Method for testing gastrointestinal cancer, gastrointestinal cancer diagnostic marker, test kit for gastrointestinal cancer, and screening method for gastrointestinal cancer preventive or improvement agent

Abstract

To provide a technique with low physical burden, no need for hospital visits, and capable of inexpensive and quick testing for gastrointestinal cancer, which contributes to the early detection of gastrointestinal cancer; according to the present invention, using non-invasively obtained biological samples such as feces, gastrointestinal cancer can be tested without causing physical burden to the subject; the quantity of intestinal bacteria-derived 5α-reductase gene can be determined by polymerase chain reaction (PCR); and since the present invention does not require comprehensive analysis of intestinal microbiota, gastrointestinal cancer can be tested quickly and inexpensively.SOLUTION: A method for testing gastrointestinal cancer comprises detecting the quantity of intestinal bacteria-derived 5α-reductase gene in a biological sample from a subject.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a method for examining digestive tract cancer, a digestive tract cancer diagnostic marker, a kit for examining digestive tract cancer, and a method for screening a preventive and ameliorating agent for digestive tract cancer.

Background Art

[0002] Digestive tract cancer is a general term for cancers that occur in the digestive tract such as the esophagus, stomach, duodenum, small intestine, large intestine, pancreas, liver, and biliary tract. Digestive tract cancer accounts for about half of cancer deaths, and among them, colorectal cancer and gastric cancer are the most common, and together they account for about half of digestive tract cancer.

[0003] Although digestive tract cancers such as colorectal cancer and gastric cancer rank high in the death statistics, this is because a considerable number of them are found in an advanced state among the large number of cases and cannot be cured. On the other hand, colorectal cancer and gastric cancer can be cured if detected and treated early.

[0004] Therefore, for early detection, in colorectal cancer and gastric cancer, it is recommended to undergo early endoscopic examination. In addition, fecal occult blood test is performed as a primary screening for colorectal cancer. Further, Non-Patent Document 1 reports that in the feces of subjects with colorectal cancer or pre-cancerous conditions, Fusobacterium nucleatum increases from intramucosal cancer to more advanced stages, Atopobium parvulum and Actinomyces odontolyticus increase only in the stages of adenoma and / or intramucosal cancer, branched amino acids and phenylalanine increase in the stage of intramucosal cancer, and bile acids containing deoxycholic acid increase in the stages of adenoma and / or intramucosal cancer.

Prior Art Documents

Non-Patent Documents

[0005]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0006] Colonoscopy is currently the best test for detecting and treating early colorectal cancer and pre-cancerous adenomas. However, since colonoscopy needs to be performed by a trained doctor, one has to go to a hospital where the test can be carried out. Also, the difficulty varies depending on the shape of an individual's intestine, and it is affected by the conditions of both the person being examined and the examiner. There are also quite a few problems, such as the significant physical burden including pretreatment.

[0007] In addition, the fecal occult blood test has advantages such as a small physical burden and can be performed without visiting a hospital. However, since it is a test for checking the presence or absence of blood in the stool, the frequency of diagnosing colorectal cancer with a positive fecal occult blood test is only about 5%. The accuracy as a colorectal cancer test is not high. There are also many cases where diseases such as hemorrhoids result in a positive fecal occult blood test, and among those with a positive fecal occult blood test, less than half of them proceed to undergo a more accurate colonoscopy. This is considered to be a major reason why the number of deaths from colorectal cancer in this country has not decreased.

[0008] Also, if the method of detecting the bacterial species described in Non-Patent Document 1 is used as a test, since shotgun sequencing is performed, the processing of one sample is very expensive and it also takes a considerable amount of time for analysis. Therefore, it is not realistic to use it in primary screening.

[0009] The present invention has been made to solve such problems, and aims to provide a technique that can contribute to the early detection of digestive organ cancer, involves less physical burden, does not require a hospital visit, is inexpensive, and can quickly examine the possibility of suffering from digestive organ cancer by inspection. Another object is to provide a technique capable of searching and selecting a substance (a preventive agent for digestive organ cancer) that can reduce the possibility of suffering from digestive organ cancer.

