Elimination of PD-l1-positive malignancies by PD-l1 chimeric antigen receptor-expressing NK cells

Abstract

To provide an effective cancer therapy that targets both the tumor cells and the cells in the tumor microenvironment.SOLUTION: A recombinant NK-92 cell comprises a recombinant nucleic acid encoding a recombinant chimeric antigen receptor (CAR) that binds to PD-L1, an Fc receptor, and a suicide gene, wherein the recombinant NK-92 cell expresses the CAR and the Fc receptor on its surface.SELECTED DRAWING: Figure 2

Description

Technical Field

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 753,740, filed Oct. 31, 2018, which is hereby incorporated by reference in its entirety.

[0002] Sequence Listing The content of the ASCII text file of the sequence listing named 104077.0006PCT_ST25_REV006 with a size of 40 kb was created on Jul. 26, 2019, and was electronically submitted via EFS-Web together with this application and is hereby incorporated by reference in its entirety.

Background Art

[0003] Cancer cells in solid tumors can form a tumor microenvironment around them to support the growth and metastasis of cancer cells. The tumor microenvironment can promote tumorigenic transformation, support tumor growth and invasion, protect the tumor from the host immune system, enhance treatment resistance, and provide a niche for the growth of latent metastases. The tumor and its surrounding microenvironment are closely related and constantly interact. The tumor can affect its microenvironment by releasing extracellular signals, promoting tumor angiogenesis, and inducing peripheral immune tolerance, while immune cells in the microenvironment can affect the growth and evolution of cancerous cells. See Swarts et al., “Tumor Microenvironment Complexity: Emerging Roles in Cancer Therapy,” Cancer Res, vol., 72, pages 2473-2480, 2012.

[0004] Natural killer (NK) cells are cytotoxic lymphocytes that constitute a major component of the innate immune system. Natural killer (NK) cells generally account for about 10-15% of circulating lymphocytes and bind to and kill target cells, such as virus-infected cells and many malignant tumor cells, non-specifically with respect to antigens and without prior immunization. Herberman et al., Science 214:24 (1981). Killing of target cells occurs by induction of cytolysis. NK cells used for this purpose are isolated from the peripheral blood lymphocyte ("PBL") fraction of blood from a subject, expanded in cell culture to obtain a sufficient number of cells, and then reinjected into the subject. Such autologous NK cells have shown some efficacy in both ex vivo therapy and in vivo treatment. However, such therapies are limited to autologous situations and are further complicated by the fact that not all NK cells are cytolytic.

[0005] Currently, CAR-T therapy has become a common therapy for targeting immune cells in the tumor microenvironment. However, since many of the target antigens are also expressed on normal precursor cells, these CAR-T therapies often cause cytopenia and reduction of bone marrow precursors in in vivo models, suggesting that tumor antigen-specific CAR-T cells that are permanently expressed have unacceptable toxicity for patients. Furthermore, CAR-T technology relies on genetic manipulation of autologous T cells, which results in significant inter-patient variability and exclusion of a large number of patients who cannot expand T cells. Therefore, there is still a need for an effective cancer therapy that targets both tumor cells and cells in the tumor microenvironment. Summary of the Invention Means for Solving the Problems

[0006] In some embodiments, the present disclosure provides modified NK-92® cells that express a PD-L1 CAR and an Fc receptor. In some embodiments, the modified NK-92® cells comprise a multicistronic construct that encodes a PD-L1 CAR and an Fc receptor. In some embodiments, the Fc receptor is CD16. In some embodiments, the Fc receptor comprises SEQ ID NO: 2. In some embodiments, the multicistronic transgene further comprises a sequence encoding IL-2 or a variant thereof. In some embodiments, the PD-L1 CAR, the Fc receptor, and / or IL2 are encoded by codon-optimized nucleic acid sequences. In some embodiments, the IL-2 variant is erIL-2.

[0007] In some embodiments, one or more coding sequences of the PD-L1 CAR, the Fc receptor, or erIL-2 are codon-optimized for expression in a human system. In some embodiments, the modified NK-92® cells can kill PD-L1-expressing cells. In some embodiments, the PD-L1-expressing cells are myeloid-derived suppressor cells (MDSCs) or tumor cells. In some embodiments, the PD-L1 CAR comprises a scFv antibody fragment. In some embodiments, the modified NK-92® cells comprise a sequence encoding a self-cleaving peptide that is located between the PD-L1 CAR and CD16 and enables equimolar expression of the PD-L1 CAR and the FcR. In some embodiments, the modified NK-92® cells comprise an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof.

[0008] In some embodiments, the direct cytotoxicity of the modified NK-92® cells against PD-L1-expressing cells is 40-100% when the effector-to-target ratio is 10. In some embodiments, the direct cytotoxicity of the modified NK-92® cells against PD-L1-expressing cells is higher than that of aNK® cells. In some embodiments, the ADCC activity of the modified NK-92® cells is 20%-60% when the effector-to-target ratio is 10. In some embodiments, the PD-L1 CAR comprises a sequence sharing at least 90% identity with SEQ ID NO: 10 (in particular, the CDR sequences within SEQ ID NO: 10). In some embodiments, the present disclosure provides a kit comprising a pharmaceutical composition comprising the modified NK-92® cells disclosed above. In some embodiments, the present disclosure provides a method of generating modified NK-92® cells, the method comprising providing vectors encoding a PD-L1 CAR and CD16, and introducing the vectors into NK-92® cells to generate modified NK-92® cells.

[0009] In some embodiments, the vector further comprises a sequence encoding IL-2. In some embodiments, the vector comprises a sequence encoding a self-cleaving peptide, the sequence being located between the CAR and CD16, the sequence enabling equimolar expression of the CAR and CD16. In some embodiments, the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 coding sequence. In some embodiments, the present disclosure provides a method of killing PD-L1-expressing cells, the method comprising incubating myeloid-derived immunosuppressive cells (MDSC), tumor-associated macrophages (TAM), or tumor cells with a plurality of the modified NK-92® cells according to any one of claims 1-17, thereby killing the MDSC, TAM, or tumor cells.

[0010] In some embodiments, the PD-L1-expressing cells are tumor cells or cells in the tumor microenvironment. In some embodiments, the cells in the microenvironment are myeloid-derived suppressor cells (MDSC) or tumor-associated macrophages (TAM). In some embodiments, MDSC cells express CD14 or CD15. In some embodiments, TAM expresses one or more of CD68 and CD206, CD204, or CD163. In some embodiments, the present disclosure provides a method of killing myeloid-derived suppressor cells (MDSC), tumor-associated macrophages, or tumor cells in a subject, comprising administering to the subject a therapeutically effective amount of a composition, the composition comprising a plurality of the modified NK-92® cells described above.

[0011] In some embodiments, about 1×10 2 per square meter of the subject's body surface area 8 to about 1×10 11 modified cells are administered to the subject. In some embodiments, the present disclosure provides a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition, the composition comprising any of the plurality of modified NK-92® cells described above. In some embodiments, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, gastric cancer, prostate cancer, squamous cell carcinoma, head and neck cancer, colon cancer, pancreatic cancer, uterine cancer, renal cell carcinoma, glioblastoma, medulloblastoma, sarcoma, and lung cancer. In some embodiments, the cells are administered intravenously. In some embodiments, the cells are administered intratumorally.

[0012] In some embodiments, the present disclosure provides a method of killing myeloid-derived suppressor cells (MDSC) or tumor cells in a subject, comprising administering to the subject a therapeutically effective amount of a first composition and a second composition, the first composition comprising a plurality of NK-92® cells, and the second composition comprising an anti-PD-L1 antibody.

[0013] In some embodiments, NK-92® cells express Fc receptors. In some embodiments, NK-92® cells are haNK® cells. In some embodiments, the second composition is abelumab.

[0014] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the present disclosure. Other objectives, advantages, and novel features will be readily apparent to those skilled in the art.

[0015] The objectives, features, and advantages will be more readily recognized when considered in conjunction with the accompanying drawings and when reference is made to the following disclosure.

Brief Description of the Drawings

[0016]

Figure 1

Figure 2

Figure 3

Figure 4

Figures 5A-C

Figures 6A-B

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

[0017] Overview The present disclosure provides NK-92™ cells expressing a combination of a PD-L1 CAR, an Fc receptor, and IL2. These cells can target both tumor cells and cells in the tumor microenvironment and effectively treat cancer.

[0018] Terms Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0019] As used herein, and in the following claims, reference is made to a number of terms that are defined to have the following meanings.

[0020] The terms used herein are for the purpose of describing particular embodiments only and are not limiting. The singular forms "a", "an", and "the" as used herein include the plural forms as well, unless the context clearly dictates otherwise. Thus, for example, reference to "natural killer cells" includes a plurality of natural killer cells.

[0021] All numerical designations, for example, pH, temperature, time, concentration, amount, and molecular weight, are approximate values that vary, as appropriate, by increments of 0.1 or 1.0 (+) or (-), including ranges. It should be understood that although not always explicitly stated, the term "about" may precede all numerical designations.

[0022] As used herein, when “+” is used to indicate the presence of a particular cell marker, it means that the cell marker is detectably present relative to an isotype control in fluorescence-activated cell sorting; or is detectable above background in quantitative or semi-quantitative RT-PCR.

[0023] As used herein, when “-” is used to indicate the presence of a particular cell marker, it means that the cell marker is not detectably present relative to an isotype control in fluorescence-activated cell sorting; or is not detectable above background in quantitative or semi-quantitative RT-PCR.

[0024] As will be understood by those skilled in the art, for any and all purposes, particularly with respect to the provision of written descriptions, all ranges disclosed herein include any and all conceivable sub-ranges and combinations of those sub-ranges. Any recited range can be readily recognized as being fully described and thus enabled if the same range is divided into at least equal halves, thirds, quarters, fifths, tenths, etc. Non-limiting examples include that each range disclosed herein can be readily divided into lower one-third, middle one-third, and upper one-third, etc. Similarly, as will be understood by those skilled in the art, all language such as “up to,” “at least,” “greater than,” “less than,” etc., refers to a number including the recited number and ranges that can be subsequently divided into the above sub-ranges. Finally, as will be understood by those skilled in the art, ranges include each and every individual member. Thus, for example, a group having 1 to 3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells refers to a group having 1, 2, 3, 4, or 5 cells, and so on.

