Strains and methods for preparing hem-containing proteins

Abstract

To provide materials and methods for producing hem-binding proteins.SOLUTION: Provided herein is a nucleic acid construct comprising: a first nucleotide sequence encoding an aminolevulinate synthase (ALAS) operably linked to a first promoter element, where the ALAS protein comprises at least a first hem-responsive motif (HRM), and the ALAS protein comprises a mutation at a cysteine in the first HRM; and a second nucleotide sequence encoding a hem-binding protein, where the second nucleotide sequence encoding the hem-binding protein is operably linked to the first promoter element or linked to a second promoter element.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Application No. 62 / 838,770, filed on April 25, 2019, which is hereby incorporated by reference in its entirety.

[0002] Description of Electronically Submitted Text File Text file submitted electronically with this specification: named 38767 - 0158WO1.txt, with a filing date of April 24, 2020, and a file size of ≈69 kilobytes. The content of the copy of the sequence listing in a computer - readable format is hereby incorporated by reference in its entirety.

[0003] Technical Field The present disclosure generally relates to DNA constructs and methods of using such DNA constructs to genetically engineer cells (e.g., yeast cells (e.g., methanol - assimilating yeast cells)).

Background Art

[0004] Cells such as Pichia pastoris are generally used for the expression of recombinant proteins. Provided herein are constructs that can be used to efficiently express one or more proteins in fungal cells (e.g., cells of the genus Aspergillus, Trichoderma, or yeast cells (e.g., methanol - assimilating yeast cells)).

Summary of the Invention

[0005] ​​​​​​​​This document is based at least in part on the identification of mutations within aminolevulinate synthase (ALAS) that can confer increased expression of heme-binding proteins. The mutant ALAS proteins described herein can be used, for example, for the efficient expression of heme-binding proteins in Pichia. In one aspect of the present disclosure, there is provided a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS contains a first mutation within a first heme-responsive motif (HRM), a first exogenous nucleic acid construct, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein operably linked to the first promoter element or operably linked to a second promoter element, and a methanol-utilizing yeast cell is provided. The methanol-utilizing yeast cell can have one or more of the following features. The methanol-utilizing yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methanol-utilizing yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-utilizing yeast cell can be a Pichia pastoris cell. The mutant ALAS protein can be used for the efficient expression of heme-binding proteins in Pichia.

[0006] In one aspect of the present disclosure, there is provided a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS contains a first mutation within a first heme-responsive motif (HRM), a first exogenous nucleic acid construct, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein operably linked to the first promoter element or operably linked to a second promoter element, and a methanol-utilizing yeast cell is provided. The methanol-utilizing yeast cell can have one or more of the following features. The methanol-utilizing yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methanol-utilizing yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-utilizing yeast cell can be a Pichia pastoris cell. The mutant ALAS protein can be used for the efficient expression of heme-binding proteins in Pichia. In one aspect of the present disclosure, there is provided a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS contains a first mutation within a first heme-responsive motif (HRM), a first exogenous nucleic acid construct, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein operably linked to the first promoter element or operably linked to a second promoter element, and a methanol-utilizing yeast cell is provided. The methanol-utilizing yeast cell can have one or more of the following features. The methanol-utilizing yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methanol-utilizing yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-utilizing yeast cell can be a Pichia pastoris cell. The mutant ALAS protein can be used for the efficient expression of heme-binding proteins in Pichia. In one aspect of the present disclosure, there is provided a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS contains a first mutation within a first heme-responsive motif (HRM), a first exogenous nucleic acid construct, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein operably linked to the first promoter element or operably linked to a second promoter element, and a methanol-utilizing yeast cell is provided.

[0007] The methanol-utilizing yeast cell can have one or more of the following features. The methanol-utilizing yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methanol-utilizing yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-utilizing yeast cell can be a Pichia pastoris cell. The methanol-utilizing yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The methanol-utilizing yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-utilizing yeast cell can be a Pichia pastoris cell. The mutant ALAS protein can be used for the efficient expression of heme-binding proteins in Pichia. The methanol-utilizing yeast cell can be a Pichia pastoris cell. It can be Pichia pastoris cells. The first mutation can be a mutation from cysteine to serine. The first mutation can be a mutation from cysteine to alanine. ALAS can include a second mutation within the second HRM. The second mutation can be a mutation from cysteine to serine. The second mutation can be a mutation from cysteine to alanine. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The ALAS protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein can include an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. The heme-binding protein can be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemocyanin, histoglobin, leghemoglobin, myoglobin, neuroglobin, nonsymbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein can be nonsymbiotic hemoglobin. The heme-binding protein can be leghemoglobin. The heme-binding protein can have at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 - 27. acid sequence. It may contain an acid sequence. The methanol-assimilating yeast cell may further contain a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor. The third nucleic acid construct may be operably linked to a first promoter element, a second promoter element, or a third promoter element. The first promoter element may contain a recognition sequence for the transcription factor. The second exogenous nucleic acid construct may be operably linked to the second promoter element, and the second promoter element contains a recognition sequence for the transcription factor. The third nucleic acid construct may be operably linked to the third promoter element, and the third promoter element contains a recognition sequence for the transcription factor. The methanol-assimilating yeast cell may further contain a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis. The fourth nucleic acid construct is operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. The protein involved in heme biosynthesis may be selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase. The first exogenous nucleic acid construct may be a heterologous nucleic acid construct. The second exogenous nucleic acid construct may be a heterologous nucleic acid construct. The heme-binding protein may be an exogenous heme-binding protein. The heme-binding protein may be a heterologous heme-binding protein.

[0008] In another aspect of the present invention, a method for producing a heme-binding protein in a Pichia pastoris cell is provided. The method includes: The nucleotide sequence encoding the ALAS protein is The AS comprises a first exogenous heme-responsive motif (HRM)-containing first mutation. Expressing the nucleic acid construct and expressing the nucleotide sequence encoding the heme-binding protein. expressing a second exogenous nucleic acid construct comprising a heme binding protein sequence, A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a gene is coupled to the first promoter. operably linked to the element or operably linked to a second promoter element Optionally linked, methods are provided.

[0009] Implementations may have one or more of the following features: the ALAS is in the second HRM; The method may include a second mutation of the first exogenous nucleic acid construct. The method can produce a heme-binding protein with a titer of at least 5%. The corresponding method lacking the causative nucleic acid construct was used to detect heme-binding proteins at a titer of at least 10%. The method may comprise at least one step of producing a corresponding protein lacking the first exogenous nucleic acid construct. The method may produce a heme-binding protein at a titer of greater than 15%. The corresponding method lacking the construct expressed heme-binding protein at a titer of at least 20%. The method may produce a titer that is at least 5% greater than a corresponding method lacking the first mutation. The method may further comprise the step of: generating a heme-binding protein by subjecting the heme-binding protein to a corresponding method lacking the first mutation. The heme-binding protein may be produced at a titer of at least 10%. A corresponding method lacking a mutation can produce a heme-binding protein at a titer exceeding at least 15%. The method can produce a heme-binding protein at a titer exceeding at least 20% of a corresponding method lacking a first mutation. The method can produce a heme-binding protein at a titer exceeding at least 5% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 5% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 10% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 10% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 15% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 15% of a corresponding method lacking a first mutation and a second mutation. The method can produce a heme-binding protein at a titer exceeding at least 20% of a corresponding method lacking a first mutation and a second mutation. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be cells of the genus Pichia, Candida, Hansenula, or Torulopsis. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be cells of the genus Pichia, Candida, Hansenula, or Torulopsis. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be cells of the genus Pichia, Candida, Hansenula, or Torulopsis. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be Pichia methanolica cells, Pichia pastoris cells, Candida boidinii cells, or Hansenula polymorpha cells. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be Pichia methanolica cells, Pichia pastoris cells, Candida boidinii cells, or Hansenula polymorpha cells. It can be carried out in the absence of the addition of methanol. Methanol-utilizing yeast cells can be Pichia pastoris cells. The first mutation can be a mutation from cysteine to serine. The first mutation can be a mutation from cysteine to alanine. The mutation of 2 can be a mutation from cysteine to serine. The second mutation can be a mutation from cysteine to alanine. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The ALAS protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein can include an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. The heme-binding protein can be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein can be non-symbiotic hemoglobin. The heme-binding protein can be leghemoglobin. The heterologous heme-binding protein can include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. The method may further include the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is a first promoter element, a second promoter element, or The mutation from cysteine to alanine is possible. The first exogenous nucleic acid construct may include a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. It can contain a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The ALAS protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein can include an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. The heme-binding protein can be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. It can be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. It can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein can be non-symbiotic hemoglobin. The heme-binding protein can be leghemoglobin. The heterologous heme-binding protein can include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. The method may further include the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is a first promoter element, a second promoter element, or The heme-binding protein can be leghemoglobin. The heterologous heme-binding protein can include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. The heterologous heme-binding protein can include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. The method may further include the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is a first promoter element, a second promoter element, or The method may further include the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is a first promoter element, a second promoter element, or a combination thereof. is operably linked to a third promoter element. The first promoter ele ment may include a recognition sequence for a transcription factor. The second exogenous nucleic acid construct may be operably linked to a second pro moter element, and the second promoter element includes a recognition sequence for a transcription factor. The third nucleic acid construct may be operably linked to a third promoter ele ment, and the third promoter element includes a recognition sequence for a transcription factor The method may further include the step of expressing a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis, and the fourth nucleic acid construct is operably linked to the first promoter element, the second promoter element, the third promoter element, or a fourth promoter element. The protein involved in heme biosynthesis is selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CP G oxidase, PPG oxidase, and ferrochelatase. The first exogenous nucleic acid construct may be a heterologous nucleic acid construct. The second exogenous nucleic acid construct may be a heterologous nucleic acid construct. The heme-binding protein may be an exogenous heme-binding protein and may be a heterologous heme-binding protein. In another aspect of the present specification, a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element is provided, wherein ALAS has a first mutation within a first heme-responsive motif (HRM) and a second mutation within a second heme-responsive motif, and the second mutation is different from the first mutation.

[0010] In another aspect of the present disclosure, a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element is provided, wherein ALAS has a first mutation within a first heme-responsive motif (HRM) and a second mutation within a second heme-responsive motif, and the second mutation is different from the first mutation. A first exogenous nucleic acid construct comprising a second mutation within the HRM of 2, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin, which is operably linked to it, or a second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin, which is operably linked to a first promoter element, is provided in Pichia pastoris cells. The practice may include one or more of the following features. The first mutation may be a mutation from cysteine to serine. The second mutation may be a mutation from cysteine to serine.

[0011] In another aspect of the present specification, a method for producing leghemoglobin, comprising expressing a nucleotide sequence encoding aminolevulinate synthase (ALAS), which is operably linked to a first promoter element, and ALAS comprises a first mutation within a first heme reactive motif (HRM) and a second mutation within a second HRM, a first exogenous nucleic acid construct, and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin, wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin is operably linked to a first promoter element or is operably linked to a second promoter element, is provided. The practice may have one or more of the following features. The method may further comprise culturing the Pichia pastoris cells under conditions suitable for expressing the first exogenous nucleic acid construct and the second exogenous nucleic acid construct. The method may further comprise isolating the leghemoglobin from the culture medium.

[0012] The first mutation may be a mutation from cysteine to serine. The second mutation may be a mutation from cysteine to serine.

[0013] The practice may have one or more of the following features. The method may further comprise culturing the Pichia pastoris cells under conditions suitable for expressing the first exogenous nucleic acid construct and the second exogenous nucleic acid construct. The method may further comprise isolating the leghemoglobin from the culture medium. A corresponding method lacking the building can produce leghemoglobin at a titer exceeding at least 5%. A method can produce leghemoglobin at a titer exceeding at least 10% of a corresponding method lacking a first exogenous nucleic acid construct. A method can produce leghemoglobin at a titer exceeding at least 15% of a corresponding method lacking a first exogenous nucleic acid construct. A method can produce leghemoglobin at a titer exceeding at least 20% of a corresponding method lacking a first exogenous nucleic acid construct. A method can produce leghemoglobin at a titer exceeding at least 20% of a corresponding method lacking a first exogenous nucleic acid construct. A method can produce leghemoglobin at a titer exceeding at least 5% of a corresponding method lacking a first mutation and a second mutation. A method can produce leghemoglobin at a titer exceeding at least 10% of a corresponding method lacking a first mutation and a second mutation. A method can produce leghemoglobin at a titer exceeding at least 15% of a corresponding method lacking a first mutation and a second mutation. A method can produce leghemoglobin at a titer exceeding at least 20% of a corresponding method lacking a first mutation and a second mutation. A method can produce leghemoglobin at a titer exceeding at least 20% of a corresponding method lacking a first mutation and a second mutation. A method can produce leghemoglobin at a titer exceeding at least 20% of a corresponding method lacking a first mutation and a second mutation. The method can be carried out in the absence of the addition of methanol.

[0014] In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided. In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided. In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided. In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided. In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided. In another aspect of the present specification, a first exogenous nucleic acid construct is provided that includes a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element, and Pichia pastoris cells are provided.

[0015] ​The implementation may include one or more of the following features. Pichia pastoris cells contain a nucleotide sequence encoding a protein having at least 90% sequence identity to any of SEQ ID NOs: 1-27, and may be operably linked to a first promoter element or may further contain a second exogenous nucleic acid construct operably linked to a second promoter element. Pichia pastoris cells contain a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 4, and may be operably linked to a first promoter element or may further contain a second exogenous nucleic acid construct operably linked to a second promoter element. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the practice of this invention, methods and materials similar or equivalent to those described herein may be used, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. For details of one or more embodiments of the present disclosure, reference is made to the accompanying drawings and the following description.

[0016]

[0017] It will be apparent. Other features, objects, and advantages of the present disclosure will be apparent from the description and drawings, as well as from the patent claims. In the claims, the term "comprising" may, in accordance with standard practice in patent law, be replaced with "consisting essentially of" or "consisting of" .

Brief Description of the Drawings

[0018]

Figure 1

Figure 2

Figure 3

Figure 4-1

Figure 4-2

Figure 4-3

Figure 4-4

Figure 4-5

Figure 4-6

Figure 4-7

Figure 4-8

Figure 4-9

Figure 4-10

Figure 4-11

Figure 4-12

Figure 4-13

Figure 4-14

Figure 4-15

Figure 4-16

Figure 4-17

Figure 4-18

Figure 4-19

Figure 4-20

Figure 5

Figure 6-1

Figure 6-2

Figure 7-1

Figure 7-2

Figure 8-1

Figure 8-2

Figure 8-3

DETAILED DESCRIPTION OF THE INVENTION

[0019] This document relates to materials and methods for protein production. In particular, this document relates to materials and methods for the production of heme and heme-binding proteins. and heme-binding proteins.

[0020] Methanol-utilizing yeasts such as Pichia pastoris are commonly used to produce recombinant proteins. Pichia strains are typically capable of growing using methanol as the sole carbon source. The term "Pichia pastoris" is still used, and any suitable strain can be used. source. The term "Pichia pastoris" is still used, and any suitable strain can be used. It may refer to Komagataella species, but Pichia pastoris is reclassified as Komagataella species such as Komagataella phaffii, Komagataella pastoris (Komagataella pastoris), or Komagataella pseudopastoris. It will be understood that in general, laboratory strains of P. pastoris are Komagataella phaffii. Proteins that bind to heme include, inter alia, cytochrome, catalase, myoglobin, and hemoglobin. Aminolevulinate synthase (ALAS) is an enzyme (EC 2.3.1.37) that

[0021] catalyzes the first step in heme biosynthesis (see Figure 1 for a schematic of the biosynthetic pathway of heme b), converting glycine and succinyl CoA to aminolevulinic acid. ALAS translocates to the mitochondria for this step of heme biosynthesis. Aminolevulinic acid is converted to heme b (Figure 2) by other enzymes (e.g., ALA dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen I / II synthase (UPG3S), uroporphyrinogen III decarboxylase (U PG3D), coproporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and / or ferrochelatase (FC)). In some cases, the action of ALAS is regulated by heme ​​Regarding the biosynthetic pathway, it may be rate-limiting. Other hemes (e.g., heme o, heme a, heme c ) can be made via the action of enzymes on heme b. Hemin (Figure 3) is a complex of protoporph yrin IX (e.g., the protoporphyrin of heme b), ferric (+3 oxidation state) iron, and chloride ligands.

