Method for examining ovarian cancer

Abstract

To provide a method for examining ovarian cancer.SOLUTION: Provided is a method for examining ovarian cancer. The method comprises (1) a step of detecting at least one miRNA selected from groups including a miRNA group (X), a miRNA group (A), a miRNA group (B), and a miRNA group (C), in extracellular vesicles purified from a body fluid taken from a subject, a body fluid containing extracellular vesicles, or ovarian tissue.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for testing for ovarian cancer. [Background technology]

[0002] Ovarian cancer tests are usually performed using imaging tests such as ultrasound (echo) tests, CT tests, and MRI tests. In order to diagnose ovarian cancer more accurately, it is necessary to collect and examine ovarian tissue. However, since the ovaries are located deep inside the body, surgery is required to collect ovarian tissue. For this reason, efforts are being made to develop biomarkers that will allow for more accurate ovarian cancer tests (Patent Document 1).

[0003] Extracellular vesicles (EVs) are cell-derived membrane vesicles present in various body fluids. EVs are released from donor cells and taken up by recipient cells via endocytosis, membrane fusion or internalization of specific ligand receptors, thereby delivering EV contents (e.g., nucleic acids, lipopolysaccharides, proteins and / or lipids) from donor cells to recipient cells. EVs are known to mediate various physiological and pathological responses, including organ development, cell-cell communication, tumor metastasis, and the onset and progression of immune-related diseases (e.g., autoimmune, degenerative or inflammatory diseases). The contents of EVs reflect the status of donor cells and can therefore be used as candidate molecules in diagnostic, prognostic, and epidemiological applications. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2021-004740 A [Patent Document 2] International Publication No. 2020 / 090859 Summary of the Invention [Problem to be solved by the invention]

[0005] An objective of the present invention is to provide a method for testing for ovarian cancer. [Means for solving the problem]

[0006] In view of the above problems, the present inventors have conducted intensive research and have found that (1) miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C) are present in extracellular vesicles purified from body fluids collected from subjects, body fluids containing extracellular vesicles, or ovarian tissues: (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) A group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, The inventors have found that the above-mentioned problems can be solved by a method for testing for ovarian cancer, comprising a step of detecting at least one miRNA selected from the group consisting of:

[0007] Item 1. (1) miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C) in extracellular vesicles purified from body fluids collected from a subject, body fluids containing extracellular vesicles, or ovarian tissue: (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) A group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, A method for testing for ovarian cancer, comprising the step of detecting at least one miRNA selected from the group consisting of:

[0008] Item 2. The method according to Item 1, wherein the miRNA comprises at least one miRNA selected from the miRNA group (X).

[0009] Item 3. The method according to Item 1, wherein the step (1) comprises detecting the miRNA in the extracellular vesicles.

[0010] Item 4. The miRNA is selected from the group consisting of miRNA group (X), miRNA group (AX), miRNA group (BX), and miRNA group (CX): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (AX) a group of miRNAs consisting of let-7a-5p, let-7f-5p, miR-151a-3p, let-7i-5p, miR-128-3p, miR-144-5p, miR-199b-3p, miR-340-5p, miR-423-3p, and miR-378d; (BX) a group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-101-3p, miR-30d-5p, and miR-30e-5p; and (CX)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, mi miRNA group consisting of R-27a-3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, and miR-99b-3p, The method according to item 1, wherein the miRNA is at least one selected from the group consisting of:

[0011] Item 5. The miRNA is selected from the group consisting of miRNA group (X), miRNA group (AXX), miRNA group (BXX), and miRNA group (CXX): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (AXX) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, let-7i-5p, and miR-340-5p; (BXX) miRNA group consisting of miR-3074-5p, and (CXX) a group of miRNAs consisting of miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1307-5p, and miR-499a-5p; The method according to item 1, wherein the miRNA is at least one selected from the group consisting of:

[0012] Item 6. Further, (2) determining whether or not the subject is affected with ovarian cancer based on the amount or concentration of the miRNA detected in the step (1); The method according to any one of items 1 to 5, comprising:

[0013] Item 7. The step (2) includes step (2a) and step (2b): (2a) miRNA group (Xa), miRNA group (Aa), miRNA group (Ba), and miRNA group (Ca) measured in the step (1): (Xa) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, and miR-3074-5p; (Aa) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128 miRNA group consisting of -3p, miR-144-5p, miR-146b-5p, miR-199b-3p, miR-30e-3p, miR-340-5p, and miR-423-3p, (Ba) miRNA group consisting of miR-3074-5p, and (Ca) A group of miRNAs consisting of miR-3611 and miR-6776-3p; determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than the cutoff value; (2b) miRNA group (Xb), miRNA group (Ab), miRNA group (Bb), and miRNA group (Cb) measured in the step (1): (Xb) a group of miRNAs consisting of miR-1468-5p, miR-191-3p, and miR-3064-5p; (Ab) A group of miRNAs consisting of miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (Bb) A group of miRNAs consisting of miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (Cb)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, miR-27a-3p, miR-36 miRNA group consisting of 9-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than the cutoff value. Item 7. The method according to item 6, comprising at least one step selected from the group consisting of:

[0014] Item 8. The step (1) A group of miRNAs in extracellular vesicles purified from blood collected from a subject or blood containing extracellular vesicles (A); A group of miRNAs in extracellular vesicles purified from urine collected from a subject or urine containing extracellular vesicles (B); and (C) a group of miRNAs in extracellular vesicles purified from ascites collected from a subject or in ascites containing extracellular vesicles; 6. The method according to any one of items 1 to 5, comprising a step of detecting at least one miRNA selected from the group consisting of:

[0015] Item 9. The method according to any one of Items 1 to 5, wherein the subject is a human.

[0016] Item 10. The method according to Item 3, wherein the extracellular vesicles are extracellular vesicles purified by a method comprising contacting the body fluid with a carrier comprising cellulose fibers and / or nanowires.

