Method for activating expression of γ-globin gene, and composition
By using ssODN and CRISPR-Cas gene editing to introduce GATA elements in the γ-globin gene promoter, the method enhances HbF expression in erythrocytes, addressing the limitations of current treatments for β-hemoglobinopathies and offering a promising, safer alternative.
Patent Information
- Application Number
- JP2025052481
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-07-01
- Filing Date
- 2025-03-26
- Publication Date
- 2025-06-12
AI Technical Summary
Current treatments for β-hemoglobinopathies such as sickle cell disease and β-thalassemia are inadequate, with blood transfusions and iron chelation therapy offering only symptom relief and carrying significant risks, while allogeneic hematopoietic stem cell transplantation is limited by low matching success rates and immune rejection risks.
The method involves using a single-stranded oligonucleotide (ssODN) containing GATA or its antisense complementary sequence TATC, combined with CRISPR-Cas gene editing, to introduce specific base mutations in the promoter region of the γ-globin gene, forming an erythroid enhancer element containing GATA, thereby promoting γ-globin gene expression in mature erythrocytes.
This approach significantly improves the expression of fetal hemoglobin (HbF) in erythrocytes, potentially alleviating anemia symptoms and reducing the need for blood transfusions in patients with β-hemoglobinopathies, while offering a safer and more effective treatment option compared to existing methods.
Smart Images

Figure 2025089506000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene editing, and relates to a method, a composition and its use for activating γ-globin gene expression. The method uses a single-stranded oligonucleotide (ssODN) containing GATA or its antisense complementary sequence TATC as guide information, performs gene editing in the promoter region of the γ-globin gene, and forms an erythroid enhancer element containing GATA, thereby promoting the expression of the γ-globin gene in mature erythrocytes.
Background Art
[0002] Hemoglobin (simply called Hb) is a special protein for carrying and transporting oxygen gas within red blood cells. Hemoglobin consists of globin and heme. Hemoglobin in the adult body is mainly a tetramer (α2β2) composed of two α-globins and two β-globins, and is called adult hemoglobin (HbA). Mutations in the β-globin gene (HBB) can cause β-hemoglobin disorders (also called β-hemoglobinopathies), including sickle cell disease (SCD) and β-thalassemia (simply called β-thal). Sickle cell anemia is caused by a point mutation in the β-globin structural gene and may generate abnormal hemoglobin (HbS). β-thalassemia is caused by partial or complete defects in β-globin gene expression and may cause defects or deficiencies in adult hemoglobin (HbA). A decrease or deficiency in the globin chains of hemoglobin may cause the structure of hemoglobin to become abnormal. Red blood cells containing such abnormal hemoglobin have reduced deformability, a short lifespan, and may undergo in situ hemolysis in the bone marrow. After entering the peripheral blood circulation, they are removed and destroyed by organs such as the spleen, which may cause anemia, iron deposition in the body, and ultimately growth abnormalities. Hemoglobinopathies affect millions of people worldwide. Currently, approximately 330,000 children are born with hemoglobinopathies each year, seriously threatening human health and life. Patients with thalassemia and sickle cell disease mainly relieve their conditions through regular long-term blood transfusions and iron chelation therapy. However, not only can the condition not be cured in this way, but there are also high security risks. Allogeneic hematopoietic stem cell transplantation is currently the only treatment technology that can cure thalassemia and sickle cell disease. However, due to limitations such as a low success rate of bone marrow matching and the existence of an immune rejection risk, it is difficult to widely apply clinically. Therefore, the need to develop new safe and effective treatment methods is increasing.
[0003] During the development process of humans, hemoglobin is not always composed in the form of two α-globins and two β-globins. During the embryonic development period and immediately after birth, hemoglobin exists in the form of a tetramer consisting of two α-globin chains and two γ-globin chains (α2γ2), which is called fetal hemoglobin (HbF) and has a stronger oxygen affinity than HbA. As the fetus develops, the γ-globin gene gradually becomes silent without being expressed, while the expression of the β-globin gene near the same genomic site gradually increases. After about half a year after the baby is born, the components and proportions of hemoglobin in the blood gradually stabilize, HbF is replaced by adult hemoglobin (HbA), and only an extremely low level of HbF remains (accounting for less than 1% of the total hemoglobin).
[0004] As can be seen from the studies, in some people, mutations appear at certain specific sites, activating γ-globin gene transcription and increasing the proportion of HbF in hemoglobin (also known as hereditary persistence of fetal hemoglobin, HPFH). For example, several different types of mutations have been discovered in the promoter region of the γ-globin gene, such as -114~-102 13bp del c., 4bp del c.-225~-222, c.-114C>T, c.-117G>A, c.-158C>T, c.-167C>T, c.-170G>A, c.-175T>G, c.-175T>C, c.-195C>G, c.-196C>T, c.-198T>C, c.-201C>T, etc. These naturally occurring mutations can increase the proportion of HbF relative to total hemoglobin to varying degrees. As can be seen from clinical studies, a small number of patients with β-thalassemia or sickle cell anemia have HPFH mutations present in their genomes, so the expression of HbF compensates for the deficiency of HbA and can, to some extent, alleviate or relieve the patients' anemia symptoms or reduce the need for blood transfusions. Inspired by this discovery, scientists have been continuously exploring various methods to induce the expression of various HbFs in order to achieve the goal of treating β-hemoglobinopathies. For example, currently, clinically, drugs such as hydroxyurea are sometimes used to induce HbF expression to treat β-hemoglobinopathies, but the induction level of HbF is low for many patients and cannot completely improve the patients' conditions.
