Agents for treatment of claudin expressing cancer diseases

Abstract

To provide a novel agent and method for treatment of cancer diseases.SOLUTION: The present invention provides binding agents that contain a binding domain that is specific for CD3 allowing binding to T cells and a binding domain that is specific for a tumor-associated claudin molecule, and methods of using these binding agents or nucleic acids encoding therefor for treating cancer.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Claudins are integral membrane proteins located within epithelial and endothelial tight junctions. Claudins are predicted to have four transmembrane segments with two extracellular loops and cytoplasmic N- and C-termini. The claudin (CLDN) family of transmembrane proteins plays a crucial role in maintaining epithelial and endothelial tight junctions and may also play a role in cytoskeletal maintenance and cell signaling. [Background technology]

[0002] Claudin 18 (CLDN18) is an integral transmembrane protein (tetraspanin) with four membrane-spanning hydrophobic regions and two extracellular loops (loop 1 surrounded by hydrophobic regions 1 and 2; loop 2 surrounded by hydrophobic regions 3 and 4). Two distinct splice variants of CLDN18 have been described in mice and humans (Niimi, Mol. Cell. Biol., 21:7380-90, 2001). These splice variants (GenBank accession numbers: splice variant 1 (CLDN18.1): NP_057453, NM_016369, and splice variant 2 (CLDN18.2): NM_001002026, NP_001002026) have molecular weights of approximately 27.9 kD and 27.72 kD. The splice variants CLDN18.1 and CLDN18.2 differ in the N-terminal portion including the first transmembrane (TM) region and loop 1, whereas the primary protein sequence at the C-terminus is identical.

[0003] In normal tissues, no detectable expression of CLDN18.2 is observed except in the stomach, where it is expressed exclusively on the surface of short-lived differentiated gastric epithelial cells. CLDN18.2 is maintained during the process of malignant transformation and is therefore frequently displayed on the surface of human gastric cancer cells. Furthermore, this pan-tumor antigen is ectopically activated at significant levels in esophageal, pancreatic, and lung adenocarcinomas. CLDN18.2 protein is also localized in lymph node metastases of gastric adenocarcinoma and in distant metastases, particularly in the ovaries (so-called Krukenberg tumors).

[0004] CLDN6 is expressed in a range of different human cancer cells, while expression in normal tissues is restricted to the placenta.

[0005] The differential expression of various claudins (e.g., CLDN18.2 and CLDN6) between cancer and normal cells, their membrane localization, and their absence in the majority of normal tissues associated with toxicity make these molecules attractive targets for cancer immunotherapy; therefore, the use of antibody-based therapeutics to target claudins promises a high level of therapeutic specificity. Efforts to harness the potential of T cells for cancer treatment include vaccination with tumor-derived protein, RNA, or peptide antigens; infusion of tumor-derived ex vivo expanded T cells (called adoptive transfer); T cell receptor gene transfer; or direct engagement of T cells with bispecific or trispecific antibodies. Similarly, numerous stimulators of T cell responses are undergoing clinical trials, either in combination or as monotherapy, including ligands for Toll-like receptors, antibodies that block CTLA-4 on T cells, immunostimulatory cytokines, or antibodies that neutralize molecules involved in immune evasion of cancer cells (e.g., TGF-beta or B7-H1). Intensive development of T cell-based therapies is motivated by the observation that patients appear to survive significantly longer if their tumors are infiltrated by T cells. Moreover, numerous mouse models have demonstrated that engagement of T cells by various means can eradicate even large tumors, and several T cell therapies have recently made significant progress in treating various cancer indications. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Niimi, Mol.Cell.Biol., 21:7380~90, 2001 Summary of the Invention [Problem to be solved by the invention]

[0007] It was one of the objects of the present invention to provide novel agents and methods for the treatment of cancer diseases. [Means for solving the problem]

[0008] The solution to the problem underlying the present invention is based on the idea of ​​creating a binding agent containing a binding domain specific for tumor-associated claudin molecules, i.e., cancer cells. The other binding domain is specific for CD3, which allows it to bind to T cells and recruit T cells into a complex, thus directing the cytotoxic effects of the T cells toward the cancer cells as targets. The formation of this complex can induce signaling in cytotoxic T cells, either by themselves or in combination with accessory cells, which leads to the release of cytotoxic mediators.

[0009] We report for the first time that binding agents targeting claudins and CD3 can induce potent T cell-mediated cytolysis and are effective in treating tumor diseases.

[0010] In one aspect, the present invention relates to a binding agent comprising at least two binding domains, a first binding domain that binds to a claudin and a second binding domain that binds to CD3. The binding agent of the present invention may bind to cytotoxic cells (by engaging with the CD3 receptor) and to cancer cells expressing a CLDN, which are then targeted for destruction.

[0011] In one embodiment, the binding agent is a bispecific molecule, such as a bispecific antibody, particularly a bispecific single-chain antibody. In one embodiment, the claudin is expressed in a cancer cell. In one embodiment, the claudin is expressed on the surface of a cancer cell. In one embodiment, the claudin is selected from the group consisting of claudin 18.2 and claudin 6. In one embodiment, the first binding domain binds to the extracellular domain of the claudin. In one embodiment, the first binding domain binds to a native epitope of CLDN present on the surface of a living cell. In one embodiment, the first binding domain binds to the first extracellular loop of CLDN. In one embodiment, the second binding domain binds to the epsilon chain of CD3. In one embodiment, the CD3 is expressed on the surface of a T cell. In one embodiment, binding of the binding agent to CD3 on T cells causes proliferation and / or activation of the T cells, with the activated T cells preferably releasing cytotoxic factors (e.g., perforin and granzymes) and initiating cytolysis and apoptosis of cancer cells. In one embodiment, the binding to claudins and / or the binding to CD3 is specific binding.

[0012] In one embodiment, the binding agent is in the form of a full-length antibody or antibody fragment. In one embodiment, the binding agent comprises four antibody variable domains with at least two binding domains, wherein at least one binding domain binds to a claudin and at least one binding domain binds to CD3. In one embodiment, the binding agent comprises an immunoglobulin heavy chain variable domain (VH) with specificity for a claudin antigen (VH(CLDN)), an immunoglobulin light chain variable domain (VL) with specificity for a claudin antigen (VL(CLDN)), an immunoglobulin heavy chain variable domain (VH) with specificity for CD3 (VH(CD3)), and an immunoglobulin light chain variable domain (VL) with specificity for CD3 (VL(CD3)).

[0013] In one embodiment, the binding agent is in the form of a diabody, which comprises a heavy chain variable domain linked to a light chain variable domain in the same polypeptide chain, thereby preventing pairing of the two domains. In one embodiment, the diabody comprises two polypeptide chains, wherein one polypeptide chain comprises a VH(CLDN) and a VL(CD3), and the other polypeptide chain comprises a VH(CD3) and a VL(CLDN).

[0014] In one embodiment, the binding agent is in the form of a bispecific single-chain antibody consisting of two scFv molecules connected via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are preferably arranged from N- to C-terminus in the following order: VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN), or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). In one embodiment, the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are connected via a long peptide linker, preferably a peptide linker comprising the amino acid sequence (GGGGS)3 or VE(GGGGS)2GGVD. In one embodiment, the two VH-VL type scFv units or VL-VH type scFv units are connected via a short peptide linker, preferably via a peptide linker comprising the amino acid sequence SGGGGS or GGGGS.

[0015] In one embodiment, the CLDN is CLDN18.2, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of said amino acid sequence or fragment.

[0016] In one embodiment, the CLDN is CLDN18.2, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof or a variant of said amino acid sequence or fragment.

[0017] In one embodiment, the CLDN is CLDN6, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof or a variant of said amino acid sequence or fragment.

[0018] In one embodiment, the CLDN is CLDN6, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, or SEQ ID NO: 100, or a fragment thereof, or a variant of said amino acid sequence or fragment.

[0019] In one embodiment, the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO: 36, SEQ ID NO: 94 or SEQ ID NO: 95, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO: 37 or SEQ ID NO: 96, or a fragment thereof, or a variant of said amino acid sequence or fragment.

[0020] In one embodiment, the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO: 36, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO: 37, or a fragment thereof, or a variant of said amino acid sequence or fragment.

[0021] In one embodiment, the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof or a variant of said amino acid sequence or fragment.

[0022] In one aspect, the binding agent of the present invention is in the form of a bispecific single-chain antibody comprising two scFv molecules linked via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N-terminus to C-terminus in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3). In one embodiment, the VH(CD3) and VL(CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably comprising the amino acid sequence (GGGGS)4. In one embodiment, the VH(CLDN) and VL(CLDN) are connected via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably via a peptide linker comprising the amino acid sequence (GGGGS)4. In one embodiment, the two VH-VL type scFv units are connected via a linker peptide comprising the amino acid sequence SGGGGS. One or both of the two VH-VL type scFv units may comprise one or more interconnecting disulfide bridges.

[0023] In one aspect, the binding agent of the present invention is in the form of a bispecific single-chain antibody comprising two scFv molecules linked via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N-terminus to C-terminus in the order VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3). In one embodiment, the VH(CD3) and VL(CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably comprising the amino acid sequence (GGGGS)4. In one embodiment, the VL(CLDN) and VH(CLDN) are connected via a peptide linker consisting of 20 to 25, preferably 20 or 25, amino acids (preferably glycine and / or serine), preferably comprising the amino acid sequence (GGGGS)5. In one embodiment, the VL-VH type scFv unit and VH-VL type scFv unit are connected via a linker peptide comprising the amino acid sequence SGGGGS. One or both of the two VL-VH type scFv units or VH-VL type scFv units may comprise one or more interconnecting disulfide bridges.

[0024] In one aspect, the binding agent of the present invention is in the form of a bispecific single-chain antibody comprising two scFv molecules connected via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N- to C-terminus in the order VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3). Preferably, the VL(CD3)-VH(CD3) scFv unit comprises one or more interconnecting disulfide bridges. In one embodiment, the VL(CD3) and VH(CD3) are connected via a peptide linker consisting of 20 to 25, preferably 20 or 25, amino acids (preferably glycine and / or serine), preferably comprising the amino acid sequence (GGGGS)5. In one embodiment, the VH(CLDN) and VL(CLDN) are connected via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably via a peptide linker comprising the amino acid sequence (GGGGS)4. In one embodiment, the VH-VL type scFv unit and the VL-VH type scFv unit are connected via a linker peptide comprising the amino acid sequence SGGGGS. The VH(CLDN)-VL(CLDN) scFv unit may comprise one or more interconnecting disulfide bridges.

[0025] In one aspect, the binding agent of the present invention is in the form of a bispecific single-chain antibody comprising two scFv molecules connected via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N- to C-terminus in the following order: VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3). Preferably, the VL(CD3)-VH(CD3) scFv unit comprises one or more interconnecting disulfide bridges. In one embodiment, the VL(CD3) and VH(CD3) are connected via a peptide linker consisting of 20 to 25, preferably 20 or 25, amino acids (preferably glycine and / or serine), preferably comprising the amino acid sequence (GGGGS). In one embodiment, the VL(CLDN) and VH(CLDN) are connected via a peptide linker consisting of 20 to 25, preferably 20 or 25, amino acids (preferably glycine and / or serine), preferably comprising the amino acid sequence (GGGGS)5. In one embodiment, the two VL-VH scFv units are connected via a linker peptide comprising the amino acid sequence SGGGGS. The VL(CLDN)-VH(CLDN) scFv units may comprise one or more interconnecting disulfide bridges.

[0026] In one embodiment of any of the above aspects, the CLDN is CLDN18.2. Preferably, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO:8, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO:15, or a fragment thereof, or a variant of said amino acid sequence or fragment. Alternatively, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO:6, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO:11, or a fragment thereof, or a variant of said amino acid sequence or fragment. In one embodiment, the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO:95, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO:96, or a fragment thereof, or a variant of said amino acid sequence or fragment.

[0027] In one aspect, the binding agent of the present invention is in the form of a bispecific single-chain antibody comprising two scFv molecules linked via a linker peptide, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N-terminus to C-terminus in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3) or VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN). In one embodiment, the VH(CLDN) and VL(CLDN) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably comprising the amino acid sequence (GGGGS)3. In one embodiment, the VH(CD3) and VL(CD3) are linked via a peptide linker consisting of 15 to 20, preferably 15 or 20, amino acids (preferably glycine and / or serine), and preferably comprising the amino acid sequence GGGGS(GGS)3GGGS. In one embodiment, the two VH-VL scFv units are linked via a linker peptide comprising the amino acid sequence SGGGGS.

[0028] In one embodiment of the above aspect, the CLDN is CLDN6. Preferably, the VH(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 22, or a fragment thereof, or a variant of said amino acid sequence or fragment. Preferably, the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 98, SEQ ID NO: 99, or SEQ ID NO: 100, or a fragment thereof, or a variant of said amino acid sequence or fragment. Most preferably, the VL(CLDN) comprises the amino acid sequence represented by SEQ ID NO: 99, or a fragment thereof, or a variant of said amino acid sequence or fragment. In one embodiment, the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO: 95, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO: 96, or a fragment thereof, or a variant of said amino acid sequence or fragment.

[0029] In one embodiment, the CLDN is CLDN18.2, and the binding agent of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41, or a fragment or variant thereof.

[0030] In one embodiment, the CLDN is CLDN18.2, and the binding agent of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO:103, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:93, or a fragment or variant thereof. In one embodiment, the CLDN is CLDN18.2 and the binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NO:103, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92 and SEQ ID NO:93 or a fragment or variant thereof, with the proviso that the amino acid sequence lacks a secretory signal, such as an N-terminal secretory signal, in particular the sequence according to SEQ ID NO:51, if a secretory signal is present, and / or lacks a His tag, such as a C-terminal His tag, in particular the sequence Gly-Gly-Ser-(His)6 or the sequence (His)6, if a His tag is present.

[0031] In one embodiment, the CLDN is CLDN6, and the binding agent of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, and SEQ ID NO: 45, or a fragment or variant thereof.

[0032] In one embodiment, the CLDN is CLDN6 and the binding agent of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, or a fragment or variant thereof. In one embodiment, the CLDN is CLDN6 and the binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, or a fragment or variant thereof, with the proviso that the amino acid sequence lacks a secretory signal, such as an N-terminal secretory signal, particularly the sequence according to SEQ ID NO: 51, if a secretory signal is present, and / or lacks a His tag, such as a C-terminal His tag, particularly the sequence Gly-Gly-Ser-(His)6 or the sequence (His)6, if a His tag is present.

[0033] In one embodiment, the cancer cells expressing CLDN18.2 are cancer cells of a cancer selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer, gallbladder cancer, and metastases thereof, Krukenberg tumors, peritoneal metastases and / or lymph node metastases.

[0034] In one embodiment, the cancer cells expressing CLDN6 are selected from bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian teratocarcinoma), lung cancer (including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), particularly squamous cell lung carcinoma and squamous cell lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell carcinoma and squamous cell carcinoma), malignant melanoma, head and neck cancer (particularly malignant pleomorphic adenoma), sarcoma (particularly synovial sarcoma and synovial carcinosarcoma), bile duct cancer, and bladder cancer (particularly transitional cancer). and transitional cell papillary carcinoma), kidney cancer (particularly renal cell carcinoma including renal clear cell carcinoma and papillary renal cell carcinoma), colon cancer, small intestine cancer (including ileal cancer, particularly small intestinal adenocarcinoma and ileal adenocarcinoma), testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer (particularly testicular seminoma, testicular teratoma and embryonal testicular cancer), uterine cancer, germ cell tumors (e.g., teratocarcinoma or embryonal carcinoma, particularly testicular germ cell tumors), and metastatic forms thereof.

[0035] In one embodiment, the binding agent has an N-terminal secretion signal and / or a C-terminal histidine epitope tag (preferably a six histidine epitope tag).

[0036] In one aspect, the present invention relates to a recombinant nucleic acid encoding a binding agent of the present invention. In one embodiment, the recombinant nucleic acid is in the form of a vector. In one embodiment, the recombinant nucleic acid is RNA.

[0037] In one aspect, the invention relates to a host cell containing a recombinant nucleic acid of the invention.

[0038] In one aspect, the invention relates to a binding agent of the invention, a recombinant nucleic acid of the invention or a host cell of the invention for use in therapy, in particular for use in treating or preventing cancer.

[0039] In one aspect, the present invention relates to a pharmaceutical composition comprising the binding agent of the present invention, the recombinant nucleic acid of the present invention, or the host cell of the present invention.

[0040] In one aspect, the present invention relates to a method for treating or preventing cancer disease, comprising administering to a patient a pharmaceutical composition of the present invention.

[0041] In one embodiment, cells of the cancer express a claudin to which the binding agent can bind.

[0042] In one embodiment, the claudin is CLDN18.2, and the cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer, gallbladder cancer, and metastases thereof, Krukenberg tumors, peritoneal metastases, and / or lymph node metastases.

[0043] In one embodiment, the claudin is CLDN6, and the cancer is selected from the group consisting of bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian teratoma cancer), lung cancer (including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), particularly squamous cell lung carcinoma and squamous cell lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell carcinoma and squamous cell carcinoma), malignant melanoma, head and neck cancer (particularly malignant pleomorphic adenoma), sarcoma (particularly synovial sarcoma and synovial carcinosarcoma), bile duct cancer, and urinary tract cancer. The cancer is selected from the group consisting of cancer of the bladder (especially transitional cell carcinoma and transitional cell papillary carcinoma), kidney cancer (especially renal cell carcinoma including renal clear cell carcinoma and papillary renal cell carcinoma), colon cancer, small intestine cancer (including cancer of the ileum, particularly small intestinal adenocarcinoma and ileal adenocarcinoma), embryonal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer (especially testicular seminoma, testicular teratoma and embryonal testicular carcinoma), uterine cancer, germ cell tumors (e.g., teratocarcinoma or embryonal carcinoma, particularly testicular germ cell tumors), and metastatic forms thereof.

[0044] In one aspect, the invention provides a binding agent as described herein, or a nucleic acid as described herein encoding the binding agent, or a host cell as described herein, for use in the methods of treatment described herein. In one embodiment, the invention provides a pharmaceutical composition as described herein for use in the methods of treatment described herein.

[0045] According to the present invention, CLDN18.2 preferably has the amino acid sequence according to SEQ ID NO:1, and CLDN6 preferably has the amino acid sequence according to SEQ ID NO:2 or SEQ ID NO:3.

[0046] Other features and advantages of the invention will be apparent from the following detailed description and claims. [Brief explanation of the drawings]

