Pyrrolysyl-trna synthetase
By employing PylRS from Methanomethylophilus alvus and utilizing strong promoters, the efficiency of introducing non-natural amino acids into polypeptides is enhanced, overcoming limitations of previous methods and achieving high-yield production.
Patent Information
- Application Number
- JP2025062607
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-07-19
- Filing Date
- 2025-04-04
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2039-08-30
AI Technical Summary
Existing methods for introducing non-natural amino acids into proteins using pyrrolysyl tRNA synthetase (PylRS) in both cell-free and E. coli protein synthesis systems suffer from low efficiency and concentration limitations, leading to suboptimal production of polypeptides containing these amino acids.
The use of PylRS from organisms of the order Methanomassiliicoccales or Thermoplasmatales, such as Methanomethylophilus alvus (MaPylRS), which can be concentrated to higher levels than Methanosarcina mazei (MmPylRS), combined with the use of strong promoters in E. coli systems, significantly enhances the efficiency of introducing non-natural amino acids into polypeptides.
This approach allows for the production of polypeptides with non-natural amino acids at significantly higher efficiencies, up to 20 times greater than using MmPylRS, and enables rapid binding reactions suitable for click chemistry applications.
Smart Images

Figure 2025102980000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing a non-natural amino acid-containing polypeptide using pyrrolysyl tRNA synthetase, and the like.
Background Art
[0002] Aminoacyl-tRNA synthetase (aaRS) is an enzyme involved in protein synthesis. Specifically, it is known to have an activity of synthesizing aminoacyl-tRNA by esterifying an amino acid to tRNA. Aminoacyl-tRNA is a molecule involved in the elongation of a peptide chain that constitutes a protein at the ribosome.
[0003] Research has been conducted on introducing non-natural amino acids into proteins using pyrrolysyl tRNA synthetase (PylRS), which is a type of aminoacyl-tRNA synthetase. For example, Patent Document 1 describes that an α-hydroxy acid derivative of a lysine derivative was introduced into a protein by using PylRS of Methanosarcina mazei (MmPylRS). Patent Document 2 describes that a lysine derivative was introduced into a protein by using a mutant of MmPylRS. Patent Document 3 describes that a ZLys derivative was introduced into an antibody by using a mutant of MmPylRS. This document also describes that a chemically modified product of an antibody into which a ZLys derivative has been introduced was prepared using click chemistry.
[0004] Non-Patent Document 1 also describes that the N-terminal domain of PylRS is necessary for in vivo activity. Non-Patent Document 2 describes that the N-terminal domain of PylRS binds to tRNA. Non-Patent Document 3 describes that the N-terminal domain of PylRS and tRNA interact with each other.
[0005] Non-Patent Document 4 describes that MmPylRS has an N-terminal domain, while PylRS from Methanomethylophilus alvus (MaPylRS) does not have an N-terminal domain. It also describes the introduction of unnatural amino acids into proteins by an Escherichia coli protein synthesis system using MaPylRS.
Prior Art Documents
Patent Documents
[0006]
Patent Document 1
Patent Document 2
Patent Document 3
Non-Patent Documents
[0007]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Summary of the Invention
Problems to be Solved by the Invention
[0008] Non-Patent Document 4 describes that non-natural amino acids can be introduced even when MaPylRS without an N-terminal domain is used. However, in the E. coli protein synthesis system of Non-Patent Document 4, the efficiency of introducing non-natural amino acids was not sufficiently high.
[0009] Non-Patent Document 4 describes experiments on the introduction of non-natural amino acids and orthogonality, experiments on the selectivity of non-natural amino acids, and experiments on introducing different non-natural amino acids into one polypeptide. On the other hand, no method for significantly increasing the introduction efficiency when compared with MmPylRS is described. Note that the glmS promoter (non-high expression promoter) is used as the promoter for MmPylRS expression.
[0010] On the one hand, the inventors of the present application attempted to introduce unnatural amino acids into proteins by means of a cell-free protein synthesis system using MmPylRS. However, as a result of isolating MmPylRS for use in the cell-free protein synthesis system, it was discovered that the concentration limit was 4 mg / mL or less, and it was not possible to use MmPylRS at a higher concentration (Experimental Example 1, Examples 2 and 3). As a result, the efficiency of introducing unnatural amino acids could not be increased.
[0011] In addition, the inventors of the present application attempted to introduce unnatural amino acids into proteins by means of an E. coli protein synthesis system using MmPylRS. At this time, MmPylRS was highly expressed using a high-expression promoter. However, the efficiency of introducing unnatural amino acids was low (Example 9). In addition, deterioration of the growth of E. coli was also observed. From this, it was found that high expression of PylRS is inappropriate in the E. coli protein synthesis system using MmPylRS.
[0012] The present invention has been made in view of the above circumstances, and an object thereof is to provide an efficient method for producing a polypeptide containing an unnatural amino acid, a method for introducing an unnatural amino acid into a polypeptide, a method for producing a tRNA to which an unnatural amino acid is bound, an unnatural amino acid introduction system, or a material used therefor.
Means for Solving the Problems
[0013] As described in the examples below, the inventors of the present application isolated and purified MaPylRS for the first time. Furthermore, when the MaPylRS solution was concentrated, it was discovered that the concentration limit of MaPylRS was significantly higher, and a high-concentration MaPylRS solution could be prepared (Example 1, Example 3). This concentration limit of MaPylRS was more than 5 times the concentration limit of MmPylRS, which was an unexpected result.
[0014] Furthermore, attempts were made to introduce unnatural amino acids into proteins using a cell-free protein synthesis system with a high-concentration MaPylRS solution (Examples 3 and 6). As a result, the introduction efficiency of the unnatural amino acids was unexpectedly significantly higher compared to MmPylRS.
[0015] In addition, attempts were made to react a fluorescent substrate with TCO*-Lys introduced into a Fab antibody by click chemistry (Example 8). As a result, surprisingly, the binding reaction was almost complete in just 10 minutes. Since proteins have unstable properties, the fact that the reaction could be completed in a short time was an epoch-making result.
[0016] Also, attempts were made to introduce unnatural amino acids into proteins using an E. coli protein synthesis system with a vector having a MaPylRS gene under the control of a strong promoter (Examples 9 to 12). As a result, the introduction efficiency of the unnatural amino acids was unexpectedly significantly higher compared to MmPylRS.
[0017] That is, according to one aspect of the present invention, there is provided a method for producing a polypeptide containing an unnatural amino acid, the method comprising a step of contacting a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid, the method including an introduction step selected from: (a) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to the case of using a cell-free protein synthesis system using MmPylRS; or (b) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glnS promoter. By using this production method, a polypeptide containing an unnatural amino acid can be efficiently produced. Note that the glmS promoter and the glnS promoter (Plumbridge and Soll, Biochimie. 1987 May;69(5):539-41.) are promoters that do not correspond to high-expression promoters (non-high-expression promoters).
[0018] Also, according to one aspect of the present invention, there is provided a method for introducing an unnatural amino acid into a polypeptide, the method comprising a step of contacting a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid, the method including an introduction step selected from: (a) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to the case of using a cell-free protein synthesis system using MmPylRS; or (b) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glnS promoter. By using this introduction method, an unnatural amino acid can be efficiently introduced into a polypeptide.
[0019] According to one aspect of the present invention, there is provided a non-natural amino acid introduction system containing PylRS of organisms of the order Methanomassiliicoccales or the order Thermoplasmatales. By using this non-natural amino acid introduction system, a non-natural amino acid-containing polypeptide can be efficiently produced.
[0020] According to one aspect of the present invention, there is provided a reaction solution for a cell-free protein synthesis system containing PylRS of organisms of the order Methanomassiliicoccales or the order Thermoplasmatales. By using this reaction solution, a non-natural amino acid-containing polypeptide can be efficiently produced.
[0021] According to one aspect of the present invention, there is provided a method for producing a non-natural amino acid-containing polypeptide, which includes a step of contacting PylRS of organisms of the order Methanomassiliicoccales or the order Thermoplasmatales with a non-natural amino acid extracellularly. By using this production method, a non-natural amino acid-containing polypeptide can be efficiently produced.
[0022] According to one aspect of the present invention, there is provided a method for introducing a non-natural amino acid into a polypeptide, which includes a step of contacting PylRS of organisms of the order Methanomassiliicoccales or the order Thermoplasmatales with a non-natural amino acid extracellularly. By using this introduction method, a non-natural amino acid can be efficiently introduced into the polypeptide.
[0023] According to one aspect of the present invention, there is provided a method for producing tRNA bound to a non-natural amino acid, which includes a step of contacting PylRS of organisms of the order Methanomassiliicoccales or the order Thermoplasmatales with a non-natural amino acid and tRNA extracellularly. By using this production method, tRNA bound to a non-natural amino acid can be efficiently produced.
[0024] According to one aspect of the present invention, there is provided a purified PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. Using this PylRS, a polypeptide containing a non-natural amino acid can be efficiently produced.
[0025] According to one aspect of the present invention, there is provided a solution containing PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales at 5 mg / mL or more. Using this solution, a polypeptide containing a non-natural amino acid can be efficiently produced.
[0026] According to one aspect of the present invention, there is provided a polynucleotide encoding PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales and a high-expression promoter. Using this polynucleotide, a polypeptide containing a non-natural amino acid can be efficiently produced.
[0027] According to one aspect of the present invention, there is provided a method for producing a polypeptide containing a non-natural amino acid, which includes a step of highly expressing PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales in living cells. Using this production method, a polypeptide containing a non-natural amino acid can be efficiently produced.
Brief Description of the Drawings
[0028]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Figure 26
Figure 27
Figure 28
Figure 29
Mode for Carrying Out the Invention
[0029] Hereinafter, embodiments of the present invention will be described in detail. In order to avoid repetition and complexity for the same content, the description will be omitted as appropriate.
[0030] One embodiment of the present invention is a method for producing a novel non-natural amino acid-containing polypeptide. This production method includes, for example, a step of contacting a pyrrolysyl-tRNA synthetase (PylRS) of an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid. This production method preferably includes an introduction step selected from (a) a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared with the case of using a cell-free protein synthesis system using PylRS of Methanosarcina mazei (MmPylRS), or (b) a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared with the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glnS promoter. In this case, according to this production method, a non-natural amino acid-containing polypeptide can be produced with high efficiency. Note that the glmS promoter and the glnS promoter are promoters that do not correspond to high-expression promoters (non-high-expression promoters). Also, in one embodiment of the present invention, the introduction step includes, for example, a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared with the case of using MmPylRS as PylRS. In one embodiment of the present invention, the degree of "high efficiency" may be, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 5.0, 10.0, 20.0, 30.0, or 40.0 times, any value equal to or greater than those values, or within the range of any two of those values, as compared with the comparison target.
