Cell-penetrating peptides
Peptides with defined cationic and hydrophobic domains enhance cell permeability and reduce toxicity, addressing the limitations of current CPPs in delivering therapeutic molecules for Duchenne muscular dystrophy, achieving improved exon skipping and dystrophin restoration.
Patent Information
- Application Number
- JP2025062268
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-08-09
- Filing Date
- 2025-04-04
- Publication Date
- 2025-07-15
AI Technical Summary
Current cell-penetrating peptides (CPPs) used for delivering therapeutic molecules, such as antisense oligonucleotides, are limited by the trade-off between efficacy and toxicity, particularly in treating genetic disorders like Duchenne muscular dystrophy (DMD), with existing peptides showing low efficacy and high toxicity.
Development of peptides with specific structures containing two or more cationic domains and one hydrophobic domain, each of defined length, without artificial amino acids, which enhance cell permeability and reduce toxicity when conjugated with therapeutic molecules.
The peptides demonstrate improved exon skipping and dystrophin protein restoration in skeletal muscle, reducing toxicity markers and increasing efficacy compared to previous CPPs, making them suitable for human treatment of DMD.
Smart Images

Figure 2025106403000008 
Figure 2025106403000009 
Figure 2025106403000010
Abstract
Description
Technical Field
[0001] The present invention relates to peptides, particularly cell-penetrating peptides, and conjugates of such cell-penetrating peptides with therapeutic molecules. The present invention further relates to the use of such peptides or conjugates in a method of treatment or as a medicament, especially in the treatment of genetic disorders, particularly muscular dystrophy, such as Duchenne muscular dystrophy.
Background Art
[0002] Nucleic acid drugs are genomic drugs that hold the potential to transform medicine in humans. Research has suggested that such therapeutic agents can be applied across a wide range of disease areas, including neuromuscular diseases. Antisense oligonucleotide-based methods that modulate pre-mRNA splicing have been applied to Duchenne muscular dystrophy (DMD), a neuromuscular disease, and this single-gene disorder is at the forefront of precision medicine.
[0003] However, the therapeutic development of these promising antisense therapeutics has been hampered by insufficient cell permeability and poor distribution characteristics. This problem is further exacerbated in DMD by the large amount of muscle tissue matrix and its dispersion properties.
[0004] DMD affects 1 in 3,500 newborn male infants. This severe X-linked recessive disorder is caused by mutations in the DMD gene that encodes the dystrophin protein. The disorder is characterized by progressive muscle degeneration and atrophy, accompanied by the appearance of respiratory failure and heart complications, ultimately leading to premature death. Most of the mutations underlying DMD are out-of-frame deletions in the genome that induce early truncations within the open reading frame, resulting in a lack of dystrophin protein.
[0005] Exon skipping therapy utilizes splice-switching antisense oligonucleotides (SSOs) to target specific regions of DMD transcripts, induce the exclusion of individual exons, restore the abnormal reading frame, and result in the production of internally deleted but partially functional dystrophin protein. Despite the unquestionable potential of antisense oligonucleotide exon skipping therapy for DMD, the success of this approach is currently limited by the relatively inefficient targeting of skeletal muscle and the insufficient targeting of single-stranded oligonucleotides to other affected tissues such as the heart.
[0006] In September 2016, the Food and Drug Administration (FDA) granted early approval to “eteplirsen,” a single-stranded oligonucleotide that modulates the splicing of exon 51. This was a pioneer of the first approved oligonucleotide to modulate splicing in the United States, but the level of dystrophin recovery was only about 1% of the normal dystrophin level, which was disappointing. Comparisons with the allelic disorder Becker muscular dystrophy and experiments in mdx mice have suggested that at least about 15% wild-type uniform myofiber sheath dystrophin expression is required to protect muscle from exercise-induced damage.
[0007] Therefore, there is an urgent and strong need to improve the delivery of antisense oligonucleotides in order to provide more effective treatments for severe genetic diseases such as DMD.
[0008] Although the use of viruses as delivery vehicles has been suggested, their use is limited by the immunotoxic and carcinogenic effects of viral coat proteins. As an alternative, various non-viral delivery vectors have been developed, among which peptides have emerged as the most promising due to their small size and the target specificity and ability for the capillary delivery of large biocargo. Some peptides have been reported to be able to penetrate cells either alone or in a biocargo-loaded state.
[0009] For several years, cell-penetrating peptides (CPPs) have been conjugated to SSOs (especially charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)), and the cellular delivery of such oligonucleotide analogs has been enhanced by their ability to effectively carry them across the cell membrane and reach the pre-mRNA target sites in the cell nucleus. PMO therapeutics conjugated to a specific arginine-rich CPP (also known as P-PMO or peptide-PMO) have been shown to enhance dystrophin production in skeletal muscle after systemic administration in the mdx mouse model of DMD.
[0010] In particular, the PNA / PMO internalization peptide (Pip) has already been developed. This is an arginine-rich CPP composed of two arginine-rich sequences separated by a central short hydrophobic sequence. These "Pip" peptides were designed to improve serum stability while maintaining a high level of exon skipping by first binding to the PNA cargo. Further derivatives of these peptides were designed as conjugates of PMO, and these derivatives were shown to result in systemic skeletal muscle dystrophin production after systemic administration to mice, and importantly, this included the heart. However, despite the effectiveness of these peptides, the application of these treatments has been hampered by the toxicity associated with them.
[0011] Alternative cell - permeable peptides having a single arginine - rich domain such as R6Gly have also been produced. These CPPs have been used in the generation of less - toxic peptide conjugates, but these conjugates have shown lower efficacy compared to Pip peptides.
[0012] Therefore, currently available CPPs have not yet been shown to be suitable for use in human treatment of diseases such as DMD.
Summary of the Invention
Problems to be Solved by the Invention
[0013] The problem in the field of cell - permeable peptide technology has been to decouple efficacy and toxicity. The inventors have now identified, synthesized, and tested several improved CPPs having the specific structures described in the present invention that at least address this problem.
[0014] When these peptides are tested in vitro and in vivo using a cargo therapeutic molecule, they maintain good levels of efficacy in skeletal muscle. Furthermore, these peptides have demonstrated improved efficacy when used in the same conjugates compared to already available CPPs. At the same time, these peptides act effectively in vivo after systemic injection, reduce clinical signs, and show reduced toxicity when observed through measurement of biochemical markers. Importantly, it has been demonstrated that these peptides have a surprisingly reduced toxicity after a similar systemic injection into mice compared to previous CPPs. Therefore, the peptides of the present invention present an improvement in compatibility for use as therapeutic agents for humans compared to already available peptides and can be used in therapeutic conjugates for safe and effective treatment in human subjects.
