Gene expression enhancer
A gene expression enhancer from ancient anaerobically deposited marine soil enhances BMP4, VEGF, and β-catenin gene expression in dermal papilla cells, addressing the lack of specificity in existing hair growth agents and promoting hair growth effectively.
Patent Information
- Application Number
- JP2023221706
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2025-07-09
AI Technical Summary
Existing hair growth agents, including those derived from humus soil, lack specificity in enhancing the expression of genes that promote hair matrix cell differentiation, growth, and proliferation, such as BMP4, VEGF, and β-catenin in dermal papilla cells.
A gene expression enhancer is developed from soil collected under anaerobic conditions over 300,000 years ago, containing a soil-derived extract that enhances the expression of BMP4, VEGF, and β-catenin genes in dermal papilla cells, utilizing a soil-derived extract with specific sugar chain nutrients and humic acid, and having an average molecular weight of 500 to 1000.
The enhancer safely and effectively promotes hair differentiation and growth by enhancing gene expression in dermal papilla cells, with minimal side effects, and is available in various forms for oral or parenteral use.
Smart Images

Figure 2025103944000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a gene expression enhancer that enhances (activates) the expression of the BMP4 gene, VEGF gene, KGF gene, or β-catenin gene in dermal papilla cells.
Background Art
[0002] Conventionally, the demand for hair growth agents that improve thin hair or hair loss has been high, and various hair growth agents have been researched and developed. On the other hand, it is known that humus soil has various effects such as antibacterial and bactericidal effects, virus inactivation effects, antioxidant effects, antiseptic effects, body purification effects, fat decomposition effects, alcohol decomposition effects, surfactant effects, cholesterol decomposition effects, etc. For example, Patent Document 1 and Patent Document 2 disclose that a humus soil extract extracted from this humus soil is effective for hair growth.
Prior Art Documents
Patent Documents
[0003]
Patent Document 1
Patent Document 2
Summary of the Invention
Problems to be Solved by the Invention
[0004] However, even if it is generally referred to as humus soil, there are various types from different ages. Also, various mechanisms of hair growth can be considered. The present invention has been made in view of such circumstances, and an object of the present invention is to provide a gene expression enhancer capable of enhancing (activating) the expression of the BMP4 gene, VEGF gene, KGF gene, or β-catenin gene in dermal papilla cells, which is effective for promoting the differentiation, growth, and proliferation of hair matrix cells that contribute to hair growth.
Means for Solving the Problems
[0005] The gene expression enhancer according to the present invention that meets the above object is extracted from soil collected from a stratum formed by the deposition of marine plants and marine animals under anaerobic conditions more than 300,000 years ago, and contains a soil-derived extract that enhances the expression of any one or more of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene in dermal papilla cells.
[0006] Here, the stratum formed by the deposition of marine plants and marine animals under anaerobic conditions more than 300,000 years ago is, for example, a stratum formed when a part of the sea isolated by the uplift of the ground or the like more than 300,000 years ago was covered by debris flow and / or volcanic ash, and the marine plants and marine animals in the covered sea repeatedly fermented and decomposed. Specifically, soil collected from the stratum 3 to 80 m underground in the Isahaya area of Nagasaki Prefecture (known as Shialmarin) is preferably used, but it is not limited thereto. Also, the soil may be collected from a stratum 100 million years ago as long as it was deposited under anaerobic conditions and there has been no ashing of organic matter.
[0007] In the gene expression enhancer according to the present invention, it is preferable that the soil-derived extract is obtained by extracting water-soluble substances contained in the soil. Here, as the extraction solvent, an aqueous solvent such as water, hydrous ethanol, or ethanol can be used. Also, the obtained soil-derived extract may be in a liquid state or may be a dry powder obtained by freeze-drying or the like. Note that one type of the soil-derived extract (soil-derived extract = Shialmarin extract (Shialmarin is a registered trademark)) is a sugar chain nutrient extract, and a specific example thereof is Noguchi Catalyzer 21 (Catalyzer and Noguchi Catalyzer 21 are registered trademarks) manufactured and sold by the applicant of this application.
[0008] In the gene expression enhancer according to the present invention, it is preferable that the average molecular weight of the active substance contained in the soil-derived extract is 500 to 1000.
