Method for inactivating virus, agent, and composition for virus inactivation

Abstract

To achieve direct inactivation of viruses present in a living body.SOLUTION: The present invention provides a method that comprises binding a drug labeled with a radioactive isotope capable of α decay specifically to a virus, and irradiating the virus with recoil nuclei produced through the α decay of the radioactive isotope. In addition, the present invention provides a drug for inactivating viruses, the drug comprising a substance capable of specific binding to the virus, wherein the substance is labeled with a radioactive isotope capable of α decay.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for inactivating a virus, an agent, and a composition for inactivating a virus. [Background technology]

[0002] Recently, there is a global demand for the development of new methods of preventing and treating viral infections. Vaccines are the most effective countermeasures against viral infections, but they are not universal and require a considerable amount of time to develop. In addition, the effectiveness of vaccines may weaken over time and as the virus mutates. When there is no vaccine or the vaccine is ineffective, treatment with antiviral drugs is selected. Examples of antiviral drugs include drugs that suppress viral proliferation in vivo by suppressing viral invasion into cells, viral replication within cells, and viral release outside cells, as well as immunostimulants such as interferon that suppress viral proliferation and eliminate viruses by enhancing host immune function. However, these antiviral drugs do not have a pharmacological action to directly inactivate or eliminate viruses. In other words, treatment with these antiviral drugs depends on the host's immunity, so there is a large individual difference in the effectiveness, and it is extremely difficult to inactivate or eliminate the infectious virus, especially when the source virus has an immune evasion mechanism.

[0003] One method for directly inactivating viruses is to destroy the viral DNA / RNA, and radiation exposure is an effective means of doing so. However, viruses have a higher radiation resistance than humans and animals, and the radiation dose required to inactivate viruses (20-40 kGy) far exceeds the lethal dose for humans. For this reason, there is a demand for the development of a treatment that directly irradiates radiation to viruses, and the use of radioisotopes is one possible method for this purpose.

[0004] As a technique for binding a radioisotope to an antibody, techniques related to substances in which a radioisotope is bound to a compound such as an antibody or peptide capable of specifically binding to a virus (Patent Documents 1 to 3) have been disclosed. It is also known that an antibody bound to a radioisotope can be bound to a virus-infected cell to induce cell death and inhibit virus proliferation (Non-Patent Document 1). Research is also known in which an antibody labeled with a radioisotope that emits Auger electrons is bound to magnetic beads that resemble virus particles (Non-Patent Document 2). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2016-182138 A [Patent Document 2] Special Publication No. 04-506217 [Patent Document 3] JP 2022-188016 A [Non-patent literature]

[0006] [Non-Patent Document 1] Ekaterina Dadachova et. al., Targeted Killing of Virally Infected Cells by Radiolabeled Antibodies to Viral Proteins, PLoS Med, 3, p. 2094-2103, 2006 [Non-Patent Document 2] Nagavarakishore Pillarsetty et al., Oncology-Inspired Treatment Options for COVID-19, J Nucl Med, 61, p.1720-1723, 2020 Summary of the Invention [Problem to be solved by the invention]

[0007] Regarding Non-Patent Document 2, considering that the particle size of the virus is 10 to 400 nm, it is difficult to say that the range and dose of Auger electrons are sufficient to reach and destroy the viral DNA / RNA from the virus surface. For this reason, it is considered difficult to inactivate the virus by Auger electrons alone.

[0008] Furthermore, in the above-mentioned prior art documents, no experimental verification has been conducted on the direct effect of radioisotopes on viruses, i.e., there is no knowledge regarding the direct inactivation of viruses by radioisotopes.

[0009] One aspect of the present invention has been made in view of the above problems, and has an object to realize a method for directly inactivating viruses present in a living body. [Means for solving the problem]

[0010] After extensive research, the inventors of the present application have discovered that in order to directly inactivate viruses in the body, it is effective to destroy the viral DNA / RNA by irradiating the virus with recoil nuclei produced by the alpha decay of a radioactive isotope.

[0011] That is, in order to solve the above-mentioned problems, one aspect of the present invention provides a method comprising specifically binding a drug labeled with an alpha-decaying radioisotope to a virus, and irradiating the virus with a recoil nucleus produced by the alpha decay of the radioisotope.