[0047] [Figure 1] Modular layout diagram illustrating the design of recombinant bi-scFv proteins targeting the TAA CLDN18.2. Bi-scFv design at (A) the N-terminal position and (B) the C-terminal position relative to the anti-TAA variable region. The VH and VL regions of anti-CLDN18.2 are generated from the sequence of the monoclonal CLDN18.2 antibody (mCLDN18.2ab). Anti-CD3 collectively represents the VH and VL regions generated from the sequences of the following monoclonal CD3 antibodies: UCHT1-HU (humanized mAB), UCHT1, CLB-T3, TR66, and 145-2C11. Bi-scFv indicates a bispecific single-chain variable fragment; His indicates a hexahistidyl tag; HU indicates humanized; LL indicates a long linker (15 to 18 amino acids); Sec indicates a secretion signal; SL indicates a short linker (5 to 6 amino acids); TAA indicates a tumor-associated antigen; and V indicates the variable regions of the heavy (H) and light (L) chains of the antibody. [Figure 2]The influence of domain orientation and anti-CD3-scFv selection on specific target cell lysis: 1 BiMAB and no. 15 of the 5'-mCLDN18.2abVH-VL_TR66VH-VL-3' bi-scFv were the most potent variants. Several bi-scFv variants directed against CLDN18.2 and CD3 were transiently expressed in HEK293T cells and purified at small scale using a Ni-NTA column to compare their potency in cytotoxicity assays. NugC4 cells, which endogenously express CLDN18.2 and stably express luciferase, were selected as target cells. Human T cells and target cells were incubated with 5 ng / ml of each bi-scFv protein at an E:T ratio of 5:1 in a 96-well format. Negative controls included no. 35, which targets a non-expressed TAA, and nos. 11 and 16, both of which target mouse T cells but not human T cells. Each test sample was plated in sextuplicate, and control samples for Lmin were plated in nine replicates. Pre-analysis incubation times were 8, 16, and 24 hours. After adding luciferin solution at designated time points, luminescence was measured using an Infinite M200 TECAN reader. Specific target cell lysis was calculated by normalizing the sample to the control bi-scFv no. 35 (Lmin). The most potent bi-scFv proteins, i.e., 1BiMAB and no. 15, share the same domain orientation and anti-CD3 origin of mAB TR66, but differ in their codon optimization (HS and CHO, respectively) and long linker sequences. CHO indicates Chinese hamster ovary; mAB indicates monoclonal antibody; HU indicates humanized; TAA indicates tumor-associated antigen. [Figure 3]Coomassie gel and Western blot analysis of the bi-scFv protein 1BiMAB. FCS-free supernatant from monoclonal HEK293 cells stably expressing 1BiMAB was purified by Ni-NTA affinity chromatography (IMAC). Aliquots from various purification steps were loaded onto a 4-12% Bis-Tris gel. (A) Coomassie staining of the cell supernatant, eluate flow-through, and eight fractions. The fractions from the first eluted peak were discarded, while the fractions from the second eluted peak were pooled for further study and dialyzed against PBS followed by 200 mM arginine buffer. (Lane 1: HEK293 / 1BiMAB SN; Lane 2: IMAC flow-through; Lanes 3-4: Elution peak 1 fractions (discarded); Lanes 5-10: Elution peak 2 fractions (pooled).) (B) Western blot analysis of 0.5 μg of 1BiMAB from three independent purifications (lanes 1, 2, and 3). Detection was performed with a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS indicates phosphate-buffered saline; SN indicates supernatant; and WB indicates Western blot. [Figure 4A] The bi-scFv protein 1BiMAB efficiently and specifically binds to CLDN18.2-expressing target cells and human T cells. [Figure 4B] The bi-scFv protein 1BiMAB efficiently and specifically binds to CLDN18.2-expressing target cells and human T cells. [Figure 4C] The bi-scFv protein 1BiMAB efficiently and specifically binds to CLDN18.2-expressing target cells and human T cells. [Figure 4D]The bi-scFv protein 1BiMAB efficiently and specifically binds to CLDN18.2-expressing target cells and human T cells. (A) 2.5 × 105 NugC4 cells endogenously expressing CLDN18.2 were incubated with 50 μg / ml of 1BiMAB or 10 μg / ml of mCLDN18.2ab as a positive control, and their corresponding APC-conjugated secondary antibodies. Control staining included the secondary APC-conjugated antibodies (gah, gam) alone, anti-His and gam APC, or 1BiMAB and gam APC. Analysis was performed by flow cytometry. The MFI of the APC signal was calculated using FlowJo software. (B) 1 × 105 NugC4 cells endogenously expressing CLDN18.2 were stained with increasing concentrations of 1BiMAB (20 pg / ml to 20 μg / ml), anti-His, and gam APC. As a negative control, cells were incubated with anti-His and gam APC. As a positive control, mCLDN18.2ab and gah APC were used. The MFI of the APC signal was calculated using FlowJo software. (C) 1 × 106 human T cells were incubated with increasing concentrations of 1 BiMAB (2 ng / ml to 2 μg / ml), anti-His and gam APC. As a negative control, cells were incubated with anti-His and gam APC, or gam APC alone. The MFI of the APC signal was calculated using FlowJo software. (D) 1 × 105 CLDN18.2-negative PA-1 cells were incubated with increasing concentrations of 1 BiMAB (10 ng / ml to 10 μg / ml), anti-His and gam APC. As a negative control, cells were stained with anti-His and gam APC, or gah APC alone. Cells were confirmed to be CLDN18.2-negative using 10 μg / ml mCLDN18.2ab and gah APC. gah indicates goat anti-human; gam indicates goat anti-mouse; MFI indicates mean fluorescence intensity; TL indicates T lymphocytes. [Figure 5]The bi-scFv protein 1BiMAB induces T cell clustering on the surface of CLDN18.2-positive target cells. NugC4 cells, which endogenously express CLDN18.2, were incubated in 6-well plates with 1 ng / ml and 1 μg / ml of 1BiMAB and human T cells at a 5:1 effector-to-target ratio for 24 hours. T cells alone (TL), target cells alone (NugC4), and human T cells with target cells (-ctrl) were selected as control samples. After 24 hours, the samples were photographed at 200x magnification using a Nikon Eclipse Ti microscope. White arrows indicate clusters of T cells on target cells. TL indicates T lymphocytes. [Figure 6] 1BiMAB mediates T cell activation in a dose-dependent manner. NugC4 cells, which endogenously express CLDN18.2, were incubated in duplicate in a 24-well format with increasing concentrations of the bi-scFv protein 1BiMAB (0.001 ng / ml to 1000 ng / ml) and human T cells at a 5:1 effector-to-target ratio for 24 and 48 hours. As a control, human T cells were incubated with 1BiMAB at 1 ng / ml to 1000 ng / ml without NugC4 target cells to confirm the target-dependent activation of T cells mediated by 1BiMAB. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC, and analyzed by flow cytometry. TL indicates T lymphocytes. [Figure 7]1BiMAB mediates strictly target-dependent T cell activation even after prolonged incubation with CLDN18.2 high-, low-, and non-expressing cell lines. (A) RT-PCR data derived from total RNA of six tumor cell lines are shown. Ct values ​​of CLDN18.2 expression normalized to the housekeeping gene HPRT were calculated from two independent experiments. The breast cancer cell line MCF7 (gray bars) was chosen as a negative CLDN18.2 expression control cell line. (B) The cancer cell lines from (A) were incubated in duplicate in a six-well format with 5 ng / ml of the bi-scFv protein 1BiMAB for 144 hours, with or without human T cells at a 5:1 effector-to-target ratio. T cells were labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC, and the total T cell population (CD3), early activation (CD69), and late activation (CD25) of T cells were analyzed by flow cytometry. TL indicates T lymphocytes. [Figure 8]1BiMAB induces T cell proliferation and granzyme B upregulation only in the presence of CLDN18.2-positive target cells. (A) Human T cells were stained with CFSE and cultured for 120 h alone (TL), in the presence of 1 ng / ml 1BiMAB (TL + 1 ng / ml 1BiMAB), in the presence of NugC4 cells (TL + NugC4), or in the presence of NugC4 cells and 1 ng / ml 1BiMAB (TL + 1 ng / ml 1BiMAB + NugC4). A 5:1 effector-to-target ratio was selected. The decrease in CFSE signal, indicating T cell proliferation, was analyzed by flow cytometry. (B) Human T cells were incubated with or without NugC4 target cells and with or without 5 ng / ml bi-scFv 1BiMAB protein. The effector-to-target ratio was 5:1 in a 6-well format. After 96 hours of co-incubation, T cells were collected, intracellularly stained with anti-GrB-PE, and analyzed by flow cytometry. The MFI of the anti-GrB-PE signal was calculated using FlowJo software. The signal of the unstained sample (TL + NugC4 + 5 ng / ml 1BiMAB) was subtracted from all samples. CFSE indicates carboxyfluorescein succinimidyl ester; GrB indicates granzyme B; MFI indicates mean fluorescence intensity; PE indicates phycoerythrin; and TL indicates T lymphocytes. [Figure 9]The EC50 of 1BiMAB for specific target cell lysis after 48 h is approximately 10 pg / ml. NugC4 cells endogenously expressing CLDN18.2 and stably expressing luciferase were incubated with increasing concentrations of the bi-scFv protein 1BiMAB (0.001 ng / ml to 1000 ng / ml) for 24 and 48 h in triplicate in a 96-well format, along with human T cells at a 5:1 effector-to-target ratio. As a minimum lysis (Lmin) control, effector and target cells were plated without bi-scFv 1BiMAB. Maximum lysis (Lmax), for normalization to spontaneous luminescence counts, was achieved by adding Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv immediately before luciferin addition. After adding luciferin solution, luminescence was measured 24 and 48 hours later using an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - Lmax) / (Lmin - Lmax)] x 100. Values ​​were plotted against the log10 of 1 BiMAB concentration. EC50 indicates the 50% maximally effective concentration; L indicates lysis. [Figure 10A] 1BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 10B] 1BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 10C] 1BiMAB demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 10D]1BiMAB demonstrates in vivo therapeutic efficacy in an advanced SC tumor model. NOD.Cg-Prkdscid IL2rgtm1Wjl / SzJ (NSG) mice were SC-injected with 1x107 HEK293 cells stably expressing CLDN18.2. Five days later, 2x107 human PBMC effector cells were IP-injected into groups G3 and G4, while the control groups (G1 and G2) received PBS alone. Daily IP administration of 5µg of bi-scFv protein 1BiMAB per animal or vehicle as a control began the following day. Treatment was administered for 22 days, and tumor volume was measured using calipers and calculated according to the following formula: mm3 = length (mm) x width (mm) x (width (mm) / 2). (A) Individual tumor volumes and median tumor volumes per group are shown for treatment days 0 and 15 (top row) and 3 and 13 days after treatment termination (bottom row). (B) Average tumor volumes for the two treatment groups implanted with human effector cells are shown. Dashes indicate sacrificed animals. (C) Kaplan-Meier survival curves for all groups from the day of tumor inoculation through day 41. Animals were sacrificed as soon as tumor volumes exceeded 500 mm3. After day 41, all remaining animals were sacrificed for analysis of human effector cell engraftment in the mouse spleens. (D) Splenocytes from all mice were isolated and stained with anti-CD45-APC and anti-CD3-FITC for flow cytometric detection of human T cells. Median engraftment is shown in box plots. G indicates group; IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate-buffered saline; SC indicates subcutaneous. [Figure 11]Figure 1 shows a modular layout diagram illustrating the design of a recombinant bi-scFv protein targeting the TAA CLDN6. Bi-scFv design at (A) the N-terminal position and (B) the C-terminal position relative to the anti-TAA variable region. The anti-CLDN6 VH and VL regions are generated from the sequence of a monoclonal CLDN6 antibody (mCLDN6ab). The anti-CD3 VH and VL regions are generated from the sequence of a monoclonal CD3 antibody TR66. Bi-scFv indicates a bispecific single-chain variable fragment; His indicates a hexahistidyl tag; LL indicates a long linker (15-18 amino acids); Sec indicates a secretion signal; SL indicates a short linker (5 amino acids); TAA indicates a tumor-associated antigen; and V indicates the variable regions of the antibody heavy (H) and light (L) chains. [Figure 12] The bi-scFv proteins 6PHU5 and 6PHU3 induce T cell clustering on the surface of CLDN6-positive target cells. PA-1 cells, which endogenously express CLDN6, were incubated with 50 ng / ml of 6PHU5 or 6PHU3 and human T cells at a 5:1 effector-to-target ratio in 6-well plates for 24 hours. T cells alone (TL), target cells alone (PA-1), and human T cells with target cells (-ctrl) were selected as control samples. After 24 hours, samples were photographed at 200x magnification with a Nikon Eclipse Ti microscope. White arrows indicate clusters of T cells on target cells. TL indicates T lymphocytes. [Figure 13]Effect of domain orientation on potency: The bi-scFv protein 6PHU3 is slightly more efficient than 6PHU5 in inducing T cell activation. PA-1 cells, which endogenously express CLDN6, were incubated in duplicate in a six-well format with increasing concentrations (5 ng / ml to 200 ng / ml) of 6PHU5 or 6PHU3 and human T cells at an effector-to-target ratio of 5:1 for 44 hours. As a control, human T cells were incubated with 100 ng / ml and 200 ng / ml of 6PHU5 or 6PHU3 without target cells. After 44 hours, T cells were collected and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC. Dose-dependent T cell activation was analyzed by flow cytometry. Hu indicates human; TL indicates T lymphocyte. [Figure 14] Coomassie gel and Western blot analysis of 6PHU3 protein. FCS-free supernatant from polyclonal HEK293 cells stably expressing 6PHU3 was purified by Ni-NTA affinity chromatography (IMAC). Aliquots from various purification steps were loaded onto a 4-12% Bis-Tris gel. (A) Coomassie staining of the cell supernatant, eluate flow-through, and nine fractions. The fraction from the first eluted peak was discarded, while the fractions from the second and third eluted peaks were pooled for further study and dialyzed against PBS followed by 200 mM arginine buffer. (Lane 1: HEK293 / 6PHU3 SN; Lane 2: IMAC flow-through; Lanes 3-5: fractions from elution peak 1 (which were discarded); Lanes 6-11: fractions from elution peaks 2 and 3 (which were pooled).) (B) Western blot analysis of 0.5 μg of 6PHU3 from two independent purifications. Detection was performed with a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS indicates phosphate-buffered saline; SN indicates supernatant; WB indicates Western blot. [Figure 15A1]The bi-scFv protein 6PHU3 binds efficiently and specifically to CLDN6-expressing target cells and human T cells. [Figure 15A2] The bi-scFv protein 6PHU3 binds efficiently and specifically to CLDN6-expressing target cells and human T cells. [Figure 15B] The bi-scFv protein 6PHU3 binds efficiently and specifically to CLDN6-expressing target cells and human T cells. [Figure 15C]The bi-scFv protein 6PHU3 efficiently and specifically binds to CLDN6-expressing target cells and human T cells. (A) 1 × 105 PA-1 and OV-90 cells endogenously expressing CLDN6 were incubated with increasing concentrations of 6PHU3 or the control bi-scFv 1BiMAB (10 ng / ml to 10 μg / ml) and 10 μg / ml of mCLDN6ab or the control mAB mCLDN18.2ab, along with their corresponding APC-conjugated secondary antibodies. Control staining was with the secondary APC-conjugated antibodies (gah, gam) alone. Analysis was performed by flow cytometry. The MFI of the APC signal was calculated using FlowJo software. (B) 5 × 105 human T cells were incubated with increasing concentrations of 6PHU3 (100 ng / ml to 10 μg / ml), anti-His, and gam-mPE. As a negative control, cells were incubated with anti-His and gam-mPE or gam-mPE alone. The MFI of the PE signal was calculated using FlowJo software. (C) 1 × 105 CLDN6-negative NugC4 cells were incubated with increasing concentrations of 6PHU3 and 1 BiMAB (10 ng / ml to 10 μg / ml), anti-His, and gam APC. As a negative control, cells were incubated with gam APC alone. 10 μg / ml of mCLDN6ab and gah APC were used to confirm the CLDN6 negativity of the cells. As a positive control, mCLDN18.2ab and gah APC were used. The MFI of the APC signal was calculated using FlowJo software. APC indicates allophycocyanin; gah indicates goat anti-human; gam indicates goat anti-mouse; mAB indicates monoclonal antibody; MFI indicates mean fluorescence intensity; PE indicates phycoerythrin; TL indicates T lymphocyte. [Figure 16]6PHU3 mediates T cell activation in a dose-dependent manner. PA-1 cells, which endogenously express CLDN6, were incubated in duplicate in a 24-well format with increasing concentrations of the bi-scFv protein 6PHU3 (0.001 ng / ml to 1000 ng / ml) and human T cells at a 5:1 effector-to-target ratio for 24 and 48 hours. As a control, human T cells were incubated with 1 ng / ml to 1000 ng / ml of 6PHU3 without PA-1 target cells to confirm target-dependent activation of T cells mediated by 6PHU3. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC, and analyzed by flow cytometry. TL indicates T lymphocytes. [Figure 17] The EC50 of 6PHU3 for specific target cell lysis after 48 hours is approximately 10 pg / ml. PA-1 cells stably expressing luciferase and endogenously expressing CLDN6 were incubated in triplicate in a 96-well format with increasing concentrations of 6PHU3 protein (0.001 ng / ml to 1000 ng / ml) for 24 and 48 hours, along with human T cells at a 5:1 effector-to-target ratio. For the minimum lysis control (Lmin), effector and target cells were plated without bi-scFv 6PHU3. Maximum lysis (Lmax), for normalization to spontaneous luminescence counts, was achieved by adding Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv immediately before luciferin addition. After adding luciferin solution, luminescence was measured 24 and 48 hours later using an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - Lmax) / (Lmin - Lmax)] x 100. Values ​​were plotted against the log10 of 6PHU3 concentration. EC50 indicates the 50% maximally effective concentration; L indicates lysis. [Figure 18A] 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 18B] 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 18C] 6PHU3 demonstrates in vivo therapeutic efficacy in advanced SC tumor models. [Figure 18D] 6PHU3 demonstrates in vivo therapeutic efficacy in an advanced SC tumor model. NOD.Cg-PrkdscidIL2rgtm1Wjl / SzJ (NSG) mice were SC-injected with 1x107 PA-1 cells, which endogenously express CLDN6. 15 days later, 2x107 human PBMCs were IP-injected into groups G3 and G4, while the control groups (G1 and G2) received PBS only. Daily IP administration of 5µg of 6PHU3 per animal, or the control bi-scFv 1BiMAB or vehicle alone as a control, began 5 days after PBMC injection. Treatment was administered for 25 days, and tumor volume was measured using calipers and calculated according to the following formula: mm3 = length (mm) x width (mm) x (width (mm) / 2). (A) Individual tumor volumes and median tumor volumes per group are shown for treatment days 0 and 14 (top row) and treatment days 21 and 25 (bottom row). (B) Mean tumor volumes for all treatment groups are shown. Dashes indicate sacrificed animals. (C) Kaplan-Meier survival curves for all groups from the day of tumor inoculation to day 45 are shown. Animals were sacrificed when tumor volumes exceeded 1500 mm3. After day 45, all remaining animals were sacrificed to analyze the engraftment of human effector cells in the spleen. (D) Splenocytes from all mice were isolated and stained with anti-CD45-APC and anti-CD3-FITC for flow cytometric detection of human T cells. Median engraftment is shown in box plots. IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate-buffered saline; and SC indicates subcutaneous. [Figure 19AB] Enhanced T cell infiltration into SC PA-1 tumors in response to 6PHU3 treatment. [Figure 19CD] Enhanced T cell infiltration into SC PA-1 tumors in response to 6PHU3 treatment. [Figure 19E] Enhanced T cell infiltration into SC PA-1 tumors in response to 6PHU3 treatment. NSG mice were injected SC with 1×107 PA-1 cells endogenously expressing CLDN6. 15 days later, 2×107 human PBMCs were injected IP into groups G3 and G4, while the control groups (G1 and G2) received PBS only. Daily IP administration of 5 μg of 6PHU3 per animal, or the control bi-scFv 1BiMAB or vehicle alone as a control, began 5 days after PBMC injection. Tumors were dissected when they reached a size of 1500 mm3 or at the end of the experiment and preserved in 4% buffered formaldehyde solution for paraffin embedding. Paraffin-embedded tumor tissues of SC PA-1 tumors were subjected to immunohistochemical staining. Serial sections were stained with either polyclonal primary antibodies, anti-claudin-6 or anti-human CD3. The primary antibody was detected using a secondary HRP-conjugated anti-rabbit antibody. The top rows in A–E show CLDN6 staining, and the bottom rows show CD3 staining. Images were captured using a Mirax scanner. (A) and (B) show PBS control groups G1 and G2, respectively, which received no human effector cells and either vehicle or bi-scFv 6PHU3. (C) shows control group G3, which received human effector cells and vehicle as treatment. (D) shows group G4, which received human effector cells and bi-scFv 6PHU3 as treatment. (E) shows control group G5, which received human effector cells and the control bi-scFv 1BiMAB. Positive signals appear as red staining. Black arrows indicate examples of CD3 signals. IP indicates intraperitoneal; PBMC indicates peripheral blood mononuclear cells; PBS indicates phosphate-buffered saline; and SC indicates subcutaneous. [Figure 20]Schematic illustration of an IVT-RNA molecule encoding a bi-scFv antibody targeting the TAA CLDN18.2. Diagram of the in vitro transcribed RNA sequence encoding the anti-CLDN18.2 bi-scFv antibody. (A) IVT-mRNA in the 5' and 3' positions relative to the anti-TAA variable region. (B) IVT alphavirus replicon in the 5' position relative to the anti-TAA variable region. The VH and VL regions of anti-CLDN18.2 were generated from the sequence of the monoclonal CLDN18.2 antibody (mCLDN18.2ab). "Cap" is used uniformly in place of ARCA, beta-S-ARCA (D1), or beta-S-ARCA (D2). In (A), "anti-CD3" refers collectively to the VH and VL regions generated from the sequences of the following monoclonal CD3 antibodies: UCHT1-HU (humanized mAB), UCHT1, CLB-T3, TR66, and 145-2C11. In (B), "anti-CD3" refers only to the VH and VL derived from TR66. A indicates adenine; bi-scFv indicates a bispecific single-chain variable fragment; hAg indicates the 5'-UTR of human alpha globin; hBg indicates the 3'-UTR of human beta globin; His indicates a hexahistidyl tag; IVT indicates in vitro transcribed; LL indicates a long linker (15 to 18 amino acids); nsP1 to 4 indicate nonstructural proteins 1 to 4; Sec indicates a secretion signal; sgP indicates a subgenomic promoter; SL indicates a short linker (5 to 6 amino acids); TAA indicates a tumor-associated antigen; UTR indicates an untranslated region; and V indicates the variable regions of the heavy (H) and light (L) chains of the antibody. [Figure 21]Effects of domain orientation and anti-CD3-scFv selection on target-dependent T cell activation and specific target cell lysis. NugC4 cells, which endogenously express CLDN18.2, were transiently transfected with several bi-scFv variants directed against CLDN18.2 and CD3 to compare their potency in cytotoxicity assays. For each variant, 5 × 10 NugC4 cells were electroporated with 20 μg / ml IVT-mRNA. Transfected target cells were counted, and 1 × 10 cells were seeded per 6-well plate and incubated with human cytotoxic T cells (CD8+ selected T cells) at an E:T ratio of 5:1. As negative controls, we chose the bi-scFv IVT-mRNA (ctrl), which targets a non-expressed TAA, and the original IgG mAb chCLDN18.2ab (ctrl IgG), which targets CLDN18.2 but not T cells. 1 BiMAB protein at a concentration of 5 ng / ml served as a positive control. As a reference for background cell death, electroporated target cells were plated without T cells. As a reference for background activation, T cells were plated without target cells. Each sample was plated in duplicate. After 48 hours, T cells and target cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC, and 7-AAD for live / dead staining, and analyzed by flow cytometry. (A) TAA-dependent bi-scFv-mediated T cell activation was observed with all anti-CLDN18.2 bi-scFv variants. (B) Specific target cell lysis was determined by subtracting the 7-AAD reference population from the 7-AAD sample target cell population. The bi-scFv antibodies that caused slightly greater target cell lysis, i.e., 1BiMAB and no. 5, both share the same domain orientation and anti-CD3 origin of mAB TR66, but differ in their codon optimization (HS and CHO, respectively) and long linker sequences.bi-scFv indicates bispecific single-chain variable fragment; ctrl indicates control; IgG indicates immunoglobulin G; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocyte. [Figure 22] Co-incubation of target cells transfected with 1BiMAB IVT-mRNA and human T cells induces T cell clustering. NugC4 cells, which endogenously express CLDN18.2, were transiently transfected with 80 μg / ml 1BiMAB IVT-mRNA by electroporation and co-incubated with human cytotoxic T cells (CD8+ selected T cells) at an effector-to-target ratio of 5:1 in 96-well plates. As a negative control sample, NugC4 target cells (-ctrl) transfected with bi-scFv IVT-mRNA targeting a non-expressed TAA were used (top row, left). The bottom row shows NugC4 cells transfected with control bi-scFv IVT-mRNA (left) or 1BiMAB IVT-mRNA (right) without human T cells. After 24 hours of co-incubation, samples were photographed at 200x magnification with a Nikon Eclipse Ti microscope. White arrows indicate clusters of T cells on target cells. CTL indicates cytotoxic T lymphocytes; ctrl indicates control; hu indicates human. [Figure 23]1BiMAB secreted by target cells after transfection with IVT-mRNA mediates T cell activation in a concentration-dependent manner. NugC4 cells, which endogenously express CLDN18.2, were transiently transfected by electroporation with 40 μg / ml of IVT-mRNA containing 0.4 μg / ml to 40 μg / ml of 1BiMAB IVT-mRNA and an appropriate amount of luciferase IVT-mRNA. Transfected target cells were co-incubated in duplicate in six-well plates with human cytotoxic T cells (CD8+ selected T cells) at a 5:1 effector-to-target ratio. As a reference for T cell activation, human T cells were co-incubated with NugC4 target cells transfected with 40 μg / ml of luciferase IVT-mRNA (0.0 μg / ml of 1BiMAB IVT-mRNA). After 24 hours (A) and 48 hours (B), T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC, and analyzed by flow cytometry. Graphs reveal the percentage of positively stained cytotoxic human T cells as determined using FlowJo software. IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocytes. [Figure 24]After transfection with IVT-mRNA, 1BiMAB secreted by target cells induces concentration-dependent target cell lysis. NugC4 cells, which endogenously express CLDN18.2, were transiently transfected by electroporation with 40 μg / ml of IVT-mRNA containing 0.4 μg / ml to 40 μg / ml of 1BiMAB IVT-mRNA and an appropriate amount of luciferase IVT-mRNA, or with 40 μg / ml of luciferase IVT-mRNA alone as a reference sample. Transfected target cells were seeded with human cytotoxic T cells (CD8+ selected T cells) at a 5:1 effector-to-target ratio, or without effector cells, to determine the percentage of background target cells killed by each individual electroporation. All samples were cultured in duplicate in six-well plates. After 24 hours (A) and 48 hours (B), T cells were collected, labeled with propidium iodide (PI) for live / dead staining, and analyzed by flow cytometry. The percentage of dead (PI+) target cells was determined using FlowJo software. Values ​​were further normalized to each individual background sample and to a reference sample. IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocytes. [Figure 25]T cell proliferation was specifically induced in response to 1BiMAB secretion by target cells in the presence of CLDN18.2. Human T cells were CFSE-stained for the assay. T cells were cultured without target cells (T cells), in combination with 5 μg / ml OKT3 and 2 μg / ml αCD28 as a positive activation control (+ctrl), with 5 ng / ml of non-targeting control bi-scFv (-ctrl protein), or with 5 ng / ml of 1BiMAB protein (1BiMAB protein). T cells were incubated with NugC4 target cells overexpressing CLDN18.2 (T cells + CLDN18.2-positive target cells), without (mock), or with 5 ng / ml of 1BiMAB protein (1BiMAB protein). To test IVT-mRNA, NugC4 cells were transfected with 20 μg / ml of 1BiMAB IVT-mRNA (1BiMAB mRNA) or bi-scFv IVT-mRNA targeting an unexpressed TAA (-ctrl mRNA) and incubated with T cells. In addition, NugC4 cells transfected with bi-scFv IVT-mRNA targeting an unexpressed TAA were combined with 5 ng / ml of 1BiMAB protein (-ctrl mRNA + 1BiMAB protein). As an additional specificity control, a sample containing the target cell line MDA-MB-231, which does not express CLDN18.2, was included together with T cells (T cells + CLDN18.2-negative target cells). MDA-MB-231 were used without treatment, incubated alone (mock), or incubated with 5 ng / ml of control bi-scFv protein (-ctrl protein) or 5 ng / ml of 1BiMAB protein (1BiMAB protein), or transfected with 20 μg / ml of 1BiMAB IVT-mRNA (1BiMAB mRNA) or bi-scFv IVT-mRNA targeting a non-expressed TAA (-ctrl mRNA).Assays were performed in 96-well plates at a 5:1 effector-to-target ratio, with each sample in triplicate and an incubation time of 72 hours. The decrease in CFSE signal, indicating T cell proliferation, was analyzed by flow cytometry, calculated using FlowJo software, and plotted as % proliferating T cells. CFSE stands for carboxyfluorescein succinimidyl ester; IVT stands for in vitro transcribed; mRNA stands for messenger RNA. [Figure 26] T cell activation and T cell-mediated target cell lysis in response to 1BiMAB secretion begin at an effector-to-target ratio of 0.3:1. NugC4 cells, which endogenously express CLDN18.2, were transiently transfected with 40 μg / ml of 1BiMAB IVT-mRNA by electroporation. Transfected target cells were co-incubated in duplicate in six-well plates with human cytotoxic T cells (CD8+ selected T cells) at the indicated effector-to-target ratios ranging from 0.3:1 to 10:1. As controls, human T cells were cultured in the absence of target cells ((A), 1:0), and target cells transfected with control IVT-mRNA were cultured in the absence of effector cells ((B), 0:1). As a negative control, human T cells were co-incubated with NugC4 target cells transfected with 40 μg / ml luciferase IVT-mRNA (ctrl IVT-mRNA) at an E:T ratio of 10:1 ((A) and (B) ctrl IVT-mRNA, 10:1). After 48 h, cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC, and propidium iodide (PI) for live / dead staining, and analyzed by flow cytometry. (A) shows the percentage of positively stained cytotoxic human T cells. (B) reveals the percentage of dead (PI+) target cells. All values ​​were calculated using FlowJo software. E:T indicates effector vs. target; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; and TL indicates T lymphocytes. [Figure 27] Human cytotoxic T cells can serve as recipients and producers of bi-scFv IVT-mRNA. Human cytotoxic T cells were freshly isolated from PBMCs by CD8 positive selection and subsequently transiently transfected with 80 μg / ml or 240 μg / ml of 1BiMAB IVT-mRNA by electroporation. Transfected effector cells were co-incubated in duplicate in six-well plates with NugC4 target cells endogenously expressing CLDN18.2 at an effector-to-target ratio of 5:1. As a reference, untreated human T cells were cultured with the target cells. As a negative control, human T cells transfected with 80 μg / ml or 240 μg / ml of eGFP control IVT-mRNA were co-incubated with NugC4 target cells. After 48 hours, cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC, and propidium iodide (PI) for live / dead staining, and analyzed by flow cytometry. (A) The percentage of positively stained cytotoxic human T cells is shown. In (B), the percentage of dead (PI+) target cells normalized to the reference sample is plotted. All values ​​were calculated using FlowJo software. ctrl indicates control; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocytes. [Figure 28]CLDN18.2-negative target cells transfected with IVT-mRNA of 1BiMAB were not lysed by T cells. The CLDN18.2-negative cell line PA-1, which stably expresses luciferase, served as the target cell line. 5 x 106 PA-1 / luc cells were transfected with a total of 40 μg / ml IVT-mRNA by electroporation. 1BiMAB IVT-mRNA was transfected at 4 μg / ml and 40 μg / ml, or 6RHU3, which targets endogenously expressed CLDN6, as a positive control. As a bi-scFv negative control, 40 μg / ml bi-scFv IVT-mRNA(-ctrl), which targets a non-expressed TAA, was transfected. This IVT-mRNA also served as fill-up RNA in the 4 μg / ml IVT-mRNA samples (IVT-mRNA 4 μg / ml 1BiMAB, IVT-mRNA 4 μg / ml 6RHU3). PA-1 / luc cells transfected with bi-scFv negative control and protein control samples using 1BiMAB and 6PHU3 in combination with effector cells were included. Transfected target cells were seeded with human cytotoxic T cells (pan T cells) at a 5:1 effector-to-target ratio. All samples were seeded in triplicate in a 96-well format and co-incubated for 72 hours. As a minimal lysis control (Lmin), each individual transfected target cell sample was seeded without effector cells. Maximum lysis (Lmax) for normalization to spontaneous luminescence counts was achieved by adding Triton X-100 to control wells containing effector cells and untreated target cells (Lmax1) or untreated target cells alone (Lmax2) before adding luciferin. Thirty minutes after adding the luciferin solution, luminescence was measured on an Infinite M200 Tecan microplate reader.Specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - Lmax1) / (Lmin_test sample - Lmax2)] × 100. ctrl indicates control; IVT indicates in vitro transcribed; mRNA indicates messenger RNA. [Figure 29A] Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. [Figure 29B] Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. [Figure 29C]Evidence of 1BiMAB production by mammalian cells transfected with bi-scFv IVT-mRNA or bi-scFv IVT-replicon RNA. (A) 5 × 10 BHK21 cells were transiently transfected with 40 μg / ml of 1BiMAB IVT-mRNA or 1BiMAB IVT-replicon RNA by electroporation. As a mock control, cells were electroporated without RNA. 18 hours after transfection, supernatants and cells were collected. Cells were lysed, and supernatants were subjected to approximately 50-fold concentration. Untreated and concentrated supernatants were analyzed by ELISA using Ni-NTA plates, anti-chCLDN18.2ab idiotypic mAB, and a secondary AP-conjugated antibody. Purified 1BiMAB protein in a two-fold dilution series ranging from 2.3 ng / ml to 37.5 ng / ml was used as a standard. (B) Concentrated supernatants, cell lysates from (A), and 0.1 μg of purified 1BiMAB protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed using a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. (C) 5 × 10 BHK21 cells were transiently transfected by electroporation with 40 μg / ml of 1BiMAB IVT-mRNA or no. 25 IVT-mRNA. As a mock control, cells were electroporated without RNA. 48 hours after transfection, supernatants were collected and subjected to 40-fold concentration. SN and 0.1 μg of purified 1BiMAB protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed using a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. ctrl indicates control; mAB indicates monoclonal antibody; SN indicates supernatant; WB indicates Western blot. [Figure 30]Injection of 1BiMAB bi-scFv IVT-mRNA or IVT-replicon RNA resulted in in vivo production and detectable 1BiMAB bi-scFv molecules in mice. 10 μg of 1BiMAB IVT-mRNA, with or without EBK IVT-mRNA, or 10 μg of 1BiMAB IVT-replicon, was injected IM into NSG mice. Serum from blood collected 2, 4, and 7 days after injection was used in an in vitro cytotoxicity assay. NugC4-LVT-CLDN18.2 / luc target cells stably expressing CLDN18.2 and luciferase were co-incubated with human T cells at an E:T ratio of 30:1 with 20 μl of sample supernatant for 48 hours. Standard 1BiMAB protein controls, Lmin, and Lmax contained 20 μl of NSG mock serum. EBK indicates vaccinia virus protein cocktail (E3, B-18R, K3); IM indicates intramuscular. [Figure 31]Schematic illustration of an IVT-RNA molecule encoding a bi-scFv antibody targeting the TAA CLDN6. Diagram of the in vitro transcribed RNA sequence encoding the anti-CLDN6 bi-scFv antibody. (A) IVT mRNA in the 5' and 3' positions relative to the anti-TAA variable region. (B) IVT alphavirus replicon in the 3' position relative to the anti-TAA variable region. The VH and VL regions of anti-CLDN6 are generated from the sequence of a monoclonal CLDN6 antibody (mCLDN6ab). "Cap" is used uniformly in place of ARCA, beta-S-ARCA (D1), or beta-S-ARCA (D2). The VH and VL regions of anti-CD3 are generated from the sequence of the monoclonal CD3 antibody TR66. A indicates adenine; bi-scFv indicates a bispecific single-chain variable fragment; hAg indicates the 5'-UTR of human alpha globin; hBg indicates the 3'-UTR of human beta globin; His indicates a hexahistidyl tag; IVT indicates in vitro transcribed; LL indicates a long linker (15 to 18 amino acids); nsP1 to 4 indicate nonstructural proteins 1 to 4; Sec indicates a secretion signal; sgP indicates a subgenomic promoter; SL indicates a short linker (5 to 6 amino acids); TAA indicates a tumor-associated antigen; UTR indicates an untranslated region; and V indicates the variable regions of the heavy (H) and light (L) chains of the antibody. [Figure 32]Co-incubation of human T cells with target cells transfected with anti-CLDN6 bi-scFv IVT-mRNA induces T cell clustering. PA-1 cells, which endogenously express CLDN6, were transiently transfected with 20 μg / ml of 6RHU5 or 6RHU3 IVT-mRNA by electroporation and co-incubated with human T cells (pan T cells) at an effector-to-target ratio of 5:1 in 6-well plates. As a negative control, PA-1 target cells (-ctrl) transfected with bi-scFv IVT-mRNA targeting a non-expressed TAA were used (top row, left photograph) and co-incubated with human T cells. The middle row shows untreated PA-1 cells and human T cells without protein (mock, left photo) as a negative control, or with 50 μg / ml of purified anti-CLDN6 bi-scFv proteins 6PHU5 (center) or 6PHU3 (right) as a positive control. The bottom row shows untreated PA-1 cells (left) and human T cells (right) alone. After 24 hours of co-incubation, samples were photographed at 200x magnification with a Nikon Eclipse Ti microscope. White arrows indicate clusters of T cells on target cells. bi-scFv indicates bispecific single-chain variable fragment; ctrl indicates control; hu indicates human; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocyte. [Figure 33]Effect of domain orientation on potency: Transfection of target cells with anti-CLDN6 bi-scFv 6RHU3 resulted in a greater percentage of activated T cells than with 6RHU5. PA-1 cells, which endogenously express CLDN6, were transiently transfected with two bi-scFv variants (6RHU5 and 6RHU3) directed against CLDN6 and CD3 to compare their potency in T cell activation assays. For each variant, 5 × 10 PA-1 cells were electroporated with 20 μg / ml IVT-mRNA. Transfected target cells were recounted, and 1 × 10 cells were seeded per 6-well plate and incubated with human cytotoxic T cells (CD8+ selected T cells) at an E:T ratio of 5:1. As negative controls, untreated target cells (hu TL+PA-1 untreated) and target cells transfected with bi-scFv IVT-mRNA targeting a non-expressed TAA (hu TL+PA-1 -ctrl) were selected. 6PHU5 protein at a concentration of 50 ng / ml served as a positive control (hu TL+PA-1 protein ctrl). Additionally, T cells were seeded without target cells, with or without 6PHU5 protein as a reference for background activation. Each sample was seeded in duplicate. Analysis was performed 24 and 48 hours later: T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC, and 7-AAD for live / dead staining, and analyzed by flow cytometry. TAA-dependent bi-scFv-mediated T cell activation was observed with both anti-CLDN6 bi-scFv variants after 24 hours (A) and 48 hours (B) of co-incubation. Transfection with bi-scFv 6RHU3 resulted in approximately 20% greater T cell activation at both time points. bi-scFv indicates bispecific single-chain variable fragment; ctrl indicates control; hu indicates human; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocyte. [Figure 34]Secretion of 6RHU3 mediates T cell activation in a concentration-dependent manner. PA-1 cells, which endogenously express CLDN6, were transiently transfected by electroporation with a total of 20 μg / ml of IVT-mRNA containing 0.2 μg / ml to 20 μg / ml of 6RHU3 IVT-mRNA and an appropriate amount of bi-scFv IVT-mRNA targeting a non-expressed TAA. Transfection with 20 μg / ml of bi-scFv IVT-mRNA targeting a non-expressed TAA (0.0 μg / ml of 6RHU3 IVT-mRNA) served as a specificity control. Transfected target cells were co-incubated in duplicate in six-well plates with human cytotoxic T cells (pan T cells) at an effector-to-target ratio of 5:1. As a reference for T cell activation, human T cells were cultured alone (hu TL-) or with 6PHU5 protein (hu TL protein ctrl). As a negative control, T cells were co-incubated with untreated PA-1 target cells (hu TL+PA-1 -ctrl). 6PHU5 protein at a concentration of 50 ng / ml served as a positive control (hu TL+PA-1 protein ctrl). After 48 hours, T cells were collected, labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC, and analyzed by flow cytometry. Graphs show the percentage of positively stained human T cells as determined by FlowJo software. bi-scFv indicates bispecific single-chain variable fragment; ctrl indicates control; hu indicates human; IVT indicates in vitro transcribed; mRNA indicates messenger RNA; TL indicates T lymphocyte. [Figure 35]The EC50 of 6RHU3 for specific target cell lysis after 48 hours is approximately 200 ng / ml. PA-1 cells stably expressing luciferase and endogenously expressing CLDN6 were transiently transfected by electroporation with a total concentration of 13.3 μg / ml of bi-scFv IVT-mRNA containing 0.004 μg / ml to 13.3 μg / ml of 6RHU3 and an appropriate amount of bi-scFv IVT-mRNA targeting an unexpressed TAA. Transfected target cells were seeded in triplicate in a 96-well format with human T cells at an effector-to-target ratio of 5:1. As a minimum lysis control (Lmin), each individual transfected target cell sample was seeded without effector cells. Maximum lysis (Lmax) for normalization to spontaneous luminescence counts was achieved by adding Triton X-100 to effector cells and control wells containing untreated target cells immediately before luciferin addition. Thirty minutes after addition of luciferin solution, luminescence was measured 24 and 48 hours later using an Infinite M200 Tecan microplate reader. Specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - Lmax) / (Lmin_test sample - Lmax)] x 100. Values ​​were plotted against the log10 of the 6RHU3 concentration. EC50 indicates the 50% maximally effective concentration; L indicates lysis. [Figure 36]T cell proliferation is specifically induced in the presence of CLDN6 in response to 6PHU3 secretion by target cells. Human T cells were CFSE-stained for the assay. T cells were cultured without target cells (T cells), in combination with 5 μg / ml OKT3 and 2 μg / ml αCD28 as a positive activation control (+ctrl), with 5 ng / ml of non-targeting control bi-scFv (-ctrl protein), or with 5 ng / ml of 6PHU3 protein (6PHU3 protein). T cells were incubated with PA-1 target cells that endogenously express CLDN6 (T cells + CLDN6-positive target cells), without (mock), or with 5 ng / ml of 6PHU3 protein (6PHU3 protein). To test IVT-mRNA, PA-1 cells were transfected with 20 μg / ml of 6RHU3 IVT-mRNA (6RHU3 mRNA) or bi-scFv IVT-mRNA targeting an unexpressed TAA (-ctrl mRNA) and incubated with T cells. In addition, PA-1 cells transfected with bi-scFv IVT-mRNA targeting an unexpressed TAA were combined with 5 ng / ml of 6PHU3 protein (-ctrl mRNA + 6PHU3 protein). As an additional specificity control, a sample containing the target cell line MDA-MB-231, which does not express CLDN6, was included together with T cells (T cells + CLDN6-negative target cells). MDA-MB-231 cells were used untreated (mock), incubated with 5 ng / ml of control bi-scFv protein (-ctrl protein) or 5 ng / ml of 6PHU3 (6PHU3 protein), or transfected with 20 μg / ml of 6RHU3 IVT-mRNA (6RHU3 mRNA) or bi-scFv IVT-mRNA targeting a non-expressed TAA (-ctrl mRNA). Assays were performed in 96-well plates at a 5:1 effector-to-target ratio, with each sample in triplicate, and the incubation time was 72 hours.The decrease in CFSE signal, indicating T cell proliferation, was analyzed by flow cytometry, calculated using FlowJo software, and plotted as % proliferating T cells. CFSE stands for carboxyfluorescein succinimidyl ester; IVT stands for in vitro transcribed; mRNA stands for messenger RNA. [Figure 37A] Evidence for 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. [Figure 37B] Evidence for 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. [Figure 37C]Evidence for 6RHU3 translation by mammalian cells transfected with bi-scFv IVT-mRNA or IVT-replicon RNA. (A) 5 × 10 BHK21 cells were transiently transfected with 40 μg / ml of 6RHU3 IVT-mRNA or 6RHU3 IVT-replicon RNA by electroporation. Transfection with 40 μg / ml of no. 25 IVT-mRNA was included as an additional sample. As a mock control, cells were electroporated without RNA. 18 hours after transfection, supernatants and cells were collected. Cells were lysed, and the supernatants were subjected to approximately 50-fold concentration. The untreated and concentrated supernatants were analyzed by ELISA using Ni-NTA plates, anti-mCLDN6ab idiotypic mAB, and a secondary AP-conjugated antibody. Purified 6PHU3 protein in a two-fold dilution series ranging from 2.3 ng / ml to 150 ng / ml was used as a standard. (B) Concentrated supernatant, cell lysate from (A), and 0.1 μg of purified 6PHU3 protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed using a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. (C) 5 × 10 BHK21 cells were transiently transfected by electroporation with 40 μg / ml of 6RHU3 IVT-mRNA or no. 25 IVT-mRNA. As a mock control, cells were electroporated without RNA. 48 hours after transfection, supernatant was collected and subjected to 40-fold concentration. SN and 0.1 μg of purified 6PHU3 protein as a positive control were separated by SDS-PAGE. Western blot analysis was performed with a primary monoclonal anti-His antibody and a secondary peroxidase-conjugated anti-mouse antibody. ctrl indicates control; mAB indicates monoclonal antibody; SN indicates supernatant; WB indicates Western blot. [Figure 38]Injection of 6RHU3 bi-scFv IVT-mRNA or IVT-replicon RNA resulted in in vivo translation and detectable bi-scFv molecules in mice. 10 μg of 6RHU3 IVT-mRNA, with or without EBK IVT-mRNA, or 10 μg of 6RHU3 IVT-replicon, was injected intramuscularly into NSG mice. Serum from blood collected 7 days after injection was used in an in vitro cytotoxicity assay. PA-1 / luc target cells, which endogenously express CLDN6 and stably express luciferase, were co-incubated with human T cells at an E:T ratio of 30:1 with 20 μl of sample serum for 48 hours. The standard 6RHU3 protein control, Lmin, and Lmax contained 20 μl of NSG mock serum. EBK indicates vaccinia virus protein cocktail (E3, B-18R, K3); IM indicates intramuscular. [Figure 39A] Cytotoxicity results of anti-CLDN18.2 bi-scFv proteins containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. [Figure 39B] Cytotoxicity results of anti-CLDN18.2 bi-scFv proteins containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. [Figure 39C] Cytotoxicity results of anti-CLDN18.2 bi-scFv proteins containing the scFv anti-CD3 binding domain in the C-terminal portion of the protein. [Figure 39D]Cytotoxicity results of anti-CLDN18.2 bi-scFv proteins containing an scFv anti-CD3 binding domain at the C-terminal end of the protein. Bi-scFv variants directed against CLDN18.2 and CD3 were transiently expressed in CHO cells and purified using Protein-L resin to compare their potency in cytotoxicity assays. NugC4 cells, which endogenously express CLDN18.2 and stably express luciferase, were chosen as target cells. Human T cells and target cells were incubated in a 96-well format with 5000 ng / ml, 1000 ng / ml, 200 ng / ml, and 40 ng / ml of each bi-scFv protein at an E:T ratio of 5:1. Each test sample was plated in triplicate, and a control sample for Lmin was plated in triplicate. Co-incubation times before analysis were 24 and 48 hours. After adding luciferin solution at given time points, luminescence was measured using an Infinite M200 TECAN reader. Specific target cell lysis was calculated for each concentration, and specific target cell lysis was reported. a. The anti-CD3 variable domains are in the VH-VL domain order, separated by an LL4 peptide linker. b. The anti-CD3 variable domains are in the VH-VL order, separated by an LL4 peptide linker. The scFv anti-CD3 contains an interconnecting disulfide bridge between the VH and VL domains. c. The anti-CD3 variable domains are in the VL-VH order, separated by an LL5 peptide linker. d. The anti-CD3 variable domains are in the VL-VH order, separated by an LL5 peptide linker. The scFv anti-CD3 contains an interconnecting disulfide bridge between the VL and VH domains. [Figure 40]Intra-assay comparison of EC50 values ​​obtained in luciferase cytotoxicity assays using anti-CLDN6 bi-scFv proteins. Luciferase cytotoxicity assays were performed on three different donors for T cell preparation. Calculated EC50 values ​​(calculated with six tested anti-CLDN6 bi-scFv proteins after 24 and 48 hours of incubation) are reported for each independent assay (Figures A, B, and C). PA-1 cells, which endogenously express CLDN6, were incubated in triplicate in a 96-well format with increasing concentrations of anti-CLDN6 bi-scFv proteins (0.025 ng / ml to 50,000 ng / ml for A and B, and 0.0025 ng / ml to 5,000 ng / ml for C) and human T cells at an effector-to-target ratio of 5:1 for 24 and 48 hours. For the minimum lysis control (Lmin), effector and target cells were plated without bi-scFv protein. Maximum lysis (Lmax) for normalization to spontaneous luminescence counts was achieved by adding Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv just before luciferin addition. Thirty minutes after addition of luciferin solution, luminescence was measured using an Infinite M200 Tecan microplate reader after 24 and 48 hours of target and effector cell incubation. Specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - Lmax) / (Lmin - Lmax)] × 100. EC50 indicates the 50% maximally effective concentration; L indicates lysis; NA indicates not applicable. DETAILED DESCRIPTION OF THE INVENTION