[0017] Item 11. miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) A group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, A diagnostic agent for ovarian cancer, comprising a detection agent for at least one miRNA selected from the group consisting of:

[0018] Item 12. An ovarian cancer diagnostic agent for use in the method according to any one of Items 1 to 5, comprising a carrier comprising cellulose fibers and / or nanowires. Effect of the Invention

[0019] According to the present invention, a method for testing for ovarian cancer can be provided. [Brief description of the drawings]

[0020] [Figure 1] The figures show the results of real-time PCR measurements in Test Example 2. The left side of each graph shows the miRNA to be measured, the vertical axis shows the relative amount of miRNA, and the horizontal axis shows the HGSC group, a group of subjects diagnosed with high-grade serous ovarian cancer, and the control group, a group of non-cancer subjects, with the p-values ​​for comparison between the two groups shown above the columns. The four columns of graphs show, from the left, the results using serum samples, urine samples, ascites samples, and ovarian surface fluid samples (ovarian tumor surface fluid for the HGSC group). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0022] 1. How to test for ovarian cancer In one aspect, the present invention comprises: (1) miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C) in extracellular vesicles purified from body fluids collected from subjects, body fluids containing extracellular vesicles, or ovarian tissue: (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) A group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, The present invention relates to a method for testing for ovarian cancer (sometimes referred to as the "testing method of the present invention" in this specification), which comprises a step of detecting at least one miRNA selected from the group consisting of:

[0023] 1-1. Process (1) Ovarian cancers to be examined include, but are not limited to, superficial, epithelial, and stromal malignant tumors (e.g., serous (cystic) adenocarcinoma, mucinous (cystic) adenocarcinoma, endometrioid adenocarcinoma, clear cell adenocarcinoma, adenocarcinoma fibroma (each of the above types), adenosarcoma, mesodermal mixed tumor, [Mullerian mixed tumor] [carcinosarcoma], malignant Brenner tumor, transitional cell carcinoma, undifferentiated carcinoma, etc.), sex cord stromal tumors (e.g., fibrosarcoma, Sertoli-stromal cell tumor (poorly differentiated type), etc.), germ cell tumors (e.g., undifferentiated germ cell tumor, yolk sac tumor [endodermal sinus tumor], embryonal carcinoma [embryonic carcinoma], polyembryoma, choriocarcinoma, mature cystic teratoma with malignant transformation, immature teratoma (G3), etc.), carcinoma, sarcoma, malignant lymphoma (primary), secondary [metastatic] tumors, etc. Ovarian cancer of all classes, grades, and stages according to various classification criteria regarding the progression, condition, etc. of ovarian cancer can be the subject of the test.

[0024] The subject is a target organism of the test method of the present invention, and the species of the subject is not particularly limited. Examples of the subject's species include various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits, and preferably humans.

[0025] The condition of the subject is not particularly limited. Examples of the subject include a specimen whose presence or absence of ovarian cancer is unknown, a specimen whose presence or absence has already been determined by another method to be caused by ovarian cancer, a specimen whose presence or absence has already been determined by another method to be not caused by ovarian cancer, and a specimen undergoing treatment for ovarian cancer.

[0026] The body fluid is not particularly limited as long as it contains extracellular vesicles. Examples of the body fluid include blood, urine, ascites, cerebrospinal fluid, saliva, synovial fluid, tissue fluid, sweat, tears, sputum, nasal mucus, breath, and breath condensate, and preferably include blood, urine, and ascites. The body fluid may be used alone or in combination of two or more kinds.

[0027] A body fluid can be collected from a subject by a method known to those skilled in the art. For example, blood can be collected by blood collection using a syringe or the like. The collected body fluid can be used as it is, or can be used after a purification procedure. For example, blood can be used as serum or plasma after a purification procedure. Serum is a portion of whole blood from which blood cells and specific blood coagulation factors have been removed, and can be obtained, for example, as a supernatant after whole blood has been coagulated. Plasma is a portion of whole blood from which blood cells have been removed, and can be obtained, for example, as a supernatant when whole blood is centrifuged under conditions that do not cause coagulation.

[0028] Extracellular vesicles are not particularly limited as long as they are membrane vesicles secreted or released from cells. Extracellular vesicles are usually defined as membrane vesicles that are responsible for local or systemic intercellular information transmission by transporting intracellular proteins or genetic information (mRNA, miRNA, etc.) to the outside of cells. Examples of extracellular vesicles include exosomes, microvesicles, apoptotic bodies, ectosomes, microparticles, and secreted microvesicles. From the viewpoint of test accuracy, etc., the extracellular vesicles are particularly preferably exosomes.

[0029] Extracellular vesicles can be purified, separated, concentrated, etc. from body fluids according to or in accordance with known methods. Methods for purifying, separating, concentrating, etc. extracellular vesicles include, for example, carrier adsorption method, ultracentrifugation (e.g., pellet down method, sucrose cushion method, density gradient centrifugation, etc.), methods using immunoaffinity carriers, gel filtration method, field-flow fractionation method, FACS method, etc. Purification, separation, concentration, etc. of extracellular vesicles can also be performed using commercially available kits. These methods may be used alone or in combination of two or more types.

[0030] From the viewpoints of ease of purification operation, detection sensitivity of miRNA, etc., the extracellular vesicles are preferably extracellular vesicles purified by a method including contacting a body fluid with a carrier including cellulose fibers and / or nanowires. Carriers including cellulose fibers and / or nanowires are publicly known (e.g., Patent Document 2), and can be obtained according to or in a similar manner to the publicly known method. In addition, methods for purifying extracellular vesicles using such carriers are also publicly known (e.g., Patent Document 2), and extracellular vesicles can be purified according to or in a similar manner to the publicly known method or the Examples of the present application.

[0031] The shape of the carrier is not particularly limited, and may be, for example, any of a film shape, a thread (string) shape, a cylindrical shape, a prismatic shape, or an amorphous three-dimensional shape.

[0032] The cellulose fiber is particularly preferably a cellulose nanofiber.