Means for Solving the Problems

[0010] As a result of intensive research, the present inventors have found that the number of intestinal bacteria carrying the 5α-reductase gene is significantly smaller in patients with digestive organ cancer than in healthy subjects, and there is an inverse correlation with the progression of digestive organ cancer (the more the cancer has progressed, the smaller the number of such bacteria). Based on these findings, the following respective inventions have been completed.

[0011] (1) The method for inspecting digestive organ cancer according to the present invention includes detecting the amount of the 5α-reductase gene derived from intestinal bacteria in a biological sample from a subject. This method may exclude medical acts.

[0012] (2) The diagnostic marker for digestive organ cancer according to the present invention includes the 5α-reductase gene derived from intestinal bacteria.

[0013] (3) The inspection kit for digestive organ cancer according to the present invention includes a PCR primer set capable of amplifying the 5α-reductase gene derived from intestinal bacteria.

[0014] (4) The screening method for a preventive and ameliorating agent for digestive organ cancer according to the present invention includes detecting the amount of the 5α-reductase gene derived from intestinal bacteria in a sample. This method may exclude medical acts.

Effects of the Invention

[0015] According to the present invention, it is possible to examine the possibility of suffering from digestive organ cancer.

[0016] According to the present invention, it is possible to examine digestive tract cancer without imposing a physical burden on a subject by using a non-invasively obtained biological sample such as feces.

[0017] The amount of the 5α-reductase gene derived from intestinal bacteria can be measured by polymerase chain reaction (PCR). Since comprehensive analysis of the intestinal flora is not required in the present invention, digestive tract cancer can be examined quickly and inexpensively.

[0018] In a test method targeting a specific bacterial species, the effectiveness of the test may be problematic due to individual differences in the flora, such as not originally having the bacterial species. In contrast, the present invention targets the 5α-reductase gene possessed by a group of bacteria composed of a plurality of genera. Since it exists in most people as long as it is a group of bacteria possessing the 5α-reductase gene, it is possible to provide a highly versatile test method for digestive tract cancer.

[0019] From the above, the test method, digestive tract cancer diagnostic marker or test kit of the present invention can be used, for example, in the primary or 1.5-stage screening for colorectal cancer to select people who should undergo a colonoscopy, and can contribute to the early detection and early treatment start of colorectal cancer.

[0020] According to the present invention, it is possible to screen for a substance that reduces the likelihood of developing digestive tract cancer or improves the disease state, that is, a preventive or ameliorating agent for digestive tract cancer. With the agent extracted thereby, it is possible to expect prevention, improvement of digestive tract cancer or maintenance of health.

Brief Description of the Drawings

[0021]

Figure 1

Figure 2

Best Mode for Carrying Out the Invention

[0022] Hereinafter, the present invention will be described in detail.

[0023] As described above, gastrointestinal cancer refers to cancer that develops in the digestive organs such as the esophagus, stomach, large intestine, pancreas, liver, and biliary tract. That is, examples of gastrointestinal cancer include pharyngeal cancer, esophageal cancer, gastric cancer, duodenal adenoma, pancreatic cancer, gallbladder cancer, cholangiocarcinoma, liver cancer, and colorectal cancer.

[0024] In the present invention, "examination for gastrointestinal cancer" includes an examination for determining whether a subject is likely to have gastrointestinal cancer or not, and an examination for making a definitive diagnosis when the subject already has gastrointestinal cancer.