[0009] In the gene expression enhancer according to the present invention, it is preferable that the soil-derived extract contains natural sugar chain nutrients in addition to humic acid. Here, as the sugar chain nutrients, it is particularly preferable that all eight monosaccharides constituting the human sugar chain are included. Specifically, it is preferable that the eight monosaccharides of glucose, galactose, xylose, mannose, N-acetylglucosamine, N-acetylgalactosamine, fucose, and N-acetylneuraminic acid (sialic acid) are included. Furthermore, in the gene expression enhancer according to the present invention, in addition to the eight sugar chain nutrients, it is preferable that two monosaccharides of rhamnose and arabinose are included.
[0010] As described above, the gene expression enhancer according to the present invention contains a soil-derived extract having an action of enhancing (activating) the expression of any one or more of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene in dermal papilla cells. Specifically, it can be used as an enhancer for the BMP4 gene expression in dermal papilla cells, an enhancer for the VEGF gene expression in dermal papilla cells, an enhancer for the KGF gene expression in dermal papilla cells, or an enhancer for the β-catenin gene expression in dermal papilla cells.
[0011] In addition, the gene expression enhancer according to the present invention can be used as an oral preparation or a parenteral preparation (for example, an external preparation, an injection). Further, as its form, it can be used in various forms such as powdery, granular, tablet, capsule, liquid, gel, etc.
Effects of the Invention
[0012] The gene expression enhancer according to the present invention can enhance the expression of any one or more of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene in dermal papilla cells, and thereby can act on dermal papilla cells safely and effectively with few side effects to promote hair differentiation and growth.
[0013] In the gene expression enhancer according to the present invention, when the soil-derived extract is obtained by extracting water-soluble substances contained in the soil, it is excellent in safety and mass productivity.
[0014] In the gene expression enhancer according to the present invention, when the average molecular weight of the active substance contained in the soil-derived extract is 500 to 1000, it contains a large amount of cell adhesion enhancing components. Correspondingly, the expression enhancement of each of the BMP4 gene, VEGF gene, KGF gene and β-catenin gene is expected, and the promoting effect on hair differentiation and growth is strengthened.
[0015] In the gene expression enhancer according to the present invention, when the soil-derived extract contains natural sugar chain nutrients in addition to humic acid, the BMP4 gene, VEGF gene, KGF gene or β-catenin gene is activated due to the effect of maintaining cell health and improving immunity, and the hair growth effect is enhanced.
Brief Description of Drawings
[0016]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Modes for Carrying Out the Invention
[0017] Next, with reference to the attached drawings, embodiments of the present invention will be described to facilitate understanding of the present invention. As shown in FIG. 1, when dermal papilla cells are stimulated and activated, various proteins such as BMP4, VEGF, KGF, and β-catenin are produced and secreted, thereby promoting the proliferation and activation of the dermal papilla cells themselves, and further promoting the activation of the entire hair follicle including hair matrix cells and keratinocytes, resulting in hair growth. Therefore, focusing on the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene, which are considered to be effective in promoting the differentiation, growth, and proliferation of hair matrix cells, a gene expression enhancer according to an embodiment of the present invention was developed.
[0018] The gene expression enhancer according to an embodiment of the present invention contains a soil-derived extract extracted from soil collected from a stratum (3 to 80 m underground) formed by the deposition of marine plants and marine animals (fish, shellfish, seaweeds, moss, etc.) under anaerobic conditions more than 300,000 years ago. In addition to humic acids (humic acid and fulvic acid), the above soil-derived extract contains natural sugar chain nutrients. The soil-derived extract is a solution obtained by extracting water-soluble substances from the pulverized and micronized soil, and impurities have been removed. It is preferable that the soil-derived extract is sterilized. This soil-derived extract has the effect of enhancing the expression of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene in dermal papilla cells. In particular, the active substances with an average molecular weight of 500 to 1000 contained in the soil-derived extract contain many components that enhance cell adhesion ability, and enhanced expression of each of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene is expected. Therefore, by applying a gene expression enhancer containing this soil-derived extract to dermal papilla cells, the differentiation and growth of hair can be promoted.
Examples
[0019] Next, the experiments conducted to confirm the effects of the present invention will be described. <Preparation of Soil-derived Extract> One kind of soil-derived extract, Noguchi Catalyzer 21 (manufactured by Noguchi General Institute Co., Ltd., sugar chain nutrient extract), was used and neutralized with sodium hydroxide, and the supernatant was used as a sample (gene expression enhancer).