[0012] Another aspect of the present invention provides a drug for inactivating a virus, the drug comprising a substance capable of specifically binding to a virus, the substance being labeled with a radioisotope that undergoes alpha decay. Effect of the Invention

[0013] According to one aspect of the present invention, viruses present in a living body can be directly inactivated. [Brief description of the drawings]

[0014] [Figure 1] FIG. 11 is a diagram showing the binding activity of 211At and 211At-labeled anti-VSV-G antibody (211At-VSV-GmAb) to a VSV-G expressing cell line according to Example 2 of the present invention. [Diagram 2] FIG. 11 shows a comparison of quantitative PCR analysis results for lentivirus genomic RNA treated with phosphate buffer (Control), 211At phosphate buffer solution, and 211At-labeled anti-VSV-G antibody (211At-VSVG) phosphate buffer solution according to Example 3 of the present invention. [Diagram 3] FIG. 11 shows the results of agarose electrophoresis of PCR amplified products for lentivirus genomic RNA treated with phosphate buffer (Control), 211At phosphate buffer solution, and 211At-labeled anti-VSV-G antibody (211At-VSVG) phosphate buffer solution according to Example 4 of the present invention (A: agarose electrophoresis photograph, B: DNA band brightness value analysis results using ImageJ). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] <Definition> In this specification, when a range is indicated in the format of "A to B," this notation is used to mean that both ends of the range, A and B, are included, unless otherwise specified.

[0016] 1. Methods for inactivating viruses A method according to one embodiment of the present invention is a method for inactivating a virus, which comprises specifically binding a drug labeled with a radioisotope that undergoes α-decay to the virus, and irradiating the virus with recoil nuclei generated by the α-decay of the radioisotope. Note that in the following explanation, "inactivating a virus" refers to directly inactivating a virus by damaging and destroying the viral DNA / RNA.

[0017] The virus to be inactivated is not particularly limited, and any virus can be the target, as long as an α-nuclide labeled drug capable of specifically binding to the virus can be prepared, as described below. For example, the virus may be an enveloped virus such as influenza virus, coronavirus, vesicular stomatitis virus (VSV), hepatitis C virus, Zika virus, measles virus, respiratory syncytial virus, human immunodeficiency virus, Oz virus, Lassa virus, Crimean-Congo hemorrhagic fever virus, Marburg virus, West Nile virus, Nipah virus, Japanese encephalitis virus, yellow fever virus, hantavirus, cytomegalovirus, monkeypox virus, herpes virus, rubella virus, rabies virus, Ebola virus, Lassa virus, and dengue virus, or a non-enveloped virus such as adenovirus, norovirus, rotavirus, poliovirus, human papilloma virus, calicivirus, sapovirus, hepatitis E virus, astrovirus, and enterovirus.

[0018] (Radioisotope) As used herein, "alpha decay" refers to a radioisotope that decays by emitting alpha rays, and is also referred to as alpha decay. As used herein, "alpha nuclide" refers to a radioisotope that undergoes alpha decay. As used herein, "alpha nuclide-labeled drug" refers to a drug that is labeled with an alpha nuclide. As used herein, "alpha recoil nucleus" refers to an atomic nucleus that is released when an alpha nuclide undergoes alpha decay, and that has lost the particles that make up alpha rays (two protons and two neutrons) from the alpha nuclide.

[0019] The range of α-recoil nuclei emitted by α-decay in water varies depending on the α-nuclide, but is in the range of 68nm to 118nm. Therefore, if a radioisotope that undergoes α-decay is present on the surface of the target virus, the α-recoil nuclei can reach inside the virus. In addition, the α-recoil nuclear energy emitted from an α-nuclide is 96.9 to 160.4keV. If all of this is absorbed inside the virus, the absorbed dose will be 22.3kGy to 36.9kGy. Therefore, it is possible to irradiate the virus with radiation at a high absorbed dose, making it possible to directly destroy the viral DNA / RNA.