[0033] The above carrier is preferably configured so that the fibers constituting the carrier have gaps (nanopores). By adjusting the size of the nanopores, the capture efficiency of extracellular vesicles can be improved. The average size of the nanopores can be, for example, a lower limit of 10 nm or more, 15 nm or more, 20 nm or more, 25 nm or more, or 30 nm or more, and an upper limit of less than 1000 nm, 500 nm or less, 200 nm or less, or 100 nm or less.

[0034] The ovarian tissue is not particularly limited as long as it is an ovarian tissue that may contain ovarian tumor surface fluid or ovarian cancer cells when the subject has ovarian cancer. In one embodiment of the present invention, the ovarian tissue may be a surface tissue of the ovary. The ovarian tissue may be collected, for example, according to or in accordance with a conventional biopsy method.

[0035] In step (1), extracellular vesicles purified from body fluids, body fluids containing extracellular vesicles, or ovarian tissues are used as test samples, and miRNAs contained in the test samples are detected. The detection targets in step (1) are miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) A group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, Hereinafter, these may be collectively referred to as "target biomarkers."

[0036] Among miRNA group (X), miRNA group (Xa): (Xa) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, and miR-3074-5p are miRNAs whose expression is decreased in subjects with ovarian cancer; and (Xb) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, and miR-3074-5p are miRNAs whose expression is decreased in subjects with ovarian cancer. (Xb) The miRNA group consisting of miR-1468-5p, miR-191-3p, and miR-3064-5p is a miRNA whose expression is increased in subjects with ovarian cancer.

[0037] Among miRNA group (A), miRNA group (Aa): (Aa) A group of miRNAs consisting of let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b-3p, miR-30e-3p, miR-340-5p, and miR-423-3p are miRNAs whose expression is decreased in subjects with ovarian cancer. (Ab): (Ab) The miRNA group consisting of miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429 are miRNAs whose expression is increased in subjects with ovarian cancer.

[0038] Among the miRNA group (A), from the viewpoint of the accuracy of ovarian cancer testing, the miRNA group (AX): (AX) a miRNA group consisting of let-7a-5p, let-7f-5p, miR-151a-3p, let-7i-5p, miR-128-3p, miR-144-5p, miR-199b-3p, miR-340-5p, miR-423-3p, and miR-378d, more preferably a miRNA group (AXX): (AXX) A group of miRNAs consisting of let-7f-5p, miR-151a-3p, let-7i-5p, and miR-340-5p.

[0039] Among the miRNA group (A), the miRNA group (AY): (AY) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-12 miRNA group consisting of 8-3p, miR-146b-5p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-16-5p, and miR-486-5p, and more preferably the miRNA group (AYY): (AYY) A group of miRNAs consisting of let-7a-5p, let-7f-5p, miR-151a-3p, let-7i-5p, miR-126-3p, and miR-486-5p It is.

[0040] Among miRNA group (B), miRNA group (Ba): (Ba) miRNA group consisting of miR-3074-5p is a miRNA whose expression is decreased in subjects with ovarian cancer. (Bb) A group of miRNAs consisting of miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429 are miRNAs whose expression is increased in subjects with ovarian cancer.

[0041] Among the miRNA group (B), from the viewpoint of the test accuracy of ovarian cancer, the miRNA group (BX): (BX) a group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-101-3p, miR-30d-5p, and miR-30e-5p; and more preferably the miRNA group (BXX): (BXX) miRNA group consisting of miR-3074-5p; It is.

[0042] Among the miRNA group (B), the miRNA group (BY): (BY) a group of miRNAs consisting of miR-3074-5p, miR-184, miR-200a-3p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, and miR-30e-5p, more preferably a group of miRNAs (BYY): (BYY) A group of miRNAs consisting of miR-1246, miR-30c-5p, and miR-30d-5p.

[0043] Among miRNA group (C), miRNA group (Ca): (Ca) miRNA group consisting of miR-3611 and miR-6776-3p are miRNAs whose expression is decreased in subjects with ovarian cancer. (Cb) miRNA group: (Cb) The miRNA group consisting of let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, miR-27a-3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429 are miRNAs whose expression is increased in subjects with ovarian cancer.

[0044] Among the miRNA group (C), from the viewpoint of the test accuracy of ovarian cancer, the miRNA group (CX): (CX)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, mi miRNA group consisting of R-27a-3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, and miR-99b-3p, and more preferably the miRNA group (CXX): (CXX) a group of miRNAs consisting of miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1307-5p, and miR-499a-5p; It is.

[0045] Among the miRNA group (C), the miRNA group (CYY): (CYY)miRNA group consisting of miR-27a-3p It is.

[0046] Among the target biomarkers, miR-200a-3p, miR-425-5p, and miR-429 are preferred from the viewpoints of being less affected by the type of sample and being more suitable for detection by analytical methods using primers and / or probes (e.g., quantitative PCR methods such as real-time PCR methods).

