker of the invention, and the use of the conjugate in the treatment of various diseases.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to linkers for attaching carrier molecules to therapeutic molecules to form conjugates. The present invention further relates to conjugates comprising the linkers of the present invention and the use of said conjugates in the treatment of various diseases. [Background technology]

[0002] Therapeutic conjugates, comprising a carrier molecule and a therapeutic molecule covalently linked to each other, were first developed after earlier realizations (therapeutic molecules, when used alone, often had poor cell permeability.) To facilitate cellular uptake of therapeutic molecules into cells and / or tissues, the use of partner carriers was proposed.

[0003] One such group of therapeutic molecules is antisense oligonucleotides (ONs). ON therapy has made rapid clinical progress for treating various disease indications due to its targeting and high efficacy. ONs can cause targeted regulation of pre-mRNA splicing, thus making ONs particularly attractive candidates for new gene therapy drugs (especially for the treatment of diseases caused by loss-of-function mutations, such as Duchenne muscular dystrophy (DMD)). However, despite their wide applicability for the treatment of many genetic diseases, systemic in vivo administration of ON compounds has achieved limited success in providing therapeutic effects due to their poor permeability to target tissues and low levels of cellular uptake.

[0004] To address the problem of poor cellular uptake in oligonucleotide therapeutics, complexes comprising carriers formed from short peptides have been developed.In the past few years, cationic, i.e., positively charged cell-penetrating peptides (CPPs) have been used as carriers to facilitate the cellular uptake of charge-neutral species, such as therapeutic phosphorodiamidate morpholino oligomers (PMOs).CPP complexes have been shown to effectively promote the in vivo cellular uptake of PMOs in various disease models, including DMD.

[0005] However, the application of carrier-therapeutic conjugates as therapeutics is hindered by their associated toxicity.

[0006] Amantana et al. described that peptide-PMO conjugates exert dose-dependent toxicity (Bioconjug Chem., 2007, 1325-1331). Above a certain threshold of toxicity, fatigue, respiratory distress, tubular degeneration in the kidney, and weight loss are observed. One such CPP conjugate, the B-PMO conjugate, showed high acute toxicity in mdx mice (Wu et al., Am J Pathol, 2012, 392-400).

[0007] Research into reducing the toxicity of such therapeutic conjugates has focused on the development of carriers that are believed to be the source of toxicity. In relation to peptide carriers, Wu et al. showed that an increase in the number of 6-aminohexanoic acid residues correlates with increased toxicity (Nuc Acids Res, 2007, 35, 5182-5191), and that more active and stable CPPs contain arginine (R, D They claim that the peptide carrier is designed by optimizing the position and number of arginine (-R), aminohexanoic acid (X) and β-alanine (B) residues. Other studies have further shown that the number and frequency of arginine residues in the peptide carrier negatively impacts toxicity and that these should be reduced.

[0008] Since then, carrier peptides with various sequences have been developed in an attempt to make the conjugate less toxic, but many such conjugates have not reached the clinic. This is either due to intolerable levels of toxicity or due to undesirable loss of efficacy of the conjugate. For example, Betts et al. demonstrated that even some promising CPP carriers, known in the art as "Pips", still do not have an adequate therapeutic index for clinical development (Molecular Therapy-Nucleic Acids, 2012, 1, e38). Furthermore, US Patent Application Publication No. 2016 / 0237426 contains data showing that other differently designed CPP carriers, such as R6Gly, have reduced toxicity but reduced efficacy in inducing exon skipping when used in conjugates with therapeutic molecules. Summary of the Invention [Problem to be solved by the invention]

[0009] Despite efforts by researchers to modify the sequences of carriers for use in therapeutic conjugates, it has thus far proven extremely difficult to generate conjugates that are highly effective, both in terms of therapeutic efficacy and acceptable toxicity levels. Thus, a need remains for conjugates for delivering therapeutic molecules that exhibit reduced toxicity when administered systemically to patients, while maintaining therapeutic efficacy.

[0010] One or more aspects of the present invention aim to address at least this problem. [Means for solving the problem]

[0011] According to a first aspect of the present invention, there is provided a conjugate or a pharma- ceutically acceptable salt or solvate thereof comprising at least one carrier, the carrier being covalently attached to at least one linker, the linker being covalently attached to at least one therapeutic molecule, each of the at least one linker independently having a structure according to formula (I):

[0012] Formula (I) -T1-(CR 1 R 2 ) n -T2- (I) {where: T1 is for binding to a carrier and is selected from -NH- or -C(O)-; T2 is for attachment to a first therapeutic molecule and is selected from -NH- or -C(O)-; n is an integer selected from 1, 2, or 3; and Each R 1 are independently expressed as -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 1 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR A3 )-, -N(R A3 )-, -N(R A3 )-C(O)-, -N(R A3 )-C(O)O-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3)-, -N(R A3 )C(NR A3 )N(R A3 )-, -SO-, -S-, -SO2-, -S(O)2N(R A3 )- or -N(R A3 )SO2-(where, each R A3 is independently selected from hydrogen or methyl; and Z 1 is a further therapeutic molecule or is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 or (1-4C)alkoxy (wherein R A4 and R A5 are each independently substituted by one or more substituents selected from hydrogen or (1-2C) alkyl). is a group represented by the formula: Each R 2 are independently expressed as -Y 2 -X 2 -Z 2 [where: Y 2 is absent or the formula -[CR B1 R B2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R B1 and R B2 are each independently selected from hydrogen, OH, or (1-2C)alkyl; X 2 is absent or is -O-, -C(O)-, -C(O)O-, -OC(O)-, -CH(OR B3 )-, -N(RB3 )-, -N(R B3 )-C(O)-, -N(R B3 )-C(O)O-, -C(O)-N(R B3 )-, -N(R B3 )C(O)N(R B3 )-, -N(R B3 )C(NR B3 )N(R B3 )-, -SO-, -S-, -SO2-, -S(O)2N(R B3 )- or -N(R B3 )SO2-(where, each R B3 is independently selected from hydrogen or methyl; and Z 2 is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR B4 R B5 or (1-4C)alkoxy (wherein R B4 and R B5 are each independently substituted by one or more substituents selected from hydrogen or (1-2C) alkyl). is the basis of; however, When n=1, and T1 and T2 are different from each other, R 1 and R 2 cannot both be H; n=1, T1 and T2 are different from each other, and R 1 and R 2 If one of is H, then R 1 and R 2 the other is not methyl; or n=2, and each R 1 and R 2is H, T1 and T2 are both -C(O)- or both -NH-; When the carrier is a peptide, the peptide is non-glycosylated.

[0013] According to a second aspect of the invention there is provided a conjugate according to the first aspect for use as a medicament.

[0014] According to a third aspect of the invention there is provided a pharmaceutical composition comprising a conjugate according to the first aspect.

[0015] According to a fourth aspect of the invention there is provided a pharmaceutical composition according to the third aspect for use as a medicament. [Brief description of the drawings]

[0016] [Figure 1] Figure 1 is a graph showing relative levels of normalized urinary kidney injury marker (KIM-1) to urinary creatinine measured in urine of C57BL / 6 mice on days 2 and 7 after administration of a single dose of 30 mg / kg DPEP3.1 peptide conjugated to therapeutic antisense PMODMD via different linkers, compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10).

[0017] [Diagram 2]Figures 2A-2C are graphs showing the in vivo efficacy of DPEP3.1 peptides conjugated to therapeutic antisense PMODMD via different linkers in (A) tibialis anterior, (B) diaphragm, and (C) cardiac muscle, respectively, after a single intravenous bolus administration of 30 mg / kg in C57BL / 6 mice. Efficacy was measured 7 days after administration by qPCR for exon skipping of dystrophin (exon 23). Exon skipping efficacy was compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD. Outliers for DPEP3.1d-PMODMD suggest erroneous injections (error bars: standard error of the mean, n=3-10).

[0018] [Diagram 3] Figure 3 is a graph showing the relative levels of normalized urinary kidney injury marker (KIM-1) to urinary creatinine measured in the urine of C57BL / 6 mice on days 2 and 7 after administration of a single dose of 10 mg / kg, 30 mg / kg, or 50 mg / kg of DPEP1.9 peptide conjugated to therapeutic antisense PMODMD via different linkers, compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10).

[0019] [Figure 4]Figures 4A-4C are graphs showing the in vivo efficacy of DPEP1.9 peptide conjugated to therapeutic antisense PMODMD via different linkers in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle after a single intravenous bolus administration of 10 mg / kg, 30 mg / kg, or 50 mg / kg in C57BL / 6 mice. Efficacy was measured 7 days after administration by qPCR for exon skipping of dystrophin (exon 23). Exon skipping efficacy was compared to 0.9% saline control and currently available peptide carriers (R6Gly- and Pip9b2-) conjugated to the same therapeutic antisense PMODMD (error bars: standard error of the mean, n=3-10).

[0020] [Diagram 5] FIG. 5 is a graph showing that different DPEP1 / 3-[CAG]7 complexes using linkers a, b, and d at various concentrations corrected the splicing defect of Mbnl1-dependent transcription in DM1 patient myoblasts derived from a DM1 patient carrying 2600 CTG repeats in the DMPK gene.

[0021] [Figure 6] FIG. 6 is a graph showing that different DPEP1 / 3-[CAG]7PMO complexes using linkers a, b, and d at various concentrations correct the splicing defect of in vitro DMD transcripts in DM1 patient myoblasts derived from a DM1 patient with 2600 repeats in the DMPK gene.

[0022] [Figure 7] FIG. 7 is a graph showing that different DPEP1 / 3-[CAG]7 complexes using various concentrations of linkers a, b, and d corrected the splicing defect of Mbnl1-dependent transcription in DM1 patient myoblasts derived from a DM1 patient carrying 2600 CTG repeats in the DMPK gene.

[0023] [Figure 8]8 is a graph showing myoblast viability of DM1 patient myoblasts with 2600 CTG repeats transfected for 48 hours with various doses of different DPEP1 / 3-[CAG]7 conjugates using linkers a, b, and d. The concentration of the conjugates can be increased several-fold from therapeutic levels without causing cell death.