Means for Solving the Problems
[0015] According to a first aspect of the present invention, two or more cationic domains each containing at least 4 amino acid residues, and One or more hydrophobic domains each containing at least 3 amino acid residues A peptide having a full length of 40 amino acid residues or less, comprising A peptide that does not contain artificial amino acid residues is provided.
[0016] According to a second aspect of the present invention, a conjugate comprising the peptide of the first aspect covalently bound to a therapeutic molecule is provided.
[0017] According to a third aspect of the present invention, a conjugate comprising the peptide of the first aspect covalently bound to an imaging molecule is provided.
[0018] According to a fourth aspect of the present invention, a pharmaceutical composition comprising the conjugate of the second aspect is provided.
[0019] According to a fifth aspect of the present invention, a conjugate according to the second aspect for use as a medicament is provided.
[0020] In one embodiment of the fifth aspect, a pharmaceutical composition according to the fourth aspect for use as a medicament is provided.
[0021] According to a sixth aspect of the present invention, a method of treating a disease in a subject, comprising administering a therapeutically effective amount of the conjugate of the second aspect to the subject, is provided.
[0022] In one embodiment of the sixth aspect, a method of treating a disease in a subject, comprising administering a therapeutically effective amount of the pharmaceutical composition according to the fourth aspect to the subject, is provided.
[0023] According to a seventh aspect of the present invention, an isolated nucleic acid encoding the peptide of the first aspect or the conjugate of the second aspect or the conjugate of the third aspect is provided.
[0024] According to an eighth aspect of the present invention, an expression vector comprising the nucleic acid sequence of the seventh aspect is provided.
[0025] According to a ninth aspect of the present invention, there is provided a host cell comprising the expression vector of the eighth aspect. BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Mode for Carrying Out the Invention
[0027] Detailed Description The inventors have generated a series of peptides suitable for use as cell-penetrating peptides for delivering therapeutic molecules to cells.
[0028] Surprisingly, the inventors have found a group of peptides having at least two cationic domains and at least one hydrophobic domain of defined length, without any artificial amino acids, with enhanced cell permeability to muscle compared to currently available cell-penetrating peptides. This effect is observed when delivered to cells as a conjugate with an antisense oligonucleotide therapeutic or when administered in vivo.
[0029] In the context of the disease DMD, enhanced cell permeability by the peptides of the invention linked to an appropriate therapeutic molecule can be demonstrated by specific exon skipping within the transcript. When an antisense oligonucleotide is directed to an appropriate sequence, forced skipping of exons, correction of the open reading frame, and restoration of internally deleted but partially functional dystrophin isoforms are brought about.
[0030] The peptides of the present invention are shown herein to have high levels of exon skipping and dystrophin protein restoration when used as conjugates with antisense oligonucleotide therapeutics designed to target the dystrophin gene.
[0031] In particular, conjugates containing the peptides of the present invention show a significant increase in cell permeability when compared to currently available peptides conjugated to the same antisense oligonucleotide therapeutic. This is demonstrated in the present invention by an increase in exon skipping within the dystrophin gene in various different muscle groups.
[0032] In vivo, the results described herein show that the levels of exon skipping and functional dystrophin expression when using the peptide conjugates of the present invention are nearly twice the levels obtained from the use of the same antisense oligonucleotide therapeutic conjugated to currently available cell - permeable peptides.
[0033] This represents a significant improvement in the effectiveness of such peptide carriers to penetrate muscle cells and is effective in neuromuscular diseases.
[0034] While not wishing to be bound by theory, the inventors believe that the removal of artificial amino acids, such as the 6 - aminohexanoic acid residues typically used in cell - permeable peptides, and replacement with, for example, naturally occurring beta - alanine residues, have a beneficial effect on reducing overall toxicity and increasing the cell permeability of the peptides.
[0035] However, such a peptide structure without artificial amino acid residues was never expected to improve the delivery properties of cell-penetrating peptides that have been reported to transport therapeutic molecular cargos such as oligonucleotides into muscle. The effectiveness of a peptide depends largely on its serum stability during the length of time it takes for the peptide to enter the cell. Peptides formed without artificial amino acids were expected to be unstable in vivo, susceptible to proteolytic degradation, and unable to permeate sufficient amounts into muscle cells and tissues to enhance the therapeutic effect. Contrary to this expectation, the inventors have found that peptides having the specific structures recited in the claims enter cells, have sufficient stability to maintain good and improved effects, and moreover have the advantage that their toxicity profile is reduced due to the absence of artificial amino acids.
[0036] It was not expected that such transport would be enhanced and that therapeutic molecules such as antisense oligonucleotides would result in the smooth improvement of exon skipping and functional dystrophin protein production in various different muscles as demonstrated herein.
[0037] Furthermore, it was not expected that such a peptide structure would significantly reduce the toxicity of cell-penetrating peptides when transporting therapeutic cargos in vivo to the extent that treatment of humans with such conjugates can be realized. In vivo, the results described herein show a decrease in nephrotoxicity as determined by biochemical markers.
[0038] To avoid misunderstanding and to clarify the direction in which the present disclosure is to be interpreted, certain terms used in accordance with the present invention are further defined herein.
[0039] The present invention includes any combination of the described aspects and features, except where such combinations are clearly not permitted or are clearly avoided.
[0040] The section headings used in this specification are for purposes of organization only and are not to be construed as limiting the described subject matter.
[0041] References to "X" throughout refer to any form of aminohexanoic acid, an artificially synthetically produced amino acid.
[0042] References to "B" throughout refer to beta-alanine, a natural but non-genetically encoded amino acid.
[0043] References to "Ac" throughout refer to the acetylation of the relevant peptide.
[0044] References to "Hyp" throughout refer to hydroxyproline, a natural but non-genetically encoded amino acid.
[0045] References to other capital letters throughout refer to the relevant genetically encoded amino acid residues according to the recognized alphabetic amino acid code.
[0046] Artificial amino acids The present invention relates to short cell-permeable peptides having a specific structure in which no artificial amino acid residues are present.
[0047] References to "artificial" amino acids or residues herein mean any amino acid not found in nature and also include synthetic amino acids, modified amino acids (e.g., those modified with sugars), non-natural amino acids, artificial amino acids, spacers, and non-peptide bond spacers.
[0048] Synthetic amino acids can be those chemically synthesized by humans.
[0049] To avoid misunderstanding, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. To avoid misunderstanding, beta-alanine (B) and hydroxyproline (Hyp) are present in nature and are therefore natural amino acids and not artificial amino acids in the context of the present invention.
[0050] Artificial amino acids can include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine-carboxylic acid (Az), 11-aminoundecanoic acid.
[0051] Suitably, the peptide does not contain an aminohexanoic acid residue. Suitably, the peptide does not contain any form of an aminohexanoic acid residue. Suitably, the peptide does not contain a 6-aminohexanoic acid residue.