[0047] The base sequence of the target biomarker can be identified in a known database (e.g., miRBase: http: / / www.mirbase.org / ). For example, in the case of humans, the base sequence is as follows: hsa-let-7a-5p MIMAT0000062 UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 1) hsa-let-7f-5p MIMAT0000067 UGAGGUAGUAGAUUGUAUAGUU (SEQ ID NO: 2) hsa-miR-151a-3p MIMAT0000757 CUAGACUGAAGCUCCUUGAGG (SEQ ID NO: 3) hsa-let-7d-5p MIMAT0000065 AGAGGUAGUAGGUUGCAUAGUU (SEQ ID NO: 4) hsa-let-7g-5p MIMAT0000414 UGAGGUAGUAGUUUGUACAGUU (SEQ ID NO: 5) hsa-let-7i-5p MIMAT0000415 UGAGGUAGUAGUUUGUGCUGUU (SEQ ID NO: 6) hsa-miR-126-3p MIMAT0000445 UCGUACCGUGAGUAAUAAUGCG (SEQ ID NO: 7) hsa-miR-128-3p MIMAT0000424 UCACAGUGAACCGGUCUCUUU (SEQ ID NO: 8) hsa-miR-144-5p MIMAT0004600 GGAUAUCAUCAUAUACUGUAAG (SEQ ID NO: 9) hsa-miR-146b-5p MIMAT0002809 UGAGAACUGAAUUCCAUAGGCUG (SEQ ID NO: 10) hsa-miR-199b-3p MIMAT0004563 ACAGUAGUCUGCACAUUGGUUA (SEQ ID NO: 11) hsa-miR-30e-3p MIMAT0000693 CUUUCAGUCGGAUGUUUACAGC (SEQ ID NO: 12) hsa-miR-340-5p MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU (SEQ ID NO: 13) hsa-miR-423-3p MIMAT0001340 AGCUCGGUCUGAGGCCCCUCAGU (SEQ ID NO: 14) hsa-miR-15b-3p MIMAT0004586 CGAAUCAUUAUUUGCUGCUCUA (SEQ ID NO: 15) hsa-miR-16-5p MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 16) hsa-miR-378d MIMAT0018926 ACUGGACUUGGAGUCAGAAA (SEQ ID NO: 17) hsa-miR-486-5p MIMAT0002177 UCCUGUACUGAGCUGCCCCGAG (SEQ ID NO: 18) hsa-miR-3074-5p MIMAT0019208 GUUCCUGCUGAACUGAGCCAG (SEQ ID NO: 19) hsa-miR-9-5p MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA (SEQ ID NO: 20) hsa-miR-184 MIMAT0000454 UGGACGGAGAACUGAUAAGGGU (SEQ ID NO: 21) hsa-miR-200a-3p MIMAT0000682 UAACACUGUCUGGUAACGAUGU (SEQ ID NO: 22) hsa-miR-421 MIMAT0003339 AUCAACAGACAUUAAUUGGGCGC (SEQ ID NO: 23) hsa-miR-509-3-5p MIMAT0004975 UACUGCAGACGUGGCAAUCAUG (SEQ ID NO: 24) hsa-miR-101-3p MIMAT0000099 UACAGUACUGUGAUAACUGAA (SEQ ID NO: 25) hsa-miR-1246 MIMAT0005898 AAUGGAUUUUUGGAGCAGG (SEQ ID NO: 26) hsa-miR-30b-5p MIMAT0000420 UGUAAACAUCCUACACUCAGCU (SEQ ID NO: 27) hsa-miR-30c-5p MIMAT0000244 UGUAAACAUCCUACACUCUCAGC (SEQ ID NO: 28) hsa-miR-30d-5p MIMAT0000245 UGUAAACAUCCCCGACUGGAAG (SEQ ID NO: 29) hsa-miR-30e-5p MIMAT0000692 UGUAAACAUCCUUGACUGGAAG (SEQ ID NO: 30) hsa-let-7a-3p MIMAT0004481 CUAUACAAUCUACUGUCUUUC (SEQ ID NO: 31) hsa-miR-1468-5p MIMAT0006789 CUCCGUUUGCCUGUUUCGCUG (SEQ ID NO: 32) hsa-miR-191-3p MIMAT0001618 GCUGCGCUUGGAUUUCGUCCCC (SEQ ID NO: 33) hsa-miR-3064-5p MIMAT0019864 UCUGGCUGUUGUGGUGUGCAA (SEQ ID NO: 34) hsa-miR-3611 MIMAT0017988 UUGUGAAGAAAGAAAUUCUUA (SEQ ID NO: 35) hsa-miR-6776-3p MIMAT0027453 CAACCACCACUGUCUCUCCCCAG (SEQ ID NO: 36) hsa-miR-1301-3p MIMAT0005797 UUGCAGCUGCCUGGGAGUGACUUC (SEQ ID NO: 37) hsa-miR-1307-5p MIMAT0022727 UCGACCGGACCUCGACCGGCU (SEQ ID NO: 38) hsa-miR-27a-3p MIMAT0000084 UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 39) hsa-miR-369-5p MIMAT0001621 AGAUCGACCGUGUUAUAUUCGC (SEQ ID NO: 40) hsa-miR-382-5p MIMAT0000737 GAAGUUGUUCGUGGUGGAUUCG (SEQ ID NO: 41) hsa-miR-499a-5p MIMAT0002870 UUAAGACUUGCAGUGAUGUUU (SEQ ID NO: 42) hsa-miR-9985 MIMAT0039763 UUCACAGUGGCUAAGCUAU (SEQ ID NO: 43) hsa-miR-99b-3p MIMAT0004678 CAAGCUCGUGUCUGUGGGUCCG (SEQ ID NO: 44) hsa-miR-425-5p MIMAT0003393 AAUGACACGAUCACUCCCGUUGA (SEQ ID NO: 45) hsa-miR-429 MIMAT0001536 UAAUACUGUCUGGUAAAACCGU (SEQ ID NO: 46)

[0048] The number of target biomarkers to be detected in step (1) may be one or more, but from the standpoint of test accuracy and the like, the number of target biomarkers to be detected is preferably two or more, three or more, four or more, five or more, ten or more, fifteen or more, twenty or more, twenty-five or more, thirty or more, thirty-five or more, forty or more, or all types (46 types).

[0049] In a preferred embodiment of the present invention, the target biomarker detected in step (1) preferably comprises at least one miRNA selected from the miRNA group (X).

[0050] Detection is usually performed by measuring the amount or concentration of the target biomarker. "Concentration" is not limited to absolute concentration, but may also be relative concentration, weight per unit volume, raw data measured to know the absolute concentration, etc.

[0051] The method for detecting the target biomarker is not particularly limited as long as it can specifically detect a part or all of the target biomarker. Specific examples of the detection method include RNA-seq analysis, RT-PCR, nucleic acid chip analysis, and Northern blotting.

[0052] When RNA-seq analysis is used, specifically, cDNA is prepared from RNA derived from the subject in a standard manner, and sequence analysis is performed using a next-generation sequencer or the like. Based on the obtained data, mapping, gene expression analysis, expression level analysis, etc. are performed to obtain expression level information.