[0005] Gene editing technology has brought new hope and new methods for the treatment of genetic diseases such as hemoglobinopathy. In recent years, gene editing technology has undergone epoch-making development, making it possible to artificially modify the nucleotide sequence at specific sites in the genome and becoming increasingly easier. Currently, gene editing technologies that have relatively matured in development are ZFN (zinc finger nuclease), TALEN (transcription activator-like effector nuclease), and CRISPR (clustered regularly interspaced short palindromic repeats) / Cas system (CRISPR-Cas system). By designing a specific gene editing system and cleaving the target genomic DNA site in living cells to form double-strand breaks (DSBs), cells can utilize the non-homologous end joining (NHEJ) repair mechanism to repair DNA defects and randomly form mutations such as sequence insertions, deletions, and base substitutions. For example, by providing an artificially designed DNA donor template while performing gene editing, cells can complete the repair by utilizing the homology-directed repair (HDR) mechanism, thereby introducing the desired base mutation form into the target site.
[0006] Currently, there are several different international therapeutic strategies for enhancing HbF expression in red blood cells by gene editing. (1) Deleting or disrupting the erythroid enhancer element in the intron of the BCL11A gene on human chromosome 2 to reduce the expression of BCL11A in red blood cells and relieve the inhibitory effect of BCL11A on γ-globin gene transcription. (2) Deleting or disrupting some sequences in the promoter region of the γ-globin gene to prevent the binding of transcriptional repressors or introducing naturally occurring HPFH mutation types, such as the deletion of 13 base pairs at the -114 to -102 site (13bp del c.). (3) Producing a DNA deletion of a large segment of 3.5 kb to 13.6 kb and deleting the sequence containing an unknown suppressor between the γ-globin gene and β-globin to promote the binding of the γ-globin gene to the distal LCR enhancer. Although these methods have shown the effect of activating HbF expression, their long-term effects and / or safety are still not clear, and it is necessary to further develop new methods.
Summary of the Invention
Problems to be Solved by the Invention
[0007] The present invention provides a method for activating γ-globin gene transcription by gene editing. The present invention utilizes a single-stranded oligonucleotide (ssODN) containing GATA or its antisense complementary sequence TATC, and by gene editing techniques (e.g., CRISPR-Cas gene editing system), a small number of base mutations (deletion, substitution, insertion, etc.) are introduced at appropriate positions in the promoter region of the γ-globin gene. After editing, an erythroid enhancer element containing GATA is formed in the sense strand or antisense strand of the promoter region of the γ-globin gene, such as the sequence structure of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR, thereby promoting transcription in mature erythrocytes of the γ-globin gene and improving HbF expression in erythrocytes. Among them, W is T or A, R is A or G, N is A, G, C or T, and it is more preferably C or T. N(7-8) refers to 7 to 8 arbitrary bases.
[0008] As shown in Figure 1, the principle of the present invention is based on gene editing techniques such as CRISPR-Cas, in combination with the single-stranded oligonucleotide (ssODN) according to the present invention, to perform efficient gene editing on stem cells and progenitor cells with erythroid differentiation ability, such as CD34+ hematopoietic stem cells, to introduce mutations in the promoters of the HBG1 and HBG2 genes encoding human γ-globin (located on human chromosome 11), and artificially create the sequence structure of one NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR in the sense strand or antisense strand of the promoter. This sequence, as an enhancer, recruits activator factors such as GATA1 after the target cells differentiate into erythrocytes to promote γ-globin expression.
[0009] The present invention provides an ssODN containing a GATA or TATC sequence. The ssODN can be used for gene editing of the γ-globin gene. In the present invention, the ssODN structure includes a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm. Among them, the GATA or TATC sequence may be located at any position in the ssODN, such as the substitution sequence, the 5′ homologous arm, the 3′ homologous arm, the junction between the 5′ homologous arm and the substitution sequence, and the junction between the 3′ homologous arm and the substitution sequence. The length of one-sided homologous arm may be 20 - 300 nt. In the examples of the present invention, the length of the ssODN homologous arm is about 40 nt. In some embodiments of the present invention, the ssODN containing the GATA or TATC sequence is selected from the sequences represented by SEQ ID NO:40 - SEQ ID NO:65. In some of these embodiments, the 5′ and 3′ of the ssODN are modified with phosphorothioate.
