Method and composition for preventing or treating myopia

Abstract

To provide a method for preventing or treating myopia, and a composition for use therein.SOLUTION: The present invention provides a method and a composition that are for inhibiting, ameliorating, or treating myopia by administering berberine, taurine, lipoic acid, a salt of any of these, or a derivative of any of these.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method and composition for preventing or treating myopia, more particularly to a composition that acts on immune cells in the choroid to inhibit the progression of myopia, more particularly by inducing polarization to M2 macrophages or modulating the function of choroidal resident immune cells, such as by administering mast cell stabilizers, chemical mediator release inhibitors, or lactic acid bacteria.The present invention also relates to a method and composition for preventing or treating myopia by administering berberine, taurine, or lipoic acid, or salts thereof, or derivatives thereof. [Background technology]

[0002] Myopia refers to a condition in which light is focused in front of the retina due to axial elongation, and the longer the axial length, the stronger the myopia. As the prevalence of myopia increases, there has been growing interest in the factors involved in the development of myopia and in methods to prevent and control myopia progression. Recent studies have suggested that the choroid is important in regulating eye growth and the development of myopia, and choroidal thinning has been shown to be a structural feature of myopia. The negative correlation between choroidal thickness and axial length suggests that changes in choroidal thickness may be a predictive biomarker for axial elongation. However, the detailed mechanisms by which the choroid is involved in the development and progression of myopia remain unclear.

[0003] The choroid is a tissue that covers the outer side of the retina and is rich in fine blood vessels. In addition to supplying oxygen and nutrients to retinal cells, it also supplies growth factors involved in tissue remodeling of the outer sclera and regulating eye growth. It is thought that a decrease in choroidal thickness or blood flow contributes to scleral ischemia and hypoxia, which affect changes in scleral structure that lead to axial length elongation. Therefore, maintaining or increasing choroidal thickness and blood flow is attracting attention as a new target for the prevention and treatment of myopia.

[0004] Methods have been proposed for inhibiting the progression of myopia by maintaining or increasing choroidal thickness, such as the ingestion of crocetin (see Non-Patent Document 1) and exposure to violet light (Non-Patent Document 2).

[0005] Crocetin is known to have anti-inflammatory and immunomodulatory effects, and is known to exert its effects through adjusting the balance of Th1 / Th2 and Th17 / Treg in T cells and suppressing the NF-κB pathway in cells that produce inflammatory mediators (TNF-α, IL-6, IFN-γ, etc.), such as macrophages (Non-patent Documents 3-5).

[0006] There are 13 types of cells in the choroid, 4 of which are immune cells. Tissue-resident immune cells are responsible for maintaining tissue homeostasis and structure in addition to immune responses. For example, it has been reported that the choroid thins in mice lacking macrophages or mice in which degranulation of mast cells is induced (Non-Patent Documents 6-7).

[0007] Patent Document 1 describes that lipoic acid and its derivatives are effective in treating presbyopia and cataracts. Patent Document 2 also describes that lipoic acid choline ester is effective in treating presbyopia. However, Patent Documents 1 and 2 do not describe or suggest the relationship between lipoic acid and its derivatives and myopia. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] International Publication No. 2009 / 111633 Brochure [Patent Document 2] Patent No. 7091318 [Non-patent literature]

[0009] [Non-Patent Document 1] Mori et al., Sci Rep. 2019. 22;9(1):295. [Non-Patent Document 2] Jiang et al. Proc Natl Acad Sci USA. 2021. 1;118(22):e2018840118. [Non-Patent Document 3] Oxid Med Cell Longev. 2021 Sep 10;2021:6631929. [Non-Patent Document 4] Eur J Pharmacol. 2012 Jan 15;674(2-3):391-6. [Non-Patent Document 5] Biofactors. 2023 Feb 6. doi: 10.1002 / biof.1942. [Non-Patent Document 6] Elife. 2020 Apr 1;9:e55564. [Non-Patent Document 7] FASEB J. 2020 Aug;34(8):10117-10131. Summary of the Invention [Problem to be solved by the invention]

[0010] The present disclosure aims to provide a method for preventing or treating myopia and a composition used therein, particularly a composition that targets choroid-resident immune cells, particularly macrophages and mast cells. [Means for solving the problem]

[0011] Myopia is a major cause of visual impairment and has emerged as a global public health concern. One of the main structural features of myopia is the corresponding reduction in choroidal thickness, and evidence indicates that choroidal macrophages play a key role in maintaining choroidal thickness. Nevertheless, the influence of choroidal macrophages on myopia remains unclear. Here, we found that continuous intraperitoneal injection of clodronate liposomes depletes choroidal macrophages and causes myopia, confirming that choroidal macrophages play a key role in the development of myopia. Then, based on the phenotypic characteristics of macrophages, experiments were designed to study the effects of different polarization directions of macrophages on the development of myopia. We found that injection of lipopolysaccharide (LPS) could induce polarization of choroidal M1 macrophages, leading to a thinning of the choroidal thickness and causing myopia. Conversely, injection of IL-4 or IL-13 induces polarization of choroidal M2 macrophages, thickening the choroid and inhibiting myopia progression. Furthermore, we demonstrated that the opposite effects of M1 and M2 macrophages on myopia progression may be related to their influence on choroidal thickness, inflammation, and oxidative stress responses. These findings establish the importance of choroidal macrophages in the development of myopia and provide a new strategy for myopia treatment.

[0012] That is, the present inventors have found that administration of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof is effective in preventing and treating myopia.

[0013] Furthermore, the present inventors discovered that polarization of macrophages in the choroid into M2 macrophages suppresses choroidal thinning and is effective in preventing and treating myopia.

[0014] In addition, mast cells are distributed in large numbers around small blood vessels, and their presence has been observed in the choroid, a tissue made up of blood vessels, suggesting their involvement in maintaining the morphology of the choroid. The present inventors have found that the progression of myopia is suppressed by instilling a drug (mast cell stabilizer) that inhibits the degranulation of mast cells. That is, the present inventors have found that the progression of myopia is suppressed by instilling a mast cell stabilizer (sodium cromoglycate, pemirolast potassium), a type of antiallergic drug, into a mouse model of myopia induced by wearing minus lenses. However, the inhibition of myopia progression was not observed when another antiallergic drug, an antihistamine (levocabastine), was instilled into mice undergoing myopia induction by wearing minus lenses.

[0015] Furthermore, it is known that administration of lactic acid bacteria such as Lactobacillus paracasei induces and activates polarization into M2 macrophages, and the present inventors have found that administration of lactic acid bacteria such as Lactobacillus paracasei inhibits the progression of myopia. Considering these findings, together with the findings of Non-Patent Documents 6 to 7 mentioned above, it is believed that if the choroidal structure (thickness) can be maintained by intervention targeting immune cells normally present in the choroid, it will have an inhibitory effect on the progression of myopia, and these findings suggest that a composition that targets immune cells present in the choroid, such as macrophages and mast cells, and induces the properties of each cell to an appropriate state will have an inhibitory effect on the progression of myopia. The present invention is based on such findings and includes the following aspects.

[0016] [Aspect 1] 1. A method for inhibiting, ameliorating or treating myopia, comprising administering to a subject in need of treatment a therapeutically effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. [Aspect 2] The method of embodiment 1, wherein berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, is contained in a pharmaceutical composition, a supplement, or a food product. [Aspect 3] The method of embodiment 1, wherein refractive loss, axial elongation, and / or choroidal thinning are inhibited. Aspect 4 A composition for inhibiting or treating myopia, comprising a therapeutically effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. Aspect 5 A supplement for inhibiting or improving myopia, comprising an effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. Aspect 6 A food for inhibiting or improving myopia, comprising an effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. Aspect 7 1. Use of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, in the manufacture of a medicament for inhibiting or treating myopia. Aspect 8 Use of berberine, taurine, or lipoic acid, or their salts, or derivatives thereof, for inhibiting or treating myopia. Aspect 9 An eye drop for inhibiting or treating myopia, comprising berberine, or a salt or derivative thereof, Eye drops administered 3 or more times a day. Aspect 10 The eye drop according to aspect 9, wherein the eye drop is administered in 1 to 3 drops at a time. Aspect 11 The eye drop according to aspect 9 or 10, wherein the content of berberine, or a salt thereof, or a derivative thereof in the eye drop (100 (w / v)%) is 0.005 to 0.025 (w / v)%. Aspect 12 12. The eye drop according to any one of aspects 9 to 11, which suppresses at least one selected from the group consisting of a decrease in refractive index, axial elongation, and choroidal thinning. Effect of the Invention

[0017] According to the present disclosure, a new method for preventing and treating myopia can be provided by administering berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof.In addition, according to the present disclosure, a new method for preventing and treating myopia can be provided by adjusting the function of choroidal resident immune cells, more specifically, by inducing polarization to M2 macrophages in the choroid, or by administering mast cell stabilizer, chemical mediator release inhibitor, or lactic acid bacteria. [Brief description of the drawings]