[0052] Suitably, the peptide contains only natural amino acid residues and thus consists of natural amino acid residues.
[0053] Suitably, artificial amino acids typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced with natural amino acids. Suitably, artificial amino acids typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, are replaced with an amino acid selected from beta-alanine, serine, proline, arginine, and histidine or hydroxyproline.
[0054] In one embodiment, aminohexanoic acid is replaced with beta-alanine. Suitably, 6-aminohexanoic acid is replaced with beta-alanine.
[0055] In one embodiment, aminohexanoic acid is replaced with histidine. Suitably, 6-aminohexanoic acid is replaced with histidine.
[0056] In one embodiment, the aminohexanoic acid is replaced by hydroxyproline. Suitably, 6-aminohexanoic acid is replaced by hydroxyproline.
[0057] Suitably, the unnatural amino acids typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, can be replaced by any combination of beta-alanine, serine, proline, arginine and histidine or hydroxyproline, suitably any combination of beta-alanine, histidine, and hydroxyproline.
[0058] In one embodiment, two or more cationic domains each containing at least 4 amino acid residues, and one or more hydrophobic domains each containing at least 3 amino acid residues A peptide having a full length of 40 amino acid residues or less, comprising is provided, wherein at least one cationic domain contains a histidine residue.
[0059] Suitably, at least one cationic domain is histidine-rich.
[0060] Suitably, what is meant by histidine-rich is defined herein in relation to the cationic domain.
[0061] Cationic domain The present invention relates to short cell-penetrating peptides having a specific structure in which there are at least two cationic domains having a certain length.
[0062] References to "cationic" herein refer to amino acids or domains of amino acids that are overall positively charged at physiological pH.
[0063] Suitably, the peptide contains up to 4 cationic domains, up to 3 cationic domains.
[0064] Preferably, the peptide comprises two cationic domains.
[0065] As defined above, the peptide comprises two or more cationic domains each having a length of at least 4 amino acid residues.
[0066] Preferably, each cationic domain has a length between 4 and 12 amino acid residues, preferably between 4 and 7 amino acid residues.
[0067] Preferably, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues.
[0068] Preferably, each cationic domain is of similar length, preferably, each cationic domain is of the same length.
[0069] Preferably, each cationic domain contains cationic amino acids and may also contain polar and / or non-polar amino acids.
[0070] Non-polar amino acids can be selected from alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Preferably, non-polar amino acids have no charge.
[0071] Polar amino acids can be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine. Preferably, the selected polar amino acids have no negative charge.
[0072] Cationic amino acids can be selected from arginine, histidine, lysine. Preferably, cationic amino acids have a positive charge at physiological pH.
[0073] Suitably, each cationic domain does not contain an anionic amino acid residue or a negatively charged amino acid residue.
[0074] Suitably, each cationic domain contains arginine, histidine, beta-alanine, hydroxyproline and / or serine residues.
[0075] Suitably, each cationic domain consists of arginine, histidine, beta-alanine, hydroxyproline and / or serine residues.
[0076] Suitably, each cationic domain contains at least 40%, at least 45%, at least 50% cationic amino acids.
[0077] Suitably, each cationic domain contains a majority of cationic amino acids. Suitably, each cationic domain contains at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.
[0078] Suitably, each cationic domain contains an isoelectric point (pI) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.
[0079] Suitably, each cationic domain contains an isoelectric point (pI) of at least 10.0.
[0080] Suitably, each cationic domain contains an isoelectric point (pI) between 10.0 and 13.0.
[0081] In one embodiment, each cationic domain contains an isoelectric point (pI) between 10.4 and 12.5.
[0082] Suitably, the isoelectric point of the cationic domain is calculated at physiological pH by any suitable means available in the art, suitably using a web-based algorithm developed by Lukasz Kozlowski of IPC (www.isoelectric.org), Biol Direct. 2016;11:55. DOI:10.1186 / s13062-016-0159-9.
[0083] Suitably, each cationic domain contains at least one cationic amino acid, suitably between 1 and 5 cationic amino acids. Suitably, each cationic domain contains at least 2 cationic amino acids, suitably between 2 and 5 cationic amino acids.
[0084] Suitably, each cationic domain is arginine-rich and / or histidine-rich. Suitably, the cationic domain may contain both histidine and arginine.
[0085] "Arginine-rich" or "histidine-rich" means that at least 40% of the cationic domain is formed by said residues.
[0086] Suitably, each cationic domain contains a majority of arginine residues and / or histidine residues.
[0087] Suitably, each cationic domain contains at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues and / or histidine residues.
[0088] Suitably, the cationic domain can contain at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues.
[0089] Suitably, the cationic domain can contain at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% histidine residues.
[0090] Suitably, the cationic domain can contain between 1 and 5 histidine residues in total and between 1 and 5 arginine residues in total. Suitably, the cationic domain can contain between 1 and 5 arginine residues. Suitably, the cationic domain can contain between 1 and 5 histidine residues. Suitably, the cationic domain can contain between 2 and 5 histidine residues in total and between 3 and 5 arginine residues in total. Suitably, the cationic domain can contain between 3 and 5 arginine residues. Suitably, the cationic domain can contain between 2 and 5 histidine residues.
[0091] Suitably, each cationic domain contains one or more beta-alanine residues. Suitably, each cationic domain can contain between 2 and 5 beta-alanine residues in total, suitably 2 or 3 beta-alanine residues in total.
[0092] Suitably, the cationic domain can contain one or more hydroxyproline residues or serine residues.
[0093] Suitably, the cationic domain may include a hydroxyproline residue between 1 hydroxyproline residue and 2 hydroxyproline residues. Suitably, the cationic domain may include a serine residue between 1 serine residue and 2 serine residues.
[0094] Suitably, all cationic amino acids within a given cationic domain may be histidine, or suitably, all cationic amino acids within a given cationic domain may be arginine.
[0095] Suitably, the peptide may include at least one histidine-rich cationic domain. Suitably, the peptide may include at least one arginine-rich cationic domain.
[0096] Suitably, the peptide may include at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.
[0097] In one embodiment, the peptide includes two arginine-rich cationic domains.
[0098] In one embodiment, the peptide includes two histidine-rich cationic domains.
[0099] In one embodiment, the peptide includes two arginine and histidine-rich cationic domains.
[0100] In one embodiment, the peptide includes one arginine-rich cationic domain and one histidine-rich cationic domain.
[0101] Suitably, each cationic domain includes 3 or fewer consecutive arginine residues, suitably 2 or fewer consecutive arginine residues.
[0102] Suitably, each cationic domain does not include consecutive histidine residues.