[0031] One embodiment of the present invention is a method for introducing a non-natural amino acid into a polypeptide, which includes a step of contacting PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with a non-natural amino acid, and includes an introduction step selected from: (a) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency compared to the case of using a cell-free protein synthesis system using MmPylRS, or (b) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency compared to the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of the glnS promoter. According to this method, a non-natural amino acid can be efficiently introduced into a polypeptide.
[0032] One embodiment of the present invention is a non-natural amino acid introduction system containing PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales. From the viewpoint of more efficiently introducing a non-natural amino acid into a protein, it preferably contains a high concentration of PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales.
[0033] One embodiment of the present invention is a reaction solution of a cell-free protein synthesis system containing PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales. This reaction solution can contain a high concentration of PylRS. Thereby, a non-natural amino acid-containing polypeptide can be produced with high efficiency.
[0034] One embodiment of the present invention is a method for producing a polypeptide containing an unnatural amino acid, which includes a step of contacting PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid extracellularly. This production method can be carried out using a reaction solution of a cell-free protein synthesis system. This reaction solution can contain a high concentration of PylRS. Thereby, a polypeptide containing an unnatural amino acid can be produced with high efficiency.
[0035] One embodiment of the present invention is a method for introducing an unnatural amino acid into a polypeptide, which includes a step of contacting PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid extracellularly. This introduction method can be carried out using a reaction solution of a cell-free protein synthesis system. This reaction solution can contain a high concentration of PylRS. Thereby, an unnatural amino acid can be efficiently introduced into a polypeptide.
[0036] One embodiment of the present invention is a method for producing tRNA bound with an unnatural amino acid, which includes a step of contacting PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales, an unnatural amino acid, and tRNA extracellularly. This production method can be carried out using a reaction solution of a cell-free protein synthesis system. Thereby, tRNA bound with an unnatural amino acid can be produced with high efficiency.
[0037] One embodiment of the present invention is purified PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales. By concentrating the solution containing this PylRS, a solution containing a high concentration of PylRS can be prepared. By using this solution in a cell-free protein synthesis system, a polypeptide containing an unnatural amino acid can be produced with high efficiency.
[0038] One embodiment of the present invention is a solution containing PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. This solution preferably contains 5 mg / mL or more of PylRS. In this case, by mixing this solution with a solution containing a non-natural amino acid or tRNA, etc., a reaction solution for a cell-free protein synthesis system can be produced. By using this solution in a cell-free protein synthesis system, a non-natural amino acid-containing polypeptide can be produced with high efficiency. In one embodiment of the present invention, the solution may contain, for example, a buffer, NaCl, or a reducing agent.
[0039] One embodiment of the present invention is an agent for introducing a non-natural amino acid into a polypeptide, which contains the above reaction solution or solution. By using this agent in a cell-free protein synthesis system, a non-natural amino acid can be efficiently introduced into a polypeptide.
[0040] One embodiment of the present invention is a polynucleotide encoding PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. This polynucleotide preferably encodes a high-expression promoter. In this case, by using this polynucleotide in a living cell protein synthesis system, a non-natural amino acid-containing polypeptide can be produced with high efficiency. The polynucleotide includes a vector. The high-expression promoter may be located upstream of PylRS. The high-expression promoter may be operably linked to control the expression of PylRS within the polynucleotide.
[0041] One embodiment of the present invention is a method for producing a polypeptide containing an unnatural amino acid, which includes a step of introducing the above polynucleotide into a cell or a step of expressing PylRS from the above polynucleotide. By using this production method in a cell-free protein synthesis system, a polypeptide containing an unnatural amino acid can be produced with high efficiency. This production method may include, for example, a step of ligating a polynucleotide to a vector, a step of introducing a polynucleotide encoding tRNA into a cell, a step of culturing the above cell, a step of evaluating the expression of PylRS, a step of evaluating the expression of a polypeptide containing an unnatural amino acid, or a step of purifying or isolating a polypeptide containing an unnatural amino acid. The vector may be, for example, an expression vector, a circular vector, or a plasmid.
[0042] One embodiment of the present invention is a cell containing a polynucleotide encoding PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales and a high-expression promoter. By using this cell in a cell-free protein synthesis system, a polypeptide containing an unnatural amino acid can be produced with high efficiency.
[0043] One embodiment of the present invention is a method for introducing an unnatural amino acid into a polypeptide, which includes a step of introducing the above polynucleotide into a cell or a step of expressing PylRS from the above polynucleotide. By using this production method in a cell-free protein synthesis system, an unnatural amino acid can be efficiently introduced into a polypeptide. This introduction method may include, for example, the same steps as those included in the above production method.
[0044] One embodiment of the present invention is an agent for introducing an unnatural amino acid into a polypeptide, which contains the above polynucleotide. By using this introducing agent in a cell-free protein synthesis system, an unnatural amino acid can be efficiently introduced into a polypeptide.
[0045] One embodiment of the present invention is a method for producing tRNA to which an unnatural amino acid is bound, including the step of introducing the above polynucleotide into a cell or the step of expressing PylRS from the above polynucleotide. By using this production method in a cell-free protein synthesis system, tRNA to which an unnatural amino acid is bound can be produced with high efficiency. This production method may include, for example, the step of introducing a polynucleotide encoding PylRS into a cell, the step of culturing the above cell, the step of evaluating the expression of PylRS, the step of evaluating the expression of tRNA, the step of evaluating the expression of a polypeptide containing an unnatural amino acid, or the step of purifying or isolating a polypeptide containing an unnatural amino acid.
[0046] One embodiment of the present invention is a method for producing a polypeptide containing an unnatural amino acid, including the step of highly expressing PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales in living cells. By using this production method in a cell-free protein synthesis system, a polypeptide containing an unnatural amino acid can be produced with high efficiency. The step of highly expressing may include, for example, the step of highly expressing PylRS by a highly expressing promoter.
[0047] In one embodiment of the present invention, the production method or the introduction method may be performed, for example, in an unnatural amino acid introduction system containing PylRS.
[0048] In one embodiment of the present invention, the non-natural amino acid introduction system may be, for example, a reaction solution of a cell-free protein synthesis system. In one embodiment of the present invention, the concentration of PylRS in the reaction solution may be, for example, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 120 μM, any value greater than those, or within the range of any two of those values. From the viewpoint of more efficiently introducing non-natural amino acids into proteins, 25 μM or more is preferable, 50 μM or more is more preferable, and 75 μM or more is even more preferable. The reaction solution may contain, for example, a polynucleotide encoding a gene having a stop codon at a position different from the natural type, tRNA, or a non-natural amino acid. The concentration of the polynucleotide encoding a gene having a stop codon at a position different from the natural type may be, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.5, 3.0, 4.0, 5.0, or 10.0 mg / mL, any value greater than those, or within the range of any two of those values. The position different from the natural type includes, for example, a position corresponding to the site of introduction of non-natural amino acids into the polypeptide. The position different from the natural type may be, for example, a position corresponding within the constant region of the antibody. The concentration of tRNA may be, for example, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 12.0, 14.0, 16.0, 18.0, or 20.0 μM, any value greater than those, or within the range of any two of those values. The concentration of the non-natural amino acid may be, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.5, 3.0, 4.0, 5.0, or 10.0 mM, any value greater than those, or within the range of any two of those values.The reaction solution may contain, for example, LMCPY mixture-PEG-DTT, tRNA, magnesium acetate, amino acid mixture, creatine kinase, RNA polymerase, chaperone enhanced S30 extract, buffer, template DNA, GSSG, DsbC, pH adjuster, or water. The concentrations of these components may be within ±40, ±30, ±20, ±10, or ±5% of the concentrations described in Table 2 below. The template DNA may be, for example, a nucleic acid containing a nonsense codon in the base sequence encoding the target protein for amino acid introduction. In one embodiment of the present invention, the cell-free protein synthesis system can utilize, for example, an Escherichia coli-derived cell-free protein synthesis system, a mammalian cell-derived cell-free protein synthesis system, an insect cell-derived cell-free protein synthesis system, a wheat germ-derived cell-free protein synthesis system, a reconstituted cell-free protein synthesis system, and the like.
[0049] In one embodiment of the present invention, the non-natural amino acid introduction system may be a cell of a living cell protein synthesis system. In one embodiment of the present invention, the cell may contain a polynucleotide encoding PylRS and a high-expression promoter. In one embodiment of the present invention, the high-expression promoter includes a promoter that highly expresses a polypeptide (e.g., PylRS). The high-expression promoter includes, for example, the glmS promoter and a promoter having a higher expression ability than the glmS promoter. The high-expression promoter that controls PylRS includes, for example, high-expression promoters derived from phages such as T3, T5, T7, SP6, etc., tac, trc, lac, lacUV5, araBAD, rhaBAD, SV40, CMV, CAG, SV40, EF-1α, TEF1, PGK1, HXT7, TPI1, TDH3, PYK1, ADH1, GAL1, GAL10, polyhedrin, p10, metallothionein, or Actin 5C. In the E. coli culture system, T3, T5, T7, SP6, tac, trc, lac, lacUV5, araBAD, or rhaBAD is preferable. In the mammalian cell culture system, SV40, CMV, CAG, SV40, or EF-1α is preferable. In the budding yeast (S. cerevisiae) culture system, TEF1, PGK1, HXT7, TPI1, TDH3, PYK1, ADH1, GAL1, or GAL10 is preferable. In the fission yeast (Schizosaccharomyces pombe) culture system, CMV is preferable. In the insect cell (e.g., cells of moths infected with baculovirus) culture system, polyhedrin or p10 is preferable. In the insect cell (e.g., Drosophila S2 cells) culture system, metallothionein or Actin 5C is preferable. The promoter that controls the high expression of tRNA includes, for example, U6, H1, 7SK, tRNA(Val), tRNA(Arg), tRNA(Tyr), lpp, or T5. In the mammalian cell culture system or the insect cell culture system, U6, H1, 7SK, tRNA(Val), tRNA(Arg), or tRNA(Tyr) is preferable. In the E. coli culture system, lpp or T5 is preferable.In one embodiment of the present invention, living cell protein synthesis systems can utilize, for example, bacteria such as Escherichia coli, mammalian cells, insect cells, yeast, and the like.
[0050] In one embodiment of the present invention, the unnatural amino acid introduction system is also applicable to an unnatural amino acid introduction system including a plurality of orthogonal systems.
[0051] In one embodiment of the present invention, a high concentration of PylRS in the reaction solution includes, for example, a concentration of 15 μM or more. This concentration may be, for example, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 120 μM, any value greater than these, or within the range of any two of these values. From the viewpoint of more efficiently introducing unnatural amino acids into proteins, 25 μM or more is preferable, 50 μM or more is more preferable, and 75 μM or more is even more preferable.
[0052] In one embodiment of the present invention, the production method may include a step of mixing a solution containing PylRS of organisms of the order Methanomassiliicoccales or Thermoplasmatales at 5 mg / mL or more with an unnatural amino acid to prepare a mixed solution. This mixed solution can contain a high concentration of PylRS. By using a mixed solution containing a high concentration of PylRS in a cell-free protein synthesis system, a polypeptide containing an unnatural amino acid can be produced with high efficiency.