[0020] There is no particular limitation on the α-decaying radioisotope to be used, but it is preferable that the radioisotope be one that is permitted for use in living organisms. From this viewpoint, examples of α-decaying radioisotopes include 149 Tb, 212 Pb, 213 Bi, 211 At, 223 Ra, 224 Ra, 225 Ac, 226 Th, 227 Th, 230 Examples of radioisotopes that are stable with one α-decay include U. Furthermore, it is more preferable that the radioisotope is one that becomes stable with one α-decay. This is because, although the number of α-decays required to become stable varies for each α nuclide, if the labeled α nuclide undergoes many decays, the energy generated by the decay may break the bond between the virus and the radioisotope via the drug, making the irradiation of the virus with the α-recoil nucleus unstable. Examples of radioisotopes that become stable with one α-decay include, for example, 211 At is preferred.

[0021] The radioisotope may be one that is commercially available as an alpha nuclide, or may be produced based on a commercially available element. For example, 211 For At, cyclotron 209 A method for producing Bi by irradiating it with alpha rays is known. 211 For α nuclides other than At, for example, 224 Ra and 212It is known that Pb can be obtained by repeatedly separating only the daughter nuclide from the parent nuclide and daughter nuclide in radioactive equilibrium using a generator. 225 Ac is a method to generate electricity by using nuclear reactors such as fast reactors and commercial reactors. 229 Manufacture Th, 225 Produced by decay through Ra 225 It is known that Ac can be extracted and obtained.

[0022] (α-nuclide labeled drugs) In one aspect of the present invention, the drug labeled with a radioisotope undergoing α-decay has a mechanism of virus-specific binding. As the mechanism, the α-nuclide labeled drug preferably contains an antibody or a compound other than an antibody (hereinafter collectively referred to as "antibody, etc.") that specifically binds to the virus. That is, the drug may be in the form of an antibody, etc. that specifically binds to the virus, labeled with a radioisotope undergoing α-decay.

[0023] As used herein, the term "specifically binds to a virus" refers to an antibody or the like that binds to a virus with higher affinity than to in vivo substrates other than the virus, such as cells, cell-derived components, and tissues. For example, the dissociation constant (Kd value) between the virus and the antibody or the like is 10 -9 It is preferable that the molecular weight is equal to or less than M. In addition, in this specification, the term "specifically binds to a virus" does not only mean specifically binding to a particular virus, but also means recognizing a structure commonly found in many viruses and binding to any type of virus.

[0024] The antibody that specifically binds to a virus may be any antibody that can bind to the target virus and does not bind to anything other than the virus, and may be, for example, an antibody that specifically binds to a protein expressed on the surface of the target virus. For example, when the target virus is an enveloped virus, an antibody that specifically binds to the envelope can be selected.

[0025] Specific examples of antibodies that specifically bind to viruses are listed below for each type of virus they target. Influenza virus: CR8020, CR6261, FGI-101-1A6, Anti-Hemagglutinin Antibodies, TCN-032 Coronavirus: AZD7442, AZD8895, AZD1061, REGN3048, REGN3051, Casirivimab, Imdevimab Hepatitis C virus: Lenvatinib Zika virus: Tyzivumab Respiratory syncytial virus: RSM01, Palivizumab, Nirsevimab Herpes virus: UB-621 Rabies virus: rabies mAb CBB 1, human rabies immune globulin (HRIG) Ebola virus: Ansuvimab, VRC-EBOMAB092-00-AB (MAb114) Human immunodeficiency virus: TMB-355, zinlirvimab, teropavimab Poliovirus: NTX-1088

[0026] The antibody that specifically binds to the virus may be either a monoclonal antibody or a polyclonal antibody, but is preferably a monoclonal antibody. The class of the antibody is not particularly limited, and may be any isotype of antibody, such as IgG, IgM, IgA, IgD, or IgE. The antibody may also be a multimer, such as a dimer, trimer, or tetramer.

[0027] The antibody that specifically binds to a virus is not particularly limited as long as it has a complementarity determining region (CDR) for binding to the virus. Specifically, the antibody may be a complete antibody molecule, Fab, Fab', F(ab') 2and the like, or genetically engineered conjugate molecules such as scFv, scFv-Fc, minibodies, and diabodies, or derivatives thereof modified with molecules having a protein stabilizing effect, such as polyethylene glycol (PEG).