[0024] [Figure 9] 9 is a graph showing cell viability of hepatocytes transfected with 40 μM of different DPEP1 / 3-[CAG]7 conjugates using linkers a, b, and d. Concentrations of the conjugates can be increased several-fold from therapeutic levels without causing cell death, in contrast to the Pip6a conjugate.

[0025] [Figure 10] Figure 10 shows urinary toxicity markers from day 2 and day 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into C57BL6 female mice measured by ELISA (R&D cat# MKM100) with samples diluted to fit the standard curve. Values ​​were normalized to urinary creatinine levels to account for protein concentration in the urine (Harwell). KIM-1 levels were similar to saline control injections compared to the several-fold increase elicited by the previous Pip series peptide carriers.

[0026] [Figure 11] Figure 11 shows urinary toxicity markers from day 2 and day 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into C57BL6 female mice measured by ELISA (R&D cat# MKM100) with samples diluted to fit the standard curve. Values ​​were normalized to urinary creatinine levels to account for protein concentration in the urine (Harwell). VKIM-1 levels were similar to saline control injections compared to the several-fold increase elicited by the previous Pip series peptide carriers.

[0027] [Figure 12]Figure 12 shows toxicity markers assessed in plasma from C57BL6 female mice (age: 8-10 weeks, n=5 per group) injected bolus IV (tail vein) with different DPEP1 / 3-[CAG]7PMO with different linkers. Plasma collections were compared to saline on day 7 post-injection. All levels were similar to saline control injections on day 7 post-injection.

[0028] [Figure 13] Figure 13 shows toxicity markers assessed in plasma from C57BL6 female mice (age: 8-10 weeks, n=5 per group) injected bolus IV (tail vein) with different DPEP1 / 3-[CAG]7PMO with different linkers. Plasma collections were compared to saline on day 7 post-injection. All levels were similar to saline control injection on day 7 post-injection. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] The inventors have discovered that a linker located in the conjugate between the carrier and the therapeutic molecule has a surprising effect on the toxicity of the conjugate.

[0030] When a linker is used in a conjugate, it is typically a small molecule used for the sole purpose of connecting the carrier molecule to the therapeutic molecule, and to date, it is not expected or intended that the linker itself will have any role in the properties of the conjugate.

[0031] To the best of the inventors' knowledge, no studies have been performed on how the choice of linker affects the properties of the conjugate, and in particular, how the choice of linker affects the toxicity of the conjugate.

[0032] In the present invention, the inventors have investigated the effect of using different linkers on the toxicity of several peptide carrier conjugates. The inventors have identified several linkers that positively improve the toxicity of therapeutic conjugates. Surprisingly, the inventors have found that linkers belonging to the structure of the first aspect of the present invention act to reduce the toxicity of carrier-therapeutic conjugates by a significant amount, when compared to other linkers used in the art.

[0033] Without wishing to be bound by any theory, purely from scientific speculation, the inventors believe that the linkers falling within the definition of the first aspect of the invention have the ability to position the carrier and the therapeutic molecule in a special orientation that stabilizes and protects them against cleavage by proteases. As a result, the conjugate as a whole has reduced toxicity compared to similar conjugates using conventional linkers. This favorable orientation comes from the length of the carbon chain that connects the carrier to the therapeutic molecule. The inventors believe that the special length of the carbon chain provides sufficient distance between the charge of the carrier and the therapeutic molecule. In addition, the inventors believe that the metabolites generated upon destruction of the linker are less toxic.

[0034] Advantageously, the discovery of such reduced toxicity linkers means that previously developed and newly developed therapeutic conjugates can now be used in the clinical setting. Moreover, because the linkers are independent moieties of the carrier and therapeutic molecule, they can be easily used in many different conjugates with many different carriers and therapeutic molecules without affecting the cell permeability of the carrier or the efficacy of the therapeutic molecule.

[0035] Particular features of any of the above aspects of the invention are defined in the following paragraphs.

[0036] The present invention includes combinations of the above aspects and features except where such combinations are expressly impermissible or expressly avoided.

[0037] The headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0038] Linker The linker is used to covalently attach the carrier to the therapeutic molecule. The conjugate of the present invention comprises at least one linker defined by formula (I).

[0039] Suitably, each linker has formula (I) as defined above, i.e. -T1-(CR 1 R 2 ) n -T2- (I) It has a structure according to the following:

[0040] In one embodiment, T1 is -NH-. In another embodiment, T1 is -C(O)-.

[0041] In one embodiment, T2 is -C(O)-.

[0042] In one embodiment, each R 1 is the formula -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen or (1-2C)alkyl; X 1 is absent or -O-, -C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3 )-C(O)-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(RA3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, or -S-, where each R A3 is independently selected from hydrogen or methyl; and Z 1 is a further therapeutic molecule or is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 or (1-4C)alkoxy (wherein R A4 and R A5 are each independently substituted by one or more substituents selected from hydrogen or (1-2C) alkyl). is the basis.

[0043] In one embodiment, each R 1 is the formula -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen or (1-2C)alkyl; X 1 is absent or -O-, -C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3 )-C(O)-, -C(O)-N(R A3)-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, or -S-, where each R A3 is independently selected from hydrogen or methyl; and Z 1 is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl, where each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR A4 R A5 or (1-4C)alkoxy (wherein R A4 and R A5 are each independently substituted by one or more substituents selected from hydrogen or (1-2C) alkyl). is the basis.

[0044] In other embodiments, each R 1 is the formula -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen or (1-2C)alkyl; X 1 is absent or -O-, -C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3)-C(O)-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, or -S-, where each R A3 is independently selected from hydrogen or methyl; and Z 1 is a further therapeutic molecule or is selected from hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl is optionally substituted by one or more substituents selected from (1-4C)alkyl, halo, or hydroxy. is the basis.

[0045] In one embodiment, each R 1 is the formula -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen or (1-2C)alkyl; X 1 is absent or -C(O)-, -C(O)O-, -N(R A3 )-C(O)-, -C(O)-N(R A3 ) (where each R A3 is independently selected from hydrogen or methyl; and Z 1is a further therapeutic molecule or is selected from hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl is optionally substituted by one or more substituents selected from (1-4C)alkyl, halo, or hydroxy. is the basis.

[0046] In one embodiment, each R 1 is the formula -Y 1 -X 1 -Z 1 [where: Y 1 is absent or the formula -[CH2] m - where m is an integer selected from 1 or 2; X 1 is absent or -N(R A3 )-C(O)-, -C(O)-N(R A3 )-wherein each R A3 is independently selected from hydrogen or methyl; and Z 1 is hydrogen or (1-2C) alkyl] is the basis.

[0047] In certain embodiments, Z 1 may be an additional therapeutic molecule. The additional therapeutic molecule may be the same or different from the first therapeutic molecule that binds to T2.

[0048] In one embodiment, each R 2 are each independently represented by the formula -Y 2 -X 2 -Z 2 [where: Y 2 is absent or the formula -[CR A1 R A2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R A1 and R A2 are each independently selected from hydrogen or (1-2C)alkyl; X 2 is absent or -O-, -C(O)-, -C(O)O-, -N(R A3 )-, -N(R A3 )-C(O)-, -C(O)-N(R A3 )-, -N(R A3 )C(O)N(R A3 )-, -N(R A3 )C(NR A3 )N(R A3 )-, or -S-, where each R A3 is independently selected from hydrogen or methyl; and Z 2 is selected from hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl is optionally selected from (1-4C)alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NR B4 R B5 or (1-4C)alkoxy (wherein R B4 and R B5 are each independently substituted by one or more substituents selected from hydrogen or (1-2C) alkyl). is the basis.

[0049] In one embodiment, each R 2 are independently expressed as -Y 2 -Z 2 [where Y 2 is absent or the formula -[CR B1 R B2 ] m - (wherein m is an integer selected from 1, 2, 3, or 4, and R B1 and R B2 are each independently selected from hydrogen or (1-2C)alkyl; and Z 2 is hydrogen or (1-6C) alkyl] is the basis.

[0050] In preferred embodiments, each R 2 is H.

[0051] In certain embodiments, n is 1.

[0052] In certain embodiments, n is 2 or 3.

[0053] In one embodiment, there is provided a conjugate as defined herein, said conjugate having one of the following structures: [ka] [ka] [ka] [ka]

[0054] In certain embodiments, the linker is an amino acid or a derivative thereof. Thus, the linker is an amino acid or modified amino acid that connects the carrier to the therapeutic molecule. The amino acid may be modified to include a capping group (e.g., an acetyl capping group formed by capping with acetic anhydride) or a protecting group. Preferably, the capping group or protecting group is present on the side chain of the amino acid.

[0055] Preferably, the amino acid is attached to at least one carrier and at least one therapeutic molecule by at least two of either the side chain, the N-terminus, or the C-terminus. Preferably, the amino acid linker is attached to at least one carrier by the side chain, the N-terminus, or the C-terminus. Preferably, the amino acid linker is attached to at least one therapeutic molecule by the side chain, the N-terminus, or the C-terminus. For example, the amino acid linker is attached to at least one carrier and at least one therapeutic molecule by the N-terminus and the side chain, respectively, the C-terminus and the side chain, respectively, or the N-terminus and the C-terminus, respectively. In one embodiment, the linker is an amino acid attached through the N-terminus and the C-terminus. In one embodiment, the linker is an amino acid attached to the carrier through the N-terminus and to the therapeutic molecule through the C-terminus. In one embodiment, the linker is an amino acid attached to the carrier through the C-terminus and to the therapeutic molecule through the N-terminus. Suitably, the amino acid side chain is attached to a second therapeutic molecule.

[0056] Preferably, the linker is an amino acid selected from glutamic acid, aspartic acid, lysine, valine, leucine, histidine, tryptophan, threonine, serine, isoleucine, methionine, phenylalanine, and tyrosine, or a derivative thereof.