[0103] Suitably, each cationic domain comprises arginine, histidine, and / or beta-alanine residues. Suitably, each cationic domain comprises a majority of arginine, histidine, and / or beta-alanine residues. Suitably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues within each cationic domain are arginine, histidine, and / or beta-alanine residues. Suitably, each cationic domain consists of arginine, histidine, and / or beta-alanine residues.
[0104] In one embodiment, the peptide comprises a first cationic domain comprising arginine residues and beta-alanine residues, and a second cationic domain comprising arginine residues and beta-alanine residues.
[0105] In one embodiment, the peptide comprises a first cationic domain comprising arginine residues and beta-alanine residues, and a second cationic domain comprising histidine residues, beta-alanine residues, and optionally arginine residues.
[0106] In one embodiment, the peptide comprises a first cationic domain comprising arginine residues and beta-alanine residues, and a second cationic domain comprising histidine residues and beta-alanine residues.
[0107] In one embodiment, the peptide comprises a first cationic domain consisting of arginine residues and beta-alanine residues, and a second cationic domain consisting of arginine residues and beta-alanine residues.
[0108] In one embodiment, the peptide comprises a first cationic domain consisting of arginine residues and beta-alanine residues, and a second cationic domain consisting of arginine residues, histidine residues, and beta-alanine residues.
[0109] Suitably, the peptide comprises at least two cationic domains, suitably these cationic domains form the arms of the peptide. Suitably, the cationic domains are located at the N-terminus and C-terminus of the peptide. Suitably, thus, the cationic domains may be known as cationic arm domains.
[0110] In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and the other located at the C-terminus of the peptide. Suitably, it is located at either end of the peptide. Suitably, except for other groups such as terminal modifications, linkers and / or therapeutic molecules, no additional amino acids or domains are present at the N-terminus and C-terminus of the peptide. To avoid misunderstanding, such other groups may be present in addition to the "peptide" described and claimed herein. Suitably, thus, each cationic domain forms the end of the peptide. Suitably, this does not exclude the presence of additional linker groups described herein.
[0111] Suitably, the peptide may comprise up to four cationic domains. Suitably, the peptide comprises two cationic domains.
[0112] In one embodiment, the peptide comprises two cationic domains that are both arginine-rich.
[0113] In one embodiment, the peptide comprises one cationic domain that is arginine-rich.
[0114] In one embodiment, the peptide comprises two cationic domains that are both arginine-rich and histidine-rich.
[0115] In one embodiment, the peptide comprises one cationic domain that is arginine-rich and one cationic domain that is histidine-rich.
[0116] Suitably, the cationic domain comprises amino acid units selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.
[0117] Suitably, the cationic domain may also contain serine residues, proline residues and / or hydroxyproline residues. Suitably, the cationic domain further comprises amino acid units selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above.
[0118] Suitably, each cationic domain comprises any one or any combination of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19).
[0119] Suitably, each cationic domain consists of any one or any combination of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO: 19).
[0120] Suitably, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9).
[0121] Suitably, each cationic domain of the peptide may be the same or different. Suitably, each cationic domain of the peptide is different.
[0122] Hydrophobic domain The present invention relates to short cell-penetrating peptides having a specific structure in which there is at least one hydrophobic domain having a certain length.
[0123] References to "hydrophobic" herein refer to amino acids or domains of amino acids that have the ability to repel water or do not mix with water.
[0124] Suitably, the peptide contains a maximum of three hydrophobic domains, a maximum of two hydrophobic domains.
[0125] Suitably, the peptide contains one hydrophobic domain.
[0126] As defined above, the peptide contains one or more hydrophobic domains each having a length of at least 3 amino acid residues.
[0127] Suitably, each hydrophobic domain has a length between 3 and 6 amino acids. Suitably, each hydrophobic domain has a length of 5 amino acids.
[0128] Suitably, each hydrophobic domain may contain non-polar amino acid residues, polar amino acid residues, and hydrophobic amino acid residues.
[0129] The hydrophobic amino acid residues can be selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.
[0130] The non-polar amino acid residues can be selected from proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine.
[0131] The polar amino acid residues can be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.
[0132] Suitably, the hydrophobic domain does not contain hydrophilic amino acid residues.
[0133] Suitably, each hydrophobic domain contains a majority of hydrophobic amino acid residues. Suitably, each hydrophobic domain contains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. Suitably, each hydrophobic domain consists of hydrophobic amino acid residues.
[0134] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.
[0135] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.
[0136] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.
[0137] Suitably, each hydrophobic domain comprises a hydrophobicity between 0.4 and 1.4.
[0138] In one embodiment, each hydrophobic domain comprises a hydrophobicity between 0.45 and 0.48.
[0139] In one embodiment, each hydrophobic domain comprises a hydrophobicity between 1.27 and 1.39.
[0140] Suitably, the hydrophobicity is that measured by White and Wimley: W.C. Wimley and S.H. White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842(1996).
[0141] Suitably, each hydrophobic domain comprises at least 3 hydrophobic amino acid residues, at least 4 hydrophobic amino acid residues.
[0142] Suitably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine residues. Suitably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.
[0143] In one embodiment, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues.
[0144] In one embodiment, each hydrophobic domain consists of tryptophan and / or proline residues.
[0145] Suitably, the peptide comprises one hydrophobic domain. Suitably, the hydrophobic domain or each hydrophobic domain is located in the center of the peptide. Suitably, thus, the hydrophobic domain may be known as a core hydrophobic domain. Suitably, the hydrophobic core domain or each hydrophobic core domain is flanked on both sides by arm domains. Suitably, the arm domain may comprise one or more cationic domains and one or more additional hydrophobic domains. Suitably, each arm domain comprises a cationic domain.
[0146] In one embodiment, the peptide comprises two arm domains sandwiching a hydrophobic core domain, and each arm domain comprises a cationic domain.
[0147] In one embodiment, the peptide consists of two cationic arm domains sandwiching a hydrophobic core domain.
[0148] Suitably, the hydrophobic domain or each hydrophobic domain comprises one or any combination of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26).
[0149] Suitably, the hydrophobic domain or each hydrophobic domain consists of one or any combination of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26).
[0150] Suitably, the hydrophobic domain or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), ILFQY (SEQ ID NO: 22).
[0151] Suitably, the hydrophobic domain or each hydrophobic domain consists of FQILY (SEQ ID NO: 21).
[0152] Suitably, each hydrophobic domain within the peptide may have the same or different sequences.
[0153] Peptide The present invention relates to short cell-penetrating peptides for use in the transport of therapeutic cargo molecules in the treatment of medical conditions.
[0154] The peptide has a sequence that is a continuous single molecule, and thus the domains of the peptide are contiguous. Suitably, the peptide comprises several domains linearly arranged between the N-terminus and the C-terminus. Suitably, the domains are selected from the cationic domains and hydrophobic domains described above. Suitably, the peptide consists of a cationic domain and a hydrophobic domain, and the domains are as defined above.