[0025] Isoallo-LCA is a kind of bile acid metabolite (secondary bile acid) produced by the metabolism of bile acids (primary bile acids) synthesized in the liver by intestinal bacteria. It promotes the differentiation of anti-inflammatory regulatory T cells and is significantly reduced to below the detection limit in fecal samples of patients with inflammatory bowel disease (Li W, Hang S et al., 2021, Cell Host Microbe. 29: 1366-1377 e9.), and is detected in large amounts in the feces of centenarians (Yuko Sato et al., Nature volume 599, pages 458-464 (2021)). Therefore, it is suggested that it may play an important role in maintaining immune homeostasis in humans.

[0026] Isolithocholic acid has been reported to be produced from 3-oxolithocholic acid by the catalytic action of 5α-reductase, 5β-reductase, and 3β-hydroxysteroid dehydrogenase (Li W, Hang S et al., 2021, Cell Host Microbe. 29: 1366-1377 e9.). Among these three isolithocholic acid-producing enzymes, 5α-reductase can be said to be the key enzyme. This is because, while many bile acid molecular species have a 5β-type structure (cis-type), isolithocholic acid is characterized by having a 5α-type (trans-type) structure, and 5α-reductase is the enzyme that gives this structure.

[0027] As intestinal bacteria that produce isolithocholic acid from 3-oxolithocholic acid, Bacteroidota such as the genera Bacteroides, Parabacteroides, Odoribacter, Butyricimonas, and Alistipes have been reported so far. Among these, Parabacteroides merdae, Phocaeicola dorei, Phocaeicola vulgatus, and Bacteroides uniformis have been reported as bacterial species with particularly high isolithocholic acid-producing ability (Li W, Hang S et al., 2021, Cell Host Microbe. 29: 1366-1377 e9.)(Yuko Sato et al., Nature volume 599, pages458-464 (2021)).

[0028] The 5α-reductase gene is a gene that encodes 5α-reductase.

[0029] As shown in the examples described below, there is a correlation in that the proportion of bacteria carrying the 5α-reductase gene in the intestine decreases as digestive organ cancer progresses. Therefore, the 5α-reductase gene derived from intestinal bacteria (possessed by intestinal bacteria) can be used as a diagnostic marker for digestive organ cancer. That is, by detecting the amount of the 5α-reductase gene derived from intestinal bacteria, the likelihood of developing digestive organ cancer can be examined.

[0030] Also, based on the above correlation, it can be said that a substance that increases the amount of the 5α-reductase gene derived from intestinal bacteria reduces the likelihood of developing digestive organ cancer or improves the disease state. From this, using the amount of the 5α-reductase gene derived from intestinal bacteria as an index, a preventive agent or improving agent for digestive organ cancer can be screened. In this screening method, for example, a test substance may be added to a cultured human intestinal tract model, or a test substance may be administered to a subject, and after a certain period of time, the amount of the 5α-reductase gene derived from intestinal bacteria may be detected. If a substance that increases the amount of the 5α-reductase gene is extracted by this test system, it can be said to be a substance that reduces the likelihood of developing digestive organ cancer or improves the disease state, that is, a preventive or improving agent for digestive organ cancer.

[0031] More specifically, the screening method may include, for example, a step of measuring the amount of the 5α-reductase gene in a sample before administration of the test substance, a step of measuring the amount of the 5α-reductase gene in a sample after administration of the test substance, and a step of selecting a test substance useful as a preventive agent or improving agent for digestive organ cancer based on the measurement results of the amount of the 5α-reductase gene from the pre-administration sample and the post-administration sample.