[0053] When RT-PCR is used, specifically, cDNA is prepared from RNA derived from a specimen in a conventional manner, and a pair of primers (a positive strand that binds to the above cDNA (-strand) and a reverse strand that binds to the + strand) are hybridized to the cDNA so that the target region can be amplified using the cDNA as a template, and PCR is performed in a conventional manner to detect the resulting amplified double-stranded DNA. The amplified double-stranded DNA can be detected by a method of detecting labeled double-stranded DNA produced by performing the above PCR using primers that have been labeled with RI or a fluorescent substance in advance, or by transferring the produced double-stranded DNA to a nylon membrane or the like in a conventional manner and hybridizing it with a labeled probe for detection.

[0054] When using nucleic acid chip analysis, a method can be used in which a nucleic acid chip with a nucleic acid probe (single-stranded or double-stranded) attached thereto is prepared, and this is hybridized with RNA derived from a specimen or a nucleic acid prepared from the RNA by standard methods, and the double strand formed is detected.

[0055] When using the Northern blot method, a specific example is a method in which a probe is labeled with a radioisotope (32P, 33P, etc.: RI) or a fluorescent substance, and then hybridized with RNA derived from a test subject, and the formed double strand is then detected and measured by using a radiation detector or a fluorescence detector to detect a signal derived from the label of the probe (labeling substance such as RI or a fluorescent substance).

[0056] From the viewpoint of the accuracy of ovarian cancer testing, step (1) preferably includes a step of detecting the miRNA in extracellular vesicles.

[0057] Step (1) is, from the viewpoint of the accuracy of ovarian cancer testing, A group of miRNAs in extracellular vesicles purified from blood collected from a subject or blood containing extracellular vesicles (A); A group of miRNAs in extracellular vesicles purified from urine collected from a subject or urine containing extracellular vesicles (B); and (C) a group of miRNAs in extracellular vesicles purified from ascites collected from a subject or in ascites containing extracellular vesicles; It is preferable that the method comprises the step of detecting at least one miRNA selected from the group consisting of:

[0058] According to the testing method of the present invention including step (1), it is possible to provide the amount and / or concentration of a target biomarker that is an indicator for testing for ovarian cancer, thereby assisting in testing for ovarian cancer, etc.

[0059] 1-2. Process (2) In one embodiment, the inspection method of the present invention further comprises: (2) determining whether or not the subject is affected by ovarian cancer based on the amount or concentration of the miRNA detected in the step (1); It is preferred that the compound contains

[0060] More specifically, step (2) includes steps (2a) and (2b): (2a) miRNA group (Xa), miRNA group (Aa), miRNA group (Ba), and miRNA group (Ca) measured in the step (1): (Xa) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, and miR-3074-5p; (Aa) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128 miRNA group consisting of -3p, miR-144-5p, miR-146b-5p, miR-199b-3p, miR-30e-3p, miR-340-5p, and miR-423-3p, (Ba) miRNA group consisting of miR-3074-5p, and (Ca) A group of miRNAs consisting of miR-3611 and miR-6776-3p; determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than the cutoff value; (2b) miRNA group (Xb), miRNA group (Ab), miRNA group (Bb), and miRNA group (Cb) measured in the step (1): (Xb) a group of miRNAs consisting of miR-1468-5p, miR-191-3p, and miR-3064-5p; (Ab) A group of miRNAs consisting of miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (Bb) A group of miRNAs consisting of miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (Cb)let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, miR-27a-3p, miR-36 miRNA group consisting of 9-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than the cutoff value. The method may include at least one step selected from the group consisting of:

[0061] In the above steps, the incidence of ovarian cancer can be replaced with the therapeutic effect of ovarian cancer. That is, according to a modification of step (2), the therapeutic effect of ovarian cancer can be evaluated, and according to steps (2a) / (2b), it can be determined whether or not the therapeutic effect is present in a subject during or after ovarian cancer treatment.

[0062] The cutoff value can be appropriately set by a person skilled in the art from the viewpoints of sensitivity, specificity, positive predictive value, negative predictive value, etc., and can be a value determined on a case-by-case basis or a predetermined value based on the amount and / or concentration of the target biomarker in extracellular vesicles purified from body fluids collected from various subjects (e.g., subjects not suffering from ovarian cancer, subjects suffering from ovarian cancer) or body fluids containing extracellular vesicles. More specifically, for example, the amount or concentration of the target biomarker in extracellular vesicles purified from body fluids collected from subjects not suffering from ovarian cancer and subjects suffering from ovarian cancer or body fluids containing extracellular vesicles is measured, and the measured value is used to perform statistical analysis based on analysis of the receiver operating characteristic (ROC) curve (more specifically, a method using the Youden index is exemplified). The cutoff value can be set by measuring the amount or concentration of the target biomarker in extracellular vesicles purified from body fluids collected from subjects not suffering from ovarian cancer and subjects suffering from ovarian cancer, and performing statistical analysis based on analysis of the receiver operating characteristic (ROC) curve (more specifically, a method using the Youden index is exemplified). The cutoff value can be, for example, a percentile value of the amount or concentration value of the target biomarker in extracellular vesicles purified from a body fluid in a reference subject group or a body fluid containing extracellular vesicles, for example, any of the 10th to 90th percentile values, any of the 30th to 70th percentile values, or any of the 40th to 60th percentile values.

[0063] 2. Higher accuracy in diagnosing ovarian cancer When the testing method of the present invention including step (2) determines that the subject is suffering from ovarian cancer or that the subject is not suffering from ovarian cancer, ovarian cancer can be diagnosed with higher accuracy by combining the testing method of the present invention with a further step of a doctor's diagnosis.