[0018] [Figure 1]Myopia is accompanied by a persistent decrease in macrophages present in the choroid of 3- and 8-week-old mice. (A) Three-week-old wild-type C57BL / 6JJc1 mice were injected once every 2 days with 0.1 ml / 10 g body weight of clodronate liposomes or control liposomes (n=12 per group). Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive and SD-OCT system at baseline and 8 days after four injections. (B) Compared with the control group, the clodronate liposome (Clolip)-injected group showed greater refractive change (P<0.001), axial ocular growth (P<0.01), and thinner choroid (P<0.001). Bars represent the mean + / - standard deviation. (C) The percentage of macrophages in the choroid was analyzed using flow cytometry. Macrophages were identified as CD11b+ and F4 / 80+ appearing in the H3-UR region. Compared with the control liposome-injected group, the percentage of macrophages in the clodronate liposome-injected group was significantly decreased (P < 0.05). (D) Eight-week-old wild-type C57BL / 6JJc1 mice (four per group unless otherwise indicated) were injected every 2 days with 0.1 ml / 10 g body weight of clodronate liposomes and control liposomes. Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive and SD-OCT system at baseline and 8 days after four injections. (E) Compared with the control group, the clodronate liposome (Clolip)-injected group showed significantly greater refractive change (P < 0.01), elongation of axial length (P < 0.05), and thinner choroid (P < 0.01). Bars represent the mean + / - standard deviation. Differences between groups were compared using t-test. *P<0.05. **P<0.01. ***P<0.001. [Diagram 2]Polarization of M1 macrophages in the choroid could induce myopia in a mouse model. (A) Three-week-old wild-type C57BL / 6JJc1 mice were divided into two groups (four per group unless otherwise indicated), one group was intraperitoneally injected with 10 μl / g LPS, and the other group was intraperitoneally injected with PBS. The injections lasted for 2 weeks, and refraction, axial length, and choroidal thickness were measured weekly with an infrared photorefractor and SD-OCT system. Choroidal blood perfusion was measured with OCTA. In addition, choroidal samples were collected for real-time PCR. (B) Compared with the PBS-injected group, the LPS-injected group showed significantly greater refractive changes (P<0.001), significant axial eye growth (P<0.001), and significantly thinner choroids (P<0.001). Bars represent the mean + / - standard deviation. (C) Choroidal blood perfusion was significantly decreased 2 weeks after LPS injection compared with the PBS-injected group. (D) The mRNA levels of TNF-α and IL-6 were significantly increased 2 weeks after LPS injection. P values ​​were obtained from t-test. *P<0.05. **P<0.01. ***P<0.001. [Diagram 3]Inhibition of myopia progression by polarization of choroidal M2 macrophages was demonstrated in a lens-induced myopia mouse model. Three-week-old wild-type C57BL / 6JJc1 mice were injected with 0.1 μg / 100 μl IL-4, and choroidal samples were collected at 0, 24, and 48 h after injection for flow cytometry and real-time PCR. (A) Macrophages in the H3-UR region were shown as CD11b+ and F4 / 80+. The percentage of macrophages was significantly increased after IL-4 injection (P<0.001). M2 macrophages in the Q2-UR were identified as CD206+. 48 h after IL-4 injection, M2 macrophages were dramatically polarized (P<0.05). (B) Real-time PCR results showed that the mRNA expression levels of Mrc1 and CD163 were significantly increased 48 h after IL-4 injection. (C) Three-week-old wild-type C57BL / 6JJc1 mice were divided into two groups and injected with 0.1 μg / 100 μl IL-4 or PBS every other day to induce myopia (four times per group unless otherwise indicated). Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive and SD-OCT system at the early (3 weeks of age) and final (6 weeks of age) stages of myopia induction. (D) Eyes treated with -30D lenses showed significantly greater refractive change (P<0.01), greater axial length elongation (P<0.05), and increased choroidal thickness (P<0.001) compared with eyes treated with 0D lenses from PBS-injected mice. Mice injected with 0.1 μg / 100 μl IL-4 showed significantly smaller refractive changes (P<0.05), smaller changes in axial length (P<0.05), and positive changes in choroidal thickness with statistical significance (P<0.001). Bars represent the mean + / - standard deviation. (E) To evaluate changes in choroidal blood perfusion, 3-week-old mice were divided into three groups: both eyes fitted with 0D lenses (control-0D group), binocular myopia induction (control-30D group), and binocular myopia induction by IL-4 injection once every 2 days group (IL-4-30D group). Choroidal blood perfusion was evaluated at the early (3 weeks of age) and end (6 weeks of age) stages of myopia induction using OCTA. Compared with the control-0D group, choroidal blood perfusion was significantly decreased in the control-30D group.Thus, choroidal blood perfusion was significantly improved in the IL-4-30D group compared with the control-30D group. (F) Mice used for measuring choroidal blood perfusion were euthanized at 6 weeks of age, and choroids were collected for flow cytometry. The results showed that mice treated with -30D lenses and injected with IL-4 had a significant proportion of M2 macrophages compared with mice treated with -30D lenses and injected with PBS. P values ​​correspond to comparisons made using one-way ANOVA. *P<0.05. **P<0.01. ***P<0.001. [Figure 4] Effect of macrophage polarization direction on oxidative stress response. (A) Experimental design to evaluate Nox2, Nox4, Mmp2, and Mmp9 mRNA expression in the choroid during M1 and M2 macrophage polarization. Three-week-old wild-type C57BL / 6JJc1 mice were injected with LPS to polarize M1 macrophages, IL-4 was injected into polarized M2 macrophages, and the control group was injected with PBS. For real-time PCR and ELISA experiments, choroidal samples were collected 24 h after LPS injection, 24 and 48 h after IL-4 injection, and after PBS injection. (B) Comparison of Nox2, Nox4, Mmp2, and Mmp9 mRNA expression in the choroid between the control and M1 macrophage polarization groups showed a significant increase in the LPS-injected group. (C) Quantitative PCR analysis of the choroid 48 h after IL-4 injection showed a corresponding decrease in the expression of Nox2, Mmp2, and Mmp9 mRNA, corresponding to M2 macrophage polarization. (D) ELISA analysis showed that choroidal 8-OHdG concentrations were decreased in the IL-4-injected group compared with the control group (P<0.01). Conversely, choroidal 8-OHdG concentrations were increased in the LPS-injected group compared with the IL-4-injected group (P<0.05). P values ​​indicate comparison with control, one-way ANOVA, or t-test. *P<0.05. **P<0.01. ***P<0.001. [Diagram 5]Administration of EPA inhibited the progression of myopia caused by LPS injection. Three-week-old wild-type C57BL / 6JJc1 mice were divided into three groups: control, LPS-injected, and LPS-administered with EPA (n=4). Changes in refraction, axial length, and choroidal thickness were measured after 3 weeks of feeding. (A) Compared with the large changes in refraction caused by LPS injection, the changes in refraction after EPA administration were smaller (P<0.01). (B) Compared with the increase in the ratio of axial length to body weight caused by LPS injection, EPA feeding decreased the ratio of axial length to body weight (P<0.001). (C) Choroidal thinning occurred in the LPS-injected group, but EPA administration significantly improved choroidal thickness (P<0.05). P values ​​indicate comparison with control using one-way ANOVA. *P<0.05. **P<0.01. ***P<0.001. [Figure 6]IL-13 injection inhibited myopia progression and increased choroidal blood perfusion in a mouse model of lens-induced myopia. (A) Choroidal samples were collected 48 h after IL-13 and PBS injections and subjected to flow cytometry analysis designed to evaluate the optimal time for M2 macrophage polarization. (B) Flow cytometry analysis demonstrated that both macrophage ratio and M2 macrophage ratio were significantly increased 48 h after IL-13 injection compared with the PBS-injected group. (C) Three-week-old mice were divided into three groups: a group fitted with 0D lenses in both eyes (control 0D group), a group in which binocular myopia was induced (control-30D group), and a group in which binocular myopia was induced and injected with IL-13 (IL-13-30D group). The frequency of IL-13 injection was once every two days. Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive and SD-OCT system at the early (3 weeks of age) and end (6 weeks of age) stages of myopia induction. (D) The Control-30D group showed significantly greater refractive change (P<0.001), greater axial length elongation (P<0.05), and thinner choroid (P<0.001) compared with the Control-0D group. The IL-13-30D group showed significantly smaller refractive change (P<0.001), smaller axial length change (P<0.05), and a positive change in choroidal thickness with statistical significance (P<0.001). Bars represent the mean + / - standard deviation. (E) Choroidal blood perfusion was measured using OCTA. Choroidal blood perfusion was significantly decreased in the Control-30D group compared with the Control-0D group. Correspondingly, choroidal blood perfusion was significantly improved in the IL-13-30D group compared with the Control-30D group. (F) The percentage of M2 macrophages in the choroid showed a significant increase in the IL-13-30D group compared with the Control-30D group. P values ​​indicate comparison with control by one-way ANOVA or t test. *P<0.05. **P<0.01. ***P<0.001. [Figure 7]Continuous berberine instillation can inhibit the progression of myopia in mice. Three-week-old wild-type C57BL / 6JJc1 mice were divided into control 0D group, control-30D group, 2% DMSO-30D group, and berberine-30D group (n=4). The instillation frequency of 2% DMSO and 0.26 mg / ml berberine was once a day. After 3 weeks of instillation, the changes in refraction, axial length, and choroidal thickness were measured using SD-OCT. (A) Compared with the control 0D group, refractive changes were observed in the control-30D group and the 2% DMSO group (P<0.001). Compared with the 2% DMSO group, smaller refractive changes were observed in the berberine-30D group (P<0.001). (B) The berberine-30D group showed a smaller axial length elongation (P<0.05) compared with that of the control-30D and 2% DMSO groups (P<0.05). (C) Choroidal thickness was decreased in the control-30D and 2% DMSO-30D groups compared with the control 0D group (P<0.001). Conversely, choroidal thickness was improved in the berberine-30D group compared with the 2% DMSO-30D group (P<0.001). P values ​​indicate comparison with control using one-way ANOVA. *P<0.05. **P<0.01. ***P<0.001. [Figure 8] 1 shows the results of myopia induction by LPS administration. (A) A diagram showing the experimental schedule. (B) Graphs showing changes in refractive index (left), axial length (center), and choroidal thickness (right). [Figure 9] 1 is a graph showing changes in the expression of M1 macrophage marker genes and oxidative stress-related genes by LPS administration. [Figure 10] 1 shows the results of M2 macrophage polarization induction by IL-4 administration. (A) A diagram showing the experimental schedule. (B) A graph showing changes in the expression of CD206 protein and phosphorylated STAT6 in the choroid by IL-4 administration. (C) A graph showing changes in the expression of CD163 and CD206 mRNA by IL-4 administration. [Figure 11]1 is a graph showing changes in the expression of M2 macrophage marker genes and oxidative stress-related genes by administration of IL-4. [Figure 12] 1 shows the results of an experiment to suppress myopia by administration of IL-4. (A) A diagram showing the experimental schedule. (B) A diagram showing the changes in refraction (left), axial length (center), and choroidal thickness (right) by administration of IL-4 during the myopia induction period. [Figure 13] IL-13 administration suppresses myopia and induces M2 macrophage polarization. (A) Experimental schedule. (B) Graphs showing changes in refraction (upper left), axial length (upper right), choroidal thickness (lower left), and blood flow (lower right) due to IL-13 administration during the myopia induction period. (C) Graphs showing changes in macrophage number and M2 macrophage ratio due to myopia induction and IL-13 administration. [Figure 14] These are results showing the myopia suppression effect of instilling mast cell stabilizer. (A) Graph showing the amount of change in axial length. (B) Graph showing the amount of change in refractive index. (C) Graph showing the amount of change in choroidal thickness. The left graph shows the control group vs. the pemirolast potassium instillation group, and the right graph shows the control group vs. the cromoglycic acid instillation group. *p<0.05, **p<0.01, ***p<0.001, student's t-test [Figure 15] Graphs comparing the myopia suppression effects of instilling a mast cell stabilizer with those of a histamine receptor inhibitor. (A) Graph showing the change in axial length. (B) Graph showing the change in refractive index. (C) Graph showing the change in choroidal thickness. From the left, the groups are the control group, the levocabastine instillation group (histamine receptor inhibitor), and the pemirolast potassium instillation group (mast cell stabilizer). *p<0.05, **p<0.01, ***p<0.001, student's t-test [Figure 16]These are results showing the effect of administering Lactobacillus paracasei in inhibiting the progression of myopia. (A) A graph showing the amount of change in axial length. (B) A graph showing the amount of change in refractive index. (C) A graph showing the amount of change in choroidal thickness. The left graph shows the control group, and the right graph shows the Lactobacillus paracasei-administered group. [Figure 17] Graphs showing the myopia suppression effect of administration of berberine chloride once a day or three times a day. (A) A diagram showing the experimental schedule. (B) A graph showing the refractive index and its change in the group with and without myopia induction. (C) A graph showing the axial length and its change in the group with and without myopia induction. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] The present invention will be described in detail below. The present invention is not limited to the following embodiments and examples, and includes various modifications and applications within the scope of the gist of the present invention.