[0048] Although the present invention is described in detail below, it should be understood that the present invention is not limited to the specific methodology, protocols, and reagents described herein, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0049] Below, the components of the present invention will be described. These components are listed with specific embodiments; however, it should be understood that they can be combined in any manner and in any number to create further embodiments. The various described examples and preferred embodiments should not be construed to limit the invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments that combine the explicitly described embodiment with any number of the disclosed and / or preferred components. Moreover, any permutation and combination of all described components in this patent application should be considered to be disclosed by the description of this patent application, unless the context indicates otherwise.

[0050] Preferably, the terms used herein are defined as set forth in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)" (H.G.W. Leuenberger, B. Nagel and H. Kolbl, eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995)).

[0051] The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA technology as described in the literature in this field (see, e.g., Molecular Cloning: A Laboratory Manual, 2nd Edition (J. Sambrook et al., eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989)).

[0052] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations (e.g., "comprises" and "comprising") will be understood to imply the inclusion of a stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of any other element, integer, or step, or group of elements, integers, or steps. However, in some embodiments, such other element, integer, or step, or group of elements, integers, or steps, is excluded, i.e., the subject matter may consist of an element, integer, or step, or group of elements, integers, or steps. As used in the context of describing the present invention (particularly in the context of the claims), the terms "a," "an," and "the" and similar references should be construed to encompass both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated herein as if that value were individually listed herein. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as"), if provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention or the claims. No language herein should be construed as indicating any non-claimed element essential to the practice of the invention.

[0053] Several documents are cited throughout the text of this specification. Whether supra or infra, each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention.

[0054] Claudins are a group of proteins that are essential components of tight junctions, which define the paracellular barrier that regulates the flow of molecules between epithelial cells. Claudins are transmembrane proteins that span the membrane four times, with both their N- and C-terminal ends located in the cytoplasm. The first extracellular loop (EC1 or ECL1) averages 53 amino acids, and the second extracellular loop (EC2 or ECL2) consists of approximately 24 amino acids. Cell surface proteins of the claudin family, such as CLDN6 and CLDN18.2, are expressed in tumors of various origins. Their selective expression (absence of expression in normal tissues associated with toxicity) and plasma membrane localization make them particularly suitable as target structures in antibody-mediated cancer immunotherapy.

[0055] In the context of the present invention, preferred claudins are CLDN6 and CLDN18.2. CLDN6 and CLDN18.2 have been identified as being differentially expressed in tumor tissues, with the only normal tissue expressing CLDN18.2 being the stomach and the only normal tissue expressing CLDN6 being the placenta.

[0056] CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of the gastric mucosa. CLDN18.2 is expressed in cancers of various origins, such as pancreatic carcinoma, esophageal carcinoma, gastric carcinoma, bronchial carcinoma, breast carcinoma, and ENT tumors. CLDN18.2 is a valuable target for the prevention and / or treatment of primary tumors, such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), ovarian cancer, colon cancer, liver cancer, head and neck cancer, and gallbladder cancer, as well as their metastases (particularly gastric cancer metastases, e.g., Krukenberg tumors, peritoneal metastases, and lymph node metastases).

[0057] CLDN6 has been found to be expressed in, for example, ovarian cancer, lung cancer, stomach cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, melanoma, head and neck cancer, sarcoma, bile duct cancer, renal cell carcinoma, and bladder cancer. CLDN6 is expressed in ovarian cancer (particularly ovarian adenocarcinoma and ovarian teratocarcinoma), lung cancer (including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), particularly squamous cell lung carcinoma and squamous cell lung adenocarcinoma), stomach cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell carcinoma and squamous cell carcinoma), malignant melanoma, head and neck cancer (particularly malignant pleomorphic adenoma), sarcoma (particularly synovial sarcoma and synovial carcinosarcoma), bile duct cancer, and bladder cancer (particularly transitional cell carcinoma and transitional cell papillary carcinoma). ), kidney cancer (particularly renal cell carcinoma including renal clear cell carcinoma and papillary renal cell carcinoma), colon cancer, small intestine cancer (including ileal cancer, particularly small intestinal adenocarcinoma and ileal adenocarcinoma), testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer (particularly testicular seminoma, testicular teratoma, and embryonal testicular cancer), uterine cancer, germ cell tumors (e.g., teratocarcinoma or embryonal carcinoma, particularly testicular germ cell tumors), and metastatic forms thereof are particularly preferred targets for prevention and / or treatment. In one embodiment, the cancer disease associated with CLDN6 expression is selected from the group consisting of ovarian cancer, lung cancer, metastatic ovarian cancer, and metastatic lung cancer. Preferably, the ovarian cancer is carcinoma or adenocarcinoma. Preferably, the lung cancer is carcinoma or adenocarcinoma, preferably bronchiolar carcinoma, such as bronchiolar carcinoma or bronchiolar adenocarcinoma.

[0058] The term "CLDN" as used herein means claudin and includes CLDN18.2 and CLDN6. Preferably, the claudin is a human claudin.

[0059] The term "CLDN18" refers to claudin 18, including any variants thereof, including splice variant 1 of claudin 18 (claudin 18.1 (CLDN18.1)) and splice variant 2 of claudin 18 (claudin 18.2 (CLDN18.2)).

[0060] The term "CLDN18.2" preferably relates to human CLDN18.2, and in particular refers to a protein comprising the amino acid sequence of SEQ ID NO: 1 in the Sequence Listing or a variant of said amino acid sequence, preferably a protein consisting of the amino acid sequence of SEQ ID NO: 1 in the Sequence Listing or a variant of said amino acid sequence. The first extracellular loop of CLDN18.2 preferably comprises amino acids 27 to 81 of the amino acid sequence shown in SEQ ID NO: 1, more preferably amino acids 29 to 78 of the amino acid sequence shown in SEQ ID NO: 1. The second extracellular loop of CLDN18.2 preferably comprises amino acids 140 to 180 of the amino acid sequence shown in SEQ ID NO: 1. The first and second extracellular loops preferably form the extracellular portion of CLDN18.2.

[0061] The term "CLDN6" preferably relates to human CLDN6, and particularly refers to a protein comprising the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:3 in the Sequence Listing or a variant of said amino acid sequence, preferably a protein consisting of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:3 in the Sequence Listing or a variant of said amino acid sequence. The first extracellular loop of CLDN6 preferably comprises amino acids 28 to 80 of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3, more preferably comprises amino acids 28 to 76 of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3. The second extracellular loop of CLDN6 preferably comprises amino acids 138 to 160 of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3, preferably comprises amino acids 141 to 159 of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3, more preferably comprises amino acids 145 to 157 of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3. The first and second extracellular loops preferably form the extracellular portion of CLDN6.

[0062] The term "variant" according to the present invention particularly refers to mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologs, especially those occurring in nature. Allelic variants relate to variations in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies numerous allelic variants for a given gene. Species homologs are nucleic acid or amino acid sequences that have a species of origin different from that of the given nucleic acid or amino acid sequence. The term "variant" is intended to encompass any post-translationally modified variants and conformational variants.

[0063] A second target molecule for the binding agents described herein is CD3 (cluster of differentiation 3). The CD3 complex refers to an antigen expressed as part of a multimolecular T cell receptor (TCR) complex on the surface of mature human T cells, thymocytes, and a subset of natural killer cells. This T cell coreceptor is a protein complex composed of four distinct chains. In mammals, this complex contains the CD3γ chain, the CD3δ chain, and two CD3ε chains. These chains associate with a molecule known as the T cell receptor (TCR) and a ζ chain to generate an activation signal in T lymphocytes. The TCR, ζ chain, and CD3 molecule together comprise the TCR complex.

[0064] Human CD3 epsilon is designated GenBank Accession No. NM_000733 and contains SEQ ID NO: 4. Human CD3 gamma is designated GenBank Accession No. NM000073. Human CD3 delta is designated GenBank Accession No. NM_000732. CD3 is involved in TCR signaling. As described by Lin and Weiss (Journal of Cell Science 114, 243-244 (2001)), activation of the TCR complex by binding of a specific antigen epitope presented on the MHC results in phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) by kinases of the Src family, which triggers the recruitment of additional kinases that result in T cell activation, including Ca2+ release. Clustering of CD3 on T cells, for example, by immobilized anti-CD3 antibodies, triggers T cell activation similar to T cell receptor engagement but independent of its clonal specificity.

[0065] As used herein, "CD3" includes human CD3 and refers to an antigen expressed on the surface of human T cells as part of the multimolecular T cell receptor complex.

[0066] With respect to CD3, the binding agents of the invention preferably recognize the epsilon chain of CD3, and in particular recognize an epitope corresponding to the first 27 N-terminal amino acids of CD3 epsilon or a functional fragment of this 27 amino acid stretch.

[0067] According to the present invention, the term "claudin-positive cancer" or similar terms refers to cancers involving cancer cells that express claudins, preferably cancer cells that express claudins on their surface.

[0068] "Cell surface" is used according to its ordinary meaning in the art and thus includes the outside of the cell that is accessible for binding by proteins and other molecules.

[0069] A claudin is expressed on the surface of a cell if it is located on the surface of the cell and accessible for binding by a claudin-specific antibody added to the cell.

[0070] The term "extracellular portion" in the context of the present invention refers to a part of a molecule (such as a protein) that faces the extracellular space of a cell and is preferably accessible from the outside of said cell, for example, by an antigen-binding molecule (such as an antibody located outside the cell). Preferably, this term refers to one or more extracellular loops or domains or fragments thereof.

[0071] The terms "portion" and "fragment" are used interchangeably herein and refer to a contiguous component. For example, a portion of a structure (such as an amino acid sequence or a protein) refers to a contiguous component of said structure. A portion, part, or fragment of a structure preferably comprises one or more functional properties of said structure. For example, a portion, part, or fragment of an epitope or peptide is preferably immunologically equivalent to the epitope or peptide from which it is derived. A portion or fragment of a protein sequence preferably comprises a sequence of at least 6, particularly at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 contiguous amino acids of said protein sequence.

[0072] According to the present invention, CLDN18.2 is not substantially expressed in cells if its expression level is lower than that in gastric cells or gastric tissue. Preferably, the expression level is less than 10% of that in gastric cells or gastric tissue, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1%, or 0.05%, or even lower. Preferably, CLDN18.2 is not substantially expressed in cells if its expression level exceeds the expression level in non-cancerous tissues other than the stomach by at most twofold, preferably by at most 1.5fold, and preferably does not exceed the expression level in said non-cancerous tissues. Preferably, CLDN18.2 is not substantially expressed in cells if its expression level is below the detection limit and / or if the expression level is too low to allow binding by a CLDN18.2-specific antibody added to the cells.

[0073] According to the present invention, CLDN18.2 is expressed in cells if the expression level is preferably more than 2-fold, preferably more than 10-fold, more than 100-fold, more than 1000-fold, or more than 10000-fold higher than the expression level in non-cancerous tissues other than the stomach. Preferably, CLDN18.2 is expressed in cells if the expression level is above the detection limit and / or if the expression level is high enough to allow binding by a CLDN18.2-specific antibody added to the cells. Preferably, CLDN18.2 expressed in cells is expressed or exposed on the surface of the cells.

[0074] According to the present invention, CLDN6 is not substantially expressed in cells if its expression level is lower than that in placental cells or placental tissues. Preferably, the expression level is less than 10% of that in placental cells or placental tissues, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1%, or 0.05%, or even lower. Preferably, CLDN6 is not substantially expressed in cells if its expression level exceeds the expression level in non-cancerous tissues other than the placenta by at most twofold, preferably by at most 1.5fold, preferably not exceeding the expression level in said non-cancerous tissues. Preferably, CLDN6 is not substantially expressed in cells if its expression level is below the detection limit and / or if the expression level is too low to allow binding by a CLDN6-specific antibody added to the cells.

[0075] According to the present invention, CLDN6 is expressed in a cell if the expression level is preferably more than 2-fold, preferably more than 10-fold, more than 100-fold, more than 1000-fold, or more than 10000-fold higher than the expression level in non-cancerous tissues other than placenta. Preferably, CLDN6 is expressed in a cell if the expression level is above the detection limit and / or if the expression level is sufficiently high to allow binding by a CLDN6-specific antibody added to the cell. Preferably, CLDN6 expressed in a cell is expressed or exposed on the surface of the cell.

[0076] According to the present invention, the term "disease" refers to any pathological condition, including cancer, particularly those forms of cancer described herein. Any reference herein to cancer or a specific form of cancer also encompasses cancer metastases thereof. In a preferred embodiment, the disease to be treated according to this patent application involves cells that express claudins (CLDN), such as cells that express CLDN18.2 and / or CLDN6.

[0077] According to the present invention, a "disease associated with cells expressing CLDN" or similar expression means that CLDN is expressed in cells of diseased tissues or organs. In one embodiment, CLDN expression in cells of diseased tissues or organs is increased compared to the state in healthy tissues or organs. The increase indicates an increase of at least 10%, particularly an increase of at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000%, or even greater. In one embodiment, expression is found only in diseased tissues, while expression in healthy tissues is suppressed. According to the present invention, diseases associated with cells expressing CLDN include cancer diseases. Moreover, according to the present invention, the cancer disease is preferably a cancer disease in which cancer cells express CLDN.

[0078] As used herein, "cancer disease" or "cancer" includes diseases characterized by abnormally regulated cell growth, cell proliferation, cell differentiation, cell adhesion, and / or cell migration. By "cancer cells" is meant abnormal cells that grow by rapid, uncontrolled cell proliferation and continue to grow after the stimulus that initiated the new growth has ceased. Preferably, "cancer diseases" are characterized by cells that express CLDN, and the cancer cells express CLDN. The CLDN-expressing cells are preferably cancer cells, preferably cancer cells of a cancer described herein.

[0079] The term "cancer" according to the present invention includes leukemia, seminoma, melanoma, teratoma, lymphoma, neuroblastoma, glioma, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, blood cancer, skin cancer, brain cancer, cervical cancer, intestinal cancer, liver cancer, colon cancer, stomach cancer, bowel cancer, head and neck cancer, gastrointestinal cancer, lymph node cancer, esophageal cancer, colorectal cancer, pancreatic cancer, ear, nose and throat (ENT) cancer, breast cancer, prostate cancer, uterine cancer, ovarian cancer, and lung cancer, as well as metastases thereof. Examples are lung carcinoma, breast carcinoma, prostate carcinoma, colon carcinoma, renal cell carcinoma, cervical carcinoma, or metastases of the cancer types or tumors described above. The term cancer according to the present invention also includes cancer metastases.

[0080] According to the present invention, a "carcinoma" is a malignant tumor derived from epithelial cells. This group represents the most common cancers, including common forms of breast, prostate, lung, and colon cancer.

[0081] "Adenocarcinoma" is a cancer originating in glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands, and various other tissues lining body cavities and organs. Epithelium is embryologically derived from ectoderm, endoderm, and mesoderm. To be classified as adenocarcinoma, cells do not necessarily need to be part of a gland, as long as they have secretory properties. This form of carcinoma can occur in some higher mammals, including humans. Well-differentiated adenocarcinomas tend to resemble the glandular tissue from which they originate, while poorly differentiated adenocarcinomas may not. By staining cells from a biopsy, a pathologist will determine whether the tumor is an adenocarcinoma or some other type of cancer. Various adenocarcinomas can arise in many tissues of the body due to the ubiquity of glands in the body. Although each gland may not continue to secrete the same substances, as long as there is an exocrine function for the cells, they are considered glandular, and therefore, their malignant forms are called adenocarcinomas. Malignant adenocarcinomas, if given enough time to do so, can invade other tissues and often metastasize. Ovarian adenocarcinoma is the most common type of ovarian carcinoma. This includes serous and mucinous adenocarcinoma, clear cell adenocarcinoma, and endometrioid adenocarcinoma.

[0082] By "metastasis" is meant the spread of cancer cells from their initial site to another part of the body. The formation of metastases is a highly complex process, dependent on the detachment of malignant cells from the primary tumor, their invasion into the extracellular matrix, their penetration through the endothelial basement membrane to enter body cavities and blood vessels, and their subsequent infiltration into the target organ after transport by the blood. Finally, the growth of new tumors at the target site depends on angiogenesis. Tumor metastasis often occurs even after removal of the primary tumor, as tumor cells or tumor components may persist and develop metastatic potential. In one embodiment, the term "metastasis" according to the present invention refers to "distant metastasis," which refers to metastases located far from the primary tumor and the regional lymph node system. In one embodiment, the term "metastasis" according to the present invention refers to lymph node metastasis. One particular form of metastasis treatable using the therapies of the present invention is metastasis originating from gastric cancer as the primary site. In a preferred embodiment, such gastric cancer metastasis is a Krukenberg tumor, peritoneal metastasis, and / or lymph node metastasis.

[0083] Krukenberg tumor is a rare metastatic tumor of the ovary, accounting for 1% to 2% of all ovarian tumors. The prognosis for Krukenberg tumor remains very poor, and no established treatment exists for Krukenberg tumor. Krukenberg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. The stomach is the primary site in most Krukenberg tumor cases (70%). Carcinoma of the colon, appendix, and breast (mainly invasive lobular carcinoma) are the next most common primary sites. Rare cases of Krukenberg tumor originating from the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and bladder / urachal carcinoma have been reported.

[0084] By "treating" is meant administering a compound or composition or combination of compounds or compositions to a subject to prevent or eliminate disease, including reducing tumor size or the number of tumors in a subject; halting or slowing disease in a subject; inhibiting or slowing the development of new disease in a subject; reducing the frequency or severity and / or recurrence of symptoms in a subject currently with disease or in a subject who has previously had the disease; and / or prolonging, i.e., increasing, the lifespan of the subject.

[0085] In particular, the term "treating a disease" includes curing the disease, shortening the duration of the disease, ameliorating the disease, preventing the disease, slowing or inhibiting the progression or worsening of the disease, or preventing or delaying the onset of the disease or its symptoms.

[0086] In the context of the present invention, terms such as "protect," "prevent," "prophylactic," "preventive," or "protective" relate to the prevention or treatment, or both, of the occurrence and / or spread of disease in a subject, and in particular to minimizing the likelihood that a subject will develop a disease or delaying the development of a disease. For example, a person at risk of cancer may be considered a candidate for treatment to prevent cancer.

[0087] By "at risk" is meant a subject who is identified as having a greater than normal likelihood of developing a disease (especially cancer) compared to the general population. In addition, subjects who have had a disease (especially cancer) or who currently have a disease (especially cancer) are subjects who have an increased risk for developing the disease because such subjects may continue to develop the disease. Subjects who currently have cancer or who have had cancer also have an increased risk for cancer metastasis.

[0088] The term "patient", according to the present invention, means a subject for treatment, in particular a subject with a disease, and includes humans, non-human primates and other animals, in particular mammals, such as cows, horses, pigs, sheep, goats, dogs, cats or rodents (such as mice and rats). In a particularly preferred embodiment, the patient is a human.

[0089] "Target cell" shall mean any cell that is unwanted (e.g., cancer cell, etc.). In a preferred embodiment, the target cell expresses a CLDN.

[0090] The term "antigen" relates to an agent (such as a protein or peptide) that contains an epitope against which an immune response is and / or will be directed. In a preferred embodiment, the antigen is a tumor-associated antigen (such as CLDN18.2 or CLDN6), i.e., a component of a cancer cell that may originate from the cytoplasm, the cell surface, and the cell nucleus, and in particular such an antigen that is produced, preferably in large amounts, intracellularly or as a surface antigen on the cancer cell.

[0091] In the context of the present invention, the term "tumor-associated antigen" preferably relates to a protein that, under normal conditions, is specifically expressed in a limited number of tissues and / or organs or at a particular developmental stage and that is expressed or aberrantly expressed in one or more tumor or cancer tissues. In the context of the present invention, tumor-associated antigens are preferably associated with the cell surface of cancer cells and are preferably not expressed, or are only rarely expressed, in normal tissues.

[0092] The term "epitope" refers to an antigenic determinant on a molecule, i.e., a portion of a molecule that is recognized by the immune system, e.g., an antibody. For example, an epitope is a discrete three-dimensional site on an antigen that is recognized by the immune system. Epitopes usually consist of chemically active surface groupings of molecules (e.g., amino acids or sugar side chains) and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. An epitope of a protein preferably comprises a contiguous or discontinuous portion of said protein and is preferably between 5 and 100 amino acids in length, preferably between 5 and 50 amino acids, more preferably between 8 and 30 amino acids, and most preferably between 10 and 25 amino acids in length, for example, an epitope may be preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acids in length.

[0093] The term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. The term "antibody" includes monoclonal, recombinant, human, humanized, and chimeric antibodies. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain is composed of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability (called complementarity-determining regions (CDRs)) interspersed with more conserved regions (called framework regions (FRs)). Each VH and VL is composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain the binding domains that interact with antigens. The constant regions of the antibodies may mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0094] The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody displays a single binding specificity and affinity. In one embodiment, a monoclonal antibody is produced by a hybridoma comprising a B cell obtained from a non-human animal (e.g., a mouse) fused to an immortalized cell.

[0095] The term "recombinant antibody," as used herein, encompasses all antibodies prepared, expressed, produced, or isolated by recombinant means: for example, (a) antibodies isolated from an animal (e.g., a mouse) that is genetically or chromosomally modified for immunoglobulin genes or from a hybridoma prepared from such an animal; (b) antibodies isolated from a host cell that is transformed to express the antibody, e.g., antibodies isolated from a transfectoma; (c) antibodies isolated from a recombinant combinatorial antibody library; and (d) antibodies prepared, expressed, produced, or isolated by any other means involving splicing immunoglobulin gene sequences into other DNA sequences.

[0096] The term "human antibody," as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

[0097] The term "humanized antibody" refers to a molecule having an antigen-binding site substantially derived from an immunoglobulin obtained from a species other than human, with the remaining immunoglobulin structure of the molecule based on the structure and / or sequence of a human immunoglobulin. The antigen-binding site may comprise either complete variable domains fused to constant domains or only the complementarity-determining regions (CDRs) of the variable domains grafted onto appropriate framework regions. The antigen-binding site may be wild-type or may be modified by one or more amino acid substitutions, e.g., to more closely resemble human immunoglobulins. Some forms of humanized antibodies retain all CDR sequences (e.g., a humanized mouse antibody containing all six CDRs from a mouse antibody). Other forms have one or more CDRs altered with respect to the original antibody.