[0053] In one embodiment of the present invention, a PylRS concentration in the solution of 5 mg / mL or more may be, for example, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 26, 27, 28, 29, or 30 mg / mL, any value greater than these, or within the range of any two of these values. When the above is 12.6 mg / mL or more, preparation in a cell-free protein synthesis system with particularly high efficiency is easy. From this viewpoint, 12.6 mg / mL or more is preferable, 15 mg / mL or more is more preferable, and 20 mg / mL or more is even more preferable.
[0054] In one embodiment of the present invention, a cell-free protein synthesis system includes a reaction solution containing a cell extract such as Escherichia coli prepared for cell-free protein synthesis, and a cell extract expressing PylRS, a crudely purified PylRS, or a purified PylRS added at a high concentration, or a synthesis system using a cell extract prepared from Escherichia coli or the like in which PylRS highly expressed for cell-free protein synthesis is used as the reaction solution.
[0055] In one embodiment of the present invention, a natural amino acid-containing polypeptide includes a polypeptide bound to a drug. The drug includes, for example, an anticancer agent.
[0056] In one embodiment of the present invention, PylRS includes a protein having an activity of binding an amino acid to tRNA. The amino acid includes, for example, pyrrolysine or a non-natural amino acid. In one embodiment of the present invention, the non-natural amino acid includes, for example, a lysine derivative, a tyrosine derivative, a phenylalanine derivative, a tryptophan derivative, an arginine derivative, a methionine derivative, a leucine derivative, a histidine derivative, a proline derivative, a cysteine derivative, a threonine derivative, a serine derivative, an alanine derivative, an isoleucine derivative, a valine derivative, a glutamine derivative, a glutamate derivative, an asparagine derivative, an aspartate derivative, a glycine derivative, a selenocysteine derivative, a pyrrolysine derivative, a kynurenine derivative, an ornithine derivative, a citrulline derivative, a canavanine derivative, diaminopimelic acid, or an α-hydroxy acid derivative of any of these. Unless otherwise specified, PylRS includes both wild-type PylRS and mutant PylRS.
[0057] Organisms of the order Methanomassiliicoccales and the order Thermoplasmatales form a single group and are distantly related to organisms of the genus Methanosarcina such as M. mazei and M. barkeri. The amino acid sequence of PylRS of organisms of the order Methanomassiliicoccales and the order Thermoplasmatales may have a structure in which the amino acid sequence on the N-terminal side is deleted when aligned with the amino acid sequence of PylRS of M. barkeri or M. mazei.
[0058] In one embodiment of the present invention, organisms of the order Methanomassiliicoccales include, for example, organisms of the genus Methanomethylophilus, Methanomassiliicoccus, and Methanoplasma. Organisms of the order Methanomassiliicoccales may also include organisms whose genus has not been classified. Organisms of the genus Methanomethylophilus include, for example, Methanomethylophilus alvus (M. alvus) (WP_015505008), or Methanomethylophilus sp. 1R26 (WP_058747239). Organisms of the genus Methanomassiliicoccus include, for example, Methanomassiliicoccus luminyensis (WP_019176308), or Methanomassiliicoccus intestinalis (WP_020448777). Organisms of the genus Methanoplasma include, for example, Methanoplasma termitum (WP_048111907). Organisms whose genus has not been classified include, for example, Methanomassiliicoccales archaeon RumEn M1 (KQM11560), Methanogenic archaeon ISO4-H5 (WP_066075773), or Methanogenic archaeon ISO4-G1 (AMK13702). The numbers in parentheses after the organism names indicate the NCBI accession numbers of PylRS.
[0059] In one embodiment of the present invention, organisms of the order Thermoplasmatales include, for example, organisms whose genus has not been classified. Examples of organisms whose genus has not been classified include, for example, Thermoplasmatales archaeon BRNA1 (WP_015492598).
[0060] An example of a phylogenetic tree of PylRS including organisms of the genus Methanomethylophilus or Methanomassiliicoccus is shown in FIG. 1. From the viewpoint of more efficiently introducing unnatural amino acids into proteins, M. alvus or Methanogenic archaeon ISO4-G1 is preferable. Methanomethylophilus alvus is generally sometimes referred to as Candidatus Methanomethylophilus alvus. Therefore, in the present specification, Methanomethylophilus alvus includes Candidatus Methanomethylophilus alvus. Also, with respect to other organisms (including genus, species, etc.), organisms corresponding to names including Candidatus are included in organisms indicated by names not including Candidatus. That is, an organism indicated by Candidatus X is included in an organism indicated by X.
[0061] In one embodiment of the present invention, MaPylRS includes, for example, a protein having an amino acid sequence represented by SEQ ID NO: 5. In one embodiment of the present invention, G1PylRS includes, for example, a protein having an amino acid sequence represented by SEQ ID NO: 10. When the amino acid sequences of MaPylRS and G1PylRS are aligned with the PylRS possessed by archaea such as M. barkeri and M. mazei, they have amino acid sequences with a deleted N-terminal region. An alignment using Clustal Omega is shown in Figure 2. The enclosed part is a region presumed to be a pyrrolysine-binding pocket. In one embodiment of the present invention, the amino acid sequence of PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales may have 70% or more identity with the amino acid sequence of MaPylRS. This value may be, for example, 70, 75, 80, 85, 90, 95, 97, 98, 99, or 100%, or within the range of any two of these values.
[0062] In one embodiment of the present invention, PylRS includes, for example, a PylRS having an amino acid sequence in which at least 50 amino acids on the N-terminal side are deleted when aligned with the PylRS of M. barkeri or M. mazei. This value may be 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 185, or within the range of any two of these values. From the viewpoint of more efficiently introducing unnatural amino acids into proteins, at least 110 amino acids are preferable, and at least 130 amino acids are more preferable. The alignment may be performed, for example, using Clustal Omega or BLAST of NCBI.
[0063] In one embodiment of the present invention, PylRS includes, for example, PylRS that binds to a non-natural amino acid in an amino acid binding pocket. The amino acids in the amino acid binding pocket include, for example, the amino acids at positions 96, 120, 121, 122, 125, 126, 129, 164, 166, 168, 170, 203, 204, 205, 206, 207, 221, 223, 227, 228, 233, 235, 239, 241, or 243 when aligned with MaPylRS. The amino acids in the amino acid binding pocket may include, for example, the amino acids at positions 95, 119, 120, 121, 124, 125, 128, 163, 165, 167, 169, 201, 202, 203, 204, 205, 219, 221, 225, 226, 231, 233, 237, 239, or 241 when aligned with ISO4-G1 PylRS. In one embodiment of the present invention, PylRS includes, for example, PylRS that binds to a non-natural amino acid (e.g., a lysine derivative) in an amino acid binding pocket.
[0064] In one embodiment of the present invention, the purified PylRS includes, for example, isolated PylRS. PylRS includes, for example, PylRS synthesized in a cell-free protein synthesis system and recombinant PylRS expressed in living cells. In one embodiment of the present invention, the cells include, for example, Escherichia coli or mammalian cells. In one embodiment of the present invention, the mammals include, for example, humans, rats, mice, rabbits, cows, and monkeys. The purified PylRS includes, for example, PylRS purified by a purification method such as HisTrap purification or gel filtration chromatography.
[0065] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having an amino acid sequence with 70% or more identity to the amino acid sequence of the native PylRS and having pyrrolysyl-tRNA synthetase activity. The identity may be, for example, 70, 75, 80, 85, 90, 95, 97, 98, 99, 99.5, or 99.9% or more, or within the range of any two of these values. The identity may be less than 100%. The identity may be calculated according to a method known in the art as the ratio of the number of identical amino acids in the amino acid sequences between two or more. Before calculating the ratio, the amino acid sequences of the amino acid sequence groups to be compared are aligned, and gaps are introduced into a part of the amino acid sequence if necessary to maximize the ratio of identical amino acids. Methods for alignment, methods for calculating the ratio, comparison methods, and computer programs related thereto are well known in the art (for example, BLAST, GENETYX, etc.). The identity can be represented by a value measured by BLAST of NCBI. For comparison of amino acid sequences, Blastp can be used with default settings. In this specification, mutant PylRS and PylRS mutant are synonymous.
[0066] In one aspect of the present invention, the pyrrolysyl-tRNA synthetase activity includes, for example, the activity of binding a non-natural amino acid to tRNA. The activity includes, for example, the activity of binding a non-natural amino acid to a suppressor tRNA. The activity includes, for example, the activity of introducing a non-natural amino acid into a protein.
[0067] In one embodiment of the present invention, the mutant PylRS has an amino acid sequence encoded by a polynucleotide that specifically hybridizes under stringent conditions to a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence encoding the amino acid sequence of the native PylRS, and includes a mutant PylRS having pyrrolysyl tRNA synthetase activity. As the stringent conditions, for example, the following conditions can be employed. (1) Use low ionic strength and high temperature for washing (for example, at 50°C, 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate), or (2) use a denaturing agent such as formamide during hybridization (for example, at 42°C, 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer at pH 6.5, and 750 mM sodium chloride, 75 mM sodium citrate). Note that the temperature during washing may be 50, 55, 60, or 65°C, or may be within the range of any two of these values. The washing time may be 5, 15, 30, 60, or 120 minutes, or longer. As factors affecting the stringency of the hybridization reaction, multiple factors such as temperature and salt concentration can be considered, and details can be referred to Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
[0068] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS that has a deletion, addition, insertion, or substitution of one or several amino acid residues with respect to the native PylRS and has pyrrolysyl tRNA synthetase activity. Several may be 2, 3, 4, 5, 6, 7, 8, 9, or 10, or may be within the range of any two of them. It is known that a polypeptide that has undergone a deletion, addition, insertion, or substitution of one or several amino acid residues maintains its biological activity (Mark et al., Proc Natl Acad Sci U S A. 1984 Sep;81(18):5662 - 5666., Zoller et al., Nucleic Acids Res. 1982 Oct 25;10(20):6487 - 6500., Wang et al., Science. 1984 Jun 29;224(4656):1431 - 1433.). The polypeptide with deletions or the like may be prepared, for example, by a site - directed mutagenesis method or a random mutagenesis method. As the site - directed mutagenesis method, for example, the PrimeSTAR mutagenesis kit (Takara Bio Inc.) may be used.
[0069] In one embodiment of the present invention, an amino acid includes an organic compound having an amino group and a carboxyl group. When a polypeptide according to an embodiment of the present invention includes a specific amino acid sequence, any amino acid in the amino acid sequence may form a salt or a solvate. Also, any amino acid in the amino acid sequence may be of the L - type or the D - type. Even in such cases, it can be said that the polypeptide according to the embodiment of the present invention includes a specific amino acid sequence.