[0010] The present invention discloses a composition for γ-globin gene editing. The composition includes ssODN, sgRNA, and CRISPR-Cas nuclease. In some embodiments of the present invention, the sgRNA target site in the gene editing system is located in the sequences represented by SEQ ID NO:32 - SEQ ID NO:39. In some embodiments of the present invention, the sgRNA is the sequence represented by SEQ ID NO:69 - SEQ ID NO:76. In some embodiments of the present invention, the Cas9 protein is the Cas9 protein derived from Streptococcus pyogenes.
[0011] The present invention discloses an electrotransfer method for γ-globin gene editing. The method uses electroporation technology to efficiently transfect a composition consisting of ssODN, sgRNA, and CRISPR-Cas nuclease into human hematopoietic stem cells to induce efficient gene editing.
[0012] The present invention further discloses hematopoietic stem cells. Using an electrotransfer method, a composition containing the above ssODN, sgRNA, and CRISPR-Cas nuclease is introduced into hematopoietic stem cells, and the promoter region of the γ-globin gene in the cells contains an active GATA element, which can improve the expression of the γ-globin gene when differentiating into erythrocytes.
Advantages of the Invention
[0013] Compared with the prior art, the present invention has the following beneficial effects.
[0014] The ssODN according to the present invention is introduced into cells together with a gene editing system (such as CRISPR-Cas, TALEN, ZFN, etc.) to guide gene editing in the promoter region of the γ-globin gene, mutate at a specific site, and form a GATA element with an activating effect. In some embodiments of the present invention, the ssODN and the CRISPR-Cas gene editing system are introduced into human hematopoietic stem cells using electrotransfer technology, efficient gene editing is achieved in the promoter region of the γ-globin gene, mutations are introduced at specific sites to form an erythroid enhancer element containing the desired GATA. After the hematopoietic stem cells differentiate into erythrocytes, the expression of the γ-globin gene is significantly improved, and the proportion of HbF in hemoglobin can be significantly improved.
Brief Description of the Drawings
[0015]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Embodiments for Carrying Out the Invention
[0016] Hereinafter, for the purpose of facilitating the understanding of the present invention, the present invention will be described in more detail with reference to the related drawings. Preferred embodiments of the present invention are shown in the drawings. However, the present invention can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the provision of these embodiments is intended to make the understanding of the content of the present invention more thorough and comprehensive.
[0017] Unless otherwise defined, all technical terms and scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the technical field to which the present invention belongs. In this specification, the terms used in the description of the present invention are only for explaining specific embodiments and do not limit the present invention. The term "and / or" used in this specification includes any and all combinations of one or more related items.
[0018] The raw materials used in the following examples are all commercially available.
[0019] In this specification, using gene editing techniques, for example, CRISPR-Cas induced gene editing techniques, the single-stranded oligonucleotide (ssODN) according to the present invention is linked to perform efficient gene editing on stem cells and progenitor cells having the ability to differentiate into red blood cells, such as CD34+ hematopoietic stem cells, and mutations are produced in the promoters of the HBG1 and HBG2 genes (located on human chromosome 11) of the encoded human γ-globin, artificially creating a sequence structure of one NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR in the sense strand or antisense strand of the promoter (Figure 1). This sequence, as an enhancer, can recruit transcriptional activators such as GATA1 after the target cells differentiate into red blood cells to promote γ-globin expression.
[0020] GATA-1 is a transcription regulatory factor with highly specific expression in the erythroid system and plays an important role in the differentiation process of erythrocytes. In erythrocytes, genes with highly specific expression in erythrocytes, such as α-globin, β-globin, and heme biosynthesis enzymes, are all directly transcribed and activated by GATA-1. As a transcription factor, GATA-1 selectively binds to the WGATAR sequence element in chromatin DNA (where W represents T or A, R represents A or G, and it may be represented by T / A(GATA)A / G, and its antisense complementary sequence is YTATCW, where Y represents T or C and may be represented by T / C(TATC)T / A). For example, multiple GATA sites have also been discovered in the regulatory region of the human β-globin gene. It should be noted that genes containing the GATA sequence are not necessarily activated by GATA-1. This is because the distribution of the GATA sequence in the genome is very wide, and it is necessary to form a certain form of sequence combination (element combination) with upstream and downstream sequences (cis elements) to play a role. For example, there are cis regulatory elements such as CACCC or GC box near the GATA sequence, and usually, it can recruit GATA-1 and co-bind with the transcription factor EKLF. For example, if there is an E-box element (CAGNTG, N represents any base) or a half E-box element (NTG) near the GATA sequence, it will recruit GATA-1 and co-bind with the transcription factor TAL1. By examining the binding sites of GATA-1 and TAL1 at the genomic level by ChIP-seq, there is an obvious sequence rule in about three-quarters of the co-binding sites of GATA-1 / TAL1, and a half E-box element (NTG) often exists in the 7-8 bases upstream of the WGATA sequence, which may be represented by NTG-N(7-8)-WGATA. According to tests, such a sequence is an active GATA element, and it has been proven that it can promote the expression of genes in erythrocytes. For example, the +58 enhancer in the BCL11A intron contains the CTG-N(7)-TGATAA sequence, and by destroying the GATA motif in this sequence, the expression of BCL11A in erythrocytes can be significantly reduced.