[0098] The term "chimeric antibody" refers to an antibody in which a portion of each of the heavy and light chain amino acid sequences is homologous to the corresponding sequence in antibodies from a particular species or class, while the remaining segments of the chains are homologous to the corresponding sequence in another antibody. Typically, the variable regions of both the light and heavy chains resemble the variable regions of antibodies from one mammalian species, while the constant portions are homologous to the sequences of antibodies from another species. One distinct advantage of such chimeric forms is that the variable regions can be conveniently derived from currently known sources, for example, using readily available B cells or hybridomas from non-human host organisms in combination with constant regions derived from human cell preparations. While the variable regions have the advantage of being easily prepared and specificity is not affected by source, the human constant regions mean that the antibody is less likely to elicit an immune response from a human subject when injected than constant regions derived from non-human sources would. However, the definition is not limited to this specific example.

[0099] Antibodies may be derived from a variety of species, including, but not limited to, mouse, rat, rabbit, guinea pig, and human.

[0100] Antibodies described herein include IgA antibodies (such as IgA1 or IgA2 antibodies), IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, IgG4 antibodies, IgE antibodies, IgM antibodies, and IgD antibodies. In various embodiments, the antibody is an IgG1 antibody, more specifically an IgG1 kappa isotype or an IgG1 lambda isotype (i.e., IgG1, κ, λ), an IgG2a antibody (e.g., IgG2a, κ, λ), an IgG2b antibody (e.g., IgG2b, κ, λ), an IgG3 antibody (e.g., IgG3, κ, λ), or an IgG4 antibody (e.g., IgG4, κ, λ).

[0101] As used herein, a "heterologous antibody" is defined in relation to the transgenic animal producing such an antibody. The term refers to an antibody that has an amino acid sequence or a corresponding encoding nucleic acid sequence found in an organism that is not a transgenic organism, and that generally originates from a species other than the transgenic organism.

[0102] As used herein, a "heterohybrid antibody" refers to an antibody having light and heavy chains of different organismal origins. For example, an antibody having a human heavy chain with a murine light chain is a heterohybrid antibody.

[0103] The antibodies described herein are preferably isolated. As used herein, the term "isolated antibody" is intended to refer to an antibody that is substantially free of other antibodies having different antigen specificities (e.g., an isolated antibody that specifically binds to CLDN18.2 is substantially free of antibodies that specifically bind to antigens other than CLDN18.2). However, an isolated antibody that specifically binds to an epitope, isoform, or variant of human CLDN18.2 may have cross-reactivity to other related antigens from other species (e.g., species homologs of CLDN18.2), for example. Moreover, an isolated antibody may be substantially free of other cellular material and / or chemicals. In one embodiment of the present invention, a combination of "isolated" monoclonal antibodies refers to a combination of various antibodies having different specificities and combined in a well-defined composition or mixture.

[0104] The terms "antigen-binding portion" (or simply "binding portion") of an antibody or "antigen-binding fragment" (or simply "binding fragment") of an antibody, or similar terms, refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding portion" of an antibody include: (i) a Fab fragment, i.e., a monovalent fragment consisting of the VL, VH, CL, and CH domains; (ii) a F(ab')2 fragment, i.e., a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH domains; (iv) a Fv fragment consisting of the VL and VH domains of only one arm of an antibody; (v) a dAb fragment consisting of the VH domain (Ward et al. (1989) Nature 341:544-546); (vi) an isolated complementarity-determining region (CDR); and (vii) a combination of two or more isolated CDRs, optionally joined by a synthetic linker. Moreover, although the two domains of an Fv fragment, i.e., VL and VH, are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that allows them to be produced as a single protein chain in which the VL and VH regions pair to form a monovalent molecule known as a single-chain Fv (scFv) (see, e.g., Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody.A further example is a binding domain-immunoglobulin fusion protein comprising (i) a binding domain polypeptide fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. Binding domain-immunoglobulin fusion proteins are further disclosed in U.S. Patent Application Publication Nos. 2003 / 0118592 and 2003 / 0133939. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as intact antibodies are screened.

[0105] The term "binding domain" in the context of the present invention characterizes a structure (e.g., the structure of an antibody) that binds to / interacts with a given target structure / antigen / epitope. A binding domain according to the present invention therefore exhibits an "antigen interaction site".

[0106] For purposes of the present invention, all antibodies and antibody derivatives (e.g., antibody fragments, etc.) as described herein are encompassed by the term "antibody." The term "antibody derivative" refers to any modified form of an antibody, such as a conjugate of an antibody with another agent or antibody, or an antibody fragment. Furthermore, antibodies and antibody derivatives as described herein are useful for producing binding agents (e.g., antibody fragments, etc.) of the present invention.

[0107] Naturally occurring antibodies are generally monospecific, i.e., they bind to only one antigen. The present invention provides binding agents that bind to cytotoxic cells (by associating with the CD3 receptor) and to cancer cells (by associating with CLDN). The binding agents of the present invention are at least bispecific or multispecific (e.g., trispecific, tetraspecific, etc.).

[0108] The binding agents of the present invention may be in the form of an antibody molecule, or an antibody-like molecule, or a protein scaffold with antibody-like properties, or a cyclic peptide with at least two binding specificities. Thus, the binding agent may comprise one or more antibodies or fragments thereof as described herein.

[0109] According to the present invention, bispecific molecules, particularly bispecific proteins such as bispecific antibodies, are molecules that have two different binding specificities and can therefore bind to two different types of antigens (e.g., CLDN and CD3). In particular, the term "bispecific antibody" as used herein refers to an antibody that comprises two antigen-binding sites, where the first binding site has affinity for a first antigen or epitope and the second binding site has affinity for a second antigen or epitope that is different from the first antigen or epitope. Specifically, bispecific antibodies are artificial proteins that are composed of fragments of two different antibodies (where the fragments of the two different antibodies form two binding domains) and, as a result, bind to two different types of antigens. Bispecific antibodies according to the present invention are engineered to simultaneously bind to immune cells (e.g., immune effector cells), in particular T cells (e.g., cytotoxic cells) (by binding to CD3) and to target cells, such as cancer cells, for destruction (by binding to the tumor-associated antigen CLDN).

[0110] The term "bispecific antibody" also includes diabodies, which are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but with a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing them to pair with the complementary domains on another chain and providing two antigen-binding sites (see, e.g., Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ et al. (1994) Structure 2:1121-1123).

[0111] A "multispecific binding agent" is a molecule that has three or more different binding specificities.

[0112] Particularly preferred according to the present invention are bispecific antibodies, including bispecific antibody fragments, and in particular bispecific single-chain antibodies, including bispecific single-chain antibody fragments. The term "bispecific single-chain antibody" refers to a single polypeptide chain comprising two binding domains. In particular, the term "bispecific single-chain antibody" or "single-chain bispecific antibody" or related terms according to the present invention preferably refer to an antibody construct resulting from linking at least two antibody variable regions in a single polypeptide chain that lacks the constant and / or Fc portions present in intact immunoglobulins.

[0113] For example, a bispecific single-chain antibody can be a construct in which a total of two antibody variable regions (e.g., two VH regions, each capable of specifically binding to a different antigen) are linked to each other via a short polypeptide spacer, such that the two antibody variable regions, with the spacer between them, exist as a single continuous polypeptide chain. Another example of a bispecific single-chain antibody can be a single polypeptide chain having three antibody variable regions. Here, two antibody variable regions, for example, one VH and one VL, can constitute an scFv in which the two antibody variable regions are linked to each other via a synthetic polypeptide linker, although in this case the latter is often genetically engineered to be minimally immunogenic while remaining maximally resistant to proteolysis. This scFv can specifically bind to a specific antigen and is linked to an additional antibody variable region (e.g., a VH region) capable of binding to an antigen different from the antigen bound by the scFv. Yet another example of a bispecific single-chain antibody can be a single polypeptide chain having four antibody variable regions. Here, two first antibody variable regions, for example, a VH region and a VL region, may form one scFv capable of binding to one antigen, while a second VH region and a second VL region may form a second scFv capable of binding to a different antigen. Within a single continuous polypeptide chain, the individual antibody variable regions of one specificity may conveniently be separated by a synthetic polypeptide linker, while each scFv may conveniently be separated by a short polypeptide spacer, as described above.

[0114] According to one embodiment of the present invention, the first binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the present invention, the first binding domain of the bispecific antibody comprises two antibody variable domains, preferably an scFv, i.e., VH-VL or VL-VH. According to one embodiment of the present invention, the second binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the present invention, the second binding domain of the bispecific antibody comprises two antibody variable domains, preferably an scFv, i.e., VH-VL or VL-VH. Thus, in its minimal form, the total number of antibody variable regions in the bispecific antibody according to the present invention is only two. For example, such an antibody may comprise two VH domains or two VHH domains.

[0115] According to one embodiment of the present invention, the first binding domain and the second binding domain of the bispecific antibody each comprise one antibody variable domain, preferably a VHH domain. According to one embodiment of the present invention, the first binding domain and the second binding domain of the bispecific antibody each comprise two antibody variable domains, preferably an scFv, i.e., VH-VL or VL-VH. In this embodiment, the binding agent of the present invention preferably comprises (i) a heavy chain variable domain (VH) of a CLDN antibody, (ii) a light chain variable domain (VL) of a CLDN antibody, (iii) a heavy chain variable domain (VH) of a CD3 antibody, and (iv) a light chain variable domain (VL) of a CD3 antibody.

[0116] Bispecific full-length antibodies may be obtained by covalently linking two monoclonal antibodies or by conventional hybrid-hybridoma technology. Covalently linking two monoclonal antibodies is described by Anderson, Blood, 80 (1992), 2826-34. In the context of the present invention, one of these antibodies is specific for CLDN and the other for CD3.

[0117] In one embodiment, the bispecific binding agent is in the form of an antibody-like molecule having a heavy chain containing two consecutive N-terminal variable domains with different specificities and a light chain with two consecutive variable domains with different specificities, resulting in four binding domains with two different specificities (Wu et al., Nat. Biotechnology, 2007, 25(11)), except in this case one specificity is CD3 and the other specificity is CLDN.

[0118] In a preferred embodiment, the bispecific binding agents of the invention are in the form of antibody fragments.

[0119] In one embodiment, a bispecific molecule according to the present invention comprises two Fab regions, one directed against a CLDN antigen and the other directed against CD3. In one embodiment, the molecule of the present invention is an antigen-binding fragment (Fab)2 complex. The Fab2 complex is composed of two Fab fragments, one of which contains an Fv domain (i.e., a VH domain and a VL domain) specific for the CD3 antigen, and the other of which contains an Fv domain specific for a CLDN antigen. Each of these Fab fragments may be composed of two single chains, i.e., a VL-CL module and a VH-CH module. Alternatively, each of the individual Fab fragments may be arranged as a single chain, preferably VL-CL-CH-VH, and the individual variable and constant domains may be connected by a peptide linker. Generally, the individual single chains and Fab fragments may be connected by disulfide bonds, adhesive domains, chemical linkages, and / or peptide linkers. Bispecific molecules may also comprise three or more Fab fragments, in particular molecules may be Fab3, Fab4 or multimeric Fab complexes with specificities for two, three, four or more different antigens. The invention also includes chemically linked Fabs.

[0120] In one embodiment, binding agents according to the present invention include various types of bivalent and trivalent single-chain variable fragments (scFvs), i.e., fusion proteins mimicking the variable domains of two antibodies. Single-chain variable fragments (scFvs) are fusion proteins in which the variable regions of an immunoglobulin's heavy (VH) and light (VL) chains are linked by a short linker peptide of 10 to about 25 amino acids. The linker is typically glycine-rich for flexibility, as well as serine- or threonine-rich for solubility, and can link the N-terminus of the VH to the C-terminus of the VL, or conversely, the N-terminus of the VL to the C-terminus of the VH. Divalent (di-scFv, bi-scFv) single-chain variable fragments can be engineered by linking two scFvs. This can be done by creating a single peptide chain containing two VH and two VL regions, resulting in a tandem scFv. The present invention also includes multispecific molecules comprising three or more scFv binding domains. This allows the molecule to comprise multiple antigen specificities and be either a trispecific, tetraspecific or multispecific molecule, or a bispecific molecule comprising two or more scFv binding domains with specificity for the same antigen. In particular, the molecules of the present invention may be multispecific single-chain Fvs.

[0121] Another possibility is to create scFvs using a linker peptide (approximately 5 amino acids) that is too short for the two variable regions to fold together, thereby forcing the scFv to dimerize. This type is known as a diabody. Even shorter linkers (1 or 2 amino acids) lead to the formation of trimers (so-called triabodies or tribodies). Tetrabodies have also been created. They show even greater affinity for their targets than diabodies.

[0122] A particularly preferred example of a bispecific antibody fragment is a diabody (Kipriyanov, Int. J. Cancer, 77 (1998), 763-772), which is a small, bivalent, and bispecific antibody fragment. Diabodies contain a heavy-chain variable domain (VH) linked to a light-chain variable domain (VL) in the same polypeptide chain (VH-VL) by a peptide linker that is too short to allow pairing between the two domains on the same chain. This forces pairing with the complementary domain in another chain and promotes the assembly of a dimeric molecule with two functional antigen-binding sites. To construct the bispecific diabody of the present invention, the V domains of an anti-CD3 antibody and an anti-CLDN antibody may be fused to generate two chains: VH(CD3)-VL(CLDN) and VH(CLDN)-VL(CD3). Each chain alone cannot bind to its respective antigen, but when paired with the other chain, it recreates the functional antigen-binding sites of anti-CD3 and anti-CLDN antibodies. To achieve this goal, a peptide linker that is too short to allow pairing between the two domains on the same chain is used. These two scFv molecules are co-expressed with a linker between the heavy and light chain variable domains that is too short for intramolecular dimerization, and they self-assemble to form a bispecific molecule with two binding sites on opposite sides.

[0123] In one embodiment, a multispecific molecule according to the invention comprises immunoglobulin variable domains (VH, VL) and constant domains (C). In one embodiment, the bispecific molecule is a minibody, preferably a minibody comprising two single VH-VL-C chains connected to each other via the constant domains (C) of each chain. According to this aspect, the corresponding variable heavy chain region (VH), the corresponding variable light chain region (VL), and the constant domains (C) are arranged from N-terminus to C-terminus in the order VH(CLDN)-VL(CLDN)-(C) and VH(CD3)-VL(CD3)-C, where C is preferably a CH3 domain. Pairing of the constant domains results in the formation of a minibody.

[0124] According to another particularly preferred aspect, the bispecific binding agent of the invention is in the form of a bispecific single-chain antibody construct comprising or consisting of at least two binding domains, whereby one of said domains binds to CLDN and the second domain binds to CD3. Such molecules are also called "bispecific T cell engagers" (BiTEs) (the term BiTE only refers to bispecific molecules in which one arm is specific for CD3), and consist of two scFv molecules connected via a linker peptide.

[0125] As used herein, a "bispecific single-chain antibody" refers to a single polypeptide chain comprising two binding domains. Each binding domain comprises a variable region ("VH region") from an antibody heavy chain, where the VH region of the first binding domain specifically binds to a CLDN and the VH region of the second binding domain specifically binds to CD3. These two binding domains are optionally linked to each other by a short polypeptide spacer. A non-limiting example of a polypeptide spacer is Gly-Gly-Gly-Gly-Ser (GGGGS) and repeats thereof. Each binding domain may further comprise one variable region ("VL region") from an antibody light chain, where the VH and VL regions within the first and second binding domains are linked to each other via a polypeptide linker long enough to allow pairing between the VH and VL regions of the first binding domain and the VH and VL regions of the second binding domain.

[0126] According to this aspect, the corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) are arranged from N-terminus to C-terminus in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN), or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). However, it is also envisaged that the bispecific single chain antibodies of the invention comprise other domain configurations, such as VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3), VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3), VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3), VL(CD3)-VH(CD3)-VH(CLDN)-VL(CLDN), VL(CD3)-VH(CD3)-VL(CLDN)-VH(CLDN), etc.

[0127] A long linker typically connects a corresponding variable heavy chain region (VH) and a corresponding variable light chain region (VL) to form an scFv binding domain, while a short linker typically connects two scFv binding domains. Linkers are typically designed to provide flexibility and protease resistance, and preferably contain glycine and / or serine amino acid residues. A short peptide linker may consist of 12 or fewer amino acids, e.g., 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acids, preferably 5 or 6 amino acids. A short peptide linker preferably contains the amino acid sequence SGGGGS or GGGGS. A long peptide linker may consist of 12 or more amino acids, e.g., 15-25 amino acids, 15-20 amino acids, or 15-18 amino acids. The long peptide linker preferably comprises the amino acid sequence (GGGGS)3 or VE(GGSGGS)2GGVD. Further long peptide linkers may comprise the amino acid sequence (GGGGS)4, (GGGGS)5 or GGGGS(GGS)3GGGS.

[0128] Binding agents according to the invention may also comprise an amino acid sequence to facilitate secretion of the molecule (e.g., an N-terminal secretory signal) and / or one or more epitope tags to facilitate binding, purification or detection of the molecule.

[0129] Preferably, the secretory signal is a signal sequence (e.g., a signal sequence selected from any one of SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55) that allows for efficient passage through the secretory pathway and / or secretion of the binding agent into the extracellular environment. Preferably, the secretory signal sequence is cleavable and removed from the mature binding agent. The secretory signal sequence is preferably selected with respect to the cell or organism in which the binding agent is produced.

[0130] The amino acid sequence of the epitope tag may be introduced at any position within the amino acid sequence of the binding agent, may take the form of a loop within the encoded protein structure, or may be fused to the binding agent at its N- or C-terminus. Preferably, the epitope tag is fused to the binding agent at its C-terminus. The epitope tag may contain a cleavage site that allows the tag to be removed from the binding agent. The epitope tag may be any type of epitope tag that is functional under native and / or denaturing conditions, preferably a histidine tag, and most preferably a tag containing six histidines.

[0131] In addition to the first and second binding domains, the bispecific binding agents of the invention may contain further binding domains that serve, for example, to enhance selectivity for tumor cells. This can be achieved, for example, by providing binding domains that bind to other antigens expressed on tumor cells.

[0132] In the context of the present invention, the produced binding agents are preferably capable of eliciting immune effector functions as described herein, preferably against cells bearing the tumor-associated antigen CLDN on their surface.

[0133] The term "immune effector function," in the context of the present invention, includes any function mediated by a component of the immune system that results in the inhibition of tumor growth and / or tumor progression, including, for example, the inhibition of tumor dissemination and metastasis. Preferably, the immune effector function results in the killing of tumor cells. Such functions include complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), induction of apoptosis in tumor-associated antigen-bearing cells, cytolysis of tumor-associated antigen-bearing cells, and / or inhibition of proliferation of tumor-associated antigen-bearing cells. Binding agents may also exert their effects by simply binding to tumor-associated antigens on the surface of cancer cells. For example, an antibody may block the function of a tumor-associated antigen or induce apoptosis simply by binding to a tumor-associated antigen on the surface of cancer cells.

[0134] The binding agents described herein may be conjugated to a therapeutic moiety or agent, such as a cytotoxin, a drug (e.g., an immunosuppressant), or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to, and in particular kills, cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, as well as analogs and homologs thereof. Suitable therapeutic agents for forming conjugates include, but are not limited to, the following: antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibenzofuran, Examples of therapeutic agents include bromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatinum(II) (DDP) (cisplatin)), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic or radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF.In preferred embodiments, the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide, or ricin A.

[0135] The binding agents can also be conjugated to radioisotopes (eg, iodine-131, yttrium-90, or indium-111) to create cytotoxic radiopharmaceuticals.

[0136] A variety of techniques are well known for conjugating such therapeutic moieties to antibodies. For example, Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc., 1985); Hellstrom et al., "Antibodies For Drug Delivery", Controlled Drug Delivery (2nd edition), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc., 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", Monoclonal Antibodies'84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", Monoclonal Antibodies For Cancer Detection And See Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press, 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates," Immunol. Rev., 62 (1982), 119-58.

[0137] The term "binding" according to the present invention preferably relates to specific binding.

[0138] According to the present invention, an agent, such as an antibody, is capable of binding to a predetermined target if it has significant affinity for the target and binds to the target in a standard assay. "Affinity" or "binding affinity" is often measured by the equilibrium dissociation constant (KD). Preferably, the term "significant affinity" refers to an affinity greater than 10 -5 M or less, 10 -6 M or less, 10 -7 M or less, 10 -8 M or less, 10 -9 M or less, 10 -10 M or less, 10 -11 It indicates binding to a given target with a dissociation constant (KD) of 10 M or less or 10 M or less.

[0139] An agent is incapable of (substantially) binding to a target if it has no significant affinity for the target and does not significantly bind to the target in a standard assay, particularly if it does not detectably bind. Preferably, the agent does not detectably bind to the target if the target is present at a concentration of up to 2 μg / ml, preferably up to 10 μg / ml, more preferably up to 20 μg / ml, particularly up to 50 μg / ml or 100 μg / ml or more. Preferably, the agent has a KD that is at least 10 times greater than the KD for binding to a given target that the agent can bind, such as by a KD that is 100 times greater, such as by a KD that is 1 ... 3 With a KD that is 10 times larger 4 With a KD that is 10 times larger 5 By 10 times larger KD, or 6 If an agent binds to a target with a KD that is 10 times greater, then it does not have significant affinity for that target. For example, if an agent has a KD for binding to a target to which it can bind, then it does not have significant affinity for that target. -7 M, then the KD for binding to a target for which the agent has no significant affinity is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M or 10-1 It seems to be M.

[0140] An agent such as an antibody is specific for a given target if it can bind to the given target while being unable to bind to other targets, i.e., if it has no significant affinity for the other targets and does not significantly bind to the other targets in standard assays. According to the present invention, an agent is specific for a CLDN if it can bind to the CLDN but is (substantially) unable to bind to other targets. Preferably, an agent is specific for a CLDN if its affinity and binding to such other targets do not significantly exceed its affinity or binding to non-CLDN-related proteins (e.g., bovine serum albumin (BSA), casein, human serum albumin (HSA), or transmembrane proteins other than claudins (e.g., MHC molecules or transferrin receptors), or any other specified polypeptides). Preferably, an agent is specific for a given target if it binds to the given target with a KD that is at least 10-fold lower, 100-fold lower, 103-fold lower, 104-fold lower, 105-fold lower, or 106-fold lower than the KD for binding to a target for which the agent is not specific. For example, if an agent has a KD for binding to a target for which the agent is specific, the agent may bind to the given target with a KD that is at least 10-fold lower, 100-fold lower, 103-fold lower, 104-fold lower, 105-fold lower, or 106-fold lower. -7 M, then the KD for binding to a target to which the agent is not specific is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M or 10 -1 It seems to be M.

[0141] The binding of an agent to a target can be experimentally determined using any suitable method (see, for example, Berzofsky et al., "Antibody-Antigen Interactions," Fundamental Immunology, Paul, WE ed., Raven Press, New York, NY (1984); Kuby, Janis, Immunology, WH Freeman and Company, New York, NY (1992)) and the methods described herein. Affinity can be easily determined using conventional techniques, such as by equilibrium dialysis; by using a BIAcore 2000 instrument using the general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by other methods known to those skilled in the art. Affinity data can be analyzed, for example, by the method of Scatchard et al. (Ann NYAcad.ScL, 51:660 (1949)). The measured affinity of a particular antibody-antigen interaction may differ if measured under different conditions (e.g., salt concentration, pH). Therefore, measurements of affinity and other antigen binding parameters (e.g., KD, IC50) are preferably performed using standardized solutions of antibody and antigen and standardized buffers.

[0142] As used herein, "isotype" refers to the antibody class (eg, IgM or IgG1) that is encoded by heavy chain constant region genes.

[0143] As used herein, "isotype switching" refers to the phenomenon in which the class of an antibody, i.e., the isotype of an antibody, changes from one Ig class to one of the other Ig classes.

[0144] The term "naturally occurring," as used herein as applied to an object, refers to the fact that the object can be found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including a virus) that can be isolated from a natural source and has not been intentionally modified by man in the laboratory is naturally occurring.

[0145] The term "rearranged," as used herein, refers to the configuration of a heavy or light chain immunoglobulin locus in which a V segment is positioned immediately adjacent to a DJ or J segment in a configuration that encodes essentially a complete VH or VL domain, respectively. Rearranged immunoglobulin (antibody) gene loci can be identified by comparison to germline DNA; rearranged loci will have at least one recombined heptamer / nonamer homology element.

[0146] The term "unrearranged configuration" or "germline configuration," as used herein in reference to V segments, refers to an arrangement in which the V segment does not recombine so that it is immediately adjacent to a D or J segment.

[0147] In one embodiment, the binding agent of the present invention has the ability to bind to CLDN18.2, i.e., the ability to bind to an epitope present in CLDN18.2, preferably the ability to bind to an epitope located in the extracellular domain of CLDN18.2 (particularly the first extracellular loop, preferably amino acid positions 29 to 78 of CLDN18.2). In a specific embodiment, the agent capable of binding to CLDN18.2 binds to an epitope on CLDN18.2 that is not present on the surface of CLDN18.1.

[0148] The agent capable of binding to CLDN18.2 preferably binds to CLDN18.2 but not to CLDN18.1. Preferably, the agent capable of binding to CLDN18.2 is specific for CLDN18.2. Preferably, the agent capable of binding to CLDN18.2 binds to CLDN18.2 expressed on the cell surface. In a particularly preferred embodiment, the agent capable of binding to CLDN18.2 binds to a native epitope of CLDN18.2 present on the surface of living cells.

[0149] In a preferred embodiment, the agent capable of binding to CLDN18.2 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and fragments thereof.

[0150] In a preferred embodiment, the agent capable of binding to CLDN18.2 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and fragments thereof.

[0151] In certain preferred embodiments, the agent capable of binding to CLDN18.2 comprises a combination of a heavy chain variable region (VH) and a light chain variable region (VL) selected from possibilities (i) to (ix) below: (i) VH comprises the amino acid sequence represented by SEQ ID NO: 5 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof; (ii) the VH comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof; (iii) the VH comprises the amino acid sequence represented by SEQ ID NO: 7 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof; (iv) the VH comprises the amino acid sequence represented by SEQ ID NO: 9 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 16 or a fragment thereof; (v) the VH comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof; (vi) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof; (vii) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 17 or a fragment thereof; (viii) the VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 18 or a fragment thereof; (ix) VH comprises the amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof.

[0152] In a particularly preferred embodiment, the agent capable of binding to CLDN18.2 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof.

[0153] In a further particularly preferred embodiment, the agent capable of binding to CLDN18.2 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 11 or a fragment thereof.

[0154] The term "fragment" particularly refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable region (VH) and / or the light chain variable region (VL), and preferably refers to at least the CDR3 variable region of the heavy chain variable region (VH) and / or the light chain variable region (VL). In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

[0155] In one embodiment, a binding agent as described herein comprising one or more CDRs, a set of CDRs, or a combination of sets of CDRs comprises the CDRs together with their intervening framework regions. Preferably, the portion will also comprise at least about 50% of either or both of the first and fourth framework regions, provided that the 50% is the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents produced by recombinant DNA techniques may result in the introduction of N- or C-terminal residues of the variable region encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers for joining the variable regions of the invention to additional protein sequences, including immunoglobulin heavy chains, other variable domains (e.g., in the production of diabodies), or protein tags.

[0156] In one embodiment, a binding agent as described herein comprising a combination of one or more CDRs, a set of CDRs or sets of CDRs comprises said CDRs within a human antibody framework.

[0157] In one embodiment, the binding agent of the present invention has the ability to bind to CLDN6, i.e., the ability to bind to an epitope present in CLDN6, preferably the ability to bind to an epitope located in the extracellular domain of CLDN6 (particularly the first extracellular loop, preferably amino acid positions 28 to 76 of CLDN6, or the second extracellular loop, preferably amino acid positions 141 to 159 of CLDN6). In a specific embodiment, the agent capable of binding to CLDN6 binds to an epitope on CLDN6 that is not present on the surface of CLDN9. Preferably, the agent capable of binding to CLDN6 binds to an epitope on CLDN6 that is not present on the surface of CLDN4 and / or CLDN3. Most preferably, the agent capable of binding to CLDN6 binds to an epitope on CLDN6 that is not present on the surface of CLDN proteins other than CLDN6.

[0158] The agent capable of binding to CLDN6 preferably binds to CLDN6 but not to CLDN9, and preferably not to CLDN4 and / or CLDN3. Preferably, the agent capable of binding to CLDN6 is specific for CLDN6. Preferably, the agent capable of binding to CLDN6 binds to CLDN6 expressed on the cell surface. In a particularly preferred embodiment, the agent capable of binding to CLDN6 binds to a native epitope of CLDN6 present on the surface of living cells.

[0159] In a preferred embodiment, the agent capable of binding to CLDN6 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26 and fragments thereof.

[0160] In a preferred embodiment, the agent capable of binding to CLDN6 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100 and fragments thereof.

[0161] In certain preferred embodiments, the agent capable of binding to CLDN6 comprises a combination of a heavy chain variable region (VH) and a light chain variable region (VL) selected from the following possibilities (i) to (xi): (i) VH comprises the amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof; (ii) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof; (iii) the VH comprises the amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 25 or a fragment thereof; (iv) the VH comprises the amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 27 or a fragment thereof; (v) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof; (vi) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 28 or a fragment thereof; (vii) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof; (viii) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 97 or a fragment thereof; (ix) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 98 or a fragment thereof; (x) the VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 99 or a fragment thereof; (xi) VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 100 or a fragment thereof.

[0162] In a particularly preferred embodiment, the agent capable of binding to CLDN6 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof.

[0163] In a further particularly preferred embodiment, the agent capable of binding to CLDN6 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 97 or a fragment thereof.

[0164] In a further particularly preferred embodiment, the agent capable of binding to CLDN6 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 98 or a fragment thereof.

[0165] In a further particularly preferred embodiment, the agent capable of binding to CLDN6 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 99 or a fragment thereof.

[0166] In a further particularly preferred embodiment, the agent capable of binding to CLDN6 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 100 or a fragment thereof.