[0057] Preferably, the linker is glutamic acid or a derivative thereof. Preferably, the linker is glutamic acid and its derivatives found in the GABA shunt. Preferably, the linker is selected from glutamic acid, succinic acid, or gamma-aminobutyric acid (GABA).

[0058] In one embodiment, the linker is GABA, which is attached to the carrier via its N-terminus and to the therapeutic molecule via its C-terminus.

[0059] In one embodiment, the linker is succinic acid which is attached to the therapeutic molecule through one of its carboxyl groups and to the carrier through the other carboxyl group.

[0060] In one embodiment, the linker is a glutamic acid that is attached to the carrier via its N-terminus and to the therapeutic molecule via its side chain.

[0061] In one embodiment, the linker is a glutamic acid that is attached to the carrier via its C-terminus and to the therapeutic molecule via its side chain.

[0062] definition Throughout, the symbol "X" refers to various forms of the amino acid aminohexanoic acid, for example 6-aminohexanoic acid.

[0063] Throughout, the designation "B" refers to the amino acid β-alanine.

[0064] Throughout, the designation "[Hyp]" refers to the amino acid hydroxyproline.

[0065] Throughout, the designation "Ac" denotes acetylation of the relevant peptide.

[0066] Throughout, other capital letters refer to the related genetically encoded amino acid according to the accepted alphabetic amino acid code.

[0067] As used herein, the term "alkyl" includes both straight-chain and branched alkyl groups. References to individual alkyl groups, such as "propyl", specifically refer to the straight-chain version only, and references to individual branched alkyl groups, such as "isopropyl", specifically refer to the branched version only. For example, "(1-6C)alkyl" includes (1-4C)alkyl, (1-3C)alkyl, propyl, isopropyl, and t-butyl. Similarly for other groups, for example, "phenyl(1-6C)alkyl" includes phenyl(1-4C)alkyl, benzyl, 1-phenylethyl, and 2-phenylethyl.

[0068] As used herein, the term "alkenyl" refers to an aliphatic group containing at least one double bond, and includes both "unsubstituted alkenyl" and "substituted alkenyl," the latter of which refers to an alkenyl moiety having a substituent replacing a hydrogen on one or more carbons of the alkenyl group. Such substituents may be present on one or more carbons that are included or not included in one or more double bonds. For example, substitution of an alkenyl group with one or more alkyl, carbocyclic, aryl, or heterocyclic groups is contemplated.

[0069] As used herein, the term "alkynyl" refers to an aliphatic group containing at least one triple bond, and includes both "unsubstituted alkynyl" and "substituted alkynyl," the latter of which refers to an alkynyl moiety having a substituent replacing a hydrogen on one or more carbons of the alkynyl group. Such substituents may be present on one or more carbons that are either included or not included in the one or more triple bonds. Additionally, such substituents include all of those contemplated herein.

[0070] The term "(m-nC)" or "(m-nC) group" used alone or as a prefix, refers to any group having m through n carbon atoms.

[0071] "(3-8C)cycloalkyl" means a hydrocarbon ring containing 3 to 8 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or bicyclo[2.2.1]heptyl.

[0072] "(3-8C)Cycloalkenyl" means a hydrocarbon ring containing at least one double bond, for example cyclobutenyl, cyclopentenyl, cyclohexenyl, or cycloheptenyl, for example 3-cyclohexen-1-yl, or cyclooctenyl.

[0073] The term "halo" or "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0074] "Bridged ring system" means a ring system in which two rings share two or more atoms (see, for example, Advanced Organic Chemistry, 4th Edition, Wiley Interscience, by Jerry March, p. 131-133, 1992). Examples of bridged heterocyclic ring systems include aza-bicyclo[2.2.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza-bicyclo[3.2.1]octane, and quinuclidine.

[0075] The term "aryl" refers to an aromatic or polycyclic aromatic ring having 5 to 12 carbon atoms. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. In particular embodiments, aryl is an optionally substituted phenyl.

[0076] The term "heteroaryl" or "heteroaromatic" refers to an aromatic monocyclic, bicyclic, or polycyclic ring containing one or more (e.g., 1 to 4, particularly 1, 2, or 3) heteroatoms selected from nitrogen, oxygen, or sulfur. The term heteroaryl includes both monovalent and divalent species. Examples of heteroaryl groups include monocyclic and bicyclic groups containing 5 to 12 ring members, more typically 5 to 10 ring members. Heteroaryl groups are, for example, 5- or 6-membered monocyclic or 9- or 10-membered bicyclic rings, such as fused 5- and 6-membered rings, or bicyclic structures formed from two fused 6-membered rings. Each ring can contain up to about 4 heteroatoms, typically selected from nitrogen, sulfur, and oxygen. Typically, heteroaryl rings contain no more than 3 heteroatoms, more typically no more than 2 heteroatoms, e.g., 1 heteroatom. In one embodiment, the heteroaryl ring contains at least one nitrogen atom. The nitrogen atoms in the heteroaryl ring can be basic, as in an imidazole or pyridine, or essentially non-basic, as in the case of an indole or pyrrole nitrogen. Generally, the number of basic nitrogen atoms present in a heteroaryl group is at least 5 or more, including any amino acid substituents on the ring.

[0077] Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolinyl, isoquinolyl, and quinolyl. These include nazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzisoquinolinyl, pyridopyrazinyl, thieno[2,3-b]furanyl, 2H-furo[3,2-b]-pyranyl, 5H-pyrazino[2,3-d]-o-oxazinyl, 1H-pyrazolo[4,3-d]-oxazolyl, 4H-imidazo[4,5-d]thiazolyl, pyrazino[2,3-d]pyridazinyl, imidazo[2,1-b]thiazolyl, and imidazo[1,2-b][1,2,4]triazinyl. "Heteroaryl" also includes partially aromatic di- or polycyclic ring systems in which at least one ring is aromatic and one or more of the other rings are non-aromatic, saturated or partially saturated, so long as at least one ring contains one or more heteroatoms selected from nitrogen, oxygen, or sulfur. Examples of partially aromatic heteroaryl groups include, for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1,2,3,4-tetrahydroquinolinyl, dihydrobenzothienyl, dihydrobenzofuranyl, 2,3-dihydro-benzo[1,4]dioxinyl, benzo[1,3]dioxolyl, 2,2-dioxo-1,3-dihydro-2-benzothienyl, 4,5,6,7-tetrahydrobenzofuranyl, indolinyl, 1,2,3,4-tetrahydro-1,8-naphthyridinyl, 1,2,3,4-tetrahydropyridido[2,3-b]pyrazinyl, and 3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazinyl.

[0078] Examples of 5-membered heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl, and tetrazolyl groups.

[0079] Examples of 6-membered heteroaryl groups include, but are not limited to, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, and triazinyl.

[0080] Bicyclic heteroaryl groups are, for example, groups selected from the following: a benzene ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a pyridine ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; A pyrimidine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrrole ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; A pyrazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; A pyrazine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an imidazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an oxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isoxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; A thiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isothiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiophene ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a furan ring fused to a 5- or 6-membered ring containing 1, 2, or 3 ring heteroatoms; a cyclohexyl ring fused to a 5- or 6-membered aromatic heterocycle containing 1, 2, or 3 ring heteroatoms; and A cyclopentyl ring fused to a 5- or 6-membered aromatic heterocycle containing 1, 2, or 3 ring heteroatoms.

[0081] Particular examples of bicyclic heteroaryl groups containing a 6-membered ring fused to a 5-membered ring include, but are not limited to, benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxalyl, and pyrazolopyridinyl groups.

[0082] Particular examples of bicyclic heteroaryl groups containing two fused 6-membered rings include, but are not limited to, quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolidinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl, and pteridinyl groups.

[0083] The term "optionally substituted" refers to groups, structures, or molecules that are substituted and to groups, structures, or molecules that are not substituted. 1 Any CH, CH2, CH3 group or heteroatom (i.e., NH) in the group is optionally substituted" 1 It means that (any) one of the hydrogen atoms of the group is replaced by an appropriately defined group.

[0084] Where any substituent is selected from "one or more" groups, this definition should be understood to include all of the substituents being selected from one of the specified groups or the substituents being selected from two or more of the specified groups.

[0085] Carrier The conjugates of the invention comprise a linker that is used to attach a therapeutic molecule to a carrier molecule to form the conjugate.

[0086] In general, carrier molecules assist in transporting therapeutic molecules to reach therapeutic targets, whether the therapeutic molecule is a gene, transcript, or protein. Carriers have a stabilizing effect on therapeutic molecules, allowing them to reach therapeutic targets without degradation. Similarly, carriers have an effect of facilitating the transfer of therapeutic molecules into target cells.

[0087] A variety of known carrier molecules are preferably used in the conjugates of the present invention, including a variety of biologically acceptable molecules, such as proteins, peptides, fatty acids, polymers, nanoparticles, and nucleic acid polymers.

[0088] In one embodiment, the carrier is a peptide.

[0089] Suitably, the carrier peptide is attached to the linker at the N-terminus or C-terminus of the carrier peptide.

[0090] Preferably, in any of the structures disclosed herein, the peptide carrier is attached to the therapeutic molecule at the N- or C-terminus of the peptide via a linker, and similarly, the therapeutic molecule is attached to the peptide carrier at the N- or C-terminus via a linker. Suitable peptide carriers are known in the art, for example, as described in GB1812972.6, GB1812980.9, WO2009 / 147368, WO2013 / 030569, WO2009 / 005793.

[0091] Preferably, when the carrier molecule is a peptide, the peptide is not glycosylated. Preferably, the carrier molecule is not a glycosylated peptide.

[0092] Preferably, the peptide carrier is 40 amino acids or less in length. Thus, the peptide is considered to be an oligopeptide.

[0093] Suitably, the peptide has a total length of 3 to 30 amino acid residues, preferably 5 to 25 amino acid residues, 10 to 25 amino acid residues, 13 to 23 amino acid residues, 15 to 20 amino acid residues.

[0094] Suitably, the peptides have an overall length of at least 12, at least 13, at least 15, at least 16, at least 17 amino acid residues.

[0095] Advantageously, the peptide is capable of penetrating cells, and therefore the peptide is considered to be a cell penetrating peptide.