[0021] The sequence of 1400 bases upstream of the transcription start sites of the HBG1 and HBG2 genes has a very high similarity and is considered to be the promoter region. The inventors of the present application have found through research that while the promoter region of the γ-globin gene itself contains multiple GATA sequences (or TATC), it also contains a very large number of TG sequences, but γ-globin is hardly expressed in mature red blood cells. Through intensive research, the inventors of the present application have found that the GATA (or TATC) and TG sequences in the promoter of the γ-globin gene do not form an active GATA element (such as TG-N(7-8)-WGATAR) in terms of position and direction, so they cannot recruit highly expressed transcriptional activators in mature red blood cells such as GATA-1 / TAL1 and bind (co-bind) to the promoter region of the γ-globin gene, resulting in the silencing of γ-globin in mature red blood cells and hardly any expression.
[0022] Through intensive research, the inventors of the present application have found that there are some sites in the promoter regions of HBG1 and HBG2. If the sequences in their sense or antisense strands are modified (substituted, deleted, inserted, etc.) by a small number of bases, a sequence structure of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR can be formed. The inventors of the present application believe that if these sites are cleaved using a gene editing system to form DSBs, and a donor DNA template (for example, single-stranded oligonucleotide ssODN) is added to guide these sites to perform HDR repair, a certain proportion of the genome can be edited into the desired sequence structure. Finally, since sequences such as NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR are formed in the promoter region of the γ-globin gene, it is possible to recruit highly expressed transcriptional activators in mature red blood cells such as GATA-1 / TAL1 as enhancers and bind (co-bind) to the promoter region of the γ-globin gene, thereby promoting the high expression of γ-globin in mature red blood cells.
[0023] From the perspective of purpose, gene editing can be divided into two types. One type is to disrupt the sequence or structure of the target site, which is called knockout. The other type is to introduce specific sequence variations into the target site, which is called knockin. When introducing specific sequence variations, a commonly seen method is to simultaneously introduce a DNA donor template, enabling cells to utilize the homologous recombination mechanism to replace the sequence in the template with the genomic sequence, thereby achieving knockin. The DNA template used in HDR may be plasmid DNA, linearized double-stranded DNA, DNA carried by AAV, or single-stranded oligonucleotide (ssODN). ssODN is increasingly being used in gene editing, with high efficiency, easy synthesis, and is particularly applicable to gene editing in in vitro cultured cells.
[0024] The ssODN structure includes a 5′ homologous arm, a replacement sequence, and a 3′ homologous arm. The homologous arms are sequences homologous to the DNA regions on both sides of the target site waiting to be edited and are used to position to the target site on the chromosome. The 5′ homologous arm and the 3′ homologous arm are not usually positioned continuously in the chromosome, and there is a certain interval in the middle, for example, an interval of 1 to 20 nucleotides. These intervening sequences are the targets of gene editing (pseudo-editing sequences), that is, the sequences replaced by gene editing. The "replacement sequence" between the 3′ end of the 5′ homologous arm and the 5′ end of the 3′ homologous arm on the ssODN is the desired result of gene editing. While performing gene editing, ssODN is added to induce homologous recombination repair during gene editing, and from the result of the repair, the pseudo-editing sequence in the cell genome can be repaired to the replacement sequence. The length of the replacement sequence in the ssODN may be smaller than the pseudo-editing sequence. In this case, the result of gene editing is the deletion and / or replacement of the pseudo-editing sequence in the original genome. The length of the replacement sequence in the ssODN may be 0 bases. In this case, the pseudo-editing sequence in the genome is deleted. The length of the replacement sequence in the ssODN may be larger than the pseudo-editing sequence. In this case, the result of gene editing is that the pseudo-editing sequence is replaced and / or inserted.
[0025] The present invention is used in gene editing systems induced by site-specific nucleases such as "CRISPR-Cas", TALEN, and ZFN. "CRISPR-Cas" is a gene editing technology, including but not limited to various naturally occurring or artificially designed CRISPR-Cas systems, such as CRISPR-Cas9 system, CRISPR-Cas12 system, etc. The operating principle of CRISPR-Cas9 is that crRNA (CRISPR-derived RNA) binds to tracrRNA (trans-activating RNA) by base pairing to form a tracrRNA / crRNA complex, and this complex guides the nuclease Cas9 protein to cleave double-stranded DNA at the sequence target site paired with crRNA. The functions of tracrRNA and crRNA can be replaced by a single synthetic sgRNA with a guiding function. When using other CRISPR-Cas systems, it is necessary to design the corresponding sgRNA or crRNA. When using systems such as TALEN or ZFN, it is necessary to design the corresponding TALEN or ZFN nuclease based on the editing site according to the present invention.