[0167] The term "fragment" particularly refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable region (VH) and / or the light chain variable region (VL), and preferably refers to at least the CDR3 variable region of the heavy chain variable region (VH) and / or the light chain variable region (VL). In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

[0168] In one embodiment, a binding agent as described herein comprising one or more CDRs, a set of CDRs, or a combination of sets of CDRs comprises the CDRs together with their intervening framework regions. Preferably, the portion will also comprise at least about 50% of either or both of the first and fourth framework regions, provided that the 50% is the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents produced by recombinant DNA techniques may result in the introduction of N- or C-terminal residues of the variable region encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers for joining the variable regions of the invention to additional protein sequences, including immunoglobulin heavy chains, other variable domains (e.g., in the production of diabodies), or protein tags.

[0169] In one embodiment, a binding agent as described herein comprising a combination of one or more CDRs, a set of CDRs or sets of CDRs comprises said CDRs within a human antibody framework.

[0170] Anti-CD3 antibodies useful for providing binding agents according to the present invention include, but are not limited to, UCHT1-HS (humanized mAB), UCHT1-MM (murine mAB), CLB-T3, TR66, 145-2C11.

[0171] UCHT1 is a monoclonal IgG1 anti-CD3 antibody that detects CD3 in human and primate sample types. CLB-T3 is a mouse monoclonal anti-CD3 antibody directed against the CD3 antigen and reacts with 80%-90% of human peripheral T lymphocytes and medullary thymocytes. TR66 is a mouse IgG1 monoclonal anti-CD3 antibody that recognizes the epsilon chain of human CD3. 145-2C11 is an Armenian hamster monoclonal anti-mouse CD3 antibody.

[0172] Preferably, the VH and VL regions of the CD3-binding domain are derived from antibodies / antibody molecules and antibody-like molecules capable of specifically recognizing human CD3 in the context of other TCR subunits as present on the surface of activated primary human T cells expressing the TCR in its native configuration. VH and VL regions derived from antibodies specific for the CD3 epsilon chain are most preferred, and the (parent) antibody should specifically bind to an epitope that reflects the native or near-native structure or a conformational epitope of human CD3 presented in the context of the TCR complex. In a preferred embodiment of the invention, the VH and VL regions of the CD3-binding domain are derived from a CD3-specific antibody selected from the group consisting of UCHT1-HS, UCHT1-MM, CLB-T3, and TR66, preferably TR66.

[0173] In a preferred embodiment, the agent capable of binding to CD3 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 94, SEQ ID NO: 95 and fragments thereof.

[0174] In a preferred embodiment, the agent capable of binding to CD3 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 96 and fragments thereof.

[0175] In certain preferred embodiments, the agent capable of binding to CD3 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from possibilities (i) to (ix) below: (i) the VH comprises the amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 31 or a fragment thereof; (ii) the VH comprises the amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 33 or a fragment thereof; (iii) the VH comprises the amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof; (iv) the VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof; (v) the VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof; (vi) the VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof; (vii) the VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof; (viii) the VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof; (ix) VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof.

[0176] In a particularly preferred embodiment, the agent capable of binding to CD3 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof.

[0177] In a further particularly preferred embodiment, the agent capable of binding to CD3 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 94 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof.

[0178] In a further particularly preferred embodiment, the agent capable of binding to CD3 comprises the following combination of heavy chain variable regions (VH) and light chain variable regions (VL): The VH comprises the amino acid sequence represented by SEQ ID NO: 95 or a fragment thereof, and the VL comprises the amino acid sequence represented by SEQ ID NO: 96 or a fragment thereof.

[0179] The term "fragment" particularly refers to one or more of the complementarity determining regions (CDRs) of the heavy chain variable region (VH) and / or the light chain variable region (VL), and preferably refers to at least the CDR3 variable region of the heavy chain variable region (VH) and / or the light chain variable region (VL). In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from a set of complementarity determining regions (CDR1, CDR2 and CDR3). In a particularly preferred embodiment, the term "fragment" refers to CDR1, CDR2 and CDR3 of the complementarity determining regions of the heavy chain variable region (VH) and / or the light chain variable region (VL).

[0180] In one embodiment, a binding agent as described herein comprising one or more CDRs, a set of CDRs, or a combination of sets of CDRs comprises the CDRs together with their intervening framework regions. Preferably, the portion will also comprise at least about 50% of either or both of the first and fourth framework regions, provided that the 50% is the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents produced by recombinant DNA techniques may result in the introduction of N- or C-terminal residues of the variable region encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers for joining the variable regions of the invention to additional protein sequences, including immunoglobulin heavy chains, other variable domains (e.g., in the production of diabodies), or protein tags.

[0181] In one embodiment, a binding agent as described herein comprising a combination of one or more CDRs, a set of CDRs or sets of CDRs comprises said CDRs within a human antibody framework.

[0182] According to the present invention, a preferred binding agent that targets CLDN18.2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, or a variant thereof.

[0183] According to the present invention, a further preferred binding agent targeting CLDN18.2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92 and SEQ ID NO: 93, or a fragment or variant thereof. In one embodiment, the amino acid sequence lacks a secretion signal, such as an N-terminal secretion signal, in particular the sequence according to SEQ ID NO: 51, if a secretion signal is present, and / or lacks a His tag, such as a C-terminal His tag, in particular the sequence Gly-Gly-Ser-(His)6 or the sequence (His)6, if a His tag is present.

[0184] According to the present invention, a preferred binding agent that targets CLDN6 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45, or a variant thereof.

[0185] According to the present invention, a further preferred binding agent targeting CLDN6 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64 and SEQ ID NO: 65, or a fragment or variant thereof. In one embodiment, said amino acid sequence lacks a secretory signal, such as an N-terminal secretory signal, in particular, a sequence according to SEQ ID NO: 51, if a secretory signal is present, and / or lacks a His tag, such as a C-terminal His tag, in particular, the sequence Gly-Gly-Ser-(His)6 or the sequence (His)6, if a His tag is present.

[0186] It should be understood that the binding agents described herein may be delivered to a patient by administering a nucleic acid (e.g., RNA, etc.) encoding the agent and / or by administering host cells containing a nucleic acid (e.g., RNA, etc.) encoding the agent. Thus, when administered to a patient, the nucleic acid encoding the binding agent may be present in a naked form or in a suitable delivery vehicle, such as a liposome or viral particle, i.e., within the host cell. The provided nucleic acid can produce the agent in a sustained manner over an extended period of time, which at least partially alleviates the instability observed with therapeutic antibodies (particularly bispecific antibodies). Nucleic acids for delivery to a patient can be produced by recombinant means. If the nucleic acid is administered to a patient without being present within a host cell, the nucleic acid is preferably taken up by the patient's cells for expression of the binding agent encoded by the nucleic acid. If the nucleic acid is administered to a patient while present within a host cell, the nucleic acid is preferably expressed by the host cell within the patient's body to produce the binding agent encoded by the nucleic acid.

[0187] The term "recombinant" in the context of the present invention means "produced by genetic engineering." Preferably, a "recombinant," such as a recombinant nucleic acid in the context of the present invention, does not occur in nature.

[0188] The term "naturally occurring" as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses), can be isolated from a natural source, and has not been intentionally modified by man in the laboratory is naturally occurring.

[0189] The term "nucleic acid," as used herein, is intended to include DNA and RNA, such as genomic DNA, cDNA, mRNA, recombinantly produced molecules, and chemically synthesized molecules. Nucleic acids can be single-stranded or double-stranded. RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA.

[0190] The nucleic acid may be contained in a vector. As used herein, the term "vector" encompasses any vector known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors (e.g., lambda phage), viral vectors (e.g., adenovirus vectors or baculovirus vectors), or artificial chromosome vectors (e.g., bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or P1 artificial chromosomes (PAC)). The vector also includes expression vectors, as well as cloning vectors. Expression vectors, including plasmids and viral vectors, generally contain a desired coding sequence and the appropriate DNA sequences required to express the operably linked coding sequence in a specific host cell (e.g., bacteria, yeast, plant, insect, or mammalian) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a specific desired DNA fragment and may lack functional sequences required for expression of the desired DNA fragment.

[0191] In the context of the present invention, the term "RNA" refers to a molecule comprising ribonucleotide residues, preferably a molecule composed entirely or substantially of ribonucleotide residues. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. This term includes double-stranded RNA, single-stranded RNA, isolated RNA (e.g., partially purified RNA), essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, for example, to the end of the RNA or internally, for example, at one or more nucleotides of the RNA. Nucleotides in RNA molecules can also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally occurring RNA.

[0192] According to the present invention, the term "RNA" refers to "messenger RNA" and includes "mRNA," which may be produced using DNA as a template and relates to a "transcript" encoding a peptide or protein, and preferably relates to such an "mRNA." mRNA typically comprises a 5'-untranslated region (5'-UTR), a protein or peptide coding region, and a 3'-untranslated region (3'-UTR). mRNA has a limited half-life in cells and in vitro. Preferably, mRNA is produced by in vitro transcription using a DNA template. In one embodiment of the present invention, RNA is obtained by in vitro transcription or chemical synthesis. In vitro transcription methodologies are known to those skilled in the art. For example, there are various in vitro transcription kits available commercially.

[0193] In one embodiment of the present invention, the RNA is self-replicating RNA, such as a single-stranded self-replicating RNA. In one embodiment, the self-replicating RNA is a positive-sense single-stranded RNA. In one embodiment, the self-replicating RNA is viral RNA or RNA derived from viral RNA. In one embodiment, the self-replicating RNA is alphavirus genomic RNA or derived from alphavirus genomic RNA. In one embodiment, the self-replicating RNA is a viral gene expression vector. In one embodiment, the virus is Semliki Forest virus. In one embodiment, the self-replicating RNA contains one or more transgenes, wherein at least one of the transgenes encodes a binding agent described herein. In one embodiment, if the RNA is viral RNA or derived from viral RNA, the transgene may partially or completely replace viral sequences (e.g., viral sequences encoding structural proteins). In one embodiment, the self-replicating RNA is in vitro transcribed RNA.

[0194] The genome of alphaviruses is a positive-sense single-stranded RNA (ssRNA(+)) encoding two open reading frames (ORFs) for a large polyprotein. The ORF at the 5' end of the genome encodes the nonstructural proteins nSP1 to nSP4 (nsP1 to nsP4), which are translated and processed by an RNA-dependent RNA polymerase (replicase); the ORF at the 3' end encodes the structural proteins, i.e., capsid and glycoproteins. Both ORFs are separated by a so-called subgenomic promoter (SGP), which controls the transcription of this structural ORF. When used as a gene vector, the structural proteins following the SGP are typically replaced by a transgene. To package such vectors into viral particles, the structural proteins are typically expressed in trans from a helper construct. Alphaviruses replicate exclusively at the RNA level in the cytoplasm of infected cells. After infection, the ssRNA (+) genome serves as mRNA for the translation of the nsP1234 polyprotein precursor, which is autoproteolytically processed into nsP123 and nsP4 fragments during the early stages of the viral life cycle. The nsP123 and nsP4 fragments form a negative-strand replicase complex that transcribes negative-strand RNA from the genomic RNA template. Later, the nsP1234 polyprotein is fully cleaved into individual proteins that assemble into the positive-strand replicase complex, synthesizing the new positive-strand genome as well as subgenomic transcripts encoding structural proteins or transgenes. Like the new genomic RNA, the subgenomic RNA is capped and polyadenylated and is therefore recognized as mRNA after target cell infection. Only the new genomic RNA contains a packaging signal that ensures exclusive packaging of the genomic RNA into budding virions. The appeal of alphavirus replicons for vectorology is based on the positive orientation of the capped and polyadenylated RNA genome.Translatable replicon RNA can be easily synthesized in vitro, whereby capping may be achieved by adding a cap analog to the in vitro transcription reaction, or a poly(A) tail may be encoded as a poly(T) run in the plasmid template. In vitro transcribed (IVT) replicons are transfected using conventional transfection techniques, rapidly expanding even small starting amounts of IVT RNA. Within hours of transfection, transgenes placed downstream of SGPs are transcribed to very high copy numbers of subgenomic RNA, approximately 40,000 to 200,000 copies per cell, leading not surprisingly to robust recombinant protein expression. Depending on the specific objective, IVT replicons may be transfected directly into target cells or packaged into alphavirus particles together with a helper vector that provides the structural gene in trans. Intradermal or intramuscular transfection results in significant, sustained local expression, paralleled by robust induction of humoral and cellular immune responses.

[0195] To increase the expression and / or stability of the RNA used in accordance with the present invention, the RNA may be modified, preferably without altering the sequence of the expressed peptide or protein.

[0196] The term "modified" in relation to RNA as used in accordance with the present invention encompasses any modification of RNA that is not naturally occurring in said RNA.

[0197] In one embodiment of the present invention, the RNA used in accordance with the present invention is free of uncapped 5'-triphosphates, and removal of such uncapped 5'-triphosphates can be achieved by treating the RNA with a phosphatase.

[0198] The RNA of the present invention may have modified naturally occurring or synthetic ribonucleotides to increase its stability and / or reduce cytotoxicity.For example, in one embodiment, in the RNA used according to the present invention, 5-methylcytidine is used partially or completely, preferably completely, to replace cytidine.Alternatively, or in addition, in one embodiment, in the RNA used according to the present invention, pseudouridine is used partially or completely, preferably completely, to replace uridine.

[0199] In one embodiment, the term "modification" refers to providing an RNA with a 5'-cap or 5'-cap analog. The term "5'-cap" refers to the cap structure found at the 5' end of an mRNA molecule, generally consisting of a guanosine nucleotide joined to the mRNA via an unusual 5'-to-5' phosphate linkage. In one embodiment, the guanosine is methylated at position 7. The term "conventional 5'-cap" refers to a naturally occurring RNA 5'-cap, preferably a 7-methylguanosine cap (m7G). In the context of the present invention, the term "5'-cap" includes 5'-cap analogs that are modified to resemble an RNA cap structure and, if added to RNA, preferably have the ability to stabilize the RNA in vivo and / or intracellularly.

[0200] Providing a 5'-cap or 5'-cap analog to RNA can be achieved by in vitro transcription of a DNA template in the presence of the 5'-cap or 5'-cap analog, where the 5'-cap is co-transcriptionally incorporated into the resulting RNA strand, or the RNA can be generated, for example, by in vitro transcription, and the 5'-cap added to the RNA post-transcriptionally using a capping enzyme, for example, vaccinia virus capping enzyme.

[0201] RNA may comprise further modification.For example, the further modification of the RNA used in the present invention may be the extension or shortening of naturally occurring poly(A) tail, or the change of 5' or 3' untranslated region (UTR), for example, the introduction of UTR that is not related to the coding region of said RNA, for example, the insertion of one or more copies, preferably two copies, of 3'-UTR from globin gene (for example, alpha2-globin, alpha1-globin, beta-globin, etc., preferably beta-globin, more preferably human beta-globin).

[0202] Therefore, to increase the stability and / or expression of the RNA used according to the present invention, the RNA may be modified to contain a polyA sequence, preferably a polyA sequence having 10 to 500 adenosine residues, more preferably a polyA sequence having 30 to 300 adenosine residues, even more preferably a polyA sequence having 65 to 200 adenosine residues, and especially a polyA sequence having 100 to 150 adenosine residues. In a particularly preferred embodiment, the polyA sequence has a length of approximately 120 adenosine residues. Additionally, incorporating two or more 3' untranslated regions (UTRs) into the 3' untranslated region of the RNA molecule can result in enhanced translation efficiency. In one specific embodiment, the 3'-UTR is derived from the human β-globin gene.

[0203] Preferably, when the RNA is delivered to a cell (particularly a cell present in a living organism), i.e., when transfected into a cell (particularly a cell present in a living organism), the RNA expresses the protein, peptide or antigen encoded by the RNA.

[0204] The term "transfection" refers to the introduction of nucleic acids (especially RNA) into cells. For purposes of the present invention, the term "transfection" also encompasses the introduction of nucleic acids into cells or the uptake of nucleic acids by such cells, although in this case the cells may be present in a subject (e.g., a patient). Thus, according to the present invention, cells for transfection of nucleic acids described herein can be present in vitro or in vivo; for example, the cells can form part of a patient's organ, tissue, and / or organism. According to the present invention, transfection can be transient or stable. For some transfection applications, transfection is sufficient if the transfected genetic material is only transiently expressed. Because nucleic acids introduced in the transfection process are usually not integrated into the nuclear genome, the foreign nucleic acid will be diluted or degraded through mitosis. In cells that allow episomal amplification of nucleic acids, the dilution rate is greatly reduced. If it is desired that the transfected nucleic acid actually remain in the genome of the cell and its daughter cells, stable transfection must occur. The RNA can be transfected into cells to transiently express the encoded protein.

[0205] The term "stability" of RNA relates to the "half-life" of the RNA. "Half-life" relates to the period required to eliminate half of the activity, amount, or number of a molecule. In the context of the present invention, the half-life of an RNA is an indication of the stability of said RNA. The half-life of an RNA may affect the "duration of expression" of the RNA. It can be expected that an RNA with a long half-life will be expressed for a long period of time.

[0206] In the context of the present invention, the term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA. The RNA may then be translated into protein. According to the present invention, the term "transcription" includes "in vitro transcription", provided that in this case the term "in vitro transcription" refers to the process by which RNA (particularly mRNA) is synthesized in vitro in a cell-free system, preferably using an appropriate cell extract. Preferably, various cloning vectors are applied for the production of transcripts. These cloning vectors are commonly referred to as transcription vectors and are encompassed by the term "vector" according to the present invention.

[0207] The term "translation" according to the present invention relates to the process in the ribosomes of a cell in which a chain of messenger RNA leads to the assembly of a sequence of amino acids to make a peptide or protein.

[0208] The term "expression" is used according to the present invention in its most general sense and includes the production of RNA and / or peptides or proteins, for example by transcription and / or translation. With respect to RNA, the term "expression" or "translation" particularly relates to the production of peptides or proteins. The term "expression" or "translation" also includes partial expression of nucleic acids. Moreover, expression can be transient or stable. According to the present invention, the term expression also includes "aberrant expression" or "abnormal expression".

[0209] "Aberrant expression" or "abnormal expression," according to the present invention, means that expression is altered, preferably increased, compared to a reference, e.g., compared to the state in a subject without a disease associated with aberrant or abnormal expression of a particular protein (e.g., a tumor antigen). An increase in expression indicates an increase of at least 10%, particularly an increase of at least 20%, at least 50%, or at least 100% or more. In one embodiment, expression is only found in diseased tissue, while expression in healthy tissue is suppressed.

[0210] The term "specifically expressed" means that a protein is essentially expressed only in a particular tissue or organ. For example, a tumor antigen specifically expressed in the gastric mucosa means that the protein is primarily expressed in the gastric mucosa and not expressed in other tissues or not expressed to a significant extent in other tissue or organ types. Thus, a protein that is exclusively expressed in cells of the gastric mucosa and expressed to a significantly lesser extent in any other tissue (e.g., testis) is specifically expressed in cells of the gastric mucosa. In some embodiments, a tumor antigen may also be specifically expressed in two or more tissue types or organs, for example, in two or three tissue types or organs, but preferably not more than three different tissue types or organ types, under normal conditions. In this case, the tumor antigen is then specifically expressed in these organs. For example, if a tumor antigen is expressed, preferably to approximately equal extent, in the lung and the stomach under normal conditions, the tumor antigen is specifically expressed in the lung and the stomach.

[0211] According to the present invention, the term "RNA encoding" means that the RNA can be expressed to produce the protein or peptide encoded by the RNA if the RNA is present in the appropriate environment, preferably within a cell.

[0212] Some aspects of the invention rely on adoptive transfer of host cells that are transfected in vitro with nucleic acid (e.g., RNA encoding a binding agent described herein) and transferred to a recipient (e.g., a patient), preferably after ex vivo expansion from low precursor frequencies to clinically relevant cell numbers. Host cells used for treatment according to the invention can be autologous, allogeneic, or syngeneic to the treated recipient.

[0213] The term "autologous" is used to refer to anything derived from the same subject. For example, an "autologous graft" refers to a transplant of tissue or organs derived from the same subject. Such procedures are advantageous because they overcome immunological barriers that would otherwise result in rejection.

[0214] The term "allogenic" is used to denote anything derived from different individuals of the same species. Two or more individuals are said to be allogenic to one another when their genes at one or more loci are not identical.

[0215] The term "syngeneic" is used to refer to anything derived from individuals or tissues having the same genotype, i.e., from identical twins or animals of the same inbred strain, or their tissues.

[0216] The term "xenogeneic" is used to describe something that is made up of many different elements. As an example, transferring bone marrow from one individual to a different individual constitutes a xenogeneic transplant. A xenogeneic gene is a gene that comes from a source other than the subject.

[0217] The term "peptide" according to the present invention includes oligopeptides and polypeptides and refers to a substance comprising two or more, preferably three or more, preferably four or more, preferably six or more, preferably eight or more, preferably nine or more, preferably ten or more, preferably thirteen or more, preferably sixteen or more, preferably twenty one or more, preferably up to eight, ten, twenty, thirty, forty or fifty amino acids, in particular up to one hundred amino acids, covalently linked by peptide bonds. The term "protein" refers to large peptides, preferably peptides having more than 100 amino acid residues, although in general the terms "peptide" and "protein" are synonymous and are used interchangeably herein.

[0218] Any teachings given herein regarding specific amino acid sequences (e.g., those shown in the Sequence Listing) should also be interpreted to relate to variants of the specific sequence that result in sequences that are functionally equivalent to the specific sequence, e.g., amino acid sequences that exhibit identical or similar properties to the specific amino acid sequence. One important property is retaining binding to a target or maintaining effector function. Preferably, a sequence that is a variant with respect to a specific sequence, when it replaces the specific sequence in an antibody, retains the antibody's ability to bind to CLDN and / or CD3 and, preferably, the function of the antibody as described herein, e.g., CDC- or ADCC-mediated lysis.

[0219] For example, the sequences shown in the sequence listing can be modified to remove one or more free cysteine ​​residues, preferably all free cysteine ​​residues, particularly by substituting these cysteine ​​residues with amino acids other than cysteine, preferably by substituting with serine, alanine, threonine, glycine, tyrosine, leucine or methionine, most preferably by substituting with alanine or serine.For example, the cysteine ​​at position 103 of the sequence shown in SEQ ID NO:36 in the sequence listing, or the corresponding cysteine ​​in the sequence containing said sequence, can be modified in this way.Other cysteines that can be modified in this way are the cysteine ​​at position 178 of SEQ ID NO:42, the cysteine ​​at position 197 of SEQ ID NO:43, the cysteine ​​at position 427 of SEQ ID NO:44, or the cysteine ​​at position 446 of SEQ ID NO:45.

[0220] In particular, it will be understood by those skilled in the art that the sequences of the CDR regions, hypervariable regions, and variable regions can be modified without losing the ability to bind to CLDN and / or CD3. For example, the CDR regions will be either identical to or highly homologous to regions of the antibodies specified herein. By "highly homologous," it is intended that one to five substitutions, preferably one to four substitutions, e.g., one to three substitutions, or one or two substitutions, etc., can be made in the CDRs. In addition, the hypervariable and variable regions can be modified to exhibit substantial homology with regions of the antibodies specifically disclosed herein.

[0221] For purposes of the present invention, "variants" of amino acid sequences include amino acid insertion variants, amino acid addition variants, amino acid deletion variants, and / or amino acid substitution variants. Amino acid deletion variants, including deletions at the N- and / or C-terminus of a protein, are also referred to as N- and / or C-terminal truncation variants.

[0222] Amino acid insertion variants include the insertion of only one or more amino acids in a specific amino acid sequence. In the case of amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific sites in the amino acid sequence, although random insertion with appropriate screening of the resulting products is also possible.

[0223] Amino acid addition variants include amino- and / or carboxy-terminal fusions of one or more amino acids (e.g., 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids, etc.).

[0224] Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, for example, 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. The deletion may be at any position in the protein.

[0225] Amino acid substitution variants are characterized by the removal of at least one residue in the sequence and the insertion of another residue in its place. It is preferred that the alteration be at a position in the amino acid sequence that is not conserved among homologous proteins or peptides and / or that the amino acid be replaced with another amino acid with similar properties. Preferably, the amino acid changes in the protein variant are conservative, i.e., the substitution of a similar charged or uncharged amino acid. Conservative amino acid changes involve the substitution of an amino acid within a family of amino acids that are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic amino acids (aspartic acid, glutamic acid), basic amino acids (lysine, arginine, histidine), nonpolar amino acids (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar amino acids (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.

[0226] Preferably, the degree of similarity, preferably the degree of identity, between a given amino acid sequence and an amino acid sequence that is a variant of the given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. The degree of similarity or identity is preferably given over an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably given for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids (preferably contiguous amino acids). In a preferred embodiment, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. Alignment to determine sequence similarity, preferably alignment to determine sequence identity, can be performed using tools known in the art, preferably using best sequence alignment, for example, Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0227] "Sequence similarity" refers to the percentage of amino acids, whether they are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences.

[0228] The term "percent identity" is intended to mean the percentage of amino acid residues that are identical between the two sequences to be compared, obtained after best alignment, provided that this percentage is purely statistical, and the differences between these two sequences are distributed randomly and over their entire length. Sequence comparison between two amino acid sequences is traditionally carried out by comparing these sequences after optimal alignment, provided that in this case the comparison is carried out by segments or "windows of comparison" to identify and compare local regions of sequence similarity. Optimal alignment of sequences for comparison may be performed manually or by the local homology algorithm of Smith and Waterman (1981, Ads App. Math., 2, 482), by the local homology algorithm of Neddleman and Wunsch (1970, J. Mol. Biol., 48, 443), by the similarity search method of Pearson and Lipman (1988, Proc. Natl. Acad. Sci. USA, 85, 2444), or by computer programs that use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA, which are included in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Drive, Madison, Wis.)).

[0229] Percent identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared, and multiplying the result by 100 to obtain the percentage identity between the two sequences.

[0230] Binding agents of the invention can be produced intracellularly (e.g., in the cytosol, periplasma, or in inclusion bodies) and then isolated from the host cells and, if necessary, further purified; alternatively, binding agents of the invention can be produced extracellularly (e.g., in the medium in which the host cells are cultured) and then isolated from the culture medium and, if necessary, further purified. Various methods and reagents used for recombinant production of polypeptides are known in the art, such as specific suitable expression vectors, transformation or transfection methods, selection markers, methods for inducing protein expression, and culture conditions. Similarly, various protein isolation and purification techniques are well known to those skilled in the art.

[0231] The term "cell" or "host cell" preferably relates to an intact cell, i.e., a cell with an intact membrane that has not released its normal intracellular components (e.g., enzymes, organelles, or genetic material). An intact cell is preferably a viable cell, i.e., a living cell that is capable of carrying out its normal metabolic functions. Preferably, the term relates, according to the present invention, to any cell that can be transfected with an exogenous nucleic acid. Preferably, the cell is capable of transfecting with an exogenous nucleic acid and expressing the nucleic acid in the recipient when transferred to the recipient. The term "cell" includes bacterial cells; other useful cells are yeast cells, fungal cells, or mammalian cells. Suitable bacterial cells include cells derived from Gram-negative bacterial strains, such as Escherichia coli, Proteus and Pseudomonas strains, and Gram-positive bacterial strains, such as Bacillus, Streptomyces, Staphylococcus, and Lactococcus strains. Suitable fungal cells include cells derived from Trichoderma, Neurospora, and Aspergillus species. Suitable yeast cells include cells derived from Saccharomyces species (e.g., Saccharomyces cerevisiae), Schizosaccharomyces species (e.g., Schizosaccharomyces pombe), Pichia species (e.g., Pichia pastoris and Pichia methanolicid), and Hansenula species. Suitable mammalian cells include, for example, CHO cells, BHK cells, HeLa cells, COS cells, 293HEK, and the like. However, amphibian cells, insect cells, plant cells, and any other cells used in the art for the expression of heterologous proteins can also be used. Mammalian cells are particularly preferred for adoptive transfer, such as cells from humans, mice, hamsters, pigs, goats, and primates.The cells may be derived from numerous tissue types and include primary cells and cell lines, such as cells of the immune system, particularly antigen-presenting cells (such as dendritic cells and T cells), stem cells (such as hematopoietic stem cells and mesenchymal stem cells), and other cell types. Antigen-presenting cells are cells that present antigens on their surface in the context of a major histocompatibility complex. T cells may recognize this complex using their T cell receptor (TCR).

[0232] "Reduce," "reduce," or "inhibit," as used herein, means an overall decrease in level, e.g., in the level of expression or in the level of cell proliferation, preferably by 5% or more, 10% or more, 20% or more, more preferably 50% or more, and most preferably 75% or more, or capable of causing such an overall decrease.

[0233] Terms such as "increase" or "enhance" preferably relate to an increase or enhancement of about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80%, and most preferably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000%, or even more.

[0234] Antibody-dependent cell-mediated cytotoxicity ADCC refers to the cell killing ability of effector cells (particularly lymphocytes) as described herein, although this preferably requires that the target cells be marked by an antibody.

[0235] ADCC preferably occurs when an antibody binds to an antigen on the surface of a tumor cell and the Fc domain of the antibody engages with an Fc receptor (FcR) on the surface of an immune effector cell. Several families of Fc receptors have been identified, and specific cell populations characteristically express defined Fc receptors. ADCC can be viewed as a mechanism for directly inducing variable, immediate tumor destruction, resulting in antigen presentation and induction of tumor-directed T cell responses. Preferably, in vivo induction of ADCC will result in tumor-directed T cell responses and host-derived antibody responses.

[0236] Complement-dependent cytotoxicity CDC is another cell killing method that can be induced by antibodies. IgM is the most effective isotype for complement activation. Both IgG1 and IgG3 are also highly effective in inducing CDC via the classical complement activation pathway. Preferably, in this cascade, the formation of an antigen-antibody complex exposes multiple C1q binding sites (C1q is one of the three subcomponents of complement C1) in close proximity on the surface of the CH2 domain of the participating antibody molecule (e.g., IgG molecule). Preferably, these exposed C1q binding sites convert the previously low-affinity C1q-IgG interaction into a high-avidity interaction, which triggers a cascade of events involving a series of other complement proteins, leading to the proteolytic release of the effector cell chemoattractants / activators C3a and C5a. Preferably, the complement cascade culminates in the formation of a membrane attack complex, which creates pores in the cell membrane that facilitate the free passage of water and solutes into and out of the cell.