[0032] Examples of the DNA sequence of the 5α-reductase gene derived from intestinal bacteria include, for example, the DNA sequences (SEQ ID NOs: 1 to 4) of the gene possessed by the reference strains of the above four bacterial species, or DNA sequences having high sequence identity with SEQ ID NOs: 1 to 4. [Accession No. 1]Phocaeicola (Bacteroides) dorei DSM 17855 (length 765 bases) ATGGGACAACAGACTTTTGAATTTTTGCTATTGGCAATGTCCGCACTTGCGGTGATTGTATTTGTAGCCCTCTATTATGTACGTGCCGGTTATGGTATATTCCACACCCCGAAATGGGGACTTTCAGTGAACAATAAATTAGGTTGGGTGCTGATGGAAGCGCCTGTATTCCTTGTAATGCTTTATCTGTGGTGGAACAGCAGCGTGCGTTTTGATGCCGCTCCTTTCCTCTTTTTTCTTCTTTTTGAATTACATTATTTCCAGCGCTCTTTTATCTTCCCTTTCCTGATGAAAGGAAAGAGCCGGATGCCCCTTGCCATTATGTTGATGGGAGTGGTCTTTAATGTCCTGAACGGACTGATGCAGGGCGAATGGTTGTTCTATCTGGCTCCGGAAGGACTCTATACAGATGCCTGGCTCAGTACTCCTTCTTTTTGGTTTGGGATCATTTTGTTCTTTATAGGGATGGGCATTAATCTACATTCCGACAGTGTGATCCGCCATTTACGTAAACCGGGCGATACACGTCATTATTTGCCGCAGAAGGGAATGTACCGATATGTCACTTCGGGCAACTATTTTGGCGAGTTGGTGGAATGGATAGGGTTTGCCGTACTCACTTGTTCGCCTGCTGCATGGGTGTTTGTACTGTGGACGTTTGCTAATCTGGCTCCACGTGCTAATTCCATCCGTAACCGTTACCGGGAAGAGTTTGGTAAGGATGCGGTAGGAAAAAAGAAAAGAATGATTCCTTTTATTTATTGA

[0033] [Accession No. 2]Parabacteroides merdae ATCC 43184 (length 762 bases) ATGACAACTGAACATTTCACCTTATTTCTAATTGTTATGGCAGCTATCGCCGCCATAGTCTTCATAGCCCTTTATTTCGTCGAAGCCGGTTATGGAATGTTGTTCGATAAAAAATGGGGACTTCCGATACCGAACAAGATTGCTTGGATTTGCATGGAAGCGCCGGTTTTTATCGTCATGTTTTTGTTATGGAACGGATCGGAACGACAGTTCGAGACAGTACCGTTCCTGATATTCTTATTCTTCGAACTGCATTATTTCCAACGATCTTTTATTTTTCCTCTGTTGATAAAAGGCAAAAGTAAAATGCCGGCAGGCATCATGCTTATGGGAATCACCTTTAACCTCCTGAACGGTTATATGCAGGGAGAATGGATTTTCTACTTAGCACCGCAGGATATGTATACGAAAAGCTGGCTGCACAGCCCTCAATTTATAGTCGGGACAATCTTGTTCTTCACCGGCATGGCAATCAATATCCAGTCAGACCATATTGTCCGCCACCTCAGAAAGCCTGGCGACACGAACCATTATCTGCCTAAAAAAGGCCTGTTCAAATATGTGACATCAGCCAACTACTTTGGCGAAATCGTGGAATGGTGCGGATTTGCAATCCTGACCTGGAGTGCAAGCGGAGCTGTTTTCGCTTGGTGGACATTTGCAAACCTTGTACCTCGCGCAAACACCATCTACCATAAATACAAAGCGATGTTTGGTAACGAACTGGAAAACCGTAAACGGGTTATTCCTTTTATATATTGA