[0020] [Method for preventing or treating myopia] As described above, in recent years, it has become clear that choroidal thinning is involved in the onset of myopia. As a result of extensive research into factors that control this thinning, the present inventors have found that changes in the state (polarization) of macrophages in the choroid cause changes in choroidal thickness, thereby controlling the progression of myopia. There are two types of macrophages: M1 macrophages and M2 macrophages. M1 macrophages are mainly involved in the initiation of inflammation, whereas M2 macrophages act antagonistically to terminate and suppress inflammation. The present inventors have found for the first time that choroidal thinning and myopia progression are observed by inducing polarization to M1 macrophages in the choroid, while choroidal thinning and myopia progression are suppressed by inducing polarization to M2 macrophages. In addition, mast cells are distributed in large numbers around small blood vessels, and their presence has been observed in the choroid, which is a tissue composed of blood vessels, suggesting their involvement in maintaining the morphology of the choroid. The present inventors have found that the progression of myopia is suppressed by instilling a drug (mast cell stabilizer) that inhibits the degranulation of mast cells. Furthermore, it is known that administration of lactic acid bacteria such as Lactobacillus paracasei induces and activates polarization into M2 macrophages, and the present inventors have found that administration of lactic acid bacteria such as Lactobacillus paracasei inhibits the progression of myopia. Thus, the present inventors have found that the progression of myopia can be inhibited by regulating the function of choroidal resident immune cells. Thus, one aspect of the present disclosure relates to methods for inhibiting, ameliorating or treating myopia by modulating the function of choroidal resident immune cells, more specifically, by polarizing macrophages into M2 macrophages in the choroid, or by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria. One aspect of the present disclosure relates to a method for inhibiting, ameliorating, or treating myopia by modulating the function of choroid-resident immune cells, more specifically, by inducing polarization to M2 macrophages in the choroid using an M2 macrophage polarization inducer, or by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria. One aspect of the present disclosure relates to a method for suppressing a decrease in refraction, elongation of the eye axis, and / or thinning of the choroid in a subject in need of treatment, more specifically, delivering an M2 macrophage polarization inducer to the choroid of the subject, or administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria. Also, one aspect of the present disclosure relates to a screening method for searching for a substance that regulates the function of choroidal resident immune cells, such as a component that promotes polarization to M2 macrophages, for controlling choroidal thinning, which is a mechanism of myopia onset, and a screening method for searching for a component effective for the prevention and treatment of myopia. One aspect of the present disclosure relates to a method for suppressing, improving, or treating myopia by administering berberine, taurine, lipoic acid, or a salt or derivative thereof.

[0021] <Substance for regulating the function of choroidal resident immune cells> A substance for regulating the function of choroidal resident immune cells is a substance that regulates the function of choroidal resident immune cells. Examples of substances that regulate the function of choroidal resident immune cells preferably include substances that regulate to suppress inflammation in the choroid and substances that regulate to make the choroid an anti-inflammatory environment. Examples of choroidal resident immune cells include macrophages, mast cells, and the like. Examples of substances for regulating the function of choroidal resident immune cells include M2 macrophage polarization inducers, mast cell stabilizers, chemical mediator release inhibitors, lactic acid bacteria, and the like.

[0022] <M2 macrophage polarization inducer> Macrophages are classified into inflammatory M1 macrophages and anti-inflammatory M2 macrophages with different functions, and they polarize in response to signals such as cytokines and stimulatory components to exhibit specific functions. Therefore, the M2 macrophage polarization inducer in the present disclosure includes various substances involved in signal transduction that induces polarization into M2 macrophages in the choroid, and proteins, peptides, nucleic acid drugs, low molecular weight compounds, high molecular weight compounds, etc. can be used without particular limitation. Examples of such substances include cytokines such as IL-4 and IL-13 produced by Th2 cells, as well as the leucine zipper transcription factor c-Maf, the carbohydrate-binding lectin galectin-3, etc. In addition, it is known that there are several populations of M2 macrophages, and in addition to the above-mentioned IL-4 and IL-13 that induce M2a macrophages, IL-10 and glucocorticoid hormones (GCs) involved in the induction of M2c macrophages, and TLR2, TLR4, TLR7, TLR9 and their ligands (ligands for TLRs) involved in the induction of M2d macrophages, etc., can also be listed as M2 macrophage polarization inducers in the present disclosure.

[0023] Examples of M2 macrophage polarization inducers in the present disclosure include various low molecular weight compounds, such as bisantrene dihydrochloride, triptolide, lovastatin, QS11, regorafenib, sorafenib, ixazomib, GW-843682X, KW 2449, axitinib, JTE 013, purmorphamine, arcyriaflavin A, dasatinib, NVP-LDE225, 1-naphthyl PP1, MGCD-265, and bosutinib.

[0024] Agonists of the above substances can also be used as M2 macrophage polarization inducers. Those skilled in the art can evaluate whether a substance has M2 macrophage polarization induction ability by culturing cells such as monocyte cell lines (e.g., RAW264 cells, J774 cells, U937 cells), mouse peritoneal macrophages, and bone marrow-derived macrophages in a medium containing the substance to be evaluated, and using an in vitro evaluation system for evaluating the expression of M2 macrophage markers, etc., to obtain M2 macrophage polarization inducers suitable for use in the methods and compositions of the present disclosure, in addition to the M2 macrophage polarization inducers specifically described in this specification.

[0025] When the M2 macrophage polarization inducer is a protein or peptide, it may be administered to the subject in the form of DNA or RNA encoding the protein or peptide. The nucleic acid encoding the M2 macrophage polarization inducer may be administered to the subject using a plasmid or an expression vector. The expression vector may be, for example, a viral vector, particularly an adenovirus vector, but is not limited thereto. Other usable viral vectors include, for example, retrovirus, adeno-associated virus, pox, baculovirus, vaccinia, herpes simplex, Epstein-Barr, geminivirus, and caulimovirus vectors. The nucleic acid encoding the M2 macrophage polarization inducer may contain a regulatory element for expressing the protein specifically in the choroid or RPE. That is, the nucleic acid encoding the M2 macrophage polarization inducer may be operably linked to a regulatory element such as a promoter or enhancer.

[0026] <Mast cell stabilizer> Mast cell stabilizers are also called mast cell stabilizers or mast cell stabilizing drugs. Mast cell stabilizers are, for example, drugs that suppress the release of allergens from mast cells, such as drugs that stabilize the cell membrane of mast cells to suppress the release of allergens from mast cells. Mast cell stabilizers include, for example, ashitazanolast hydrate solution (Zepelin), amlexanox (Elix), pemirolast potassium (Alegysal), pemirolast potassium (Pemilaston), cromoglycate sodium (Intal), tranilast (Rizaben), tranilast (Tramelas), ibudilast (Ketas), β2-adrenergic agonists, cromolyn sodium, cromoglycic acid, ketotifen, methylxanthine, omalizumab, pemirolast, and quercetin, and preferably cromoglycic acid or pemirolast or its salt.

[0027] <Chemical mediator release inhibitors> Chemical mediator release inhibitors are drugs that suppress allergic reactions by suppressing the release of chemical mediators from immune cells such as mast cells. For example, they are drugs that stabilize the cell membrane of mast cells to prevent histamine and other substances from being released, and they suppress the release of allergens (substances that cause allergic reactions) such as histamine, LTB4, LTC4, LTD4, PGD2, TXB2, and PAF from mast cells. Examples of chemical mediator release inhibitors include ashitazanolast hydrate solution (Zeperin), amlexanox (Elix), pemirolast potassium (Alegysal), pemirolast potassium (Pemilaston), sodium cromoglycate (Intal), tranilast (Rizaben), tranilast (Tramelas), ibudilast (Ketas), β2-adrenergic agonists, cromolyn sodium, cromoglycic acid, ketotifen, methylxanthine, omalizumab, pemirolast, and quercetin, and preferably, cromoglycic acid or pemirolast, or a salt thereof.

[0028] <Lactic acid bacteria> Examples of lactic acid bacteria include homolactic acid bacteria and heterolactic acid bacteria. Examples of lactic acid bacteria include coccoid lactobacilli and rod-shaped lactobacilli. Examples of lactic acid bacteria include gram-positive, rod-shaped or coccoid bacteria, non-spore forming, non-motile, producing 50% or more lactic acid relative to consumed glucose, and requiring niacin (B3). Examples of lactic acid bacteria include intestinal lactobacilli, animal lactobacilli, vegetable lactobacilli, and marine lactobacilli. Examples of lactic acid bacteria include lactobacilli of the order Lactobacillales and lactobacilli of the phylum Actinomycetes. Examples of lactic acid bacteria of the Lactobacillales include lactic acid bacteria of the genus Lactobacillus, lactic acid bacteria of the genus Enterococcus, lactic acid bacteria of the genus Lactococcus, lactic acid bacteria of the genus Pediococcus, lactic acid bacteria of the genus Leuconostoc, lactic acid bacteria of the genus Streptococcus, etc. Examples of lactic acid bacteria of the phylum Actinomycetes include lactic acid bacteria of the genus Bifidobacterium, etc. Examples of lactic acid bacteria of the genus Lactobacillus include Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus bulgaricus, Lactobacillus gasseri, Lactobacillus acidophilus, Lactobacillus fructivorans, Lactobacillus hilgardii, Lactobacillus rhamnosus, Lactobacillus plantarum, Lactobacillus casei Shirota, etc. Examples of lactic acid bacteria of the genus Enterococcus include Enterococcus faecalis and Enterococcus faecium, etc.Examples of lactic acid bacteria of the Lactococcus genus include Lactococcus lactis and Lactococcus cremoris. Examples of lactic acid bacteria of the Pediococcus genus include Pediococcus damnosus. Examples of lactic acid bacteria of the Leuconostoc genus include Leuconostoc mesenteroides. Examples of lactic acid bacteria of the Streptococcus genus include Streptococcus thermophiles and Streptococcus mutans. Examples of lactic acid bacteria of the Bifidobacterium genus include Bifidobacterium bifidum and Bifidobacterium adolescentis. It is known that administration of Lactobacillus paracasei improves the symptoms of non-alcoholic steatohepatitis by shifting the liver's Kupffer cells (resident macrophages) to M2 (Sohn et al, Dig Dis Sci, 2015 Nov;60(11):3340-50). It is known that administration of Lactobacillus paracasei activates M2 macrophages and alleviates retinal degeneration caused by blue light (Morita et al, Nutrients, 2018 Dec15;10(12):1991). It is known that administration of Lactobacillus plantarum alleviates colitis by promoting polarization from M1 macrophages to M2 macrophages (Jang et al, Int Immunopharmacol, 2014 Jul;21(1):186-92). It is known that administration of Lactobacillus brevis bacteria alleviates colitis by promoting polarization from M1 macrophages to M2 macrophages (Jang et al, J Appl Microbiol, 2013 Sep;115(3):888-96). Thus, it is known that administration of lactic acid bacteria of the order Lactobacillales, such as the genus Lactobacillus, induces and activates polarization to M2 macrophages. Therefore, the lactic acid bacteria is preferably lactic acid bacteria of the order Lactobacillales, such as the genus Lactobacillus.