[0237] The antibodies described herein, e.g., the antibodies described herein to provide VL and VH regions, can be produced by a variety of techniques, including conventional monoclonal antibody methodologies, e.g., the standard somatic cell hybridization technique of Kohler and Milstein (Nature, 256:495 (1975)). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibodies can be used, such as viral or oncogenic transformation of B lymphocytes, or phage display techniques using libraries of antibody genes.

[0238] The preferred animal system for preparing hybridomas secreting monoclonal antibodies is the mouse system. Hybridoma production in mice is a very well-established procedure. Various immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Various fusion partners (e.g., mouse myeloma cells) and fusion procedures are also known.

[0239] Other preferred animal systems for preparing hybridomas secreting monoclonal antibodies are the rat and rabbit systems (which are described, for example, in Spieker-Polet et al., Proc. Natl. Acad. Sci. USA, 92:9348 (1995); see also Rossi et al., Am. J. Clin. Pathol. 124:295 (2005)).

[0240] In yet another preferred embodiment, human monoclonal antibodies can be produced using transgenic or transgenic mice that have parts of the human immune system, rather than using the mouse system. These transgenic and transgenic mice include mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice." Human antibodies can be produced in such transgenic mice as described in detail for CD20 in International Publication WO2004035607.

[0241] Yet another strategy for generating monoclonal antibodies is to isolate antibody-encoding genes directly from lymphocytes that produce antibodies of defined specificities. See, e.g., Babcock et al. (1996, A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities). For details on recombinant antibody engineering, see also Welschof and Kraus, Recombinant antibodies for cancer therapy (ISBN-0-89603-918-8), and Benny KC Lo, Antibody Engineering (ISBN 1-58829-092-1).

[0242] To raise antibodies, mice can be immunized with carrier-conjugated peptides derived from the antigen sequence, i.e., the sequence to which the antibody is directed, an enriched preparation of recombinantly expressed antigen or its fragment, and / or cells expressing the antigen, as described. Alternatively, mice can be immunized with DNA encoding the antigen or its fragment. If immunization with a purified or enriched preparation of antigen does not result in antibodies, mice can also be immunized with cells (e.g., cell lines) expressing the antigen to enhance the immune response.

[0243] The immune response can be monitored over the course of the immunization protocol, with plasma and serum samples being obtained by tail vein or retroorbital bleeds. Mice with sufficient titers of immunoglobulin can be used for fusions. Mice can be boosted intraperitoneally or intravenously with antigen-expressing cells 3 days before sacrifice and removal of the spleen to increase the proportion of hybridomas secreting specific antibodies.

[0244] To generate hybridomas that produce monoclonal antibodies, spleen cells and lymph node cells from immunized mice can be isolated and fused to a suitable immortalized cell line (e.g., a mouse myeloma cell line). The resulting hybridomas can then be screened for the production of antigen-specific antibodies. Individual wells can then be screened by ELISA for antibody-secreting hybridomas. Immunofluorescence analysis and FACS analysis using antigen-expressing cells can identify antibodies with specificity for the antigen. Antibody-secreting hybridomas can be replated, screened again, and, if still positive for monoclonal antibodies, can be subcloned by limiting dilution. Stable subclones can then be cultured in vitro to generate antibodies in tissue culture medium for characterization.

[0245] Antibodies can also be produced in host cell transfectomas using a combination of recombinant DNA technology and gene transfection methods, for example, as are well known in the art (Morrison, S. (1985), Science, 229:1202).

[0246] For example, in one embodiment, a gene of interest, e.g., an antibody gene, can be ligated into an expression vector (e.g., a eukaryotic expression plasmid (e.g., the eukaryotic expression plasmid used by the GS gene expression system disclosed in International Publication Nos. WO 87 / 04462, WO 89 / 01036, and EP 338841), or other expression systems widely known in the art). The purified plasmid carrying the cloned antibody gene can be introduced into eukaryotic host cells (e.g., CHO cells, NS / 0 cells, HEK293T cells, or HEK293 cells), or alternatively, into other eukaryotic cells such as plant-derived cells, fungal cells, or yeast cells. The method used to introduce these genes can be any method described in the art, such as electroporation, lipofectin, or lipofectamine. After introducing these antibody genes into host cells, cells expressing the antibody can be identified and selected. These cells represent transfectomas that can then be amplified for their expression levels and scaled up to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and / or cells.

[0247] Alternatively, cloned antibody genes can be expressed in other expression systems, including prokaryotic cells (e.g., microorganisms), for example, E. coli. Furthermore, antibodies can be produced in non-human transgenic animals, for example, in milk from sheep and rabbits, or in eggs from chickens, or in transgenic plants; see, e.g., Verma, R. et al. (1998), J. Immunol. Meth., 216:165-181; Pollock et al. (1999), J. Immunol. Meth., 231:147-157; and Fischer, R. et al. (1999), Biol. Chem., 380:825-839.

[0248] Chimerization Unlabeled mouse antibodies are highly immunogenic in humans when administered repeatedly, resulting in reduced therapeutic efficacy. The primary immunogenicity is mediated by the heavy chain constant region. The immunogenicity of mouse antibodies in humans can be reduced or completely avoided if the respective antibodies are chimerized or humanized. Chimeric antibodies are antibodies whose various portions are derived from different animal species, such as antibodies having a variable region derived from a mouse antibody and a human immunoglobulin constant region. Antibody chimerization is achieved by linking the heavy and light chain variable regions of a mouse antibody with human heavy and light chain constant regions (e.g., as described by Kraus et al. in Methods in Molecular Biology series, Recombinant antibodies for cancer therapy (ISBN-0-89603-918-8)). In a preferred embodiment, chimeric antibodies are produced by linking a human kappa light chain constant region to a mouse light chain variable region. In a similarly preferred embodiment, chimeric antibodies can be produced by linking a human lambda light chain constant region to a mouse light chain variable region. Preferred heavy chain constant regions for producing chimeric antibodies are IgG1, IgG3, and IgG4. Other preferred heavy chain constant regions for generating chimeric antibodies are IgG2, IgA, IgD, and IgM.

[0249] Humanization Antibodies interact with target antigens primarily through amino acid residues located in the six complementarity-determining regions (CDRs) of their heavy and light chains. For this reason, the amino acid sequences within the CDRs exhibit greater diversity among individual antibodies than sequences outside the CDRs. Because CDR sequences are involved in most antibody-antigen interactions, recombinant antibodies that mimic the properties of a particular naturally occurring antibody can be expressed by constructing expression vectors containing CDR sequences from a specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al. (1998), Nature, 332:323-327; Jones, P. et al. (1986), Nature, 321:522-525; and Queen, C. et al. (1989), Proc. Natl. Acad. Sci. USA, 86:10029-10033). Such framework sequences can be obtained from publicly available DNA databases containing germline antibody gene sequences. These germline sequences will differ from the gene sequences of mature antibodies because they will not contain fully assembled variable genes (which are formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of high affinity secondary repertoire antibodies in individuals uniformly across the variable regions.

[0250] The ability of antibodies and other binding agents to bind to an antigen can be determined using standard binding assays, such as ELISA, Western blot, immunofluorescence and flow cytometry analysis.

[0251] To purify the antibody, the selected production cell line can be grown in a 2-liter spinner flask for recombinant antibody purification. Alternatively, the antibody can be produced in a dialysis-based bioreactor. The supernatant can be filtered and, if necessary, concentrated before affinity chromatography using protein L-Sepharose. The eluted IgG can be examined by gel electrophoresis and high-performance liquid chromatography to ensure purity. The buffer solution can be exchanged into PBS, and the concentration can be determined by OD280 using the respective extinction coefficients. The recombinant antibody can be aliquoted and stored at -80°C.

[0252] Flow cytometry can be used to demonstrate the binding of monoclonal antibodies to live cells expressing the antigen. Cell lines expressing the antigen naturally or after transfection, as well as negative controls lacking antigen expression (grown under standard growth conditions), can be mixed with various concentrations of monoclonal antibodies in hybridoma supernatants or in PBS containing 1% FBS and incubated at 4°C for 30 minutes. After washing, anti-IgG antibodies labeled with APC or Alexa647 can be bound to the antigen-bound monoclonal antibodies under the same conditions as primary antibody staining. Samples can be analyzed by flow cytometry using a FACS instrument, which uses light and side scatter properties to gate on individual live cells. A cotransfection method can be used to distinguish antigen-specific monoclonal antibodies from nonspecific binders in a single measurement. Cells transiently transfected with plasmids encoding the antigen and a fluorescent marker can be stained as described above. The transfected cells can be detected in a different fluorescence channel than the antibody-stained cells. Because the majority of transfected cells express both transgenes, antigen-specific monoclonal antibodies bind preferentially to cells expressing the fluorescent marker, whereas nonspecific antibodies bind at a similar rate to non-transfected cells. An alternative assay using fluorescence microscopy may be used in addition to or instead of the flow cytometry assay. Cells can be stained exactly as described above and examined by fluorescence microscopy.

[0253] Immunofluorescence microscopy can be used to demonstrate binding of monoclonal antibodies to live cells expressing the antigen. For example, cell lines expressing the antigen, either spontaneously or after transfection, and negative controls lacking antigen expression are grown in chamber slides under standard growth conditions in DMEM / F12 medium supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, 100 IU / ml penicillin, and 100 μg / ml streptomycin. Cells can then be fixed with methanol or paraformaldehyde or left untreated. The cells can then be reacted with monoclonal antibodies against the antigen for 30 minutes at 25°C. After washing, the cells can be reacted with an Alexa555-labeled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. The cells can then be examined by fluorescence microscopy.

[0254] Cell extracts from cells expressing the antigen and appropriate negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens will be transferred to a nitrocellulose membrane, blocked, and probed with the monoclonal antibody to be tested. IgG binding can be detected using anti-mouse IgG peroxidase and developed with ECL substrate.

[0255] The antibodies can also be examined for reactivity with the antigen by immunohistochemistry in a manner well known to those skilled in the art, for example, using paraformaldehyde-fixed or acetone-fixed frozen sections or paraformaldehyde-fixed paraffin-embedded tissue sections from non-cancerous and cancerous tissue samples obtained from patients during routine surgical procedures or from mice bearing xenograft tumors inoculated with cell lines expressing the antigen spontaneously or after transfection. For immunostaining, antibodies reactive with the antigen can be incubated, followed by incubation with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit antibodies (DAKO) according to the supplier's instructions.

[0256] Preclinical research The binding agents described herein can also be tested in an in vivo model, for example, in immunodeficient mice bearing xenograft tumors inoculated with a cell line expressing CLDN, to determine their efficacy in suppressing the growth of CLDN-expressing tumor cells.

[0257] In vivo studies can be conducted using the binding agents described herein after xenografting of CLDN-expressing tumor cells into immunocompromised mice or other animals. The binding agents can be administered to tumor-free mice, followed by injection of tumor cells, to measure the effectiveness of the binding agents in preventing tumor formation or tumor-related symptoms. The binding agents can be administered to tumor-bearing mice to determine the therapeutic efficacy of each binding agent in reducing tumor growth, metastasis, or tumor-related symptoms. Application of the binding agents can be combined with the administration of other substances, such as cytostatic drugs, growth factor inhibitors, cell cycle arresters, angiogenesis inhibitors, or antibodies, to determine the synergistic efficacy and potential toxicity of the combination. To analyze toxic side effects mediated by the binding agents, animals can be inoculated with the binding agent or a control agent, and the animals can be closely examined for symptoms that may be associated with CLDN binding agent therapy.

[0258] Mapping of epitopes recognized by binding agents can be performed as described in detail in "Epitope Mapping Protocols" (Methods in Molecular Biology) (Glenn E. Morris, ISBN-089603-375-9) and "Epitope Mapping: A Practical Approach" (Practical Approach Series 248, Olwyn MRWestwood, Frank C. Hay).

[0259] The compounds and agents described herein may be administered in the form of a suitable pharmaceutical composition, whatever the composition.

[0260] The pharmaceutical compositions of the present invention are preferably sterile and contain an effective amount of a binding agent described herein, and, if necessary, an effective amount of an additional agent as discussed herein, to produce the desired reaction or desired effect.

[0261] The pharmaceutical compositions are usually provided in uniform dosage form and may be prepared in a manner known per se The pharmaceutical composition may, for example, be in the form of a solution or suspension.

[0262] Pharmaceutical compositions may contain salts, buffer substances, preservatives, carriers, diluents and / or excipients, all of which are preferably pharmaceutically acceptable. The term "pharmaceutically acceptable" refers to the non-toxicity of materials that do not interact with the action of the active ingredients of the pharmaceutical composition.

[0263] Pharmaceutically unacceptable salts may be used to prepare pharmaceutically acceptable salts and are included in the present invention. Pharmaceutically acceptable salts of this type include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0264] Suitable buffering substances for use in the pharmaceutical compositions include acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt.

[0265] Suitable preservatives for use in pharmaceutical compositions include benzalkonium chloride, chlorobutanol, parabens and thimerosal.

[0266] Injectable formulations may contain pharmaceutically acceptable excipients such as Ringer's Lactate.

[0267] The term "carrier" refers to a natural or synthetic organic or inorganic ingredient with which the active ingredient is combined to facilitate, enhance, or enable application. According to the present invention, the term "carrier" also includes one or more compatible solid or liquid fillers, diluents, or encapsulating substances that are suitable for administration to a patient.

[0268] Possible carrier materials for parenteral administration are, for example, sterile water, Ringer's, lactated Ringer's, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes, and, particularly, biocompatible lactide polymer, lactide / glycolide copolymer, or polyoxyethylene / polyoxypropylene copolymer.

[0269] The term "excipient," as used herein, is intended to refer to any substance that may be present in a pharmaceutical composition and that is not an active ingredient (e.g., carriers, binders, lubricants, thickeners, surface-active agents, preservatives, emulsifiers, buffers, flavorings or coloring agents, etc.).

[0270] The agents and compositions described herein may be administered via any conventional route, for example, parenterally, including by injection or infusion. Administration is preferably parenteral, for example, intravenously, intraarterially, subcutaneously, intradermally, or intramuscularly.

[0271] The composition suitable for parenteral administration usually comprises a sterile aqueous or non-aqueous preparation of the active compound, which is preferably isotonic with the blood of the recipient. Examples of suitable carriers and solvents are Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are usually used as a solution medium or suspension medium.

[0272] The agents and compositions described herein are administered in an effective amount. An "effective amount" refers to an amount that alone or together with further doses achieves the desired response or desired effect. When treating a specific disease or a specific condition, the desired response preferably relates to inhibiting the course of the disease. This includes slowing the progression of the disease, and in particular, halting or reversing the progression of the disease. The desired response in the treatment of a disease or condition may also be slowing the onset of the disease or condition, or preventing the onset of the disease or condition.

[0273] The effective amount of the agent or composition described herein will depend on various factors, such as the condition to be treated, the severity of the disease, the individual parameters of the patient (including age, physiological condition, size and weight), the duration of treatment, the type of concomitant treatment (if any), the specific route of administration and similar factors.Therefore, the dose of the agent described herein to be administered may depend on various such parameters.If the patient's response is insufficient with the initial dose, a larger dose (or a substantially larger dose achieved by a different, more localized route of administration) may be used.

[0274] The agents and compositions described herein can be administered to patients, for example, in vivo, to treat or prevent various disorders (such as those described herein). Preferred patients include human patients with disorders that can be corrected or ameliorated by administering the agents and compositions described herein. This includes disorders involving cells characterized by altered expression patterns of CLDNs (such as, for example, CLDN18.2 and / or CLDN6).

[0275] For example, in one embodiment, the agents described herein can be used to treat patients with cancer diseases, e.g., patients with cancer diseases such as those described herein that are characterized by the presence of cancer cells that express CLDN.

[0276] The pharmaceutical compositions and treatment methods described according to the present invention may also be used for immunization or vaccination to prevent the diseases described herein.

[0277] The pharmaceutical compositions of the present invention may be administered together with supplemental immunopotentiators (e.g., one or more adjuvants), which may further enhance their effectiveness, preferably to achieve a synergistic immune stimulation effect. The term "adjuvant" refers to a compound that prolongs, enhances, or promotes an immune response. Various mechanisms are possible in this regard, depending on the type of adjuvant. For example, compounds that enable DC maturation, such as lipopolysaccharide or CD40 ligand, form the first category of suitable adjuvants. In general, any agent that affects the immune system as a "danger signal" (e.g., LPS, GP96, dsRNA, etc.) or cytokines (e.g., GM-CSF, etc.) can be used as an adjuvant that allows the immune response to be enhanced and / or influenced in a controlled manner. CpG oligodeoxynucleotides can also be used in this context, if necessary, although their side effects, which may occur under certain circumstances, must be taken into consideration, as explained above. Particularly preferred adjuvants are cytokines, such as monokines, lymphokines, interleukins, or chemokines, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFα, INF-γ, GM-CSF, LT-α, or growth factors (e.g., hGH). Additional known adjuvants include aluminum hydroxide, Freund's adjuvant, or oils (e.g., Montanide®), most preferably Montanide® ISA51. Lipopeptides, such as Pam3Cys, are also suitable for use as adjuvants in the pharmaceutical compositions of the present invention.

[0278] The agents and compositions provided herein may be used alone or in combination with conventional treatment regimens such as surgery, radiation, chemotherapy and / or bone marrow transplantation (autologous, syngeneic, allogeneic or unrelated).

[0279] Cancer treatment represents a particularly desirable area for combination strategies, as the combined action of two, three, four, or even more cancer drugs / therapeutics frequently results in synergistic effects significantly stronger than the effects of monotherapy approaches. Thus, in another embodiment of the present invention, cancer treatments that utilize immune- or vaccination-based mechanisms, such as the methods and pharmaceutical compositions of the present invention, can be effectively combined with various other drugs and / or methods that target similar or other specific mechanisms. These include, for example, combinations with conventional tumor therapies, multi-epitope strategies, additional immunotherapies, and treatment approaches that target angiogenesis or apoptosis (for a review, see, e.g., Andersen et al., 2008, Cancer treatment: the combination of vaccination with other therapies, Cancer Immunology Immunotherapy, 57(11):1735-1743). Sequential administration of different agents may inhibit cancer cell growth at different checkpoints, while other agents may inhibit, for example, angiogenesis, malignant cell survival, or metastasis (which potentially transforms cancer into a chronic disease). The following list provides some non-limiting examples of anti-cancer drugs and anti-cancer therapies that can be used in combination with the present invention:

[0280] 1.Chemotherapy Chemotherapy is the standard treatment for many types of cancer. Most common chemotherapeutic agents act by killing rapidly dividing cells, which is one of the main properties of cancer cells. Therefore, combination with conventional chemotherapy drugs, such as alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumor agents that affect either cell division or DNA synthesis, may significantly improve the therapeutic effects of the present invention by eliminating suppressor cells, i.e., by rebooting the immune system, or by making tumor cells more susceptible to immune-mediated killing, or by further activating cells of the immune system. Numerous studies have demonstrated the synergistic anti-cancer effects of chemotherapy drugs and vaccination-based immunotherapy drugs (see, e.g., Quoix et al., 2011, Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial, Lancet Oncol., 12(12):1125-33; see also, Liseth et al., 2010, Combination of intensive chemotherapy and anticancer vaccines in the treatment of human malignancies: the hematological experience, J Biomed Biotechnol, 2010:6920979; see also, Hirooka et al., 2009, A combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer, Pancreas, 38(3):e69-74). There are hundreds of chemotherapy drugs available that are essentially suitable for combination therapy.Some (non-limiting) examples of chemotherapy drugs that can be combined with the present invention include carboplatin (Paraplatin), cisplatin (Platinol, Platinol-AQ), cyclophosphamide (Cytoxan, Neosar), docetaxel (Taxotere), doxorubicin (Adriamycin), erlotinib (Tarceva), etoposide (VePesid), fluorouracil (5-F U), gemcitabine (Gemzar), imatinib mesylate (Gleevec), irinotecan (Camptosar), methotrexate (Folex, Mexate, Amethopterin), paclitaxel (Taxol, Abraxane), sorafinib (Nexavar), sunitinib (Sutent), topotecan (Hycamtin), vincristine (Oncovin, Vincasar PFS), and vinblastine (Velban).

[0281] 2.Surgery Cancer surgery, i.e., surgery to remove tumors, remains the cornerstone of cancer treatment. Surgery can be combined with other cancer treatments to remove any remaining tumor cells. Combining surgical methods with subsequent immunotherapy treatments is a promising approach that has been demonstrated countless times.

[0282] 3. Radiation Radiation therapy remains an important component of cancer treatment, with approximately 50% of all cancer patients receiving radiation therapy at some point during their disease course. The primary goal of radiation therapy is to deprive cancer cells of their ability to grow (divide). Types of radiation used to treat cancer include photon radiation (X-rays and gamma rays) and particle radiation (electron beam, proton beam, and neutron beam). There are two methods for delivering radiation to the cancer site. External beam radiation is delivered from outside the body by directing high-energy rays (photon, proton, or particle radiation) at the tumor site. Internal radiation, or brachytherapy, is delivered from inside the body directly into the tumor site by radioactive sources sealed in catheters or seeds. Radiation therapy techniques that may be used in conjunction with the present invention include, for example, fractionation (radiation therapy delivered in a fractionated treatment plan, e.g., daily fractions of 1.5 Gy to 3 Gy given over several weeks), 3D conformal radiation therapy (3DCRT, which delivers radiation according to the gross tumor volume); intensity-modulated radiation therapy (IMRT, computer-controlled intensity modulation of multiple radiation beams), image-guided radiation therapy (IGRT, a technique that includes pre-radiotherapy imaging to allow for correction), and stereotactic body radiation therapy (SRBT, which delivers very large individual doses of radiation over just a few fractionated treatments). For a review of radiation therapy, see Baskar et al., 2012, Cancer and radiation therapy: current advances and future directions, Int. J Med Sci., 9(3):193-199.

[0283] 4. Antibodies Antibodies (preferably monoclonal antibodies) achieve their therapeutic effect on cancer cells through various mechanisms. Antibodies can have a direct effect by inducing apoptosis, i.e., programmed cell death. Antibodies can block components of signaling pathways (e.g., growth factor receptors), thereby halting tumor cell proliferation. In cells expressing monoclonal antibodies, the cells can induce the formation of anti-idiotypic antibodies. Indirect effects include recruiting cytotoxic cells (e.g., monocytes and macrophages). This type of antibody-mediated cell killing is called antibody-dependent cell-mediated cytotoxicity (ADCC). Antibodies also bind complement, thereby causing direct cytotoxicity known as complement-dependent cytotoxicity (CDC). Combining surgical methods with immunotherapeutic drugs or methods has been a successful approach, as shown, for example, in Gadri et al., 2009, Synergistic effect of dendritic cell vaccination and anti-CD20 antibody treatment in the therapy of murine lymphoma, J Immunother, 32(4):333-40. The following list provides some non-limiting examples of anti-cancer antibodies and potential antibody targets (in parentheses) that can be used in combination with the present invention: Abagovomab (CA-125), Abciximab (CD41), Adecatumumab (EpCAM), Afutuzumab (CD20), Alacizumab pegol (VEGFR2), Altumomab pentetate (CEA), Amatuximab (MORAb-009), Anatumomab mafenatox (Anatumomabmafenatox (TAG-72), apolizumab (HLA-DR), arcitumomab (CEA), bavituximab (phosphatidylserine), bectumomab (CD22), belimumab (BAFF), bevacizumab (VEGF-A), bivatuzumab mertansine (CD44 v6), blinatumomab (CD19), brentuximab vedotin (CD30 TNFRSF8), cantuzumab mertansine (mucin CanAg), cantuzumab ravtansine (MUC1), capromab pendetide pendetide (prostate cancer cells), carlumab (CNTO888), catumaxomab (EpCAM, CD3), cetuximab (EGFR), sitatuzumab bogatox (EpCAM), cixutumumab (IGF-1 receptor), claudiximab (claudin), clivatuzumab tetraxetan (ClivatuzumabTetraxetan (MUC1), Conatumumab (TRAIL-R2), Dacetuzumab (CD40), Dalotuzumab (Insulin-like growth factor I receptor), Denosumab (RANKL), Detumomab (B-lymphoma cells), Drozitumab (DR5), Ecromeximab (GD3 ganglioside), Edrecolomab (EpCAM), Elotuzumab (SLAMF7), Enavatuzumab (PDL192), Ensituximab (NPC-1C), Epratuzumab (CD22), Ertumaxomab mab (HER2 / neu, CD3), Etaracizumab (integrin αvβ3), Farletuzumab (folate receptor 1), FBTA05 (CD20), Ficlatuzumab (SCH900105), Figitumumab (IGF-1 receptor), Flanvotumab (glycoprotein 75), Fresolimumab (TGF-β), Galiximab (CD80), Ganitumab (IGF-I), Gemtuzumab ozogamicin (CD33), Gevokizumab (IL-1β), Girentuximab (carbonic anhydrase 9 (CA-IX)), Glembatumumab vedotin vedotin (GPNMB), Ibritumomab tiuxetan (CD20), Icrucumab (VEGFR-1), Igovoma (CA-125), Indatuximab ravtansine (SDC1), Intetumumab (CD51), Inotuzumab ozogamicin (CD22), Ipilimumab (CD152), Iratumumab (CD30), Labetuzumab (CEA), Lexatumumab (TRAIL-R2), Ribivirumab (Hepatitis B Surface Antigen), Lintuzumab (CD33), Lorvotuzumabmertansine (CD56), lucatumumab (CD40), lumiliximab (CD23), mapatuzumab (TRAIL-R1), matuzumab (EGFR), mepolizumab (IL-5), milatuzumab (CD74), mitumomab (GD3 ganglioside), mogamulizumab (CCR4), moxetumomab pasudotox (CD22), nacolomab tafenatox (C242 antigen), naptumomab estafenatox estafenatox (5T4), Narnatumab (RON), Necitumumab (EGFR), Nimotuzumab (EGFR), Nivolumab (IgG4), Ofatumumab (CD20), Olaratumab (PDGF-Rα), Onartuzumab (human scatter factor receptor kinase), Oportuzumab monatox ( monatox (EpCAM), oregovomab (CA-125), oxelumab (OX-40), panitumumab (EGFR), patritumab (HER3), pemtumomab (MUC1), pertuzumab (HER2 / neu), pintumomab (adenocarcinoma antigen), pritumumab (vimentin), racotumomab (N-glycolylneuraminic acid), radretumab (fibronectin extracellular matrix). Main-B), Rafivirumab (rabies virus glycoprotein), Ramucirumab (VEGFR2), Rilotumumab (HGF), Rituximab (CD20), Robatumumab (IGF-1 receptor), Samalizumab (CD200), Sibrotuzumab (FAP), Siltuximab (IL-6), Tabalumab (BAFF), Tacatuzumab tetraxetanTetraxetan (alpha-fetoprotein), Taplitumomab paptox (CD19), Tenatumomab (tenascin-C), Teprotumumab (CD221), Ticilimumab (CTLA-4), Tigatuzumab (TRAIL-R2), TNX-650 (IL-13), Tositumomab (CD20), Trastuzumab (HER2 / neu), TRBS07 (GD2), Tremelimumab (CTLA-4), Tucotuzumab celmoleukin (EpCAM), ublituximab (MS4A1), urelumab (4-1BB), volociximab (integrin α5β1), votumumab (tumor antigen CTAA16.88), zalutumumab (EGFR), and zanolimumab (CD4).

[0284] 5. Cytokines, chemokines, costimulatory molecules, and fusion proteins Another embodiment of the present invention is the combined use of the antigen-encoded pharmaceutical composition of the present invention with cytokines, chemokines, costimulatory molecules, and / or their fusion proteins to induce beneficial immunomodulatory or tumor-inhibitory effects. Various chemokines with C, CC, CXC, and CX3C structures may be used to enhance immune cell infiltration into tumors and facilitate the movement of antigen-presenting cells to tumor-draining lymph nodes. Some of the most promising chemokines are, for example, CCR7 and its ligands CCL19 and CCL21, as well as CCL2, CCL3, CCL5, and CCL16. Other examples are CXCR4, CXCR7, and CXCL12. Furthermore, costimulatory or regulatory molecules, such as B7 ligands (B7.1 and B7.2), are useful. Also useful are other cytokines, such as, inter alia, interleukins (e.g., IL-1 to IL-17), interferons (e.g., IFNalpha1 to IFNalpha8, IFNalpha10, IFNalpha13, IFNalpha14, IFNalpha16, IFNalpha17, IFNalpha21, IFNbeta1, IFNW, IFNE1, and IFNK), hematopoietic factors, TGFs (e.g., TGF-α, TGF-β, and other members of the TGF family), and finally, members of the tumor necrosis factor family of receptors and their ligands, as well as other costimulatory molecules, including, but not limited to, the following: Not detected: 4-1BB, 4-1BB-L, CD137, CD137L, CTLA-4, GITR, GITRL, Fas, Fas-L, TNFR1, TRAIL-R1, TRAIL-R2, p75NGF-R, DR6, LT.beta.R, RANK, EDAR1, XEDAR, Fn114, Troy / Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1BB, OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT, as well as CD95 (Fas / APO-1), glucocorticoid-induced TNFR-associated protein, TNF receptor-associated apoptosis-mediating protein (TRAMP), and death receptor-6 (DR6).In particular, CD40 / CD40L and OX40 / OX40L are important targets for combined immunotherapy due to their direct effects on T cell survival and proliferation. For a review, see Lechner et al., 2011, Chemokines, costimulatory molecules and fusion proteins for the immunotherapy of solid tumors, Immunotherapy, 3(11), 1317-1340.

[0285] 6. Bacterial Treatment Researchers have used anaerobic bacteria (e.g., Clostridium novyi) to deplete the oxygen-poor interior of tumors. These anaerobic bacteria should then die when they come into contact with the oxygenated surface of the tumor, meaning they would be harmless to the rest of the body. Another strategy is to use anaerobic bacteria transformed with an enzyme that can convert nontoxic prodrugs into toxic drugs. This enzyme is expressed exclusively in tumors, with the bacteria growing in necrotic and hypoxic regions of tumors. Thus, systemically applied prodrugs are metabolized to toxic drugs only in tumors. This has been shown to be effective using the nonpathogenic anaerobe Clostridium sporogenes.