[0022] As used herein, "intermediate of the heme biosynthetic pathway" refers to one or more of delta-aminolevulinic acid ( d-ALA), porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, or protoporphyrin IX. In some embodiments, the intermediate of the heme biosynthetic pathway can be selected from the group consisting of delta-aminolevulinic acid (d-ALA), porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, and protoporphyrin IX. In some embodiments, the intermediate of the heme biosynthetic pathway can be selected from the group consisting of porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, or protoporphyrin IX. .

[0023] The translocation of some ALAS proteins to the mitochondria can be affected by one or more heme regulatory motifs (HRMs; sometimes also called heme-responsive motifs) contained within the ALAS protein. Many HRMs contain a C-P motif, and cysteine is often the ligand of the main axis to heme. In some embodiments ​​​​​​​​​​​HRM is R / L / N / A / C / S / H / I / G / Q-C-P-L / V / I / F / C - having the sequence of -L / M / P / V (SEQ ID NO: 32) (e.g., HRM is A-C-P-F -V (SEQ ID NO: 33), H-C-P-V-V (SEQ ID NO: 34), I-C-P-F-M (SEQ ID NO: 35), or G-C-P-V-V (SEQ ID NO: 36); see, e.g., FIG. 8 i). Some organisms have three HRMs within their ALAS sequences, whereas other organisms (e.g., methylotrophic yeasts such as Pichia pastoris ) have two HRMs. Generally, HRMs can be designated HRM1, HRM2, HRM3, etc., depending on where they occur within the protein sequence. For example, the first-occurring HRM (read from the N-terminus to the C-terminus) within the protein sequence would be designated HRM1. Mutations of cysteine within the HRM (e.g., to serine or alanine) can increase the mitochondrial translocation of ALAS (see, e.g., Gonzalez-Domínguez, et al., Yeast. 2001 Jan 15;18(1):41-8. (PubMed ID (PMID) 11124700; Munakata et al., J Biochem. 2004 Aug;136(2):233-8. (PMID 15496594); Dailey et al, Biochem J. 2005 Mar 1;386(Pt 2):381-6. (PMID 15482256), each of which is incorporated herein by reference in its entirety). Without being bound to any particular theory, the heme that binds to the HRM of wild-type ALAS is ALAS and ALAS is thought to inhibit mitochondrial translocation in a negative feedback manner. Heme is also thought to be involved in the degradation of some ALAS proteins (see, for example, Kubota, et al., J Biol Chem. 2016 Sep 23;291(39):20516-29. doi: 10.1074 / jbc.M116.719161. Epub 2016 Aug 5. (PMID 274969 48), which is incorporated herein by reference in its entirety).

[0024] The "first HRM" can be an HRM in any part of the protein sequence; it is understood that the "first HRM" can be, but is not necessarily, the first-occurring HRM (HRM1) within the protein sequence. In some embodiments, the first HRM is HRM1 and the second HRM is HRM2. In some embodiments, the first HRM is HRM1 and the second HRM is HRM3. In some embodiments, the first HRM is HRM2 and the second HRM is HRM1. In some embodiments, the first HRM is HRM2 and the second HRM is HRM3. In some embodiments, the first HRM is HRM3 and the second HRM is HRM1. In some embodiments, the first HRM is HRM3 and the second HRM is HRM2.

[0025] In some embodiments, the mutation in the nucleic acid can be an insertion, deletion, or substitution. In some embodiments, the mutation in the nucleic acid can be a substitution (e.g., a guanosine-to-cytosine mutation). In some embodiments, the coding sequence (e.g., a sequence encoding a protein) The substitutions within may be silent mutations (e.g., coding for the same amino acid). In some embodiments, the substitutions within the coding sequence may be non-synonymous mutations (e.g., missense mutations or nonsense mutations). In some embodiments, the substitutions within the coding sequence may be missense mutations (e.g., coding for different amino acids). In some embodiments, the substitutions within the coding sequence may be nonsense mutations (e.g., coding for premature stop codons). In some embodiments, the mutations within the nucleic acid may be deletions. It is understood that mutations may be used, for example, with CRISPR, TALEN, and / or zinc finger nucleases to modify endogenous nucleic acids.

[0026] In some embodiments, the mutations within the protein sequence may be insertions, deletions, or substitutions. It is understood that mutations within the nucleic acid encoding the protein may cause mutations within the protein sequence. In some embodiments, the mutations within the protein sequence may be substitutions (e.g., mutations from cysteine to serine, mutations from cysteine to alanine, mutations from cysteine to valine, mutations from cysteine to leucine, mutations from cysteine to isoleucine, mutations from cysteine to glycine, mutations from cysteine to phenylalanine, mutations from cysteine to threonine, mutations from cysteine to methionine, mutations from cysteine to tryptophan, mutations from cysteine to tyrosine, mutations from cysteine to asparagine, mutations from cysteine to glutamine, mutations from cysteine to proline, cysteine mutations from arginine, mutations from cysteine to histidine, mutations from cysteine to lysine, mutations from cysteine to aspartic acid, or mutations from cysteine to glutamic acid). In some embodiments, the mutations within the protein sequence can be deletions.

[0027] In some embodiments, the ALAS proteins described herein have at least one HRM; for example, mutations in the first HRM, the second HRM, the third HRM, the fourth HRM, the fifth H RM, etc. may be included.

[0028] In some embodiments, the ALAS proteins described herein can include mutations within at least one HRM (e.g., within the first HRM). In some embodiments, the ALAS proteins described herein can include mutations within a single HRM (e.g., within the first HRM or the second HRM). In some embodiments, the ALAS proteins described herein can include mutations at the cysteine of at least one HRM (e.g., the first HRM). In some embodiments, the ALAS proteins described herein can include mutations at the cysteine of a single HRM (e.g., the first HRM or the second HRM).

[0029] In some embodiments, the ALAS proteins described herein can include mutations in at least two HRMs (e.g., the first HRM and the second HRM). In some embodiments, the ALAS proteins described herein can include mutations in each of the two HRMs (e.g., the first HRM and the second HRM). In some embodiments In this case, the mutation in the first HRM and the mutation in the second HRM can be the same ( for example, both are mutations from cysteine to serine or alanine). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be different (for example, one is a mutation from cysteine to serine and one is a mutation from cysteine to alanine). In some embodiments, the ALAS protein described herein can include mutations at the cysteines of at least two HRMs (for example, the first HRM and the second HRM). In some embodiments, the A LAS protein described herein can include mutations at the cysteines of each of the two HRMs (for example, the first HRM and the second HRM). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be the same (for example, both are mutations from cysteine to serine or alanine). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be different (for example, one is a mutation from cysteine to serine and one is a mutation from cysteine to alanine). (for example, one is a mutation from cysteine to serine and one is a mutation from cysteine to alanine). In some embodiments, the ALAS protein described herein can include mutations in at least three HRMs (for example, the first HRM, the second HRM, and the third HRM).

[0030] In some embodiments, the ALAS protein described herein can include mutations in three HRMs (for example, the first HRM, the second HRM, and the third HRM). In some embodiments, the ALAS protein described herein can include mutations in each of the three HRMs (for example, the first HRM, the second HRM, and the third HRM). In some embodiments, the ALAS protein described herein is may include mutations in the cysteine of at least three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the ALAS proteins described herein may include mutations in the cysteine of each of the three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the mutations in each of the first HRM, the second HRM, and the third HRM may be the same (e.g., all are mutations from cysteine to serine or alanine). In some embodiments, the mutations in one or two of the three HRMs may be different. In some embodiments, the substitution (mutation to a different amino acid) may be a substitution of an amino acid ( e.g., cysteine) within the HRM. In some embodiments, the mutation within the first HRM

[0031] may be a substitution of an amino acid (e.g., cysteine) within the first HRM. In some embodiments, the mutation within the second HRM may be a substitution of an amino acid (e.g., cysteine) within the second HRM. In some embodiments, the mutation within the third HRM may be a substitution of an amino acid (e.g., cysteine) within the third HRM. The substitution may be any suitable substitution. In some embodiments, the different amino acids may be selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, and valine. In some embodiments, the different amino acids may be arginine, histidine, lysine, serine, threonine, asparagine, gluta mine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, and valine. In some embodiments, the different amino acids may be selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, and valine. Rutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine , methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, th rosine, and valine. In some embodiments, the different amino acids are nonpolar aliphatic amino acids (e.g., glycine, proline, alanine, isoleucine, leucine, methionine, or valine), aromatic amino acids (e.g., phenylalanine, tryptophan, or tyrosine), polar uncharged amino acids (e.g., serine, threonine , asparagine, or glutamine), or positively charged amino acids (arginine, histidine , or lysine). In some embodiments, the different amino acids are serine . In some embodiments, the different amino acids are alanine. In some embodiments, the different amino acids are phenylalanine. In some embodiments, the different amino acids are asparagi ne acid. In some embodiments, the different amino acids are histidine.

[0032] Surprisingly, in each of the two HRMs, co-expressing an ALAS protein with a cysteine-to-serine mutation along with an exogenous heme-binding protein can significantly increase the titer of the exogenous heme-binding protein.

[0033] Generally, "titer" is a measure of the amount of a substance in a solution. As used herein, the "titer" of a heme -binding protein refers to the total polypeptide amount, whether or not bound to heme, unless otherwise specified. The titer of a protein is measured by high performance liquid chromatography (HPLC or UPLC), liquid chromatography , or the like. The titer of a protein can be determined by high performance liquid chromatography (HPLC or UPLC), liquid chromatography Liquid chromatography-mass spectrometry (LC-MS), enzyme immunoassay (ELISA), enzyme activity measurement , iron measurement techniques such as atomic absorption spectrometry, LC-MS, or ultraviolet and / or visible light spectrometry, etc., can be measured by an appropriate method.

[0034] Mutations within ALAS, such as those described herein, can be used to increase the production of heme . In some embodiments, the titer of the heme-binding protein can increase . In some embodiments, the titer of leghemoglobin (LegH) can increase. The materials and methods of the present disclosure can be useful for increasing the production of heme.

[0035] The materials and methods described herein can have applications in many industries. For example , heme proteins can be used in food. As another example, heme proteins (e.g., hemoglobin, cytochrome P450) can be prepared for research purposes (e.g., to study drug metabolism ). Heme proteins can also be used in industry (e.g ., for use in detergents for cleaning, pulp bleaching, lignin decomposition, etc., catalase, laccase , and / or peroxidase). Another potential application for heme proteins is biocatalysis (e.g., cytochrome P450, lipoxygenase , and / or laccase can be used in the production of pharmaceutical and household chemicals ). Some heme proteins can be used as therapeutic agents (e.g., as part of a nitric oxide synthase or a blood exchange agent). In some cases, heme proteins can be used for electronic engineering purposes (e.g., for the production of renewable electricity). Another By way of example, heme therapy can be an option for treating patients with acute porphyria, which is a group consisting of eight hereditary diseases resulting from the inability to produce heme. It can be an option for treating patients with acute porphyria, which is a group consisting of eight hereditary diseases resulting from the inability to produce heme.

[0036] As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule. As used herein, there is provided a nucleic acid construct (which may also be referred to as a nucleic acid molecule in some cases) that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to produce mutant ALAS. In addition, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, as used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducer molecule.

[0037] As used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells. The cells can be any suitable cells. For example, the cells can be bacterial cells (e.g., E. coli cells, B. subtilis cells, or Lactococcus lactis cells As used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells. The cells can be any suitable cells. For example, the cells can be bacterial cells (e.g., E. coli cells, B. subtilis cells, or Lactococcus lactis cells As used herein, there is provided a nucleic acid construct that enables genetic manipulation of cells. The cells can be any suitable cells. For example, the cells can be bacterial cells (e.g., E. coli cells, B. subtilis cells, or Lactococcus lactis cells ) It can be a bacterial cell, fungal cell, algal cell, plant cell, insect cell, or mammalian cell. In some embodiments, the cell can be a fungal cell. In some embodiments, the cell can be a filamentous fungus cell. In some embodiments, the cell can be an Aspergillus cell or a Trichoderma cell. In some embodiments, the cell can be a yeast cell. Non-limiting examples of yeast cells include Pichia (e.g., Pichia methanolica, Pichia pastoris), Candida (e.g., Candida boidinii) cells, Hansenula (e.g., Hansenula polymorpha) cells, Torulopsis cells, and Saccharomyces (e.g., Saccharomyces cerevisiae) cells. In some embodiments, the cell can be a methanol-utilizing yeast cell. Non-limiting examples of methanol-utilizing yeast cells include Pichia cells, Candida cells, Hansenula cells, and Torulopsis cells. In some embodiments the cell can be a Pichia cell or a Saccharomyces cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is a plant cell. In some embodiments the cell is an algal cell. In some embodiments, the cell is a yeast cell. In some embodiments the cell can be a Pichia cell or a Saccharomyces cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is a plant cell. In some embodiments the cell is an algal cell. In some embodiments, the cell is a yeast cell. In some embodiments the cell is a mammalian cell. In some embodiments In some embodiments, the cells are Saccharomyces cerevisiae cells Some embodiments, the cells are methanol-assimilating yeast cells. As used herein, methods using species of the genus Pichia (e.g., P. pastoris) are exemplified but other species of the genus Pichia, or species derived from any of the genera Candida, Hansenula , Pichia, and Torulopsis, such as other cells may also be used. Non-limiting examples of methanol-assimilating yeast species are , Pichia methanolica, Pichia pastoris , Candida boidinii, and Hansenula polymorpha . In one aspect, therefore, the present document provides materials and methods for expressing a protein

[0038] . In some embodiments, the present document provides a cell (e.g., a cell of the genus Aspergillus , a cell of the genus Trichoderma, or a fungal cell such as a yeast cell (e.g., a methanol-assimilating yeast cell)) comprising a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein . In some embodiments, the first nucleic acid encodes an ALAS protein and is operably linked to a first promoter element . In some embodiments, the ALAS protein comprises at least one HRM (e.g., 1, 2 , 3, or more HRMs). In some embodiments, the ALAS protein . In some embodiments, the ALAS protein includes at least two HRMs (e.g., 2, 3, or more HRMs). In some embodiments, the ALAS protein includes at least three HRMs (e.g., 3 or more HRMs). In some embodiments, the ALAS protein includes a mutation within a first HRM (which may also be referred to as, in some cases, "the first mutation within the first HRM"). In some embodiments, the ALAS protein includes a mutation within a second HRM (which may also be referred to as, in some cases, "the second mutation within the second HRM"). In some embodiments, the ALAS protein includes a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the first HRM is HRM1. In some embodiments, the second HRM is HRM2. In some embodiments, the ALAS protein includes a mutation within a third HRM (which may also be referred to as, in some cases, "the third mutation within the third HRM"). In some embodiments, the ALAS protein includes a mutation within a first HRM, a mutation within a second HRM, and a mutation within a third HRM. In some embodiments, the mutation within the first HRM is a substitution. In some embodiments, the mutation within the first HRM is a substitution of cysteine. In some embodiments, the mutation within the first HRM is a mutation from cysteine to serine. In some embodiments, the mutation within the first HRM is a mutation from cysteine to alanine. In some embodiments, the mutation within the first HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation within the first HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation within the first HRM is a substitution. In some embodiments, the mutation within the first HRM is a cysteine substitution. In some embodiments, the mutation within the first HRM is a cysteine-to-serine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-alanine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-phenylalanine mutation.