[0034] [SEQ ID NO: 3] Phocaeicola (Bacteroides) vulgatus ATCC 8482 (length 765 bases) ATGGGACAACAGACTTTTGAATTTTTGCTATTGGCAATGTCCGCACTTGCGGTGATTGTATTTGTAGCCCTCTATTATGTACGTGCCGGTTATGGTATGTTCCACACCCCGAAATGGGGACTTTCAGTGAACAATAAATTAGGTTGGGTACTGATGGAAGCGCCTGTATTCCTTGTAATGCTTTATCTGTGGTGGAACAGCAGCGTGCGTTTTGATGCCGCTCCTTTCCTCTTTTTTCTTCTTTTTGAATTACATTATTTCCAGCGCTCTTTTATCTTCCCTTTCCTGATGAAAGGAAAGAGCCGGATGCCCCTTGCCATTATGTTGATGGGAGTGGTCTTTAATGTCCTGAACGGACTGATGCAGGGCGAATGGTTGTTCTATCTGGCTCCGGAAGGACTCTATACAGATGCCTGGCTCAGTACTCCTTCTTTTTGGCTTGGGGTTATTCTGTTCTTTATAGGGATGGGCATTAATCTACATTCCGACAGTGTGATCCGCCATTTACGTAAACCGGGCGATACACGCCATTATTTGCCGCAGAAGGGAATGTACCGATATGTCACTTCGGGCAACTATTTTGGCGAGTTGGTGGAATGGATAGGGTTTGCCGTACTCACTTGTTCGCCCGCTGCATGGGTGTTTGTGCTGTGGACGTTTGCTAATCTGGCTCCACGTGCCAATTCCATCCGTAACCGTTATCGGGAAGAGTTTGGTAAGGATGCGGTAGGAAAAAAGAAAAGAATGATTCCTTTTATTTATTGA

[0035] [SEQ ID NO: 4] Bacteroides uniformis ATCC 8492 (length 771 bases) ATGAATCAGGAAACTTTTCAGATATTTCTGTGGGTAATGAGTGCTGTGGCATTGGTTGTCTTTATTGCACTCTATTTTGTCAAAGCGGGTTATGGCATGTTCCGTACTGCCTCGTGGGGAATCTCCATCAATAATAAACTGGCGTGGGTGCTTATGGAAGCGCCGGTATTCATCGTCATGTTTGGGTTGTGGGGGAAGAGTGGAGCGGGATTTGCCGTGCCGGTATATTTCTTCTTCCTGCTGTTTCAGTTGCACTATCTTCAGCGGGCCTTTATTTTTCCGTTCCTGCTGAAAGGTAAAAGCCGGATGCCGGTAGCTATTATGGCGATGGGTATCGTCTTCAACCTTTTGAACGGGATGATGCAGGCGGGCGGTTTGTTCTATTTCGCTCCCGAAGGCTTGTATGCCGATGGCTGGGCCTATTTGCTGAAACCTCATGCCTTGTTGGGAATCATTCTGTTTTTTGCAGGTATGTTCGTCAATTTGCATTCCGACTATGTGATACGTCATCTGCGCAGGCCAGGTGATACGAAGCATTATCTTCCCGGAAAAGGGCTTTACCGATACGTCACTTCTGCCAATTACTTCGGTGAACTGGTGGAATGGACGGGGTTTGCCATACTCACAGCTTCTCCCGCCGCCTGGGTGTTCGTCTGGTGGACGTTTGCCAACCTTGTTCCCCGTGCCGATGCCATTCACCGCCGTTATCGGGAGGAGTTTGGTGATGAGGCGGTAGGAAAGCGCAAACGCATCATTCCATTTCTTTATTAA

[0036] Here, as the value of the sequence identity in the case of "a DNA sequence having a high sequence identity with SEQ ID NOS: 1 to 4", for example, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, 90% or more, 95% or more, etc. can be exemplified, and 100% is also included. Note that "sequence identity" refers to sequence consistency and can be used interchangeably with "identity".

[0037] "A DNA sequence having a high sequence identity with SEQ ID NOS: 1 to 4" can also be referred to as "a DNA sequence in which one or more nucleotides are deleted, substituted, inserted, or added in SEQ ID NOS: 1 to 4". In this case, the number of nucleotides deleted, substituted, inserted, or added can be exemplified, for example, as 1 to 231, 1 to 223, 1 to 215, 1 to 208, 1 to 200, 1 to 192, 1 to 185, 1 to 177, 1 to 169, 1 to 161, 1 to 154, 1 to 115, 1 to 77, 1 to 38.