[0028] In one embodiment of the present invention, the subject of virus inactivation may be a human. Therefore, in one embodiment, the antibody that specifically binds to a virus is preferably an antibody with reduced risk in consideration of application to humans. Specifically, fully human antibodies, humanized antibodies, mouse-human chimeric antibodies (chimeric antibodies), etc. are preferred, and fully human antibodies are particularly preferred. These antibodies can be produced by genetic engineering according to known methods, more specifically, methods for producing hybridomas from humans or human antibody-producing animals (e.g., mice), phage display methods, etc. can be mentioned.

[0029] When an antibody that specifically binds to a virus is labeled with an α-decaying radioisotope, the site of the antibody to be labeled with the radioisotope is not particularly limited, as long as it does not inhibit specific binding to the virus. The size of one antibody molecule is about 10 nm, which is sufficiently small compared to the range of α-recoil nuclei, so that a sufficient radiation dose can be given to the virus regardless of which site of the antibody is labeled with the radioisotope. In addition, the method of labeling an antibody with a radioisotope is not particularly limited, and any method known in the art may be adopted. For example, a method of labeling a label precursor prepared by binding an antibody to a linker with a radioisotope under acidic conditions is known (reference: J Nucl Med, 49, 1537-1545 (2008)). In addition, the number of radioisotopes bound to one antibody molecule is not limited, and may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more.

[0030] The antibody that specifically binds to a virus may be a commercially available antibody depending on the target virus, or such an antibody may be synthesized and used. The antibody that specifically binds to a virus may also be an antibody that is further labeled with, for example, a fluorescent dye label, an enzyme label, or the like.

[0031] Compounds other than antibodies that specifically bind to viruses include peptides such as frog-defensin-derived basic peptide (FBP) and macrocyclic peptide, carbon nanoparticles, quantum dots, and lectins. 211 In the case of At, a labeling precursor containing a trimethyltin or tributyltin group is prepared and oxidized in the presence of an oxidizing agent. 211 A method of labeling by reacting with At is known. When the α nuclide is a metal element, an α nuclide label can be obtained by reacting a compound bound to a chelating agent (DTPA, DOTA, etc.) with the α nuclide. In order to ensure that the energy of the α recoil nucleus can be sufficiently absorbed by the virus, the size of the compound can be approximately the same as that of a general antibody, and the maximum diameter is preferably 15 nm or less, and more preferably 10 nm or less. In addition, the compound is preferably a medium or low molecule with a small size, and particularly preferably a low molecule. In this specification, the term "medium molecule" refers to a molecule with a molecular weight of 500 or more and less than 20,000, and the term "low molecule" refers to a molecule with a molecular weight of less than 500.

[0032] (Drug binding to the virus) The method of binding a drug labeled with an α-decaying radioisotope to a virus is not particularly limited, but for example, when inactivating a virus present in a subject, a method of binding an antibody or the like contained in the drug to a virus specifically can be selected by appropriately administering the drug to the subject. In this specification, the term "subject" refers to animals and plants. The term "animal" refers to humans, mammals other than humans, vertebrates other than mammals, and invertebrates such as insects. The mammals include, for example, mice, guinea pigs, hamsters, rats, mice, rabbits, pigs, sheep, goats, cows, horses, cats, dogs, monkeys, and chimpanzees.

[0033] The route of administration of the drug to an animal subject may be oral administration, parenteral administration, transdermal administration, transmucosal administration, intravenous administration, etc. In cases where the virus does not remain locally at the infected site, intravenous administration is preferred. In cases where the virus remains locally at the infected site and the α-nuclide labeled drug can be sufficiently distributed to the infected site by administration methods such as transdermal, abdominal, muscular, transmucosal, and inhalation to inactivate the virus, these methods are also preferred. The drug may be administered in the form of a virus inactivating composition described below.

[0034] Regarding the method of administration when administering a drug to a plant subject, any known method can be used as long as the compound constituting the α-nuclide labeled drug can be taken up by the plant.

[0035] The dosage of the drug is not particularly limited as long as the desired effect is obtained, and may be appropriately determined taking into consideration the amount of alpha nuclide labeling per drug, the type of drug used (type of antibody and compound), the target virus, the drug administration route, and the type, sex, body weight, age, etc. of the subject to be administered.

[0036] (Irradiation of the virus with alpha recoil nuclei) As described above, when the antibodies and the like contained in the agent bind to the virus, the alpha recoil nuclei are irradiated onto the virus due to the decay of the alpha nuclide labeled on the antibody bound to the virus.