[0020] <Cell Culture> Cell culture was performed using human hair follicle dermal papilla cells (HFDPC, Takara Bio Inc.). HFDPC was cultured in a basal medium (Supplement Mix, PromoCell) supplemented with 4% fetal bovine serum, 0.4% bovine pituitary extract, 1 ng / mL basic fibroblast growth factor, and 5 μg / mL insulin. The cells were maintained in a humidified incubator at 37°C and 5% CO2. Before treatment with the gene expression enhancer, to minimize the effects of serum and growth supplements, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 1% fetal bovine serum (FBS, Gibco) and 1 ng / mL basic fibroblast growth factor (bFGF, Merck), and the cells were cultured for 24 hours.
[0021] <Cell Viability Assay> The effect of the gene expression enhancer on the viability of HFDPC was examined using the WST-1 assay (Tongrentang Research Institute), the luminescence ATP detection assay, and a cell counter (Countess3 Automated Cell Counter, Thermo Fisher Scientific Inc.) according to the manufacturer's protocol. HFDPC (3×104 cells / well) was seeded in a 96-well plate and treated with various concentrations of the gene expression enhancer in RPMI medium containing 5% FBS. For the examination, the production amounts of reduced nicotinamide adenine dinucleotide (NADH) and ATP were measured. The production amount of NADH was measured by the WST-1 assay. The absorbance was read at 450 nm using a microplate reader. The measurement of ATP was performed by lysing the cells and inhibiting ATP synthesis with a detergent solution. The luminescence due to the ATP / luciferin reaction was measured.
[0022] <Quantitative Real-time PCR> To examine the effect of the gene expression enhancer on the expression of survival-related genes in HFDPC, real-time PCR was used. Cells were seeded in 6-well plates (1.5×105 cells / well) and cultured for 3 days and 6 days. After culturing for 24 hours in RPMI medium supplemented with 5% FBS, the gene expression enhancer was treated for 3 days and 6 days, and untreated cells were used as controls. Total RNA was extracted using the High Pure RNA Isolation Kit (Roche Molecular Systems Inc.), and cDNA was synthesized according to the manufacturer's protocol using Rever Tra Ace (registered trademark) qPCR RT Master Mix (Toyobo Co., Ltd.) and a thermocycler (R&D Systems). Briefly, total RNA (1 μg) from each sample was reverse-transcribed in 20 μl using 0.5 μg Oligo dT and 200 U Super Script (registered trademark) II RT (Thermo Fisher Scientific K.K.). Amplification was performed in a total volume of 20 μl containing 0.5 μM of each primer, 4 mM MgCl2, 3 μl LightCycler (registered trademark) FastStart DNA Master SYBR Green I (Roche Molecular Systems Inc.), and 2 μl of 1:10 diluted complementary DNA (cDNA). Quantification of unknown samples was performed using LightCycler Relative Quantification Software version 3.3 (Roche Molecular Systems Inc.). In each experiment, the GAPDH housekeeping gene was amplified as a reference standard. Primers for GAPDH were designed. GAPDH(f): GGGCCAAAAGGGTCATCATC; GAPDH(r): ATGACCTTGCCCACAGCCTT. The other target gene primers are as follows.VEGF(f): GTGGTTGCCCTTCTACTTTGC; VEGF(r): GAGGACTCCAGCCACAAAGATG; BMP4(f): CAGCTTCATATAACCCCAGGGAC; BMP4(r): GCTAGGTGGTCATTCAGGTAGG; KGF(f): TGTCACAGAGGGGCTACGAG; KGF(r): GAGCGATGTTGTCCACCAGG; β-catenin(f): GTTTACATTGTTCAGGACCTCATGG; β-catenin(r): TCGGTA AGAAAGCCAGTGTGGT. The reaction solution was prepared in duplicate and heated at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 20 seconds. All PCR reactions were performed in duplicate. Standard curves (cycle threshold vs. template concentration) were generated for each target gene and the endogenous reference gene (GAPDH) in each sample. To confirm the specificity of the PCR reaction, the PCR products were electrophoresed on a 1.2% agarose gel.