[0025] As used herein, the term "substantially identical" is used interchangeably with the terms "equivalent" or "substantially similar" and, when referring to a quantifiable property of NK-92™ cells, such as cytotoxicity, viability, or cell doubling time, means that two measurements of those properties differ from each other by no more than 15%, no more than 10%, no more than 8%, or no more than 5%.

[0026] Although not always explicitly stated, it should also be understood that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

[0027] For the purposes of the present invention, and unless otherwise indicated, the term "NK-92™" shall be taken to refer to the original NK-92™ cell line as well as NK-92™ cell lines, clones of NK-92™ cells, and NK-92™ cells modified (e.g., by introduction of exogenous genes). NK-92™ cells and exemplary and non-limiting modifications thereof are all described in U.S. Patent Nos. 7,618,817; 8,034,332; 8,313,943; 9,181,322; 9,150,636; and U.S. Patent Application Publication No. 10 / 008,955, which are hereby incorporated by reference in their entireties, and include, by way of example, wild-type NK-92™, NK-92™-CD16, NK-92™-CD16-γ, NK-92™-CD16-ζ, NK-92™-CD16(F176V), NK-92™MI, and NK-92™CI. NK-92™ cells are known to those of skill in the art and such cells are readily available from NantKwest, Inc.

[0028] As used herein, the term "NK-92™ cell" refers to natural killer cells derived from the highly potent and unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights to which are held by NantKwest (hereinafter, "NK-92™ cells").

[0029] As used herein, the term "aNK™ cells" refers to unmodified natural killer cells derived from the highly potent and unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights to which are owned by NantKwest (hereinafter, "aNK™ cells").

[0030] As used herein, the term "haNK® cells" refers to natural killer cells derived from the highly potent and unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights to which are owned by NantKwest and which have been modified to express CD16 on the cell surface (hereinafter, "CD16+NK-92™ cells" or "haNK® cells").

[0031] As used herein, the term "taNK® cells" refers to natural killer cells derived from the highly potent and unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights to which are owned by NantKwest and which have been modified to express a chimeric antigen receptor (hereinafter, "CAR-modified NK-92™ cells" or "taNK® cells").

[0032] As used herein, the term "t-haNK™ cells" refers to natural killer cells derived from the highly potent and unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), which are owned by NantkWest, express CD16 on the cell surface, and have been modified to express a chimeric antigen receptor (hereinafter, "CAR-modified CD16+NK-92™ cells" or "t-haNK cells"). In some embodiments, the tumor-specific antigen is PD-L1, and those NK-92™ cells are referred to as PD-L1 t-haNK cells.

[0033] As used herein, the term "multicistronic construct" refers to a recombinant DNA construct that can be transcribed into a single mRNA molecule, which encodes two or more transgenes. A multicistronic construct is referred to as a bicistronic construct when it encodes two transgenes, a tricistronic construct when it encodes three genes, a quadricistronic construct when it encodes four genes, and so on.

[0034] As used herein, the term "chimeric antigen receptor" (CAR) refers to an extracellular antigen-binding domain fused to an intracellular signaling domain. CARs can be expressed in T cells or NK cells to increase cytotoxicity. Generally, the extracellular antigen-binding domain is an scFv specific for an antigen found on the target cell. CAR-expressing NK-92™ cells are targeted to cells expressing an antigen on the cell surface based on the specificity of the scFv domain. The scFv domain can be genetically engineered to recognize any antigen, for example, tumor-specific antigens and virus-specific antigens. For example, a PD-L1 CAR recognizes PD-L1, a cell surface marker expressed by some cancers.

[0035] As used herein, the term "tumor-specific antigen" refers to an antigen that is present on cancer or neoplastic cells but is not detectable on normal cells derived from the same tissue or lineage as the cancer cells. The tumor-specific antigens used herein also refer to tumor-associated antigens, i.e., antigens that are expressed on cancer cells at higher levels compared to normal cells derived from the same tissue or lineage as the cancer cells.

[0036] As used herein, the term "target" when referring to tumor targeting refers to the ability of NK-92™ cells to recognize and kill tumor cells (i.e., target cells). The term "targeted" in this context refers to the ability of a CAR expressed by NK-92™ cells to recognize and bind to a cell surface antigen expressed by a tumor.

[0037] The term "antibody" refers to an intact immunoglobulin of any isotype, or a fragment thereof that can compete with an intact antibody for specific binding to a target antigen, including chimeric, humanized, fully human, and bispecific antibodies. Intact antibodies generally include at least two full-length heavy chains and two full-length light chains, although in some instances they may include fewer chains; for example, antibodies that occur naturally in camels may include only heavy chains. Antibodies can be derived solely from a single source or can be "chimeric" such that different portions of the antibody are derived from two different antibodies. Antigen-binding proteins, antibodies, or binding fragments can be produced by recombinant DNA techniques in hybridomas or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise indicated, the term "antibody" includes antibodies containing two full-length heavy chains and two full-length light chains, as well as derivatives, variants, fragments, and muteins thereof. Further, unless explicitly excluded, antibodies include monoclonal antibodies, bispecific antibodies, minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), and fragments thereof. In some embodiments, the term also includes peptibodies.

[0038] The term "subject" refers to non-human animals, such as mammals, for example, cats, dogs, cows, horses, pigs, sheep, and goats, as well as humans. The term "subject" also refers to a patient in need of treatment for a disease described herein.

[0039] "Optionally" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes examples in which the event or circumstance occurs and examples in which it does not.

[0040] The term "comprising" is intended to mean that the compositions and methods include the recited elements but are not to be construed as excluding other elements. "Consisting essentially of" when used to define compositions and methods is intended to mean excluding any other elements of any essential significance to the combination. For example, a composition consisting essentially of the elements defined herein does not exclude other elements that do not substantially affect the basic and novel characteristics of the claimed invention. "Consisting of" is intended to exclude other ingredients in amounts greater than trace amounts and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of the present disclosure.

[0041] As used herein, the terms "cytotoxic" and "cytolytic" are to be considered synonymous when used to describe the activity of effector cells, e.g., NK cells. In general, cytotoxic activity relates to the killing of target cells by any of a variety of biological, biochemical, or biophysical mechanisms. Cytolysis more specifically refers to the activity of an effector to lyse the plasma membrane of a target cell, thereby disrupting its physical integrity. This results in the killing of the target cell. Without wishing to be bound by theory, the cytotoxic effects of NK cells are thought to be due to cytolysis.

[0042] The term "kill" with respect to a cell / cell population is intended to include any type of manipulation that results in the death of that cell / cell population.

[0043] The term "cytokine" refers to a general class of biomolecules that affect cells of the immune system. Exemplary cytokines include, but are not limited to, FLT3 ligand, interferons, and interleukins (IL), particularly IL-2, IL-12, IL-15, IL-18, and IL-21.

[0044] The terms "patient", "subject", "individual", etc. are used interchangeably herein and refer to any animal suitable for the methods described herein, or to its cells, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0045] The term "treat" or "treatment" encompasses the treatment of a disease or disorder described herein in a subject, e.g., a human, and includes (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) alleviating a disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of a disease or disorder. The terms "administer" or "administration" of a monoclonal antibody or natural killer cell to a subject includes any route by which the antibody or cell is introduced or delivered to effect the desired function. Administration can be effected by any route suitable for delivery of the cell or monoclonal antibody. Thus, examples of delivery routes include intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, the modified NK-92™ cells are administered directly to a tumor, e.g., by injection into the tumor. In some embodiments, the modified NK-92™ cells described herein are administered parenterally, e.g., by injection, infusion, or implantation (subcutaneous, intravenous, intramuscular, intracavitary, or intraperitoneal).

[0046] The term "expression" refers to the production of a gene product.

[0047] As used herein, the term "cytotoxicity", when used to describe the activity of effector cells, e.g., NK cells, relates to the killing of target cells by any of a variety of biological, biochemical, or biophysical mechanisms.

[0048] The terms "reduce", "reduced", "reduction" and "decrease" are all used herein to refer to a decrease of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or a maximum 100% decrease (i.e., a level of non-existence compared to a reference sample), or any decrease from 10 to 100% compared to a reference level.

[0049] The term "cancer" refers to all types of cancer, neoplasms, or malignancies found in mammals, by way of example, leukemia, carcinomas and sarcomas. Exemplary cancers include cancers of the brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus, and medulloblastoma. Additional examples include Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, essential thrombocythemia, primary macroglobulinemia, primary brain tumors, carcinomas, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, hypercalcemia of malignancy, endometrial cancer, adrenocortical carcinoma, neoplasms of the endocrine and exocrine pancreas, and prostate cancer.

[0050] The term "therapeutically effective amount" or "effective amount" refers to the amount required to ameliorate the symptoms of a disease in a non-treated patient. The effective amount of the active compound used to practice the present disclosure for the treatment of a disease will vary depending on the mode of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.

[0051] The term "tumor microenvironment" refers to the cellular environment in which a tumor exists, including surrounding blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells, signaling molecules, and the extracellular matrix. Exemplary types of cells in the tumor microenvironment include, but are not limited to, myeloid-derived suppressor cells (MDSC) and tumor-associated macrophages (TAM).

[0052] The term "immune cell" refers to hematopoietic-derived cells involved in the specific recognition of antigens. Immune cells include antigen-presenting cells (APC), such as dendritic cells or macrophages, B cells, T cells, natural killer cells, myeloid-derived suppressor cells (MDSC), and myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0053] Titles or subtitles can be used in this specification for the convenience of the reader and they do not affect the scope of the present disclosure. Further, some of the terms used in this specification are defined more specifically below.

[0054] MDSC Myeloid-derived suppressor cells (MDSC) are one of the main immunosuppressive cells in the tumor microenvironment. The tumor microenvironment interferes with the interaction of immune-active cells, such as NK cells, with tumor cells and their attack and killing of them. These negative paralyzing effects can be mediated by the metabolic and secreted products of immunosuppressive cells present in the tumor microenvironment.