[0037] When irradiating a virus with an α-recoil nucleus, it is preferable to prevent interference from impurities. One method for avoiding interference from impurities is to reduce the binding of substances that are not labeled with α-nuclides to the virus. For this reason, when labeling an antibody or the like that specifically binds to a virus with a radioisotope that undergoes α-decay, it is preferable to adjust the reaction amount of the α-nuclides and the antibody or the like so that as little unlabeled antibody or the like remains as possible.

[0038] (Other processes) The method for inactivating a virus according to this embodiment may include other steps. Examples of other steps include (i) a step of detecting gamma rays and the like emitted from α nuclides outside the body to monitor the distribution of α nuclides in the body, (ii) a step of separating and purifying an α nuclides-labeled drug by gel filtration, high performance liquid chromatography, ultrafiltration, or the like before administering the α nuclides-labeled drug to a subject, and (iii) a step of adding a preservative such as ascorbic acid to the α nuclides-labeled drug in order to suppress radiolysis of the α nuclides-labeled drug. By monitoring the distribution of α nuclides in the body, it is possible to confirm the accumulation of α nuclides in the target site, and also to estimate the radiation dose of each organ by dose simulation, enabling risk management. Separation and purification of α nuclides-labeled drugs is preferable from the viewpoints of avoiding a decrease in the labeling rate due to impurities, replacing with a buffer solution suitable for administration, and the like.

[0039] By adopting the method according to the above embodiment, it is possible to accumulate a radioisotope undergoing α-decay in a target virus, and to specifically and directly irradiate the virus with the α-recoil nucleus generated by α-decay. As a result, it is possible to destroy the viral DNA / RNA and directly inactivate the virus. In addition, it can be suitably used as a means for inactivating and actively eliminating the virus, particularly in cases where existing antiviral drugs cannot be used or are ineffective, in cases of asymptomatic infection, and in cases where the virus remains in the body even after treatment.

[0040] In addition, since the method according to the above-mentioned embodiment can specifically inactivate viruses, it can be used in cases where existing physical (e.g., heat and radiation) or chemical (e.g., sodium hypochlorite and ethanol, etc.) methods are insufficient to inactivate viruses, or where virus inactivation can be achieved but serious harm is caused to the host carrying the virus. Therefore, the scope of use is not limited to mammals including humans, but extends to animals in general and plants. For example, it is expected that the method can be used to treat viral infections in pets, preserve species by inactivating viruses that have infected rare animals and plants, and prevent virus transmission by inactivating viruses in the natural host of a pathogenic virus.

[0041] (application) When the α-nuclides bound to the virus via the drug undergo α-decay, in addition to the α-recoil nucleus, α-rays and γ-rays are also emitted. α-rays are known to destroy cells infected with viruses. In addition, since γ-rays can be measured and imaged outside the body, it is expected that γ-rays can be used to diagnose the amount and location of viruses in the body. By combining these technologies with the method according to the above-mentioned embodiment, it is possible to provide virus theranostics, which combines the diagnosis and treatment of viral infections.

[0042] 2. Virus inactivation composition Another embodiment of the present invention is a composition for virus inactivation containing the α-nuclide labeled drug described in the above section [1. Method for inactivating viruses], and one aspect of the composition is a pharmaceutical composition for treating or preventing a viral infection. Hereinafter, the composition for virus inactivation as a pharmaceutical composition for treating or preventing a viral infection will be described.

[0043] The virus inactivation composition of this embodiment contains a pharma- ceutically acceptable carrier, excipient, or diluent in addition to the α-nuclide labeled drug of the above embodiment. The α-nuclide labeled drug contained may be one type or multiple types. The pharma-ceutically acceptable carrier, excipient, or diluent is well known and can be appropriately selected by those skilled in the art. The virus inactivation composition may further contain a buffer, stabilizer, binder, lubricant, suspending agent, coating agent, solubilizer, etc. that are commonly used in the pharmaceutical field. In addition, a preservative for suppressing radiolysis may be contained in order to maintain the stability of the α-nuclide labeled drug. Examples of the preservative include ascorbic acid. The virus inactivation composition of this embodiment can be further used in combination with other drugs such as antiviral drugs.