[0286] 7. Kinase inhibitors Another large group of potential targets for complementary cancer therapy includes kinase inhibitors, because cancer cell growth and survival are closely linked to deregulation of kinase activity. A wide variety of inhibitors have been used to restore normal kinase activity and thus reduce tumor growth. One group of targeted kinases includes receptor tyrosine kinases such as BCR-ABL, B-Raf, EGFR, HER-2 / ErbB2, IGF-IR, PDGFR-α, PDGFR-β, c-Kit, Flt-4, Flt3, FGFR1, FGFR3, FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases such as c-SRC, c-YES, Abl, JAK-2, serine / threonine kinases such as ATM, Aurora A&B, various CDKs, mTOR, PKCi, various PLKs, b-Raf, S6K, STK11 / LKB1, and lipid kinases such as PI3K, SK1. Small molecule kinase inhibitors include, for example, PHA-739358, nilotinib, dasatinib, as well as PD166326, NSC743411, lapatinib (GW-572016), canertinib (CI-1033), semaxinib (SU5416), vatalanib (PTK787 / ZK222584), Sutent (SU11248), sorafenib (BAY43-9006) and leflunomide (SU101).For more information, see, for example, Zhang et al., 2009, Targeting cancer with small molecule kinase inhibitors, Nature Reviews Cancer, 9, 28-39.

[0287] 8. Toll-like receptors Members of the Toll-like receptor (TLR) family are key linkages between innate and adaptive immunity, and the effectiveness of many adjuvants relies on TLR activation. Numerous established vaccines for cancer incorporate ligands for TLRs to enhance vaccine responses. In addition to TLR2, TLR3, TLR4, and especially TLR7 and TLR8, have been investigated for cancer treatment in passive immunotherapy approaches. The closely related TLR7 and TLR8 contribute to antitumor responses by influencing immune cells, tumor cells, and the tumor microenvironment and can be activated by nucleoside analog structures. All TLRs have been used as stand-alone immunotherapeutic agents or cancer vaccine adjuvants and may be synergistically combined with the formulations and methods of the present invention. For more information, see van Duin et al., 2005, Triggering TLR signaling in vaccination. Trends in Immunology, Trends in Immunology, 27(1):49-55.

[0288] 9. Angiogenesis inhibitors In addition to therapies that target immunomodulatory receptors that are affected by tumor-mediated escape mechanisms and immunosuppression, there are also therapies that target the tumor environment. Angiogenesis inhibitors prevent the widespread growth of blood vessels (angiogenesis) that tumors need to survive. For example, the angiogenesis promoted by tumor cells to meet their increasing nutrient and oxygen demands can be blocked by targeting various molecules. Non-limiting examples of angiogenesis mediating molecules or angiogenesis inhibitors that may be combined with the present invention include soluble VEGF (VEGF isoforms VEGF121 and VEGF165, receptors VEGFR1, VEGFR2, and co-receptors neuropilin-1 and neuropilin-2) 1 and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules, endostatin, vasostatin, calreticulin, platelet factor-4, TIMPs and CDAI, Meth-1 and Meth-2, IFN-α, IFN-β and IFN-γ, CXCL10, IL-4, IL-12 and IL-18, prothrombin (kringle domain-2), antithrombin III fragment, prolactin, VEGI, SPARC, and oocyte growth factor receptor 1 (OGF). These include osteopontin, maspin, canstatin, proliferin-related protein, restin, and drugs such as bevacizumab, itraconazole, carboxyamidotriazole, TNP-470, CM101, IFN-α, platelet factor-4, suramin, SU5416, thrombospondin, VEGFR antagonists, antiangiogenic steroids plus heparin, cartilage-derived angiogenesis inhibitor, matrix metalloproteinase inhibitors, 2-methoxyestradiol, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, prolactin αVβ3 inhibitors, linomide, tasquinimod. For a review, see Schoenfeld and Dranoff, 2011, Anti-angiogenesis immunotherapy, Hum Vaccin, (9):976-81.

[0289] 10. Small molecule targeted therapeutic drugs Small molecule targeted therapeutic drugs are generally inhibitors of enzyme domains in mutant, overexpressed, or otherwise critical proteins in cancer cells. Prominent, non-limiting examples include the tyrosine kinase inhibitors imatinib (Gleevec / Glivec) and gefitinib (Iressa). The use of small molecules, such as sunitinib malate and / or sorafenib tosylate, which target several kinases, in combination with vaccines for cancer treatment has also been described in a previous patent application (U.S. Patent Application Publication No. 2009004213).

[0290] 11. Viral vaccines There are several viral cancer vaccines available or under development that can be used with the formulations of the present invention in a combined therapeutic approach. One advantage of using such viral vectors is their inherent ability to initiate an immune response, with the inflammatory response resulting from viral infection providing the necessary danger signals for immune activation. An ideal viral vector should be safe and not induce an anti-vector immune response, allowing for the enhancement of specific anti-tumor responses. Recombinant viruses, such as vaccinia virus, herpes simplex virus, adenovirus, adeno-associated virus, retrovirus, and avipox virus, have been used in animal tumor models, and based on these encouraging results, human clinical trials have begun. A particularly important viral vaccine is a virus-like particle (VLP), i.e., a small particle containing certain proteins derived from the viral envelope coat. Virus-like particles do not contain any genetic material derived from viruses and are incapable of causing infection, but can be constructed to display tumor antigens on their coat surface. VLPs can be derived from a variety of viruses, such as hepatitis B virus or other viral families, including parvoviridae (e.g., adeno-associated virus), retroviridae (e.g., HIV), and flaviviridae (e.g., hepatitis C virus).For general reviews, see Sorensen and Thompsen, 2007, Virus-based immunotherapy of cancer: what do we know and where are we going?, APMIS, 115(11):1177-93; virus-like particles for cancer are reviewed in: Buonaguro et al., 2011, Developments in virus-like particle-based vaccines for infectious diseases and cancer, Expert Rev Vaccines, 10(11):1569-83, and Guillen et al., 2010, Virus-like particles as vaccine antigens and adjuvants: application to chronic disease, cancer immunotherapy and infectious disease preventive strategies, Procedia in Vaccinology, 2(2), 128-133.

[0291] 12.Multiple epitope strategy The use of multiple epitopes has shown promising results for vaccination. Rapid sequencing technology combined with intelligent algorithmic systems has enabled access to the tumor mutanome, which may provide numerous epitopes for personalized vaccines that can be combined with the present invention. For further information, see 2007, Vaccination of metastatic colorectal cancer patients with mature dendritic cells loaded with multiple major histocompatibility complex class I peptides, J Immunother, 30:762-772; and Castle et al., 2012, Exploiting the mutanome for tumor vaccination, Cancer Res, 72(5):1081-91.

[0292] 13. Adoptive T cell transfer For example, the combination of tumor antigen vaccination and T cell transfer is described in: Rapoport et al., 2011, Combination immunotherapy using adoptive T-cell transfer and tumor antigen vaccination on the basis of hTERT and survivin after ASCT for myeloma, Blood, 117(3):788-97.

[0293] 14. Peptide-based targeted therapy Various peptides can bind to cell surface receptors or to the affected extracellular matrix surrounding tumors. Radionuclides conjugated to these peptides (e.g., various RGDs) ultimately kill cancer cells if the radionuclides decay in the vicinity of the cells. Oligomers or multimers of these binding motifs are particularly interesting because they can result in increased tumor specificity and avidity. For non-limiting examples, see Yamada, 2011, Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma, Nihon Rinsho, 69(9):1657-61.

[0294] 15. Other Treatments There are numerous other cancer therapies that can be combined with the formulations and methods of the present invention to produce synergistic effects, including, but not limited to, apoptosis-targeting treatments, hyperthermia, hormone therapy, telomerase therapy, insulin-augmenting therapy, gene therapy, and photodynamic therapy.

[0295] The present invention is further illustrated by the following examples, which are not to be construed as limiting the scope of the invention. [Example]

[0296] Example 1: Generation and testing of bispecific binding agents targeting CLDN18.2 and CD3 a. Sequence origin, design and cloning of bi-scFv constructs into expression vectors Bispecific tandem single-chain antibody constructs (bi-scFv) containing binding domains specific for the human T-cell receptor component CD3 and human tumor-associated antigens (TAAs) were prepared. The corresponding variable heavy (VH) and variable light (VL) regions for each construct were specifically arranged, from N- to C-terminus, in the following sequential order: [ka]

[0297] Table 1 summarizes all bi-scFv constructs specific for the TAAs CLDN18.2 and PLAC1 generated in the course of this invention. These bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimization, e.g., for human (Homo sapiens) (HS), Mus musculus (MM), or Chinese hamster ovary (CHO), was performed using GeneArt's GeneOptimizer® software. These are shown in Table 1. Information on specificity, sequence origin from monoclonal antibodies (mABs), codon usage, further sequence characteristics, and references for all applied domains is summarized in Table 2. The variable domain sequence origin of each CD3 antibody is shown in Table 2. Due to the high homology between human and mouse TAAs, the same anti-TAA VH and VL sequences could be used to generate bi-scFv constructs for mouse assays, except in combination with the VH and VL sequences of the mouse-specific anti-CD3 antibody clone 145-2C11. DNA cloning and expression vector construction were performed according to standard procedures widely known by those skilled in the art (Green / Sambrook, Molecular Cloning, 2012). Briefly, the initial bi-scFv DNA sequence was endowed with a 5' HindIII restriction site and a 3' XhoI restriction site (HindIII and XbaI in the case of bi-scFv 1BiMAB) for cloning into an expression plasmid. A secretion signal sequence was introduced upstream of the bi-scFv sequence at the 5' end for protein secretion from the cytoplasm into the culture medium. A sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids was inserted to connect the VH and VL domains for assembling a single-chain variable antibody fragment (scFv), one of which binds CD3 and the other to a TAA. To form a bispecific single-chain antibody, these two scFv domain sequences were connected by a sequence encoding a short peptide linker (GGGGS). Together with this linker sequence, a BamHI restriction site was introduced for scFv domain exchange for the upcoming cloning of bi-scFv constructs. Specifically, the 5' scFv domains could be exchanged by restriction with HindIII and BamHI, and the 3' scFv domains could be exchanged by restriction with BamHI and XhoI. See also Figure 1 for an overview of the constructs. All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA™3.1 / myc-His(+) (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). A C-terminal 6xHis tag served for metal affinity purification of the proteins and for detection assays. All constructs were verified by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany).

[0298] [Table 1]

[0299] [Table 2]

[0300] b. Generation of stable producing cell lines To generate stable producer cell clones of CLDN18.2-specific bi-scFv protein, the human embryonic kidney cell line HEK293 (ATCC CRL-1573) and the Chinese hamster ovary cell line CHO-K1 (ATCC CCL-61) were used.

[0301] HEK293 transfection 1×10 7Two days before transfection, HEK293 cells were plated in 20 ml of complete DMEM medium (DMEM / F-12 GlutaMax supplemented with 10% heat-inactivated FBS and 0.5% penicillin-streptomycin; all reagents were obtained from Gibco / Life Technologies GmbH, Darmstadt, Germany) in a 14.5 cm tissue culture dish. Prior to transfection, the cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 20 ml of unsupplemented DMEM without FBS or antibiotics. 20 μg of linearized DNA of the construct described in Example 1.a was diluted in 0.5 ml of unsupplemented DMEM / F-12 medium. 75 μl of a 1 mg / ml linear PEI solution (polyethyleneimine; Polysciences Europe GmbH, Eppelheim, Germany) was added to the diluted DNA and vortexed vigorously. After 15 minutes of incubation at room temperature, the DNA / PEI complex was added dropwise to the cells, and the cell culture dish was gently rotated, followed by incubation at 37°C and 5% CO2. 24 hours after transfection, the medium was changed. Selection of transfected cells was initiated 48 hours after transfection using G418 sulfate (Gibco / Life Technologies GmbH, Darmstadt, Germany) at a final concentration of 0.8 mg / ml. G418 was always added to the culture medium for cell culture.

[0302] CHO-K1 transfection 1×10 6CHO-K1 cells were plated in 2 ml of complete DMEM medium (antibiotic-free DMEM / F-12 GlutaMax supplemented with 10% heat-inactivated FBS; all reagents were obtained from Gibco / Life Technologies GmbH, Darmstadt, Germany) in 6-well tissue culture plates one day before transfection. Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 1.5 ml of unsupplemented DMEM without FCS or antibiotics. Four micrograms of linearized DNA of the construct described in Example 1.a was diluted in 0.25 ml of unsupplemented DMEM / F-12 medium and gently mixed. In a second reaction tube, 2.5 μl of Lipofectamine 2000 (Invitrogen / Life Technologies GmbH, Darmstadt, Germany) was diluted in 0.25 ml of unsupplemented DMEM / F12 medium, gently mixed, and incubated at RT for 5 minutes. The DNA mix and Lipofectamine mix were combined in a 1:1 ratio, gently mixed, and incubated at RT for 20 minutes. The DNA / Lipofectamine 2000 complex was added dropwise to the cells, and the cell culture dish was gently rotated, followed by incubation at 37°C and 5% CO2. Six hours after transfection, the medium was replaced with complete DMEM / F-12 medium. The cells were split the next day at a ratio of 1:10. Selection of transfected cells began 48 hours after transfection using G418 sulfate (Gibco / Life Technologies GmbH, Darmstadt, Germany) at a final concentration of 0.5 mg / ml. G418 was always added to the culture medium for cell culture.

[0303] c. Selection of HEK293 as producer cells Expression of bi-scFv proteins by the stably transfected HEK293 and CHO-K1 cell lines described in Example 1.b was characterized by immunofluorescence staining to detect bi-scFv expression according to standard procedures (Current Protocols in Immunology, 2012). Briefly, 2 x 10 5 Cells were grown on glass slides for 24 hours and then permeabilized with 2% PFA. DPBS supplemented with 5% BSA and 0.2% saponin was used as the blocking buffer. After washing with DPBS and blocking with blocking buffer, cells were incubated with the primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1:500 in blocking buffer for 30 minutes at room temperature. After washing with blocking buffer, the secondary Cy3-conjugated goat anti-mouse IgG (H+L) antibody (Jackson ImmunoResearch Europe, Suffolk, UK) diluted 1:500 in blocking buffer was added and incubated for 3 hours at room temperature. After washing with blocking buffer and HO, cells were embedded in DAKO mounting medium (Dako, Carpinteria, CA, USA) supplemented with Hoechst 33342 dye (Pierce / Thermo Fisher Scientific, Rockford, IL, USA). Slides were examined for the presence of bi-scFv-positive cells using a Nikon-Eclipse Ti fluorescence microscope and photographed (data not shown). HEK293 cells showed overall better expression of bi-scFv protein than CHO-K1 cells, and therefore, HEK293 cells were chosen as the production cell line.

[0304] d. Production and detection of bi-scFv protein 1 BiMAB by HEK293 clone #28 The bi-scFv 1BiMAB was chosen as the first bi-scFv protein to be produced, purified, and used to establish various assays. To this end, a clonal cell line of HEK293 bulk cells stably expressing 1BiMAB (see Example 1.b) was obtained by single-cell sorting using a FACSAria cell sorter (BD Biosciences, Heidelberg, Germany). After expansion of approximately 40 clonal lines, the best-producing clones were selected by immunofluorescence as described in Example 1.c. The selected producer clone #28 was expanded and cultured in a 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM / F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin-streptomycin, and 0.8 mg / ml G418 (all reagents were obtained from Gibco / Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's instructions. At confluence, cells were washed with DPBS, and the medium was changed to DMEM / F-12 medium containing antibiotics but without FBS. Cell supernatant containing the bi-scFv protein 1BiMAB was collected every 3–5 days for up to 4 weeks. The supernatant was filtered using a 500 ml Steritop Filter Unit (Merck Millipore, Billerica, MA, USA) and stored at 4°C until FPLC purification. Prior to FPLC purification, the presence of bi-scFv in the cell culture supernatant was examined by polyacrylamide gel electrophoresis performed by standard methods (Current Protocols in Protein Science, 2012), followed by Coomassie staining and Western blot analysis. The supernatant was concentrated 5x-10x using a Centricon Centrifugal Filter Device (10K MWCO) (Merck Millipore, Billerica, MA, USA) according to the manufacturer's protocol. Concentrated and unconcentrated supernatants were separated on NuPAGE Novex 4-12% Bis-Tris gels (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). The gels were then stained with Coomassie Brilliant Blue solution according to standard procedures to detect bi-scFv proteins between 50 and 60 kD, including 1BiMAB and other proteins, contained in the cell culture supernatant. Western blot analysis was performed to specifically detect the bi-scFc protein 1 BiMAB via its 6xHis tag. Briefly, the protein was blotted onto a PVDF membrane. After blocking with PBST / 3% milk powder, the membrane was incubated with the primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1:500 in blocking buffer at 4°C for 1 hour. After washing with blocking buffer, the membrane was incubated with the Fc-specific secondary peroxidase-conjugated goat anti-mouse IgG antibody (Sigma-Aldrich, Germany) diluted 1:10,000 in blocking buffer at 4°C for 1 hour.After washing with blocking buffer, signals were visualized using SuperSignal West Femto Chemiluminescent Substrate (Pierce / Thermo Fisher Scientific, Rockford, IL, USA) and recorded using an ImageQuant LAS 4000 Imager (GE Healthcare Life Sciences, Munich, Germany). The signal of the bi-scFv was detected between 50 and 60 kD when compared with an internal molecular weight standard (see Figures 3A and 3B).

[0305] e. Purification and quantification of bi-scFv protein 1BiMAB The cell culture supernatant of HEK293 clone #28 containing the bi-scFv protein 1BiMAB (described in Example 1.d) was subjected to immobilized metal affinity chromatography (IMAC) using standard procedures (Current Protocols in Protein Science, 2012). Briefly, the filtered cell culture supernatant was loaded onto a HisTrap FF (5 ml) column connected to an AKTA Purifier 10 FPLC system (both GE Healthcare Life Sciences, Munich, Germany). The PBS wash buffer contained 10 mM imidazole, and the PBS elution buffer contained 500 mM NaCl, 50 mM NaH2PO4, and 250 mM imidazole, with the pH of both buffers adjusted to 7.4. Elution was performed using a step gradient. The eluted bi-scFv protein 1BiMAB was immediately dialyzed against 1x PBS using a Slide-A-Lyzer G2 Dialysis Cassette (10K MWCO) (Pierce / Thermo Fisher Scientific, Rockford, IL, USA). After dialysis against 1x PBS, the bi-scFv was dialyzed against 200 mM arginine buffer (L-arginine monohydrochloride; Roth, Karlsruhe, Germany) based on HO. The concentration of bi-scFv was determined by measurement at 280 nm using a NanoDrop 2000c, taking into account the extinction coefficient and molecular weight of bi-scFv protein 1BiMAB as determined by the ProtParam tool (http: / / web.expasy.org / protparam / ). The purified protein was aliquoted and stored at -80°C for long-term storage or kept at 4°C for immediate use. The quality and purity of the bi-scFv protein 1BiMAB were examined by Coomassie staining and Western blot analysis as described in Example 1.d (see also Figures 3A and 3B). BSA standard dilutions were included in the Coomassie procedure to roughly confirm the concentrations measured by NanoDrop (data not shown).

[0306] f. Establishing the ELISA assay A specific ELISA assay had to be established to quantify 1BiMAB in cell culture supernatants of HEK293 cells. For this purpose, the supernatant from Example 1.d and the purified bi-scFv protein 1BiMAB described in Example 1.e were used. The bi-scFv protein 1BiMAB was immobilized via its 6xHis tag using Ni-NTA plates (Thermo Fisher Scientific, Rockford, IL, USA) pre-blocked with BSA. All washing steps were performed three times with 200 μl of 1x PBS / 0.05% Tween (washing buffer) per well, and all steps were performed at room temperature. Purified 1BiMAB protein was used as a standard, diluted in 1x PBS within the range of 10 ng / ml to 500 ng / ml. The supernatant was diluted 1:10 in 1x PBS. 100 μl of diluted protein or supernatant was transferred to each well and incubated for 1 hour with shaking. After washing, an anti-idiotypic antibody against the VH-VL domain of mCLDN18.2ab was diluted to a final concentration of 0.5 μg / ml in 1x PBS / 3% BSA. 100 μl of anti-mCLDN18.2ab solution was added per well and incubated with shaking for 1 hour. After washing, AP-conjugated anti-mouse Fc antibody (Jackson ImmunoResearch Europe, Suffolk, UK) was diluted to a final concentration of 300 ng / ml in 1x PBS / 3% BSA. 100 μl of this secondary antibody solution was added per well and incubated with shaking for an additional hour. Secondary antibody alone, 1BiMAB + secondary antibody, and anti-mCLDN18.2ab + secondary antibody were used as negative controls. Additionally, HEK293 cell supernatant without bi-scFv protein was included in the assay. Finally, 50 μl of AP substrate solution (1.5 mg pNPP per ml of substrate buffer, AppliChem GmbH, Darmstadt, Germany) was added per well after washing.After 5, 15, and 30 minutes of incubation in the dark, absorbance was measured at 405 nm with an excitation wavelength of 492 nm using an Infinite M200 Tecan microplate reader (Tecan, Mannedorf, Switzerland). The concentration of the bi-scFv protein from the supernatant was calculated against a standard series (data not shown).

[0307] g. Transient transfection of CLDN18.2-specific bi-scFv proteins for comparative studies Preferably, to transiently produce large amounts of CLDN18.2-specific bi-scFv protein, the human embryonic kidney cell line HEK293T (ATCC CRL-11268) was used for transfection. 1×10 7Two days before transfection, HEK293T cells were plated in 20 ml of complete DMEM medium (DMEM / F-12 GlutaMax supplemented with 10% heat-inactivated FBS and 0.5% penicillin-streptomycin; all reagents were obtained from Gibco / Life Technologies GmbH, Darmstadt, Germany) in a 14.5 cm tissue culture dish. Prior to transfection, cells were washed with DPBS supplemented with 2 mM EDTA, followed by the addition of 20 ml of unsupplemented DMEM without FBS or antibiotics. 20 μg of circular DNA construct (1BiMAB, nos. 11 to 20 and 35 (described in Example 1.b)) was diluted in 0.5 ml of unsupplemented DMEM / F-12 medium. 75 μl of 1 mg / ml linear PEI solution (polyethyleneimine; Polysciences Europe GmbH, Eppelheim, Germany) was added to the diluted DNA and vortexed vigorously. After 15 min of incubation at RT, the DNA / PEI complex was added dropwise to the cells, the cell culture dish was gently rotated, and then incubated for 24 h at 37°C and 5% CO2. After medium replacement with unsupplemented DMEM / F-12, the cells were incubated for an additional 48 h at 33°C and 5% CO2. The cell supernatant was collected after incubation and sterile filtered using a 0.2 μm Minisart syringe filter (Sigma-Aldrich, Germany). Subsequently, the bi-scFv protein was purified on a small scale from the cell culture supernatant using a Ni-NTA spin column according to the manufacturer's protocol (Qiagen, Hilden, Germany). The concentration of the bi-scFv protein was estimated by ELISA as described in Example 1.f and confirmed by Western blot analysis as described in Example 1.e (data not shown). The purified protein was stored at 4°C for immediate use.

[0308] Example 2: Establishment of a functional assay to monitor specific T cell activation and target cell lysis by target-redirected T cells mediated by bi-scFv proteins Using FPLC-purified bi-scFv protein 1BiMAB, we established an in vitro assay to monitor the ability of bi-scFv protein to specifically target human effector cells to TAA-positive target cells, with the goal of visualizing and quantifying human T cell activation and specific target cell lysis.

[0309] a. Microscopy analysis of T cells retargeted to target cells by bi-scFv proteins To visualize the functionality of the bi-scFv protein, we established an assay to microscopically demonstrate the retargeting of effector cells to CLDN18.2-expressing target cells by the bi-scFv protein. For this purpose, we used the gastric cancer cell line NugC4 (Sahin U. et al., Clin Cancer Res, 2008(Dec 1), 14(23):7624-34), which endogenously expresses relatively high levels of human CLDN18.2, as the target cell line. Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Current Protocols in Immunology, 2012): Briefly, blood was diluted with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences, Munich, Germany), and centrifuged. Peripheral blood mononuclear cells (PBMCs) were collected from the interphase, washed with cold DPBS supplemented with 2 mM EDTA, and counted. Subsequently, human T cells were isolated from PBMCs by magnetically activated cell sorting (MACS) using the Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's instructions. 1×10 5NugC4 cells were seeded per well in a 6-well tissue culture plate. Human cells were prepared as described above and added at a 5:1 effector-to-target (E:T) ratio. RPMI 1640 medium (Gibco / Life Technologies GmbH, Darmstadt, Germany) supplemented with 5% heat-inactivated human AB serum, 0.5% penicillin-streptomycin, 1x NEAA, and 1 mM sodium pyruvate was used for all cells, and the final volume was adjusted to 2 ml per well. Control samples included target cells or T cells alone, with and without the bi-scFv protein. The tissue culture plate was then incubated at 37°C and 5% CO2. Assays were continuously observed using a Wilovert S inverted microscope (Hund, Wetzlar, Germany) from 6 to 48 hours of co-incubation. Significant effects on T cell clustering on target cells, immunological synapse formation, and target cell killing were observed in the presence of bi-scFv protein 1BiMAB at 24 hours. After 48 hours, few viable target cells could be found. Photographs were taken at 24 hours using a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). See also Figure 5. This assay was also included as a visibility control in all cytotoxicity assays in various well formats.

[0310] b. Target-dependent T cell activation by bi-scFv protein 1 BiMAB A flow cytometry assay was established to detect specific activation of human T cells by bi-scFv proteins. To detect T cell activation, the early activation marker CD69 and the late activation marker CD25 were selected for staining with fluorescently conjugated antibodies. To detect human T cells in a mixture of target cells and T cells, CD3 on T cells was stained. An assay design was selected from the above (Example 2.a). Briefly, NugC4 target cells were seeded with human T cells at a 5:1 E:T ratio in 2 ml of complete medium, and bi-scFv protein 1 BiMAB was added at concentrations ranging from 0.001 ng / ml to 1000 ng / ml. Control samples contained target cells or T cells alone, with or without bi-scFv protein 1 BiMAB. After 24 and / or 48 hours (depending on the results of the visibility control), all cells were collected by gentle scraping using Cell Scrapers (Sarstedt AG&Co, Nurmbrecht, Germany) and transferred to a 5 ml round-bottom tube (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. For cell staining, mouse anti-human CD3-FITC, mouse anti-human CD69-APC, and mouse anti-human CD25-PE (all antibodies from BD Biosciences, Heidelberg, Germany) were used. Cell pellets were resuspended in 50 μl of FACS buffer (DPBS supplemented with 5% FBS) containing fluorescently conjugated antibodies. After 20 minutes of incubation at 4°C in the dark, the samples were washed with 4 ml of DPBS, and the cell pellets were resuspended in 200 μl of FACS buffer containing propidium iodide (PI) or 7-AAD (both from Sigma-Aldrich, Germany) at a final dilution of 1:1000 for dead cell detection. Samples were kept on ice and in the dark throughout the measurement period. Assay setup was performed using a FACSCalibur, and subsequent measurements were performed using a FACSCanto II flow cytometer (both from BD Biosciences, Heidelberg, Germany). Analyses were evaluated by FlowJo software (Tree Star, San Carlos, CA, USA). As shown in Figures 6A and 6B, 1BiMAB-mediated T cell activation was completely undetectable in the absence of target cells, highlighting the strict target-dependence of bi-scFv functionality. Significant T cell activation in the presence of target cells occurred after 24 hours with only 0.01 ng / ml of 1BiMAB. Maximum efficacy was achieved using 100 ng / ml of 1BiMAB. In addition to studying T cell activation, this assay also allows for qualitative analysis of bi-scFv-mediated effects on target cell killing by gating on target cell populations and estimating the percentage of PI- or 7-AAD-positive target cells (data not shown). All analyses were performed using FlowJo software (Tree Star, San Carlos, CA, USA).

[0311] c. Luciferase cytotoxicity assay To reveal subtle differences in the target cell killing abilities of bi-scFv proteins directed against CLDN18.2 and CD3, a highly sensitive assay had to be developed. The goal was to establish an assay that could quantitatively monitor target cell killing in a high-throughput manner. To achieve this, a luciferase cytotoxicity assay was chosen. With this, measurement of luciferase expression by viable target cells allows indirect determination of target cell lysis mediated by cytotoxic effector cells in the presence of antibody. First, NugC4 cells (described above) were transduced with a lentiviral vector carrying firefly luciferase, an EGFP reporter gene, and an antibiotic selection marker. After antibiotic selection of the transduced cells, high-EGFP-expressing cells were sorted using a FACSAria cell sorter (BD Biosciences, Heidelberg, Germany), analyzed for high luciferase expression, and subsequently expanded for further study. Human effector cells were prepared as described in Example 2.a. Assays were established within the range of 1 ng / ml to 100 ng / ml of bi-scFv protein 1BiMAB, whereby a concentration of 5 ng / ml was found to produce a highly efficient and reproducible effect, and this concentration was further used as the standard concentration. NugC4 cells (described above) stably expressing luciferase were used as target cells. 1 × 10 4 Target cells were seeded per well in a white, flat-bottom 96-well plate. Human T cells (prepared as described in Example 2.a) were added at an E:T ratio of 5:1. The medium described above (Example 2.a) was used and the final volume per well was adjusted to 100 μl. Test and control samples were plated in at least triplicate. The cell culture microplates were incubated at 37°C and 5% CO2 for 24 and 48 hours. For analysis, 50 μl of an aqueous solution containing 1 mg / ml luciferin (BD Monolight, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES was added per well, followed by incubation of the plate at 37°C in the dark for 30 minutes. Luminescence resulting from the oxidation of luciferin by live cells expressing luciferase was measured with a microplate reader (Infinite M200, Tecan, Mannedorf, Switzerland). The percentage of specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescence test sample - L max ) / (L min -L max )] × 100, where "L" indicates dissolution. min indicates minimal lysis in the absence of bi-scFv, and L max indicates maximal lysis (equivalent to spontaneous luminescence counts) in the absence of bi-scFv achieved by addition of Triton X-100 (2% final concentration). Potential direct effects of bi-scFv proteins on target cells independent of effector cells were investigated by comparing all controls (e.g., L min and L maxThe results were obtained by plating target cells without human T cells, including human T cells. This assay was used for further studies to investigate the specific T cell-mediated lysis of target cells. Various modifications were made, such as bi-scFv concentration, bi-scFv protein, E:T ratio, or effector cells (CD8 + This was performed by changing the markers of serotonin levels (e.g., CD4+ T cells, PBMCs).