[0096] Preferably, the carrier peptide has a sequence that is a contiguous single molecule, so that the various domains of the peptide are contiguous. Preferably, the peptide may have several domains that are linearly arranged between the N-terminus and the C-terminus. Preferably, the peptide carrier comprises various types of domains, such as hydrophobic domains, hydrophilic domains, cationic domains, anionic domains, neutral domains, acidic domains, basic domains. Preferably, the peptide carrier comprises several domains in any arrangement.

[0097] By "cationic" herein is meant an amino acid or domain of amino acids that carries an overall positive charge at physiological pH.

[0098] Suitably, each cationic domain has an isoelectric point (pI) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0099] Suitably, each cationic domain has an isoelectric point (pI) of at least 10.0.

[0100] Preferably, each cationic domain has an isoelectric point (pI) of 10.0 to 13.0.

[0101] Preferably, the isoelectric point of the cationic domain is calculated at physiological pH by any suitable means available in the art. www.isoelectric.org ) (Biol Direct. 2016; 11: 55. DOI: 10.1186 / s13062-016-0159-9).

[0102] As used herein, "hydrophobic" refers to an amino acid or domain of amino acids that has the ability to repel water or is immiscible with water.

[0103] Suitably, each hydrophobic domain has a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0104] Preferably, each hydrophobic domain has a hydrophobicity of 0.4 to 1.4.

[0105] Preferably, hydrophobicity is measured by White and Wimley: WC Wimley and SH White, "An experimentally determined hydrophobicity scale for proteins at membrane interfaces", Nature Struct Biol, 3: 842 (1996).

[0106] Preferably, the peptide carrier comprises or consists of a hydrophobic domain and / or a cationic domain. Preferably, the peptide carrier comprises at least one cationic domain and at least one hydrophobic domain. Preferably, the peptide carrier consists of two cationic domains and one hydrophobic domain.

[0107] Preferably, the cationic domains are located at the N- and C-termini of the peptide carrier. Preferably, at either terminus of the peptide carrier. Preferably, one or more hydrophobic domains are located at the centre of the peptide carrier. Preferably, a hydrophobic domain separates two cationic domains. Preferably, each hydrophobic domain carries a cationic domain on its side. Preferably, no cationic domain is adjacent to another cationic domain.

[0108] Preferably, each domain is 3 to 15 amino acid residues in length. Preferably, each domain is 3 to 7 amino acid residues in length. Preferably, each domain of the same type is of similar length, preferably each domain of the same type is of the same length. Preferably, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues.

[0109] Preferably, each hydrophobic domain has a length of 3 to 6 amino acid residues. Preferably, each hydrophobic domain has a length of 5 amino acid residues.

[0110] Preferably, the peptide carrier is a positively charged peptide.

[0111] Preferably, the peptide carrier is an arginine-rich peptide. Preferably, the peptide carrier comprises at least 20%, at least 30%, at least 32%, at least 34%, at least 36%, at least 38%, at least 40%, at least 42%, at least 44%, at least 46%, at least 48%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of arginine residues. Preferably, the peptide carrier comprises a majority of arginine residues.

[0112] Preferably, the peptide carrier does not comprise an artificial amino acid. Preferably, the peptide carrier does not comprise an aminohexanoic acid residue. Here, "artificial" amino acid or residue refers to any amino acid that does not occur in nature, including synthetic amino acids, modified amino acids (e.g., sugar modified), non-natural amino acids, man-made amino acids, spacers, and non-peptide bond spacers.

[0113] Synthetic amino acids are those that are chemically synthesized by humans.

[0114] For the avoidance of doubt, aminohexanoic acid (X) is an unnatural amino acid in the context of the present invention.

[0115] Preferably, the amino acid is positively charged.

[0116] Preferably, the cationic domains are arginine-rich. Preferably, each cationic domain is composed mostly of arginine residues. Preferably, the cationic domains comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 80%, at least 90% of arginine residues. Preferably, each cationic domain comprises between 40 and 70% of arginine residues.

[0117] Preferably, each hydrophobic domain consists predominantly of arginine residues. Preferably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acid residues. Preferably, each hydrophobic domain consists of hydrophobic amino acid residues.

[0118] Preferably, each cationic domain has at least 3 arginine residues, preferably at least 4 arginine residues. Preferably, each cationic domain contains 4, 5, 6 or more arginine residues. Preferably, a cationic domain comprises less than 3 consecutive arginine residues, preferably less than 2 consecutive arginine residues.

[0119] Suitably, the cationic domain comprises amino acid units selected from among: RBR, RXR, XXR, XRR, RRX, BXR, RXB, XRB, RBB, BRB, BBR, RRB, BRR, and BRX R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0120] Suitably, the cationic domain is formed from amino acid units selected from among R, RR, RJR, RRJ, and JRR in any combination or permutation, where J represents any unnatural amino acid.

[0121] Suitably, the cationic domain comprises or consists of (RXR)n (wherein n=2, 3 or 4) (SEQ ID NOs: 1 to 3), and / or (RBR)n (wherein n=2, 3 or 4) (SEQ ID NOs: 4 to 6), and / or (RHR)n (wherein n=2, 3 or 4) (SEQ ID NOs: 7 to 9).

[0122] Suitably, the cationic domain may comprise serine, proline and / or hydroxyproline residues. Suitably, the cationic domain may further comprise RP, PR, PP, RPR, RRP, PRR, PRP, Hyp;R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above.

[0123] Suitably, the hydrophobic domain may comprise one of the following sequences: ZAA, ZA, Z, AZA, AZ, ZAZ, ZZA, and ZZZ.

[0124] Here, Z represents a 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (TIC) residue.

[0125] Here, A represents a hydrophobic amino acid residue as defined above.

[0126] Preferably, the hydrophobic domain is selected from one of the following sequences: GFTGPL (SEQ ID NO:10), QFL, Z, ZL, F, FL, FQILY (SEQ ID NO:11), FQ, WF, QF, FQ, and YQFLI (SEQ ID NO:12). Preferably, the core domain is selected from one of the following sequences: Z, F, and FL, or any combination thereof, where Z is a 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (TIC) residue.

[0127] The or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:12), FQILY (SEQ ID NO:11), ILFQY (SEQ ID NO:13), FQIY (SEQ ID NO:14), WWW, WWPWW (SEQ ID NO:15), WPWW (SEQ ID NO:16), WWPW (SEQ ID NO:17), ILFQ (SEQ ID NO:18), ILIQ (SEQ ID NO:19), IKILFQN (SEQ ID NO:20), IHILFQN (SEQ ID NO:21), IRILFQN (SEQ ID NO:22), IILFQN (SEQ ID NO:23), KILFQN (SEQ ID NO:24), or KILFQN (SEQ ID NO:25). SEQ ID NO:24), HILFQN (SEQ ID NO:25), RILFQN (SEQ ID NO:26), ILFQN (SEQ ID NO:27), HLIQN (SEQ ID NO:28), KILIQN (SEQ ID NO:29), KILIQY (SEQ ID NO:30), HILIQN (SEQ ID NO:31), RILIQN (SEQ ID NO:32), HILIQY (SEQ ID NO:33), RILIQY (SEQ ID NO:34), ILIQN (SEQ ID NO:35), ILIQY (SEQ ID NO:36), or various combinations thereof, or various combinations with the amino acid units listed above.

[0128] Suitably, the peptide carrier may consist of one of the following sequences: RRRRR (SEQ ID NO:37) RRRRRR (SEQ ID NO:38) RRRRRRR (SEQ ID NO:39) RRRRRRRR (SEQ ID NO:40) (RXRRBR)2 (SEQ ID NO: 41) RXRRBRRXRRBRX (SEQ ID NO:42) RXRRXRRXRRXRX (SEQ ID NO:43) RXRRBRRFQILYRBRXR (SEQ ID NO:44) RXRRBRRXRILFQYRXRBRXR (SEQ ID NO:45) RXRRBRRXRILFQYRXRXRXR (SEQ ID NO:46) RXRRXRILFQYRXRRXR (SEQ ID NO:47) RBRRXRRBRILFQYRBRXRBR (SEQ ID NO:48) RBRRXRRBRILFQYRXRBRXR (SEQ ID NO:49) RBRRXRRBRILFQYRXRRXR (SEQ ID NO:50) RBRRXRRBRILFQYRXRBRX (SEQ ID NO:51) RXRRBRRXRILFQYRXRRXR (SEQ ID NO:52) RXRRBRRXRILFQYRXRBRX (SEQ ID NO:53) RXRRBRRXRILFQYRXRBRXR (SEQ ID NO:54) RXRRBRRXRYQFLIRXRBRXR (SEQ ID NO:55) RXRRBRRXRIQFLIRXRBRXR (SEQ ID NO:56) RXRRBRRXRQFLIRXRBRXR (SEQ ID NO:57) RXRRBRRXRQFLRXRBRXR (SEQ ID NO:58) RXRRBRRXYRFLIRXRBRXR (SEQ ID NO:59) RXRRBRRXRFQILYRXRBRXR (SEQ ID NO:60) RXRRBRRXYRFRLIXRBRXR (SEQ ID NO:61) RXRRBRRXILFRYRXRBRXR (SEQ ID NO:62) RXRRBRRXRIYQFLIRXRBRXR (sequence number: 63).

[0129] Suitably, the peptide carrier may consist of one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO:64) YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO:65) YQFLIRBRRBRBRBBRXRBYQFLI (sequence number: 66).

[0130] Suitably, the peptide carrier may consist of one of the following sequences: Suitably the peptide carrier may consist of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:67) RBRRBRRYQFLIRBRBR (SEQ ID NO:68) RBRRBRRILFQYRBRBR (SEQ ID NO:69) RBRRBRFQILYBRBR (SEQ ID NO:70) RBRRBRRFQILYRBHBH (SEQ ID NO:71) RBRRBRRFQILYHBHBR (SEQ ID NO:72) RBRRBRFQILYRBHBH (sequence number: 73).