[0055] MDSCs are regulators of the immune response in cancer and other pathological conditions, such as myelodysplastic syndromes (MDS) (see, e.g., Bronte et al., Nature Communications, 6 Jul 2016, 7:12150, DOI:10.1038 / ncomms12150; Eksioglu et al., “Novel Therapeutic Approach to Improve Hematopoiesis in low risk MDS by Targeting myeloid-derived suppressor cells with The Fc-engineered CD33 Antibody BI 836858,” Leukemia. 2017 October; 31(10):2172-2180.doi:10.1038 / leu.2017.21). Myeloid-derived suppressor cells are a heterogeneous group of immune cells from the myeloid lineage, such as early myeloid precursors, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. Myeloid-derived suppressor cells expand strongly as a result of altered hematopoiesis in pathological situations, such as chronic infection and cancer (see, e.g., Eksioglu et al., “Novel Therapeutic Approach to Improve Hematopoiesis in low risk MDS by Targeting myeloid-derived suppressor cells with The Fc-engineered CD33 Antibody BI 836858,” Leukemia. 2017 October; 31(10):2172-2180.doi:10.1038 / leu.2017.21).

[0056] Myeloid-derived suppressor cells are distinguished from other myeloid cell types by their possession of potent immunosuppressive activity rather than immunostimulatory properties. Similar to other myeloid cells, myeloid-derived suppressor cells interact with other immune cell types, such as T cells, dendritic cells, macrophages, and natural killer cells, to regulate their functions. Myeloid-derived suppressor cells can suppress both the cytotoxic activities of natural killer (NK) cells and NKT cells, as well as the adaptive immune responses mediated by CD4+ and CD8+ T cells. Although these mechanisms of action are not fully understood, clinical and experimental evidence indicates that cancer tissues with high infiltration of myeloid-derived suppressor cells are associated with poor patient prognosis and resistance to treatment modalities.

[0057] The accumulation of MDSCs in the peripheral circulation is associated with and correlates with the disease stage. MDSCs are mainly involved in promoting tumor growth by suppressing antitumor immunity. There is also compelling evidence that MDSCs are involved in angiogenesis and metastatic dissemination.

[0058] Two main subsets of MDSCs have been identified in cancer patients: a monocytic subset characterized by the expression of CD14, and a granulocytic subset characterized by the expression of CD15. Both subsets of MDSCs actively suppress host immunity through various mechanisms, such as the production of reactive oxygen species and arginase. Similar to humans, the accumulation of monocytic and granulocytic MDSCs has been noted in the bone marrow, spleen, peripheral circulation, and tumors of tumor-bearing mice. Good targeting of MDSCs in mice is associated with improved immune responses, delayed tumor growth, improved survival, and increased efficacy of vaccination therapy. In tumors, monocyte-derived MDSCs rapidly differentiate into tumor-associated macrophages (TAMs).

[0059] Tumor-associated macrophages Tumors are often associated with immune infiltration as part of a reactive stroma in which macrophages are concentrated. Typically, macrophages are classified into M1 and M2 macrophages, which have opposite effects on tumor growth: M1 macrophages inhibit tumor cell growth, while M2 macrophages promote tumorigenesis. Tumor cells direct macrophages to an M2-like phenotype via chemokines and polarized cytokines, assisting their avoidance from destruction and promoting their development. These M2 macrophages are generally referred to as tumor-associated macrophages (TAM). TAM reside in the tumor microenvironment and play an important role in facilitating tumor growth by promoting angiogenesis and matrix degradation. Consequently, many tumors with numerous TAM have an increased tumor growth rate, local proliferation, and distant metastasis.

[0060] TAM express CD68 as well as other markers, for example, some TAM express one or more of the following markers CD206, CD204, or CD163.

[0061] NK-92™ cells NK-92™ is a cytolytic cancer cell line that was discovered in the blood of a subject suffering from non-Hodgkin lymphoma and then immortalized in vitro. NK-92™ cells are derived from NK cells, but lack the major inhibitory receptors displayed by normal NK cells while retaining the majority of activating receptors. However, NK-92™ cells do not attack normal cells, nor do they induce an unacceptable immune rejection response in humans. The characterization of the NK-92™ cell line is disclosed in International Publication No. WO 98 / 49268 and U.S. Patent Application Publication No. 2002-0068044. NK-92™ cells are being evaluated as a therapeutic agent in the treatment of certain cancers.

[0062] Vector Vectors for transfecting cells to produce the modified cells described herein are described herein. In one embodiment, the vectors described herein are transient expression vectors. The exogenous transgenes introduced using such vectors are not integrated into the nuclear genome of the cells; thus, in the absence of vector replication, the transgenes are degraded or diluted over time.

[0063] In one embodiment, the vectors described herein enable stable transfection of cells. In one embodiment, the vector enables the incorporation of the transgene into the genome of the cell. In one embodiment, the vector has a positive selection marker. Examples of positive selection markers include any gene that allows cells to grow under conditions that kill cells that do not express any gene. Non-limiting examples include antibiotic resistance, such as geneticin (Neo gene from Tn5).

[0064] In one embodiment, the vector is a plasmid vector. In one embodiment, the vector is a viral vector. As will be understood by those skilled in the art, any suitable vector can be used. Suitable vectors are well known in the art.

[0065] In some embodiments, the cells are transfected with mRNA encoding a protein of interest (e.g., CAR). Transfection with mRNA results in transient expression of the protein. In one embodiment, transfection of mRNA into NK-92™ cells is performed immediately prior to administration of the cells. In one embodiment, "immediately prior" to administration of the cells refers to about 15 minutes to about 48 hours before administration. Preferably, mRNA transfection is performed about 5 hours to about 24 hours before administration.

[0066] PD-L1 Programmed death ligand 1 (PD-L1) is an inhibitory ligand that binds to PD-1 and suppresses T cell activation. PD-L1 is constitutively expressed and induced in tumor cells. PD-L1 is also expressed in MDSCs. It has been reported that the number of PD-L1-expressing MDSCs is significantly increased in tumor-bearing mice compared to tumor-free mice, and that PD-L1 expression is significantly higher in tumor-infiltrating MDSCs compared to lymphoid organs. See Lu et al., J. Immunol., May 1, 2017, 198 (1 Supplement)124.9. PD-L1 is also expressed in tumor-associated macrophages (TAMs), and its TAM expression can directly induce T cell apoptosis after receptor binding. Kuang et al., J. Exp. Med. 2009;206:1327-1337.

[0067] CAR Phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are often associated with one or more changes in the expression of specific gene products, for example, loss of normal cell surface components or acquisition of other cell surface components (i.e., antigens not detectable in the corresponding normal, non-cancerous tissue). Antigens that are expressed in neoplastic or tumor cells but not in normal cells, or that are expressed in neoplastic cells at levels substantially above those found in normal cells, are referred to as "tumor-specific antigens" or "tumor-associated antigens." Tumor-specific antigens are used as targets for cancer immunotherapy. One such therapy utilizes chimeric antigen receptors (CARs) expressed on the surface of immune cells, such as T cells and NK cells, to improve cytotoxicity against cancer cells. A CAR contains a single-chain variable fragment (scFv) that binds to at least one intracellular signaling domain. The scFv recognizes and binds to an antigen on a target cell (e.g., a cancer cell) and triggers effector cell activation. The signaling domain contains an immunoreceptor tyrosine-based activation motif (ITAM) that is important for intracellular signaling by the receptor.

[0068] The present disclosure provides NK-92™ cells that are genetically engineered to express at least a chimeric antigen receptor (CAR) on the cell surface. The CAR combines an extracellular antigen recognition portion (usually derived from the variable domain of a specific antibody, which recognizes a specific antigen and can trigger a cytolytic response) with an intracellular signaling domain (having a single or additional co-stimulatory element). There are multiple types of CARs, and all of them can be used in the present application. First-generation CARs contain one cytoplasmic signaling domain. The signaling domain can be derived, for example, from Fc epsilon receptor gamma (FcεRIγ) containing one immunoreceptor tyrosine-based activation motif (ITAM), or from CD3ζ containing three ITAMs. CD3ζ CARs are thought to be more efficient than FcεRIγ CARs in tumor eradication. See, for example, Haynes, et al. 2001, J. Immunology 166:182-187; Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304. Second- and third-generation CARs combine multiple signaling domains, such as the cytoplasmic signaling domain of CD3ζ and co-stimulatory signaling domains, such as CD28 / CD134 / CD137 / ICOS and CD28 / CD134, with a single CAR to promote the activation and proliferation of NK-92™ cells. Thus, in some embodiments, the PD-L1 CAR expressed by PD-L1 t-haNK cells includes the hinge region from CD8 and / or the transmembrane domain of CD28. In some embodiments, the PD-L1 CAR includes the cytoplasmic signaling domain of FcεRIγ. In some embodiments, the PD-L1 CAR includes the cytoplasmic signaling domain of CD3ζ. Examples of the hinge region, the transmembrane domain of CD28, and the cytoplasmic signaling domain of FcεRIγ or CD3ζ are disclosed in U.S. Provisional Patent Application No. 62 / 674,936, the entire content of which is incorporated herein by reference.Conventional publications, for example, Haynes, et al. 2001, J. Immunology 166:182-187 and Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304 disclose that CD3ζ CAR may be more effective than FcεRIγ CAR in tumor eradication. However, in the present case, the inventors have surprisingly and unexpectedly found that such is not applicable to the cells, compositions, and methods disclosed herein. In fact, the inventors have found that NK-92 cells containing a first-generation CAR comprising an intracellular domain from FcεRIγ having only one ITAM domain have equal or greater cytotoxic activity against cancer cells expressing an antigen recognized by the CAR compared to NK-92 cells expressing a CAR having a CD3ζ signaling domain with three ITAM domains, even when the three ITAM domains are combined with other signaling domains (i.e., second or third-generation CAR; data not shown here). An exemplary CAR is schematically illustrated in FIG. 1. In particular, the IgE receptor (FcεRI) in its native context contains two gamma chains that are linked to each other via disulfide bonds and is normally expressed only in eosinophils, basophils, and epidermal Langerhans cells. The inventors have also made the unexpected discovery that a CAR comprising an intracellular domain from FcεRIγ is expressed on the surface of NK-92 cells at a higher level than other CARs, particularly those comprising a CD3ζ signaling domain.