[0312] Example 3: Selection of CLDN18.2-specific bi-scFv lead candidates Luciferase cytotoxicity assay using various CLDN18.2-specific bi-scFv proteins to select the most potent bi-scFv variants All 10 CHO codon-optimized constructs (no. 11 to no. 20) specific for the TAA CLDN18.2 were tested in comparison with the human codon-optimized bi-scFv protein 1 BiMAB in a luciferase cytotoxicity assay using NugC4 target cells that endogenously express CLDN18.2 and ectopically express luciferase (see also Example 2.c). The characteristics of the bi-scFv proteins used are detailed in Table 2. Because PLAC1 is not expressed by NugC4 cells, bi-scFv no. 35 specific for the TAA PLAC1 was used as an isotype control. Binding activity to CD3 on human T cells was demonstrated in a FACS binding assay (data not shown). All bi-scFv proteins were generated as described in Example 1.g and used for the cytotoxicity assay set up as described in Example 2.c. All bi-scFv proteins were used at a final concentration of 5 ng / ml. min For the determination of β-actin activity, control bi-scFv protein no. 35 was plated in nine replicates with target and T cells, and test samples were plated in sextuplicate. One plate per time point was prepared for analysis. The specific lysis at each analyzed time point (8 h, 16 h, 24 h) was plotted against the bi-scFv protein used. The bi-scFv proteins 1BiMAB (SEQ ID NO: 39) and no. 15 (SEQ ID NO: 41), constructed in the same orientation and containing the same anti-CD3 sequence (TR66), differing only in their codon usage at the nucleic acid level and in the linker sequence, were found to be the most potent antibodies in mediating target cell lysis (see Figure 2). Because 1BiMAB and no. 15 were equivalent in efficiency, the previously well-characterized bi-scFv protein 1BiMAB was selected for all subsequent assays. The constructs 18PHU3 and 18PHU5 (see Tables 1 and 2) were compared against 1BiMAB at subsequent time points. The efficiency of 18PHU5 was comparable to that of 1BiMAB, while 18PHU3 was less potent (data not shown).

[0313] Example 4: Binding ability of bi-scFv protein 1BiMAB Establishment of a FACS-based binding assay To evaluate the binding ability of the CLDN18.2-targeting and CD3-targeting components of the bi-scFv protein, a flow cytometry assay was established. NugC4 cells, which endogenously express CLDN18.2, were used to probe the anti-CLDN18.2 site, and human T cells were used to probe the anti-CD3 site. To investigate the anti-CLDN18.2 binding capacity, NugC4 cells were trypsinized and washed with complete RPMI1640 medium, followed by DPBS. All washing steps were performed by centrifugation at 1200 rpm for 6 min at 4°C. 2.5 × 10 5NugC4 cells were transferred to a 5 ml round-bottom tube and incubated with 50 μg / ml of FPLC-purified 1BiMAB protein in FACS buffer at 4°C for 30 minutes. The cells were washed with 2 ml of FACS buffer and subsequently incubated with 3.3 μg / ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) at 4°C for 30 minutes. After washing with 2 ml of FACS buffer, the cell pellet was incubated with APC-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, UK) at a dilution of 1:200 in FACS buffer for 20 minutes at 4°C in the dark. The cells were washed twice with 2 ml of FACS buffer and finally resuspended in 150 μl of FACS buffer supplemented with 1 μg / ml of PI (Sigma-Aldrich, Germany) to counterstain dead cells. Another staining experiment using the same procedure but without the Anti-HIS Epitope-Tag antibody was included using 50 μg / ml of 1BiMAB and an APC-conjugated goat anti-mouse secondary antibody (1:200). Negative control samples included secondary goat anti-mouse APC antibody alone, monoclonal antibody Anti-HIS Epitope-Tag + secondary goat anti-mouse APC antibody. As positive controls, 10 μg / ml of the monoclonal CLDN18.2-specific antibody mCLDN18.2ab stained with secondary goat anti-human APC antibody (Jackson ImmunoResearch Europe, Suffolk, UK) and the secondary antibody-only control were performed. Samples were measured using a FACSCalibur flow cytometer (BD Biosciences, Heidelberg, Germany) and analyzed with FlowJo software (Tree Star, San Carlos, CA, USA). Strong signals were detected by sequential staining with 1BiMAB, anti-HIS epitope tag, and goat anti-mouse APC. The signal intensity was comparable to that of the positive control mCLDN18.2ab with goat anti-human APC. Low direct binding of goat anti-mouse APC to 1BiMAB was observed in samples stained with 1BiMAB and goat anti-mouse APC without the anti-HIS epitope tag (see Figure 4A). For all further FACS binding assays to investigate the binding ability of bi-scFv proteins, a sequential staining protocol with bi-scFv, anti-HIS epitope tag, and goat anti-mouse APC was used (see Figures 4B, 4C, and 4D). To exclude nonspecific binding of 1BiMAB, target cells that do not express CLDN18.2, as confirmed by RT-PCR (data not shown), were subjected to this FACS-based binding assay. No nonspecific binding of 1BiMAB was detected, as shown in Figure 4D.

[0314] To investigate the binding capacity of the anti-CD3 arm of bi-scFv protein 1 BiMAB, human T cells were used. 1 x 10 human T cells were prepared as described in Example 2.a. 6 T cells were transferred to a 5 ml round-bottom tube and incubated with FPLC-purified 1BiMAB protein in the range of 0.002 μg / ml to 2 μg / ml in FACS buffer at 4°C for 30 min. Further staining procedures were as described above. Control samples included secondary goat anti-mouse APC antibody alone and monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat anti-mouse APC antibody. Measurements and analysis were performed as described above. A significant signal was obtained with 1BiMAB at 2 μg / ml (see Figure 4C).

[0315] Example 5: Investigation of highly specific target-dependent T cell activation by bi-scFv 1BiMAB Cancer cell lines that endogenously express high or low levels of CLDN18.2, as well as those that do not express CLDN18.2, were selected to demonstrate the strict target-dependent nature of the bi-scFv protein 1 BiMAB in in vitro cytotoxicity assays. The selected cell lines represented two major carcinoma types that express CLDN18.2: gastric cancer (NugC4, MKN7, SNU-1) and pancreatic cancer (DanG, KP-4). The breast cancer cell line MCF7 was used as a negative control.

[0316] a. RT-PCR of CLDN18.2 in cancer cell lines Total RNA was extracted from the above-mentioned carcinoma cell lines using the RNEasy Mini Kit procedure according to the manufacturer's protocol (Quiagen, Hilden, Germany). Five micrograms of RNA was used for cDNA synthesis using SuperScript II reverse transcriptase (Life Technologies GmbH, Darmstadt, Germany). RT-PCR analysis was performed on an ABI Prism 7300 Real Time PCR System (Applied Biosystems / Life Technologies GmbH, Darmstadt, Germany) using Sybr Green dye and the following primers: CLDN18.2, forward: TGGCTCTGTGTCGACACTGTG; reverse: GTGTACATGTTAGCTGTGGAC HPRT, forward: TGACACTGGCAAAACAATGCA; reverse: GGTCCTTTTCACCAGCAAGCT Delta Ct was calculated by subtracting the Ct value of the housekeeping gene HPRT from the Ct value of CLDN18.2 (see Figure 7A for results).

[0317] b. Exclusive T cell activation in the presence of CLDN18.2The cytotoxicity assay was set up as described in Example 2.a. Carcinoma cell lines examined for CLDN18.2 transcripts by quantitative RT-PCR in Example 5.a were used as target cells. The concentration of bi-scFv protein 1BiMAB in this assay was set at 5 ng / ml. Target cells were seeded in duplicate with human T cells and 1BiMAB to analyze T cell activation. To monitor any potential alloreactivity of T cells against target cells independent of bi-scFv protein 1BiMAB, target cells and T cells were seeded in duplicate without 1BiMAB. Cells were continuously observed microscopically to confirm T cell clustering and target cell binding. In the case of the CLDN18.2-high-expressing cell line NugC4, significant effects occurred after 24 hours; after 48 hours, few viable target cells were observed. In the case of the CLDN18.2-low-expressing cell line DanG, initial effects were observed after 96 hours, and significant effects were observed after 120 hours. For CLDN18.2-negative cell lines, no effects indicative of T cell activation were observed even after 144 hours. T cells from all samples were analyzed by flow cytometry for the early T cell activation marker CD69 and the late activation marker CD25 after 144 hours of co-incubation with target cells, as described in Example 2.a. T cell populations were counterstained with CD3 and dead cells with PI. Interestingly, up to 100% of T cells co-incubated with NugC4 and 1BiMAB were CD25-positive but CD69-negative, indicating long-term activation of T cells after CD69 downregulation had already occurred. Roughly 75% of T cells co-incubated with DanG and 1BiMAB were activated, and approximately 40% of them simultaneously expressed CD25 and CD69, indicating ongoing T cell activation. T cells co-incubated with the CLDN18.2-negative cell line did not show any signs of T cell activation: neither CD69 nor CD25 expression was significantly elevated compared to the levels in samples without 1BiMAB (see also Figure 7B).

[0318] Example 6: Investigation of T cell function induced by bi-scFv protein 1 BiMAB aInduction of T cell proliferation T cell proliferation is an indicator of T cell activation. A flow cytometry assay was used to demonstrate T cell proliferation in response to bi-scFv protein 1BiMAB in the presence of CLDN18.2-positive target cells. Briefly, 1 x 10 isolated T cells as described in Example 2.a were used. 6 Human T cells were stained with 0.5 μM carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen / Life Technologies GmbH, Germany) dissolved in DPBS for 10 minutes at 37°C in the dark. Staining was stopped by adding 5 volumes of chilled complete RPMI 1640 medium. Cells were kept on ice for 5 minutes, washed three times with complete RPMI medium (5% heat-inactivated human AB serum, 0.5% penicillin-streptomycin, 1x NEAA, and 1 mM sodium pyruvate), and then 1x10 cells were cultured at 37°C for 10 minutes. 5 The cells were resuspended at 1:1000 cells / ml. A cytotoxicity assay, as described in Example 2.b, was set up using NugC4 cells, which endogenously express CLDN18.2, and human T cells as effector cells. 50 U of IL-2 per ml of medium was added to the cells. Samples included T cells alone, T cells with 1 ng / ml of 1BiMAB, T cells and NugC4 cells, and T cells with 1 ng / ml of 1BiMAB and NugC4 cells. After 120 hours of co-incubation, the T cells were collected, placed in a 5 ml round-bottom tube, washed, and stained with 7-AAD in DPBS at 1:1000 for 15 minutes at 4°C to counterstain dead cells. After washing with DPBS, the cells were resuspended in FACS buffer and analyzed using a FACSCanto II (BD Biosciences, Heidelberg, Germany). T cell proliferation was detected by a reduced CFSE signal only in the presence of target cells and bi-scFv protein 1BiMAB (see also Figure 8A).

[0319] b. Induction of the serine protease granzyme B To demonstrate the upregulation of proteolytic molecules following T cell activation mediated by the bi-scFv protein 1BiMAB in the presence of CLDN18.2-positive target cells, we chose to detect the serine protease granzyme B by flow cytometry analysis. A cytotoxicity assay, as described in Example 2.b, was set up using NugC4 cells, which endogenously express CLDN18.2, and human T cells as effector cells. Samples included T cells alone, T cells with 5 ng / ml of 1BiMAB, T cells and NugC4 cells, and T cells with 5 ng / ml of 1BiMAB and NugC4 cells. After 96 hours of co-incubation, T cells were collected, collected into 5 ml round-bottom tubes, washed, and stained with 7-AAD in DPBS at 1:1000 for 15 minutes at 4°C to counterstain dead cells. After washing with DPBS, cells were fixed with 100 μl of Cytoperm / Cytofix solution for 20 minutes at room temperature. Cells were washed with 1×Perm / Wash and subsequently stained with PE-conjugated mouse anti-human granzyme B antibody for 20 minutes at room temperature. After washing, cells were resuspended in FACS buffer and analyzed using a FACSCanto II (all reagents and FACS equipment from BD Biosciences, Heidelberg, Germany). Granzyme B upregulation in T cells was detected only in the presence of target cells and bi-scFv protein 1BiMAB (see also Figure 8B).

[0320] Example 7: EC of bi-scFv protein 1 BiMAB in an in vitro cytotoxicity assay 50 Decision Luciferase cytotoxicity assay To determine the 50% maximal effective dose of bi-scFv protein 1BiMAB, a titration series of 1BiMAB was tested in an in vitro luciferase cytotoxicity assay, primarily as described in Example 2.c. Stably luciferase-expressing NugC4 cells as described in Example 2.c were incubated with human T cells and bi-scFv protein 1BiMAB concentrations ranging from 1 pg / ml to 1 μg / ml (in 10-fold increments) or with L min To determine the value, incubation was performed without 1BiMAB. The luminescence of live cells was measured 24 and 48 hours after assay setup using an Infinite M200 Tecan plate reader. Specific target cell lysis was calculated using the formula illustrated in Example 2.c. Maximum lysis was achieved after 48 hours with 1 ng / ml to 10 ng / ml of 1BiMAB. The EC determined after 48 hours in this assay was 50 is approximately 10 pg / ml (see also Figure 9). The results of this assay, as also reported by others (e.g., Lutterbuese, R et al., Proc. Natl. Acad. Sci. USA, 2010 (Jul 13), 107(28):12605-10), strongly depend on the potency of human T cells, which varies according to the immune status of the donor. In addition, the target cell line used, NugC4, shows variable expression of CLDN18.2, which also affects the results. Therefore, the EC of bi-scFv protein 1BiMAB ranges from 10 pg / ml to 300 pg / ml. 50 Variations in values ​​have been observed during the course of the present invention.

[0321] Example 8: Efficacy in a mouse xenograft model To further explore the therapeutic potential of the bi-scFv protein 1BiMAB in vivo, NOD.Cg-Prkd scid IL2rg tm1WjlWe selected the / SzJ or short NSG mouse strains (Jackson laboratory, Bar Harbor, ME, USA). For the described studies, engraftment of human effector cells and human T lymphocytes in mice is essential for studying the effects of bi-scFv binding to T cells in vivo. The NSG mouse strain is preferred for this type of xenotransplantation study because it completely lacks B cells, T cells, and NK cells. A mouse model with primarily engrafted human T cells after PBMC injection was established as part of this study.

[0322] a. Late-start treatment of advanced CLDN18.2-high-expressing tumors in mice with bi-scFv protein 1 BiMAB In the illustrated study, 40 female NSG mice at 8 weeks of age were transfected with 1 × 10 cells stably expressing high levels of human CLDN18.2. 7 HEK293 cells (HEK293-CLDN18.2) were subcutaneously inoculated. Five days after tumor cell inoculation, mice were stratified into treatment groups according to their tumor volume, and mice without tumor growth were excluded. On the same day, peripheral blood mononuclear cells (PBMCs) were isolated from human blood of healthy donors by the Ficoll density gradient technique as described in Example 2.a and used as effector cells in vivo. 2 x 10 cells diluted in 300 μl of DPBS were used. 7PBMCs were injected intraperitoneally on the day of isolation into the experimental treatment groups indicated by "PBMC." The treatment group indicated by "PBS" received 300 μl of unsupplemented DPBS intraperitoneally instead and served as a control without human effector cells. The "PBS" control group allowed for investigation of potential effects on tumor growth caused by the 1BiMAB itself, or any potential side effects caused by the 1BiMAB or vehicle (i.e., graft-versus-host reaction exerted by human effector cells on mouse tissues) rather than by human effector cells on mouse tissues. The "PBS / vehicle" group contained 4 mice (n = 4), the "PBS / 1BiMAB" group contained 5 mice (n = 5), the "PBMC / vehicle" group contained 13 mice (n = 13), and the "PBMC / 1BiMAB" group contained 15 mice (n = 15). Treatment began one day after application of DPBS or PBMC: Group "PBS / 1BiMAB" and group "PBMC / 1BiMAB" received 5 μg of purified bi-scFv protein 1BiMAB diluted in 200 μl of DPBS intraperitoneally per animal. Group "PBS / Vehicle" and group "PBMC / Vehicle" received 200 μl of vehicle buffer (200 mM L-arginine monohydrochloride dissolved in HO, sterile filtered) diluted in DPBS intraperitoneally. The treatment groups are summarized in Table 3. Treatment was performed daily for 22 days. Twice a week, tumor size was measured with a calibrated digital caliper, and tumor volume was calculated according to the following formula: mm 3 = length x width x (width / 2). Figures 10A and 10B illustrate the inhibition of tumor growth and elimination of tumor burden in half of the mice in the "PBMC / 1BiMAB" group by antibody alone in the presence of human effector cells. Mice were cultured in a 500 mm 3 When the body weight exceeded 100 mg / kg / day or in the case of severe morbidity (graft-versus-host syndrome was observed in some mice), the mice were sacrificed by cervical dislocation.

[0323] [Table 3]

[0324] b. Determining the effect of treatment on body weight The weight of each mouse was measured twice a week using a laboratory scale. None of the mice in either group showed weight loss over the treatment period (data not shown). Some mice in both "PBMC" groups showed symptoms of graft-versus-host reaction 4 weeks after PBMC injection and several days after the end of treatment. No effect of 1BiMAB itself on body weight or any other side effects on the health of the mice were observed.

[0325] c. Tissue preservation and splenocyte isolation After sacrificing the mice, tumors were dissected, and tissues were immediately fixed in 10 ml of Roti-Histofix 4% (Carl Roth, Karlsruhe, Germany) for immunohistochemical analysis. Additionally, spleens were dissected for flow cytometry analysis to detect human cell engraftment. Splenocyte isolation was performed immediately after spleen dissection by mashing the spleen with the sterile plunger of a 3-5 ml syringe and passing it through a 70 μm cell strainer placed in a 50 ml reaction tube, followed by repeated flushing of the cell strainer with warm DPBS. The isolated splenocytes were centrifuged, the DPBS was decanted, and the splenocyte pellet was resuspended in 1 ml of heat-inactivated fetal bovine serum supplemented with 10% DMSO. Splenocyte samples were immediately frozen and stored at -80°C until all samples from all mice were completed.

[0326] d. Analysis of human T lymphocyte engraftment in mouse spleens Splenocytes from all mice were collected and frozen as described in Example 8.c. Once the completed collection of splenocyte samples was thawed, all cells were washed twice with warm DPBS and 1 x 10 cells were collected per sample. 6Splenocytes were incubated with fluorescently conjugated antibodies for 20 minutes at 4°C in the dark, and human cell engraftment was detected by anti-CD45 staining, and the percentage of human T cells was detected by anti-CD3, anti-CD4, and anti-CD8 staining. Flow cytometry analysis was performed using a FACSCalibur (BD Biosciences, Heidelberg, Germany). Human T cell engraftment in both "PBMC" groups could be confirmed by the high percentage of CD45-CD3 double-positive splenocytes, as shown in Figure 10D.

[0327] Example 9: Generation and testing of bispecific binding agents targeting CLDN6 and CD3 a. Sequence origin, design and cloning of bi-scFv constructs into expression vectors The bispecific tandem single-chain antibody constructs (bi-scFv) contained binding domains specific for the human T-cell receptor component CD3 and a human tumor-associated antigen (TAA). The corresponding variable heavy (VH) and variable light (VL) regions were specifically arranged in the following sequential order from N-terminus to C-terminus for each construct: [ka]

[0328] Table 4 summarizes all bi-scFv constructs specific for the TAA CLDN6 generated during the course of this invention. The CLDN18.2-specific bi-scFv construct 1BiMAB was used as a control antibody. These bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt / Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimization, e.g., for human (Homo sapiens) (HS) or Mus musculus (MM), was performed using GeneArt's GeneOptimizer® software. These are shown in Table 5. Information on specificity, sequence origin from monoclonal antibodies (mABs), codon usage, additional sequence features, and references for all applied domains is summarized in Table 5. The variable domain sequence origin of each CD3 antibody is shown in Table 5. Due to the high homology between human and mouse TAAs, the same anti-TAA VH and VL sequences could be used to generate bi-scFv constructs for mouse assays, except in combination with the VH and VL sequences of the mouse-specific anti-CD3 antibody clone 145-2C11. DNA cloning and expression vector construction were performed according to standard procedures widely known by those skilled in the art (Sambrook, 1989). Briefly, the bi-scFv DNA sequence was provided with a 5' HindIII restriction site and a 3' BamHI restriction site for cloning into an expression plasmid. A secretory signal sequence was introduced upstream of the bi-scFv sequence at the 5' end for protein secretion from the cytoplasm into the culture medium. A sequence encoding a flexible glycine-serine peptide linker of 15 to 18 amino acids was inserted to connect the VH and VL domains for assembling a single-chain variable antibody fragment (scFv), one of which binds CD3 and the other to a TAA. To form a bispecific single-chain antibody, these two scFv domain sequences were connected by a sequence encoding a short peptide linker (GGGGS). Together with this linker sequence, a BamHI restriction site was introduced for scFv domain swapping for the cloning of the planned bi-scFv construct. In particular, the 5' scFv domains could be exchanged by restriction with HindIII and BamHI, and the 3' scFv domains could be exchanged by restriction with BamHI and XhoI. All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA™3.1 / myc-His(+) (Invitrogen / Life Technologies GmbH, Darmstadt, Germany). A C-terminal 6xHis tag served for metal affinity purification of the proteins and for detection assays. All constructs were verified by sequencing by MWG's single-read sequence service (Eurofins MWG Operon, Ebersberg, Germany). See also Figure 11 for an overview of the constructs.

[0329] [Table 4]

[0330] [Table 5]

[0331] b. Generation of stable producing cell lines To generate stable producer cell clones of CLDN6-specific bi-scFv proteins, the human embryonic kidney cell line HEK293 (ATCC CRL-1573) was used. 1×10 7 HEK293 cells were plated in 14.5 cm tissue cu...

Claims

1. A binding agent comprising at least two binding domains, a first binding domain that binds to a claudin (CLDN) and a second binding domain that binds to CD3.

2. The binding agent of claim 1 which is a bispecific molecule.

3. The binding agent of claim 2 , wherein the bispecific molecule is a bispecific antibody.

4. The binding agent of claim 3 , wherein the bispecific antibody is a bispecific single chain antibody.

5. The binding agent of any one of claims 1 to 4, wherein the claudin is expressed in a cancer cell.

6. The binding agent of any one of claims 1 to 5, wherein the claudin is expressed on the surface of a cancer cell.

7. The binding agent of any one of claims 1 to 6, wherein the claudin is selected from the group consisting of claudin 18.2 and claudin 6.

8. The binding agent of any one of claims 1 to 7, wherein the first binding domain binds to the extracellular domain of the claudin.

9. The binding agent according to any one of claims 1 to 8, wherein the second binding domain binds to the epsilon chain of CD3.

10. The binding agent of any one of claims 1 to 9, wherein the CD3 is expressed on the surface of a T cell.

11. 11. The binding agent according to any one of claims 1 to 10, wherein the binding of said agent to CD3 on T cells leads to proliferation and / or activation of said T cells, wherein said activated T cells preferably release cytotoxic factors (e.g. perforin and granzymes) and initiate cytolysis and apoptosis of cancer cells.

12. The binding agent according to any one of claims 1 to 11, wherein the binding to claudin and / or the binding to CD3 is a specific binding.

13. The binding agent according to any one of claims 1 to 12, which is in the format of a full length antibody or an antibody fragment.

14. 14. The binding agent of any one of claims 1 to 13, comprising a set of antibody variable domains with at least two binding domains (preferably four antibody variable domains), wherein at least one binding domain binds to a claudin and at least one binding domain binds to CD3.

15. The binding agent according to any one of claims 1 to 14, comprising a variable domain (VH) of an immunoglobulin heavy chain having specificity for a claudin antigen (VH(CLDN)), a variable domain (VL) of an immunoglobulin light chain having specificity for a claudin antigen (VL(CLDN)), a variable domain (VH) of an immunoglobulin heavy chain having specificity for CD3 (VH(CD3)), and a variable domain (VL) of an immunoglobulin light chain having specificity for CD3 (VL(CD3)).

16. 16. The binding agent of any one of claims 1 to 15, which is in the form of a diabody comprising a heavy chain variable domain linked to a light chain variable domain in the same polypeptide chain, such that these two domains are not paired.

17. The binding agent of claim 16, wherein the diabody comprises two polypeptide chains, wherein one polypeptide chain comprises a VH (CLDN) and a VL (CD3), and the other polypeptide chain comprises a VH (CD3) and a VL (CLDN).

18. The binding agent according to any one of claims 1 to 15, which is in the format of a bispecific single chain antibody consisting of two scFv molecules linked via a linker peptide.

19. 19. The binding agent of claim 18, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are arranged from N-terminus to C-terminus in the following order: VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN), or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN).

20. 20. The binding agent of claim 19, wherein the heavy chain variable region (VH) and its corresponding light chain variable region (VL) are connected via a long peptide linker, preferably via a peptide linker comprising the amino acid sequence (GGGGS)3 or VE(GGGGS)2GGVD.

21. The binding agent according to claim 19 or 20, wherein the two VH-VL or VL-VH scFv units are linked via a short peptide linker, preferably a peptide linker comprising the amino acid sequence SGGGGS or GGGGS.

22. The binding agent according to any one of claims 15 to 21, wherein the CLDN is CLDN18.2, the VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of said amino acid sequence or fragment.

23. The binding agent according to any one of claims 15 to 21, wherein the CLDN is CLDN6, the VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of said amino acid sequence or fragment, and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof or a variant of said amino acid sequence or fragment.

24. 24. The binding agent of any one of claims 15 to 23, wherein the VH(CD3) comprises the amino acid sequence represented by SEQ ID NO: 36, or a fragment thereof, or a variant of said amino acid sequence or fragment, and the VL(CD3) comprises the amino acid sequence represented by SEQ ID NO: 37, or a fragment thereof, or a variant of said amino acid sequence or fragment.

25. The binding agent according to any one of claims 1 to 22 and 24, wherein the CLDN is CLDN18.2 and the binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, or a fragment or variant thereof.

26. The binding agent according to any one of claims 1 to 21, 23 and 24, wherein the CLDN is CLDN6 and the binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45, or a fragment or variant thereof.

27. The cancer cells expressing CLDN18.2 are selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer, gallbladder cancer, and metastases thereof, Krukenberg tumors, peritoneal metastases and / or lymph node metastases. The binding agent of any one of claims 5 to 22, 24 and 25.

28. The cancer cells expressing CLDN6 include bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian teratocarcinoma), lung cancer (including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), particularly squamous cell lung cancer and squamous cell lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell carcinoma and squamous cell carcinoma), malignant melanoma, head and neck cancer (particularly malignant pleomorphic adenoma), sarcoma (particularly synovial sarcoma and synovial carcinosarcoma), bile duct cancer, bladder cancer (particularly transitional cell carcinoma and transitional cell papillary carcinoma), kidney cancer.

27. The binding agent according to any one of claims 5 to 21, 23, 24 and 26, which is a cancer cell of a cancer selected from the group consisting of: renal cell carcinoma (especially including renal clear cell carcinoma and papillary renal cell carcinoma), colon cancer, small intestine cancer (including cancer of the ileum, especially small intestine adenocarcinoma and ileal adenocarcinoma), embryonal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer (especially testicular seminoma, testicular teratoma and embryonal testicular cancer), uterine cancer, germ cell tumors (such as teratocarcinoma or embryonal carcinoma, especially testicular germ cell tumors) and metastatic forms thereof.

29. 29. The binding agent of any one of claims 1 to 28, which has an N-terminal secretion signal and / or a C-terminal histidine epitope tag, preferably a 6 histidine epitope tag.

30. A recombinant nucleic acid encoding a binding agent according to any one of claims 1 to 29.

31. 31. The recombinant nucleic acid of claim 30 in the form of a vector or in the form of RNA.

32. A host cell comprising a recombinant nucleic acid according to claim 30 or 31.

33. A binding agent according to any one of claims 1 to 29, a recombinant nucleic acid according to claim 30 or 31, or a host cell according to claim 32 for use in therapy, in particular for use in treating or preventing cancer.

34. A pharmaceutical composition comprising a binding agent according to any one of claims 1 to 29, a recombinant nucleic acid according to claim 30 or 31, or a host cell according to claim 32.

35. 35. A method of treating or preventing a cancer disease comprising administering to a patient the pharmaceutical composition of claim 34.

36. 36. The binding agent, recombinant nucleic acid or host cell of claim 33, or the method of claim 35, wherein cells of the cancer express a claudin to which the binding agent can bind.

37. 37. The binding agent, recombinant nucleic acid, host cell or method of claim 36, wherein the claudin is CLDN18.2 and the cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), breast cancer, ovarian cancer, colon cancer, liver cancer, head and neck cancer, gallbladder cancer, and metastases thereof, Krukenberg tumors, peritoneal metastases and / or lymph node metastases.

38. The claudin is CLDN6, and the cancer is bladder cancer, ovarian cancer (particularly ovarian adenocarcinoma and ovarian teratocarcinoma), lung cancer (including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), particularly squamous cell lung cancer and squamous cell lung adenocarcinoma), gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer (particularly basal cell carcinoma and squamous cell carcinoma), malignant melanoma, head and neck cancer (particularly malignant pleomorphic adenoma), sarcoma (particularly synovial sarcoma and synovial carcinosarcoma), bile duct cancer, bladder cancer (particularly transitional cell carcinoma and transitional cell carcinoma), 37. The binding agent, recombinant nucleic acid, host cell or method of claim 36, wherein the cancer is selected from the group consisting of: renal cancer (particularly renal cell carcinoma including renal clear cell carcinoma and papillary renal cell carcinoma), colon cancer, small intestine cancer (including cancer of the ileum, particularly small intestine adenocarcinoma and ileal adenocarcinoma), embryonal testicular carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer (particularly testicular seminoma, testicular teratoma and embryonal testicular cancer), uterine cancer, germ cell tumors (e.g. teratocarcinoma or embryonal carcinoma, particularly testicular germ cell tumors) and metastatic forms thereof.

Images