[0044] The virus inactivating composition may be in the form of a pharmaceutical composition, such as an injection, capsule, tablet, or granule.

[0045] The amount of α-nuclide labeled drug contained in the virus inactivation composition and the amount of the virus inactivation composition administered to a subject are not particularly limited, and may be appropriately determined taking into consideration the amount of α-nuclide labeled drug per drug contained, the type of drug used (type of antibody and compound), the target virus, the administration route of the virus inactivation composition, and the sex, weight, age, etc. of the subject to be administered.

[0046] There are no particular limitations on the viral infection to be treated or prevented, and any viral infection can be treated or prevented as long as an α-nuclide labeled drug capable of specifically binding to the virus can be prepared.

[0047] <Summary> To summarise the above embodiments, the present invention can also be summarised as follows. (1) A method for inactivating a virus, comprising: specifically binding a drug labeled with a radioisotope that undergoes alpha decay to the virus; and irradiating the virus with recoil nuclei produced by the alpha decay of the radioisotope. (2) The method according to (1), wherein the radioisotope is a radioisotope that becomes stable after a single alpha decay. (3) The radioisotope is 211 The method according to (1) or (2), wherein At is At. (4) The method according to any one of (1) to (3), wherein the drug comprises an antibody that specifically binds to the virus. (5) A drug for inactivating a virus, comprising a substance capable of specifically binding to a virus, said substance being labeled with a radioisotope that undergoes alpha decay. (6) The drug according to (5), wherein the radioisotope is a radioisotope that becomes stable after a single alpha decay. (7) The radioisotope is 211 The drug according to (5) or (6), wherein the drug is At. (8) The agent according to any one of (5) to (7), wherein the substance is an antibody that specifically binds to a virus. (9) A composition for inactivating a virus, comprising the agent according to any one of (5) to (8). (10) The virus inactivation composition according to (9) above, as a pharmaceutical composition for treating or preventing a viral infection.

[0048] The following examples are provided to further explain the embodiments of the present invention. Of course, the present invention is not limited to the following examples, and various modifications are possible in detail. Furthermore, the present invention is not limited to the above-described embodiments, and various modifications are possible within the scope of the claims. The embodiments obtained by appropriately combining the technical means disclosed herein are also included in the technical scope of the present invention. In addition, all of the documents described in this specification are incorporated by reference. EXAMPLES

[0049] <Example 1: Prediction of the irradiation dose of α-recoil nuclei> Water spheres with a diameter of 110 nm were used to represent viruses (lentiviruses), 211The absorbed dose was calculated when all the recoil energy from the α-recoil nuclei produced by the α-decay of At was absorbed in a water sphere with a diameter of 110 nm. Specifically, 211 The α-recoil nucleus released by the α-decay of At is 207 Bi or 207 The energy of each α-recoil nucleus and its range in water are shown in the literature (Nuclear Recoils from 211 At Decay, Radiochimica Acta 47, 87-89, 1989.), and the radiation dose absorbed in the water globule was calculated based on the predicted value. The radiation dose was calculated using the following formula. Exposure dose (kGy) = recoil nuclear energy (keV) × 1.6 × 10 -19 (J / eV) / Water polo weight (kg)

[0050] The results are shown in Table 1. As shown in the table, the radiation dose absorbed by all α-recoil nuclei was 20 kGy or more, suggesting that the absorbed dose was sufficient for virus inactivation. 211 It was suggested that the virus could be sufficiently inactivated by irradiation with α-recoil nuclei derived from the α-decay of At.

[0051] [Table 1]

[0052] In addition, it is used for medical purposes. 211 Alpha nuclides other than At ( 149 Tb, 213 Bi, 223 Ra, 224 Ra, 225 Ac, 226 Th, 227 Th, 230 The α-recoil nuclear energy emitted from U is 96.9 to 160.4 keV, 211Even when using therapeutic alpha nuclides other than At, it is possible to irradiate with an absorbed dose of 20 kGy or more using alpha recoil nuclei (References: De Kruijff, RM; Wolterbeek, HT; Denkova, AG A Critical Review of Alpha Radionuclide Therapy-How to Deal with Recoiling Daughters? Pharmaceuticals 2015, 8, 321-336. https: / / doi.org / 10.3390 / ph8020321, see Table 1). From the above, it was shown that the alpha recoil nuclei emitted from alpha nuclides have an absorbed dose sufficient for virus inactivation.