[0069] Optionally, the CAR is specific for PD-L1. In some embodiments, PD-L1 is human PD-L1. In some embodiments, the PD-L1 CAR comprises the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the PD-L1 CAR has the amino acid sequence of SEQ ID NO: 14.

[0070] In some embodiments, the PD-L1 CAR polypeptide comprises a sequence that shares at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity with SEQ ID NO: 10 or the CDR sequence portion within SEQ ID NO: 10. In some embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the polypeptide to facilitate cell surface detection by use of anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0071] In the examples, variant polypeptides are made using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985) or other known techniques are performed on the cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0072] In some embodiments, the polynucleotide encoding the PD-L1 CAR is mutated to change the amino acid sequence encoding the CAR without changing the function of the CAR. For example, polynucleotide substitutions that result in amino acid substitutions at "non-essential" amino acid residues can be made in SEQ ID NO: 9, which is a codon-optimized sequence encoding the scFv portion of the PD-L1 CAR.

[0073] Conservative substitutions in SEQ ID NO:9 that replace one class of amino acids with another amino acid of the same class fall within the scope of the disclosed variants so long as such substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those of skill in the art. Non-conservative substitutions that affect the structure of the polypeptide backbone, such as, for example, beta-sheet or alpha-helical secondary structure, charge, hydrophobicity, or bulk of the side chain in the target site may alter polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of one of these classes with another class. Substitutions can be introduced at conserved substitution sites or, more preferably, at non-conserved sites.

[0074] In one example, variant polypeptides are produced using methods known in the art such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-specific mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985) or other known techniques can be performed on the cloned DNA to generate variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0075] In some cases, PD-L1 t-haNK cells can be used to treat cancer, particularly cancers that express PD-L1. In some cases, the cancer is leukemia (e.g., acute leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemia (e.g., chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenström macroglobulinemia, heavy chain disease, solid tumors, such as, but not limited to, sarcoma and carcinoma, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver cancer, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma, selected from the group consisting of.

[0076] Fc receptor In some embodiments, NK-92™ cells are modified to express at least one Fc receptor, such that at least one Fc receptor is displayed on the cell surface of the NK-92™ cells. Fc receptors bind to the Fc portion of antibodies. Several Fc receptors are known and differ by their preferred ligands, affinities, expression, and effects after binding to antibodies.

[0077] [Table 1]

[0078] [Table 2]

[0079] In some embodiments, NK-92™ cells are modified to express an Fc receptor protein on the cell surface.

[0080] In some embodiments, the Fc receptor is CD16. For the purposes of the present disclosure, the specific amino acid residues of CD16 are designated with reference to SEQ ID NO: 2, or SEQ ID NO: 1 which differs from SEQ ID NO: 2 at one position. Thus, the amino acid residue “at position 158” of the CD16 polypeptide is the amino acid residue corresponding to position 158 of SEQ ID NO: 2 (or SEQ ID NO: 1) when the CD16 polypeptide and SEQ ID NO: 2 are maximally aligned. In some embodiments, NK-92™ cells are modified to express human CD16 having the mature form of the protein, e.g., phenylalanine at position 158 of SEQ ID NO: 1. In exemplary embodiments, NK-92™ cells are modified to express the high affinity form of human CD16 having the mature form of the protein, e.g., valine at position 158 of SEQ ID NO: 2. Position 158 of the mature protein corresponds to position 176 of the CD16 sequence including the native signal peptide. In some embodiments, the CD16 polypeptide is encoded by a polynucleotide encoding the precursor (i.e., having the native signal peptide) polypeptide sequence of SEQ ID NO: 3 or SEQ ID NO: 4. Thus, in one embodiment, the Fc receptor comprises FcγRIII-A (CD16). In some embodiments, NK-92™ cells are genetically modified to express an Fc receptor-encoding polypeptide having at least 90% sequence identity to SEQ ID NO: 1 (FcγRIII-A or CD16 having phenylalanine at position 158 (F-158)); or at least 90% identity to SEQ ID NO: 2 (CD16 having valine at position 158 (F158V), higher affinity form).

[0081] In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with a polynucleotide sequence encoding full-length native-occurring CD16 that includes a signal peptide having phenylalanine at position 176 (corresponding to position 158 of the mature CD16 protein). In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with a polynucleotide sequence encoding full-length native-occurring CD16 that includes a signal peptide having valine at position 176 (corresponding to position 158 of the mature protein). In some embodiments, the polynucleotide encoding CD16 has at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 5 and includes a codon encoding valine at the position of the polynucleotide encoding position 176 of the full-length CD16 polypeptide that includes a signal peptide. In some embodiments, the polynucleotide encoding CD16 includes SEQ ID NO: 5 but has a codon encoding valine at position 176 of the full-length CD16.

[0082] In some embodiments, the CD16 polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 2 and contains valine at position 158 as determined with reference to SEQ ID NO: 2. In some embodiments, the polynucleotide encodes SEQ ID NO: 2. In some embodiments, the CD16 polynucleotide encodes a chimeric receptor comprising the extracellular domain of CD16, with or without a signal sequence, or any other fragment of full-length CD16, or at least a partial sequence of CD16 fused to the amino acid sequence of another protein. In other embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the mature polypeptide to facilitate cell surface detection by use of anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0083] In some embodiments, the homologous CD16 polynucleotide can be about 150 to about 700, about 750, or about 800 polynucleotides in length, but CD16 variants having more than 700 to 800 polynucleotides are within the scope of the present disclosure.

[0084] Examples of homologous polynucleotide sequences include those encoding a polypeptide sequence encoding a variant of CD16. Also included as homologous polynucleotide sequences are naturally occurring allelic variations with respect to SEQ ID NO: 1. Transfection of NK-92™ cells with a polypeptide having the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 2, a naturally occurring variant thereof, or any polynucleotide encoding a sequence that is at least 70% identical, or at least 80%, 90%, or 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2 is within the scope of the present disclosure. In some embodiments, the homologous polynucleotide sequence encodes a conservative amino acid substitution in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, NK-92™ cells are transfected using a degenerate homologous CD16 polynucleotide sequence that differs from the native polynucleotide sequence but encodes the same polypeptide.

[0085] In other examples, NK-92™ cells are modified using cDNA sequences having polymorphisms that alter the CD16 amino acid sequence, such as allelic variations between individuals that exhibit genetic polymorphisms in the CD16 gene. In other examples, NK-92™ cells are modified using the CD16 gene from other species having a polynucleotide sequence different from the sequence of SEQ ID NO: 1.

[0086] Variant polypeptides can be made using methods known in the art, such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-specific mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985) or other known techniques can be performed on the cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0087] In some embodiments, a polynucleotide encoding CD16 is mutated to change the amino acid sequence encoding CD16 without changing the function of CD16. For example, polynucleotide substitutions that result in amino acid substitutions at "non-essential" amino acid residues can be made in SEQ ID NO: 1 or SEQ ID NO: 2.

[0088] Conservative substitutions in SEQ ID NO: 1 or SEQ ID NO: 2 that replace one class of amino acids with another amino acid of the same class fall within the scope of the disclosed CD16 variants as long as the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those of skill in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, such as a β-sheet or α-helical conformation, (2) charge, (3) hydrophobicity, or (4) the bulk of the side chain at the target site may modify CD16 polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of those classes with another. Substitutions can be introduced at conservative substitution sites or more preferably, within non-conserved sites.

[0089] In some embodiments, the CD16 polypeptide variant is at least 200 amino acids in length and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant is at least 225 amino acids in length and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant has a valine at position 158 as determined with reference to SEQ ID NO: 2.

[0090] In some embodiments, the nucleic acid encoding the CD16 polypeptide may encode a CD16 fusion protein. The CD16 fusion polypeptide includes any portion of CD16 or the entire CD16 that is fused to a non-CD16 polypeptide. The fusion polypeptide is readily produced using recombinant methods. For example, a polynucleotide encoding a CD16 polypeptide, such as SEQ ID NO: 1 or SEQ ID NO: 2, is fused in-frame with a non-CD16 encoding polynucleotide (e.g., a polynucleotide sequence encoding a signal peptide of a heterologous protein). In some embodiments, a heterologous polypeptide sequence can be fused to the C-terminus of CD16 or an internally located fusion polypeptide can be created within CD16. Typically, up to about 30% of the CD16 cytoplasmic domain can be replaced. Such modifications can improve expression or improve cytotoxicity (e.g., ADCC responsiveness). In other examples, chimeric proteins, such as domains from other lymphocyte activation receptors, including, but not limited to, Ig-α, Ig-β, CD3-ε, CD3-δ, DAP-12, and DAP-10, replace a portion of the CD16 cytoplasmic domain.

[0091] Fusion genes can be synthesized by conventional techniques, such as PCR amplification using an automated DNA synthesizer and anchor primers that create complementary overhangs between two contiguous gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (Ausubel, 2002). Many vectors are commercially available that facilitate in-frame subcloning of CD16 into the fusion portion.

[0092] Cytokine The cytotoxicity of NK-92 cells is dependent on the presence of cytokines (e.g., interleukin-2 (IL-2)). The cost of using exogenously added IL-2 required to maintain and expand NK-92 cells in commercially scaled culture is significant. Administration of an amount of IL-2 sufficient to continue activation of NK92 cells to a human subject causes adverse side effects.

[0093] In one embodiment, the NK-92™ cells are modified to express at least one cytokine. In particular, the at least one cytokine is IL-2 (SEQ ID NO: 6), IL-12, IL-15, IL-18, IL-21, or a variant thereof. In some embodiments, the cytokine is IL-2 or a variant thereof. In one embodiment, IL-2 is a variant that is targeted to the endoplasmic reticulum. In some embodiments, the cytokine is IL-15 or a variant thereof. In one embodiment, IL-15 is a variant that is targeted to the endoplasmic reticulum.

[0094] In one embodiment, IL-2 is cloned and expressed (erIL-2) (SEQ ID NO: 7) with a signal sequence that directs IL-2 to the endoplasmic reticulum. This allows for the expression of IL-2 at levels sufficient for autocrine activation without releasing IL-2 extracellularly. See Konstantinidis et al “Targeting IL-2 to the endoplasmic reticulum confines autocrine growth stimulation to NK-92 TM cells” Exp Hematol. 2005 Feb;33(2):159-64. Continuous activation of FcR-expressing NK-92 cells can be prevented, for example, by the presence of a suicide gene.