[0026] Example 1: Selection of ssODN and CRISPR-Cas system for introducing an active GATA element into the promoter of the γ-globin gene
[0027] By analyzing the sequences (SEQ ID NO: 1 and SEQ ID NO: 2) within approximately 1.4 kb upstream of the HBG1 and HBG2 transcription start sites, the inventors discovered that the sequences in many sectors are altered by several bases (substitutions, deletions, insertions, etc.) and can form the sequence structures of NTG-N(7-8)-WGATAR or NAG-N(7-8)-WGATAR. By analyzing whether there is an NGG (PAM identified by spCas9) sequence near the target mutant bases in these sectors and whether the cleavage sites are well-positioned exactly at the target sequences that need to be edited, five candidate target regions ((A) to (E) in Figure 2) with the highest possibility of finally achieving efficient gene editing were obtained. Depending on the distance, the transcription start sites are as follows from near to far. Region 1: HBG1 and HBG2 promoters -92 to -66 (Figure 2(A)); Region 2: HBG1 and HBG2 promoters -129 to -98 (Figure 2(B)); Region 3: HBG1 and HBG2 promoters -175 to -153 (Figure 2(C)); Region 4: HBG1 gene and HBG2 gene -192 to -160 (Figure 2(D)); Region 5: HBG1 gene -428 to -406, and HBG2 gene -432 to -410 (Figure 2(E)).
[0028] According to the sequence characteristics within the five candidate regions and the locations of the cleavage points predicted by the CRISPR-Cas9 gene editing system, sequences within each region were analyzed to obtain appropriate mutant target types, such as those shown in Table 1 (SEQ ID NO: 3 to SEQ ID NO: 31). Among them, the underlines indicate the bases that need to be substituted, which are the desired results after gene editing. In the present invention, the length of the substituted bases is 0 to 6 bases, and the effects to be achieved are deletions, substitutions, insertions, or combinations of deletions, substitutions, and insertions.
[0029]
Table 1
[0030] In order to achieve the purpose of forming DSB by cleaving the DNA double strand near the editing site within the selected region in Table 1, the present invention selected the spCas9 CRISPR-Cas system (derived from Streptococcus pyogenes) with high cleavage efficiency, analyzed target sites that might have high cleavage efficiency, and selected site_1 to site_8 as candidate target sites. The identified target site DNA sequences and PAM sequences (NGG) are shown in Table 2 (SEQ ID NO:32 to SEQ ID NO:39).
[0031]
Table 2
[0032] According to the desired mutation type shown in Table 1 and the DNA strand (sense strand or antisense strand) identified by the sgRNA in Table 2, the corresponding guide gene editing was designed to repair the ssODN (Table 3: SEQ ID NO: 40 to SEQ ID NO: 65). The ssODN structure in the present invention includes a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm. Among them, the GATA or TATC sequence may be located at any position in the ssODN, for example, the substitution sequence, the 5′ homologous arm, the 3′ homologous arm, the junction between the 5′ homologous arm and the substitution sequence, and the junction between the 3′ homologous arm and the substitution sequence. The homologous arms on both sides of the ssODN may be symmetric or asymmetric (with different lengths on both sides). For the convenience of comparing systems, in the present invention, tests were conducted using ssODN with symmetric homologous arms. The length of the homologous arms on both sides of the ssODN may be 20 to 300 nt. For the convenience of comparing systems, in the examples of the present invention, ssODN with homologous arms of about 40 nt in length on both sides was used for illustration. The ssODN may be the sense strand or antisense strand of the edited region DNA (the homologous arm sequence is the same as the corresponding sense strand or the antisense strand), and in the present invention, the DNA strand identical to the sgRNA recognition site was selected as the ssODN master sequence. The sequence in the ssODN, other than the homologous arm sequences on both sides, may have 0, 1, 2, 3, 4, 5, or 6 bases as substitution bases, and the realized effect is deletion, substitution, insertion, or a combination of deletion, substitution, and insertion. The realized effect may be to change one or more bases in the genome, for example, deletion or substitution of 1 to 20 bases. For the sequences shown in Table 3 (SEQ ID NO: 40 to SEQ ID NO: 65), the underlined bases are the homologous arms on both sides, with a length of about 40 nt, and the non-underlined bases between the homologous arms on both sides are substitution bases. Among them, the number of substitution bases between the homologous arms on both sides of ssODN_16 is 0. The first three nucleotides at both ends of the ssODN are modified with phosphorothioate to enhance the stability of the ssODN and can improve its activity in gene editing.