[0064] 3. Treatment of ovarian cancer When the subject is judged to have ovarian cancer by the test method of the present invention including step (2), or when the subject is diagnosed to have ovarian cancer as described above in "2. Diagnosis of ovarian cancer with higher accuracy", the test method of the present invention and the step of applying a diagnosis by a doctor are further combined to perform a step (3) of treating the subject for the disease, thereby making it possible to treat the subject for the disease. Furthermore, since the test method of the present invention can test for ovarian cancer more accurately, by combining step (3) with the test method of the present invention or the combination of the test method of the present invention and the step of applying a diagnosis by a doctor, the subject suffering from ovarian cancer can be treated more efficiently and more reliably.

[0065] The method of treating ovarian cancer is not particularly limited, and examples thereof include drug therapy, surgery, and radiation therapy. The drugs used in drug therapy are not particularly limited, and examples thereof include platinum preparations, microtubule inhibitors, alkylating agents, metabolic antagonists, antibiotic anticancer drugs, topoisomerase inhibitors, molecular targeted drugs, hormones, and biological drugs. Specific examples thereof include bevacizumab, olaparib, pembrolizumab, paclitaxel, carboplatin, docetaxel, doxorubicin (e.g., liposomal doxorubicin), gemcitabine, bleomycin, etoposide, cisplatin, vinblastine, ifosfamide, vincristine, actinomycin D, and cyclophosphamide. One, two, or three or more types of drugs can be used in combination. Typically, a combination therapy of both platinum preparations or a platinum preparation and a microtubule inhibitor can be performed first.

[0066] 4. Ovarian cancer test kit 1 In one aspect, the present invention relates to a diagnostic agent for ovarian cancer (also referred to herein as "test agent 1 of the present invention") comprising a detection agent for a target biomarker (also referred to herein as "detection agent of the present invention"). This will be described below.

[0067] For matters not explained below in this section, the above description is incorporated by reference.

[0068] The detection agent of the present invention is not particularly limited as long as it can specifically detect a target biomarker. Examples of the detection agent include primers and probes for the target biomarker.

[0069] The detection agent of the present invention may be modified as long as its function is not significantly impaired. Examples of modifications include the addition of labels such as fluorescent dyes, enzymes, proteins, radioisotopes, chemiluminescent substances, biotin, etc.

[0070] The fluorescent dye used in the present invention may be one that is generally used to label nucleotides for detection or quantification of nucleic acids, and examples of such fluorescent dyes include, but are not limited to, HEX (4,7,2',4',5',7'-hexachloro-6-carboxylfluorescein, a green fluorescent dye), fluorescein, NED (trade name, manufactured by Applied Biosystems, a yellow fluorescent dye), 6-FAM (trade name, manufactured by Applied Biosystems, a yellow-green fluorescent dye), rhodamine or a derivative thereof (e.g., tetramethylrhodamine (TMR)). As a method for labeling nucleotides with fluorescent dyes, any suitable known labeling method may be used (see Nature Biotechnology, 14, 303-308 (1996)). In addition, a commercially available fluorescent labeling kit may be used (e.g., Oligonucleotide ECL 3'-Oligo Labeling System, manufactured by Amersham-Pharmacia, etc.).

[0071] The detection agent of the present invention can be used by immobilizing it on any solid phase. Therefore, the test agent 1 of the present invention can be provided in the form of a substrate on which the detection agent is immobilized (for example, a microarray chip on which a probe is immobilized, etc.).

[0072] The solid phase used for immobilization is not particularly limited as long as it can immobilize polynucleotides, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. The immobilization of the detection agent to the solid phase is not particularly limited. The immobilization method is well known in the art depending on the type of immobilized probe, such as using a commercially available spotter (such as Amersham) for microarrays (e.g., photolithographic technology (Affymetrix), in situ synthesis of oligonucleotides using inkjet technology (Rosetta Inpharmatics), etc.).

[0073] The primers, probes, etc. are not particularly limited as long as they selectively (specifically) recognize the target biomarker or a nucleic acid derived therefrom. Here, "selectively (specifically) recognize" means, for example, in the Northern blot method, that the target biomarker can be specifically detected, and in the RT-PCR method, that the target biomarker or a nucleic acid derived therefrom (cDNA, etc.) is specifically amplified, but is not limited thereto, and may be any primer or probe that allows a person skilled in the art to determine that the detected or amplified product is derived from the target biomarker.

[0074] Specific examples of primers and probes include the polynucleotides described in (a) below and the polynucleotides described in (b) below: (a) a polynucleotide having at least 15 consecutive bases in the base sequence of a target biomarker and / or a polynucleotide complementary to said polynucleotide, and (b) a polynucleotide having at least 15 bases that hybridizes under stringent conditions to the base sequence of a target biomarker or a base sequence complementary thereto. At least one selected from the group consisting of:

[0075] A complementary polynucleotide or a complementary base sequence (complementary strand, reverse strand) refers to a polynucleotide or base sequence that is base-complementary to the full-length sequence of a polynucleotide consisting of the base sequence of a target biomarker, or a partial sequence thereof having a base sequence of at least 15 consecutive bases in length (for convenience, these are also referred to as the "positive strand" herein). However, such a complementary strand is not limited to a case where it forms a completely complementary sequence with the base sequence of the target positive strand, but may have a complementary relationship to the extent that it can hybridize with the target positive strand under stringent conditions. In addition, the stringent conditions here can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe is bound, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). For example, washing conditions after hybridization can usually be about "1xSSC, 0.1% SDS, 37°C". It is preferable that the complementary strand maintains a hybridized state with the target positive strand even when washed under such conditions. Although not particularly limited, a more stringent hybridization condition can be about "0.5xSSC, 0.1% SDS, 42°C", and an even more stringent hybridization condition can be about "0.1xSSC, 0.1% SDS, 65°C". Specifically, examples of such complementary strands include a strand consisting of a base sequence that is completely complementary to the base sequence of the target positive strand, and a strand consisting of a base sequence that has at least 90%, preferably 95%, more preferably 98% or more, and even more preferably 99% or more identity with the strand.

[0076] Primers, probes, etc. can be designed, for example, based on the base sequence of a target biomarker using various design programs. Specifically, a candidate sequence for a primer or probe obtained by applying the base sequence of the target biomarker to a design program, or a sequence at least partially including the sequence, can be used as the primer or probe.