[0155] Each domain has the common array characteristics described in the relevant section above, but the exact array of each domain can be in a deformed form and modified. Therefore, various arrays are possible for each domain. Combinations of each possible domain array result in various peptide structures, each of which forms part of the present invention. The characteristics of the peptide structure are described below.
[0156] Suitably, the hydrophobic domain separates any two cationic domains. Suitably, each hydrophobic domain is sandwiched between cationic domains on both sides thereof.
[0157] Suitably, the cationic domain is not continuous with another cationic domain.
[0158] In one embodiment, the peptide comprises one hydrophobic domain sandwiched between two cationic domains in the following arrangement: [Cationic domain]-[Hydrophobic domain]-[Cationic domain].
[0159] Therefore, suitably, the hydrophobic domain may be known as the core domain, and each cationic domain may be known as the arm domain. Suitably, the hydrophobic arm domain sandwiches the cationic core domain from both sides thereof.
[0160] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.
[0161] In one embodiment, the peptide consists of one hydrophobic core domain sandwiched between two cationic arm domains.
[0162] In one embodiment, the peptide consists of one hydrophobic core domain containing a sequence selected from YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WW PWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), and WW PW (SEQ ID NO: 26), sandwiched between two cationic arm domains each containing a sequence selected from RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19).
[0163] In one embodiment, the peptide consists of one hydrophobic core domain containing a sequence selected from FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), and ILFQY (SEQ ID NO: 22), sandwiched between two cationic arm domains each containing a sequence selected from RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), and HBHBR (SEQ ID NO: 9).
[0164] In one embodiment, the peptide consists of one hydrophobic core domain containing the sequence: FQILY (SEQ ID NO: 21), sandwiched between two cationic arm domains each containing a sequence selected from RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), and RBHBH (SEQ ID NO: 8).
[0165] In any such embodiment, additional groups, such as linkers, terminal modifications, and / or therapeutic molecules, may be present.
[0166] Preferably, the peptide has a modified N-terminus.
[0167] Preferably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Preferably, the peptide is N-acetylated.
[0168] Optionally, the N-terminus of the peptide may not be modified.
[0169] In one embodiment, the peptide is N-acetylated.
[0170] Preferably, the peptide has a modified C-terminus.
[0171] Preferably, the peptide comprises a C-terminal modification selected from a carboxy group, a thioacid group, an aminooxy group, a hydrazino group, a thioester group, an azide group, a strained alkyne, a strained alkene, an aldehyde group, a thiol group or a haloacetyl group.
[0172] Advantageously, the C-terminal modification provides a means for linking the peptide to a therapeutic molecule.
[0173] Thus, the C-terminal modification can include a linker and vice versa. Preferably, the C-terminal modification may consist of a linker and vice versa. Suitable linkers are described elsewhere in this specification.
[0174] Preferably, the peptide comprises a C-terminal carboxyl group.
[0175] Preferably, the C-terminal carboxyl group is provided by a glycine or beta-alanine residue.
[0176] In one embodiment, the C-terminal carboxyl group is provided by a beta-alanine residue.
[0177] Suitably, the C-terminal beta-alanine residue is a linker.
[0178] Suitably, therefore, each cationic domain may further comprise an N-terminal modification or a C-terminal modification. Suitably, the C-terminal cationic domain comprises a C-terminal modification. Suitably, the N-terminal cationic domain comprises an N-terminal modification. Suitably, the C-terminal cationic domain comprises a linker group and, suitably, the C-terminal cationic domain comprises a C-terminal beta-alanine. Suitably, the N-terminal cationic domain is N-acetylated.
[0179] The peptides of the present invention are defined as having a total length of 40 amino acid residues or less. The peptides can therefore be regarded as oligopeptides.
[0180] Suitably, the peptides have a total length between 3 and 30 amino acid residues, suitably between 5 and 25 amino acid residues, between 10 and 25 amino acid residues, between 13 and 23 amino acid residues, between 15 and 20 amino acid residues.
[0181] Suitably, the peptides have a total length of at least 12 amino acid residues, at least 13 amino acid residues, at least 14 amino acid residues, at least 15 amino acid residues, at least 16 amino acid residues, at least 17 amino acid residues.
[0182] Suitably, the peptides are capable of permeating cells. The peptides can therefore be regarded as cell-penetrating peptides.
[0183] Suitably, the peptides are for attachment to a therapeutic molecule. Suitably, the peptides are for transporting a therapeutic molecule to a target cell. Suitably, the peptides are for delivering a therapeutic molecule to a target cell. The peptides can therefore be regarded as carrier peptides.
[0184] Suitably, the peptide can permeate cells and tissues, suitably the nucleus of cells. Suitably, it can permeate muscle tissue.