[0131] Preferably, the peptide carrier is modified at the N-terminus. Preferably, the peptide carrier is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated, or modified with an additional fatty acid. Preferably, the peptide carrier is N-acetylated.

[0132] Optionally, the N-terminus of the peptide carrier may be unmodified.

[0133] In one embodiment, the peptide carrier is N-acetylated.

[0134] Preferably, the carrier is bonded to the linker by a covalent bond. Preferably, the linker is bonded to the carrier by an amide bond, an ester bond, an ether bond, a disulfide bond, a thioether bond. Preferably, the carrier is bonded to the linker by an amide bond or an ester bond.

[0135] therapeutic molecules The complexes of the present invention comprise a therapeutic molecule bound to a carrier molecule to form said complex, which aids in the delivery of the therapeutic molecule to the appropriate therapeutic target.

[0136] Therapeutic molecules are various molecules for the treatment of diseases. Therapeutic molecules are selected from nucleic acids, peptide nucleic acids, oligonucleotides, antisense oligonucleotides (e.g., PNA, PMO), mRNA, gRNA (e.g., using CRISPR / Cas9 technology), short interfering RNA, microRNA, antagomir RNA, peptides, cyclic peptides, proteins, pharmaceuticals, drugs, or nanoparticles.

[0137] The therapeutic protein is selected from an antibody, an antigen, a VH domain, a VL domain, an scFv molecule, an Fc moiety, a receptor or its extracellular domain, a Fab, and a receptor binding protein of a ligand, an enzyme, a growth factor, an interleukin, a cytokine, or a chemokine. Preferably, the therapeutic molecule is a nucleic acid. Preferably, the therapeutic molecule is an oligonucleotide, which may be an antisense oligonucleotide.

[0138] Therapeutic nucleic acid sequences are selected from a variety of available sources, for example, antisense oligonucleotides for exon skipping in DMD are https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exon-skipping-across-the-human- and therapeutic antisense oligonucleotides complementary to the ISSN1 or IN7 sequences for the treatment of SMA are described in Zhou, HGT, 2013; and Hammond et al, 2016; and Osman et al, HMG, 2014. In one embodiment, the therapeutic molecule is an antisense oligonucleotide.

[0139] Preferably, the antisense oligonucleotides consist of phosphorodiamidate morpholino oligonucleotides (PMOs).

[0140] Alternatively, the oligonucleotide is a modified PMO or any other charge-neutral oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA (e.g., γ-PNA (Bahal, Nat.Comm. 2016)), an oligonucleotide phosphoramidate (wherein the non-linking oxygen of the phosphate is replaced by an amine or alkylamine; e.g., those described in WO2016028187A1), or any other partially or completely charge-neutralized oligonucleotide.

[0141] In one embodiment, the therapeutic molecule of the conjugate is an oligonucleotide that is complementary to the pre-mRNA of the gene target, hi one embodiment, the therapeutic molecule is a small interfering RNA.

[0142] Preferably, an oligonucleotide complementary to the pre-mRNA of the gene target creates a steric blocking event and modifies the pre-mRNA, leading to a modified mRNA and thus a protein of modified sequence.

[0143] Preferably, the steric blocking event is exon inclusion or exon skipping. In one embodiment, the steric blocking event is exon skipping. Preferably, the therapeutic molecule is an oligonucleotide sequence for inducing exon skipping. Preferably, the therapeutic molecule is an oligonucleotide sequence that induces exon skipping of one or multiple exons.

[0144] Preferably, the therapeutic molecule is one that is used to treat a genetic disease. Preferably, the therapeutic molecule is one that is used to treat an inherited genetic disease. Preferably, the therapeutic molecule is one that is used to treat an inherited X-linked genetic disease.

[0145] Preferably, the therapeutic molecule is one that is used to treat a genetic neuromuscular disease. Preferably, the therapeutic molecule is one that is used to treat a genetic disease of the neuromuscular system. Preferably, the therapeutic molecule is one that is used to treat an inherited neuromuscular genetic disease. Preferably, the therapeutic molecule is one that is used to treat an inherited X-linked genetic disease of the neuromuscular system.

[0146] Preferably, in any of the above embodiments, the therapeutic molecule is a nucleic acid, preferably an oligonucleotide, preferably an antisense oligonucleotide.

[0147] Preferably, the therapeutic molecule is one used for the treatment of DMD. Preferably, the therapeutic molecule for the treatment of DMD is a nucleic acid, preferably an antisense oligonucleotide.

[0148] Preferably, the antisense oligonucleotides are for inducing exon skipping in the dystrophin gene for the treatment of DMD.

[0149] In one embodiment, the antisense oligonucleotide sequence is for inducing exon skipping of a single exon of the dystrophin gene for the treatment of DMD. Preferably, the single exon is selected from any exon associated with DMD, such as any exon in the dystrophin gene, e.g., exon 45, 51, or 53. Preferably, the medical use of the therapeutic molecule is the same as the medical use of the complex comprising said therapeutic molecule. Thus, preferably, any of the medical uses described herein in relation to the therapeutic molecule equally apply to the complex of the present invention.

[0150] PMO oligonucleotides of either sequence are commercially available (eg, Gene Tools Inc., USA).

[0151] Optionally, lysine residues can be added to one or both ends of the therapeutic molecule (eg, PMO or PNA) prior to conjugation to the peptide to improve water solubility.

[0152] Preferably, the therapeutic molecule has a molecular weight of 5,000 Da or less, preferably 3,000 Da or less, preferably 1,000 Da or less.

[0153] Imaging molecules The complexes of the present invention equally comprise an imaging molecule bound to a carrier molecule to provide said complex.

[0154] Imaging molecules are any type of molecule that allows visualization of the complex. Preferably, the imaging molecule is capable of indicating the location of the complex, preferably in vitro or in vivo. Preferably, a method of monitoring the location of a complex comprising an imaging molecule is provided, comprising administering the complex to a subject and imaging the subject to indicate the location of the complex.

[0155] Examples of imaging molecules include detection molecules, contrast molecules, or enhancement molecules. Suitable imaging molecules are selected from radionuclides, fluorophores, nanoparticles (e.g., nanoshells), nanocargoes, color-forming agents (e.g., enzymes), radioisotopes, dyes, radio-opaque materials, fluorescent compounds, and combinations thereof.

[0156] Preferably, imaging molecules are visualized using imaging technologies, which may be cellular imaging technologies or medical imaging technologies. Suitable cellular imaging technologies include, for example, cellular image analysis, fluorescence microscopy, phase contrast microscopy, SEM, TEM. Suitable medical imaging technologies include, for example, X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI.

[0157] In some cases, the imaging molecule is considered a diagnostic molecule. Preferably, the diagnostic molecule allows for the diagnosis of a disease using the conjugate. Preferably, diagnosis of the disease is achieved through measuring the location of the conjugate using the imaging molecule. Preferably, a method of diagnosing a disease is provided, the method comprising administering to a subject an effective amount of a conjugate comprising an imaging molecule and monitoring the location of the conjugate.

[0158] Suitably, the details of the linker for the conjugate comprising an imaging molecule are the same as those described above for the conjugate comprising a therapeutic molecule.

[0159] Preferably, the complex is capable of penetrating into cells and tissues, preferably into the nucleus of cells, preferably into muscle tissue.

[0160] Complex The conjugate of the present invention comprises at least one carrier, as defined according to the first aspect, linked to at least one therapeutic molecule using at least one linker.

[0161] Preferably, a linker of the invention is used to attach a carrier to one or more therapeutic molecules to provide a conjugate. Preferably, therefore, one or more linkers of the invention are used to attach a carrier to one or more therapeutic molecules.

[0162] Preferably, the linker is attached to at least one therapeutic molecule via at least one linker. Preferably, therefore, the conjugate of the invention comprises a linker attached to at least one therapeutic molecule via at least one linker.

[0163] Suitably, the conjugate may comprise one or more linkers and / or one or more therapeutic molecules.

[0164] In one embodiment, the conjugate comprises a carrier covalently attached to a therapeutic molecule via a linker. Suitably, the conjugate comprises or consists of the following structure: [Carrier]-[Linker]-[Therapeutic molecule]

[0165] Preferably, the carrier is linked to two therapeutic molecules. In such an embodiment, the conjugate may comprise a carrier covalently linked to two therapeutic molecules via a linker. Preferably, the conjugate comprises or consists of the following structure: [ka]

[0166] Alternatively, the conjugate may comprise a carrier covalently attached to two therapeutic molecules via two linkers. Suitably, the conjugate comprises or consists of the following structure: [ka]

[0167] Alternatively, the complex comprises or consists of the structure: [therapeutic molecule]-[linker]-[carrier]-[linker]-[therapeutic molecule]

[0168] Preferably, the complex may comprise one or more carriers. Preferably, each carrier is covalently linked via a linker. Preferably, the two carriers are not contiguous. Preferably, the complex may comprise two carriers. Preferably, therefore, the complex may comprise a first carrier and a second carrier, preferably linked via a first linker and a second linker. Preferably, each carrier is the same or different. Preferably, each linker is the same or different. Each carrier may have a specific function. Preferably, at least one carrier has a function of cell penetration. However, the functions of other carriers include receptor binding, enzyme activation, enzyme inhibition, solubility regulation, half-life regulation, indication, detection, stability regulation, conformation or orientation regulation, etc.

[0169] In one embodiment, the conjugate comprises a first carrier covalently attached by a first linker to a second carrier, said second carrier being covalently attached to a second linker, said second linker being covalently attached to a therapeutic molecule.

[0170] Suitably, the complex comprises or consists of the following structure: [carrier]-[linker]-[carrier]-[linker]-[therapeutic molecule]

[0171] In one embodiment, a first carrier has a cell permeability function and a second carrier has a receptor binding function.

[0172] Advantageously, the complex of the present invention can exist in either orientation. Advantageously, therefore, the conformation of the complex is inverted.

[0173] Preferably, in any of the above embodiments, the or each therapeutic molecule is replaced by an imaging molecule. Preferably, the or each imaging molecule is bound to the or each therapeutic molecule or to the carrier or carriers. Preferably, the or each imaging molecule is bound by a further linker. Preferably, the further linker is a linker according to the invention. Preferably, the linker and any further linkers are the same or different.