[0023] <Results and Discussion> When the cell proliferation ability of dermal papilla cells was tested, an approximately 160% increase in the number of cells was observed at concentrations of 1%, 2%, 5%, and 10% of the gene expression enhancer compared to the absence of the gene expression enhancer (Figure 2). Since the increase in the proliferation rate of dermal papilla cells results in a relative increase in the secretion of dermal papilla cell secretions, it is considered to greatly contribute to hair growth and hair maintenance.
[0024] Next, the expression of the growth factor BMP4 was confirmed by real-time PCR. When 30% of the gene expression enhancer was added, the expression level increased by approximately 3-fold compared to the absence of the gene expression enhancer (Figure 3). For BMP4, it is known to promote cell differentiation and proliferation and regulate various cell functions.
[0025] Next, the expression of VEGF was similarly confirmed. When the mRNA expression levels of cells cultured with the addition of gene expression enhancers at concentrations of 0% (no addition), 1%, 10%, 20%, and 30% were confirmed, an increase dependent on the concentration of the gene expression enhancer was observed. In particular, when the gene expression enhancer was added at 30%, the expression level increased up to about 7-fold compared to when no gene expression enhancer was added (Figure 4). VEGF mainly binds as a ligand to vascular endothelial growth factor receptor (VEGFR) on the surface of vascular endothelial cells, and has the function of stimulating cell division, migration, and differentiation, or enhancing the vascular permeability of microvessels. In addition, dermal papilla cells play an important role in the progression of the hair cycle, and since VEGF is thought to be involved in maintaining the anagen phase, it can be said that the gene expression enhancer has the function of maintaining the anagen phase of hair.
[0026] Also, the expression of KGF was similarly confirmed. When the mRNA expression levels of cells cultured with the addition of gene expression enhancers at concentrations of 0%, 1%, 10%, 20%, and 30% were confirmed, an increase dependent on the concentration of the gene expression enhancer was observed. In particular, when the gene expression enhancer was added at 30%, the expression level increased by about 3.5-fold compared to when no gene expression enhancer was added (Figure 5). KGF (keratinocyte growth factor. Also known as human oligopeptide-5, FGF-7) is involved in the anagen phase of the hair cycle and activates keratinocytes themselves. Due to aging and other causes, when it becomes difficult to produce KGF by oneself, keratinocytes stop working, leading to hair growth failure, thinning hair, and hair loss. However, it is thought that the gene expression enhancer can promote the anagen phase of the hair cycle. Thus, it became clear that the gene expression enhancer has the effect of promoting the main signal pathways related to hair differentiation and promotion in dermal papilla cells.
[0027] When the gene expression level of β-catenin was confirmed, a concentration-dependent increase was observed for the addition of gene expression enhancers at concentrations of 0%, 1%, 10%, 20%, and 30%. In particular, when the gene expression enhancer was added at 30%, the expression level increased by about 1.7-fold compared to when no gene expression enhancer was added (Figure 6). Therefore, the gene expression enhancer is expected to enhance the AKT / β-catenin signaling pathway.
[0028] <Fractionation of Adhesion-Enhancing Substances in Gene Expression Enhancers> As a sample, the above-mentioned soil was pulverized and micronized, and the water-soluble substances contained therein were dissolved (extracted) in ultrapure water. After neutralizing the soil-derived extract to around pH 7, a gene expression enhancer sterilized with a 0.4-μm filter was used. Fractionation of the sample was performed using dialysis or an ultrafiltration membrane. The specific procedure is as follows. For fractions below 2k, the flow-through fraction after 3k fractionation with a UF membrane was used for fractionation by dialysis. For fractions from 3k to 2k, the MQ during dialysis for fractions below 2k was recovered, fractionated, and then concentrated using an evaporator before use. For fractions below 1k, the flow-through fraction after 3k fractionation with a UF membrane was used for fractionation with a UF membrane. For fractions from 2k to 1k, the flow-through fraction after 2k fractionation with a UF membrane was used and fractionated with a 1k UF membrane. For the fractionation of 1k - 500, the flow-through fraction of the 1k UF membrane was used and a 500 dialysis membrane was used. For fractions below 500, the MQ during dialysis obtained by dialysis was recovered, fractionated, and then concentrated using an evaporator.