[0033]
Table 3
[0034] sgRNA-spCas9 vectors (PX459, pSpCas9(BB)-2A-Puro) were used to express sgRNAs corresponding to the target sites in Table 2. These vectors can express an sgRNA with a length of 100 nt while expressing the spCas9 protein. Its 5′ end is a 20-nt guide sequence. The subsequent 80 nt is a universal sgRNA backbone sequence (SEQ ID NO:66, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU). The cloning method of sgRNA was as follows: Oligos of the guide strand sequence corresponding to each gRNA (similar to the 20-nt target site sequence in Table 2) and complementary strands were synthesized (cacc was introduced at the 5′ end of the guide strand sequence. If the first nucleotide at the 5′ end of the guide strand is not guanine G, caccG was added to the 5′ end of the guide strand, aaac was introduced at the 5′ end of the complementary strand, and if one G was added to the 5′ end of the guide strand, C was added to the 3′ end of the complementary strand to complement and pair with it). The two types of oligos were mixed equally, subjected to heat denaturation annealing treatment at 95 °C, and then ligated to the PX459 vector digested with the restriction enzyme Bbs I. Bacterial colony PCR and Sanger sequencing were used to determine whether the cloning was successful. For PCR, SEQ ID NO:67 (5′- 3′: GGACTATCATATGCTTACCGTAAC) and SEQ ID NO:68 (5′- 3′: GGCGGGCCATTTACCGTAAG) were used as primers. After successful cloning, eight types of plasmids were obtained, each expressing an sgRNA of SEQ ID NO:69 to SEQ ID NO:76 (Table 4).
[0035]
Table 4
[0036] The eight expressed plasmids were transfected into 293T cells. For the method, please refer to the method of the Lipofectamine 2000 TM kit. The transfected cells were cultured for 4 days, and the cells were collected to extract genomic DNA. Using SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, and SEQ ID NO:78 respectively, the HBG1 and HBG2 promoter gene segments were amplified by the KOD Plus high-fidelity enzyme PCR method. After purifying the obtained PCR products, sequencing was performed using SEQ ID NO:77 and SEQ ID NO:79 respectively. The gene editing efficiency was analyzed with synthego software for the files obtained from the sequencing results. As shown in Figure 3, except that the editing efficiency of sgRNA-8 is relatively low (about 20%), the overall editing mutation (insertion / deletion, Indel) efficiency in other groups is about 40 - 50%.
[0037]
Table 5
[0038] Example 2: Transfect ssODN into 293T cells together with the sgRNA-spCas9 vector to perform gene editing
[0039] By transfecting the eight types of sgRNA-spCas9 vectors described above into 293T cells together with appropriate ssODN, after adding ssODN, it was detected whether to guide the formation of the desired mutation type (generate HDR repair) after gene editing. According to the location of the sgRNA cleavage site, the eight types of sgRNA-spCas9 vectors were each formed into 30 combinations according to the sgRNA + ssODN combination method shown in Table 6. Lipofectamine 2000 TMUsing a reagent, ssODN was added while transfecting the plasmid, and the ssODN was delivered into the cells together with the plasmid. The transfected cells were cultured for 4 days, and the cells were collected to extract genomic DNA. Since the gene editing efficiencies of HBG1 and HBG2 are almost positively correlated, and often the gene editing efficiency of HBG2 is slightly higher than that of HBG1 (Figure 3), only the HBG2 genomic gene editing efficiency was selected and compared in subsequent tests. According to the method in Example 1, the HBG2 promoter gene segment was amplified by PCR, purified, and sequenced. As can be seen from the sequencing results, by analyzing the gene editing efficiency with synthego software, adding ssODN and sgRNA-spCas9 carrier for transfection can induce gene editing of 10-20% in many groups while improving the editing efficiency to form the desired mutation type (Figure 4).
[0040]
Table 6
[0041] Example 3: Gene editing was performed by transfecting ssODN and sgRNA-spCas9 carrier into K562 cells by electroporation
[0042] Liposomes (such as Lipofectamine 2000 TMThe efficiency of transfecting plasmid into suspension cells using a reagent is low. Usually, when transfecting suspension cells, the electroporation method is used. A combination of some sgRNAs and ssODNs in Example 2 was taken and introduced into K562 cells using a lonza-4D electroporation device, and the K562 cell transfection program in the device was used. The transfected cells were cultured for 4 days, the cells were collected to extract genomic DNA, and the HBG2 promoter gene segment was amplified by PCR for sequencing. As can be seen from the sequencing results, the gene editing efficiency was analyzed with synthego software. By electroporating the combinations of sgRNA-1, sgRNA-2, sgRNA-5 and ssODN into K562, high editing efficiency can be achieved (Figure 5), which is slightly higher than that in 293T cells. Inducing the formation of the desired mutation type by electroporating ssODN and sgRNA-spCas9 carrier is also slightly higher than that in 293T cells.
[0043] Example 4: Achieving efficient gene editing by transfecting ssODN and spCas9 protein / sgRNA RNP into K562 cells by electroporation
[0044] For the plasmid-expressing CRISPR-Cas system, the CRISPR-Cas system delivered in the form of ribonucleoprotein (RNP) has high gene editing efficiency and is less likely to induce apoptosis. Using commercially available spCas9 protein and chemically synthesized sgRNA-1, sgRNA-2, sgRNA-5 (identical to the sgRNA corresponding to Table 4 but with unmodified ends), RNP-1, RNP-2, and RNP-5 were incubated and packaged in vitro, respectively. A combination of RNP and some ssODN was delivered into K562 cells by electroporation. The transfected cells were cultured for 4 days, the cells were collected to extract genomic DNA, and the HBG2 promoter gene segment was amplified by PCR for sequencing. As can be seen from the sequencing results, the gene editing efficiency was analyzed with synthego software (Figure 6). For the combination without added ssODN, the overall gene editing efficiency can be significantly improved by about 2-fold by adding ssODN when electroporating RNP into K562 (Figure 6). At the same time, ssODN and RNP can induce a higher percentage of gene editing to form the desired mutation type (Figure 6).