[0038] The sequence identity between a certain DNA sequence and SEQ ID NOS: 1 to 4 can be confirmed according to conventional methods. For example, it can be confirmed using programs such as FASTA (http: / / www.genome.JP / tools / fasta / ), Basic local alignment search tool (BLAST; http: / / www.ncbi.nlm.nih.gov.), Position-Specific Iterated BLAST (PSI-BLAST; http: / / www.ncbi.nlm.nih.gov.), CLUSTALW (http: / / www.genome.jp / ja / ), MAFFT (http: / / www.genome.jp / ja / ).

[0039] The amount of the 5α-reductase gene can be detected by known methods. As such a detection method, for example, when the sample is feces, the shotgun sequencing method for the total genomic DNA of intestinal bacteria extracted from a fecal sample can be exemplified. In this method, first, the genomic DNA is cleaved with a restriction enzyme or the like, and the sequences of the cleaved short DNA strands are determined. At this time, many copies are taken from the genomic DNA, and the fragments are cleaved so that the fragments overlap each other and sequenced. Finally, a long sequence is determined by connecting the overlapping portions of the DNA fragment sequences on a computer. Although this method has relatively high costs such as expenses and time, it can accurately grasp the types and amounts of genes.

[0040] On the other hand, a method of performing PCR using specific primers on the total genomic DNA of intestinal bacteria extracted from a sample (for example, a fecal sample or a cultured human intestinal tract model) can also be exemplified. According to this method, the amount of the 5α-reductase gene can be detected more quickly and inexpensively. The specific primers for amplifying the 5α-reductase gene used in this method can be designed based on the known DNA sequences of the 5α-reductase gene (for example, SEQ ID NOs: 1 to 4). The reaction conditions of PCR can also be appropriately set according to the type of sample, preparation method, primer sequence and length, type and properties of the enzyme used in the reaction, etc. More specifically, as the specific primers, for example, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6 can be exemplified. [SEQ ID NO: 5] Forward primer for amplifying 5α-reductase gene YGTMVRWGCSGGTTATGG [SEQ ID NO: 6] Reverse primer for amplifying 5α-reductase gene CCTGCATCWDHCCGTTCA

[0041] That is, the present invention provides a test kit for digestive organ cancer and a screening kit for a preventive / ameliorating agent for digestive organ cancer, which includes a PCR primer set capable of amplifying a 5α-reductase gene derived from intestinal bacteria. This kit may further include enzymes necessary for PCR reaction such as dNTP and DNA polymerase, a specimen collection instrument, a labeling substance, a reaction buffer, a washing buffer, a positive control, a negative control, and an instruction manual such as criteria for determining digestive organ cancer and an operation method.

[0042] It can be said that if the amount of the 5α-reductase gene derived from intestinal bacteria is large, the possibility of suffering from digestive organ cancer is low or the degree of progression is low, and if it is small, the possibility of suffering is high or the degree of progression is high. However, since the amount of gene purified from a biological sample such as feces (purification efficiency) is not constant, it is preferable to calculate the ratio in the total number of intestinal bacteria and make a judgment based on this ratio.

[0043] Based on the detection result of the amount of the 5α-reductase gene, a reference value for determining the presence or absence or level of the possibility of suffering / progression (severity) can be appropriately set, and it can vary depending on various factors such as the measurement method of the gene amount, the calculation method of the reference value, the gender and age of the subject group, clinical findings, and residential area. For example, when the gene amount is detected by PCR and the value obtained by dividing the "DNA copy number of the gene" by the "DNA copy number of the 16S rRNA gene" is calculated and used as the "ratio of bacteria carrying the 5α-reductase gene (5ar level)", if the 5ar level is less than 8.109, less than 5.823, less than 5.597, or less than 3.712, it is exemplified that there is a high possibility of suffering from digestive organ cancer.