[0039] In some embodiments, the mutation within the first HRM is a substitution. In some embodiments, the mutation within the first HRM is a cysteine substitution. In some embodiments, the mutation within the first HRM is a cysteine-to-serine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-alanine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-phenylalanine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-aspartic acid mutation. In some embodiments, the mutation within the first HRM is a substitution. In some embodiments, the mutation within the first HRM is a cysteine substitution. In some embodiments, the mutation within the first HRM is a cysteine-to-serine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-alanine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-phenylalanine mutation. In some embodiments, the mutation within the first HRM is a cysteine-to-aspartic acid mutation. A mutation to gluconic acid. In some embodiments, the mutation in the first HRM is a mutation from cysteine to histidine.

[0040] In some embodiments, the mutation in the second HRM is a substitution. In some embodiments, the mutation in the second HRM is a substitution of cysteine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to serine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to alanine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation in the second HRM is a mutation from cysteine to histidine.

[0041] In some embodiments, the mutation in the third HRM is a substitution. In some embodiments, the mutation in the third HRM is a substitution of cysteine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to serine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to alanine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation in the third HRM is a mutation from cysteine to histidine.

[0042] In some embodiments, the mutation in the first HRM corresponds to the mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM corresponds to the mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine - to - serine mutation corresponding to the cysteine - to - serine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine - to - alanine mutation corresponding to the cysteine - to - alanine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine - to - phenylalanine mutation corresponding to the cysteine - to - phenylalanine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine - to - histidine mutation corresponding to the cysteine - to - histidine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - serine mutation corresponding to the cysteine - to - serine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - alanine mutation corresponding to the cysteine - to - alanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - phenylalanine mutation corresponding to the cysteine - to - phenylalanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - histidine mutation corresponding to the cysteine - to - histidine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine - to - histidine mutation corresponding to the cysteine - to - histidine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - serine mutation corresponding to the cysteine - to - serine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - alanine mutation corresponding to the cysteine - to - alanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - phenylalanine mutation corresponding to the cysteine - to - phenylalanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - alanine mutation corresponding to the cysteine - to - alanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - phenylalanine mutation corresponding to the cysteine - to - phenylalanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - histidine mutation corresponding to the cysteine - to - histidine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - phenylalanine mutation corresponding to the cysteine - to - phenylalanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine - to - histidine mutation at residue 39 in SEQ ID NO: 29. A mutation from cysteine to histidine that corresponds to the mutation in the .

[0043] In some embodiments, the first nucleic acid comprises a mutation corresponding to the mutation from guanosine to cytosine at nucleotide position 35 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation corresponding to the mutation from thymine to guanosine at nucleotide position 34 of SEQ ID NO: 28, and a mutation corresponding to the mutation from guanosine to cytosine at nucleotide position 35 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation corresponding to the mutation from guanosine to cytosine at nucleotide position 116 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation from thymine to guanosine at nucleotide position 115 of SEQ ID NO: 28, and a mutation corresponding to the mutation from guanosine to cytosine at nucleotide position 116 of SEQ ID NO: 28. The mutation from cysteine to serine can be achieved by mutations at nucleotides other than those specifically disclosed herein. It will be understood that the mutation from cysteine to alanine can be achieved by mutations at nucleotides other than those specifically disclosed herein. In some embodiments, the first nucleic acid construct comprises SEQ ID NO: 30. In some embodiments, the ALAS protein has the sequence of SEQ ID NO: 31 (see, e.g., FIG. 7). As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., In some embodiments, the first nucleic acid construct comprises SEQ ID NO: 30. In some embodiments, the ALAS protein has the sequence of SEQ ID NO: 31 (see, e.g., FIG. 7). As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g.,

[0044] As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., As used herein, "operably linked" means that a promoter, or other expression element(s), is such that the expression of the nucleic acid coding sequence (e.g., Means being arranged to direct or adjust the ( ) within the in-frame.

[0045] (For example, reference A such as SEQ ID NO: 29) within a protein sequence different from the reference protein sequence ), "corresponding" amino acid positions (or substitutions) within the ALAS protein sequences of different organisms compared to the LAS protein sequence can be identified by performing a sequence alignment between the protein sequences of interest. In some cases, it will be understood that there may be gaps in the protein alignment. Similarly, "corresponding" nucleic acid positions (or substitutions) within a nucleic acid sequence different from the reference nucleic acid sequence (for example, SEQ ID NO: 28, etc., the ALAS nucleic acid sequence of a different organism compared to the reference ALAS nucleic acid sequence) can be identified by performing a sequence alignment between the nucleic acid sequences of interest. In some cases, it will be understood that there may be gaps in the nucleic acid alignment. As used herein, a nucleotide position or amino acid position "compared to" a reference sequence can be the corresponding nucleotide position or amino acid position within the reference sequence. For example, SEQ ID NO: 28, etc., the ALAS nucleic acid sequence of a different organism compared to the reference ALAS nucleic acid sequence ), "corresponding" nucleic acid positions (or substitutions) can be identified by performing a sequence alignment between the nucleic acid sequences of interest. In some cases, it will be understood that there may be gaps in the nucleic acid alignment. As used herein, a nucleotide position or amino acid position "compared to" a reference sequence can be the corresponding nucleotide position or amino acid position within the reference sequence. As used herein, a nucleotide position or amino acid position "compared to" a reference sequence can be the corresponding nucleotide position or amino acid position within the reference sequence.

[0046] The nucleic acid molecules used in the methods described herein are typically DNA, but in appropriate circumstances, RNA molecules can also be used. As used herein, "exogenous" refers to any nucleic acid sequence introduced into cells derived from, for example, the same or different organisms, or a nucleic acid produced synthetically (e.g., a codon-optimized nucleic acid sequence). For example an exogenous nucleic acid can be a nucleic acid derived from one microorganism (e.g., one genus or species of methanol-assimilating yeast) introduced into a different genus or species of methanol-assimilating yeast; ​​​Exogenous nucleic acids can also be, as additional copies, , nuclear acids derived from methanol-assimilating yeast and recombinantly introduced into methanol-assimilating yeast, even in the presence of the corresponding native nucleic acid sequence. In some cases, the nucleic acids are those derived from methanol-assimilating yeast and recombinantly introduced into methanol-assimilating yeast, which contain one or more mutations, insertions, or deletions compared to the sequence native to methanol-assimilating yeast. For example, P. pastoris contains an endogenous nucleic acid encoding ALAS; an additional copy of the ALAS nucleic acid of P. pastoris (e.g., recombinantly introduced into P. pastoris (P. pastoris)) is considered exogenous. Similarly, an "exogenous" protein is a protein encoded by an exogenous nucleic acid. In some cases, exogenous nucleic acids can be heterologous nucleic acids. As used herein, a "heterologous" nucleic acid refers to any nucleic acid sequence that is not native to an organism (e.g., a heterologous nucleic acid can be a nucleic acid derived from one microorganism (e.g., whether codon-optimized or not) of a different genus or species than methanol-assimilating yeast and introduced into methanol-assimilating yeast

[0047] ). Similarly, a "heterologous" protein is a protein encoded by a heterologous nucleic acid. A nucleic acid molecule is considered exogenous to a host organism if any part thereof (e.g., a promoter sequence or the sequence of the encoded protein) is exogenous to the host organism. A nucleic acid molecule is considered exogenous to a host organism if any part thereof (e.g., a promoter sequence or the encoded protein sequence) is exogenous to the host organism. ), even if it is from the same genus or species as methanol-assimilating yeast). Similarly, a "heterologous" protein is a protein encoded by a heterologous nucleic acid.

[0048] A nucleic acid molecule is considered exogenous to a host organism if any part thereof (e.g., a promoter sequence or the sequence of the encoded protein) is exogenous to the host organism. A nucleic acid molecule is considered exogenous to a host organism if any part thereof (e.g., a promoter sequence or the encoded protein sequence) is exogenous to the host organism. A nucleic acid molecule is considered exogenous to a host organism if any part thereof (e.g., a promoter sequence or the encoded When the sequence of the resulting protein is heterologous to the host organism, it is considered heterologous to the host organism. It is considered to be heterologous.

[0049] In some embodiments, the present document provides a cell comprising a first nucleic acid construct and a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein as disclosed herein (e.g., a fungal cell such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methanol-assimilating yeast cell)). In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a first promoter element. In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a second promoter element. In some embodiments, the heme-binding protein can be an exogenous heme-binding protein. In some embodiments, the heme-binding protein can be a heterologous heme-binding protein. In some embodiments, the heme-binding protein can be selected from the group consisting of globin (PF00042 in the Pfam database), cytochrome (e.g., cytochrome P450, cytochrome a, cytochrome b, cytochrome c), cytochrome c oxidase, ligninase, catalase, and peroxidase. In some embodiments, the globin is androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin (e.g., beta-hemoglobin, alpha-hemoglobin), histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated type. (e.g., Aspergillus cells, Trichoderma cells , or fungal cells such as yeast cells (e.g., methanol-assimilating yeast cells)). In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a first promoter element. In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a second promoter element . In some embodiments, the heme-binding protein can be an exogenous heme-binding protein. In some embodiments, the heme-binding protein can be a heterologous heme-binding protein. In some embodiments, the heme-binding protein can be selected from the group consisting of globin (PF00042 in the Pfam database), cytochrome (e.g., cytochrome P450, cytochrome a, cytochrome b, cytochrome c), cytochrome c oxidase, ligninase, catalase, and peroxidase. In some embodiments, the globin is androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin (e.g., beta-hemoglobin, alpha-hemoglobin), histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated It may be selected from the group consisting of hemoglobin (e.g., HbN, HbO, Glb3, cyanoglobin). In some embodiments, the heme-binding protein may be a non-symbiotic hemoglobin. In some embodiments, the heme-binding protein may be leghemoglobin. In some embodiments, the heme-binding protein may be soybean leghemoglobin (LegH). The reference amino acid sequence for LegH is presented as SEQ ID NO: 4 in FIG. 4. LegH is a protein that binds to heme and results in a characteristic absorption at 415 nm and a distinct red color. The LegH protein (also known as LGB2) is naturally found in the root nodules of soybeans (e.g., see UniprotKB accession number: P02236). Also see International Publication No. WO 2014 / 110539 pamphlet and International Publication No. WO 2014 / 110532 pamphlet, each of which is incorporated herein by reference in its entirety. In some embodiments, the heme-binding protein may have an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence specified in any of SEQ ID NOs: 1-27 (FIG. 4). In some embodiments, the heme-binding protein may have the amino acid sequence specified in any of SEQ ID NOs: 1-27. In some embodiments, the heme-binding protein uses heme as a cofactor. As used herein, "cofactor" refers to a molecule or ion that is directly involved in the catalysis of an enzyme. . In some embodiments, the heme-binding protein may be an enzyme or not . In some embodiments, the heme-binding protein may be part of the heme biosynthesis pathway or not . In some embodiments, the heme-binding protein may be ALAS or not . In some embodiments, the heme-binding protein may be ferrochelatase or not . In some embodiments, the heme-binding protein may be coproporphyrinogen oxidase or not . In some embodiments, the heme-binding protein may be ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, or FC or not . In some embodiments, the heme-binding protein has an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, or 95%) identical to any of the amino acid sequences within SEQ ID NOs: 1-27 . In some embodiments, the heme-binding protein is a heme-binding protein derived from bacteria, yeast, algae, fungi, or plants . As used herein, "protein derived from bacteria", "protein derived from yeast", "protein derived from algae", "protein derived from fungi", or "protein derived from plants" . refers to the direct source of the protein and can mean any protein produced in bacteria, yeast, algae, fungi, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungi, or plants . In some embodiments, the heme-binding protein has an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, or 95%) identical to any of the amino acid sequences within SEQ ID NOs: 1-27 . In some embodiments, the heme-binding protein is a heme-binding protein derived from bacteria, yeast, algae, fungi, or plants . In some embodiments, the heme-binding protein is a heme-binding protein derived from bacteria, yeast, algae, fungi, or plants . In some embodiments, the heme-binding protein is a heme-binding protein derived from bacteria, yeast, algae, fungi, or plants

[0050] . As used herein, "protein derived from bacteria", "protein derived from yeast", "protein derived from algae", "protein derived from fungi", or "protein derived from plants" . refers to the direct source of the protein and can mean any protein produced in bacteria, yeast, algae, fungi, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungi, or plants . refers to the direct source of the protein and can mean any protein produced in bacteria, yeast, algae, fungi, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungi, or plants . refers to the direct source of the protein and can mean any protein produced in bacteria, yeast, algae, fungi, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungi, or plants . refers to the direct source of the protein and can mean any protein produced in bacteria, yeast, algae, fungi, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungi, or plants

[0051] This specification provides a method for producing an ALAS protein. This specification also provides a method for producing an ALAS protein using any of the cells described herein (e.g., Aspergillus cells, Trichoderma cells, or fungal cells such as yeast cells (e.g., methanol-utilizing yeast cells)). This specification also provides a method for producing an ALAS protein using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) increased compared to the corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in the first HRM. In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80% 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a mutation in the first HRM. 、90%、100%、120%、140%、150%、160%、180%、200%、 It may increase by 220%, 240%, 250%, or more. In some embodiments A method is provided herein, comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments The titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20 %, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 1 20%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 2 50%, or more) increased compared to the corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments The titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 1 50%, 160%, 180%, 200%, 220%, 240%, 250%, or more) increased compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein lacking the mutations in the first HRM and the second HRM. A method for producing a tetrapyrrole or a derivative thereof is provided herein. Also provided herein are cells described herein (e.g., Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-utilizing yeast cells, Pichia pastoris cells)) comprising a nucleic acid construct described herein. For example, at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 1 50%, 160%, 180%, 200%, 220%, 240%, 250%, or more) increased compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein lacking the mutations in the first HRM and the second HRM. can increase.

[0052] A method for producing a tetrapyrrole or a derivative thereof is provided herein. Also provided herein are cells described herein (e.g., Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-utilizing yeast cells, Pichia pastoris cells)) comprising a nucleic acid construct described herein. using any of fungal cells such as mother cells), to produce a tetrapyrrole or a derivative thereof A method for producing a tetrapyrrole or a derivative thereof using any of the nucleic acid constructs described herein is also provided. Also provided herein is a method for producing a tetrapyrrole or a derivative thereof using any of the nucleic acid constructs described herein In some embodiments, provided herein is a method for producing a tetrapyrrole or a derivative thereof comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM In some embodiments, the titer of the tetrapyrrole or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40% 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150% 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300% 320%, 340%, 350%, or more) increased compared to the corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM In some embodiments, the titer of the tetrapyrrole or a derivative thereof is at least 5 % (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 8 0%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200 %, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350 %, or more) increased compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein lacking a mutation within a first HRM In some embodiments, provided herein is a tetrapyrrole or a derivative thereof In some embodiments, provided herein A method for producing a porphyrin or a derivative thereof, comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a second mutation in a second HRM. In some embodiments , the titer of the porphyrin or a derivative thereof is at least 5% (e.g., at least 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120% , 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250% , 280%, 300%, 320%, 340%, 350%, or more) increased compared to the corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a second mutation in a second HRM . In some embodiments , the titer of the porphyrin or a derivative thereof is at least 5% (e.g., at least 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120% , 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250% , 280%, 300%, 320%, 340%, 350%, or more) increased compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein not comprising a mutation in a first HRM and a second mutation in a second HRM . In some embodiments, the porphyrin or a derivative thereof is chlorin (e.g., chlorophyll) or a derivative thereof . In some embodiments, the porphyrin or a derivative thereof is precorrin, coprecorrin, cobalamin (e.g., vitamin B12), or a derivative thereof . In some embodiments, the porphyrin or a derivative thereof is porphyrin . In some embodiments, the porphyrin or a derivative thereof is porphyrin . In some embodiments, the porphyrin or a derivative thereof is porphyrin . In some embodiments, the porphyrin or a derivative thereof is chlorin (e.g., chloro phyll) or a derivative thereof . In some embodiments, the porphyrin or a derivative thereof is precorrin, coprecorrin, cobalamin (e.g., vitamin B12), or derivatives thereof . In some embodiments, the porphyrin or a derivative thereof is porphyrin or a derivative thereof. In some embodiments, the tetrapyrrole or a derivative thereof is heme or a derivative thereof. In some embodiments, the tetrapyrrole or a derivative thereof is heme B. In some embodiments, the tetrapyrrole or a derivative thereof is a metabolite of heme (e.g., bilirubin or a derivative thereof).