[0070] In one embodiment of the present invention, the mutant PylRS includes a PylRS having a mutation in the amino acid - binding pocket. In one embodiment of the present invention, the mutant PylRS includes, for example, a PylRS that binds to a non - natural amino acid (for example, a lysine derivative) in the amino acid - binding pocket.
[0071] In one embodiment of the present invention, the mutant PylRS includes a PylRS having a mutation at position 96, 120, 121, 122, 125, 126, 128, 129, 164, 166, 168, 170, 203, 204, 205, 206, 207, 221, 223, 227, 228, 233, 235, 239, 241, or 243 when aligned with the native PylRS. These positions are considered to be locations where mutations are possible based on the results of mutagenesis experiments or crystal structure analysis. This mutation may be, for example, a mutation to A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V. This mutation is preferably a mutation to A, L, V, C, or F. Positions 126, 129, 168, and 206 before the mutation may be, for example, Y, M, V, and Y, respectively.
[0072] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having a higher efficiency of introducing non-natural amino acids into proteins compared to the native PylRS. In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having an activity of introducing TCO*Lys, pEtZLys, or pAzZLys into proteins.
[0073] One embodiment of the present invention is a composition for binding a non-natural amino acid and tRNA, which contains PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. This binding composition preferably contains PylRS at 5 mg / mL or more. In this case, by mixing this binding composition with a solution containing a non-natural amino acid or tRNA, etc., the non-natural amino acid and tRNA can be efficiently bound. If this binding composition is used for the synthesis of a non-natural amino acid-containing polypeptide, the non-natural amino acid-containing polypeptide can be efficiently produced. One embodiment of the present invention is the use of PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales for the production of a composition for binding a non-natural amino acid and tRNA. One embodiment of the present invention is a method for binding a non-natural amino acid and tRNA using PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales.
[0074] In one embodiment of the present invention, a method for introducing a non-natural amino acid into a polypeptide, a method for producing a non-natural amino acid-containing polypeptide, a method for binding a non-natural amino acid to tRNA, or a method for producing tRNA to which a non-natural amino acid is bound may include, for example, the following steps. (1) A step of contacting PylRS with a non-natural amino acid, (2) A step of contacting PylRS with tRNA, (3) A step of introducing PylRS, a nucleic acid encoding PylRS, or a non-natural amino acid into a solution, (4) A step of introducing tRNA or a nucleic acid encoding tRNA into a solution, (5) A step of contacting a polynucleotide encoding a gene having a stop codon at a position different from the natural type with tRNA, or (6) A step of expressing PylRS, tRNA, or a polynucleotide encoding a gene having a stop codon at a position different from the natural type in a living cell or a cell-free protein synthesis system in the presence of a non-natural amino acid. Further, it may include a step of concentrating a solution containing PylRS, or a step of mixing a concentrated PylRS solution with a non-natural amino acid. The tRNA includes, for example, a suppressor tRNA. The suppressor tRNA includes, for example, an amber suppressor tRNA. The tRNA includes, for example, tRNA of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales. Unless otherwise specified, the tRNA includes both natural type tRNA and mutant tRNA. The solution may contain, for example, a buffer, tRNA, a polynucleotide encoding a gene having a stop codon at a position different from the natural type, an amino acid mixture, template DNA, or RNA polymerase. The method for introducing a non-natural amino acid into a polypeptide, or the method for producing a non-natural amino acid-containing polypeptide may employ a cell-free protein synthesis method or a cell protein synthesis method.
[0075] In one embodiment of the present invention, the protein includes, for example, a functional protein or a structural protein. The functional protein includes, for example, an antibody or an enzyme. The protein may contain a natural type amino acid or a non-natural type amino acid. The site for introducing the non-natural amino acid may be, for example, within the constant region of the antibody.
[0076] In one embodiment of the present invention, the polypeptide includes, for example, a protein. The polypeptide includes those formed by the bonding of multiple amino acids. The number of amino acids in the polypeptide may be, for example, 10, 20, 30, 50, 70, 100, 200, 400, 500, 700, 1000, or 1500, any value greater than these, or within the range of any two of these values.
[0077] In one embodiment of the present invention, the lysine derivative includes, for example, the compound of FIG. 3. The unnatural amino acid includes, for example, the unnatural amino acids described in WO / 2017 / 030156. The unnatural amino acid includes, for example, amino acid derivatives. The phenylalanine derivative includes, for example, 3-iodo-L-phenylalanine. The tyrosine derivative includes, for example, o-propargyl-L-tyrosine.
[0078] One embodiment of the present invention is a composition. This composition includes, for example, a composition containing PylRS of organisms of the order Methanomassiliicoccales or Thermoplasmatales. The composition includes, for example, a composition for introducing an unnatural amino acid into a polypeptide or for producing an unnatural amino acid-containing polypeptide. The composition may, for example, contain an unnatural amino acid. The composition may, for example, contain a buffer, tRNA, template DNA, amino acid mixture, or RNA polymerase.
[0079] One embodiment of the present invention is a polypeptide having a non-natural amino acid. This polypeptide can be chemically modified by click chemistry. Click chemistry can utilize techniques such as Hou J et al., Expert Opin Drug Discov. 2012 Jun;7(6):489-501., Bonnet D et al., Bioconjug Chem. 2006 Nov-Dec;17(6):1618-23., etc. One embodiment of the present invention is a chemical modification product of a polypeptide having a non-natural amino acid. One embodiment of the present invention is a composition comprising a polypeptide having a non-natural amino acid or a chemical modification product thereof. The composition includes a pharmaceutical composition comprising one or more pharmaceutically acceptable carriers.
[0080] One embodiment of the present invention is a composition for a template for producing a mutant PylRS, which comprises a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales, or a nucleic acid encoding the PylRS. One embodiment of the present invention is a method for producing a mutant PylRS, which comprises a step of introducing a mutation into a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. Whether the PylRS into which the mutation has been introduced has pyrrolysyl-tRNA synthetase activity may be evaluated, for example, by a cell-free protein synthesis method or a cell-based protein synthesis method as described in the examples below. One embodiment of the present invention is a method for producing a polypeptide, which comprises a step of contacting a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales with an amino acid, and includes an introduction step selected from: (a) a step of introducing an amino acid into a polypeptide with high efficiency as compared with the case of using a cell-free protein synthesis system using MmPylRS; or (b) a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared with the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of a glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the above PylRS under the control of a glnS promoter. One embodiment of the present invention is an amino acid introduction system containing a high concentration of a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales. The amino acid introduction system may be, for example, a reaction solution of a cell-free protein synthesis system or a cell of a cell-based protein synthesis system. One embodiment of the present invention is a method for producing a polypeptide, which comprises a step of contacting a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales with an amino acid extracellularly. One embodiment of the present invention is a method for producing a polypeptide, which comprises a step of highly expressing a PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales in living cells.
[0081] All publications, gazettes (patents or patent applications) cited in this specification are hereby incorporated by reference in their entirety.
[0082] In this specification, "or" is used when "at least one or more" of the items listed in the text can be adopted. The same applies to "or else". When it is specified in this specification that it is "within the range of two values", the range includes the two values themselves. In this specification, "A to B" means A or more and B or less.
[0083] The embodiments of the present invention have been described above, but these are examples of the present invention, and various configurations other than the above can also be adopted. In addition, the configurations described in the above embodiments can also be adopted in combination.
Examples
[0084] The present invention will be further described below by way of examples, but the present invention is not limited thereto.
[0085] <Experimental Example 1> (1) Expression and purification of M. mazei PylRS After cloning the His6-SUMO-M. mazei PylRS structural gene into pET24, it was transformed into Escherichia coli BL21-Gold(DE3) and cultured in 1 L of LB medium at 37 °C. When OD600 = 0.7, 1 mM IPTG was added and cultured at 20 °C for 24 hours (the amino acid sequence of His6-SUMO-M. mazei PylRS is SEQ ID NO: 1). The cells were collected, purified by HisTrap, treated with SUMO protease, and then purified by HiTrap SP and Superdex 200 HiLoad16 / 60. 4.4 mg of M. mazei PylRS (2.82 mg / ml × 1.56 ml) was recovered from 1 L of the medium. As a result of concentrating the solution containing this MmPylRS, the concentration limit was 2.82 mg / mL.
[0086] <Example 1> 1.1 Expression and purification of M. alvus PylRS After cloning the PylRS (MaPylRS) structural gene (SEQ ID NO: 2) of Methanomethylophilus alvus into pET28, it was transformed into Escherichia coli BL21-Gold (DE3) and cultured at 37 °C in 1 L of LB medium. When OD 600 reached 0.6, 1 mM IPTG was added and cultured at 20 °C for 24 hours. The cells were collected and subjected to HisTrap purification, thrombin treatment, HiTrapQ, Hitrap Heparin, and Superdex 200 purification, and approximately 100 mg of MaPylRS was recovered from 1 L of the medium. This recovery amount was higher than that of the conventional archaeal PylRS. When the PylRS of the genus Methanosarcina was expressed in Escherichia coli, the recovery amount was small because PylRS was prone to precipitation and difficult to purify. In addition, as a result of concentrating the solution containing this MaPylRS, the concentration limit was 20 mg / mL or higher.
[0087] <Example 2> 2.1 Comparison of the synthesis amounts of non-natural amino acid-introduced proteins using MaPylRS and MmPylRS in the cell-free protein synthesis method The compositions of the reaction solution and the external dialysis solution were in accordance with Table 1.
Table 1
[0088] tRNA Pyl was tRNA derived from M. mazei Pyl and tRNA derived from M. alvus Pyl (base sequence: SEQ ID NO: 3) were used respectively. As PylRS, the native types derived from M. mazei and M. alvus were used respectively (the amino acid sequence of MmPylRS is SEQ ID NO: 4, and the amino acid sequence of MaPylRS is SEQ ID NO: 5). The non-natural amino acid was N ε -(tert-butyloxycarbonyl)-L-lysine (BOCLys) (Bachem) and N ε-Propargyloxycarbonyl-L-lysine (PocLys) (SciChem) was used. As the template DNA for introducing unnatural amino acids, pN11GFPS1sh-A17Amb was used, and for control synthesis, pN11GFPS1sh was used. The synthesis reaction was carried out by dialyzing 30 μL of the reaction solution against 1 mL of the external dialysis solution at 25 °C overnight. After synthesis, the reaction solution corresponding to 1 μL was diluted approximately 200-fold, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of standard GFPS1 at 1 mg / mL and expressed as a ratio to the control normal synthesis.
[0089] As a result, as shown in Fig. 4, the introduction of unnatural amino acids using PylRS was confirmed. In the case of BOCLys introduction, the amount of protein synthesis with MaPylRS was more than twice that with MmPylRS, and a protein equivalent to the control normal synthesis (WT) could be synthesized. In the case of PocLys introduction, the amount of protein synthesis with MaPylRS was very large, and an amount almost equivalent to the control could be synthesized. Therefore, it was clarified that unnatural proteins can be efficiently prepared by using MaPylRS.