[0029] <Berberine> Berberine is a benzylisoquinoline alkaloid found in plants such as Phellodendron amurense (Rutaceae) and Coptis japonica (Ranunculaceae), and has the following formula: [ka] Examples of berberine, its salts, or its derivatives include berberine chloride, berberine sulfate, berberine tannate, and the like.

[0030] <Taurine> Taurine is a substance with the structural formula H2N-CH2-CH2-SO3H. Taurine is also called aminoethylsulfonic acid. The IUPAC name for taurine is 2-aminoethanesulfonic acid. Taurine has the following formula: [ka] Examples of taurine, a salt thereof, or a derivative thereof include tauroursodeoxycholic acid, hypotaurine, phosphorylated tau protein, taurocholic acid (TCA), and thiotaurine (TTAU).

[0031] <Lipoic acid> Lipoic acid is an optically active organic compound that is an essential cofactor for many enzymes, an antioxidant, and contains a carboxyl group and a cyclic disulfide. The oxidized form of lipoic acid is β-lipoic acid, and the reduced form is dihydrolipoic acid. An example of lipoic acid is shown by the formula: [ka] Lipoic acid, or a salt or derivative thereof, includes α-lipoic acid, β-lipoic acid, dihydrolipoic acid, dextrolipoic acid, lipoic acid choline ester, and (R)-(+)-(7-hydroxy-2-oxo-2H-chromen-4-yl)methyl 5-(1,2-dithiolan-3-yl)pentanoate, which is represented by the following formula: [ka]

[0032] A DDS may be used to deliver a substance that modulates the function of choroid-resident immune cells, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, to the subject's choroid. For example, when the choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, is a nucleic acid, DNA or RNA (messenger RNA) encoding the choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, may be administered to a subject using a DDS such as a liposome. Other available DDSs include charged lipids, nucleic acid-protein complexes, and biopolymers. In addition, the choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, may be administered to a subject in the form of a protein. The administration may be performed, for example, by local administration to the choroid.

[0033] Delivery of a choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, to the subject's choroid may be performed by transplanting into the subject a cell that secretes a choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator, or berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. The cell that secretes a choroidal resident immune cell function regulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator, or berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, may be, for example, a retinal pigment epithelial cell (RPE). Alternatively, the cells may be genetically modified to secrete a substance that regulates the function of immune cells resident in the choroid, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator, or berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof.

[0034] The subject in the disclosed methods for inhibiting or treating myopia can be a mammal, including a human, or a non-human mammal, including a dog, a cat, a cow, or a horse, but is preferably a human.

[0035] [Composition for inhibiting or treating myopia] One aspect of the present disclosure relates to a composition for suppressing, improving or treating myopia using an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. More specifically, one aspect of the present disclosure relates to a composition for suppressing or treating myopia, comprising a therapeutically effective amount of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. Such compositions can be used to deliver M2 macrophage polarization inducers, mast cell stabilizers, choroidal resident immune cell function regulators such as chemical mediator release inhibitors, lactic acid bacteria, berberine, taurine, or lipoic acid, or salts thereof, or derivatives thereof, to the subject's choroid. Such compositions can be pharmaceutical compositions, foods, or supplements.

[0036] The pharmaceutical composition according to the present disclosure is administered, for example, locally to the eye. Examples of the administration form of the composition include eye drops (including eye ointment and eye wash), subconjunctival administration, intraconjunctival sac administration, and sub-Tenon administration.

[0037] The dosage form of the composition is not particularly limited, but examples thereof include eye drops, eye ointments, injections, patches, gels, inserts, etc., and eye drops are preferred. These can be prepared using conventional techniques commonly used in the art.

[0038] Eye drops can be prepared by selecting from isotonic agents such as sodium chloride, potassium chloride, and concentrated glycerin; buffering agents such as sodium phosphate, sodium acetate, and epsilon-aminocaproic acid; surfactants such as polyoxyethylene sorbitan monooleate, polyoxyl 40 stearate, and polyoxyethylene hydrogenated castor oil; stabilizers such as sodium citrate and sodium edetate; and preservatives such as parabens, as necessary, and the pH may be within the range acceptable for ophthalmic preparations, but is usually preferably within the range of 4 to 8. Eye ointments can be prepared using commonly used bases such as white petrolatum and liquid paraffin.

[0039] In addition, the pharmaceutical composition according to the present disclosure is not limited to administration to the eye, but can be administered by any administration route such as enteral administration (oral, tube, infusion, etc.), parenteral administration (intravenous, intraarterial, transdermal, intramuscular injection, etc.) etc. The dosage form of the composition used for these administration forms can be appropriately selected, and can be, for example, solid preparations such as tablets, granules, powders, capsules, chewable agents, etc., or liquid preparations such as liquids, syrups, injections, drips, etc. The pharmaceutical composition according to the present disclosure may contain other ingredients in appropriate amounts within the scope of not impairing the effects of the present invention. Examples of other ingredients include any carrier, buffer, diluent, excipient, suspending agent, lubricant, adjuvant, medium, delivery system, emulsifier, tablet disintegrant, absorbent, preservative, surfactant, colorant, flavoring, or sweetener. These ingredients may be used alone or in appropriate combination of two or more.

[0040] The content of the M2 macrophage polarization inducer, mast cell stabilizer, choroid-resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof in the pharmaceutical composition (100% by weight) can be appropriately set within the range of, for example, 0.001 to 99.99% by weight.

[0041] The dosage of the pharmaceutical composition according to the present disclosure is not particularly limited and can be appropriately selected depending on the dosage form, age, body weight, desired degree of effect, etc. The dosage of the M2 macrophage polarization inducer, mast cell stabilizer, choroid-resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, can be, for example, 100 to 1,000,000 nmol, preferably 150 to 100,000 nmol per day, and the administration frequency can be, for example, 1 to 100 times per month.

[0042] When the composition according to the present disclosure is an eye drop containing berberine, a salt thereof, or a derivative thereof, the content of berberine, a salt thereof, or a derivative thereof in the eye drop (100 (w / v)%) is preferably 0.005 to 0.025 (w / v)%, more preferably 0.012 to 0.025 (w / v)%, and even more preferably 0.025 (w / v)%, from the viewpoint of more effectively suppressing or treating myopia.

[0043] When the composition according to the present disclosure is an eye drop containing berberine, a salt thereof, or a derivative thereof, from the viewpoint of more effectively suppressing or treating myopia, the eye drop is preferably instilled three or more times a day, and more preferably instilled three to six times a day.

[0044] When the composition according to the present disclosure is an eye drop containing berberine, a salt thereof, or a derivative thereof, from the viewpoint of more effectively suppressing or treating myopia, the eye drop is preferably administered in an amount of one or more drops at a time, and more preferably one to three drops at a time.

[0045] When the composition according to the present disclosure is an eye drop containing berberine, or a salt thereof, or a derivative thereof, it is preferably administered for 3 weeks or more in order to more effectively suppress or treat myopia.

[0046] When the composition according to the present disclosure is an eye drop containing berberine, or a salt thereof, or a derivative thereof, it is preferably administered during the period of normal axial length elongation that occurs with growth, from the viewpoint of more effectively suppressing or treating myopia.

[0047] When the composition according to the present disclosure is an eye drop containing berberine, its salt, or its derivative, it is preferably for pediatric use in terms of more effectively suppressing or treating myopia. In the present disclosure, "children" refers to children under 15 years of age. In children, normal axial length elongation usually occurs as they grow.

[0048] The composition according to the present disclosure may be food or supplement. The form of food or supplement may be, for example, liquid, solid, tablet, granule, powder, capsule, paste, gel, etc., such as the above-mentioned solid or liquid preparations, etc., can be selected arbitrarily. Specific examples of food include, for example, various general processed foods such as fruit juice drinks, vegetable juices, soft drinks, tea, soups, puddings, yogurt, cake premix products, confectionery, cookies, candies, gummies, gums, etc., as well as special purpose foods, foods for specified health uses, nutritional functional foods, functional foods, nutritional supplements, health supplements, nutritional fortified foods, nutritionally adjusted foods, etc., such as supplements, drinks, etc.

[0049] The food or supplement according to the present disclosure may contain any functional ingredients (vitamins, minerals, etc.), any excipient, any additive (flavoring agent, sweetener, acidulant, colorant, thickener, binder, strengthening agent, disintegrant, buffer, surfactant, solubilizer, resorption promoter, dispersant, stabilizer, gelling agent, emulsifier, antioxidant, surfactant, preservative, moisture-proofing agent, pH adjuster, colorant, soothing agent, isotonicity agent, etc.).

[0050] One aspect of the present disclosure relates to the use of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, for suppressing or treating myopia. Furthermore, another aspect of the present disclosure relates to the use of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, in the manufacture of a medicament for suppressing or treating myopia.

[0051] [Screening method] One aspect of the present disclosure relates to a screening method for searching for a component that promotes polarization of macrophages into M2 macrophages in order to control choroidal thinning, which is a mechanism for the development of myopia, and a screening method for searching for a component that is effective in the prevention and treatment of myopia. In some embodiments, the screening method includes (i) administering a candidate substance to a model animal, and (ii) measuring the axial length, choroidal thickness, and refractive index in the model animal. In some embodiments, the screening method includes (i) administering a candidate substance to a model animal, and (ii) measuring the expression of a choroidal resident immune cell marker, such as an M2 macrophage marker, in a sample derived from the model animal. In some embodiments, the screening method further includes (iii) measuring the expression of a choroidal resident immune cell marker, such as an M1 macrophage marker. Also included in some embodiments are in vitro screening methods in which cells such as monocytic cell lines, such as RAW264 cells, J774 cells, and U937 cells, and choroid-resident immune cells, such as mouse peritoneal macrophages and bone marrow-derived macrophages, are cultured in a medium containing a candidate substance, and the expression of choroid-resident immune cell markers, such as the M2 macrophage marker, is evaluated. In some embodiments, the model animal can be an animal undergoing a myopia-inducing procedure. In some embodiments, the choroidal resident immune cell marker, such as the M2 macrophage marker, may be CD163, CD206, arginase, or IL-10. Methods for measuring choroidal resident immune cell markers, such as macrophage markers, include quantitative PCR, flow cytometry, immunostaining, luciferase assay, arginase activity staining, and the like.

[0052] Substances identified by such screening methods can be used to inhibit or treat myopia.