[0053] Provided herein are methods for producing intermediates of the heme biosynthetic pathway, heme (e.g., heme B, heme o, heme a, heme c), cobalin (e.g., vitamin B12), chlorophyll, or derivatives thereof. Also provided herein are methods for producing intermediates of the heme biosynthetic pathway, heme, cobalin, chlorophyll, or derivatives thereof using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-utilizing yeast cells)). Also provided herein are methods for producing intermediates of the heme biosynthetic pathway, heme, cobalin, chlorophyll, or derivatives thereof using any of the nucleic acid constructs described herein. In some embodiments, provided herein are methods for producing intermediates of the heme biosynthetic pathway, heme, cobalin, chlorophyll, or derivatives thereof, comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of intermediates of the heme biosynthetic pathway, heme, cobalin, chlorophyll, or derivatives thereof is increased by expressing a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of intermediates of the heme biosynthetic pathway, heme, cobalin, chlorophyll, or derivatives thereof is increased by expressing a nucleotide sequence encoding an ALAS protein comprising a mutation in a first Compared to the corresponding method lacking a nucleic acid construct containing the CHID sequence, it can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more than this ). In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, heme, choline, chlorophyll, or a derivative thereof is at least 5 % (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 8 0%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200 %, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350 %, or more than this ). In some embodiments, provided herein is a method of making an intermediate of the heme biosynthesis pathway, heme, choline, chlorophyll, or a derivative thereof, the method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation in the first HRM and a mutation in the second HRM. In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, heme, choline, chlorophyll, or a derivative thereof is at least 5% (e.g., at least 10%, 20 , 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 1 compared to the corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation in the first HRM and a mutation in the 40%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 2 80%, 300%, 320%, 340%, 350% or more). In some embodiments, the intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or the like The titers of these derivatives were determined by the presence of the mutation in the first HRM and the mutation in the second HRM. In comparison with the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not At least 5% (e.g. at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 0%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180% , 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340% In some embodiments, the heme biosynthetic pathway may be increased by 300%, 350%, or more. The intermediate, heme, or derivative thereof is heme. In some embodiments, the heme biosynthetic pathway The intermediate, heme, or a derivative thereof, is heme B.

[0054] As used herein, heme (e.g., heme B, heme o, heme a, heme c) or a derivative thereof is Also provided herein are methods for producing the cells described herein (e.g., A. Aspergillus cells, Trichoderma cells, or yeast cells (e.g., yeast cells, fungal cells, etc.) Also provided herein are methods for making heme or derivatives thereof. Methods for producing heme or its derivatives using any of the nucleic acid constructs described herein. Also provided herein in some embodiments is a method for producing heme or a derivative thereof. A method is provided that includes the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of heme or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160% 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320% 340%, 350%, or more) increased compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of heme or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100 %, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240 %, 250%, 280%, 300%, 320%, 340%, 350%, or more) increased compared to a corresponding method expressing a nucleic acid encoding an ALAS protein lacking a mutation within a first HRM. In some embodiments, provided herein is a method of making heme or a derivative thereof that includes the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the titer of heme or a derivative thereof is at least compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the titer of heme or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100 %, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240 %, 250%, 280%, 300%, 320%, 340%, 350%, or more) increased In some embodiments, provided herein is a method of making heme or a derivative thereof that includes the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the titer of heme or a derivative thereof is at least compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, provided herein is a method of making heme or a derivative thereof that includes the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the titer of heme or a derivative thereof is at least compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. In some embodiments, the titer of heme or a derivative thereof is at least compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) increased compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM. 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 20 0%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 35 0%, or more) can increase. In some embodiments, the titer of heme or its derivative is at least 5% compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutation in the first HRM and the mutation in the second HRM (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 2 20%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) can increase. In some embodiments, the heme or its derivative is heme B .

[0055] Provided herein are methods for making heme-binding proteins. Also provided herein are methods for making heme-binding proteins using any of the cells described herein (e.g., Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells), any of the fungal cells). Also provided herein are methods for making heme-binding proteins using any of the nucleic acid constructs described herein . In some embodiments, provided herein are nucleotides encoding an ALAS protein that contains a mutation in the first HRM ​​​​The step of expressing a first nucleic acid construct comprising an array, as well as the step of expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein are provided. In some embodiments, provided herein is a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM, as well as the step of expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, provided herein is a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, as well as the step of expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, provided herein is a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, as well as the step of expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. For any of the methods described herein, in some embodiments, the method enables an increase in the titer of the heme-binding protein. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23% higher compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23% higher compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23% higher compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. For any of the methods described herein, in some embodiments, the method enables an increase in the titer of the heme-binding protein. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% higher compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. For example, at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13% 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23% %, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this) may increase. In some embodiments, the titer of the heme-binding protein is compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a sudden mutation in the first HRM and may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this). In some embodiments, the titer of the heme-binding protein is compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a sudden mutation in the first HRM and may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this). In some embodiments, the titer of the heme-binding protein is compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a sudden mutation in the first HRM and may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this). In some embodiments, the titer of the heme-binding protein is compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a sudden mutation in the first HRM and may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this). In some embodiments, the titer of the heme-binding protein is compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein without a sudden mutation in the first HRM and may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more than this).

[0056] This specification provides a method for producing a tetrapyrrole-binding protein. This specification also provides a method for producing a tetrapyrrole-binding protein using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides a method for producing a tetrapyrrole-binding protein using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation in a first HRM, as well as expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation in a first HRM, as well as expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation in a first HRM and a mutation in a second HRM, as well as expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising a mutation in a first A method is provided that includes expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation within an HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments of any of the methods described herein, the method enables an increase in the titer of the tetrapyrrole-binding protein. In some embodiments, the titer of the tetrapyrrole-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation within a first HRM. In some embodiments, the titer of the tetrapyrrole-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to a corresponding method expressing a nucleic acid encoding an ALAS protein lacking a mutation within a first HRM. In some embodiments, the titer of the tetrapyrrole-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10% compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing mutations within a first HRM and within a second HRM. ​ 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50% (or more) can increase. In some embodiments, the titer of the tetrapyrrole-binding protein is at least 5 % higher than that of the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutation in the first HRM and the mutation in the second HRM. For example, at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 1 4%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 2 4%, 25%, 30%, 35%, 40%, 45%, 50%, or more) can increase. In some embodiments, the tetrapyrrole is chlorin (e.g., chlorophyll) or its derivative. In some embodiments, the tetrapyrrole is precorrin, coprecorrin, corrin (e.g., vitamin B12), or a derivative thereof. In some embodiments the tetrapyrrole is porphyrin or a derivative thereof. In some embodiments, the tetrapyrrole is heme or a derivative thereof. In some embodiments, the tetrapyrrole is heme B. In some embodiments, the tetrapyrrole is a metabolite of heme (e.g., bilirubin or a derivative thereof). As used herein, "corresponding method" means a method that is essentially identical in all respects to the reference method, except for the identified differences. For example, a method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutation in the first HRM and the mutation in the second HRM.

[0057] ​​​​The corresponding method would be the same in all aspects (e.g., the genetic composition of the cells, the temperature and number of cultures, etc.) except that the corresponding method expresses a nucleic acid encoding an ALAS protein that does not contain mutations in the first HRM and mutations in the second HRM. All aspects would be the same except that the corresponding method expresses a nucleic acid encoding an ALAS protein that does not contain mutations in the first HRM and mutations in the second HRM. would be the same in all aspects (e.g., the genetic composition of the cells, the temperature and number of cultures, etc.) except that the corresponding method expresses a nucleic acid encoding an ALAS protein that does not contain mutations in the first HRM and mutations in the second HRM.

[0058] Genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma ) cells, or yeast cells (e.g., methanol-assimilating yeast cells)) typically involves the introduction of a recombinant nucleic acid molecule (also referred to as a nucleic acid construct) into the cells. As described herein, a recombinant nucleic acid molecule typically contains an exogenous nucleic acid encoding a protein (e.g., a protein involved in heme biosynthesis, a heme-binding protein, or a transcription factor) that is operably linked to at least one promoter element (e.g., an inducible promoter element or a constitutive promoter element). element). In some embodiments, the recombinant nucleic acid molecule contains a linear sequence of two or more protein-encoding sequences (e.g., a first promoter operably linked to a first nucleic acid encoding a first protein and a second promoter operably linked to a second nucleic acid encoding a second protein, or a first nucleic acid encoding a first protein and a second nucleic acid encoding a second protein, both operably linked to a promoter) that are operably linked to the same promoter element or separate promoter elements. In some cases, a recombinant nucleic acid molecule contains at least one promoter operably linked to a nucleotide sequence encoding a protein. In some cases, a recombinant nucleic acid molecule contains at least one promoter operably linked to a nucleotide sequence encoding a protein. sequence encoding a protein. sequence encoding a protein. sequence encoding a protein. sequence encoding a protein. sequence encoding a protein. The son can be called a cassette.

[0059] The recombinant nucleic acid can contain an expression element. The expression element contains nucleic acid sequences that direct and regulate the expression of the nucleic acid coding sequence. One example of an expression element is a promoter sequence. The expression element can also include introns, enhancer sequences, response elements, or induction elements that regulate the expression of nucleic acids. The expression element can be of bacterial origin, yeast origin, insect origin, mammalian origin, or viral origin, and the vector can contain a combination of elements from different origins. from yeast, from insects, from mammals, or from viruses, and the vector can contain a combination of elements from different origins. from yeast, from insects, from mammals, or from viruses, and the vector can contain a combination of elements from different origins.

[0060] The nucleic acid can be detected using any number of amplification techniques (see, for example, PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188) with appropriate oligonucleotide (e.g., primer) pairs. Several modifications to the original PCR method have been developed and can be used to detect the selected nucleic acid. ffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 are hereby incorporated by reference. NY; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 are hereby incorporated by reference. The nucleic acid can be detected using any number of amplification techniques (see, for example, PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188) with appropriate oligonucleotide (e.g., primer) pairs. Several modifications to the original PCR method have been developed and can be used to detect the selected nucleic acid. Several modifications to the original PCR method have been developed and can be used to detect the selected nucleic acid.

[0061] The utilization of methanol is typically induced by the conversion of methanol to formaldehyde via the action of alcohol oxidase. Pichia pastoris contains two genes for alcohol oxidase, AOX1 and AOX2. contains two genes for alcohol oxidase, AOX1 and AOX2. Do so. Strains with reduced alcohol oxidase activity (``slow methanol utilization'' strains or MutS strains) can produce more recombinant proteins expressed from the AOX1 promoter than strains with normal alcohol oxidase activity. Strains mutated in both AOX genes and completely lacking alcohol oxidase activity cannot metabolize methanol, but can be significantly induced for expression from the AOX1 promoter by methanol. These strains use other carbon sources for growth, but retain the ability to still express heterologous proteins from the AOX1 promoter upon addition of methanol. Since these strains do not metabolize methanol (``methanol utilization minus'' strains or Mut- strains), the amount of methanol required for induction of protein expression is much less, and strains carrying these mutations avoid problems associated with methanol feeding in large-scale fermentation. See, for example, Chiruvolu et al., 1997, Enzyme M icrob. Technol., 21:277-83.

[0062] Suitable transcription factors, and nucleic acids encoding transcription factors (e.g., exogenous nucleic acids encoding transcription factors), include, for example, Mxr1 derived from P. pastoris. The nucleic acid sequence of a representative Mxr1 of K. pastoris can be found, for example, in Gen Bank accession number: DQ395124, while the protein sequence of a representative Mxr1 of K. pastoris can be found, for example, in GenBank accession number: ABD57365. In some embodiments, the transcription factor is K. f ​ The Mit1 sequence derived from Komagataella phaffii (e.g., UniParc accession number: UPI0001A4D18 see B). Appropriate transcription factors may also be found in Hansenula polymorpha (e.g., the Adr1 sequence; e.g., GenBank accession number for the nucleic acid sequence: AEOI0200000 5, bases: 858873 - 862352, and for the amino acid sequence, GenBan k accession number: see ESX01253), and Candida boidinii (e.g., the Trm1 sequence; e.g., GenBank accession number for the nucleic acid sequence : AB365355, and for the amino acid sequence, GenBank accession number: BA F99700; see also the Trm2 sequence; e.g., GenBank accession number for the nucleic acid sequence : AB548760, and for the amino acid sequence, GenBank accession number: BAJ07608).

[0063] Transcription factors such as Mxr1 can usually be expressed at low levels. In some embodiments, it is desirable to place an exogenous nucleic acid (e.g., a transcription factor) under the control of an inducible promoter.