[0029] Human hair follicle dermal papilla cells (HFDPC) were used as cells and seeded at a density of 1.9×10 4 cells / well. They were cultured in a basal medium (Supplement Mix, PromoCell) supplemented with 4% fetal bovine serum, 0.4% bovine pituitary extract, 1 ng / mL basic fibroblast growth factor, and 5 μg / mL insulin. The cells were maintained in a humidified incubator at 37°C and 5% CO2. Before treatment with the gene expression enhancer, to minimize the effects of serum and growth supplements, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 1% fetal bovine serum (FBS, Gibco) and 1 ng / mL basic fibroblast growth factor (bFGF, Merck), and the cells were cultured for 24 hours. Thereafter, the sample was cultured to a concentration of 30%, and the adhesion ability was measured after 7 days. The adhesion ability was evaluated by measuring the cells that did not detach after subjecting them to 0.1% trypsin treatment in an incubator for 2 minutes using cell counting.
[0030] <Evaluation of adhesion ability> The number of cells remaining after trypsin treatment was measured. As a result of the measurement, as shown in Fig. 7, almost all cells did not adhere by trypsin treatment at 3k MW or higher compared to the unfractionated sample, while adherent cells were observed at 3k MW or lower. Similarly, no adherent cells were observed in the fractionated sample of 3k - 2k MW, and adherent cells were confirmed in the fraction of 2k MW or lower. At 2k - 1k MW, the number of remaining cells decreased but adherent cells were confirmed, and adherent cells were also confirmed in the fractions of 1k MW or lower and 1k - 500 MW. Since no adherent cells could be confirmed at 500 or lower, it is presumed that the adhesion ability enhancing component contained in the gene expression enhancer (soil-derived extract) is between 1000 and 500 MW.
[0031] It is known that the increase in VEGF increases cell adhesion factors. Therefore, it is presumed that VEGF is mainly involved in the enhancement of adhesion ability, and the enhancement of VEGF expression is involved in the enhancement of VEGF and adhesion ability. In addition, KGF activates hair matrix cells, but also promotes the activation of dermal papilla cells themselves, and as a result, it is considered to be involved in the enhancement of adhesion ability by enhancing VEGF expression. It is known that dermal papilla secretes BMP4 during the growth period of hair, and BMP4 is also used as an index for the activation of dermal papilla cells. Since the activation of dermal papilla cells also occurs due to the enhancement of VEGF expression, it is presumed that the expression of BMP4 also increases. From the above, it can be said that the gene expression enhancer (soil-derived extract) containing the adhesion ability enhancing component has the effect of enhancing the expression of BMP4 gene, VEGF gene and KGF gene.
[0032] As described above, the embodiments of the present invention have been described. However, the present invention is not limited to the above-described embodiments, and includes other embodiments and modifications conceivable within the scope of the matters described in the claims. Changes and the like that do not deviate from the gist are all within the scope of application of the present invention.
Claims
**Claim 1** A gene expression enhancer for enhancing the expression of any one or more of the BMP4 gene, VEGF gene, KGF gene, and β-catenin gene in dermal papilla cells, comprising a soil-derived extract extracted from soil collected from a stratum formed by the deposition of marine plants and marine animals under anaerobic conditions more than 300,000 years ago. **Claim 2** The gene expression enhancer according to Claim 1, wherein the soil-derived extract is obtained by extracting water-soluble substances contained in the soil. **Claim 3** The gene expression enhancer according to Claim 1, wherein the average molecular weight of the active substance contained in the soil-derived extract is 500 to 1000. **Claim 4** The gene expression enhancer according to Claim 1, wherein the soil-derived extract contains natural sugar chain nutrients in addition to humic acid. **Claim 5** The gene expression enhancer according to Claim 1, which is for enhancing the expression of the BMP4 gene in dermal papilla cells. **Claim 6** The gene expression enhancer according to Claim 1, which is for enhancing the expression of the VEGF gene in dermal papilla cells. **Claim 7** The gene expression enhancer according to Claim 1, which is for enhancing the expression of the KGF gene in dermal papilla cells. **Claim 8** The gene expression enhancer according to Claim 1, which is for enhancing the expression of the β-catenin gene in dermal papilla cells.
Citation Information
Patent Citations
Hair grower
JP2006327978A
Hair restorer
JP2018108974A