[0185] Suitably, the peptide can be selected from any of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRFQILYRBRR (SEQ ID NO: 28) RBRRBRFQILYRRBRBR (SEQ ID NO: 29) RBRBRFQILYRBRRBRR (SEQ ID NO: 30) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYRBRBR (SEQ ID NO: 33) RBRRBFQILYRBRRBR (SEQ ID NO: 34) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBFQILYRBRBR (SEQ ID NO: 36) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRRFQILYHBRBH (SEQ ID NO: 39) RBRRBRRYQFLIRBHBH (SEQ ID NO: 40) RBRRBRRILFQYRBHBH (SEQ ID NO: 41) RBRHBHRFQILYRBRBR (SEQ ID NO: 42) RBRBBHRFQILYRBHBH (SEQ ID NO: 43) RBRRBRFQILYRBHBH (SEQ ID NO: 44) RBRRBRFQILYHBHBH (SEQ ID NO: 45) RBRRBHFQILYRBHBH (SEQ ID NO: 46) HBRRBRFQILYRBHBH (SEQ ID NO: 47) RBRRBFQILYRBHBH (SEQ ID NO: 48) RBRRBRFQILYBHBH (SEQ ID NO: 49) RBRRBRYQFLIHBHBH (SEQ ID NO: 50) RBRRBRILFQYHBHBH (SEQ ID NO: 51) RBRRBRRFQILYHBHBH (SEQ ID NO: 52)
[0186] Suitably, the peptide can be selected from any of the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO: 53) RBRRBRFQILYBRB[Hyp] (SEQ ID NO: 54) RBRRBRFQILYBR[Hyp]R (SEQ ID NO: 55) RRBRRBRFQILYBRBR (SEQ ID NO: 56) BRRBRRFQILYBRBR (SEQ ID NO: 57) RBRRBRWWWBRBR (SEQ ID NO: 58) RBRRBRWWPWWBRBR (SEQ ID NO: 59) RBRRBRWPWWBRBR (SEQ ID NO: 60) RBRRBRWWPWBRBR (SEQ ID NO: 61) RBRRBRRWWWRBRBR (SEQ ID NO: 62) RBRRBRRWWPWWRBRBR (SEQ ID NO: 63) RBRRBRRWPWWRBRBR (SEQ ID NO: 64) RBRRBRRWWPWRBRBR (SEQ ID NO: 65) RBRRBRRFQILYBRBR (SEQ ID NO: 66) RBRRBRRFQILYRBR (SEQ ID NO: 67) BRBRBWWPWWRBRRBR (SEQ ID NO: 68) RBRRBRRFQILYBHBH (SEQ ID NO: 69) RBRRBRRFQIYRBHBH (SEQ ID NO: 70) RBRRBRFQILYBRBH (SEQ ID NO: 71) RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72) R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO: 73) R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74) RBRRBRWWWRBHBH (SEQ ID NO: 75) RBRRBRWWPRBHBH (SEQ ID NO: 76) RBRRBRPWWRBHBH (SEQ ID NO: 77) RBRRBRWWPWWRBHBH (SEQ ID NO: 78) RBRRBRWWPWRBHBH (SEQ ID NO: 79) RBRRBRWPWWRBHBH (SEQ ID NO: 80) RBRRBRRWWWRBHBH (SEQ ID NO: 81) RBRRBRRWWPWWRBHBH (SEQ ID NO: 82) RBRRBRRWPWWRBHBH (SEQ ID NO: 83) RBRRBRRWWPWRBHBH (SEQ ID NO: 84) RRBRRBRFQILYRBHBH (SEQ ID NO: 85) BRRBRRFQILYRBHBH (SEQ ID NO: 86) RRBRRBRFQILYBHBH (SEQ ID NO: 87) BRRBRRFQILYBHBH (SEQ ID NO: 88) RBRRBHRFQILYRBHBH (SEQ ID NO: 89) RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 101) R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO: 102) R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 103) RBRRBRWWWBRBR (SEQ ID NO: 104) RBRRBRWWPWWBRBR (SEQ ID NO: 105)
[0187] Preferably, the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRFQILYRBHBH (SEQ ID NO: 44)
[0188] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35).
[0189] In one embodiment, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37).
[0190] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44).
[0191] Conjugate The peptides of the present invention can be covalently attached to therapeutic molecules to provide conjugates.
[0192] The therapeutic molecule can be any molecule for treating a disease. The therapeutic molecule can be selected from nucleic acids, peptide nucleic acids, antisense oligonucleotides (e.g., PNA, PMO), mRNA and gRNA (e.g., in the use of CRISPR / Cas9 technology), short interfering RNAs, microRNAs, antagomiRNAs, peptides, cyclic peptides, proteins, pharmaceuticals, drugs, or nanoparticles.
[0193] In one embodiment, the therapeutic molecule is an antisense oligonucleotide.
[0194] Suitably, the antisense oligonucleotide is composed of phosphorodiamidate morpholino oligonucleotides (PMO).
[0195] Alternatively, the oligonucleotide can be a modified PMO, or any other charge-neutral oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA, such as gamma PNA (Bahal, Nat. Comm., 2016), an oligonucleotide phosphoramidate (wherein the non-bridging oxygen of the phosphate is substituted with an amine or alkylamine, such as those described in WO2016028187A1) or any other partially or fully charge-neutralized oligonucleotide.
[0196] The therapeutic antisense oligonucleotide sequence can be selected from any available one. For example, the antisense oligonucleotide for exon skipping in DMD is disclosed at https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exon-skipping-across-the-human-, or the therapeutic antisense oligonucleotide complementary to the ISSN1 or IN7 sequence for treating SMA is disclosed in Zhou, HGT, 2013; and Hammond et al., 2016; and Osman et al., HMG, 2014.
[0197] Suitably, the antisense oligonucleotide sequence is for inducing exon skipping for use in the treatment of DMD.
[0198] Suitably, the antisense oligonucleotide sequence is for inducing exon skipping within the dystrophin gene for use in the treatment of DMD. Suitably, the antisense oligonucleotide sequence can induce exon skipping of one or more exons.
[0199] In one embodiment, the antisense oligonucleotide sequence is for inducing exon skipping of a single exon of the dystrophin gene for use in the treatment of DMD. Suitably, the single exon is selected from any exon associated with DMD, which can be any exon within the dystrophin gene, such as exon 45, 51, or 53. PMO oligonucleotides of any sequence can be purchased (e.g., from Gene Tools Inc, USA).
[0200] In one embodiment, the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of the gene target.
[0201] Suitably, the oligonucleotide complementary to the pre-mRNA of the gene target causes a steric blocking event that alters the pre-mRNA, resulting in an altered mRNA, and thereby an altered sequence of the protein. Suitably, the gene target is the dystrophin gene. Suitably, the steric blocking event can be exon inclusion or exon skipping. In one embodiment, the steric blocking event is exon skipping, suitably exon skipping of a single exon of the dystrophin gene.
[0202] Optionally, lysine residues can be added to one or both ends of the therapeutic molecule (e.g., PMO or PNA) to improve water solubility prior to conjugation to the peptide.
[0203] Suitably, the therapeutic molecule has a molecular weight of less than 5,000 Da, suitably less than 3,000 Da, suitably less than 1,000 Da.
[0204] Suitably, the peptide is covalently bound to the therapeutic molecule at the C-terminus.
[0205] Suitably, the peptide is covalently attached to the therapeutic molecule via a linker, if desired. The linker can function as a spacer to separate the peptide sequence from the therapeutic molecule.
[0206] The linker can be selected from any suitable sequence.
[0207] Suitably, the linker is present between the peptide and the therapeutic molecule. Suitably, the linker is a separate group from the peptide and the therapeutic molecule. Thus, the linker can contain artificial amino acids.
[0208] In one embodiment, the conjugate comprises a peptide covalently attached to a therapeutic molecule via a linker. In one embodiment, the conjugate has the following structure: [Peptide]-[Linker]-[Therapeutic molecule].
[0209] In one embodiment, the conjugate consists of the following structure: [Peptide]-[Linker]-[Therapeutic molecule].
[0210] Suitably, any of the peptides recited herein can be used in the conjugates described in the present invention. In one embodiment, the conjugate comprises a peptide selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), and RBRRBRFQILYRBHBH (SEQ ID NO: 44).
[0211] Suitably, in any case, the peptide can further include the N-terminal modification described above.
[0212] Suitable linkers include, for example, C-terminal cysteine residues capable of forming disulfide, thioether, or thiol-maleimide bonds, C-terminal aldehydes for forming oxime, click reaction, or morpholino bond formation with basic amino acids on the peptide, or carboxylic acid moieties on the peptide that commonly conjugate to amino groups to form carboxamide bonds.