[0077] The base length of the primer, probe, etc. is not particularly limited as long as it has a length of at least 15 consecutive bases as described above, and can be appropriately set depending on the application. For example, the base length can be 15 to 35 bases when used as a primer, and 15 to 35 bases when used as a probe.

[0078] The test agent 1 of the present invention may contain other detection agents (for example, probes for detecting other nucleic acids such as miRNA, antibodies, etc.) other than the detection agent of the present invention.

[0079] The test agent 1 of the present invention may be in the form of a composition. The composition may contain other components as necessary. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0080] The test agent 1 of the present invention may be in the form of a kit. The kit may contain, in addition to the detection agent or the composition containing the same, something that can be used to detect a target biomarker in a biological sample from a subject. Specific examples of such things include various reagents (e.g., buffer solutions, etc.), tools (e.g., tools for purifying and separating biological samples), etc.

[0081] 5. Ovarian cancer test 2 In one aspect, the present invention relates to a diagnostic agent for ovarian cancer (also referred to as "diagnostic agent 2 of the present invention" in this specification) for use in the diagnostic method of the present invention, which comprises a carrier including cellulose fibers and / or nanowires. This will be described below.

[0082] For matters not explained below in this section, the above description is incorporated by reference.

[0083] The form of the test agent 2 of the present invention is the same as that of the test agent 1 of the present invention.

[0084] The test agent 2 of the present invention can be used, for example, in such a way that a subject obtains the test agent 2 of the present invention and brings his / her own bodily fluids into contact with the above-mentioned carrier, and the obtained bodily fluid retention carrier is handed over to a person who performs the testing method of the present invention, who then uses the bodily fluid retention carrier to perform the testing method of the present invention. EXAMPLES

[0085] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0086] Reference Example 1. Preparation of carbon nanofiber (CNF) sheet CNF sheets were made from cellulose nanofibers. Cellulose nanofibers with a width of 22 ± 8 nm were first prepared using undried pulp (softwood bleached kraft pulp) according to a previous report (Acs Nano 16, 8630-8640, doi:10.1021 / scsnano.1c10728 (2022).). Next, an aqueous dispersion of cellulose nanofibers (0.2 wt%, 200 mL) was suction filtered through a membrane filter (H020A090C, hydrophilic polytetrafluoroethylene membrane, pore size 0.2 μm, Advantec Toyo Co., Ltd.). 200 mL of tert-butyl alcohol (t-BuOH, purity ≥ 99.0%, Nacalai Tesque Inc., Kyoto, Japan) was poured into it and gently filtered. The obtained wet sheet was peeled off from the filter and dried by hot pressing (1.1 MPa) at 110 °C for 30 min to obtain a CNF sheet.

[0087] Test Example 1. miRNA Expression Profile Analysis 1 Body fluids (serum, urine, and ascites) were obtained from six subjects diagnosed with high-grade serous ovarian cancer (Cancer group) and eight non-cancer subjects (Benign group).

[0088] 10-20 μL of body fluid was permeated into a CNF sheet (10 mm × 10 mm). As a result, extracellular vesicles (EVs) were captured by the CNF sheet (Patent Document 2). The sheet was dried at room temperature and left for about 7 days. The sheet was washed with PBS for 10 seconds, and RNA was extracted with RNA lysis buffer. Library preparation was performed using the collected EV-RNA, and small RNA sequencing was outsourced to Nextseq (Illumina, Macrogen). Fast files were annotated to human miRNA reference, the number of reads was evaluated, and differential expression analysis was performed using Fisher's linear discriminant analysis. Fisher's linear discriminant analysis is a method that uses machine learning to find a straight line = decision boundary that can "best discriminate" between two groups. Using this method, leave-one-out cross-validation (LOOCV, leave-one-out cross-validation) was performed to calculate the CV score, and the sensitivity, specificity, and area under the ROC curve (AUC) were also calculated.

[0089] Data on miRNA extracted when serum was used is shown in Table 1, data on miRNA extracted when urine was used in Table 2, and data on miRNA extracted when ascites was used in Table 3. In the tables, in "Benign - Cancer", ">" indicates that the miRNA had a higher read count in the Benign group than in the Cancer group, and "<" indicates that the miRNA had a higher read count in the Cancer group than in the Benign group.

[0090] [Table 1]

[0091] [Table 2]

[0092] [Table 3]

[0093] Among the miRNAs in Table 1, the miRNAs with an average read number of 1000 or more in the group with a higher read number between the Benign group and the Cancer group are let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-146b-5p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-16-5p, and miR-486-5p. Among these, the miRNAs with an average read number of 10,000 or more are let-7a-5p, let-7f-5p, miR-151a-3p, let-7i-5p, miR-126-3p, and miR-486-5p.

[0094] Among the miRNAs in Table 2, the miRNAs with an average read number of 1000 or more in the group with the higher read number between the Benign group and the Cancer group are miR-3074-5p, miR-184, miR-200a-3p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, and miR-30e-5p, and among these, the miRNAs with an average read number of 10,000 or more are miR-1246, miR-30c-5p, and miR-30d-5p.

[0095] Among the miRNAs in Table 3, the miRNA with an average read number of 1000 or more in the group with a higher read number between the Benign group and the Cancer group was miR-27a-3p, and the average read number of this miRNA was 10000 or more.

[0096] In addition, miRNAs extracted from one body fluid were found to have a certain degree of ovarian cancer discrimination when another body fluid was used. For example, let-7f-5p extracted from serum had an AUC of 0.778 when used with ascites, miR-423-3p extracted from serum had an AUC of 0.778 when used with ascites, and miR-421 extracted from urine had an AUC of 0.931 when used with ascites.

[0097] Test Example 2. miRNA Expression Profile Analysis 2 Body fluids (serum, urine, and ascites) and ovarian surface fluid (ovarian tumor surface fluid in the HGSC group) were obtained from six subjects diagnosed with high-grade serous ovarian cancer (HGSC group) and three subjects without cancer (control group). Each sample was used for the following measurements using the TRIPLICATE.