[0045] Example 5: Introduction of ssODN and spCas9 protein / sgRNA RNP into human hematopoietic stem / progenitor cells by electroporation to achieve efficient gene editing and significantly improve HBG expression
[0046] After mobilized peripheral blood-derived human CD34-positive cells (mPBSC) were revived, they were cultured for 2 days in StemSpan serum-free expansion medium (SFEM) containing a large amount of human cytokines (SCF, TPO, Flt3L, 100 ng / ml each), and ssODN and spCas9 / sgRNA RNP were delivered to mPBSC cells using the EO-100 program in a lonza-4D electroporator. After electroporation was completed, they were continuously cultured for 1 day in SFEM containing a large amount of human cytokines (SCF / TPO / Flt3L, 100 ng / ml each), and then mPBSC was induced to differentiate into erythrocytes in the following three stages. The first stage: They were cultured for 7 days in IMDM culture medium containing additives such as EPO, SCF, human AB serum, insulin, transferrin, heparin, IL-3, and hydrocortisone. On the 5th day after induction of differentiation, 2×10e5 cells were taken to extract genomic DNA, and then the HBG2 promoter segment was amplified by PCR and sent to Sanger for sequencing. Similar to the results in K562 cells, electroporation of ssODN and spCas9 / sgRNA RNP into mPBSC cells could generate efficient gene editing, and in some of the groups, the formation of the desired mutation type by gene editing reached 30% (Figs. 7(A)-(C)).
[0047] Seven days after the electroporated mPBSC cells and untreated mPBSC cells (control, NC) were induced to differentiate in the first stage, they were cultured for 4 days in IMDM culture medium containing additives such as EPO, SCF, human AB serum, insulin, transferrin, and heparin. Finally, they were cultured for 7 days in IMDM culture medium containing additives such as EPO, human AB serum, insulin, transferrin, and heparin. Eighteen days after induction of differentiation, the electroporated mPBSC cells and untreated mPBSC cells showed a distinct dark red color after centrifugation. Among them, it was proved that a large number of erythrocytes were contained and the electroporated mPBSC cells could normally differentiate into erythrocytes.
[0048] When differentiation induction was approaching the end, some cells were taken to extract mRNA, and the expression level of HBG mRNA was detected by reverse transcription-real-time quantitative PCR (RT-qPCR). For non-transfected cells (NC), by transfecting RNP-2 together with ssODN_6, ssODN_13, ssODN_14, ssODN_15, and ssODN_17, the expression level of HBG mRNA was improved (Figure 8), and the HBG mRNA could be increased by up to more than three times at its highest.
[0049] Using a glycated hemoglobin A1c detection system (VARIANT II TURBO HbA1c kit-2.0), HPLC method detection was performed on the hemoglobin after differentiating the electrically transcribed hematopoietic stem cells in the RNP-2 group into red blood cells. As a result, for cells that were not gene-edited, after adding ssODN and performing gene editing, the content of fetal hemoglobin (HbF) was significantly improved, reaching 27% - 36%, which was more than twice that of the 13.3% in the control group (Figure 9).
[0050] As can be seen from the results of the above examples, the present invention provides a gene editing method for improving γ-globin gene expression, which is different from the prior art. When the ssODN according to the present invention is used for γ-globin gene editing, it can guide the formation of desired mutations at predetermined sites in the regulatory regions of the HBG1 and HBG2 genes after gene editing, so as to form an active GATA element. This element can play a positive regulatory role after the gene-edited cells (such as hematopoietic stem cells) differentiate into red blood cells, and can activate or significantly improve the γ-globin gene expression. Therefore, the present invention has potential application value in the gene therapy of β-hemoglobinopathy.
[0051] The technical features of the above embodiments can be arbitrarily combined. For the sake of simplicity, not all combinable forms of the technical features in the above embodiments are described, but as long as there is no contradiction in the combination of these technical features, they should be regarded as within the scope described in this specification.
[0052] The above-described embodiments are merely illustrative of some embodiments of the present invention, and it should be understood that the description, although specific and detailed, does not limit the scope of the present invention. Those skilled in the art can make some modifications and improvements on the premise of not departing from the idea of the present invention, and it is obvious that all of these belong to the protection scope of the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the claims.
Claims
1. 1. A method for activating γ-globin gene expression, comprising: A method comprising artificially introducing a GATA or TATC sequence into a sense strand or an antisense strand in a γ-globin gene regulatory region by gene editing technology to form an enhancer element containing a GATA motif in the regulatory region of the γ-globin gene.
2. The introduction of a GATA or TATC sequence can be achieved by deleting a sequence, inserting a sequence, mutating a sequence, or a combination thereof. The method of claim 1.