[0213] Suitably, the linker is between 1 and 5 amino acids in length. Suitably, the linker can include any linker known in the art.
[0214] Suitably, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB. Suitably, here, X is 6-aminohexanoic acid.
[0215] Suitably, the linker can be a polymer, such as PEG, etc.
[0216] In one embodiment, the linker is beta-alanine.
[0217] In one embodiment, the peptide is conjugated to the therapeutic molecule via a carboxamide bond.
[0218] The linker of the conjugate can form part of the therapeutic molecule to which the peptide is attached. Alternatively, the attachment of the therapeutic molecule can be directly attached to the C-terminus of the peptide. Suitably, in such embodiments, a linker is not required.
[0219] Alternatively, the peptide can be chemically conjugated to a therapeutic molecule. The chemical bond can be, for example, via a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bond.
[0220] Optionally, cysteine can be added to the N-terminus of the therapeutic molecule to enable the formation of a disulfide bond to the peptide, or the N-terminus can be bromoacetylated to effect thioether conjugation to the peptide.
[0221] The peptides of the present invention can similarly be covalently attached to imaging molecules to provide conjugates.
[0222] Suitably, the imaging molecule can be any molecule that enables visualization of the conjugate. Suitably, the imaging molecule can indicate the location of the conjugate. Suitably, the location of the conjugate in vitro or in vivo. Suitably, a method is provided for monitoring the location of a conjugate comprising an imaging molecule, including administering the conjugate to a subject and imaging the subject to confirm the location of the conjugate.
[0223] Examples of imaging molecules include detection molecules, contrast molecules, or enhancement molecules. Suitable imaging molecules can be selected from radionuclides; fluorophores; nanoparticles (e.g., nanoshells); nanocages; chromophores (e.g., enzymes), radioisotopes, dyes, radiopaque substances, fluorescent compounds, and combinations thereof.
[0224] Suitably, the imaging molecules can be visualized using imaging techniques, which may be cell imaging techniques or medical imaging techniques. Suitable cell imaging techniques include, for example, image cytometry, fluorescence microscopy, phase contrast microscopy, SEM, TEM. Suitable medical imaging techniques include, for example, X-rays, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI.
[0225] In some cases, the imaging molecules can be regarded as diagnostic molecules. Suitably, the diagnostic molecules enable the diagnosis of diseases using conjugates. Suitably, the diagnosis of diseases can be achieved by determining the position of the conjugate using the imaging molecules. Suitably, there is provided a method for diagnosing a disease, which includes administering an effective amount of a conjugate containing the imaging molecules to a subject and monitoring the position of the conjugate.
[0226] Suitably, further details such as the binding of the conjugate containing the imaging molecules are the same as those described above for the conjugate containing the therapeutic molecules.
[0227] Suitably, the peptides of the present invention can be covalently bound to therapeutic molecules and imaging molecules to provide conjugates.
[0228] Suitably, the conjugate can penetrate into cells and tissues, suitably into the nuclei of cells. It can penetrate into muscle tissues suitably.
[0229] Pharmaceutical composition The conjugates of the present invention can be formulated into pharmaceutical compositions.
[0230] Suitably, the pharmaceutical composition contains the conjugate of the present invention.
[0231] Suitably, the pharmaceutical composition may further contain a pharmaceutically acceptable diluent, adjuvant or carrier.
[0232] Suitable pharmaceutically acceptable diluents, adjuvants, and carriers are well known in the art.
[0233] As used herein, the phrase "pharmaceutically acceptable" means a ligand, material, formulation, and / or dosage form that, within the scope of sound medical judgment, has no excessive toxicity, irritation, allergic response, or other problems or complications, and is suitable for use in contact with human and animal tissues with a reasonable benefit / risk ratio.
[0234] As used herein, the phrase "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, formulation, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, involved in the transport or conveyance of the conjugate from one organ or part of the body to another organ or part of the body. Each cell-penetrating peptide must be "acceptable" in the sense of being compatible with other components of the composition, such as the peptide and the therapeutic molecule, and not harmful to the individual. Lyophilized compositions that can be reconstituted and administered are also within the scope of the present composition.
[0235] Pharmaceutically acceptable carriers can be, for example, excipients, vehicles, diluents, and combinations thereof. For example, when the composition is administered orally, it can be formulated as tablets, capsules, granules, powders, or syrups, or when administered parenterally, it can be formulated as injections, infusions, or suppositories. These compositions can be prepared by conventional means and, if necessary, the active compound (i.e., the conjugate) can be mixed with any conventional additive, such as an excipient, binder, disintegrant, lubricant, flavoring agent, solubilizing agent, suspending aid, emulsifying agent, coating agent, or combinations thereof.
[0236] It should be understood that the pharmaceutical compositions of the present disclosure can further include additional known therapeutic agents, drugs, modifications to prodrugs of compounds, etc. for the medical alleviation, mediation, prevention, and treatment of the diseases, disorders, and conditions described herein.
[0237] Suitably, the pharmaceutical composition is for use as a medicine. Suitably, it is for use as a medicine in the same manner as described herein for the conjugate. All the features described herein regarding the medical procedures using the conjugate apply to this pharmaceutical composition.
[0238] Accordingly, in a further aspect of the invention, there is provided a pharmaceutical composition as described in the fourth aspect for use as a medicine. In a further aspect, there is provided a method of treating a subject for a disease state, comprising administering to the subject an effective amount of the pharmaceutical composition described in the fourth aspect.
[0239] Medical use The conjugate comprising the peptide of the present invention can be used as a medicine for treating diseases.
[0240] The medicine can be in the dosage form of the pharmaceutical composition defined above.
[0241] There is also provided a method of treating a patient or subject in need of treatment for a disease state, comprising the step of administering to the patient or subject a therapeutically effective amount of the conjugate.
[0242] Suitably, the medical procedure requires the delivery of a therapeutic molecule to a cell, suitably to the nucleus of the cell.
[0243] The diseases to be treated can include any disease in which improvement in the penetration of a therapeutic molecule through the cell and / or nuclear membrane can result in an improvement in the therapeutic effect.
[0244] Suitably, the conjugate is for use in the treatment of diseases of the neuromuscular system.
[0245] Conjugates comprising the peptide of the present invention are suitable for the treatment of genetic diseases of the neuromuscular system. Conjugates comprising the peptide of the present invention are suitable for the treatment of hereditary neuromuscular diseases. In a suitable embodiment, a conjugate as described in the second aspect for use in the treatment of genetic diseases of the neuromuscular system is provided. Suitably, the conjugate is for use in the treatment of genetic hereditary diseases. Suitably, the conjugate is for use in the treatment of genetic hereditary diseases of the neuromuscular system. Suitably, the conjugate is for use in the treatment of hereditary genetic neuromuscular diseases. Suitably, the conjugate is for use in the treatment of genetic X-linked hereditary diseases of the neuromuscular system. Suitably, the conjugate is for use in the treatment of hereditary X-linked neuromuscular diseases.