[0053] Although preferred embodiments of the present invention are shown herein, it will be apparent to those skilled in the art that such embodiments are provided for illustrative purposes only, and that various modifications, changes, and substitutions may be made by those skilled in the art without departing from the present invention. It should be understood that various alternative embodiments of the invention described herein may be used in practicing the present invention. In addition, the contents of all publications, including patents and patent applications, referenced in this specification should be construed as being incorporated by reference as if set forth herein. EXAMPLES

[0054] The present invention will now be described in more detail with reference to experimental examples.

[0055] Materials and Methods: mouse: The Ethics Committee on Animal Research at Keio University School of Medicine approved all procedures, which followed the Association for Research in Vision and Ophthalmology statement on the use of animals in ophthalmic and vision research, the Keio University Institutional Guidelines for Animal Experimentation, and the Reporting of Animal Experiments: In Vivo Experiments (ARRIVE) guidelines. Furthermore, the principle of random allocation was implemented in this study. Wild-type male C57BL / 6J mice were provided by CLEA Japan Co., Ltd. These mice were housed in standard transparent mouse cages (29 × 18 × 13 cm), four or five per cage, in a pathogen-free environment maintained at 23 ± 3 °C, under background fluorescent lighting of approximately 50 lux (color temperature: 5000 K), with a diurnal cycle of 12 h, and with regular chow (MF, Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water available at all times. All animals were randomly assigned.

[0056] LIM Mouse Model: The mouse LIM model was created as previously described [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific reports 8, 1-12 (2018)]. Briefly, mice were placed under general anesthesia using a mixture of midazolam (Sandoz KK, Tokyo, Japan), medetomidine (Domitor®, Orion Corporation, Espoo, Finland), and butorphanol tartrate (MMB) (Meiji Seika Pharma Co., Ltd., Tokyo, Japan). Eyeglass frames were designed to fit the contours of the mouse head and printed with a 3D printer. For myopia induction, a negative 30D lens was constructed using polymethyl methacrylate (PMMA). The left and right eyes of the glasses were screwed onto a stick, a joint that was adjusted to the shape of the frame on the mouse skull and could be removed for repositioning the left and right frames or for cleaning. The stick was subsequently glued to the mouse skull using a self-curing dental adhesive system. Induction began once the mice had fully recovered from anesthesia, and the lenses were removed for cleaning at least twice weekly.

[0057] Refraction, axial length, and choroidal thickness measurements: Refraction was measured using an infrared photorefractor (Steinbeis Transfer Center, Stuttgart, Baden-Württemberg, Germany) as previously reported [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific reports 8, 1-12 (2018)]. After measuring refraction, axial length and choroidal thickness were measured using an SD-OCT system (Envisu R4310, Leica Microsystems, Wetzlar, Germany). For each mouse, measurements of refraction, axial length, and choroidal thickness were performed before the start of LIM (0W) and at the end of LIM (3W). Before measurements, mouse eyes were treated with mydriatic eye drops containing 0.5% tropicamide and 0.5% phenylephrine (Santen Pharmaceutical Co., Ltd., Osaka, Japan) to ensure pupil dilation and cycloplegia. After pupil dilation, mice were subjected to general anesthesia using MMB. It is important to prevent the occurrence of corneal damage during the measurements. Axial length was measured as the perpendicular distance from the anterior corneal surface to the retinal pigment epithelium layer near the optic nerve [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific reports 8, 1-12 (2018)]. Choroidal thickness was determined by quantifying the circular area of ​​the disc at the posterior surface of the choroid using ImageJ software [Dysli, C., Enzmann, V., Sznitman, R. & Zinkernagel, MS Quantitative analysis of mouse retinal layers using automated segmentation of spectral domain optical coherence tomography images. Translational vision science & technology 4, 9-9 (2015)].

[0058] Measurement of choroidal blood perfusion: Choroidal blood perfusion was measured at the beginning (3 weeks after birth) and end (6 weeks after birth) stages of myopia induction using a SS-OCT / OCTA device (XEPHILIO OCT-S1, Canon Medical Systems, Tokyo, Japan). The measurement method was described in a previous report [Hou, J. et al. Ginkgo biloba extracts improve choroidal circulation leading to suppression of myopia in mice. Scientific Reports 13, 3772 (2023)]. Briefly, mice were dilated under general anesthesia before measurement, as in the case of refraction measurement. Choroidal blood perfusion was measured using en face angiography to identify the optic nerve as the central region. Choroidal blood perfusion signals were obtained from B-scan images at the corresponding positions. In the B-scan images, the areas covered by red noise points were areas without blood perfusion. ImageJ quantitative analysis was used to calculate the non-blood perfused area in the choroid and evaluate the percentage of the area with blood perfusion in the choroid.

[0059] Flow cytometry: Mice were administered an overdose of MMB to induce deep anesthesia before being euthanized by cervical dislocation. Eyes were immediately enucleated, and the anterior segment, vitreous, and retina were discarded. Choroidal tissues were carefully scraped off from the sclera-choroid complex and collected in tubes (10 choroidal tissues / tube), then treated with digestion buffer (0.75 mg / ml collagenase A, Fujifilm, Tokyo, Japan) in complete Dulbecco's Modified Eagle Medium (DMEM) solution at 37°C for 45 min. The digested choroidal mixture was transferred onto a cell strainer, and 5 ml of cold complete DMEM was added to pass the cells into a new 50 ml tube under the strainer, while the undigested choroidal pieces were crushed using the end of a syringe plunger. The aggregated choroidal cells were dissociated into a single cell suspension by differential centrifugation. The cells were washed by adding 700 μl of flow cytometry staining (FACS) buffer (80 μl of 0.5 mol / L ethylenediaminetetraacetic acid (EDTA) and 0.1 g of bovine serum albumin (BSA) in 20 ml of PBS (pH 7.4) solution) to the cell suspension. The pellet was resuspended in 10 μl of Fc block solution (1:10 Fc block) (BD Biosciences, NJ, USA) for 10 min and stained with a mixture of fluorochrome-conjugated antibodies (1:200 FITC anti-mouse / human CD11b M1 / 70, BioLegend, CA, USA), (1:200 APC / Cyanine7 anti-mouse F4 / 80, BioLegend, CA, USA), (1:200 CD206, AbD Serotec, Kidlington, near Oxford, UK) for at least 45 min and finally covered with 0.1 mg / ml Hoechst (DOJINDO, Amsterdam, Netherlands) for 10 min. All incubations were performed on ice and away from light. Data were acquired on a CytoFLEX S flow cytometer using CytExpert software (Beckman Coulter Life Sciences, Inc., IN, USA) and offline data analysis was performed using CyExpert software.

[0060] Clodronate Liposome Treatment: Clodronate liposomes (Liposoma BV, Amsterdam, The Netherlands) were injected intraperitoneally at a dose of 0.10 ml / 10 g (once every 2 days) into C57BL / 6J mice from P21 to P28 or from P56 to P63. Control groups were injected with an equal volume of PBS liposomes as above. Refraction, axial length, and choroidal thickness were measured before and after the four injections. Mice were then euthanized and choroidal samples were collected.

[0061] LPS treatment: Lipopolysaccharide derived from Escherichia coli O111:B4 (Merck, Tokyo, Japan) was dissolved in PBS and injected intraperitoneally to induce systemic M1 macrophage polarization. The concentration of LPS was 10 mg / ml, and the injection dose was increased proportionally to the mouse body weight, giving 10 μg of LPS per gram of mouse. Because LPS injections caused a significant decrease in mouse body weight, the body weight of the mice was monitored and recorded before each injection. In addition, a corresponding volume of PBS was injected intraperitoneally as a vehicle control.

[0062] EPA Administration: EPA-supplemented diet containing 5% EPA (EPADEL®, Mochida Pharmaceutical Co., Ltd., Tokyo, Japan) and normal diet were prepared as previously reported [Mori, K. et al. Lipidomic analysis revealed n-3 polyunsaturated fatty acids suppressed choroidal thinning and myopia progression in mice. The FASEB Journal 36, e22312 (2022)]. Briefly, EPA ethyl ester was mixed with powdered normal diet and tap water was added. The mixture was formed into small cylindrical shapes, dried and consumed. Feeding with the EPA-mixed diet began with the induction of myopia and ended with the induction of myopia.

[0063] IL-4 / IL-13 treatment: To induce systemic M2 macrophage polarization, recombinant mouse IL-4 (214-14) and IL-13 (210-13) (PeproTech, New Jersey, USA) were dissolved in PBS at the same concentration of 0.1 μg / 100 μl and injected intraperitoneally into mice once every 2 days. The control group received the same volume of PBS intraperitoneally. Injections were administered during the induction of myopia. Body weight was measured and recorded before each injection to ensure that the mice were growing normally.

[0064] Berberine chloride eye drops: Berberine chloride hydrate (TCI, Tokyo, Japan) solution was freshly prepared in DMSO. The concentration of berberine chloride eye drops was measured and found to be insoluble in water at room temperature. Dissolution was attempted using 100% DMSO and found to be approximately 13mg / ml in 100% DMSO at room temperature. Currently, the concentration of berberine chloride eye drops is 0.26mg / ml. In addition, DMSO, a dissolution vector, has been reported to exert cytotoxic effects at certain concentrations. Therefore, to check for solvent toxicity, an untreated control group should be included along with the DMSO solvent control [Galvao, J. et al. Unexpected low‐dose toxicity of the universal solvent DMSO. The FASEB Journal 28, 1317-1330 (2014)]. In order to maintain the concentration of berberine chloride hydrate at 0.26 mg / ml and to reduce the concentration of DMSO as much as possible, the final concentration of berberine chloride eye drops was 0.26 mg / ml, dissolved in 2% DMSO. In addition, a parallel control group of 2% DMSO was also set up in mice to observe its effect on myopia.