[0174] Preferably, any of the carriers listed herein are used in the preparation of a complex according to the present invention. Suitably, any of the therapeutic molecules listed herein are used in a conjugate according to the present invention.

[0175] Pharmaceutical Compositions The conjugates of the invention are formulated into pharmaceutical compositions for delivery to a subject in need thereof.

[0176] Suitably, the pharmaceutical composition comprises a conjugate of the invention.

[0177] Suitably, the pharmaceutical composition may further comprise a pharma- ceutically acceptable diluent, adjuvant, or carrier.

[0178] Suitable pharma- ceutically acceptable diluents, adjuvants, and carriers are known in the art.

[0179] As used herein, the expression "pharmacologically acceptable" refers to ligands, substances, formulations, and / or dosage forms that are suitable for use in contact with the tissues of human beings and animals, within the bounds of sound medical common sense, without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0180] As used herein, the expression "pharmaceutical acceptable carrier" refers to a pharmaceutical acceptable substance, formulation, or vehicle, such as a liquid or solid filler, diluent, additive, solvent, or encapsulating material, involved in carrying or transporting the conjugate from one organ or part of the body to another organ or part of the body. Each cell penetrating peptide must be "acceptable" in the sense that it is compatible with the other components of the composition, such as the peptide and the therapeutic molecule, and must not be harmful to humans. Lyophilized compositions (to be reconstituted and administered) are also within the scope of the compositions of the present invention.

[0181] Pharmaceutically acceptable carriers are, for example, additives, vehicles, diluents, and combinations thereof. For example, when compositions are administered orally, they are formulated as tablets, capsules, granules, powders, or syrups; for parenteral administration, they are formulated as injections, drops, nebulizers, aerosols, or suppositories. These compositions are prepared by conventional means, and if necessary, the active compound (i.e., the complex) is mixed with various conventional additives, such as excipients, binders, disintegrants, lubricants, flavorings, solubilizers, suspension aids, emulsifiers, coating agents, or combinations thereof.

[0182] It should be understood that the pharmaceutical compositions described herein can further include additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like, for medical use to alleviate, mediate, and treat the diseases, disorders, and conditions described herein. Preferably, the pharmaceutical composition is for use as a medicament, preferably for use as a medicament in the same manner as described herein for the conjugate. All features described herein for treatment using the conjugate apply to the pharmaceutical composition.

[0183] In another aspect, there is provided a method of treating a disease or condition in a subject in need thereof, the method comprising administering a therapeutically effective amount of a pharmaceutical composition according to the third aspect.

[0184] medical use Conjugates comprising the peptides of the invention are used as medicaments for the treatment of diseases.

[0185] The medicament is in the form of a pharmaceutical composition as defined above.

[0186] In a further aspect, there is also provided a method of treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a conjugate according to the first aspect.

[0187] Preferably, the medical treatment requires the delivery of a therapeutic molecule to a tissue or cell, preferably to the nucleus of a cell, preferably after systemic injection.

[0188] The diseases to be treated include a variety of diseases in which improved penetration of the cellular and / or nuclear membrane by therapeutic molecules would lead to improved therapeutic efficacy.

[0189] Suitably, the conjugate is for use in the treatment of a disease defined by the therapeutic utility of the therapeutic molecule.

[0190] Suitably, the complex comprising the linker of the invention is suitable for the treatment of a genetic disease. Suitably, the complex comprising the linker of the invention is suitable for the treatment of an inherited genetic disease. Suitably, the complex comprising the linker of the invention is suitable for the treatment of an inherited X-linked genetic disease. The complex is suitable for the treatment of a disease of the neuromuscular system. Suitably, the complex comprising the linker of the invention is suitable for the treatment of a genetic disease of the neuromuscular system. In a preferred embodiment, there is provided a complex according to the first aspect for use in the treatment of a genetic disease of the neuromuscular system.

[0191] Preferably, the complex is for use in the treatment of an inherited genetic disease of the neuromuscular system. Preferably, the complex is for use in the treatment of an inherited genetic neuromuscular disease. Preferably, the complex is for use in the treatment of an inherited X-linked genetic disease of the neuromuscular system. Preferably, the complex is for use in the treatment of an inherited X-linked genetic neuromuscular disease.

[0192] Preferably, the complex is for use in the treatment of a disease caused by a splicing defect. In such an embodiment, the therapeutic molecule may comprise an oligonucleotide capable of preventing or correcting the splicing defect and / or increasing the production of correctly spliced ​​mRNA as described above. Preferably, in such an embodiment, the therapeutic molecule is an antisense oligonucleotide as described above.

[0193] Suitably, the conjugate is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Bucher muscular dystrophy (BMD), Menkes disease, β-thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), Huntington's disease, Hutchinson-Gilford Progeria syndrome, ataxia telangiectasia, or cancer.

[0194] In one embodiment, the complex is for use in the treatment of DMD. In one embodiment, a complex according to the first aspect is provided for use in the treatment of DMD. Preferably, in such an embodiment, the therapeutic molecule of the complex is capable of restoring the reading frame of dystrophin transcription. Preferably, the therapeutic molecule of the complex is capable of inducing the production of an internally truncated partially functional dystrophin protein. In such an embodiment, the therapeutic molecule is an antisense oligonucleotide as described above in the relevant section. Preferably, the patient or subject to be treated is any animal or human. Preferably, the patient or subject may be a non-human mammal. Preferably, the patient or subject is male or female. In one embodiment, the subject is male.

[0195] Patients or subjects to be treated may be of various ages. Preferably, the patients or subjects to be treated are aged 0-40 years, preferably 0-30 years, preferably 0-25 years, preferably 0-20 years.

[0196] Suitably, the conjugate is for systemic administration to a subject, for example, by intramedullary, intrathecal, intracerebroventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, intracranial, intrastratium, intraventricular, subcutaneous, oral, or intranasal routes.

[0197] In one embodiment, the conjugate is for intravenous administration to a subject.

[0198] In one embodiment, the conjugate is for administration to a subject by injection.

[0199] Preferably, the conjugate is to be administered to a subject in a "therapeutically effective amount," meaning that the amount is sufficient to show benefit in an individual. The actual amount administered, and the rate and time-course of administration, will depend on the nature and severity of the disease being treated. Determination of dosage is within the responsibility of the general practitioner or physician. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, published by Lippincott, Williams & Wilkins.

[0200] Exemplary doses are 0.01-200 mg / kg, 0.05-160 mg / kg, 0.1-140 mg / kg, 0.5-140 mg / kg, 0.5-120 mg / kg, 1-100 mg / kg, 2-80 mg / kg, 5-60 mg / kg, 10-50 mg / kg, or any value therebetween.

[0201] Advantageously, the dosage of the complex of the invention is about or lower than the dosage required to see any effect from the therapeutic molecule alone.

[0202] Preferably, the complex of the present invention is used in an in vitro method, preferably an in vitro laboratory method. Preferably, the complex of the present invention is used in an in vitro method for testing the efficacy of a candidate therapeutic molecule. Preferably, the in vitro method is an assay. For example, the complex of the present invention is used in a splice correction assay, an exon skipping assay, a serum stability assay, a cell viability assay, or an assay for repair of a truncated partially functional protein.

[0203] Suitably, the term "in vitro" is intended to encompass experiments using cells in culture, while the term "in vivo" is intended to encompass experiments using intact multi-cellular organisms.

[0204] In one embodiment, the complex is for administration to a subject for subsequent in vitro cellular assessment.

[0205] toxicity The use of a conjugate comprising a linker as defined in the first aspect to link the carrier molecule and the therapeutic molecule advantageously reduces the toxicity of the conjugate, and thus the toxicity of the conjugate of the invention is advantageously lower than that of conventional conjugates, such as those discussed above and demonstrated in the examples.

[0206] Advantageously, following administration of a conjugate of the invention, one or more markers of toxicity are significantly reduced as compared to conventional conjugates that use currently available linkers.

[0207] Preferred markers of toxicity are markers of nephrotoxicity or hepatotoxicity.

[0208] Suitable markers of toxicity include KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine aminotransferase, and aspartate aminotransferase.

[0209] Suitably, the level of at least one of KIM-1, NGAL, and BUN is reduced following administration of a conjugate of the invention compared to a conjugate using a currently available linker.

[0210] Advantageously, the levels of each of KIM-1, NGAL, and BUN are reduced following administration of a conjugate of the invention compared to conjugates using currently available linkers.

[0211] Suitably the level of the or each marker is significantly reduced compared to conventional conjugates.

[0212] Suitably, the level of the or each marker is reduced by 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less following administration of a conjugate of the invention compared to a conjugate using a currently available linker.

[0213] Advantageously, therefore, the conjugates of the invention have reduced nephrotoxicity compared to conjugates using currently available linkers.

[0214] The KIM-1 / creatinine level has been described as a useful indicator of the toxicity of CPPs and CPP complexes. In particular, the KIM-1 / creatinine level is useful for indicating the toxicity of arginine-rich CPP complexes (Vaidya et al., Annu Rev Pharmacol Toxicol. 2008, 48, 463-493; Chaturvedi et al., Int. J. Biol. Sci. 2009, 5, 128-134; and Zhou et al., Sci Reports, 2016, 6, 38930).

[0215] Advantageously, KIM-1 / creatinine levels are reduced following administration of a conjugate of the invention compared to conjugates using currently available linkers.

[0216] Advantageously, KIM-1 / creatinine levels are significantly reduced following administration of a conjugate of the invention as compared to conjugates using currently available linkers.

[0217] Preferably, KIM-1 / creatinine levels are reduced by no more than 5%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, no more than 30%, no more than 35%, no more than 40%, no more than 45%, no more than 50% following administration of a conjugate of the invention compared to a conjugate using a currently available linker.