[0064] The methanol - regulated transcription factors in Pichia can bind to the AOX1 promoter and act cooperatively with Mxr1 to activate transcription from the AOX1 promoter. In some embodiments, two methanol - regulated transcription factors (e.g., Mxr1 and Mit1) can be operably linked to a methanol - inducible promoter element. ​​​​​

[0065] There are several inducible promoters that can be used when genetically engineering cells (e.g., fungal cells such as Aspergillus or Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). When genetically engineering cells (e.g., fungal cells such as Aspergillus or Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)), several inducible promoters can be used. Appropriate methanol-inducible promoters include pAOX1 (e.g., the promoter for AOX1 of K. pastoris (e.g., see the promoter for GenBank accession number: U96967.1)), such as pAOX1, or the promoter described in U.S. Patent Provisional Application No. 62 / 835,338, filed on April 17, 2019, which is incorporated herein by reference in its entirety. In addition to pAOX1, other methanol-inducible promoters, or promoter elements derived therefrom, are included. For example, the promoter for AOX1 of K. pastoris (e.g., see the promoter for GenBank accession number: U96967.1)), such as pAOX1, or the promoter described in U.S. Patent Provisional Application No. 62 / 835,338, filed on April 17, 2019, which is incorporated herein by reference in its entirety. In addition to pAOX1, other methanol-inducible promoters, or promoter elements derived therefrom, are included. Without limitation, these include the pAOX2 promoter (e.g., the pAOX2 promoter derived from K. phaffii or K. pastoris (e.g., see GenBank accession number: X79871.1)), such as the alcohol oxidase (AOD1) promoter derived from Candida boidinii (e.g., see GenBank accession number: E06147.1), the alcohol oxidase (MOX) promoter derived from Hansenula polymorpha (e.g., see GenBank accession number: AJ313360.1), the MOD1 promoter or M derived from Pichia methanolica such as the pAOX2 promoter derived from K. phaffii or K. pastoris (e.g., see GenBank accession number: X79871.1)), such as the alcohol oxidase (AOD1) promoter derived from Candida boidinii (e.g., see GenBank accession number: E06147.1), the alcohol oxidase (MOX) promoter derived from Hansenula polymorpha (e.g., see GenBank accession number: AJ313360.1), such as the alcohol oxidase (AOD1) promoter derived from Candida boidinii (e.g., see GenBank accession number: E06147.1), the alcohol oxidase (MOX) promoter derived from Hansenula polymorpha (e.g., see GenBank accession number: AJ313360.1), the MOD1 promoter or M derived from Pichia methanolica the MOD1 promoter or M derived from Pichia methanolica OD2 promoter (see, for example, Raymond et al., 1998, Yeast, 14:11-23; and Nakagaw a et al., 1999, Yeast, 15:1223-30), the DHAS promoter derived from P. pastoris (see, for example, the promoter for GenBank accession number: FJ752551 ), or a promoter element derived therefrom, the formaldehyde dehydrogenase derived from K. pastoris ( FLD1) promoter (see, for example, GenBank accession number: KJ755994.1 ), or the PEX8 promoter derived from P. pastoris (see, for example, Kranthi et al., 2010, Yeast, 27:705-11). Typically , these promoters can be induced by methanol. Suitable constitutive promoters , and constitutive promoter elements, include, without limitation, the P. pastoris promoter (or portion thereof) derived from the gene for the transcription elongation factor EF-1α that is strongly constitutively transcribed . Without limitation, the glyceraldehyde-3-phosphate dehydrogenase derived from K. pastoris (GAPDH) promoter (see, for example, the promoter for GenBank accession number: U62648.1 ), the promoter derived from K. phaffii for the potential glycosylphosphatidylinositol (GPI) anchor protein G CW14p (PAS_chr1-4_0586) (see, for example, Ge ), or the promoter derived from P. pastoris for the PEX8 protein (see, for example, Kranthi et al., 2010, Yeast, 27:705-11). Without limitation, the promoter derived from P. pastoris for the PEX8 protein Please refer to the promoter for the nBank trustee number: XM_002490678 ), and 3-phosphoglycerate kinase from K. pastoris The promoter derived from the PGK1 gene (e.g., GenBank accession number: AY See 288296), other suitable constitutive promoters (or promoters derived therefrom Element) can also be used. The selection of the promoter will be understood to be Affected by the expression system. For example, for expression in K. phaffii The promoter of K. phaffii can be selected for expression in K. phaffii However, for expression in C. boidinii, the promoter of C. boidinii inii) can be selected. However, in some cases, a promoter derived from one organism (e.g., K. phaffii) may be used in another organism (e.g., C. boidinii inii), or K. pastoris) may be suitable. Furthermore, inducible (e.g., methanol-inducible) promoters and constitutive Promoters (or promoter elements derived therefrom) can be combined to further increase the expression of any of the nucleic acids operably linked thereto It is noted that it can be. Any of the proteins encoded as described herein can be operably linked to an inducible Promoter element (e.g., methanol-inducible promoter element) or constitutive promoter element. Inducible promoters and these

[0066] Any of the proteins encoded as described herein can be operably linked to an inducible Promoter element (e.g., methanol-inducible promoter element) or constitutive promoter element. Inducible promoters and these Can be operably linked to a constitutive promoter element. Inducible promoters and these The elements derived from are discussed above. Constitutive promoters, and Constitutive promoter elements are known in the art. For example, commonly used , the constitutive promoter derived from P. pastoris is a promoter derived from the gene (TEF1) of elongation factor EF-1α that is strongly and constitutively transcribed, or a portion thereof. However, without limitation, a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter derived from K. pastoris (for example, see the promoter for GenBank accession number: U62648.1) ), a promoter derived from a potential glycosylphosphatidylinositol (GPI) anchor protein, GCW14p (PAS_chr1-4_0586), derived from K. phaffii (for example, see the promoter for GenBank accession number: X M_002490678), or a promoter derived from the 3-phosphoglycerate kinase gene (PGK1) derived from K. pastoris (for example, see the promoter for GenBank accession number: AY288296) ), other constitutive promoters, or promoter elements derived therefrom, may also be used. ), or a promoter derived from the 3-phosphoglycerate kinase gene (PGK1) derived from K. pastoris (for example, see the promoter for GenBank accession number: AY288296) ), other constitutive promoters, or promoter elements derived therefrom, may also be used. ), or a promoter derived from the 3-phosphoglycerate kinase gene (PGK1) derived from K. pastoris (for example, see the promoter for GenBank accession number: AY288296) ), other constitutive promoters, or promoter elements derived therefrom, may also be used. ), other constitutive promoters, or promoter elements derived therefrom, may also be used. ), other constitutive promoters, or promoter elements derived therefrom, may also be used. Promoter elements derived therefrom may also be used.

[0067] In some embodiments, any of the cells herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-utilizing yeast cells)) ), may be a first promoter element, a second ), may be a first promoter element, a second operatively linked to a promoter element of 2 or a third promoter element and may further comprise a third nucleic acid construct comprising a nucleotide sequence encoding a third protein In some embodiments, any of the cells herein (e.g., Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells), etc.) may further comprise a fourth nucleic acid construct comprising a nucleotide sequence encoding a fourth protein operatively linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. In some embodiments, the third protein may be a transcription factor. In some embodiments, the fourth protein may be a transcription factor. In some embodiments, any of the promoter elements herein (e.g., the first promoter element, the second promoter element, the third promoter element, or the fourth promoter element) may contain one or more recognition sequences for a transcription factor. Thus, in some embodiments, a feedback loop may be constructed such that a transcription factor drives the expression of one or more of ALAS and a heme-binding protein, in addition to the expression of a further copy of the transcription factor. In some embodiments, the transcription factor may be Mxr1 (see, e.g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety). In some embodiments, the third protein may be a protein involved in heme biosynthesis. In some embodiments, the transcription factor may be Mxr1 (see, e.g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety). In some embodiments, the third protein may be a protein involved in heme biosynthesis. . In some embodiments, the fourth protein is a protein involved in heme biosynthesis . In some embodiments, the protein involved in heme biosynthesis is δ-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uropo phyrinogen III synthase (UPG3S), uroporphyrinogen III deca carboxylase (UPG3D), coproporphyrinogen oxidase (COPRO X), protoporphyrinogen IX oxidase (PROTOX), and / or ferro chelatase (FC). In some embodiments, the protein involved in heme biosynthesis is δ-aminolevulinic acid dehydratase (ALAD), porpho bilinogen deaminase (PBGD), uroporphyrinogen III synthase (U PG3S), uroporphyrinogen III decarboxylase (UPG3D), copro toporphyrinogen oxidase (COPROX), and / or protoporphyrin ogen IX oxidase (PROTOX).

[0068] Previous studies in Saccharomyces cerevisiae identified ALA dehydratase and porphobilinogen deaminase as rate-limiting enzymes in heme biosynthesis (see, for example, Hoffman et al., 2003, Biochem. Biophys. Res. Com mun., 310(4):1247-53). However, in P. pastoris , of individual heme enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAP) pro Heterologous expression from a motor has failed to overcome the limitations associated with the expression of recombinant proteins containing heme (see Krainer et al., 2015, Microb. Cell Fact., 13;14:4). It is understood that one or more of the genes involved in the heme biosynthesis pathway can be expressed from one or more constitutive promoters (see, for example, U.S. Patent No. 9,938,327, which is incorporated herein by reference in its entirety), but the expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. See Krainer et al., 2015, Microb. Cell Fact., 13;14:4). One or more of the genes involved in the heme biosynthesis pathway can be expressed from one or more constitutive promoters (see, for example, U.S. Patent No. 9,938,327, which is incorporated herein by reference in its entirety), but the expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. One or more of the genes involved in the heme biosynthesis pathway can be expressed from one or more constitutive promoters (see, for example, U.S. Patent No. 9,938,327, which is incorporated herein by reference in its entirety), but the expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. One or more of the genes involved in the heme biosynthesis pathway can be expressed from one or more constitutive promoters (see, for example, U.S. Patent No. 9,938,327, which is incorporated herein by reference in its entirety), but the expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. See U.S. Patent No. 9,938,327, which is incorporated herein by reference in its entirety), but the expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. The expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. The expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter. The expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthesis pathway from a methanol-inducible promoter.

[0069] In addition, the first nucleic acid encoding the first protein (e.g., the ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding the second protein (e.g., the heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein (e.g., the ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding the second protein (e.g., the heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein (e.g., the ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding the second protein (e.g., the heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein (e.g., the ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding the second protein (e.g., the heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein (e.g., the ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding the second protein (e.g., the heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. The first nucleic acid encoding the first protein operably linked to the promoter element and the second nucleic acid encoding the second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. In some embodiments, the first nucleic acid encoding the first protein operably linked to the promoter element is operably linked to the promoter element and encodes the second protein. It may be continuous with the second nucleic acid to be encoded. Those skilled in the art will recognize that when a second nucleic acid molecule encoding a second protein is continuous with the first nucleic acid encoding the protein of interest, a single promoter, or a promoter element derived therefrom, may be used to drive the transcription of both or all of the genes (e.g., the first protein, as well as the nucleic acid encoding the second protein). It will be appreciated that when a nucleic acid molecule encoding a second protein is contiguous with a first nucleic acid encoding a protein of interest, a single promoter, or a promoter element derived therefrom, may be used to drive the transcription of both or all of the genes (e.g., the first protein, as well as the nucleic acid encoding the second protein). or a promoter element derived therefrom, may be used to drive the transcription of both or all of the genes (e.g., the first protein, as well as the nucleic acid encoding the second protein). or all of the genes (e.g., the first protein, as well as the nucleic acid encoding the second protein). will be recognized as being usable for driving the transcription of both or all of the genes (e.g., the first protein, as well as the nucleic acid encoding the second protein).

[0070] In the art, methods for introducing nucleic acids into cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are known and include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation. In the art, methods for introducing nucleic acids into cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are known and include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation. In the art, methods for introducing nucleic acids into cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are known and include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation. In the art, methods for introducing nucleic acids into cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are known and include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation.

[0071] In addition, in the art, methods for culturing cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are also known. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. In addition, in the art, methods for culturing cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are also known. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. In addition, in the art, methods for culturing cells (e.g., fungal cells such as Aspergillus, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are also known. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. In some situations, as supported herein, methanol is not required to obtain efficient expression of one or more proteins of interest at high levels, but it may be desirable to introduce or add methanol to the culture medium. In some situations, as supported herein, methanol is not required to obtain efficient expression of one or more proteins of interest at high levels, but it may be desirable to introduce or add methanol to the culture medium. In some situations, as supported herein, methanol is not required to obtain efficient expression of one or more proteins of interest at high levels, but it may be desirable to introduce or add methanol to the culture medium. In some situations (e.g., one or more nucleic acids encoding an enzyme(s) involved in heme biosynthesis), When an acid is expressed, it may be desirable to supplement the culture medium with iron or a pharmaceutically or metabolically acceptable salt (or GRAS salt).

[0072] The recombinant nucleic acid molecules described herein may be stably integrated into the genome of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) or may be expressed from a replicating competent plasmid extrachromosomally. Methods for achieving either are known in the art and are used.

[0073] The methods provided herein may also include the step of purifying the expressed protein. As used herein, an "enriched" protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more) by dry weight of the mass of the producing cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) or at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99%) by dry weight of the mass of the producing cell lysate (e.g., excluding cell wall material or cell membrane material). As used herein, a "purified" protein is one that is separated or purified from the cellular components that are naturally associated with it ​​​​​​​​​​​​​ is a protein that has been produced. Typically, the protein is, by dry weight, natural is at least 60% of the proteins and naturally occurring molecules with which it associates (e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) is not included, it is considered to be "purified."

[0074] As used herein, nucleic acids may include DNA and RNA and may include nucleic acids containing one or more nucleotide analogs or backbone modifications. Nucleic acids may be single-stranded in some cases or double-stranded in some cases, which typically depends on its intended use. Also, nucleic acids and polypeptides that are different from a given sequence are provided. Nucleic acids and polypeptides may have at least 50% sequence identity (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82 %, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a given nucleic acid sequence or polypeptide sequence. may have.

[0075] In calculating the percent sequence identity, two sequences are aligned and the number of identical matches of nucleotide or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of nucleotides or amino acid residues in the alignment) and multiplied by 100 to arrive at the percent sequence identity value. The length of the aligned region is the length of a portion of one or both sequences - the full length of the shortest sequence will be appreciated that it may be possible. Also, a single sequence may be aligned with more than one other sequence and, for this reason, it will also be appreciated that different sequence identity percentage values may be had for each region being aligned throughout.

[0076] Alignment of two or more sequences to determine the percent sequence identity is a computer program such as ClustalW that allows for alignment of nucleic acid or polypeptide sequences over their entire length (global alignment) and can be performed using the default parameters (Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500). ClustalW calculates the best match between a query sequence and one or more target sequences such that identities, similarities, and differences can be determined, and aligns them . Gaps of one or more residues may be inserted into the query sequence, target sequence, or both to maximize the sequence alignment . For rapid, pairwise alignment of nucleic acid sequences, the default parameters (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5) may be used ; for alignment of multiple nucleic acid sequences, the following parameters: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes may be used . For rapid, pairwise alignment of polypeptide sequences, the following parameters: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty: 3.0 may be used . For alignment of multiple polypeptide sequences, the following parameters: gap opening penalty: 10.0; gap extension penalty: 0.2; and weight transitions: yes may be used . It will be appreciated that the above parameters are merely exemplary and that other parameters may be used to perform sequence alignment . For the rapid, pairwise alignment of nucleic acid sequences, the default parameters (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5) may be used ; for alignment of multiple nucleic acid sequences, the following parameters: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes may be used Determination method: percentage; number of top diagonals: 5; and gap penalty: 3 can be used. For multiple alignment of polypeptide sequences, the following parameters -: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gap: on; hydrophilic residues: Gly, Pro, S er, Asn, Asp, Gln, Glu, Arg, and Lys; and residue-specific gap penalty: on can be used. ClustalW can be run, for example, on the Baylor College of Medicine Search Launcher website on the Internet or the European Bioinformatics Institute website.

[0077] Changes may be introduced into the nucleic acid molecule, thereby causing changes in the amino acid sequence of the encoded polypeptide. For example, the changes may be introduced into the nucleic acid coding sequence using mutagenesis (e.g., site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis, UV mutagenesis, or radiation-induced mutagenesis), or nucleic acid coding sequences with such changes may be introduced by chemically synthesizing nucleic acid molecules with such changes. Such nucleic acid changes may result in conservative amino acid substitutions and / or non-conservative amino acid substitutions at one or more amino acid residues. "Conservative amino acid substitution" refers to a substitution in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (e.g., a frequency table for amino acid substitutions is provided ​​​​​​​​​See, Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352) (see also), and a non-conservative substitution is a substitution in which an amino acid residue is replaced with an amino acid residue having a non-similar side chain The nucleic acid sequence and / or polypeptide sequence, without limitation, can be modified as described herein to increase expression (e.g., transcription and / or translation), tighten regulation , deregulate, lose catabolite repression, specificity, secretion, heat stability, solvent stability , oxidative stability, protease resistance, catalytic activity, and / or modify color, etc., to improve one or more properties.