[0090] <Example 3> 3.1 Concentration dependence of native PylRS in cell-free protein synthesis In the introduction of TCO*Lys, the concentration dependence when using native PylRS was evaluated. The compositions of the reaction solution and the external dialysis solution were according to Table 1. The tRNA Pyl used was tRNA Pyl from M. alvus. As PylRS, native PylRS from M. alvus was used.
[0091] The upper limit of the amount of PylRS that can be added to the reaction solution is the total amount obtained by applying the liquid volume of water (Milli-Q water) to PylRS. Since the concentration limit of MaPylRS is 20 mg / mL or higher, it could be added at a final concentration of 80 μM or higher. In this experiment, it was used in the range of 10 μM to 75 μM. In the case of MmPylRS, on the other hand, since the concentration limit is 4 mg / mL or lower, the maximum addable concentration is approximately 10 μM.
[0092] The unnatural amino acid TCO*Lys was used. The template DNA pN11GFPS1sh-A17Amb was used. The synthesis reaction was carried out by dialyzing 30 μL of the reaction solution against 1 mL of the external solution at 25°C overnight. The reaction solution after synthesis was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.
[0093] As a result, as shown in Figure 5, it was confirmed that the amount of protein synthesis increased at concentrations exceeding 10 μM, and at 75 μM PylRS, it increased by approximately 2.3 times compared to 10 μM PylRS.
[0094] <Example 4> 4.1 Crystal Structure Analysis of MaPylRS When the MaPylRS recovered in Example 1 was subjected to crystallization screening, crystals appeared under conditions using PEG as a precipitant. Diffraction data with a resolution of 2.2 Å (space group C2) were obtained at the Taiwan beamline (TPS05A), and after molecular replacement with the MmPylRS structure, structure refinement was performed (R f / R w=(28.8 / 22.8). The catalytic domain had a structure similar to that of M. mazei, but the inclination of the two α-helices at the N-terminus was different from that of M. mazei. Since Tyr206 (Phe384) did not enter into the pocket and bent around several residues around Tyr206 facing inward, the active site pocket was widely open. The shape of the active site pocket of MaPylRS was slightly different from that of MmPylRS, and the depth of the pocket seemed to be slightly narrower. Based on the structure, the preparation of PylRS mutants and the experiment of introducing unnatural amino acids were carried out.
[0095] The left side of Fig. 6 shows the superimposed structure of the monomer of the MmPylRS catalytic domain / pyrolyl-AMP complex (MmPylRSc / Pyl-AMP, gray) and the dimer of MaPylRS (apo form, green and blue). The right side of Fig. 6 shows an enlarged view of the active site in the superimposed structure of MmPylRSc and MaPylRS (apo form). In addition, the introduced amino acid residues, the corresponding amino acid residues in M. mazei, and Asn346 / Asn166 necessary for the recognition of the carbonyl group of pyrrolysine are shown.
[0096] <Example 5> 5.1 Evaluation of MaPylRS Mutants Introduced Based on the Structure Analysis Results Using PylRS with the mutation site determined based on the structure analysis results, the introduction of unnatural amino acids was evaluated. The compositions of the reaction solution and the external dialysis solution were in accordance with Table 1. tRNA Pyl was tRNA derived from M. alvus PylIt was used at 10 μM. MaPylRS is a PylRS(Y126A / M129A / H227I / Y228P) and PylRS((Y126A / M129L / H227I / Y228P) in which a new mutation (H227I / Y228P) derived from the structural analysis results was added to the conventional PylRS(Y126A / M129A) variant or PylRS(Y126A / M129L) variant. PylRS was used at 10 μM. Non-natural amino acids ZLys, mAzZLys, pEtZLys and TCO*Lys were used. The template DNA was pN11GFPS1sh-A17Amb. The synthesis reaction was carried out by dialyzing 30 μL of the reaction solution overnight at 25°C against 1 mL of the external solution. The reaction solution after synthesis was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of standard GFPS1 at 1 mg / mL.
[0097] As a result, as shown in Figure 7, by introducing the (H227I / Y228P) mutation into the PylRS(Y126A / M129A) variant, the protein synthesis amount significantly increased in all non-natural amino acids. In particular, for ZLys, mAzZLys and TCO*Lys, the synthesis amount reached the same level as that of the WT. By introducing the (H227I / Y228P) mutation, an increase of about 3-fold for ZLys, about 1.5-fold for mAzZLys, about 1.6-fold for pEtZLys, and about 9-fold for TCO*Lys was confirmed.
[0098] Next, the (H227I / Y228P) mutation was also introduced into the PylRS(Y126A / M129L) variant, which was effective for the introduction of TCO*Lys. The synthesis amount reached the same level as that of the WT, similar to the PylRS(Y126A / M129A) variant, and increased by about 4-fold. Therefore, it was suggested that the (H227I / Y228P) mutation might be effective for various variants.
[0099] <Example 6> 6.1 PylRS Concentration Dependence of Non-Natural Amino Acid Introduction Using PylRS Variants in the Cell-Free Protein Synthesis Method The compositions of the reaction solution and the external dialysis solution conformed to Table 1 above. At this time, PylRS used a PylRS mutant. The final concentration of the PylRS mutant was confirmed between 5 μM and 75 μM. Water (Milli-Q water) was changed according to the change in the liquid volume associated with the change in the PylRS mutant concentration.
[0100] tRNA Pyl was tRNA derived from M. mazei Pyl and tRNA derived from M. alvus Pyl were each used. As the PylRS mutants, MmPylRS (Y306A / Y384F / R61K) and MaPylRS (Y126A / M129L) were each used. MmPylRS (Y306A / Y384F / R61K) is a mutant with high activity against large lysine derivatives such as ZLys derivatives among MaPylRS mutants (Yanagisawa et al., Chem Biol. 2008 Nov 24;15(11):1187-97.). The unnatural amino acid was N ε -((((E)-cyclooct-2-en-1-yl)oxy)carbonyl)-L-lysine (TCO*-Lys) (SciChem), N ε -(p-ethynylbenzyloxycarbonyl)-L-lysine (pEtZLys) (Sundia / Namiki), N ε -(p-azidobenzyloxycarbonyl)-L-lysine (pAzZLys) (Sundia / Namiki) was used. As the template DNA for introducing the unnatural amino acid, pN11GFPS1sh-A17Amb was used, and as the control template DNA, pN11GFPS1sh was used. The protein synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The synthesized reaction solution was diluted approximately 200-fold with 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of the synthesized GFPS1 protein was quantified based on the fluorescence value of the standard GFPS1 at 1 mg / mL.
[0101] The upper limit of the amount of PylRS mutant that can be added to the reaction solution is the total amount obtained by applying the liquid volume of water (Milli-Q water) to PylRS. Since the concentration limit of the MmPylRS mutant is 4 mg / mL or less, a maximum of about 10 μM can be added. Since the concentration limit of the MaPylRS mutant is 20 mg / mL or more, 80 μM or more can be added.
[0102] As a result of the above, as shown in Figures 8 and 9, it was confirmed that the amount of protein synthesis increased by using a high concentration of the MaPylRS mutant. The results of introducing the unnatural amino acid TCO*-Lys, which is promising for click chemistry reactions, are shown in Figure 8. At a PylRS mutant concentration of 10 μM, M. mazei was able to synthesize about 0.25 mg / mL of the GFPS1 protein, and M. alvus was able to synthesize about 0.83 mg / mL. On the other hand, in M. alvus, synthesis was possible at a PylRS mutant concentration of 75 μM, and 3 mg / mL of protein, which is equal to or more than that of the control normal synthesis (WT) at 50 μM, could be synthesized. This is more than 10 times the synthesis using the MmPylRS mutant. Therefore, it became clear that by using a high concentration of the MaPylRS mutant, it is possible to efficiently prepare a protein into which TCO*-Lys has been introduced.
[0103] Figure 9 shows the results when pEtZLys and pAzZLys, which have lower introduction efficiencies than TCO*-Lys, were used. When the PylRS concentration was 10 μM, the amount of protein synthesis was low in both M. mazei and M. alvus. On the other hand, in the MaPylRS mutant, the amount of protein synthesis increased in a concentration-dependent manner. When the PylRS mutant concentration was increased to 75 μM, the amount of protein synthesis with pEtZLys introduction increased to about 0.5 mg / mL, which is about 2.5 times that at the time of 10 μM addition. In the case of pAzZLys introduction, it increased to about 2 mg / mL, which is about 4.6 times, and was close to the WT synthesis amount of normal synthesis. Therefore, it became clear that by using the MaPylRS mutant at a high concentration, the amount of protein synthesis can be increased in pEtZLys and pAzZLys, which have low introduction efficiencies.
[0104] <Example 7> 7.1 Introduction of ZLys unnatural amino acid using MaPylRS mutants in cell-free protein synthesis method The compositions of the reaction solution and the external dialysis solution were according to Table 1 above. At this time, PylRS mutants were used for PylRS. tRNA Pyl derived from M. alvus was used for tRNA Pyl . Mutants of PylRS derived from M. alvus shown in Figure 10 were used for the PylRS mutants. The unnatural amino acid used was N ε -benzyloxycarbonyl-L-lysine (ZLys) (Bachem). The template DNA for introducing the unnatural amino acid was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The synthesized reaction solution was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1 and expressed as a ratio to the normal synthesis of the control.
[0105] The results of examining the synthesis amount of ZLys-introduced protein are shown in Figure 10. As a result of introducing mutations at positions 126, 129, 168, and 206 in the amino acid pocket of MaPylRS, the synthesis amount showed 40% or more compared to the control. In particular, Y126A / M129A and Y126A / V168C showed a high synthesis amount. From the above results, it became clear that mutants suitable for ZLys introduction can be created.
[0106] 7.2 Introduction of mAzZLys unnatural amino acid using MaPylRS mutants in cell-free protein synthesis method The compositions of the reaction solution and the external dialysis solution were according to Table 1 above. At this time, PylRS mutants were used for PylRS. tRNA Pyl derived from M. alvus was used for tRNA Pyl . Mutants of PylRS derived from M. alvus shown in Figure 11 were used for the PylRS mutants. The unnatural amino acid used was N ε-(m-azidobenzyloxycarbonyl)-L-lysine (mAzZLys) (manufactured by Sundia / Namiki) was used. As the template DNA for introducing unnatural amino acids, pN11GFPS1sh-A17Amb was used, and as the control template DNA, pN11GFPS1sh was used. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. After synthesis, the reaction solution corresponding to 1 μL was diluted approximately 200-fold, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL of standard GFPS1 and expressed as a ratio to the normal synthesis of the control.
[0107] The results of examining the synthesis amount of the mAzZLys-introduced protein are shown in Fig. 11. As a result of introducing mutations at positions 126, 129, and 168 in the amino acid pocket of MaPylRS, at least 65% or more of the synthesis amount compared to the control was shown. From the above results, it became clear that it is possible to create mutants suitable for introducing mAzZLys.