[0053] <Example 2: Means for virus-specific accumulation of alpha nuclides> As an example of binding an alpha nuclide to a virus, an antibody (anti-VSV-G antibody) that specifically binds to the VSV-G protein expressed on the surface of a lentivirus is 211 At was bound using a known method (Reference: J Nucl Med, 49, 1537-1545 (2008)).

[0054] Specifically, a labeled precursor of anti-VSV-G antibody was first prepared by the following method. Anti-VSV-G antibody (Kerafast, Boston, MA) was prepared at 0.5 mg / mL in 0.2 M sodium carbonate buffer (pH 8.5), and 2 μL of N-succinimidyl-3-(trimethylstannyl)benzoate (25 mM, solvent: dimethylsulfoxide) was added to 100 μL of the antibody solution with vigorous stirring, and the mixture was allowed to react for 30 minutes at room temperature with gentle stirring. The labeled precursor fraction was isolated in 0.2 M sodium acetate buffer (pH 5.5) using a gel filtration spin column (Thermo Fisher Scientific).

[0055] The labeled precursor was prepared in the presence of N-iodosuccinimide. 211 After reacting with At for 10 minutes, ascorbic acid was added and the mixture was subjected to gel filtration. 211The At-labeled anti-VSV-G antibody fraction was collected.

[0056] In this embodiment, 211 At was detected by cyclotron 209 After being produced by irradiating a Bi target with α-particles ( 209 Bi(α,2n) 211 At reaction), and the product was separated and purified by dry distillation.

[0057] 211 To examine the virus binding activity of At-labeled anti-VSV-G antibodies, we used a 5'-hydroxytryptamine (5'-OH) antibody against a cell line expressing VSV-G. 211 At alone and 211 The binding activity of At-labeled anti-VSV-G antibodies was compared. Specifically, Lenti-X 293T cells seeded on a cell culture plate were transfected with plasmids using Lentiviral High Titer Packing Mix (Takara Bio Inc.) according to the attached instructions. After 24 hours, the culture supernatant was removed and 400 μL of medium was added. 211 At and 211 At-labeled antibody was added (10 kBq / well, 100 μL). 2 The cells were cultured in an incubator for 1 and 3 hours. After removing the culture supernatant, the cells were washed with ice-cold PBS. After adding 300 μL of 0.1 N NaOH to lyse the cells, the entire lysate was collected in a plastic tube and the radioactivity was measured using a gamma counter. After measuring the amount of protein in the cell lysate, the ratio of radioactivity in the cell lysate per added radioactivity / protein amount in the cell lysate (% applied dose / mg protein) was calculated.

[0058] The results are shown in Figure 1. 211 In the treatment with At-labeled anti-VSV-G antibody, 211 Radioactivity was approximately six times higher than that observed with At alone. 211 It was confirmed that the At-labeled anti-VSV-G antibody had binding activity to the viral surface antigen.

[0059] <Example 3: Viral genome destruction effect by alpha nuclides (quantitative PCR analysis)> Lentiviral High Titer Packaging Mix (Takara Bio) and pLVSIN-AcGFP1-C1 Vector (Takara Bio) were transfected into Lenti-X 293T cells, and the culture supernatant was collected after 2 days of culture to prepare lentivirus. The prepared viruses were transfected into Lenti-X 293T cells, with each copy number of 1.8 × 10 10 The subjects were divided into three groups: phosphate buffer (control), 211 At(1kBq), and 211 The cells were treated with At-labeled anti-VSV-G antibody (1 kBq) and cultured at 37°C for 24 hours, after which viral genomic RNA was collected. 211 At and labeled anti-VSV-G antibody were used in a phosphate buffer solution. Reverse transcription reaction was performed on the recovered viral genomic RNA, and the resulting DNA was amplified by PCR using primers (Sense: GCCCGAAGGAATAGAAGAAGAA (SEQ ID NO: 1), Antisense: GGGCCACAACTCCTCATAAA (SEQ ID NO: 2)) (amplified DNA: 1,854 bp), followed by quantitative PCR analysis. A Lenti-X qRT-PCR Titration Kit (Takara Bio Inc.) was used for the reverse transcription reaction and quantitative PCR analysis. Cq value (each sample) - Cq value (Control) was calculated, and the relative Cq value to the Control group was calculated. 211 At treatment group or 211 The ratio of the amount of amplified DNA in the At-labeled anti-VSV-G antibody-treated group was calculated.