[0078] As used herein, an "isolated" nucleic acid molecule is a nucleic acid molecule that does not contain sequences flanking one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived (e.g., cD NA, or a genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such an isolated nucleic acid molecule is generally introduced into a vector (e.g., a cloning vector or an expression vector) for ease of manipulation or to create a fusion nucleic acid molecule, as discussed in more detail below . In addition, an isolated nucleic acid molecule can include engineered nucleic acid molecules, such as recombinant nucleic acid molecules or synthetic nucleic acid molecules . The vectors described herein can be introduced into host cells (e.g., fungal cells such as Asperg illus cells, Trichoderma cells, or yeast cells (e.g., methanol-utilizing yeast cells)). As used herein, a "host cell"

[0079] is a cell that can be introduced into a vector (e.g., a cloning vector or an expression vector) for ease of manipulation or to create a fusion nucleic acid molecule, as discussed in more detail below . refers to a specific cell into which a nucleic acid is introduced, and also includes the progeny cells of such cells that carry the vector. The host cell can be any prokaryotic or eukaryotic cell. For example, the nucleic acid may be expressed in bacterial cells such as Escherichia coli (E. coli), insect cells, yeast cells, or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells etc.). Those skilled in the art are aware of other suitable host cells. Those skilled in the art are well aware of many methods for introducing nucleic acids into host cells, both in vivo and in vitro o. Without limitation, these methods include electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection tion, microinjection, and virus-mediated nucleic acid introduction.

[0080] The nucleic acid can be isolated using techniques defined in the art. For example, the nucleic acid can be isolated using any method including, without limitation, recombinant nucleic acid technology and / or polymerase chain reaction (PCR) techniques. General PCR techniques are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor La boratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation that can be used to isolate nucleic acids. Isolated nucleic acids can also be chemically synthesized as a single nucleic acid molecule or a series of oligonucleotides.

[0081] The polypeptide is purified by DEAE ion exchange, gel filtration, and hydroxyapatite chroma Purification from natural sources (e.g., biological samples) can be achieved by known methods such as chromatography. The polypeptide can also be purified, for example, by expressing the nucleic acid in an expression vector. In addition, the purified polypeptide can be obtained by chemical synthesis. The purity of the polypeptide can be measured by any suitable method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0082] Constructs or vectors containing nucleic acids (e.g., nucleic acids encoding polypeptides) are also provided. Constructs or vectors containing expression constructs or expression vectors are commercially available or can be prepared by recombinant DNA techniques as defined in the art. The nucleic acid-containing construct or vector can have an expression element operably linked to such nucleic acid and can further contain sequences such as a sequence encoding a selectable marker (e.g., an antibiotic resistance gene). The nucleic acid-containing construct or vector can encode a chimeric polypeptide or a fusion polypeptide (i.e., a polypeptide operably linked to a heterologous polypeptide, which can be at the N-terminus or C-terminus of the polypeptide). Representative heterologous polypeptides include heterologous polypeptides (e.g., 6×His tag, glutathione S-transferase (GST)) that can be used in the purification of the encoded polypeptide.

[0083] Nucleic acids can also be detected using hybridization. For hybridization between nucleic acids, see Sambrook et al. (1989, Molecular Cloning: A Laboratory M anual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sec tions 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57) are discussed in detail by Sambrook et al. Sambrook et al. disclose Southern blotting conditions suitable for oligonucleotide probes less than about 100 nucleotides (Sections 11.45-11.46). The Tm between a sequence less than 100 nucleotides in length and a second sequence can be calculated using the formula presented in Section 11.46. In addition, Sambrook et al. disclose Southern blotting conditions suitable for oligonucleotide probes greater than about 100 nucleotides (see Sections 9.47-9.54). The Tm between a sequence greater than 100 nucleotides in length and a second sequence can be calculated

[0084] using the formula presented in Sections 9.50-9.51 of Sambrook et al. The conditions under which a membrane containing nucleic acid is prehybridized and hybridized, as well as the conditions under which the membrane containing nucleic acid is washed to remove excess probe and nonspecifically bound probe can play a significant role in the stringency of hybridization. Such hybridization and washing can be carried out, where appropriate, under moderately stringent or highly stringent conditions. For example, Typically, it includes washing the membrane in 0.2x SSC at 65°C.

[0085] In addition, the interpretation of the amount of hybridization is affected, for example, by the specific activity of the labeled oligonucleotide probe, the number of probe-binding sites on the template nucleic acid to which the probe hybridizes, and the exposure of the autoradiograph or other detection medium. It can be appreciated by those skilled in the art that any number of hybridization conditions and washing conditions can be used to examine the hybridization of probe nucleic acid molecules to immobilized target nucleic acids, but it is important to examine the hybridization of the probe to the target nucleic acid under the same hybridization conditions, washing conditions, and exposure conditions. Preferably, the target nucleic acids are on the same membrane. It will be readily appreciated that is important. Preferably, the target nucleic acids are on the same membrane.

[0086] If the hybridization to one nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) less than the hybridization to another nucleic acid, the nucleic acid molecule is considered to hybridize to one nucleic acid but not to another nucleic acid. The amount of hybridization may be directly quantified on the membrane, for example, using a PhosphorImager or Densitometer (Molecular Dynamics, Sunnyvale, CA), or may be quantified by autoradiography. It may also be quantified by autoradiography. The polypeptide can be detected using an antibody. Techniques for detecting a polypeptide using an antibody include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation

[0087] using an antibody. Techniques for detecting a polypeptide using an antibody include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation using an antibody. Techniques for detecting a polypeptide using an antibody include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation including lowering and immunofluorescence. The antibody may be a polyclonal antibody or a monoclonal antibody. Antibodies having specific binding affinity for a polypeptide can be produced using methods well-known in the art. Antibodies can be conjugated to a solid support such as a microtiter plate using methods known in the art. In the presence of the polypeptide, an antibody-polypeptide complex is formed.

[0088] Detection (e.g., detection of an amplification product, a hybridization complex, or a polypeptide ) is typically achieved using a detectable label. The term "label" is intended to encompass the use of both direct labels and indirect labels. Detectable labels include enzymes, haptens, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.

[0089] Methods are described herein that can be used to generate strains lacking sequences for selection (i.e., lacking a selectable marker). These methods include the use of circular plasmid DNA vectors and linear DNA sequences; the circular plasmid DNA vectors contain a selectable marker and an origin of DNA replication (also known as an autonomous replication sequence (ARS)), and the linear DNA sequences contain sequences for integration into the genome (e.g., the Pichia genome) by homologous recombination. In addition, the linear DNA molecule includes, without limitation, one or more nucleic acid sequences encoding a protein of interest, such as ALAS, a heme-binding protein, or a third protein (e.g., a transcription factor or a protein involved in heme biosynthesis).

[0090] ​​Cells (e.g., Pichia cells) are transformed with both DNA molecules and the trait Transformants can be selected by the presence of a selection marker on the circular plasmid. Then, the transformants can be screened, for example, using PCR, for the integration of the linear DNA molecule into the genome Once transformants with the marker-free linear DNA molecule properly integrated are identified, the cells can be grown in the absence of selection for the circular plasmid In the absence of selection, plasmids carrying the marker are not stably maintained and thus are often lost very rapidly after selection is relaxed. The resulting strain retains the integrated linear DNA in the absence of the heterologous sequences for selection Therefore, this method can be used to construct strains (e.g., Pichia strains) lacking a selection marker (e.g., a heterologous selection marker) with little to no effect on recombinant protein yield According to the present disclosure, conventional molecular biology methods, microbiological methods, biochemical methods, and recombinant DNA techniques within the skill in the art can be employed. Such techniques are well described in the literature

[0091] In the following examples, the materials and methods of the present disclosure are further illustrated, but this is not intended to limit the scope of the methods and compositions recited in the claims In the following examples, the materials and methods of the present disclosure are further described, but this is not intended to limit the scope of the claims

[0092] In the following examples, the materials and methods of the present disclosure are further described, but this is not intended to limit the claims