3. The GATA motif is the sequence WGATAR, or the corresponding antisense complementary sequence YTATCW, where W is T or A, R is A or G, and Y is T or C. The method of claim 1.
4. The enhancer element further comprises a NTG or NAG motif, or a corresponding antisense complementary sequence; where N is A, G, C, or T. The method of claim 1.
5. the distance between the GATA motif and the NTG motif or the NAG motif is 7 to 8 bases, and the NTG motif or the NAG motif is located upstream of the GATA motif; The method according to claim 4.
6. A gene editing ssODN containing a GATA or TATC sequence.
7. The ssODN includes a 5' homology arm, a replacement sequence, and a 3' homology arm. The ssODN described in claim 6.
8. The 5' homologous arm and the 3' homologous arm in the ssODN are symmetric or asymmetric, and the length of the 5' homologous arm and the 3' homologous arm is 20 to 300 nt. The ssODN described in claim 7.
9. The 5' or 3' homologous arm in the ssODN is selected from the sense or antisense strand of the pseudo-edited region DNA; The ssODN described in claim 7.
10. The number of bases in the replacement sequence in the ssODN is 0 to 6; The ssODN described in claim 7.
11. The distance between the 3' end of the 5' homologous arm and the 5' end of the 3' homologous arm in the ssODN is 0 to 20 bases; The ssODN described in claim 7.
12. The ssODN includes sequences selected from the sequences represented by SEQ ID NO: 4 to SEQ ID NO: 7, SEQ ID NO: 9 to SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28 to SEQ ID NO: 31, or antisense complementary sequences thereof; The ssODN described in claim 6.
13. The ssODN includes sequences selected from the sequences represented by SEQ ID NO: 40 to SEQ ID NO: 65, or their antisense complementary sequences; The ssODN described in claim 6.
14. The ssODN is chemically modified, and its 5' and 3' ends are phosphorothioate-modified nucleotides. The ssODN described in claim 6.
15. A guide sequence that is partially or completely complementary to the DNA sense or antisense strand in the HBG1 or HBG2 regulatory region is included. sgRNA.
16. The sequence in the HBG1 regulatory region is represented by SEQ ID NO: 1: The sgRNA described in claim 15.
17. The sequence in the HBG2 regulatory region is represented by SEQ ID NO: 2: The sgRNA described in claim 15.
18. The sgRNA of claim 15, wherein the DNA sequence corresponding to the guide RNA sequence of the sgRNA molecule is similar to a sequence selected from the group consisting of SEQ ID NO: 32 to SEQ ID NO:
39.
19. The sgRNA is any one or more selected from the sequences represented by SEQ ID NO: 69 to SEQ ID NO: 76; The sgRNA described in claim 15.
20. The present invention includes a gene editing system for a target HBG1 or HBG2 gene regulatory region, and the ssODN according to any one of claims 6 to 14. Gene editing compositions.
21. The gene editing system is a CRISPR-Cas editing system, a TALEN editing system, or a ZFN editing system.
21. The composition of claim 20.
22. The CRISPR-Cas editing system is a CRISPR-Cas9 or CRISPR-Cas12 system; 22. The composition of claim 21.
23. Among the compositions, the CRISPR-Cas editing system is a ribonucleoprotein complex consisting of a guide RNA and a Cas protein; 22. The composition of claim 21.
24. Among the compositions, the CRISPR-Cas editing system is an RNA complex consisting of mRNA encoding a Cas protein and gRNA; 22. The composition of claim 21.
25. Among the compositions, the CRISPR-Cas editing system is a plasmid expressing a Cas protein and a gRNA; 22. The composition of claim 21.
26. The composition comprises an sgRNA according to any one of claims 15 to 19, The sgRNA is chemically synthesized or in vitro transcribed.
21. The composition of claim 20.
27. A kit for activating a γ-globin gene, comprising: (1) An ssODN according to any one of claims 6 to 14, (2) An sgRNA according to any one of claims 15 to 19, (3) A carrier expressing Cas9 or Cas12 protein, Cas9 or Cas12 protein, and at least one of mRNA corresponding to Cas9 or Cas12 protein; A kit characterized by:
28. A hematopoietic stem cell obtained by introducing the composition according to any one of claims 20 to 26 into the hematopoietic stem cell by an electrical transfer method.
29. Use of the ssODN of any one of claims 6 to 14, the sgRNA of any one of claims 15 to 19, the composition of any one of claims 20 to 26, the kit of claim 27, or the hematopoietic stem cell of claim 28 in the preparation of a cell or a drug for treating β-thalassemia or sickle cell anemia.
Citation Information
Patent Citations
CRISPR / CAS-Related Methods and Compositions for Treating Beta Hemoglobinopathies
JP2019508051A
Compositions and methods for modulating hemoglobin gene family expression
WO2013173599A1
Systems and methods for the treatment of hemoglobinopathies
WO2019178416A1
Methods for increasing fetal hemoglobin content in eukaryotic cells and uses thereof for the treatment of hemoglobinopathies
WO2020053224A1