[0044] In the present invention, the sample may be any that reflects the intestinal flora. Specifically, for example, feces, intestinal contents, washing liquid and body fluid (such as saliva, mucus, lymph fluid, etc.) collected during examinations such as endoscopy, mucosa of the digestive tract lumen, tissue or cells collected or excised by surgery, blood, skin, a cultured human intestinal tract model, etc. can be exemplified.

[0045] Hereinafter, the present invention will be described based on each example. The technical scope of the present invention is not limited to the features shown by these examples.

Example

[0046] <Example 1> Examination in colorectal cancer (1) Recovery of intestinal bacterial genomic DNA from intestinal lavage fluid For 140 adults, the water (intestinal lavage fluid) used for intestinal lavage in endoscopic examination of the intestine was collected. Generally, the types and numbers of bacteria contained in the intestinal lavage fluid are considered to reflect the intestinal flora of the individual. 1.8 mL of each person's intestinal lavage fluid was centrifuged at 10,000 revolutions per minute for 1 minute, and the precipitate was collected. This precipitate was subjected to QIAamp DNA Stool Mini Kit (QIAGEN) to recover the genomic DNA of intestinal bacteria.

[0047] (2) Specific primers According to the previous report (Tadashi Fujii et al., J Nutr Sci Vitaminol, 68, 446-451, 2022), the primers of SEQ ID NOs: 5 and 6 below were prepared. The primers were designed based on sequences with high identity in the alignment (290 bp) of SEQ ID NOs: 1-4, and it has been confirmed that they specifically amplify the 5α-reductase gene. ≪For amplification of 5α-reductase gene≫ Forward primer (290F); 5’- YGTMVRWGCSGGTTATGG -3’ (SEQ ID NO: 5) Reverse primer (290R); 5’- CCTGCATCWDHCCGTTCA -3’ (SEQ ID NO: 6)

[0048] In addition, the following were prepared as universal primers capable of amplifying the V3-V4 region of the 16S ribosomal RNA gene of all bacteria. ≪For amplification of 16S ribosomal RNA (V3-V4 region) gene of all bacteria≫ Forward primer; 5’- CGGTGAATACGTTCCCGG -3’ (SEQ ID NO: 7) Reverse primer; 5’- TACGGCTACCTTGTTACGACTT -3’ (SEQ ID NO: 8)

[0049] (3) Measurement of the proportion of bacteria carrying the 5α-reductase gene by quantitative PCR Using the genomic DNA recovered in Example 1(1) as a template, quantitative PCR was performed using the quantitative PCR reagent "PowerTrack SYBR Green Master Mix" (Thermo Fisher Scientific) and the primers of SEQ ID NOs: 5 and 6 above to determine the DNA copy number of the 5α-reductase gene. The PCR reaction was held at 95°C for 2 minutes, followed by 40 cycles of 10 seconds at 95°C, 15 seconds at 50°C, and 20 seconds at 72°C, and finally an extension reaction was performed at 72°C for 1 minute.

[0050] Similarly, quantitative PCR was performed using the primers of SEQ ID NOs: 7 and 8 above to determine the DNA copy number of the 16S ribosomal RNA gene. The PCR reaction was held at 95°C for 2 minutes, followed by 40 cycles of 10 seconds at 95°C, 15 seconds at 60°C, and 15 seconds at 72°C, and finally an extension reaction was performed at 72°C for 1 minute.

[0051] The DNA copy number of the 16S rRNA gene reflects the total number of bacteria, and it can be said that the DNA copy number of the 5α-reductase gene reflects the number of bacteria carrying the 5α-reductase gene. From this, the value obtained by dividing the "DNA copy number of the 5α-reductase gene" per 1 μL of the genomic DNA solution by the "DNA copy number of the 16S rRNA gene" was calculated and defined as the "proportion of bacteria carrying the 5α-reductase gene (5ar level)".