[0093] Exemplary Embodiments ​​​​​Embodiment 1. A nucleotide sequence encoding aminolevulinate synthase (ALAS) protein, operably linked to a first promoter element, and ALA S contains at least a first heme reactive motif (HRM), and ALAS contains a mutation within the first HRM A first exogenous nucleic acid construct; and A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein A cell comprising: A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein is operably linked to the first promoter element or operably linked to a second promoter element, a cell. Embodiment 2. The cell according to Embodiment 1, which is a fungal cell. Embodiment 3. The cell according to Embodiment 2, which is an Aspergillus cell or a Trichoderma cell. Embodiment 4. The cell according to any one of Embodiments 1 to 3, which is a yeast cell. Embodiment 5. The cell according to Embodiment 4, wherein the yeast cell is a methanol-assimilating yeast cell. Embodiment 6. The cell according to Embodiment 5, wherein the methanol-assimilating yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell Embodiment 7. The cell according to Embodiment 5, wherein the methanol-assimilating yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell Embodiment 8. The cell according to Embodiment 7, wherein the methanol-assimilating yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell , the cell according to any one of Embodiments 5 to 6. Embodiment 8. The methanol-assimilating yeast cell is a Pichia pastoris cell , the cell according to any one of Embodiments 5 to 7. Embodiment 9. The mutation in the first HRM is a mutation from cysteine to a different amino acid , the cell according to any one of Embodiments 1 to 8. Embodiment 10. The ALAS protein contains a second HRM, and the ALAS protein contains a mutation in the second HRM, the cell according to any one of Embodiments 1 to 9. Embodiment 11. The mutation in the second HRM is a mutation from cysteine to a different amino acid , the cell according to Embodiment 10. Embodiment 12. The different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM , the cell according to Embodiment 10 or Embodiment 11. Embodiment 13. The different amino acid is not the same for the mutation in the first HRM and the mutation in the second HRM , the cell according to Embodiment 10 or Embodiment 11. Embodiment 14. The ALAS protein contains a third HRM, and the ALAS protein contains a mutation in the third HRM, the cell according to any one of Embodiments 10 to 13. Embodiment 15. The mutation in the third HRM is a mutation from cysteine to a different amino acid , the cell according to Embodiment 14. Embodiment 16. The different amino acid is the same for the mutation in the first HRM, the mutation in the second HRM, and the mutation in the third HRM, the cell according to Embodiment 15 . Embodiment 17. The different amino acid is arginine, histidine, lysine, serine, threonine Nin, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalan ine, tryptophan, tyrosine, and valine, the cell according to any one of Embodiments 9 to 16. Embodiment 18. The different amino acid is selected from non-polar aliphatic amino acids, aromatic amino acids, polar uncharged amino acids, or positively charged amino acids, the cell according to any one of Embodiments 9 to 16. Embodiment 19. The non-polar aliphatic amino acid is selected from the group consisting of glycine, proline, alanine, isoleuc ine, leucine, methionine, and valine, the cell according to Embodiment 18 described. Embodiment 20. The aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyros ine, the cell according to Embodiment 18 described. Embodiment 21. The polar uncharged amino acid is selected from the group consisting of serine, threonine which are polar uncharged amino acids, asparagine, or glutamine, the cell according to Embodiment 18 described. Embodiment 22. The positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine the cell according to Embodiment 18 described. Embodiment 23. The different amino acid is serine, the cell according to any one of Embodiments 9 to 22. Embodiment 24. The different amino acid is alanine, the cell according to any one of Embodiments 9 to 22. Embodiment 26. The different amino acid is histidine, any one of Embodiments 9 to The cell described in Embodiment 27. The first HRM is HRM1, any one of Embodiments 1 to 26 The cell described. Embodiment 28. The second HRM is HRM2, any one of Embodiments 10 to 27 The cell described therein. Embodiment 29. The first HRM is HRM2, any one of Embodiments 1 to 26 The cell described. Embodiment 30. The second HRM is HRM1, any one of Embodiments 10 to 27 The cell described therein. Embodiment 31. The first exogenous nucleic acid construct contains a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28, any one of Embodiments 1 to 30 The cell described. Embodiment 32. The first exogenous nucleic acid construct contains a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28, any one of Embodiments 1 to 30 The cell described. Embodiment 33. The first exogenous nucleic acid construct contains the nucleic acid sequence within SEQ ID NO: 30, the cell described in any one of Embodiments 1 to 30. Embodiment 34. The ALAS protein contains an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29, any one of Embodiments 1 to 32 The cell described. Embodiment 35. The ALAS protein contains an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29, any one of Embodiments 1 to 32 The cell described. Embodiment 36. The ALAS protein contains the amino acid sequence within SEQ ID NO: 31, the cell described in any one of Embodiments 1 to 35. Embodiment 37. The heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase, and is the cell according to any one of Embodiments 1 to 36. Embodiment 38. The heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin, and is the cell according to any one of Embodiments 1 to 36. Embodiment 39. The heme-binding protein is non-symbiotic hemoglobin, and is the cell according to any one of Embodiments 1 to 36. Embodiment 40. The heme-binding protein is leghemoglobin, and is the cell according to any one of Embodiments 1 to 36. Embodiment 41. The heme-binding protein contains an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27, and is the cell according to any one of Embodiments 1 to 40. Embodiment 42. The cell further contains a third nucleic acid construct encoding a transcription factor, and the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element, and is the cell according to any one of Embodiments 1 to 41. Embodiment 43. The first promoter element contains a recognition sequence for the transcription factor, and is the cell according to Embodiment 42. ​​​​​​​​​​​​​​Embodiment 44. The second exogenous nucleic acid construct is operable with a second promoter element. and the second promoter element comprises a recognition sequence for a transcription factor. , A cell according to embodiment 42 or 43. Embodiment 45. The third nucleic acid construct is operably linked to a third promoter element. and the third promoter element comprises a recognition sequence for a transcription factor. 44. The cell of embodiment 42 or 43. Embodiment 46. A method for the preparation of a heme-containing nucleic acid comprising the steps of: and a fourth nucleic acid construct comprising the first promoter element, , a second promoter element, a third promoter element, or a fourth promoter element. 46. ​​The method according to any one of embodiments 1 to 45, operably linked to a control element. Cells on the plate. Embodiment 47. The protein involved in the biosynthesis of heme is ALA dehydratase, porphyrin Bilirinogen deaminase, UPG III synthase, UPG III decarboxylase The group consisting of oxidase, CPG oxidase, PPG oxidase, and ferrochelatase 47. The cell of embodiment 46, wherein the cell is selected from: Embodiment 48. The method of any one of embodiments 1 to 4, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. 7. A cell according to any one of 7. Embodiment 49. The method of any one of embodiments 1 to 4, wherein the second exogenous nucleic acid construct is a heterologous nucleic acid construct. 9. A cell according to any one of 8. Embodiment 50. The embodiment in which the heme binding protein is an exogenous heme binding protein. 48. The cell according to any one of embodiments 1 to 47. Embodiment 51. The embodiment in which the heme-binding protein is a heterologous heme-binding protein The cell according to any one of 1 to 47 or 50. Embodiment 52. A method for producing a heme-binding protein in a cell, comprising: expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme-reactive motif (HRM), and the ALAS comprises a mutation within the first HRM; and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. The second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein is operably linked to the first promoter element or a second promoter element. Embodiment 53. The method according to Embodiment 52, wherein the corresponding method lacking the first exogenous nucleic acid construct produces a heme-binding protein at a titer exceeding at least 5%. Embodiment 54. The method according to Embodiment 52 or 53, wherein the corresponding method lacking the first exogenous nucleic acid construct produces a heme-binding protein at a titer exceeding at least 10%. Embodiment 55. The method according to Embodiment 52 or 53, wherein the corresponding method lacking the first exogenous nucleic acid construct produces a heme-binding protein at a titer exceeding at least 15%. Embodiment 56. The method according to Embodiment 52 or 53, wherein the corresponding method lacking the first exogenous nucleic acid construct produces a heme-binding protein at a titer exceeding at least 20%. Embodiment 57. The method according to Embodiment 52 or 53, wherein the corresponding method lacking a mutation within the first HRM produces a heme-binding protein at a titer exceeding at least 5%. Embodiment 58. The method according to Embodiment 52 or 53, wherein the corresponding method lacking a mutation within the first HRM produces a heme-binding protein at a titer exceeding at least 10%.​​​​​​​​​​​ The method according to embodiment 52, which produces a heme-binding protein at the titer of Embodiment 58. The corresponding method lacking the mutation in the first HRM, at a titer exceeding at least 10% The method according to embodiment 52, which produces a heme-binding protein at the titer of Embodiment 59. The corresponding method lacking the mutation in the first HRM, at a titer exceeding at least 15% The method according to embodiment 52, which produces a heme-binding protein at the titer of Embodiment 60. The corresponding method lacking the mutation in the first HRM, at a titer exceeding at least 20% The method according to embodiment 52, which produces a heme-binding protein at the titer of Embodiment 61. The method according to any one of embodiments 52 to 60, which is carried out in the absence of the addition of methanol Embodiment 62. The method according to any one of embodiments 52 to 61, wherein the cell is a fungal cell Embodiment 63. The method according to embodiment 62, wherein the cell is an Aspergillus cell or a Trichoderma cell Embodiment 64. The method according to any one of embodiments 62 to 63, wherein the cell is a yeast cell Embodiment 65. The method according to embodiment 64, wherein the yeast cell is a methanol-assimilating yeast cell Embodiment 66. The method according to embodiment 65, wherein the methanol-assimilating yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell Embodiment 67. The methanol-assimilating yeast cell is a Pichia methanolica cell ) a cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell, the method according to any one of embodiments 65 to 66. which is the method according to any one of embodiments 65 to 66. which is the method according to any one of embodiments 65 to 66. Embodiment 68. The method according to any one of embodiments 51 to 53, wherein the methanol-utilizing yeast cell is a Pichia pastoris cell. which is the method according to any one of embodiments 51 to 53. Embodiment 69. The method according to any one of embodiments 52 to 68, wherein the mutation in the first HRM is a mutation from cysteine to a different amino acid. which is the method according to any one of embodiments 52 to 68. Embodiment 70. The method according to any one of embodiments 52 to 69, wherein the ALAS protein comprises a second HRM and the ALAS protein comprises a mutation in the second HRM. which is the method according to any one of embodiments 52 to 69. Embodiment 71. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM produces a heme-binding protein at a titer of at least more than 5%. which is the method according to embodiment 70. which is the method according to embodiment 70. Embodiment 72. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM produces a heme-binding protein at a titer of at least more than 10%. which is the method according to embodiment 70. which is the method according to embodiment 70. Embodiment 73. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM produces a heme-binding protein at a titer of at least more than 15%. which is the method according to embodiment 70. which is the method according to embodiment 70. Embodiment 74. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM produces a heme-binding protein at a titer of at least more than 20%. which is the method according to embodiment 70. which is the method according to embodiment 70. Embodiment 75. The mutation in the second HRM is a mutation from cysteine to a different amino acid. 75. The method of any one of embodiments 70 to 74, wherein the mutation is Embodiment 76. A different amino acid is a mutation in the first HRM and a mutation in the second HRM. 76. The method of any one of embodiments 70 to 75, wherein the same for the mutation. Embodiment 77. A different amino acid is a mutation in the first HRM and a mutation in the second HRM. 76. The method of any one of embodiments 70 to 75, wherein the mutations are not the same. Embodiment 78. The ALAS protein comprises a third HRM, 78. The cell of any one of embodiments 70 to 77, comprising a mutation in 3 HRM. Embodiment 79. The mutation in the third HRM is an abrupt change from cysteine ​​to a different amino acid. The cell of embodiment 78, which is mutated. Embodiment 80. Different amino acids are represented by a mutation in the first HRM, a mutation in the second HRM, 80. The cell of embodiment 79, wherein the mutations in the first and second HRMs are the same. . Embodiment 81. The different amino acids are arginine, histidine, lysine, serine, threo Nine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, Isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine Embodiment 69. 80. A method according to any one of claims 1 to 80. Embodiment 82. The different amino acids are non-polar aliphatic amino acids, aromatic amino acids, polar non-polar aliphatic amino acids, 81. Any one of embodiments 69 to 80, wherein the amino acid is selected from an electrically charged amino acid, or a positively charged amino acid. The method according to claim 1. Embodiment 83. The non-polar aliphatic amino acid is glycine, proline, alanine, isoleucine. The method according to embodiment 82, selected from the group consisting of leucine, methionine, and valine. The method described in the above. Embodiment 84. The aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyrosine. The method according to embodiment 82. Embodiment 85. The polar uncharged amino acid is selected from the group consisting of serine, threonine, asparagine, or glutamine, which are polar uncharged amino acids. The cell according to embodiment 82. Embodiment 86. The positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine. The method according to embodiment 82. Embodiment 87. The different amino acid is serine. The method according to any one of embodiments 69 to 86. Embodiment 88. The different amino acid is alanine. The method according to any one of embodiments 69 to 86. Embodiment 89. The different amino acid is phenylalanine. The method according to any one of embodiments 69 to 86. Embodiment 90. The different amino acid is histidine. The method according to any one of embodiments 69 to 86. Embodiment 91. The first HRM is HRM1. The cell according to any one of embodiments 52 to 90. Embodiment 92. The second HRM is HRM2. The cell according to any one of embodiments 70 to 91. Embodiment 93. The first HRM is HRM2. The cell according to any one of embodiments 52 to 90. Embodiment 94. The second HRM is HRM1. The cell according to any one of embodiments 70 to 91. Embodiment 95. The first exogenous nucleic acid construct has at least... Any one of Embodiments 52 to 94, comprising a nucleic acid sequence having at least 90% sequence identity The method according to any one of the above. Embodiment 96. The method according to any one of Embodiments 52 to 95, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28 Any one of Embodiments 52 to 95, comprising a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28 The method according to any one of the above. Embodiment 97. The method according to any one of Embodiments 52 to 96, wherein the first exogenous nucleic acid construct comprises the nucleic acid sequence within SEQ ID NO: 30 The method according to any one of Embodiments 52 to 96. Embodiment 98. The method according to any one of Embodiments 52 to 97, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29 Any one of Embodiments 52 to 97, comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29 The method according to any one of the above. Embodiment 99. The method according to any one of Embodiments 52 to 98, wherein the ALAS protein comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29 Any one of Embodiments 52 to 98, comprising an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29 The method according to any one of the above. Embodiment 100. The method according to any one of Embodiments 52 to 99, wherein the ALAS protein comprises the amino acid sequence within SEQ ID NO: 31 The method according to any one of Embodiments 52 to 99. Embodiment 101. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase The method according to any one of Embodiments 52 to 100. Embodiment 102. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, sarcoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, sarcoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, sarcoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, sarcoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin The method according to any one of Embodiments 52 to 100, selected from the group. Embodiment 103. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is a non-symbiotic hemoglobin. from 100. Embodiment 104. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is leghemoglobin. 100. Embodiment 105. The method according to any one of Embodiments 52 to 100, wherein the heterologous heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. from 100. Embodiment 106. The method according to any one of Embodiments 52 to 105, further comprising the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element. from 105. Embodiment 107. The method according to Embodiment 106, wherein the first promoter element comprises a recognition sequence for the transcription factor. Embodiment 108. The method according to Embodiment 107, wherein the second exogenous nucleic acid construct is operably linked to a second promoter element, and the second promoter element comprises a recognition sequence for the transcription factor. from 107. Embodiment 109. The method according to any one of Embodiments 107 to 108, wherein the third nucleic acid construct is operably linked to a third promoter element, and the third promoter element comprises a recognition sequence for the transcription factor. from 108. Embodiment 110. A nucleotide sequence encoding a protein involved in heme biosynthesis. ​​​​​further comprising the step of expressing a fourth nucleic acid construct, wherein the fourth nucleic acid construct is a first promoter element, a second promoter element, a third promoter element fragment, or a method according to any one of embodiments 52 to 109, which is operably linked to a fourth promoter element. Embodiment 111. The method according to embodiment 110, wherein the protein involved in the biosynthesis of heme is selected from the group consisting of ALA dehydratase, por phobilinogen deaminase, UPG III synthase, UPG III decarboxylase lase, CPG oxidase, PPG oxidase, and ferrochelatase. from the group consisting of: Embodiment 112. The method according to any one of embodiments 52 to 111, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 113. The method according to any one of embodiments 52 to 112, wherein the second exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 114. The method according to any one of embodiments 52 to 113, wherein the heme-binding protein is an exogenous heme-binding protein. Embodiment 115. The method according to any one of embodiments 52 to 111 or 114, wherein the heme-binding protein is a heterologous heme-binding protein.

Examples

[0094] [Example 1] Polymerase Chain Reaction Phusion Hi-fidelity PCR master mix (New England Biolabs, catalog number: M0531), forward primers and reverse primers each at 0.6 μM, and 10 - 50 ng of template DNA were used to target The gene was amplified from genomic DNA template or plasmid DNA template. The reaction conditions were as follows:

[0095]

Table 1

[0096] The ALAS gene of Pichia pastoris (Kyoto Encyclopedia of Genes and Genomes (KEGG) website accessible, KEGG identifier: PAS_chr2-1_0716) was amplified using primers derived from genomic D NA (ATGGAGTTTGTCGCCCGTCAG; SEQ ID NO: 6 5), and (CTACAATCTGACTCCTGATGAGGTTTC; SEQ ID NO: 6 6). In the examples, wtALAS represents the native sequence of this ALAS (SEQ ID NO: 28).

[0097] [Example 2] Cloning and mutagenesis of ALAS NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc., product number: 740609) was used to purify the PCR product, and according to the manufacturer's recommendations, Z ero Blunt TOPO PCR Cloning Kit (Thermo Fi sher Scientific, product number: K280020) was used to clone into the pCR-Blu ntII-TOPO vector. On the resulting vector (40 n g of purified plasmid), two primer sets (Set 1: CGTCAGT CCATGAATGCCTCTCCCTTTGTCAGGTCAACTTC; SEQ ID NO: 3 7; and GAAGTTGACCTGACAAAGGGAGAGGCATTCATGGA CTGACG: SEQ ID NO: 38; Set 2: GCTGCTACTGCTAGTCATTCT CCCGTGGTTGGCCCTG: SEQ ID NO: 39; and CAGGGCCAACCAC GGGAGAATGACTAGCAGTAGCAGC; SEQ ID NO: 40), and Quik Change II XL Site-Directed Mutagenesis K it (Agilent, model number: 200521) was used to perform site-directed mutagenesis to create mutALAS (SEQ ID NO: 30) that carries mutations from cysteine residues to serine residues at positions 12 and 39. In the examples, mutALAS represents, among other things, these two mutations unless otherwise specified. The reaction conditions were as follows as follows:

[0098] [Table 2]

[0099] On the vector carrying wtALAS, primer sets 1 (SEQ ID NOs: 37, 38), and set 2 (SEQ ID NOs: 39, 40) were used respectively for site-directed mutagenesis to perform C12S or C39S, which are single cysteine-to-serine mutations.

[0100] [Example 3] Construction of an ALAS (wild-type, or C12S mutation, C39S mutation) gene integration cassette The methanol-inducible alcohol oxidase derived from Pichia pastoris ​​​​​AOX1 promoter element and directly preceding the translation termination signal. Following transcription termination from the Pichia pastoris FDH1 gene Integration of wtALAS or mutALAS under the sequence so that gene integration occurs The cassette was designed as follows: Contains the LAS gene (wild type or mutant) followed by the FDH1 transcription terminator Shortly after this, the pTEF promoter from Ashbya gossypii was ter element, derived from Aspergillus nidulans The acetamidase gene (amdS) and Ashbya gossypii ) was followed by a selection cassette containing the TEF terminator derived from The construct contained a 5' promoter element (see, for example, FIG. 5).

[0101] Overlap PCR was used to generate the linear construct [3'pAOX1-ALAS(wt / mut)- FDH1tt-pTEF-amdS-TEFtt-5'pAOX1] was created. Primers used to amplify the construct:

[0102] [Table 3]

[0103] The individual PCR reaction conditions were as indicated above. eoSpin Gel and PCRClean-Up (Takara Bio Inc., model no. 0.5 U Platinum Pfx DNA Polymerase (Thermo Fisher Scientific, model number: 11708039), 1x amplification buffer, 0.3 mM dNTP, and 1 mM M gCl2 were used to perform final overlapping PCR by mixing three purified PCR unit replication sequences in equimolar ratios in a two-step PCR reaction. The PCR conditions were as follows: : Step 1:

[0104] [Table 4]

[0105] After Step 1, the reaction mix was spiked with the primers AAACGCTGTCTTGGAA CCTAATATGAC (SEQ ID NO: 41) and AAACTGTCAGTTTTGGG CCATTTG (SEQ ID NO: 46) (final concentration of 0.3 μM), and 1.5 U Pfx and continued to Step 2.

[0106] Step 2:

[0107] [Table 5]

[0108] The sequences of exemplary mutants' nucleic acids (e.g., SEQ ID NO: 30) and proteins (e.g., SEQ ID NO: 31) are presented in FIG. 7.

[0109] Expression plasmids of wtALAS and mutALAS were constructed under the transcription termination sequence derived from the Pichia pastoris FDH1 gene following modified pAOX1 within the self-replicating vector (panARS). The vector is G418 (Genetici ​​​resistance to (n) was imparted. According to the manufacturer's recommendations, Gibson Assembly Master Mix (New England Biolabs, catalog number: E2611L ) was used to perform the cloning of the inserts, GFP, wtALAS, and mutALAS, into the vector.

[0110] [Example 4] Preparation of P. pastoris Competent Cells A selected strain of P. pastoris (K. phaffii) was grown in 25 ml of YPD medium until mid-exponential growth phase (about 2 OD). The cells were harvested by centrifugation at 93 0×g for 15 minutes. The cell pellet was resuspended in 2 ml of a solution consisting of 80% YPD and 200 mM HEPES, pH 6.8. 75 μl of 1 M DTT was added. The resuspended cell pellet was mixed at 100 rpm and 30 °C for 25 minutes. 40 ml of ice-cold sterile water was added to the suspension, and the cells were harvested by centrifugation at 1125×g for 15 minutes and placed on ice. The cell pellet was resuspended in 40 ml of ice-cold water and harvested for two additional washing steps as described above. Next, the cell pellet was resuspended in 20 ml of 1 M ice-cold sorbitol and harvested by centrifugation as described above. The final cell pellet was resuspended in 0.3 ml of 1 M ice-cold sterile sorbitol, aliquoted, and frozen at -80 °C.

[0111] [Example 5] Transformation of P. pastoris For genomic integration, a GenePulser (BioRad) was set at 1.15 kV A GenePulser cuvette (Bio-Rad, model number : 1652083) with a 1 mm gap was used to transform 30 μl of electrocompetent P. pastoris cells with 100 - 300 ng of linearized DNA. 1 ml of YPD / 1M sorbitol (1:1 vol / vol) was immediately added to the cells. The cells were harvested for 3 hours with shaking at 30 °C and 100 rpm. 100 μl of the harvested mixture was plated onto yeast carbon base plates (Teknova a, model number: Y5216) containing 5 mM acetamide. The plates were incubated at 30 °C for 48 hours. Individual clones were streaked onto yeast carbon base plates containing acetamide to obtain single colonies, and colony PCR or gDNA preparation was performed using the isolated colonies to confirm the integration of the gene into the chromosome and the construct.