[0218] Advantageously, the toxicity of the conjugate is significantly reduced compared to cell penetrating peptides and conjugates thereof, in particular KIM-1 / creatinine is a marker of toxicity, which is significantly reduced by 10-fold or less, 20-fold or less, 30-fold or less, 50-fold or less, 60-fold or less, 70-fold or less, 80-fold or less, 90-fold or less, 100-fold or less, 110-fold or less, 120-fold or less when using the conjugates of the present invention comprising a linker as defined herein, compared to conventional conjugates.

[0219] KIM-1 / creatinine levels indicate that there is a reduction in kidney damage and an increase in glomerular filtration. The decrease in KIM-1 / creatinine levels is the result of a decrease in dedifferentiated proximal tubular epithelial cells that are often present in the kidney after ischemic or toxic insults (Chaturvedi et al., 2009 Int. J. Biol. Sci.). KIM-1 / creatinine levels are widely used to assess the toxicity of therapeutic agents.

[0220] Specific embodiments of the present invention will now be described with reference to the figures and tables.

[0221] Throughout the specification and claims, the terms "comprise" and "include" and variations thereof mean "including, but not limited to," and they are not intended to (and do not) exclude other moieties, additives, ingredients, integers, or steps. Throughout the specification and claims, the singular includes the plural unless the content requires otherwise. In particular, where the indefinite article is used, the specification should be understood as contemplating the plural as well as the singular, unless the content requires otherwise.

[0222] It should be understood that any feature, integer, property, compound, chemical moiety, or group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless incompatible. All of the features described in this specification (including the claims, abstract, and drawings), and / or all of the steps of the various methods described, may be combined in any combination, except where at least some of such features and / or steps are mutually exclusive.

[0223] The present invention is not limited to the details of the various preceding embodiments. The present invention extends to any one or any novel combination of features disclosed in this specification (including the claims, abstract, and drawings), or any one or any novel combination of process steps disclosed. The reader's attention is directed to all articles and documents filed contemporaneously with or prior to the specification of this application and published for inspection herewith, and the contents of all such articles and documents are incorporated herein by reference.

[0224] [Example] 1. Materials and Methods 1.1 Materials 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acid, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), Rink amide resin (0.46 mmol g 1), and Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol g 1 ) were obtained from Merck Millipore (Hohenbrunn, Germany). Tentagel Hydroxy-trityl resin was purchased from Rapp Polymere (Tübingen, Germany). HPLC grade acetonitrile, methanol, and synthesis grade N-methyl-2-pyrrolidone (NMP) were obtained from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomas, USA). MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry (Applied Biosystems, Cheshire, UK) workstation. As matrix, 0 mg ml α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water were used. -1Stock solutions were used. Analytical and semi-preparative HPLC was performed on a Varian 940-LC HPLC System (Yarnton, UK). DMEM medium (31966047), fetal bovine serum (FBS) (10270106), antibiotic-antimycotic mixture solution (A5955), ethidium bromide (15585011), 2x ReddyMix PCR Master Mix (AB0575DCLDB), M-MLV first-strand synthesis system (28025013), and TRIzol reagent (15596026) were purchased from ThermoFisher Scientific. RealTime-Glo™ MT Cell Viability Assay (G9711), Maxwell® 16 Total RNA Purification Kit (AS1050) were purchased from Promega. Myoblasts were cultured in PromoCell's Skeletal Muscle Cell Growth Medium Kit (C-23160). Insulin (91077C) and agarose (A9539) were obtained from Sigma-Aldrich. DNA Marker -HyperLadder 50bp (BIO-33039) was obtained from BioLine Reagents. All primers were ordered through IDT. For urine collection, mice were singly housed in metabolic cages from Tecniplast (UK) and a urinary biomarker ELISA for kidney injury marker-1 (KIM-1) (MKM100) was obtained from R&D. All other reagents were obtained from Sigma-Aldrich (UK) unless otherwise indicated.

[0225] 1.2 Synthesis of peptide-PMO conjugates 1.2.1 Synthesis of peptide variants via Microwave Synthesiser Peptides were synthesized on a 100 μmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry according to the manufacturer's recommendations. Peptides with glutamic or succinic acid as linkers were synthesized on Rink amide resin to generate amides at the carboxyl termini of the peptides after TFA cleavage. Peptides with β-alanine linkers were synthesized using preloaded Wang. A full list of peptides synthesized, along with the synthesis method and linker, is shown in Table 1. The side chain protecting groups used were labile to TFA treatment and peptides were synthesized using a 5-fold excess (0.25 mmol) of Fmoc-protected amino acids activated using PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% v / v in DMF) was used to remove the N-Fmoc-protecting groups. Except for the arginine residue, one coupling was performed at 75°C for 5 min at a microwave power of 60 W, and each arginine residue was coupled twice. Each deprotection reaction was performed twice at 75°C (once for 30 s and then once for 3 min) at a microwave power of 35 W. After the synthesis was completed, the resin was washed with DMF (3 x 50 ml) and the N-terminus of the solid-phase-bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature for 15 min. After N-terminus acetylation, the peptide resin was washed with DMF (3 x 20 ml) and DCM (3 x 20 ml). For DPEP peptides with succinic acid at the N-terminus, N-terminus acetylation was not performed. Instead, the free N-terminus of the peptide was treated with succinic anhydride in the presence of DIPEA at room temperature for 30 min, followed by washing with DMF (3 x 20 ml). For the DPEP peptides with glutamic acid as a linker at the N-terminus, the N-terminus was acetylated as described above, but the attachment of the PMO was carried out at the side chain carboxyl group.

[0226] 1.2.2 Synthesis of peptide variants via the Intavis Multipep Synthesiser Peptides with γ-aminobutyric acid linkers were synthesized on Tentagel® Cl-trityl resin at room temperature using an Intavis Multipep Synthesiser and Fmoc chemistry according to the manufacturer's recommendations. Tentagel® Cl-trityl resin was prepared from Tentagel® hydroxy-trityl resin using acetyl chloride as recommended by the manufacturer. Briefly, resin (1 g) was washed with DMF (2×10 ml), dry DCM (3×10 ml), and dry toluene (3×10 ml) and transferred to a round-bottom flask equipped with a condenser. Sufficient toluene was added to cover the resin, and then acetyl chloride was added dropwise (1 ml g of resin). -1 The mixture was heated at 60-70°C for 3 hours with gentle stirring (total volume 1 ml). Upon completion, the resin was cooled to room temperature and then thoroughly washed with toluene (5 x 15 ml), DMF (5 x 15 ml) and finally dry DCM (3 x 15 ml). The resin was then loaded with Fmoc-γ-aminobutyric acid (3 eq) in DCM along with DIEA (8 eq), followed by additional DIEA (4 eq) and the reaction mixture mixed for a total of 1 hour. After 1 hour the resin was then washed with MeOH (0.8 ml g -1 ) for 15 min, followed by washing with DMF (5 × 10 ml) and DCM (5 × 15 ml). The yield and loading of the resin was determined by UV / Vis spectrophotometry at 304 nm to determine Fmoc (0.41 mmol g -1 ), and the resin was used immediately. Typically, peptides were synthesized on a 100 μmol scale using standard Fmoc amino acids with TFA-labile side chain protecting groups, and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.05 mmol) activated with PyBOP (5-fold excess) in the presence of 4-methylmorpholine. Double coupling steps were used, followed by capping with acetic anhydride after each step. Piperidine (20% v / v in DMF) was used to remove the N-Fmoc protecting group. Each deprotection cycle was performed twice at room temperature (10 min each time). After completion of the synthesis, the resin was washed with DMF (3×50 ml) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature for 15 min. After N-terminal acetylation, the peptide resin was washed with DMF (3×20 ml) and DCM (3×20 ml).

[0227] [Table 1] Synthesis of peptides with different linkers, resins used, and C-terminal modifications performed TIFF2025063139000007.tif69170

[0228] 1.2.3 Cleavage from solid support and purification of peptides via semi-preparative HPLC The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of TFA / H2O / triisopropylsilane (TIPS) (95:2.5:2.5, 10 ml) for 3 h at room temperature. Excess TFA was removed by purging with nitrogen. The cleaved peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed with diethyl ether (3 x 40 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector. Peptides were purified by semi-preparative HPLC on a RP-C18 column (10 × 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / HO (0–99%, 0.1% TFA in CH3CN) at a flow rate of 15 ml / min in 15 min. Detection was performed at 220 and 260 nm.

[0229] [Table 2] In the examples, the sequences of peptides synthesized to test different linkers and binding positions are shown. a are listed as their single amino acid abbreviations. b is for peptides; C-terminus = carboxyl terminus, N-terminus = amino terminus. The SEQ ID NOs refer to the sequences of the peptides without any additional N- and C-terminal modifications, e.g. linkers. TIFF2025063139000008.tif75160

[0230] 1.2.4 Synthesis of peptide-PMO conjugates 25-mer antisense sequence for mouse dystrophin exon-23: (GGCCAAACCTCGGCTTACCTGAAAT; SEQ ID NO:74) was used. Peptides were attached to the 3'-end of the PMO either through its C-terminal carboxyl group or N-terminal amino group, depending on the attachment position of the linker. This was achieved by using 2.3-fold and 2-fold equivalents of PyBOP and HOAt (in NMP), respectively, relative to the peptide, and a 2.5-fold excess of peptide (dissolved in DMSO) relative to the PMO, in the presence of 2.3 equivalents of DIPEA. In general, to a solution of peptide (10 μmol) in N-methylpyrrolidone (NMP, 100 μl) was added PyBOP (76.6 μl of a 0.3 M solution in NMP), HOAt (66.7 μl of a 0.3 M solution in NMP), DIPEA (4.0 μl), and PMO (4 μmol, 400 μl of a 10 mM solution in DMSO). The mixture was left at 40° C. for 2 h and the reaction was stopped by adding HO (1 ml). The reaction mixture was purified on a cation exchange chromatography column (Resource S 6 ml column, GE Healthcare) using a linear gradient of sodium chloride (0-1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN at a flow rate of 6 ml / min. The fractions collected after ion exchange were passed through an Amicon® Ultra-15 3K centrifugal filter device to remove excess salt from the peptide-PMO (P-PMO). The complex was lyophilized and analyzed by MALDI-TOF. The complex was dissolved in sterile water and purified through a 0.22 μm cellulose acetate filter before use. The concentration of P-PMO was determined by molar absorptivity measurement of the complex at 265 nm in 0.1 M HCl solution. The overall yield (Table 3) was 26-64% based on P-PMO.