[0098] From the above body fluid, extracellular vesicles were purified and RNA was extracted from them in the same manner as in Test Example 1. RNA was also extracted from the ovarian surface body fluid. The amount of miRNA (miR-200a-3p, miR-425-5p, miR-429) in the extracted RNA sample was measured by real-time PCR.

[0099] The results are shown in Figure 1. The expression levels of all miRNAs were higher in the HGSC group than in the control group. The above trend could be seen even for results with a p-value of 0.05 or more in the figure, and when combined with other results, it was thought that the p-value would be less than 0.05 if the number of samples was increased.

Claims

1. (1) miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C) in extracellular vesicles purified from body fluids collected from subjects, body fluids containing extracellular vesicles, or ovarian tissue: (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) a group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C) let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, A method for testing for ovarian cancer, comprising the step of detecting at least one miRNA selected from the group consisting of:

2. The method of claim 1 , wherein the miRNA comprises at least one miRNA selected from the miRNA group (X).

3. The method of claim 1, wherein step (1) comprises detecting the miRNA in the extracellular vesicles.

4. The miRNAs are selected from the group consisting of miRNA group (X), miRNA group (AX), miRNA group (BX), and miRNA group (CX): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (AX) a group of miRNAs consisting of let-7a-5p, let-7f-5p, miR-151a-3p, let-7i-5p, miR-128-3p, miR-144-5p, miR-199b-3p, miR-340-5p, miR-423-3p, and miR-378d; (BX) a group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-101-3p, miR-30d-5p, and miR-30e-5p; and (CX) let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, mi miRNA group consisting of R-27a-3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, and miR-99b-3p, The method of claim 1, wherein the miRNA is at least one selected from the group consisting of:

5. The miRNAs are selected from the group consisting of miRNA group (X), miRNA group (AXX), miRNA group (BXX), and miRNA group (CXX): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (AXX) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, let-7i-5p, and miR-340-5p; (BXX) miRNA group consisting of miR-3074-5p, and (CXX) a group of miRNAs consisting of miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1307-5p, and miR-499a-5p; The method of claim 1, wherein the miRNA is at least one selected from the group consisting of:

6. Furthermore, (2) determining whether or not the subject is affected by ovarian cancer based on the amount or concentration of the miRNA detected in the step (1); The method according to any one of claims 1 to 5, comprising:

7. The step (2) includes step (2a) and step (2b): (2a) miRNA group (Xa), miRNA group (Aa), miRNA group (Ba), and miRNA group (Ca) measured in the step (1): (Xa) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, and miR-3074-5p; (Aa) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128 miRNA group consisting of -3p, miR-144-5p, miR-146b-5p, miR-199b-3p, miR-30e-3p, miR-340-5p, and miR-423-3p, (Ba) miRNA group consisting of miR-3074-5p, and (Ca) miRNA group consisting of miR-3611 and miR-6776-3p; determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than the cutoff value; (2b) miRNA group (Xb), miRNA group (Ab), miRNA group (Bb), and miRNA group (Cb) measured in the step (1): (Xb) A group of miRNAs consisting of miR-1468-5p, miR-191-3p, and miR-3064-5p; (Ab) A group of miRNAs consisting of miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (Bb) A group of miRNAs consisting of miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (Cb) let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-1301-3p, miR-1307-5p, miR-27a-3p, miR-36 miRNA group consisting of 9-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, determining that the subject is suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or higher than a cutoff value, and / or determining that the subject is not suffering from ovarian cancer when the amount or concentration of at least one miRNA selected from the group consisting of is equal to or lower than the cutoff value. The method according to claim 6, comprising at least one step selected from the group consisting of:

8. The step (1), A group of miRNAs in extracellular vesicles purified from blood collected from a subject or blood containing extracellular vesicles (A); A group of miRNAs in extracellular vesicles purified from urine collected from a subject or in urine containing extracellular vesicles (B); and (C) A group of miRNAs in extracellular vesicles purified from ascites collected from a subject or in ascites containing extracellular vesicles; The method according to any one of claims 1 to 5, comprising a step of detecting at least one miRNA selected from the group consisting of:

9. The method according to any one of claims 1 to 5, wherein the subject is a human.

10. The method of claim 3, wherein the extracellular vesicles are extracellular vesicles purified by a method comprising contacting the body fluid with a carrier comprising cellulose fibers and / or nanowires.

11. miRNA group (X), miRNA group (A), miRNA group (B), and miRNA group (C): (X) a group of miRNAs consisting of let-7f-5p, miR-151a-3p, miR-3074-5p, miR-1468-5p, miR-191-3p, and miR-3064-5p; (A) let-7a-5p, let-7f-5p, miR-151a-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-126-3p, miR-128-3p, miR-144-5p, miR-146b-5p, miR-199b- miRNA group consisting of 3p, miR-30e-3p, miR-340-5p, miR-423-3p, miR-15b-3p, miR-16-5p, miR-378d, miR-486-5p, miR-200a-3p, miR-425-5p, and miR-429; (B) a group of miRNAs consisting of miR-3074-5p, miR-9-5p, miR-184, miR-200a-3p, miR-421, miR-509-3-5p, miR-101-3p, miR-1246, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-425-5p, and miR-429; and (C) let-7a-3p, miR-1468-5p, miR-191-3p, miR-3064-5p, miR-3611, miR-6776-3p, miR-1301-3p, miR-1307-5p, miR-27a miRNA group consisting of -3p, miR-369-5p, miR-382-5p, miR-499a-5p, miR-9985, miR-99b-3p, miR-200a-3p, miR-425-5p, and miR-429, A diagnostic agent for ovarian cancer, comprising a detection agent for at least one miRNA selected from the group consisting of:

12. An ovarian cancer diagnostic agent for use in the method according to any one of claims 1 to 5, comprising a carrier comprising cellulose fibres and / or nanowires.

Images