[0052] (4) Evaluation of the correlation between the 5ar level and the cancer progression degree (stage) Among 140 adults from whom intestinal lavage fluid was collected, the breakdown of the cancer stage in the intestinal lumen, based on the results of endoscopic examination, was as follows: 52 had normal epithelium, 69 had adenomas (low-grade dysplastic adenomas, moderate-grade dysplastic adenomas, and high-grade dysplastic adenomas), and 19 had cancer. Therefore, for the 5ar level in Example 1(3), the mean and median values were calculated by tabulating for each cancer stage of the subjects. Statistical analysis was performed using the medical statistical analysis software GraphPad Prism (GraphPad Software), with analysis of variance based on the Kruskal-Wallis rank and Dunn's test. The results are shown in Table 1. Also, a bar graph of the mean values is shown in Figure 1.

Table 1

[0053] As shown in Table 1 and Figure 1, both the mean and median values of the 5ar level were in the order of normal epithelium > adenoma > cancer. And the mean and median values of the 5ar level in cancer were significantly smaller than those in normal epithelium. That is, in subjects with cancer in the intestinal lumen, the proportion of bacteria carrying the 5α-reductase gene was significantly decreased compared to subjects without cancer. From this result, it became clear that the amount of the 5α-reductase gene can be an indicator for judging the likelihood of developing digestive tract cancer.

[0054] <Example 2> Study in hepatocellular carcinoma (1) Recovery of intestinal bacterial genomic DNA from feces Twenty-two patients (aged 69 - 89 years, mean age 78 years, 19 males, 3 females, etiology: 5 patients with hepatitis C virus / 17 non-viral, Child-Pugh score: 5 / 15 patients: 6 / 6 patients: 7 / 1 patient, Eastern Cooperative Oncology Group Performance Status: 0 / 12 patients: 1 / 5 patients, The Barcelona Clinic Liver Cancer stage: B / 16 patients: C / 6 patients) diagnosed with unresectable hepatocellular carcinoma by imaging diagnosis and 85 healthy subjects (aged 19 - 61 years, mean age 38.3 years, 43 males, 42 females) were used as subjects.

[0055] Feces were collected from the subjects using the feces collection kit "FS-0017" (Technosuruga Laboratory Co., Ltd.). Generally, the types and numbers of bacteria contained in feces are considered to reflect the intestinal flora of the individual. Genomic DNA of intestinal bacteria was recovered by extracting DNA from the fecal sample using the QIAamp DNA Stool Mini Kit (QIAGEN) according to the attached instructions.

[0056] (2) Measurement of the proportion of bacteria carrying the 5α-reductase gene by quantitative PCR Using the genomic DNA recovered in Example 2(1) as a template, quantitative PCR was performed by the method described in Example 1(3) to determine the DNA copy numbers of the 5α-reductase gene and the 16S ribosomal RNA gene, and the "5ar level" was calculated. For the 5ar level, the average value was calculated by tabulating for each group of healthy subjects and hepatocellular carcinoma patients. Statistical analysis was performed by the method described in Example 1(4). The results are shown in Figure 2.

[0057] As shown in Figure 2, the average value of the 5ar level was 5.15×10 -2 in the healthy subject group and 2.10×10 -2 in the patient group, and the healthy subject group was significantly larger than the patient group. That is, in the subjects with hepatocellular carcinoma, the proportion of bacteria carrying the 5α-reductase gene was significantly decreased compared with the subjects without cancer. From this result, it became clear that the amount of the 5α-reductase gene can be an indicator for judging the likelihood of developing digestive tract cancer.

Claims

1. A method for testing for digestive tract cancer, comprising detecting the amount of a 5α-reductase gene derived from intestinal bacteria in a biological sample from a subject.

2. A diagnostic marker for digestive cancer, comprising the 5α-reductase gene derived from intestinal bacteria.

3. A digestive cancer testing kit that includes a PCR primer set that can amplify the 5α-reductase gene derived from intestinal bacteria.

4. A method for screening for a preventive or ameliorating agent for digestive tract cancer, comprising detecting the amount of a 5α-reductase gene derived from enterobacteria in a sample.

Images