[0095] suicide gene The term "suicide gene" refers to a transgene that enables negative selection of cells expressing the suicide gene. Suicide genes are used as a safety system that can kill cells expressing the gene by introducing a selection agent. This is desirable when the recombinant gene causes mutations leading to uncontrolled cell growth or when the cells themselves are capable of such growth. A number of suicide gene systems have been identified, such as the herpes simplex virus thymidine kinase (TK) gene, cytosine deaminase gene, varicella-zoster virus thymidine kinase gene, nitroreductase gene, Escherichia coli gpt gene, and Escherichia coli Deo gene. Typically, a suicide gene encodes a protein that has no adverse effects on cells but kills the cells in the presence of a defined compound. Thus, a suicide gene is typically part of a system.

[0096] In one embodiment, the suicide gene is active in NK-92™ cells. In one embodiment, the suicide gene is the thymidine kinase (TK) gene. The TK gene can be a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Cells expressing the TK protein can be killed using ganciclovir.

[0097] In another embodiment, the suicide gene is cytosine deaminase, which is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al. “Cytosine deaminase adenoviral vector and 5-fluorocytosine selectively reduce breast cancer cells 1 million-fold when they contaminate hematopoietic cells: a potential purging method for autologous transplantation.” Blood. 1998 Jul 15;92(2):672-82.

[0098] In another embodiment, the suicide gene is cytochrome P450, which is toxic in the presence of ifosfamide or cyclophosphamide. See, for example, Touati et al. “A suicide gene therapy combining the improvement of cyclophosphamide tumor cytotoxicity and the development of an anti-tumor immune response.” Curr Gene Ther. 2014;14(3):236-46.

[0099] In another embodiment, the suicide gene is iCasp9. Di Stasi, (2011) “Inducible apoptosis as a safety switch for adoptive cell therapy.” N Engl J Med 365:1673-1683. See also Morgan, “Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic” Molecular Therapy (2012);20:11-13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inactive small molecule that has been shown to be well tolerated in clinical trials and is used in the context of adoptive cell therapy.

[0100] Codon optimization In some embodiments, the sequences of the constructs used to transform aNK cells are codon-optimized to maximize the expression efficiency of PD-L1 CAR, CD16, and / or erIL-2 in the human system. Codon optimization is typically performed by modifying the nucleic acid sequence by replacing at least one, two or more, or a substantial number of the codons of the native sequence with codons that are used more frequently or most frequently in the genes of the expression system. Codon optimization can be used to increase the translation rate or to produce recombinant RNA transcripts with desired properties, such as a long half-life compared to transcripts produced using non-optimized sequences. Methods of codon optimization are readily available, such as GeneArt™ from Thermo Fisher Scientific (Waltham, MA); Optimizer, which is freely accessible at http: / / genomes.urv.es / OPTIMIZER, and GeneGPS® Expression Optimization Technology from DNA 2.0 (Newark, California). In certain embodiments, the coding sequence of PD-L1 CAR is codon-optimized and comprises the sequence (scFv portion) set forth in SEQ ID NO: 9 encoding the protein sequence of SEQ ID NO: 10. In some embodiments, the codon-optimized PD-L1 CAR coding sequence is the sequence set forth in SEQ ID NO: 14 encoding the protein sequence of SEQ ID NO: 15.

[0101] Transgene expression The transgene can be genetically engineered into the expression vector by any mechanism known to those of skill in the art. If multiple transgenes are to be inserted into a cell, the transgenes can be genetically engineered into the same expression vector or different expression vectors.

[0102] In some embodiments, the cells are transfected with mRNA encoding the transgenic protein to be expressed.

[0103] The introduced gene and mRNA can be introduced into NK-92™ cells using any transfection method known in the art, by way of example, and without limitation, infection, electroporation, lipofection, nucleofection, or a “gene gun”.

[0104] NK-92™ cells expressing a PD-L1 CAR The present disclosure provides modified NK-92™ cells expressing a PD-L1 CAR and an FcR. Optionally, the modified NK-92™ cells further express IL-2.

[0105] In some embodiments, the modified NK-92™ cells comprise a multicistronic introduced gene, the multicistronic introduced gene encoding a chimeric antigen receptor and an Fc receptor, and optionally IL-2.

[0106] In some embodiments, the FcR is CD16. In some embodiments, the CD16 is a high-affinity CD16 comprising or consisting of SEQ ID NO: 2. In some embodiments, the IL-2 is an erIL-2 comprising or consisting of SEQ ID NO: 7.

[0107] In some embodiments, the CAR coding sequence and the CD16 coding sequence are separated by a P2A sequence (SEQ ID NO: 8 ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct). This configuration enables equimolar expression of the CAR and CD16 from a single mRNA.

[0108] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are separated by an internal ribosome entry sequence (IRES) that enables internal translation initiation.

[0109] In some embodiments, the modified NK-92™ cells comprise a tricistronic construct that expresses a CAR, high-affinity CD16, and erIL-2 from a single mRNA. In some embodiments, the tricistronic construct comprises the sequence set forth in SEQ ID NO: 11. Integration of the CAR enables the effector cells to specifically engage and kill target cells that express the target recognized by the CAR; integration of CD16 enables ADCC when combined with a therapeutic monoclonal antibody; erIL2 enables cell expansion in the absence of exogenous IL-2 and maintains the selection pressure for transgene expression. An exemplary tricistronic construct is shown in FIG. 2, and exemplary protein sequences for the PD-L1 CAR and CD16 fusion protein are shown in SEQ ID NO: 12.

[0110] To produce modified NK-92™ cells that express a CAR and CD16 (e.g., high-affinity CD16), and erIL-2, a multicistronic plasmid is introduced into aNK™ cells, for example, by electroporation. Transformed NK-92™ cells are grown in a medium without IL-2, and individual clones are selected from the transformed NK-92™ cells by limiting dilution cloning and characterized based on criteria such as, for example, high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate, and / or IL-2 secretion. Suitable clones may also express surface markers, such as CD3, CD16, CD54, CD56, NKG2D, and / or NKp30, at levels substantially similar to those of aNK™ cells. Optionally, whole genome sequencing (WGS) is performed to determine the transgene integration site. Clones that meet one or more of these criteria are selected for further development and can be used to treat patients in a clinic.

[0111] Expression The expression of IL-2 can be confirmed by the ability of the modified NK-92™ cells under IL-2-free conditions. The expression of CAR and CD16 can be measured by flow cytometry. For NK-92™ cells transformed with a tricistronic construct containing the coding sequences of CAR, CD16, and IL-2 (e.g., erIL-2, SEQ ID NO: 13), typically at least 70%, at least 80%, at least 85% of the transformed cells that can grow under IL-2-free conditions also exhibit high expression levels of both CAR and CD16.

[0112] Optionally, the IL-2 secretion level of the transformed NK-92™ cells can be measured at various time points using methods well known in the art, e.g., by ELISA.

[0113] In some embodiments, the IL-2 level in the culture supernatant is measured to determine the level of IL-2 released into the cell culture medium. In some embodiments, the IL-2 level in the cell pellet is measured to evaluate the total intracellular level of IL-2. In some embodiments, both the amount of IL-2 in the supernatant and the amount of IL-2 in the cell pellet are measured to determine the total amount of IL-2 produced by the transformed NK-92™ cells.

[0114] Optionally, other surface markers of the transformed NK-92™ cells can be measured by flow cytometry. These markers include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Suitable clones are those that demonstrate substantially similar expression levels of these markers to aNK™ cells under the same growth conditions.

[0115] Cytotoxicity Optionally, the cytotoxicity of NK-92™ cells transformed with a tricistronic plasmid can also be tested using methods well known in the art. The cytotoxicity of NK-92™ cells can be reflected by their direct cytotoxicity or ADCC activity. The direct cytotoxicity of the produced NK-92™ cells, the ability to target and kill abnormal cells, such as tumor cells, can be determined using methods well known in the art, such as the procedure described by Klingemann et al. (Cancer Immunol. Immunother. 33:395-397 (1991)). 51 The Cr release assay (evaluated by Gong et al. (Leukemia, Apr;8(4):652-8(1994))) can be used. In some embodiments, the target cells express an antigen that can be recognized by the CAR expressed on the surface of the t-haNK cells. Briefly, 51 Cr-labeled target cells are mixed with NK-92™ cells and lysed. The percentage of specific cytotoxicity can be calculated based on the amount of 51 Cr released. See U.S. Patent Application Publication No. 20020068044.

[0116] Optionally, the cytotoxicity of NK-92® cells transformed with a tricistronic plasmid can be evaluated using in a flow-based cytotoxicity assay. Effector cells (NK-92® cells) and fluorophore-labeled target cells, such as tumor cells, are mixed at different effector-to-target ratios. Propidium iodide (PI) can be added to the cells and the samples can be analyzed by a flow cytometer. Preferably, the fluorophore used to label the target cells can be distinguished from PI in the flow cytometer. In some embodiments, the fluorophore is CFSE. In some embodiments, the fluorophore is PKHGL67. The cytotoxicity can be determined by the % of PI-positive cells within the fluorophore-positive target population.

[0117] Alternatively, the direct cytotoxicity of the generated NK-92™ cells can also be evaluated using a calcein release assay. For example, NK-92™ cells (referred to as effectors in the assay) can be mixed with calcein-loaded target cells (referred to as targets in the assay) at a certain ratio. After incubation for a certain period of time, the calcein released from the target cells can be evaluated, for example, by a fluorescence plate reader. The ratio of effector to target used in the assay can vary, and in some cases, the effector:target ratio can be 20:1, 15:1, 10:1, 8:1, or 5:1; preferably, the effector:target ratio is 10:1. The target cells can be any cells that express an antigen molecule recognizable by the CAR on NK-92™ cells (t-haNK cells). For example, MDA MB231 cells can be recognized by the PD-L1 CAR and are target cells for PD-L1 t-haNK cells. The cytotoxicity value of NK-92™ cells can vary depending on the type of target cells used and the effector:target ratio. Generally, NK-92™ cells produced using the methods described herein can have a cytotoxicity of 60-100%, for example, 70-100% or 80-100%. In some cases, NK-92™ cells can have a cytotoxicity of 80-100%, for example, 82-100%, 85-100%, 87-100%, 88-100%, or 89-100% when using an effector:target ratio of 1:10 in the calcein release assay.