[0108] <Example 8> 8.1 Preparation of a TCO*-Lys unnatural amino acid-introduced Fab antibody using MaPylRS mutants Cell-free protein synthesis for introducing the unnatural amino acid TCO*-Lys, which is promising for click chemistry reaction, into the L chain of Herceptin Fab antibody was carried out with the compositions of the reaction solution and the external dialysis solution shown in Table 2 below.
Table 2
[0109] tRNA Pyl is tRNA derived from M. mazei Pyl and tRNA derived from M. alvus Pyl were used respectively. As the PylRS mutants, the MmPylRS(Y306A / Y384F / R61K) mutant and the MaPylRS(Y126A / M129L) mutant were used respectively. The tRNA that can be added in this system PylSince the maximum liquid volume of PylRS is 460 μL, the addition amount of each was as follows: for tRNA of M. mazei Pyl and the PylRS mutant, it was 6.5 μM each; for tRNA derived from M. alvus Pyl it was 10 μM, and for the PylRS mutant it was 50 μM. As the template DNA, pN11TVGS_Her-H for the Herceptin Fab H chain and pN11TVGS_Her-L-S203Amb having a codon for the non-natural amino acid introduction site at amino acid number 203 for the Herceptin Fab L chain were used. The protein synthesis reaction was carried out by dialyzing 5 mL of the reaction solution against 50 mL of the dialysis external solution at 25°C overnight. The synthesized reaction solution was subjected to tag cleavage and purification treatment. Click chemistry was carried out by mixing with 10-fold amount of TAMRA-tetrazine and reacting at 25°C for 10 minutes and 30 minutes.
[0110] As a result, as shown in Fig. 12, the synthesis amount of the TCO*-Lys-introduced Herceptin Fab dimer per 1 mL of the cell-free protein synthesis reaction solution was 1.7 mg when M. alvus was used. This was 20 times the amount when M. mazei was used.
[0111] The results of binding the fluorescent substrate TAMRA to the introduced TCO*-Lys by click chemistry are shown in Figs. 13 and 14. TCO*-Lys had high reactivity, and the binding reaction was almost completed within 10 minutes. In the synthesis using M. alvus, the electrophoresis image of the L chain after click chemistry shifted to the high molecular weight side and showed strong fluorescence intensity. On the other hand, in the synthesis using M. mazei, the proportion that shifted to the high molecular weight side was 1 / 2 of that of M. alvus, and the fluorescence intensity was about 1 / 3. Since the fluorescence intensity per protein amount in the electrophoresis image was 1.5 times higher for M. alvus, combined with Fig. 12, it became clear that it was possible to prepare a Fab antibody into which 30 times the amount of TCO*-Lys was introduced by the synthesis using M. alvus.
[0112] Therefore, by using a high-concentration MaPylRS variant, it became possible to prepare a Fab antibody into which TCO*-Lys was introduced more efficiently than before. In addition, the introduction of TCO*-Lys enabled highly reactive click chemistry.
[0113] <Example 9> 9.1 Comparison of the efficiency of introducing unnatural amino acids by M. mazei, M. alvus, and D. hafniense PylRS in an E. coli expression system As the unnatural amino acids (ncAA), BocLys and AlocLys (Bachem) were used. As the PylRS genes (wild type), MaPylS (M. alvus PylRS gene), MmPylS (M. mazei PylRS gene), and DhPylS (D. hafniense PylRSc gene) were used. The tRNA Pyl gene was MaPylT (M. alvus tRNA Pyl ), MmPylT (M. mazei tRNA Pyl ), and DhPylT (D. hafniense tRNA Pyl ). At this time, the PylRS gene and the tRNA Pyl gene were used in combination with those from the same bacterium. As E. coli, BL21-Gold(DE3) was used. As the plasmid, the pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA Pyl ) was used. As the plasmid for protein expression, pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, with the third Ser from the N-terminus mutated to an amber codon) was used.
[0114] After transforming Escherichia coli BL21-Gold(DE3) with pBT5 series and pACYC-GST-GFP(amber3), the cells were cultured at 25 °C for 24 hours in 2 ml or 0.2 ml of 2 x YT autoinduction medium containing 1 mM unnatural amino acids (BocLys, AlocLys). At this time, PylRS was highly expressed by the T5 promoter (SEQ ID NO: 6) of the pBT5 series. 10 μl of the E. coli culture solution was added to 0.19 ml of PBS on a 96-well microplate for dilution, and fluorescence was measured at 485 / 510 nm using a SpectraMAX i3 plate reader (molecular devices), and the fluorescence value was compared by conversion based on the absorption at 600 nm.
[0115] The results are shown in Fig. 15. In the figure, -ncAA means the condition without unnatural amino acids. When DhPylS was used, no fluorescence was detected. When MmPylS was used, fluorescence was detected, and the introduction efficiency was 9% for BocLys. On the other hand, when MaPylS was used, the highest fluorescence value was shown, and the introduction efficiencies of BocLys and AlocLys were 57% and 64%, respectively. In the high-expression system of PylRS, the introduction efficiency of BocLys when using PylRS of M. alvus was 6 times that of M. mazei, and the introduction efficiency of AlocLys was 14 times that of M. mazei. In addition, the growth of E. coli with highly expressed MmPylRS was deteriorated, while the growth of E. coli with highly expressed MaPylRS was not deteriorated.
[0116] <Example 10> 10.1 Analysis of wild-type GST-GFP fusion protein (3Ser) and amber mutant GST-GFP fusion protein Wild-type GST-GFP or GST-GFP(amber3) was expressed in 5 ml of medium in the presence of 1 mM BocLys. After harvesting the cells, they were disrupted with Bugbuster Master Mix reagent (Merck Millipore), the protein was purified with GST SpinTrap (GE Healthcare), and stained with SDS-PAGE and Simplyblue safe stain. Gel pieces were excised, digested with Trypsin / Lys-C Mix, Mass Spec grade (Promega) at 37 °C for one day and night, purified with His SpinTrap TALON, eluted with 4% acetonitrile containing 0.1% TFA, and then subjected to MALDI-TOF MS analysis.
[0117] The results are shown in Figure 16. The GST-GFP product obtained using MaPylRS was 59 mg (wild-type GST-GFP was 106 mg) and was proportional to the fluorescence value. MALDI-TOF analysis after trypsin digestion confirmed that BocLys was introduced at the 3rd residue of the 1-12 peptide (MNXSSHHHHHHR) (peak 2), and that it was Ser in the wild type (peak 1). (Peak 3 is the decomposition of BocLys to Lys by acid treatment (TFA), and * is the peak derived from the product with the starting Met removed).
[0118] <Example 11> 11.1 Site-specific introduction of unnatural amino acids into proteins using MaPylRS in an E. coli expression system For unnatural amino acids (ncAA), BocLys, AlocLys, DBocLys (Bachem), and PocLys (SynChem) were used. For PylRS, MaPylRS and MmPylRS (R61K / G131E / Y384F) (BocLysRS2) were used. tRNA Pyl derived from M. alvus and that of M. mazei were used respectively. At this time, PylRS and tRNA Pyl derived from the same bacterium were used in combination. BL21-Gold(DE3) was used as the E. coli. The plasmid was the pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA Pyl) was used. The plasmid for protein expression used was pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, with the 3rd Ser from the N-terminus mutated to an amber codon).
[0119] After transforming Escherichia coli BL21-Gold(DE3) with pBT5 series (pBR322 as a control) and pACYC-GST-GFP(amber3), it was cultured at 25 °C for 24 hours in 2 ml or 0.2 ml of 2 x YT autoinduction medium containing 1 mM unnatural amino acid. At this time, PylRS was highly expressed by the T5 promoter of the pBT5 series. 10 μl of the Escherichia coli culture solution was added to 0.19 ml of PBS on a 96-well microplate for dilution, and fluorescence measurement was performed at 485 / 510 nm with a SpectraMAX i3 plate reader, and it was converted by the absorption at 600 nm.
[0120] The results are shown in Fig. 17. In the figure, -ncAA means the condition without unnatural amino acid. In the high-expression system of PylRS, when MaPylRS was used, BocLys, DBocLys, AlocLys, and PocLys could be introduced more efficiently than when MmPylRS(R61K / G131E / Y384F) was used. It should be noted that the growth of Escherichia coli with high expression of the MmPylRS mutant deteriorated, while the growth of Escherichia coli with high expression of MaPylRS did not deteriorate.
[0121] <Example 12> 12.1 Site-specific introduction of ZLys-based unnatural amino acids into proteins using MaPylRS mutants in an Escherichia coli expression system The unnatural amino acids used were ZLys (Watanabe Chemical), oClZLys, pNO2ZLys (Bachem), pTmdZLys, oAzZLys, mAzZLys, oEtZLys, AmAzZLys, AzNO2ZLys (Shinsei Chemical). The MaPylRS mutants used were Y126A / M129L, Y126A / M129L / Y206F. The MmPylRS mutant used was Y306A / Y384F. tRNA PylThose derived from M. alvus and M. mazei were used respectively. At this time, PylRS and tRNA Pyl derived from the same bacterium were used in combination. BL21-Gold(DE3) was used as the E. coli. The plasmids used were the pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA Pyl ). The plasmid for protein expression used was pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, with the third Ser from the N-terminus mutated to the amber codon).
[0122] After transforming E. coli BL21-Gold(DE3) with the pBT5 series (pBR322 as a control) and pACYC-GST-GFP(amber3), the cells were cultured in 2 ml or 0.2 ml of 2 x YT autoinduction medium containing 1 mM unnatural amino acid at 25 °C for 24 hours. At this time, PylRS was highly expressed by the T5 promoter of the pBT5 series. 10 μl of the E. coli culture solution was added to 0.19 ml of PBS on a 96-well microplate for dilution, and fluorescence measurement was performed at 485 / 510 nm using a SpectraMAX i3 plate reader. The absorbance at 600 nm was used for conversion, and the fluorescence values were compared with the fluorescence of wild-type GST-GFPwt set as 1.
[0123] The results are shown in Fig. 18. In the figure, -ncAA means the condition without unnatural amino acid. In the high-expression system of PylRS, all ZLys derivatives could be introduced. The introduction efficiency was the highest for MaPylRS(Y126A / M129L). In particular, MaPylRS(Y126A / M129L) had a higher introduction efficiency than MmPylRS(Y306A / Y384F) (3 - 18 times). It should be noted that the growth of E. coli with high expression of the MmPylRS mutant was deteriorated, while the growth of E. coli with high expression of the MaPylRS mutant was not deteriorated.
[0124] <Example 13> 13.1 Confirmation of PylRS concentration dependence in the wheat germ cell-free protein synthesis method To confirm the effectiveness of increasing the concentration of M. alvus PylRS in the eukaryotic protein synthesis system, an introduction test of TCO*Lys was conducted using the Premium PLUS Expression Kit (Cell-Free Science Co., Ltd.) of the wheat germ cell-free protein synthesis method.