[0065] Real-time quantitative PCR (qPCR): After mice were euthanized, the eyes were immediately enucleated to harvest retinal, choroidal, and scleral tissues, which were then frozen in liquid nitrogen and stored at −80°C for later use. Mouse total RNA was extracted from retinal, choroidal, and scleral tissues using TRIzol (TRI Reagent) (MOR, Miami, FL, USA #TR118). Small RNAs were isolated using RWT (QIAGEN, Hilden, Germany, #1067933) and RPE buffer (QIAGEN, Hilden, Germany, #1018013). RNA samples were dissolved in RNase-free water (TAKARA HOLDINGS Inc., Kyoto, Japan, 9012) and measured with a spectrophotometer (NanoDrop; Thermo Fisher Scientific, Waltham, MA, USA). The extracted RNA was converted to cDNA via RNA denaturation, DNase reaction, and reverse transcription according to the manufacturer's instructions. mRNA gene expression was determined using SYBR Green RT-PCR on cDNA templates, and PCR was performed using a StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). The mRNA expression of each gene was assessed using the comparative Ct (ΔΔCT) method and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression, used as a reference gene. The qPCR primer sequences are as follows: Mouse Il6 forward: CTACCCCAATTTCCAATGCT (SEQ ID NO: 1) Mouse Il6 reverse: ACCACAGTGAGGAATGTCCA (SEQ ID NO: 2) Mouse Tnfa forward: CTGTAGCCCACGTCGTAGC (SEQ ID NO: 3) Mouse Tnfa reverse: TTGAGATCCATGCCGTTG (SEQ ID NO: 4) Mouse Mrc1 forward: TCGAGACTGCTGCTGAGTCCA (SEQ ID NO: 5) Mouse Mrc1 reverse: AGACAGGATTGTCGTTCAACCAAAG (SEQ ID NO: 6) Mouse Nox2 forward: ACTCCTTGGAGCACTGG (SEQ ID NO: 7) Mouse Nox2 reverse: GTTCCTGTCCAGTTGTCTTCG (SEQ ID NO: 8) Mouse Nox4 forward: TGAACTACAGTGAAGATTTCCTTGAAC (SEQ ID NO: 9) Mouse Nox4 reverse: GACACCCGTCAGACCAGGAA (SEQ ID NO: 10) Mouse Mmp2 forward: CAAGTTCCCCGGCGAT (SEQ ID NO: 11) Mouse Mmp2 reverse: TTCTGGTCAAGGTCAC (SEQ ID NO: 12) Mouse Mmp9 forward: GGACCCGAAGCGGACA (SEQ ID NO: 13) Mouse Mmp9 reverse: CGTCGTCGAAATGGGC (SEQ ID NO: 14) Mouse GAPDH forward: AGGAGCGAGACCCCACTAAC (SEQ ID NO: 15) Mouse GAPDH reverse: GATGACCCTTTTGGCTCCAC (SEQ ID NO: 16)

[0066] 8-OHdG ELISA: To evaluate oxidative stress, the levels of 8-oxo-2'-deoxyguanosine (8-OHdG) in choroidal tissues were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions (Uscn Life Science, Wuhan, China). Because this assay uses a competitive inhibition enzyme immunoassay technique, the concentration of 8-OHdG in the samples and the assay signal intensity were inversely correlated. The concentration of 8-OHdG in each sample was calculated using a standard curve generated from standard proteins and was calculated and analyzed using Boster's ELISA Online Calculator.

[0067] Statistical analysis: In our study, independent t-tests and one-way analysis of variance (ANOVA) were used for statistical significance analysis of all data (Microsoft Excel 2003, USA). All results are presented as mean standard deviation (SD), and results with P value < 0.05 were considered statistically significant.

[0068] Study Approval: All procedures were approved by the Keio University Animal Care Committee (approval number: 16017). All methods and experimental protocols conformed to the National Institutes of Health (NIH) guidelines for working with laboratory animals and the ARVO Animal Statement for the Use of Animals in Ophthalmic and Vision Research.

[0069] result: Example 1 Chronic intraperitoneal injection of clodronate liposomes may deplete choroidal macrophages and induce myopia: It has previously been reported that choroid-resident macrophages positively influence choroidal thickness and maintain vascular integrity [Yang, X. et al. CSF1R blockade induces macrophage ablation and results in mouse choroidal vascular atrophy and RPE disorganization. Elife 9, e55564 (2020)]. In contrast, a series of animal models have demonstrated that choroidal thinning is an inevitable change in the development of experimental myopia and a prominent feature in the development of myopia [Liu, Y., Wang, L., Xu, Y., Pang, Z. & Mu, G. The influence of the choroid on the onset and development of myopia: from perspectives of choroidal thickness and blood flow. Acta Ophthalmologica 99, 730-738 (2021);Zhang, S. et al. Changes in choroidal thickness and choroidal blood perfusion in guinea pig myopia. Investigative Ophthalmology & Visual Science 60, 3074-3083 (2019);Hung, L.-F., Wallman, J. & Smith, EL Vision-dependent changes in the choroidal thickness of macaque monkeys. Investigative Ophthalmology & Visual Science 41, 1259-1269 (2000);NICKLA, DL, WILDSOET, C. & WALLMAN, J. Visual influences on diurnal rhythms in ocular length and choroidal thickness in chick eyes.Experimental eye research 66, 163-181 (1998);Read, SA, Alonso-Caneiro, D., Vincent, SJ & Collins, MJ Longitudinal changes in choroidal thickness and eye growth in childhood. Investigative ophthalmology & visual science 56, 3103-3112 (2015)]. To investigate the influence of choroidal resident macrophages on myopia in a mouse model, 3-week-old C57BL / 6J mice were randomly divided into two groups and intraperitoneally injected with clodronate or phosphate-buffered saline (PBS) liposomes. In the clodronate liposome group, after being taken up by macrophages, the clodronate liposomes were degraded by lysosomal phospholipase, and clodronate was released into macrophages to induce apoptosis, thereby promoting macrophage depletion [Weisser, SB, van Rooijen, N. & Sly, LM Depletion and reconstitution of macrophages in mice. JoVE (Journal of Visualized Experiments), e4105 (2012)]. The injection volume of clodronate liposomes was 0.1 ml per 10 g of mouse, and the injection frequency was once every 2 days. Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive and spectral domain optical coherence tomography (SD-OCT) system before and 8 days after injection, respectively (Figure 1A). Mice injected with clodronate liposomes showed a higher refractive shift (-7.30±3.61D vs. +1.17±4.40D, P<0.001), elongation of axial length (0.08±0.02mm vs. 0.05±0.02mm, P<0.01), and a thinner choroid (-1.56±0.89mm vs. 1.09±0.51mm, P<0.01) compared to the PBS liposome-injected group.001) (Figure 1B). Flow cytometry analysis of the percentage of choroidal resident macrophages showed a corresponding decrease 8 days after clodronate liposome injection compared to the control group (2.583 ± 0.002% vs. 9.290 ± 0.018%, P < 0.05) (Figure 1C). These results indicated that clodronate liposome injection depletes resident macrophages in the choroid, promotes choroidal thinning, and induces myopia in 3-week-old mice. Previous studies have shown that the thickness of the choroid in mice does not increase after about 8 weeks of age and tends to stabilize [Zhang, Y. et al. Vascular endothelial growth factor from retinal pigment epithelium is essential in choriocapillaris and axial length maintenance. PNAS Nexus 1, pgac166 (2022)]. However, it remains to be elucidated whether the reduction of choroidal macrophages in adult mice also contributes to myopia. To exclude the possibility that the depletion of choroidal macrophages causes myopia independent of the developmental stage of choroidal thickness, 8-week-old adult mice were injected with clodronate liposomes or PBS liposomes in a similar manner and the changes in refraction, axial length, and retinal thickness were observed. The choroidal thickness was analyzed 8 days later (Figure 1D). Intraperitoneal injection of clodronate liposomes significantly reduced body weight while consuming resident macrophages, which affects the comparison of changes in axial length. To avoid the effect of changes in body weight on axial length, the changes in axial length were expressed using the ratio of axial length to body weight. The clodronate liposome-injected group had a larger refractive shift (-7.52±2.57D vs. +1.52±4.91D, P<0.01), a larger axial length / weight (0.168±0.015mm / g vs. 0.155±0.002mm / g, P<0.05), and a thinner choroid (-2.39±1.33mm vs. -0.12±1.48mm, P<0.05) compared with the PBS liposome-injected group.01) was observed (Figure 1E), suggesting that clodronate liposome injection causes depletion of choroidal resident macrophages and choroidal thinning, which leads to myopia regardless of whether the choroid is developed or not.

[0070] Example 2 Continuous intraperitoneal injections of LPS stimulate polarization of choroidal M1 macrophages and induce myopia in a mouse model: Based on their activation status and function, macrophages are classified into two categories, M1 type (classically activated macrophages) and M2 type (alternatively activated macrophages), which exhibit pro-inflammatory and anti-inflammatory properties, respectively [Mosser, DM & Edwards, JP Exploring the full spectrum of macrophage activation. Nature reviews immunology 8, 958-969 (2008)]. Because upregulation of allergic inflammation is implicated in the progression of myopia in animal models [Wei, C.-C. et al. Allergic conjunctivitis-induced retinal inflammation promotes myopia progression. EBioMedicine 28, 274-286 (2018)], we investigated whether M1 macrophage polarization could induce myopia in a mouse model. Mice were divided into LPS (10 mg / ml)-injected and PBS-injected groups for daily intraperitoneal injection. To determine whether myopia had progressed, refraction, axial length, and choroidal thickness were measured using SD-OCT before injection, 1 week after injection, and 2 weeks after injection (Figure 2A). One week after LPS injection, LPS-injected mice showed refractive changes (-9.21 ± 5.91 D vs. +2.91 ± 3.91 D, P < 0.001), increased axial length / weight (0.28 ± 0.01 mm / g vs. 0.22 ± 0.005 mm / g, P < 0.001), and choroidal thinning (-1.11 ± 0.90 mm vs. 1.36 ± 0.70 mm, P < 0.001) when compared with mice injected with PBS for 1 week. Injections were continued through the end of the 2-week period, and mice injected with LPS maintained significantly greater refractive change (-7.23 ± 4.36 D vs. +8.41 ± 7.01 D, P < 0.001), increased axial length to body weight ratio (0.20 ± 0.005 mm / g vs. 0.17 ± 0.004 mm / g, P < 0.01), and choroidal thinning (-1.77 ± 1.02 mm vs. 2.05 ± 0.66 mm, P < 0.001) compared to mice injected with PBS (Figure 2B).Choroidal blood perfusion was measured by optical coherence tomography angiography (OCTA), and the results showed that the choroidal blood perfusion in mice injected with LPS for 2 weeks was decreased compared to that in mice injected with PBS (37.36 ± 3.74% area vs. 46.79 ± 4.74% area, P < 0.001) (Figure 2C). These data indicate that intraperitoneal injection of LPS can induce myopia in a mouse model. Choroidal samples were collected for real-time polymerase chain reaction (PCR) analysis to verify the polarization of M1 macrophages in the choroid stimulated by intraperitoneal injection of LPS. The expression levels of the proinflammatory cytokines Tnf and Il6 were significantly upregulated in LPS-injected choroidal samples compared to PBS-injected choroidal samples (Figure 2D). These data indicate that intraperitoneal injection of LPS polarizes choroidal M1 macrophages, promotes the release of inflammatory cytokines, and induces myopia in mouse models. As reported in LPS-treated macrophages, the secretion of proinflammatory cytokines (TNFA and IL6) was significantly attenuated by eicosapentaenoic acid (EPA), which inhibits myopia progression [Mullen, A., Loscher, CE & Roche, HM Anti-inflammatory effects of EPA and DHA are dependent upon time and dose-response elements associated with LPS stimulation in THP-1-derived macrophages. The Journal of nutritional biochemistry 21, 444-450 (2010);Mori, K. et al. Lipidomic analysis revealed n‐3 polyunsaturated fatty acids suppressed choroidal thinning and myopia progression in mice. The FASEB Journal 36, e22312 (2022)].Therefore, an experiment was designed to administer EPA diet to LPS-induced myopic mice, and it was found that myopia did not progress (Figure 5A, B, C). Taken together, these data suggest that the LPS-induced phenotypic switch to M1 macrophages is associated with the development of myopia.