[0118] In some cases, the cytotoxicity of the NK-92™ cells being evaluated, such as t-haNK cells, is antibody-dependent cell cytotoxicity (ADCC). The method for measuring the ADCC activity of NK-92™ cells is similar to the method for measuring the above direct cytotoxicity, except that an antibody capable of recognizing the target cells is also added. The Fc receptor of NK cells recognizes cell-bound antibodies, triggers a cytolytic reaction, and kills the target cells. In one exemplary example, t-haNK cells can be incubated with Herceptin (anti-Her2 antibody) and SKBr3 (target cells), and the killing of SKBr3 cells is based on the internal components of the above target cells, such as51 It can be measured by the release of Cr or calcein.

[0119] Doubling time The growth rate of NK-92™ cells, e.g., t-haNK cells, can be evaluated using the cell doubling time, i.e., the time required for the cells to grow until they reach twice the initial cell number. The doubling time is inversely proportional to the growth rate of NK-92™ cells; the longer the doubling time, the slower the growth rate.

[0120] WGS Optionally, whole genome sequencing (WGS) of the modified NK-92™ cells is performed to identify the insertion site of the multicistronic construct.

[0121] Therapeutic use The present disclosure also provides a method of treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinomas, melanomas, or sarcomas. In some embodiments, the present invention is used to treat cancers of hematopoietic origin, e.g., leukemia or lymphoma. In some embodiments, the cancer is a solid tumor.

[0122] In some embodiments, a method of treating any type of cancer in a subject comprises administering to the patient a therapeutically effective amount of the above-described NK-92™ cells, thereby treating the cancer. In some embodiments, the NK-92™ cells express an Fc receptor, e.g., a high-affinity Fc receptor having the sequence set forth in SEQ ID NO: 2. In some embodiments, the NK-92™ cells express a PD-L1 CAR, an Fc receptor, and IL-2. In some embodiments, the modified NK-92™ cells comprise a multicistronic construct, and the multicistronic construct encodes a chimeric antigen receptor and an Fc receptor.

[0123] Also provided is a method of treating a subject in need of treatment with the modified NK-92™ cells described herein. In some embodiments, the subject or patient has cancer or an infectious disease, such as a viral infection.

[0124] The modified NK-92™ cells can be administered to an individual in an absolute number of cells, e.g., from about 1000 cells / injection to a maximum of about 10 billion cells / injection to the individual, e.g., about, at least about, or at most about 1×10 8 、1×10 7 、5×10 7 、1×10 6 、5×10 6 、1×10 5 、5×10 5 、1×10 4 、5×10 4 、1×10 3 、5×10 3 NK-92™ cells (etc.), or any range (including endpoints) between any two numbers can be administered. Accordingly, the disclosure also provides a composition comprising a plurality of NK-92™ cells, wherein the number of cells is 1×10 8 、1×10 7 、5×10 7 、1×10 6 、5×10 6 、1×10 5 、5×10 5 、1×10 4 、5×10 4 、1×10 3 、or 5×10 3 cells (etc.).

[0125] In other embodiments, from about 1000 cells / injection / m 2 to a maximum of about 10 billion cells / injection / m 2 are administered to the individual, e.g., about, at least about, or at most about 1×10 8 cells / m 2 、1×10 7 cells / m 2 、5×10 7 cells / m 2 、1×106 cells / m 2 、5×10 6 cells / m 2 、1×10 5 cells / m 2 、5×10 5 cells / m 2 、1×10 4 cells / m 2 、5×10 4 cells / m 2 、1×10 3 cells / m 2 、5×10 3 cells / m 2 (etc.) of NK-92(trademark) cells, or any range (including endpoints) between any two numbers can be administered.

[0126] In other embodiments, NK-92(trademark) cells can be administered only in a relative number of cells to such an individual, for example, to the individual, about 1000 cells to a maximum of about 10 billion cells per 1 kilogram of the individual, for example, about, at least about, or at most about 1×10 8 、1×10 7 、5×10 7 、1×10 6 、5×10 6 、1×10 5 、5×10 5 、1×10 4 、5×10 4 、1×10 3 、or 5×10 3 cells (etc.) of NK-92 cells, or any range (including endpoints) between any two numbers can be administered.

[0127] In other embodiments, the total dose can be calculated by the body surface area m 2 and as such, about 1×10 2 per 1 m 11 、1×10 10 、1×10 9 、1×10 8 、1×10 7 cells, or any range (including endpoints) between any two numbers can be mentioned. The average human is about 1.6 m 2 ~ about 1.8 m2 It is. In a preferred embodiment, about 1 billion to about 3 billion NK-92™ cells are administered to a patient. In other embodiments, the amount of NK-92™ cells injected per dose can be calculated by the body surface area of m 2 and, as such, 1 m 2 per 1×10 11 , 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 cells are included. The average body surface area for humans is 1.6 - 1.8 m 2 .

[0128] In other embodiments, NK-92™ cells can be administered only a relative number of cells to such an individual, for example, to the individual, about 1000 cells to a maximum of about 10 billion cells per 1 kilogram of the individual, for example, about, at least about, or at most about 1×10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×10 3 , or 5×10 3 cells (etc.) of NK-92™ cells, or any range (including endpoints) between any two numbers can be administered.

[0129] NK-92™ cells can be administered to a patient with cancer once, or they can be administered multiple times, for example, during treatment, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours, or once every 1, 2, 3, 4, 5, 6 or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more than that, or once every any range (including endpoints) between any two numbers.

[0130] In some embodiments, the NK-92™ cells are administered in a composition comprising the NK-92™ cells and a medium, such as human serum or an equivalent thereof. In some embodiments, the medium comprises human serum albumin. In some embodiments, the medium comprises human plasma. In some embodiments, the medium comprises from about 1% to about 15% human serum or human serum equivalent. In some embodiments, the medium comprises from about 1% to about 10% human serum or human serum equivalent. In some embodiments, the medium comprises from about 1% to about 5% human serum or human serum equivalent. In a preferred embodiment, the medium comprises about 2.5% human serum or human serum equivalent. In some embodiments, the serum is human AB serum. In some embodiments, a serum substitute acceptable for use in human therapy is used in place of human serum. Such serum substitutes are known in the art or may be developed in the future. Concentrations of human serum greater than 15% can be used, but concentrations above about 5% are contemplated to be too costly. In some embodiments, the NK-92™ cells are administered in a composition comprising the NK-92™ cells and an isotonic solution that supports cell viability. In some embodiments, the NK-92™ cells are administered in a composition reconstituted from a cryopreserved sample.

[0131] Pharmaceutically acceptable compositions containing NK-92 (trademark) cells may contain various carriers and excipients. Various aqueous carriers, such as buffered saline, can be used. These solutions are sterile and generally free of unwanted substances. Suitable carriers and excipients and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). A pharmaceutically acceptable carrier means a material that is not biologically or otherwise undesirable, i.e., the material causes no undesirable biological effects and does not interact in a harmful manner with the other components of the pharmaceutical composition in which it is contained and is administered to a subject. When administered to a subject, the carrier is optionally selected to minimize degradation of the active ingredient and to minimize adverse side effects in the subject. As used herein, the term pharmaceutically acceptable is used synonymously with physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally contain agents for buffering and preservation during storage and may contain buffers and carriers for appropriate delivery depending on the route of administration.

[0132] These compositions for in vivo or in vitro use can be sterilized by sterilization techniques used for cells. The compositions may contain acceptable auxiliary substances required for an appropriate physiological state, such as pH adjusters and buffers, and toxicity modifiers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate. The concentration of cells and / or other agents in these formulations can vary and is mainly selected based on factors such as the specific mode of administration selected and requirements of the subject, such as the volume of liquid, viscosity, and body weight.

[0133] In one embodiment, NK-92™ cells are administered to a patient in combination with one or more other treatments or agents for the cancer being treated. In some embodiments, the one or more other treatments for the cancer being treated include, for example, antibodies, radiation therapy, chemotherapy, stem cell transplantation, or hormone therapy.

[0134] In some embodiments, the NK-92™ cells and the other cancer agent / treatment are administered simultaneously or nearly simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other). In some embodiments, the NK-92™ cells and the other cancer agent / treatment are administered sequentially. In some embodiments, the other cancer treatment / agent is administered 1, 2, or 3 days after the administration of the NK-92™ cells.

[0135] In one embodiment, the other cancer agent is an antibody. In one embodiment, the NK-92™ cells are administered in combination with an antibody that targets disease cells. In one embodiment, the NK-92™ cells and the antibody are administered to the patient together, e.g., in the same formulation; separately, e.g., in separate formulations, in combination; or separately, e.g., on different dosing schedules or at different times of the day. When administered separately, the antibody can be administered via any suitable route, e.g., intravenous or intratumoral injection.

[0136] In some embodiments, the NK-92™ cells of the present disclosure are used in combination with a therapeutic antibody and / or other anti-cancer agent. A therapeutic antibody can be used to target cells that express cancer-related or tumor-related markers. Examples of cancer therapeutic monoclonal antibodies are shown in Table 4. In some embodiments, the NK-92™ cells express an Fc receptor, e.g., a high-affinity Fc receptor having the sequence set forth in SEQ ID NO: 2. In some embodiments, the NK-92™ cells are haNK® cells. In one embodiment, the therapeutic antibody is abelumab.

[0137]

Table 3

[0138]

Table 4

[0139] Administration of such NK-92(trademark) cells can be carried out simultaneously with, or in a sequential manner to, the administration of the monoclonal antibody. In some embodiments, the NK-92(trademark) cells are administered to the subject after the subject has been treated with the monoclonal antibody. Alternatively, the NK-92(trademark) cells can be administered simultaneously, for example, within 24 hours of the monoclonal antibody.