[0125] tRNA Pyl was tRNA derived from M. mazei Pyl and tRNA derived from M. alvus Pyl were used. The PylRS mutants used were PylRS (Y306A / Y384F / R61K) derived from M. mazei and PylRS (Y126A / M129L) derived from M. alvus, which were added to the reaction solution in the range of 10 μM to 50 μM. The unnatural amino acid used was TCO*Lys at a final concentration of 1 mM. The template DNA for introducing the unnatural amino acid was pEU-E01-GFPS1sh-A17Amb. The synthesis reaction was carried out at 15°C for 20 hours by overlaying 206 μL of the substrate solution on approximately 20 μL of the translation reaction solution. 20 μL of the synthesized mixture was diluted approximately 10-fold, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of standard GFPS1 at 1 mg / mL.
[0126] As a result, as shown in Figure 19, it was confirmed that the amount of protein synthesis increased at a concentration exceeding 10 μM PylRS and increased approximately 7.2-fold at 50 μM PylRS. Therefore, the effectiveness of increasing the concentration of M. alvus PylRS in the eukaryotic protein synthesis system was confirmed.
[0127] <Example 14> 14.1 Confirmation of PylRS Concentration Dependency in the Human Cell-Free Protein Synthesis Method To confirm the effectiveness of M. alvus PylRS in the protein synthesis system derived from human cells, which is particularly useful among eukaryotes, an introduction test of TCO*Lys was conducted using the Human Cell-Free Protein Expression Maxi System (TAKARA) of the human cell-free protein synthesis method.
[0128] tRNA Pyl was the tRNA derived from M. alvus Pyl was used. The PylRS variant used was PylRS (Y126A / M129L) derived from M. alvus, which was added to the reaction solution in the range of 10 μM to 50 μM. The unnatural amino acid used was TCO*Lys at a final concentration of 1 mM. The template DNA for introducing the unnatural amino acid was pN11GFPS1sh-A17Amb. The synthesis reaction was carried out at 32 °C for 20 hours by dialyzing 30 μL of the reaction solution against 350 μL of the external reaction solution. 20 μL of the synthesized mixture was diluted approximately 10-fold, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of the synthesized GFPS1 protein was quantified based on the fluorescence value of the standard GFPS1 at 1 mg / mL.
[0129] As a result, as shown in Figure 20, as the PylRS concentration increased, the amount of protein synthesis increased, and it was confirmed that the amount increased by about 1.8-fold at 50 μM PylRS. Therefore, the effectiveness of increasing the concentration of M. alvus PylRS in the human cell-free protein synthesis system was confirmed. Also, since the effectiveness was shown by the cell-free protein synthesis method, the effectiveness in the human cell expression system using the same transcription-translation system was confirmed.
[0130] <Example 15> 15.1 Confirmation Test for AcLys Introduction Using M. alvus PylRS, the introduction of the unnatural amino acid N ε -acetyl-L-lysine (AcLys) was confirmed.
[0131] The compositions of the reaction solution and the external dialysis solution were in accordance with Table 1 above. At this time, tRNA Pyl was the tRNA derived from M. alvus Pyl, The PylRS variants were PylRS:AcLysRS3(121V / 125I / 126F / 129A / 168F) and AcLysRS3-IP(121V / 125I / 126F / 129A / 168F / 227I / 228P) derived from M. alvus, and 10 μM of them were added to the reaction solution. AcLys was used at a final concentration of 1 mM. The template DNA for introducing the unnatural amino acid was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was carried out by dialyzing overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The reaction solution after synthesis was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of the synthesized GFPS1 protein was quantified based on the fluorescence value of the standard GFPS1 at 1 mg / mL.
[0132] As a result, as shown in Figure 21, it was confirmed that AcLys could be introduced by using the M. alvus PylRS variant.
[0133] <Example 16> 16.1 Confirmation test for the introduction of Phe derivatives Using M. alvus PylRS, the introduction of 3-iodo-L-Phenylalanine (IPhe), a Phenylalanine (Phe) derivative, was confirmed.
[0134] The compositions of the reaction solution and the external dialysis solution were in accordance with Table 1 above. At this time, the tRNA Pyl was tRNA derived from M. alvus Pyl, The PylRS variants were PylRS(166A / 168A) and PylRS(166A / 168A / 227I / 228P) from M. alvus, which were added to the reaction solution at 10 μM, and IPhe was used at a final concentration of 1 mM. The template DNA for non-natural amino acid introduction was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. Also, since there are reported examples of introducing Phenylalanine itself as a variant for the Phe derivative, the synthesis without adding IPhe was also confirmed. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The reaction solution after synthesis was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of the standard GFPS1 at 1 mg / mL.
[0135] As a result, as shown in Fig. 22, it was confirmed that IPhe could be introduced by using the M. alvus PylRS variant. Therefore, it was confirmed that the M. alvus PylRS variant is effective for the Phe derivative.
[0136] <Example 17> 17.1 Confirmation test for the introduction of Tyr derivative Using M. alvus PylRS, the introduction of o-propargyl-L-tyrosine (oPgTyr), a Tyrosine (Tyr) derivative, was confirmed.
[0137] The composition of the reaction solution and the external dialysis solution was in accordance with Table 1 above. At this time, tRNA Pyl was tRNA from M. alvus Pyl, 10 μM of PylRS (166A / 168A) from M. alvus was added to the reaction solution for the PylRS variant, and oPgTyr was used at a final concentration of 1 mM. The template DNA for non-natural amino acid introduction was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The reaction solution after synthesis was diluted approximately 200-fold with 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of the synthesized GFPS1 protein was quantified based on the fluorescence value of the standard GFPS1 at 1 mg / mL.
[0138] As a result, as shown in Fig. 23, it was confirmed that oPgTyr could be introduced by using the M. alvus PylRS variant. Therefore, it was confirmed that the M. alvus PylRS variant is effective for Tyr derivatives.
[0139] <Example 18> 18.1 Confirmation test of PylRS from Methanogenic archaeon ISO4-G1 The PylRS (G1PylRS) of Methanogenic archaeon ISO4-G1, a methane-producing archaeon, was evaluated. The DNA sequence used for synthesis was that of ISO4-G1's PylRS: ATGGTAGTCAAATTCACTGACAGCCAAATCCAACATCTGATGGAGTATGGTGATAATGATTGGAGCGAGGCAGAATTTGAGGACGCTGCTGCTCGTGATAAAGAGTTTTCAAGCCAATTCTCCAAGTTGAAGAGTGCGAACGACAAAGGATTGAAAGACGTCATTGCGAACCCGCGTAATGACCTGACCGACCTTGAAAATAAGATTCGTGAGAAACTTGCTGCACGCGGTTTCATCGAAGTGCATACGCCTATTTTTGTATCTAAGAGTGCATTAGCCAAGATGACAATCACCGAGGATCATCCTTTATTCAAGCAGGTCTTCTGGATCGACGACAAACGTGCCTTGCGTCCAATGCATGCGATGAATCTTTATAAGGTAATGCGCGAGTTGCGCGATCACACAAAGGGACCAGTCAAGATCTTCGAGATTGGCTCGTGCTTCCGCAAGGAAAGCAAGTCATCGACGCATTTGGAAGAATTCACTATGCTGAACTTAGTTGAGATGGGACCCGATGGCGACCCTATGGAGCACCTTAAGATGTATATTGGAGACATCATGGACGCGGTTGGTGTAGAATACACCACCTCACGTGAGGAGTCTGATGTGTACGTAGAGACACTTGACGTGGAGATCAATGGAACTGAAGTTGCGTCAGGAGCAGTAGGTCCTCATAAGCTTGACCCTGCCCACGATGTGCATGAACCCTGGGCAGGAATCGGATTCGGACTGGAGCGTCTGTTGATGCTTAAGAACGGTAAATCGAATGCTCGTAAGACAGGCAAAAGTATCACCTATTTGAATGGTTACAAATTGGAT (SEQ ID NO: 7), and tRNA Pylis GGAGGGCGCTCCGGCGAGCAAACGGGTCTCTAAAACCTGTAAGCGGGGTTCGACCCCCCGGCCTTTCGCCA (SEQ ID NO: 8). The tRNA of ISO4-G1 Pyl The RNA sequence of is GGAGGGCGCUCCGGCGAGCAAACGGGUCUCUAAAACCUGUAAGCGGGGUUCGACCCCCCGGCCUUUCGCCA (SEQ ID NO: 9).
[0140] The tRNA of ISO4-G1 was added to the reaction solution of the Escherichia coli cell-free protein synthesis system Pyl and PylRS at 10 μM each, and BocLys or PocLys was added at 1 mM. The template DNA for non-natural amino acid introduction was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution against 30 μL of the reaction solution. The synthesized reaction solution was diluted approximately 200-fold with 1 μL equivalent, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of standard GFPS1 at 1 mg / mL.
[0141] As a result, as shown in Fig. 24, protein synthesis by efficient introduction of non-natural amino acids was confirmed using PylRS of ISO4-G1. Fig. 25 shows the results of comparing the synthesis amount with respect to the control with PylRS of M. mazei and M. alvus. From these results, it was confirmed that ISO4-G1 PylRS was effective. It was a surprising result that G1PylRS showed such excellent introduction efficiency in the cell-free protein synthesis system.
[0142] <Example 19> 19.1 Confirmation test of Methanogenic archaeon ISO4-G1 PylRS mutants Using PylRS(Y125A / M128A) and PylRS(Y125A / M128L) as variants of Methanogenic archaeon ISO4-G1 PylRS, the introduction of unnatural amino acids was confirmed. The unnatural amino acids ZLys, TCO*Lys, BCNLys, pETZLys, and pAzZLys were confirmed. In the reaction solution of the Escherichia coli cell-free protein synthesis system, tRNA of ISO4-G1 Pyl and each PylRS variant were added at 10 μM, and the unnatural amino acid was added at 1 mM. The template DNA for the introduction of unnatural amino acids was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was carried out by dialysis overnight at 25 °C with 1 mL of the external dialysis solution for 30 μL of the reaction solution. The synthesized reaction solution was diluted approximately 200-fold for 1 μL equivalent, and the fluorescence value was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of standard GFPS1 at 1 mg / mL.
[0143] As a result, as shown in Fig. 26, protein synthesis by efficient introduction of unnatural amino acids was confirmed using the PylRS variant of ISO4-G1. Fig. 27 shows the result of comparing the synthesis amount with respect to the control with the PylRS variant of M. mazei. From this result, it was confirmed that the ISO4-G1 PylRS variant is effective.
[0144] <Example 20> 20.1 Confirmation test of Methanogenic archaeon ISO4-G1 concentration dependence in cell-free protein synthesis method Methanogenic archaeon ISO4-G1 PylRS and PylRS variants have a high concentration limit similar to that of M. alvus PylRS and can be used at high concentrations. Therefore, the concentration dependence when using PylRS(Y125A / M128L) of the Methanogenic archaeon ISO4-G1 PylRS variant was confirmed for pEtZLys, which did not reach 100% of the control synthesis amount in Fig. 27. The compositions of the reaction solution and the external dialysis solution were according to Table 1.