[0071] Example 3 Continuous intraperitoneal injection of IL-4 / IL-13 promoted polarization of choroidal M2 macrophages and inhibited myopia progression in a mouse model of LIM: We found that intraperitoneal injection of LPS enhanced the expression of proinflammatory cytokines in the choroid and promoted myopia progression. Conversely, polarization of choroidal M2 macrophages should suppress myopia progression. Previous studies have demonstrated that IL-4 and IL-13, as anti-inflammatory interleukins, can directly activate M2 macrophages, which can be identified by the expression of M2 macrophage markers such as CD206 and mannose receptor 1 (Mrc1), also known as CD163 [Yao, Y., Xu, X.-H. & Jin, L. Macrophage polarization in physiological and pathological pregnancy. Frontiers in immunology 10, 792 (2019)]. Notably, to investigate the frequency of continuous IL-4 injection, we compared the percentage of M2 macrophages in the choroid at 0 h, 24 h, and 48 h after intraperitoneal injection of 0.1 μg / 100 μl IL-4. F4 / 80 and CD11b positive cells were considered as macrophages, and CD206 was used as a marker to identify M2 macrophages. Flow cytometry analysis showed an increase in the proportion of macrophages (6.73 ± 0.22% vs. 3.78 ± 0.41%, P < 0.001) and M2 macrophages (43.57 ± 4.72% vs. 30.33 ± 8.35%, P < 0.05) 48 h after IL-4 intraperitoneal injection compared with 0 h (Figure 3A). Real-time PCR detection after IL-4 injection under the same conditions showed that Mrc1 and CD163 mRNA expression in the choroid was enhanced 48 h after IL-4 injection (Figure 3B). These results indicated that the optimal frequency of IL-4 injection was once every 2 days. We next investigated whether promoting M2 macrophage polarization by alternate-day IL-4 injections could suppress myopia progression in the LIM mouse model. All 3-week-old mice were subjected to LIM in the same manner as previously established and received PBS or 0.1 μg / 100 μl IL-4 injections until 6 weeks of age (Figure 3C).In the PBS-injected group, eyes treated with -30 diopter (D) lenses showed greater refractive changes (-11.52 ± 4.91 D vs. +12.45 ± 8.19 D, P < 0.01), increased axial length (0.22 ± 0.01 mm vs. 0.18 ± 0.01 mm / g, P < 0.05), and decreased choroidal thickness (-1.74 ± 0.66 mm vs. 3.91 ± 0.95 mm, P < 0.001) compared with eyes treated with 0 D lenses. In contrast, the IL-4-injected group showed less choroidal thickening (1.39 ± 0.19 mm vs. -1.74 ± 0.66 mm, P < 0.001), less axial elongation (0.19 ± 0.01 mm vs. 0.22 ± 0.01 mm / g, P < 0.05), and less refractive change (-1.39 ± 2.91 D vs. -11.52 ± 4.91 D, P < 0.05) in eyes with -30D lenses when compared with the PBS-injected group with -30D lenses (Figure 3D). Meanwhile, to demonstrate the effect of continuous IL-4 injection on choroidal blood perfusion, 3-week-old mice were divided into three groups: control-0D group (both eyes treated with 0D lenses), control-30D group (bilateral myopia induction), and IL-4-30D group (bilateral myopia induction by IL-4 injection once every 2 days). Using OCTA, choroidal blood perfusion was measured at the beginning (3 weeks after birth) and end (6 weeks after birth). The results showed that 3 weeks after myopia induction, choroidal blood perfusion was lower compared to the control-0D group (8.59 ± 5.90% area vs. -6.29 ± 8.73% area, P < 0.01). Nevertheless, choroidal blood perfusion was improved in the IL4-30D group compared to the control-30D group (-6.29 ± 8.73% area vs. 1.54 ± 9.34% area, P < 0.05) (Figure 3E). To visualize M2 macrophage polarization, choroidal samples were collected for flow cytometry after measuring choroidal blood perfusion at the end stage, and data analysis revealed a corresponding increase in the percentage of M2 macrophages in the IL-4-injected group with -30D lenses compared to the PBS-injected group with -30D lenses (46.52 ± 0.05% vs. 35.71 ± 0.06%, P < 0.05) (Figure 3F).Taken together, these findings indicate that IL-4 injection can inhibit the development of myopia by stimulating the polarization of M2 macrophages in the choroid and improving choroidal blood perfusion in the LIM mouse model. To reinforce the conclusion that M2 macrophages can inhibit myopia progression, we performed the same experiment using 0.1 μg / 100 μl IL13 injection instead of IL-4 injection, and the results also showed that M2 macrophages were polarized 48 h after IL-13 injection (Figure 6A, B). The results of the LIM mouse model combined with IL-13 injection were as expected. IL-13 also polarized M2 macrophages, inhibited myopia progression, and improved choroidal blood perfusion in the mouse model of LIM (Figure 6C, D, E, F).

[0072] Example 4: Berberine eye drops polarize M2 macrophages and inhibit myopia progression with continued use: Realizing that M2 macrophage polarization may suppress myopia progression, we used an M2 macrophage activating drug as an eye drop to examine its effect on myopia progression. Several studies have shown that berberine promotes the polarization of M1 macrophages to M2 anti-inflammatory phenotype in mice [Lin, J. et al. Berberine, a traditional Chinese medicine, reduces inflammation in adipose tissue, polarizes M2 macrophages, and increases energy expenditure in mice fed a high-fat diet. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research 25, 87 (2019);WANG, Q.-Z. et al. Berberine promotes M1 proinflammatory phenotype to M2 anti-inflammatory phenotype polarization in macrophage cell line RAW264. 7. Basic & Clinical Medicine 39, 646 (2019)]. To examine the role of berberine eye drops in the progression of myopia, we examined and compared the changes in refraction, axial length, and choroidal thickness after 3 weeks of myopia induction and administration of either berberine or dimethyl sulfoxide (DMSO) eye drops in 3-week-old C57BL / 6J mice.The control-30D group (wearing -30D lenses in both eyes) and the 2% DMSO-30D group (inducing bilateral myopia by daily application of 2% DMSO eye drops) showed greater refractive changes (P<0.001), increased axial length elongation (P<0.05), and decreased choroidal thickness (P<0.001) compared with the control 0D group (wearing 0D lenses in both eyes).Furthermore, the berberine-30D group (bilateral myopia induced by daily 0.26 mg / ml eye drops) had smaller refractive index changes (2.12 ± 1.63 D vs. -5.25 ± 2.89 D, P < 0.001), smaller axial elongation (0.19 ± 0.02 mm vs. 0.22 ± 0.04 mm / g, P < 0.05), and a relatively thicker choroid (0.79 ± 0.64 mm vs. -1.56 ± 0.76 mm, P < 0.001) compared with the 2% DMSO-30D group. These results indicate that drugs used to activate M2 macrophage polarization may inhibit the development of myopia (Figure 7A, B, C).

[0073] Example 5 Effects of LPS and IL-4 injection on Nicotinamide Adenine Dinucleotide Phosphate (NADPH) Oxidation Activity: We speculated that the direction of macrophage polarization may affect the development or suppression of myopia through its pro- or anti-inflammatory properties. However, other mechanisms underlying this association remain largely unknown. LPS-treated M1 macrophages are associated with high levels of reactive oxygen and nitrogen species (ROS and RNS, respectively) and matrix metalloproteinase (MMP) activity, and ROS production is important for M1 macrophage activation and function [Virag, L., Jaen, RI, Regdon, Z., Bosca, L. & Prieto, P. Self-defense of macrophages against oxidative injury: Fighting for their own survival. Redox Biology 26, 101261 ​​(2019);Covarrubias, A., Byles, V. & Horng, T. ROS sets the stage for macrophage differentiation. Cell research 23, 984-985 (2013)]. Similarly, overproduction of ROS may impair blood perfusion to the retina, and circulatory disturbances during myopia progression may lead to oxidative stress [Coviltir, V. et al. Update on myopia risk factors and microenvironmental changes. Journal of ophthalmology 2019 (2019);Francisco, B.-M., Salvador, M. & Amparo, N. Oxidative stress in myopia. Oxidative Medicine and Cellular Longevity 2015 (2015)].To investigate whether M1 macrophage polarization also induces myopia by promoting ROS and oxidative stress responses, and whether M2 macrophage polarization suppresses myopia progression by inhibiting ROS release and oxidative stress responses, the most important mRNA expression of NADPH oxidase 2 (Nox2) was examined, and the expression of Nox4, Mmp2, and Mmp9 in the choroid was observed after LPS or IL-4 injection (Figure 4A). Quantitative analysis showed increased Nox2, Nox4, Mmp2, and Mmp9 mRNA expression in the LPS-injected group compared with the PBS-injected group (Figure 4B). In contrast, 48 h after IL-4 injection, mice showed decreased Nox2, Mmp2, and Mmp9 mRNA expression (Figure 4C). Because 8-hydroxy-2-deoxyguanosine (8-OHdG) is a valid marker for assessing oxidative DNA damage [Halliwell, B. Why and how should we measure oxidative DNA damage in nutritional studies? How far have we come? The American journal of clinical nutrition 72, 1082-1087 (2000)], we investigated the 8-OHdG levels in the choroid after intraperitoneal injection of LPS or IL-4, and found that the IL-4-injected group showed a decrease in choroidal 8-OHdG concentration compared with the control group (P<0.01). In contrast, the concentration of choroidal 8-OHdG was higher in the LPS-injected group compared with the IL-4 group (P<0.05) (Figure 4D). Taken together, these data suggest that polarized M1 macrophages may induce myopia by promoting oxidative stress, whereas polarized M2 macrophages may inhibit myopia progression by suppressing the oxidative stress response.

[0074] Example 6 Choroidal thinning and myopia caused by LPS administration To confirm whether polarization into M1 macrophages is involved in choroidal thinning and myopia, we measured the expression of polarization marker genes in the choroid after LPS administration and the choroidal thickness, axial length, and refractive index.

[0075] We measured the choroidal thickness, axial length, and refractive index of mice that had been administered LPS for 2 weeks and control mice that had been administered PBS, and calculated the changes (Figure 8A, B).The eyes were then enucleated, and the expression of polarization marker genes was measured by quantitative PCR (Figure 9).

[0076] C57BL6J mice (n=4 per group) were used. In the LPS-administered group, LPS solution was administered intraperitoneally every day at a dose of 10 mg / kg BW. To the PBS-administered group, PBS was administered instead of the LPS solution.

[0077] (Measurement of axial length, choroidal thickness, and refractive index) The axial length, choroidal thickness, and refractive index of each group of mice were measured. Measurements of axial length and choroidal thickness were performed using a spectral domain optical coherence tomography (Envisu R4310, Leica). Refractive index was measured using an infrared photorefractor for mice (made by Professor Schaeffel, University of Tubingen).