[0140] In some embodiments, the NK-92(trademark) cells are administered intravenously. In some embodiments, the NK-92(trademark) cells are directly injected into the bone marrow.

[0141] Accordingly, the present disclosure provides a method for treating cancer or viral infection in a patient in need of treatment for cancer or viral infection, the method comprising administering to the patient a therapeutically effective amount of the NK-92(trademark) cells disclosed herein, thereby treating the cancer.

[0142] Kit Also disclosed is a kit for the treatment of cancer or infectious diseases using a composition comprising a plurality of NK-92(trademark) cells described herein. In some embodiments, the kit of the present disclosure may also comprise at least one monoclonal antibody. The NK-92(trademark) cells contained in the kit express a chimeric antigen receptor (CAR) and an Fc receptor. In some embodiments, the NK-92(trademark) cells further express IL-2, such as erIL-2, or IL-15, such as erIL-15. In some embodiments, the NK-92(trademark) cells comprise a multicistronic construct that encodes a chimeric antigen receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0143] In certain embodiments, the kit may contain additional compounds to be administered before, simultaneously with, or after administration of the NK-92™ cells, such as therapeutically effective compounds or drugs. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, lidocaine, quinidine, chemotherapeutic agents, and the like.

[0144] In various embodiments, the instructions for use of the kit include instructions for using the kit components in the treatment of cancer or infectious diseases. The instructions may further contain information regarding the handling of the NK-92™ cells (e.g., thawing and / or culturing). The instructions may further include guidelines regarding dosage and frequency of administration.

[0145] In certain embodiments, the kit further comprises one or more containers filled with one or more of the compositions described herein, such as a composition comprising the NK-92™ cells described herein. Optionally, a label indicating that the kit is for treating cancer, such as that described herein, may accompany such containers. Optionally, the label also includes a notice in a form prescribed by an authority regulating the manufacture, use, or sale of pharmaceuticals or biological products, the notice reflecting approval by the authority for manufacture, use, or sale for human administration.

[0146] Materials, compositions, and components that can be used in, used in combination with, used in the preparation of, or are products of the methods and compositions of the present disclosure are disclosed. These and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are described, specific mention of each and every individual and collective combination and permutation of these compounds may not be expressly made, but each is specifically contemplated and described herein. For example, when a method is disclosed and discussed, and numerous modifications that can be made to a number of molecules that include the method are discussed, each and every combination and permutation of the method, as well as the conceivable modifications, are specifically contemplated unless specifically shown otherwise. Similarly, any subset or combination of these is specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, by way of example and not limitation, to the steps in methods of using the disclosed compositions. Thus, if there are various additional steps that can be performed, each of these additional steps can be performed by any defined method step or combination of method steps of the disclosed method, and each such combination or subset of combinations is to be considered specifically contemplated and disclosed.

Examples

[0147] The following examples are for illustrative purposes only and should not be construed as limiting. There are various alternative techniques and procedures available to those skilled in the art that would enable the following examples to be practiced equally well.

[0148] Example 1: Generation of PD-1 CAR-Modified NK-92™ Cells The PD-L1 CAR was cloned into the bicistronic plasmid pNEUKv1 FcR_IL-2 vector that also contains the CD16 and erIL-2 transgenes. The tricistronic plasmid was electroporated into aNK™ cells. Since untransformed aNK™ cells that are IL-2 dependent could not survive in IL-2 depleted medium, PD-L1 CAR-expressing NK-92™ cells were selected with IL-2 depleted medium.

[0149] Limiting dilution cloning An aliquot of the polyclonal PD-L1 t-haNK pool culture was diluted to a density of 1.5 cells / ml in growth medium without IL-2 supplementation. This cell suspension was aliquoted at a volume of 200 μl per well in a 96-well plate, which corresponded to an average of 0.3 cells per well. The plate was incubated at 37 °C for 10 days and then visually checked for cell growth. Growth cultures, now named clones, were picked and transferred to larger vessels for further expansion and characterization.

[0150] Example 2: Phenotype of modified NK-92™ cells The expression of PD-L1 CAR in PD-L1 t-haNK cells was measured by flow cytometry, and the results showed that more than 86.4% of the cells from the PD-L1 t-haNK line had stable CAR expression. Figure 3.

[0151] Example 3: Cytotoxicity of PD-L1 t-haNK cells against target cell lines The cytotoxicity of t-haNK cells was analyzed by incubating them with their respective target cells. MDA-MB-231 cells expressing PD-L1 were used as target cells for the PD-L1 t-haNK cells. The results show that the PD-L1 t-haNK cells effectively killed their respective target cells. See Figure 4.

[0152] The cytotoxicity of PD-L1 t-haNK cells against MDSCs was also tested against MDSCs. The MDSCs used in this experiment were generated from peripheral blood mononuclear cells (PBMCs) obtained from blood and separated on a Ficoll gradient. MDSCs were further enriched by positive magnetic selection for CD11b and expanded in number in culture medium supplemented with recombinant GM-CSF and IL-6 (Goedegebuure et al, 2011, Current Cancer Drug Targets, Vol. 11, issue 6, 2011). The MDSCs were then exposed to PD-L1 t-haNK cells at various effector-to-target ratios (E:T ratios).

[0153] As shown in Figure 5A, PD-L1 t-haNK cells effectively lysed (killed) MDSCs. The cytotoxicity of PD-L1-t-haNK cells was at least 50% higher than that of parental aNK™ cells; a significantly higher proportion (at least 50% higher) of target cells was killed by any of the t-haNK cell lines. Since MDSCs are one of the main immunosuppressive cells in the tumor microenvironment, this result indicates that solid tumors can be effectively treated using those PD-L1 t-haNK cells. These results also suggest that PD-L1 t-haNK cells function by first eliminating MDSCs from the tumor microenvironment via CAR-mediated cytotoxicity and then killing tumor cells by the t-haNK cells themselves or by other immune cells or specific tumor-targeted therapies.

[0154] Figure 5B shows that PD-L1 t-haNK cells improved the specific killing of aNK™-resistant, PD-L1-positive MDA-MB-231 cell lines. XL-48 and XL-49 are two PD-L1 t-haNK populations expressing CARs containing two different scFv domains derived from two different anti-PD-L1 antibodies. Figure 5C shows that when PD-L1 t-haNK cells were combined with the anti-CD20 antibody rituximab, genetically engineered SUP-B15 cells (CD19 - , CD20 +) had antibody-dependent cell-mediated cytotoxicity (ADCC) activity against , and its ADCC activity was shown to be equivalent to that of haNK (registered trademark) cells expressing only the CD16(158V) receptor. The anti-Her2 antibody Herceptin was used as a control antibody in this experiment.

[0155] The inventors further investigated the activity of PD-L1 t-haNK cells in several in vivo experiments. More specifically, female, 9- to 10-week-old NSG mice (JAX) were used in the MDA-MB-231 model (24 animals using fresh cells) and the HCC827 model (24 animals using fresh cells and 6 animals using cryopreserved cells). The MDA-MB-231 model was a human breast adenocarcinoma model, while HCC827 was a human lung adenocarcinoma model. The mice were subcutaneously inoculated on both flanks, and the average tumor burden at the start of treatment was 100 mm 3 (MDA-MB-231) and 75 - 80 mm 3 (HCC827). Freshly prepared, irradiated anti-PDL1 t-haNK was administered at a concentration of 5E7 cells / mL, while cryopreserved, irradiated anti-PDL1 t-haNK was administered at a concentration of 2E7 cells / mL. The vehicle control was growth medium alone. Administration was i.v. and intratumoral. Dose for IV: Freshly prepared cells: 1E7 cells / dose in 200 μL, and cryopreserved cells: 4E6 cells / dose in 200 μL. Intratumoral administration was 2.5E6 cells / tumor / dose in 50 μL. The dosing frequency was twice a week for 4 consecutive weeks. The first day of administration was designated as day 1.

[0156] In particular, as shown in FIGS. 6A and 6B, freshly prepared PD-L1 t-haNK cells (1E7 cells / dose) resulted in significant and long-lasting tumor growth inhibition in both the MDA-MB-231 and HCC827 models when administered intravenously. Here, tumor stasis was observed for MDA-MB-231, with a TGI of 84% (peak) on day 16 and 79% (final measurement) on day 26. For HCC827, tumor regression was observed, with a TGI of 120% (peak) on day 16 and 84% (end of study) on day 29. Cryopreserved PD-L1 t-haNK cells (4E6 cells / dose) also showed statistically significant efficacy in suppressing tumor growth compared to the vehicle control. Here, the TGI was 60% (peak) on day 26 and 40% (end of study) on day 29.

[0157] Furthermore, freshly prepared PD-L1 t-haNK cells (1E7 cells / dose) also resulted in a significant reduction in metastatic disease burden in the MDA-MB-231 model compared to the vehicle. While 100% of all control animals developed metastatic disease, only 50% of animals treated with PD-L1 t-haNK cells developed metastases (all single-organ findings). See the table below.

[0158]

Table 5

[0159] When administered intratumorally, significant tumor growth inhibition was also observed in the HCC827 model but not in the MDA-MB-231 model. Here, as shown in FIG. 7, the TGI for HCC827 was 70% (peak) on day 20 and 49% (end of study) on day 29.

[0160] Therefore, it should be noted that PDL1 t-haNK cells demonstrated significant efficacy in two subcutaneous tumor models. Specifically, intravenous administration of freshly prepared PD-L1 t-haNK cells at a dose level of 1E7 cells / dose twice weekly for 4 weeks showed significant anti-tumor efficacy in both of the subcutaneous xenograft models tested. Treatment resulted in tumor stasis in MDA-MB-231 tumor-bearing mice, with a peak TGI of 84% on day 16 and a TGI of 79% at the end of the study (P<0.0001 for both time points by two-way ANOVA followed by Tukey's multiple comparison test), and tumor regression in the HCC827 model, with a peak TGI of 120% on day 16 and a TGI of 84% at the end of the study (P<0.0001). Intravenous administration of cryopreserved PD-L1 t-haNK cells at a dose level of 4E6 cells / dose twice weekly for 4 weeks also showed significant therapeutic efficacy in the HCC827 tumor model, reaching a peak TGI of 60% (P<0.0001) and a TGI of 40% (P<0.01) at the end of the study.