[0060] The analysis results are shown in Figure 2. Compared with the control group, 211 The amount of amplified DNA in the At-labeled anti-VSV-G antibody (1 kBq) treated group was reduced to about half. 211 No change in the amount of amplified DNA was observed in the At (1 kBq) treatment group. 211 Anti-VSV-G antibody labeled with At 211This indicates that At accumulates on the virus, resulting in destruction of the viral genomic RNA and a decrease in the amount of template viral genomic RNA.

[0061] <Example 4: Viral genome destruction effect by alpha nuclide (agarose electrophoresis analysis)> Lentiviruses were prepared in the same manner as in Example 3, with each copy number being 1.8 × 10 10 The subjects were divided into six groups: phosphate buffer (control), 211 At(1kBq), 211 At(10kBq), 211 At(100kBq), 211 At(500kBq), and 211 The cells were treated with At-labeled anti-VSV-G antibody (1 kBq) and cultured at 37°C for 24 hours, after which viral genomic RNA was collected. 211 At and the labeled anti-VSV-G antibody were used in a phosphate buffer solution. The recovered viral genomic RNA was subjected to a reverse transcription reaction using a Lenti-X qRT-PCR Titration Kit (Takara Bio Inc.) in the same manner as in Example 3, and the resulting DNA was amplified by PCR using the same primers as in Example 3. The amplified DNA was subjected to 1% agarose gel electrophoresis and then stained with ethidium bromide.

[0062] The results are shown in Figure 3. Figure 3A is an image of the agarose gel after electrophoresis, taken after ethidium bromide staining, and Figure 3B is the result of analyzing the brightness value of each DNA band for the image of Figure 3A using image analysis software (ImageJ). 211 The brightness of the DNA band in the At-labeled anti-VSV-G antibody (1 kBq) treated group was weak, indicating that the amount of amplified DNA was greatly reduced. 211 The brightness of the DNA band in the At(1 kBq) group was comparable to that in the control group, and no reduction in the amount of amplified DNA was observed. 211 Anti-VSV-G antibody labeled with At 211This indicates that At accumulates on the virus, resulting in destruction of the viral genomic RNA and a decrease in the amount of template viral genomic RNA.

[0063] In addition, the antibody was not bound to 211 In the At-treated groups, the intensity of the DNA bands weakened in the order of 10 kBq, 100 kBq, and 500 kBq, and the amount of amplified DNA decreased with increasing radioactivity. 211 It is believed that At, although in very small amounts, also binds nonspecifically to the lentivirus, causing destruction of the viral genomic RNA, and thus a decrease in the amount of amplified DNA was observed with an increase in radioactivity. [Industrial Applicability]

[0064] The present invention can be used in medicines for treating or preventing viral infections.

Claims

1. 1. A method for inactivating a virus, comprising: Specific binding of an agent labeled with an alpha-decaying radioisotope to the virus; and irradiating the virus with recoil nuclei produced by alpha decay of the radioisotope.

2. 2. The method of claim 1, wherein the radioisotope is a radioisotope that is stable after a single alpha decay.

3. The radioisotope is ２１１ The method of claim 1, wherein said at least one of said amino acid sequence is At.

4. The method of claim 1 , wherein the agent comprises an antibody that specifically binds to the virus.

5. A drug for inactivating a virus, comprising: Contains a substance capable of specifically binding to a virus, The agent is labeled with a radioisotope that undergoes alpha decay.

6. The drug according to claim 5 , wherein the radioisotope is a radioisotope that becomes stable by a single α decay.

7. The radioisotope is ２１１ The drug according to claim 5, which is At.

8. The drug according to claim 5 , wherein the substance is an antibody that specifically binds to a virus.

9. A composition for inactivating a virus, comprising the agent according to any one of claims 5 to 8.

10. The virus inactivating composition according to claim 9, which is a pharmaceutical composition for treating or preventing a viral infection.

Images