[0078] (Observation of the choroid using an electron microscope) Eyes from each group were harvested and fixed overnight at 4°C in 2.5% glutaraldehyde in PBS (Phosphate Buffered Saline), then rinsed in 0.1M sodium cacodylate buffer for 1 h. They were then fixed in 1% OsO4 in 0.1M cacodylate buffer for 2 h, followed by dehydration in graded ethanol solutions. The eyes were then infiltrated overnight in a 1:2 mixture of propylene oxide and Epon-Araldite, and embedded in 100% resin. Blocks were sectioned and observed using a transmission electron microscope (JEM1400 plus; JEOL) at an accelerating voltage of 100 kV.

[0079] (Evaluation of gene marker expression) As described above, choroid, retina, and sclera samples were collected from mice administered with LPS for 2 weeks, and the expression analysis of M1 macrophage marker genes and oxidative stress-related genes was performed by quantitative PCR method.

[0080] (Results) In the LPS administration group, compared with the control group administered with PBS, a decrease in refraction (left in Fig. 8B), elongation of the eye axis (center in Fig. 8B), and thinning of the choroid (right in Fig. 8B) were observed at both the 1-week and 2-week administration periods.

[0081] Also, as a result of gene expression analysis, an increase in the expression of M1 marker genes and oxidative stress-related genes was particularly observed in the choroid (Fig. 9).

[0082] As shown in these results, it was confirmed that an increase in M1 macrophages in the choroid induces myopia.

[0083] (Example 7 Polarization into M2 macrophages by administration of IL-4 and IL-13 and myopia inhibitory effect) M1 macrophages are mainly involved in the induction of inflammation, while M2 macrophages have an antagonistic effect in that they are involved in the termination and suppression of inflammation. Since M1 macrophages have a myopia-inducing effect, it is considered that M2 macrophages act suppressively on myopia progression. Therefore, IL-4, a cytokine required for polarization into M2 macrophages, was administered to mice, and whether polarization into M2 occurred in the choroid was examined by analyzing the expression levels of CD163 and CD206, which are M2 macrophage markers (Fig. 10A, B).

[0084] (IL-4 administration) C57BL6J mice (n=4 per group) were intraperitoneally administered IL-4 solution at 0.1μg / 100μl (10μg / kg BW), and choroid, retina, and liver samples were taken at 0 hours (before administration) and 4, 24, and 48 hours after administration, and the expression of M2 macrophage marker genes was analyzed by Western blot and real-time PCR (Figure 10). In addition, choroid and retina samples were taken at 0 hours (before administration) and 4 and 24 hours after administration, and the expression of oxidative stress-related genes was analyzed by real-time PCR (Figure 11).

[0085] We also administered IL-4 to mice undergoing myopia induction and evaluated whether it had a myopia-suppressing effect (Figure 11). C57BL6 mice (-30D lens, n=4) undergoing myopia induction were intraperitoneally administered IL-4 solution at 0.1 μg / 100 μl (10 μg / kg BW) for 3 weeks. As a control group, C57BL6J mice (0D lens, -30D lens, n=4 for each group) undergoing myopia induction were used. After 3 weeks, refraction, axial elongation, and choroidal thinning were measured in the same manner as in Example 6.

[0086] (result) As a result, administration of IL-4 increased the expression of M2 markers CD163 and CD206 in the choroid (Figure 10B, C), confirming polarization to M2 macrophages. Furthermore, gene expression analysis revealed increased expression of M2 macrophage marker genes and suppressed expression of oxidative stress-related genes (Figure 12). These results suggest that administration of IL-4 induces polarization to M2 macrophages, suppresses expression of oxidative stress-related genes, and inhibits the progression of myopia (Figure 12).

[0087] In addition, administration of IL-4 during the myopia induction period was confirmed to suppress the decrease in refraction (Fig. 12B, left), the elongation of the eye axis (Fig. 12B, center), and the thinning of the choroid (Fig. 12B, right).

[0088] These results confirmed that the polarization of choroidal macrophages into M2 by IL-4 administration has a myopia-suppressing effect.

[0089] <IL-13 administration> By administering IL-13, which is known as a cytokine that polarizes macrophages to M2 similarly to IL-4, during the myopia induction period, it was confirmed using C57BL6J mice that, similar to the results of IL-4, the elongation of the eye axis, myopic refractive change, and thinning of the choroid caused by wearing a minus lens were suppressed, and polarization to M2 macrophages was induced (Figure 13). The measurement of blood flow changes and the number of macrophages was performed as follows. Blood flow changes were measured using a wavelength-swept optical coherence tomography (OCT S-1, Canon). The number of macrophages was measured by staining with F4 / 80 antibody and CD11b antibody after digestion of the choroid using a flow cytometer (CytoFLEX S, Beckman Coulter). The number of M2 macrophages was measured in the same manner as the measurement of the number of macrophages, except that the staining process with CD206 antibody was added.

[0090] As in the results of Examples 6 and 7, it was confirmed that myopia can be induced or suppressed, particularly by controlling the state of macrophages in the choroid. From the viewpoint of suppressing myopia progression and treatment, it is shown that promoting polarization to M2 macrophages is particularly effective for its achievement.

[0091] <Example 8 Suppression of myopic change by mast cell stabilizer eye drops> To verify the inhibitory effect of mast cell stabilizer eye drops on myopia progression, a lens-induced myopia model in which myopia was induced by fitting mice with a minus lens was used, and cromolyn acid solution (4% solution) or pemirolast potassium (0.1% solution) was administered to the eyes once a day during the myopia induction period.

[0092] According to the above test method, the axial length, refractive index, and choroidal thickness were measured in mice that underwent myopia induction for 3 weeks and eye drop administration of cromoglycate solution or pemirolast potassium solution and in control mice, and the amount of change was calculated (Figure 14A, B, C).

[0093] As a result, the minus lens wearing eyes of the control group that received PBS showed axial elongation (Fig. 14A), myopia (Fig. 14B), and choroidal thinning (Fig. 14C) compared to the control eyes. On the other hand, the above-mentioned changes observed in the PBS group were not observed in the groups that received instillation of cromoglycate solution or pemirolast potassium solution.

[0094] These results demonstrate that administration of a mast cell stabilizer eye drop suppresses the progression of myopia.

[0095] Example 9 Comparison of myopia suppression effects between mast cell stabilizer eye drops and histamine receptor inhibitor eye drops Antiallergic drugs are broadly divided into two types: mast cell stabilizers that inhibit the degranulation of mast cells, and histamine receptor inhibitors that inhibit the action of histamine secreted by the degranulation of mast cells. In order to clarify whether the myopia suppression effect of the mast cell stabilizer eye drop of Example 8 is due to the action of the antiallergic drug or the inhibition of mast cell degranulation, pemirolast potassium (0.1% solution) as a mast cell stabilizer and levocabastine solution (0.025% solution) as a histamine receptor inhibitor were administered as eye drops to mice that had undergone myopia induction by LIM, and the myopia suppression effects were compared. The results are shown in Figure 15.

[0096] As shown in Figure 15, the results showed that the pemirolast potassium administration group did not show the axial elongation, myopic refraction, and choroidal thinning seen in the control group, as in Example 8. On the other hand, the levocabastine administration group showed the axial elongation, myopic refraction, and choroidal thinning, as in the control group.

[0097] From the above results, it was confirmed that mast cell stabilizer, among other anti-allergy drugs, has a myopia suppression effect.

[0098] Example 10: Inhibition of myopia progression by administration of Lactobacillus paracasei Since induction of M2 macrophages can suppress the progression of myopia, Lactobacillus paracasei, a lactic acid bacterium contained in Yakult (Yakult Honsha Co., Ltd.), was cultured and grown and administered to myopic model mice, and the axial length, refractive index, and choroidal thickness were measured and the amount of change calculated in the same manner as in Examples 8 to 9 (FIG. 16). As a result, it was confirmed that administration of lactic acid bacteria suppresses the progression of myopia (FIG. 16).

[0099] Example 11 Three times daily administration of berberine chloride significantly inhibited the progression of myopia: The effect of the number of administrations per day on the inhibitory effect of berberine on the progression of myopia was examined. Eye drops with the formulations shown in Table 1 below were prepared. A LIM mouse model was created from 3-week-old mice by the method described in the above "LIM mouse model:". However, a negative 30D lens was constructed in the right eye (-30D group), and no lens was constructed in the left eye (0D group). As shown in Figure 17A, the above LIM mouse model was administered placebo eye drops A (Control) once a day, or eye drops 1 once a day or three times a day (10:00, 14:00, and 18:00) until 6 weeks of age. Thereafter, the refraction value and axial length in the -30D group and 0D group at 3 weeks of age before administration of various eye drops and at 6 weeks of age after the end of administration of various eye drops were measured based on the above "Measurement of refraction, axial length, and choroidal thickness:". These values ​​(Ref and AL, respectively), and the change in refraction and axial length (Change in Ref and Change in AL, respectively) from 3 weeks before administration of each eye drop to 6 weeks after administration of each eye drop are shown in Figs. 17B and C. In Fig. 17B, the results are shown for n=6-7 for each group. In Fig. 17C, the results are shown for n=4-6 for each group. In Figs. 17B and C, "*", "**", "***", and "****" respectively indicate that the P values ​​are P<0.05, P<0.01, P<0.001, and P<0.0001 in the statistical analysis using a combination of one-way ANOVA and least significant difference (LSD). In Figs. 17B and C, "0W" refers to the group at 3 weeks before administration of each eye drop, and "3W" refers to the group at 6 weeks after administration of each eye drop. In addition, in Figures 17B and C, "Con" refers to the placebo eye drop (Control) administration group, and "Ber 0.012 1" and "Ber 0.012 3" refer to the groups administered 0.012 (w / v)% berberine chloride eye drops once a day and three times a day, respectively.

[0100] [Table 1]

[0101] As shown in Figures 17B and C, in the -30D group, when eye drops 1 containing 0.012 (w / v)% berberine chloride were administered three times a day, the change in refractive index (reduction) and the change in axial length (elongation) were smaller than when placebo eye drops A was administered, and the change in refractive index (reduction) and the change in axial length (elongation) tended to be smaller than when eye drops 1 was administered once a day. Therefore, it was shown that administration of berberine chloride three times a day can suppress the decrease in refractive index and the elongation of axial length more than when administered once a day, and can suppress myopia more.

Claims

1. An eye drop for inhibiting or treating myopia, comprising berberine, or a salt or derivative thereof, Eye drops that are instilled three or more times a day.

2. The eye drop according to claim 1, which is administered in 1 to 3 drops at a time.

3. 3. The eye drop according to claim 1, wherein the content of berberine, or a salt thereof, or a derivative thereof in the eye drop (100% by weight / volume) is 0.005 to 0.025% by weight / volume.

4. 3. The eye drop according to claim 1, which inhibits at least one selected from the group consisting of a decrease in refractive index, axial elongation, and choroidal thinning.

Images