[0161] Intratumoral administration of freshly prepared PD-L1 t-haNK cells at a dose level of 2.5E6 cells / dose / tumor twice weekly for 4 weeks effectively inhibited the growth of HCC827 tumors, resulting in a peak TGI of 70% and a TGI of 49% at the end of the study on day 20 (P<0.001). However, MDA-MB-231 tumors were not sensitive to intratumorally administered PD-L1 t-haNK cells.

[0162] In a further embodiment, the inventors compared the expression of various markers in PD-L1 t-haNK cells versus haNK cells, and the selection results are shown in FIG. 8. As is readily apparent, while PD-L1 t-haNK cells expressed extremely large amounts of PD-L1 CAR, they also expressed a significant amount of CD16. More specifically, PD-L1 t-haNK cells had increased expression of perforin and granzyme B, which is likely to contribute to the improved cytotoxicity of PD-L1 t-haNK cells as shown in FIG. 9. Here, in the high PD-L1 cell line (MDA-MB-231), PD-L1 t-haNK was superior to haNK, and PD-L1 CAR-mediated killing by PD-L1 t-haNK was superior to anti-PD-L1 Ab-mediated ADCC using haNK. Furthermore, killing was dependent on perforin / granzyme (killing activity was significantly arrested by concanamycin-a, a perforin / granzyme inactivator), and it was observed that killing was not affected by anti-CD16.

[0163] The inventors further investigated whether PD-L1 t-haNK cells were also cytotoxic against various tumor cells in vitro. FIG. 10 shows exemplary results of co-culturing irradiated PD-L1 t-haNK with various tumors, such as breast (n = 4), lung (n = 3), colon (n = 2), urogenital (n = 2), chordoma, and ovarian cell lines. Variations in killing were observed for each cell line, and a reduction in killing ability was observed as the E:T ratio decreased. In particular, 13 / 13 cell lines were killed by PD-L1 t-haNK.

[0164] In further experiments, the inventors investigated whether PD-L1 t-haNK cells are transported into in vivo tumors. As can be seen from the results in Figure 11, PD-L1 t-haNK cells tracked PD-L1-expressing MDA-MB-231 TNBC tumors (significant versus PD-L1 null). Further, the IP administration route of PD-L1 t-haNK cells mediated significantly greater levels of PD-L1 t-haNK cell accumulation than the IV-administered cells. Here, mice were inoculated with MDA-MB-231 cells and PD-L1 knockout MDA-MB-231 cells. The flow of PD-L1 t-haNK cells was monitored for both cell lines at 24 and 72 hours later. Clearly, PD-L1 t-haNK cells tracked tumors with PD-L1 expression. Further results were shown ex vivo 21 days later, and again PD-L1 t-haNK cells tracked tumors with PD-L1 expression.

[0165] Using the same model, tumor growth curves were measured in vivo, and exemplary results are shown in Figure 12. In particular, PD-L1 t-haNK cells mediated significant anti-tumor activity after only a single injection, which was maintained. PD-L1 t-haNK cells also mediated significant anti-tumor activity against MDA-MB-231 PD-L1 KO cells (day 36).

[0166] Human MDSCs were also tested for their susceptibility to cytotoxic PD-L1 t-haNK cells. For this purpose, PBMCs were cultured for 7 days in the presence of IL-1β, IL-6, PGE2, TGFβ1, TNFα, VEGF, and GM-CSF, and the expanded cells were selected using CD33 selection. After confirmation of the MDSC phenotype (CD11b+, HLA-DR negative, CD33), a functional cytotoxicity assay was performed, and exemplary results are shown in FIG. 13. As can be seen from the figure, MDSCs are also effectively killed by PD-L1 t-haNK cells. It should be noted that in this context, M2 macrophages are also considered to be suitable targets for PD-L1 t-haNK cell-mediated cell killing. This is because M2 macrophages also express PD-L1 (see, for example, BMC Cancer (2015) 15:577 DOI 10.1186 / s12885-015-1546-9).

Claims

1. Recombinant NK-92 cells expressing PD-L1 CAR and Fc receptors.

2. 2. The NK-92 cell of claim 1, comprising a multicistronic construct, said multicistronic construct encoding said PD-L1 CAR and said Fc receptor.

3. The NK-92 cell of claim 1, wherein the Fc receptor is CD16.

4. The NK-92 cell of claim 1, wherein the Fc receptor comprises SEQ ID NO:

2.

5. The NK-92 cell of claim 2, wherein the multicistronic transgene further comprises a sequence encoding IL-2 or a variant thereof, or IL-15 or a variant thereof.

6. The NK-92 cell of any one of claims 2 to 5, wherein the PD-L1 CAR, the Fc receptor, and / or the IL2 are encoded by codon-optimized nucleic acid sequences.

7. The NK-92 cell of claim 5, wherein the IL-2 variant is erIL-2 or the IL-15 variant is erIL-15.

8. 8. The NK-92 cell of claim 7, wherein the coding sequence for one or more of the PD-L1 CAR, the Fc receptor, the erIL-15, or the erIL-2 is codon-optimized for expression in a human system.

9. The NK-92 cell according to any one of claims 1 to 7, capable of killing PD-L1 expressing cells.

10. The NK-92 cell of any one of claims 1 to 9, wherein the PD-L1 expressing cell is a myeloid-derived immunosuppressive cell (MDSC), a tumor-associated macrophage (TAM), or a tumor cell.

11. The NK-92 cell of any one of claims 1 to 10, wherein the PD-L1 CAR comprises an scFv antibody fragment.

12. The NK-92 cell of claim 11, wherein the scFv antibody fragment has the amino acid sequence of SEQ ID NO:

10.

13. The NK-92 cell of claim 2, wherein the multicistronic construct comprises the sequence of SEQ ID NO: 11, the sequence encoding the scFv antibody fragment.

14. 2. The NK-92 cell of claim 1, comprising a sequence encoding a self-cleaving peptide, said sequence being located between said PD-L1 CAR and CD16, said sequence enabling equimolar expression of said PD-L1 CAR and said FcR.

15. 13. The NK-92 cell of any one of claims 1 to 12, comprising an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof or the sequence encoding IL-15 or a variant thereof.

16. 2. The NK-92 cells of claim 1, wherein the direct cytotoxicity of said NK-92 cells against PD-L1 expressing cells is 40-100% at an effector to target ratio of 10.

17. 2. The NK-92 cells of claim 1, wherein the direct cytotoxicity of the NK-92 cells against PD-L1 expressing cells is higher than that of aNK cells.

18. 2. The NK-92 cell of claim 1, wherein the ADCC activity of the NK-92 cell is 20% to 60% when the effector to target ratio is 10.

19. The NK-92 cell of any one of claims 1 to 18, wherein the PD-L1 CAR comprises a sequence sharing at least 90% identity with SEQ ID NO:

10.

20. The NK-92 cell of claim 1, wherein the PD-L1 CAR comprises a cytoplasmic signaling domain.

21. The NK-92 cell of claim 20, wherein the cytoplasmic signaling domain is an Fc epsilon receptor gamma (FcεRIγ) and / or a CD3 zeta signaling domain.

22. A kit comprising a pharmaceutical composition comprising the NK-92 cells according to any one of claims 1 to 21.

23. 1. A method for generating NK-92 cells, comprising: providing a vector encoding PD-L1 CAR and CD16; and introducing said vector into said NK-92 cells to generate said NK-92 cells; The method includes:

24. The method of claim 23, wherein the vector further comprises a sequence encoding IL-2 or IL-15.

25. 24. The method of claim 23, wherein the vector comprises a sequence encoding a self-cleaving peptide, said sequence being located between CAR and CD16, said sequence allowing equimolar expression of CAR and CD16.

26. The method of claim 23, wherein the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 or IL-15 coding sequence.

27. 20. A method of killing PD-L1 expressing cells, comprising incubating myeloid derived immunosuppressive cells (MDSCs), tumor associated macrophages, or tumor cells with a plurality of NK-92 cells according to any one of claims 1 to 17, thereby killing said MDSCs, said TAMs, or said tumor cells.

28. 28. The method of claim 27, wherein the PD-L1 expressing cell is a tumor cell or a cell in the tumor microenvironment.

29. 29. The method of claim 28, wherein the cells in the tumor microenvironment are myeloid-derived immunosuppressive cells (MDSCs) or tumor-associated macrophages.

30. The method of claim 29, wherein the MDSC cells express CD14 or CD15.

31. 28. The method of claim 27, wherein the TAM expresses CD68 and one or more of CD206, CD204, or CD163.

32. 22. A method of killing myeloid derived immunosuppressive cells (MDSCs), tumor associated macrophages, or tumor cells in a subject, comprising administering to the subject a therapeutically effective amount of a composition, the composition comprising a plurality of NK-92 cells according to any one of claims 1 to 21.

33. The subject's body surface area 1 m ２ Approximately 1 x 10 per ８ ~Approx. 1×10 １１ 33. The method of claim 32, wherein the modified cells are administered to the subject.

34. 22. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising a plurality of NK-92 cells according to any one of claims 1 to 21.

35. 35. The method of claim 34, wherein the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, gastric cancer, prostate cancer, squamous cell carcinoma, head and neck cancer, colon cancer, pancreatic cancer, uterine cancer, renal cell carcinoma, glioblastoma, medulloblastoma, sarcoma, and lung cancer.

36. 36. The method of claim 34 or 35, wherein the cells are administered intravenously.

37. The method of any one of claims 34 to 36, wherein the plurality of NK-92 cells is administered intratumorally.

38. 1. A method of killing myeloid-derived immunosuppressive cells (MDSCs) or tumor cells in a subject, comprising administering to the subject therapeutically effective amounts of a first composition and a second composition, wherein the first composition comprises a plurality of NK-92 cells and the second composition comprises an anti-PD-L1 antibody.

39. The method of claim 38, wherein the NK-92 cells express Fc receptors.

40. The method of claim 38, wherein the NK-92 cells are haNK® cells.

41. 39. The method of claim 38, wherein the second composition is avelumab.

42. 1. A method of administering NK cells to an individual, the method comprising administering a first composition comprising NK cells that express a PD-L1 CAR and a second composition comprising primary NK cells.

Images