[0231] [Table 3] Yield of large scale synthesized P-PMO conjugate for in vivo analysis (yield is calculated via UV / visible spectroscopy and based on the extinction coefficient of PMO). Purity for P-PMOs is 95% or more as confirmed by normal phase HPLC at 220 nm and 260 nm. PMO used for conjugation to peptide ahas the following sequence: 5'-GGCCAAACCTCGGCTTACCTGAAAT-3'. b The bond position is shown here in bold italics. The part in parentheses is the linker. TIFF2025063139000009.tif70136 The following comparative conjugates were synthesized / obtained and the same PMO was attached to a peptide using comparative linkers:

[0232] [Table 4] Comparison peptide TIFF2025063139000010.tif50170

[0233] 1.3 Quantification and reconstitution of P-PMO P-PMO was dissolved in RNase-free water. An aliquot from this solution was diluted 100-fold in 0.1 M HCl and measured via UV / Visible spectroscopy at 265 nm. The concentration was calculated according to the Beer-Lambert law:

number

[0234] 1.4 Evaluation of in vivo P-PMO treatment 1.4.1 Systemic administration of P-PMO All experiments were performed at the Biomedical Sciences Unit, University of Oxford, under the Home Office Project Licence (UK), in accordance with the Animals (Scientific Procedures) Act 1986 and clinical trial ethics review. Mice were housed in a specialized pathogen-free disease facility, with a 12-h light-dark cycle and a temperature- and humidity-controlled environment. All animals had free access to commercial rodent chow and water. Experiments were performed on female C57BL / 6 mice aged 8-10 weeks. Mice were administered 0.9% saline, 10 mg / kg, 30 mg / kg, or 50 mg / kg P-PMO via a single bolus tail vein injection. One week after administration, mice were sacrificed and the tibialis anterior muscle, diaphragm, and myocardium were harvested, flash frozen on dry ice, and stored at -80°C.

[0235] 1.4.2 Toxicological evaluation of P-PMO After intravenous administration of P-PMO (see section 1.4.1), the animals were housed in metabolic cages for 20 hours, and urine was collected non-invasively under refrigerated conditions on days 2 and 7 after administration. On day 7, blood was collected from the jugular vein, fractionated, and plasma was collected. On day 7, tibialis anterior, diaphragm, and cardiac muscle were collected during dissection. Urinary levels of kidney injury molecule-1 (KIM-1) were quantified by ELISA after appropriate dilution of urine to fit a standard curve. KIM-1 values ​​were normalized to urinary creatinine levels, which were quantified at the MRC Harwell Institute, Mary Lyon Centre (Oxfordshire, UK).

[0236] 1.4.3 qPCR analysis of P-PMO-induced exon skipping Quantification of P-PMO-induced exon skipping was performed on tibialis anterior (TA), diaphragm, and cardiac muscle 7 days after treatment. Briefly, RNA was extracted from homogenized tissues using a TRIzol-based extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify a region spanning exons 23-24 (mDMD23-24, see Table 4), which indicates a non-skipped product, or to specifically amplify the transcriptionally deleted exon 23 using a probe spanning the boundary of exons 22 and 24 (mDMD22-24). The level of each transcript was measured by skipped and non-skipped transcripts and expressed as a percentage of skipped transcripts relative to total transcripts (skipped and non-skipped) (see Table 5 for sequences).

[0237] [Table 5] Primer and probe sequences for quantification of mouse dystrophin (exon 23) exon skipping by qPCR TIFF2025063139000012.tif73154

[0238] 2. Other Examples Synthesis of peptide-PMO conjugates The peptides were synthesized and conjugated to the PMO as previously described. Expanded CUG repeat: (5'-CAGCAGCAGCAGCAGCAGCAG-3': SEQ ID NO: 81) The PMO sequence targeting was purchased from Gene Tools LLC and used to generate further complexes. Cell culture and peptide-PMO treatment Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of M199:DMEM mix (ratio 1:4; Life technologies) supplemented with 20% FBS (Life technologies), gentamicin 50 μg / ml (Life technologies), fetuin 25 μg / ml, bFGF 0.5 ng / ml, EGF 5 ng / ml, and dexamethasone (Sigma-Aldrich) 0.2 μg / ml. Muscle differentiation was initiated by switching the confluent cell medium to myoblast DMEM medium supplemented with insulin (Sigma-Aldrich) 5 μg / ml. WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO at concentrations of 1, 2, 5, 10, 20, or 40 μM. After 48 h of treatment, cells were harvested for analysis. Two days after transfection of peptide-PMO at a concentration of 40 μM in human hepatocytes or at concentrations of 1, 2, 5, 10, 20, or 40 μM in human myoblasts, cell viability was quantified by a fluorescence detection assay (Promega).

[0239] RNA isolation, RT-PCR For human cells: Prior to RNA extraction, cells were lysed in Protease K buffer (NaCl 500 mM, Tris-HCl (pH 7.2) 10 mM, MgCl2 1.5 mM), EDTA 10 mM, 2% SDS, and Protease K 0.5 mg / ml) at 55°C for 45 min. Total RNA was isolated using TriReagent® according to the manufacturer's protocol. 1 μg of RNA was reverse transcribed using a total of 20 μl of M-MLV First Strand Synthesis System (Life Technologies) according to the manufacturer's instructions. 1 μl of the cDNA preparation was subsequently used in semi-quantitative PCR analysis (ReddyMix, Thermo Scientific) according to standard protocols. For each gene, PCR amplification was performed for 25-35 cycles within the linear range of amplification. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified with ImageJ software. Exon inclusion rates were quantified as the percentage of inclusion relative to the total intensity of the isotype signal. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. The PCR cycle consisted of a 15-minute denaturation step, followed by 50 cycles of a 94°C denaturation step for 15 seconds, 58°C annealing for 20 seconds, and 72°C extension for 20 seconds.

[0240] [Table 6] PCR primers TIFF2025063139000013.tif52155

[0241] Animal experiments and ASO injections Experiments were performed at the University of Oxford in accordance with UK legislation. Intravenous injections in HSA-LR C57BL / 6 mice were performed by single or repeated dosing via the tail vein. Doses of 30, 12.5, 7.5 and 5mg / kg of peptide-PMO-CAG7 were diluted in 0.9% saline and administered in a volume of 5-6μl / g body weight. KIM-1 levels in C57BL6 female mice were measured by ELISA (R&D cat# MKM100) with samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentrations.

[0242] [Table 7] The recovery time in C57BL6 mice following injection of DPEP-based [CAG]7PMO conjugates is shorter than following injection of conjugates formed using conventional peptides such as Pip6a. TIFF2025063139000014.tif84169

Claims

1. Structure: 【Chemical 1】 (Here, the carrier is an array: RBRRBRFQILYBRBR (SEQ ID NO: 70) consisting of a peptide, and the peptide is N-acetylated; and the therapeutic molecule is an array: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) consisting of an antisense oligonucleotide, and the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex or a pharmaceutically acceptable salt or solvate compound thereof.

2. Structure: 【Chemical Formula 2】 (Here, the carrier is an array: RBRRBRFQILYBRBR (SEQ ID NO: 70) consisting of a peptide, and the peptide is N-acetylated; and the therapeutic molecule is an array: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) consisting of an antisense oligonucleotide, and the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex or a pharmaceutically acceptable salt thereof.

3. Structure: [Chemical Formula 3] (Here, the carrier is an array: RBRRBRFQILYBRBR (SEQ ID NO: 70) consisting of a peptide, and the peptide is N-acetylated; and the therapeutic molecule is an array: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) consisting of an antisense oligonucleotide, and the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex.

4. Structure: 【Chemical Formula 4】 (Here, the carrier is an array: RBRRBRFQILYBRBR (SEQ ID NO: 70) consisting of a peptide, and the peptide is N-acetylated; and the therapeutic molecule is an array: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) consisting of an antisense oligonucleotide, and the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex of a pharmaceutically acceptable salt.

5. Structure: 【Chemical Formula 5】 (Here, the carrier is an array: RBRRBRFQILYBRBR (SEQ ID NO: 70) consisting of a peptide, and the peptide is N-acetylated; and the therapeutic molecule is an array: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) An antisense oligonucleotide consisting of, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex or a pharmaceutically acceptable salt or solvate thereof; and A pharmaceutically acceptable carrier A pharmaceutical composition comprising. **Claim 6** Structure: 【Chemical Formula 6】 (Here, the carrier is a peptide consisting of the sequence: RBRRBRFQILYBRBR (SEQ ID NO: 70) wherein the peptide is N-acetylated; and the therapeutic molecule is a sequence: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) An antisense oligonucleotide consisting of, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex or a pharmaceutically acceptable salt thereof; and A pharmaceutically acceptable carrier A pharmaceutical composition comprising. **Claim 7** Structure: 【Chemical Formula 7】 (Here, the carrier is a peptide consisting of the sequence: RBRRBRFQILYBRBR (SEQ ID NO: 70) wherein the peptide is N-acetylated; and the therapeutic molecule is a sequence: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) An antisense oligonucleotide consisting of, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO)) complex; and A pharmaceutically acceptable carrier A pharmaceutical composition comprising. **Claim 8** Structure: 【Chemical Formula 8】 (Here, the carrier is a peptide consisting of the sequence: RBRRBRFQILYBRBR (SEQ ID NO: 70) wherein the peptide is N-acetylated; and the therapeutic molecule is a sequence: 5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 81) An antisense oligonucleotide consisting of, wherein the antisense oligonucleotide is a pharmaceutically acceptable salt of a phosphorodiamidate morpholino oligomer (PMO)) complex; and A pharmaceutically acceptable carrier A pharmaceutical composition comprising.

Images