[0145] The methanogenic archaeon ISO4-G1 PylRS(Y125A / M128L) was used in the range of 10 μM to 75 μM. The tRNA of ISO4-G1 Pyl at 10 μM and the unnatural amino acid pEtZLys at 1 mM were added. The template DNA used was pN11GFPS1sh-A17Amb. The synthesis reaction was carried out by dialyzing 30 μL of the reaction solution against 1 mL of the external solution at 25°C overnight. After synthesis, 1 μL equivalent of the reaction solution was diluted approximately 200-fold, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.
[0146] As a result, as shown in Figure 28, it was confirmed that the protein synthesis amount increased at concentrations exceeding 10 μM and increased approximately 6.8-fold with 75 μM PylRS. From this result, it was confirmed that the ISO4-G1 PylRS mutant is effective for use at high concentrations.
[0147] <Example 21> 21.1 Introduction of mAzZLys into Proteins in Animal Cells The M. alvus PylRS mutant (Y126A / M129L / H227I / Y228P) and M. alvus tRNA Pyl or the Methanogenic archaeon ISO4-G1 PylRS mutant (Y125A / M128L) and ISO4-G1 tRNA Pyl were highly expressed in animal cells (HEK293c18 cells) using the system described in a non-patent document (Mukai, et al., Biochem. Biophys. Res. Commun. Vol. 371, pp. 818-822 (2008)). For the protein, a mutant gene with an amber codon introduced into the coding region of its gene (T137 or N157) and its expression system were used.
[0148] The results are shown in Fig. 29. In all cases, it was confirmed that non-natural amino acids were introduced into the protein. In this experiment, although the experiment was conducted with 1 copy instead of 9 copies for each tRNA gene, it was possible to synthesize a protein into which a non-natural amino acid was introduced. From the above experiments, it was shown that a high-expression system of M. alvus PylRS mutant (Y126A / M129L / H227I / Y228P) or Methanogenic archaeon ISO4-G1 PylRS mutant (Y125A / M128L) is effective for the specific introduction of mAzZLys into a desired site in animal cells.
[0149] As described above, the present invention has been described based on the examples. It is understood by those skilled in the art that these examples are merely illustrative, that various modifications are possible, and that such modifications are also within the scope of the present invention.
Claims
1. A method for producing a polypeptide containing an unnatural amino acid, comprising the step of contacting a pyrrolysyl-tRNA synthetase (PylRS) of an organism of the order Methanomassiliicoccales or Thermoplasmatales with an unnatural amino acid, wherein: the introduction step is (a) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to using a cell-free protein synthesis system using PylRS of Methanosarcina mazei (MmPylRS), or (b) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency compared to using an Escherichia coli protein synthesis system using a vector having the gene of the PylRS under the control of the glmS promoter and using an Escherichia coli protein synthesis system using a vector having the gene of the PylRS under the control of the glnS promoter;
2. The production method according to claim 1, wherein the introduction step is a step of introducing an unnatural amino acid into a polypeptide with an efficiency 1.5 times or more higher than when using MmPylRS as PylRS.
3. The production method according to claim 1 or 2, wherein the contact is carried out in an unnatural amino acid introduction system containing a high concentration of the PylRS.
4. The production method according to claim 3, wherein the unnatural amino acid introduction system is a reaction solution of a cell-free protein synthesis system, and the introduction step is the step of (a).
5. The production method according to claim 4, wherein the reaction solution contains 15 μM or more of PylRS.
6. The production method according to claim 4 or 5, wherein the reaction solution contains a polynucleotide encoding a gene having a stop codon at a position different from the natural type.
7. The production method according to any one of claims 1 to 6, comprising the step of mixing a solution containing 5 mg / mL or more of the PylRS with an unnatural amino acid to prepare a mixed solution, and the introduction step is the step of (a).
8. The production method according to claim 3, wherein the unnatural amino acid introduction system is a cell of a living cell protein synthesis system, and the introduction step is the step of (b).
9. The production method according to claim 8, wherein the cell contains a polynucleotide encoding MaPylRS and a high-expression promoter.
10. The production method according to any one of claims 1 to 9, wherein the PylRS is a PylRS of an organism belonging to the genus Methanomethylophilus, the genus Methanomassiliicoccus, or the genus Methanoplasma, or a PylRS of Methanomassiliicoccales archaeon RumEn M1, Methanogenic archaeon ISO4-H5, Methanogenic archaeon ISO4-G1, or Thermoplasmatales archaeon BRNA1.
11. The production method according to any one of claims 1 to 9, wherein the PylRS is a PylRS of an organism belonging to the genus Methanomethylophilus.
12. The production method according to any one of claims 1 to 11, wherein the PylRS has an amino acid sequence in which at least 50 amino acids on the N-terminal side are deleted when aligned with the PylRS of Methanosarcina mazei.
13. The production method according to any one of claims 1 to 11, wherein the PylRS is the PylRS of Methanomethylophilus alvus (MaPylRS).
14. The production method according to any one of claims 1 to 10, wherein the PylRS is the PylRS of Methanogenic archaeon ISO4-G1 (G1PylRS).
15. The production method according to any one of claims 1 to 14, wherein the unnatural amino acid is a lysine derivative, tyrosine derivative, phenylalanine derivative, tryptophan derivative, arginine derivative, methionine derivative, leucine derivative, histidine derivative, proline derivative, cysteine derivative, threonine derivative, serine derivative, alanine derivative, isoleucine derivative, valine derivative, glutamine derivative, glutamate derivative, asparagine derivative, aspartate derivative, glycine derivative, selenocysteine derivative, pyrrolysine derivative, kynurenine derivative, ornithine derivative, citrulline derivative, canavanine derivative, diaminopimelic acid, or an α-hydroxy acid derivative of any of these.
16. The production method according to any one of claims 1 to 15, wherein the PylRS is a natural or mutant PylRS.
17. The method for production according to any one of claims 1 to 16, wherein the non-natural amino acid-containing polypeptide is bound to a drug.
18. A method for introducing a non-natural amino acid into a polypeptide, comprising a step of contacting PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with a non-natural amino acid, comprising an introduction step selected from: (a) a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared to the case of using a cell-free protein synthesis system using MmPylRS, or (b) a step of introducing a non-natural amino acid into a polypeptide with high efficiency as compared to the case of using an Escherichia coli protein synthesis system using a vector having the gene of the PylRS under the control of the glmS promoter and the case of using an Escherichia coli protein synthesis system using a vector having the gene of the PylRS under the control of the glnS promoter.
19. A non-natural amino acid introduction system containing PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales at a high concentration.
20. The non-natural amino acid introduction system according to claim 19, which is a reaction solution of a cell-free protein synthesis system.
21. The non-natural amino acid introduction system according to claim 20, wherein the reaction solution contains PylRS at 15 μM or more.
22. The non-natural amino acid introduction system according to claim 20 or 21, wherein the reaction solution contains a polynucleotide encoding a gene having a stop codon at a position different from the natural type.
23. The non-natural amino acid introduction system according to claim 19, which is a cell of a cell-based protein synthesis system.
24. The non-natural amino acid introduction system according to claim 23, wherein the cell contains a polynucleotide encoding MaPylRS and a high-expression promoter.
25. The non-natural amino acid introduction system according to any one of claims 19 to 24, wherein the PylRS is a natural type or a mutant type PylRS.
26. A reaction solution of a cell-free protein synthesis system containing PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales.
27. The reaction solution according to claim 26, which contains a polynucleotide encoding a gene having a stop codon at a position different from the natural type.
28. A method for producing a polypeptide containing an unnatural amino acid, comprising the step of contacting a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid extracellularly.
29. The production method according to claim 28, wherein the efficiency of introducing an unnatural amino acid is higher than that when using a cell-free protein synthesis system using MmPylRS.
30. The production method according to claim 28 or 29, wherein the PylRS is a wild-type or mutant PylRS.
31. A method for introducing an unnatural amino acid into a polypeptide, comprising the step of contacting a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales with an unnatural amino acid extracellularly.
32. A method for producing a tRNA bound with an unnatural amino acid, comprising the step of contacting a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales, an unnatural amino acid, and a tRNA extracellularly.
33. A purified PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales.
34. A solution containing a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales at 5 mg / mL or more.
35. The solution according to claim 34, wherein the PylRS is a wild-type or mutant PylRS.
36. A method for producing a polypeptide containing an unnatural amino acid, comprising the step of mixing the solution according to any one of claims 34 or 35 with an unnatural amino acid to prepare a mixed solution.
37. The method for producing a polypeptide containing an unnatural amino acid according to claim 36, wherein the mixed solution is a reaction solution of a cell-free protein synthesis system.
38. A method for introducing an unnatural amino acid into a polypeptide, comprising the step of adding the solution according to any one of claims 34 or 35 to a reaction solution of a cell-free protein synthesis system.
39. An agent for introducing an unnatural amino acid into a polypeptide, comprising the solution according to any one of claims 34 or 35.
40. A method for producing a tRNA bound with an unnatural amino acid, comprising the step of adding the solution according to any one of claims 34 or 35 to a reaction solution of a cell-free protein synthesis system.
41. A polynucleotide encoding a PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales and a high-expression promoter.
42. The polynucleotide according to claim 41, wherein the PylRS is a native or mutant PylRS.
43. A cell containing the polynucleotide according to claim 41 or 42.
44. A method for producing a non-natural amino acid-containing polypeptide, comprising the step of introducing the polynucleotide according to claim 41 or 42 into a cell, or the step of expressing PylRS from the polynucleotide according to claim 40 or 41.
45. A method for introducing a non-natural amino acid into a polypeptide, comprising the step of introducing the polynucleotide according to claim 41 or 42 into a cell, or the step of expressing PylRS from the polynucleotide according to claim 40 or 41.
46. An agent for introducing a non-natural amino acid into a polypeptide, comprising the polynucleotide according to claim 41 or 42.
47. A method for producing a tRNA to which a non-natural amino acid is bound, comprising the step of introducing the polynucleotide according to claim 41 or 42 into a cell, or the step of expressing PylRS from the polynucleotide according to claim 40 or 41.
48. A method for producing a non-natural amino acid-containing polypeptide, comprising the step of highly expressing PylRS of an organism of the order Methanomassiliicoccales or the order Thermoplasmatales in a living cell.
Citation Information
Patent Citations
A monocharge system for selectively introducing non-natural amino acids into proteins using an in vitro protein synthesis system.
JP2012514979A
amino acid derivative
JP2016534099A
Mutant pyrrolysyl-trna synthetase, and method for production of protein having non-natural amino acid integrated therein by using the same
WO2009038195A1
Use of DNA gyrase inhibitors for in vitro polypeptide synthesis reactions
WO2010083148A1
Process for production of non-natural protein having ester bond therein
WO2009066761A1