[0112] After electroporation and cell recovery, except that 50 - 100 μl of the harvested mixture was plated onto YPD plates containing 300 μg / ml of G418 (Geneticin), the same steps as for genomic integration were followed for transformation with plasmid DNA.

[0113] [Example 6] Construction of strains St2, St3, St5, and St6 The high-yield parent strain (St1) had an existing recombinant ALAS in addition to multiple copies of the methanol-inducible strong promoter pAOX1 (alcohol oxidase 1), another pAOX1-driven heme enzyme, the carbon-responsive transcription factor MxR1, and LegH. Low The yield parent LegH strain (St4) lacked other heme enzymes except for recombinant MxR1, ALAS, and aminolevulinate dehydratase (ALAD).

[0114] Competent St1 cells (Table 1; high LegH titer strain) were transformed with each of the linear cassettes (for wt ALAS and mutALAS), and amdS selection cassettes were selected based on their ability to grow on agar plates containing acetamide as the sole nitrogen source. The resulting strains (St2 and St3; Table 1, each incorporating the cassette for wtAL AS and mutALAS) were purified, isolated, and the presence of pAOX1-driven wtALAS or pAOX1-driven mutA LAS was verified by colony PCR and sequencing. Similarly, competent St4 cells (low LegH titer strain) were transformed with linear cassettes for wtALAS and mutALAS to obtain St5 and St6, respectively.

[0115]

Table 6

[0116] [Example 7] ALAS gene copy number analysis The ALAS gene copy number in different strains was measured by probe-based qPCR. Briefly, in a real-time qPCR CFX96 machine (Bio- Rad), 1X concentration of PrimeTime gene expression mastermix (Integrated DNA Technologies, product number : 1055770), and PrimeTime qPCR Probe Assays Genomic DNA (20 ng) was amplified by and normalized against actin. Relative copy numbers of the target gene among strains were calculated according to the

[0117]

Table 7

[0118] The engineered strains (Table 1) contained the same number of extra ALAS gene copies, either wtALAS or mutALAS, as measured by qPCR for ALAS normalized against actin levels. Thus, any differences in the phenotypes of the resulting strains (e.g., St2 vs. St3 and St5 vs. St6) were excluded for ALAS gene dosage.

[0119] [Example 8] Detection of Hem Enzyme Genes, MxR1 Gene, LegH Gene, and Mb Gene by PCR Strains were characterized by PCR for pAOX1-driven recombinant hem biosynthesis pathway enzyme genes, recombinant MxR1 gene, and recombinant LegH gene. The forward primer sequence for PCR was TAGCGCAGTCTCTCT ATCGCTTC (SEQ ID NO: 53), specific to pAOX1. The reverse primer was specific to each target gene as shown below.

[0120]

Table 8

[0121] The results for these reaction solutions are shown below.

[0122] [Table 9]

[0123] [Example 9] Cultivation of strains St4, St5, and St6, which are strains, in shake flasks The strains were inoculated overnight into a growth medium (supplemented with 1% glycerol, 1% yeast extract, 2% peptone) while shaking at 200 rpm at 30°C. The next day, the cultures were diluted to an OD600 of 0.5 - 0.7 in YP medium supplemented with 1% methanol and 1% dextrose. The cultures were grown for 48 hours and harvested by centrifugation at approximately 4000 g for 15 minutes at 4°C.

[0124] Unlike St1, St4, which is a low LegH titer strain, did not have an existing copy of recombinant ALAS. Integration of a copy of mutALAS (St6) resulted in an approximate 30% improvement compared to St5 (wtALAS) in LegH titer. The titer calculation was based on the LegH content measured by the liquid chromatography

[0125] The relative LegH titers are shown in Table 2:

[0126] [Table 10]

[0127] [Example 10] 2 L cultivation of strains St1, St2, and St3, which are strains Strains St1, St2, and St3 were grown at 30 °C in a 2 L fermenter in a medium containing dextrose as the main carbon source. Methanol was not used. In the background of a high LegH titer strain (St1) containing the existing recombinant ALAS, St3, which overexpresses mutALAS, improved the LegH titer by > 30% compared to the parental St1. When compared to wtALAS (in St2), mutALAS (in St 3) resulted in a 20% improvement in the LegH titer. The titer calculation was based on the LegH content measured by the liquid chromatography method described in Example 13.

[0128] The relative LegH titers are shown in Table 3:

[0129]

Table 11

[0130] Thus, mutating both ALAS HRMs and overexpressing mutant ALAS (mutALAS ) in Pichia strains with different LegH titers resulted in a further improvement in the LegH titer. Furthermore, this suggested that mutALAS improved the LegH titer independent of the strain's genetic composition (hem enzymes other than MxR1 and ALAS) and the presence of methanol.

[0131] [Example 11] mutALAS improved the heme level A quantitative assay for total heme based on reverse-phase high-performance liquid chromatography showed that strains with mutALAS accumulated higher levels of heme than strains containing wtALAS. Indicated. Table 4 shows the quantification of heme in strain St3 (mutALAS) compared to strain St2 (wtALAS). In addition, mutALAS increased the low ding of heme in multiple strains.

[0132]

Table 12

[0133] [Example 12] ALAS protein level by mutALAS Generally, heme is thought to regulate the ALAS level in a feedback loop manner to regulate its own level. At the protein level, when strains were grown in a 2 L fermenter with dextrose, the ALAS level was 3-fold higher in St3 (mutALAS) compared to St2 (wtALAS) as quantified by shotgun mass spectrometry (Table 5).

[0134]

Table 13

[0135] [Example 13] Quantification of Leg hemoglobin Cell culture fluid samples were pelleted (at 4000×g for 30 minutes at 4 °C) and decanted. The pellet samples were then diluted 4-fold with lysis buffer (150 mM NaCl, 50 mM potassium phosphate, pH 7.4). 300 μL aliquots of each resuspension were dispensed into a 96-well deep-well plate with 120 μL of beads (zirconium / silica beads (0 .5 mm)) per well for cell lysis. Mini Bead Be .5 mm)) per well for cell lysis. Mini Bead Be ​​​​​​Dissolve in water for 3 minutes, then cool the plate on ice for 5 minutes and subject it to bead disruption for an additional 2 minutes. Then centrifuge the plate (4000×g, 4°C for 30 minutes). Filter the supernatant through a 0.2 µm filter (4000×g, 4°C for 60 minutes).

[0136] Load the filtered lysate onto a UHPLC with a size exclusion column (Acquity BEH SEC column, 2 00 Å, 1.7 µm, 4.6×150 mm). Method parameters: 1) Mobile phase: 5 mM NaCl, 50 mM potassium phosphate (pH 7.4) ; 2) Flow rate: 0.3 mL / min; 3) Injection volume: 10 µL; 4) Run time: 15 minutes; 5) Sample tray temperature: 4°C. Calibration curves were created using purified LegH standards with absorbance at 280 nm and 415 nm . Quantification was performed using peak areas by valley-to-valley peak integration. Absorbance at 280 nm is proportional to the amount of polypeptide present , and absorbance at 415 nm is proportional to the amount of heme present. If a peak is seen at the same elution time at both wavelengths, a protein containing heme is detected .

[0137] [Example 14] mutALAS improved the level of bovine myoglobin In addition to LegH, the production of bovine myoglobin was assayed. Strain St7 was created by integrating the myoglobin cDNA of Bos taurus (NM_173881.2) under pAOX1 into a strain containing recombinant copies of the heme enzyme and MxR1 (characterization of St7 was as described in Example 8). ​​​

[0138] For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS. For the expression of GFP (control), wtALAS, and mutALAS, three expression plasmids were constructed as described in Example 3. Using the method described in Example 5, as shown in Table 6, the strain S7 was transformed with these three plasmids to overexpress each of GFP, wtALAS, and mutALAS, thereby generating three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS.

[0139] [Table 14]

[0140] The cells were pelleted and shotgun proteomics was performed by LC-MS to quantify Mb. The average myoglobin levels in St9 and St10 were as shown in Table 7 when normalized to the myoglobin level (GFP) in strain St8. The cells were pelleted and shotgun proteomics was performed by LC-MS to quantify Mb. The average myoglobin levels in St9 and St10 were as shown in Table 7 when normalized to the myoglobin level (GFP) in strain St8. The cells were pelleted and shotgun proteomics was performed by LC-MS to quantify Mb. The average myoglobin levels in St9 and St10 were as shown in Table 7 when normalized to the myoglobin level (GFP) in strain St8. The cells were pelleted and shotgun proteomics was performed by LC-MS to quantify Mb. The average myoglobin levels in St9 and St10 were as shown in Table 7 when normalized to the myoglobin level (GFP) in strain St8.

[0141] [Table 15]

[0142] [Example 15] Mutations to other amino acids In addition to the cysteine - to - serine mutation, further mutations were evaluated. Gene synthesis and, within the self - replicating vector (panARS), following the modified pAOX1, FDH In addition to the cysteine - to - serine mutation, further mutations were evaluated. Gene synthesis and, within the self - replicating vector (panARS), following the modified pAOX1, FDH By cloning under the transcription termination sequence, the expression plasmid of the mutALAS mutant was constructed. Furthermore, using the method described in Example 5, with these plasmids , strain St1 was transformed, and except for supplementing 300 μg of growth medium per 1 ml of G418 , when cultured using the method described in Example 9, the resulting transformants produced LegH. The titer of LegH produced by these strains was normalized against the titer of LegH produced by wtALAS determined by the method described in Example 13. The results are shown in Table 8:

[0143]

Table 16

[0144] [Example 16] In Pichia pastoris, the single cysteine to serine mutants In addition to the characterization of the double mutant (C12S, C3 9S) of ALAS in P. pastoris, single cysteine to serine mutants were also characterized. Using site-directed mutagenesis as described in Example 2, a single mutation was created within wtALAS. Expression plasmids for wtALAS, mutALAS, and the single ALAS mutants (C12 S and C39S) were constructed as described in Example 3 , and using the method described in Example 5, strain St1 was transformed thereby. Except for supplementing 300 μg of growth medium per 1 ml of G4 18, when cultured using the method described in Example 9, the resulting transformants produced LegH ​​​​。The titer of LegH produced by these strains was normalized against the titer of LegH produced by wtALAS, which was determined by the method described in Example 13. The results are shown in Table 9:

[0145]

Table 17

[0146] Other embodiments Although the present invention has been described in detail, the foregoing description is intended to illustrate, not limit, the scope of the invention as defined by the appended claims. It is understood that other aspects, advantages, and modifications are within the scope of the following claims. ​​​​​

Claims

1. A nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme reactive motif (HRM), and the ALAS comprises a mutation within the first HRM, a first exogenous nucleic acid construct; and A cell comprising a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein, wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or operably linked to a second promoter element.

2. The cell according to claim 1, which is a fungal cell or a yeast cell.

3. The cell according to claim 2, wherein the yeast cell is a Pichia pastoris cell.

4. The cell according to any one of claims 1 to 3, wherein the mutation within the first HRM is a mutation from cysteine to a different amino acid.

5. The cell according to any one of claims 1 to 4, wherein the ALAS protein comprises a second HRM, and the ALAS protein comprises a mutation within the second HRM.

6. The cell according to claim 5, wherein the mutation within the second HRM is a mutation from cysteine to a different amino acid.

7. The cell according to claim 5, wherein the different amino acid is the same for the mutation within the first HRM and the mutation within the second HRM.

8. The cell according to claim 5, wherein the different amino acid is not the same for the mutation within the first HRM and the mutation within the second HRM.

9. The different amino acid is selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalanine, tryptophan, tyrosine, and valine, according to any one of claims 4 to 8.

10. The different amino acid is a non-polar aliphatic amino acid, an aromatic amino acid, a polar uncharged amino acid ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ The cell according to any one of claims 4 to 8, which is selected from negatively charged amino acids or positively charged amino acids.

11. The cell according to any one of claims 4 to 9, wherein the different amino acid is serine.

12. The cell according to any one of claims 4 to 9, wherein the different amino acid is alanine.

13. The cell according to any one of claims 4 to 9, wherein the different amino acid is phenylalanine. thereof.

14. The cell according to any one of claims 4 to 9, wherein the different amino acid is histidine. 。

15. The cell according to any one of claims 1 to 14, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO:

28.

16. The cell according to any one of claims 1 to 15, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO:

29. of the cell.

17. The cell according to any one of claims 1 to 16, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase , ligninase, catalase, and peroxidase. of the cell according to any one of claims 1 to 16.

18. The cell according to any one of claims 1 to 16, wherein the heme-binding protein is leghemoglobin. of the cell according to any one of claims 1 to 16.

19. The cell according to any one of claims 1 to 16, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. of the cell according to any one of claims 1 to 16. of the cell according to any one of claims 1 to 16.

20. A method for producing a heme-binding protein in a cell, comprising: Expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme-reactive motif (HRM), and the ALAS comprises a mutation within the first HRM; and Expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element, or the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to a second promoter element different from the first promoter element, and the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is expressed in the cell after the first exogenous nucleic acid construct is expressed in the cell. steps comprising, the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element, or the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to a second promoter element different from the first promoter element, and A method operably linked to a second promoter element. **Claim 21** The corresponding method lacking the first exogenous nucleic acid construct at a titer exceeding at least 5%, Producing the heme-binding protein described in claim 20. **Claim 22** The corresponding method lacking the first exogenous nucleic acid construct at a titer exceeding at least 10%, Producing the heme-binding protein according to claim 20 or claim 21. **Claim 23** The corresponding method lacking the mutation in the first HRM at a titer exceeding at least 5%, Producing the heme-binding protein described in claim 20. **Claim 24** The corresponding method lacking the mutation in the first HRM at a titer exceeding at least 10%, Producing the heme-binding protein described in claim 20. **Claim 25** Performed in the absence of the addition of methanol, according to any one of claims 20 to 24, The method described. **Claim 26** The mutation in the first HRM is a mutation from cysteine to a different amino acid, The method according to any one of claims 20 to 25. **Claim 27** The ALAS protein includes a second HRM, and the ALAS protein includes a mutation in the second HRM. The method according to any one of claims 20 to 26. **Claim 28** The corresponding method lacking the mutations in the first HRM and the second HRM at a titer exceeding at least 5%, Producing the heme-binding protein, the method described in claim 26. **Claim 29** The corresponding method lacking the mutations in the first HRM and the second HRM at a titer exceeding at least 10%, Producing the heme-binding protein, the method described in claim 26. **Claim 30** The mutation in the second HRM is a mutation from cysteine to a different amino acid, The method according to any one of claims 27 to 29. **Claim 31** The different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM, The method described in claim 30. **Claim 32** The different amino acid is not the same for the mutation in the first HRM and the mutation in the second HRM, The method described in claim 30. **Claim 33** The different amino acid is arginine, histidine, lysine, serine, threonine, aspartic acid, Paraquine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine ine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, trypt ophan, tyrosine, and valine, which is selected from the group consisting of, any one of claims 26 to 32 The method according to any one of.

34. The method according to any one of claims 26 to 33, wherein the different amino acid is serine 。

35. The method according to any one of claims 26 to 33, wherein the different amino acid is alanine method.

36. The method according to any one of claims 26 to 33, wherein the different amino acid is phenylalanine described method.

37. The method according to any one of claims 26 to 33, wherein the different amino acid is histidine method.

38. The method according to any one of claims 20 to 37, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28 。

39. The method according to any one of claims 20 to 38, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29 method.

40. The method according to any one of claims 20 to 39, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase , ligninase, catalase, and peroxidase, claim The method according to any one of 20 to 39.

41. The method according to any one of claims 20 to 39, wherein the heme-binding protein is leghemoglobin The method according to any one of.

42. The method according to any one of claims 20 to 39, wherein the heterologous heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27 The method according to any one of claims 20 to 39. described method.

Images