[0246] Suitably, the conjugate is for use in the treatment of diseases caused by splicing defects. In such embodiments, the therapeutic molecule can comprise an oligonucleotide capable of preventing or correcting splicing defects and / or increasing the production of correctly spliced mRNA molecules.
[0247] Suitably, the conjugate is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), Menkes disease, beta-thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), myotonic dystrophy (DM), Huntington's disease, Hutchinson-Gilford progeria syndrome, ataxia telangiectasia, or cancer.
[0248] In one embodiment, the conjugate is for use in the treatment of DMD.
[0249] In one embodiment, a conjugate as described in the second aspect for use in the treatment of DMD is provided. Suitably, in such embodiments, the therapeutic molecule of the conjugate is operable to increase the expression of the dystrophin protein. Suitably, in such embodiments, the therapeutic molecule of the conjugate is operable to increase the expression of a functional dystrophin protein.
[0250] Suitably, the conjugate increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Suitably, the conjugate increases the expression of dystrophin by up to 50%.
[0251] Suitably, the conjugate restores the expression of the dystrophin protein by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Suitably, the conjugate restores the expression of the dystrophin protein by up to 50%.
[0252] Suitably, the conjugate restores the function of the dystrophin protein by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Suitably, the conjugate restores the function of the dystrophin protein by up to 50%.
[0253] Suitably, the therapeutic molecule of the conjugate is operable to do so by causing skipping of one or more exons during dystrophin transcription.
[0254] Suitably, the therapeutic molecule of the conjugate causes skipping of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% of one or more exons of the dystrophin gene. Suitably, the therapeutic molecule of the conjugate causes skipping of up to 50% of one or more exons of the dystrophin gene.
[0255] Suitably, the patient or subject to be treated can be any animal or human. Suitably, the patient or subject can be a non-human mammal. Suitably, the patient or subject can be male or female. In one embodiment, the subject is male.
[0256] Suitably, the patient or subject to be treated can be of any age. Suitably, the patient or subject to be treated is between 0 and 40 years of age, suitably between 0 and 30 years of age, suitably between 0 and 25 years of age, suitably between 0 and 20 years of age.
[0257] Suitably, the conjugate is systemically administered to the subject by, for example, intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, intraoral, intranasal routes.
[0258] In one embodiment, the conjugate is for intravenous administration to a subject.
[0259] In one embodiment, the conjugate is for intravenous administration to a subject by injection.
[0260] Suitably, the conjugate is for administration to a subject in a "therapeutically effective amount", which thereby means that the amount is sufficient for showing benefit to the individual. The actual amount administered, as well as the rate and time course of administration, depend on the nature and severity of the disease to be treated. Determination of dosage is within the responsibility of the general practitioner and other physicians. Examples of techniques and protocols can be found in Remington’s Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
[0261] Exemplary dosages can be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, between 13 mg / kg and 17 mg / kg.
[0262] Advantageously, the dosage of the conjugate of the present invention is in an order or degree lower than the dosage required to see any effect from the therapeutic molecule alone.
[0263] Suitably, after administration of the conjugate of the present invention, one or more markers of toxicity are significantly reduced compared to conjugates prior to using currently available peptide carriers.
[0264] A suitable marker of toxicity can be a marker of nephrotoxicity.
[0265] Suitable markers of toxicity include KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartic acid aminotransferase.
[0266] Suitably, the level of at least one of KIM-1, NGAL, and BUN decreases after administration of the conjugate of the present invention as compared to a previous conjugate using an available peptide carrier.
[0267] Suitably, the level of each of KIM-1, NGAL, and BUN decreases after administration of the conjugate of the present invention as compared to a previous conjugate using an available peptide carrier.
[0268] Suitably, the level of said marker or each marker decreases significantly as compared to a previous conjugate using an available peptide carrier.
[0269] Suitably, the level of said marker or each marker decreases by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% after administration of the conjugate of the present invention as compared to a previous conjugate using an available peptide carrier.
[0270] Advantageously, the toxicity of the peptide and the conjugate thereby obtained decreases significantly as compared to previous cell-penetrating peptides and conjugates. In particular, KIM-1 and NGAL-1 are markers of toxicity, and these decrease significantly by up to 120-fold as compared to previous conjugates using available peptide carriers.
[0271] Nucleic acid and host The peptides of the present invention can be produced by any standard protein synthesis method, such as chemical synthesis, semi-chemical synthesis, or via the use of an expression system.
[0272] Accordingly, the present invention also relates to a nucleotide sequence comprising or consisting of DNA encoding a peptide, a vector comprising said sequence together with sequences necessary for expression and control of expression, and a host cell and host organism transformed by said expression system.
[0273] Accordingly, nucleic acids encoding the peptides described in the present invention are also provided.
[0274] Suitably, the nucleic acid can be provided in isolated or purified form.
[0275] Expression vectors containing nucleic acids encoding the peptides described in the present invention are also provided.
[0276] Suitably, the vector is a plasmid.
[0277] Suitably, the vector contains control sequences, such as a promoter operably linked to a nucleic acid encoding the peptide described in the present invention. Suitably, the expression vector is capable of expressing the peptide when transfected into a suitable cell, such as a mammalian, bacterial or fungal cell.
[0278] Host cells containing the expression vectors of the present invention are also provided.
[0279] The expression vector can be selected according to the host cell into which the nucleic acid of the present invention can be inserted. Such transformation of host cells includes those taught by conventional techniques, such as Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the skill of those in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.
[0280] The resulting peptide can be isolated and purified from the host cell by any suitable method, such as precipitation or chromatographic separation, such as affinity chromatography.
[0281] Suitable vectors, hosts, and recombinant techniques are well known in the art.
[0282] As used herein, the term "operably linked" can include situations where a selected nucleotide sequence and a control nucleotide sequence are covalently linked such that the expression of the nucleotide coding sequence is placed under the regulation of the control sequence, and thus the control sequence is capable of effecting transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. Where appropriate, the resulting transcript can then be translated into the desired peptide.
[0283] Certain embodiments of the invention will then be described with reference to the following figures and tables.
[0284] Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of these words mean "including but not limited to" and are not intended (and do not) exclude other parts, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, the specification is to be understood as contemplating both the singular and the plural unless the context requires otherwise.
[0285] Features, integers, characteristics, compounds, chemical moieties or groups described in connection with a particular aspect, embodiment or example of the invention are to be understood as applicable to any other aspect, embodiment or example described herein, unless they are inconsistent therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.
[0286] The present invention is not limited to the details of any of the above embodiments. The present invention extends to any novel one or any novel combination of features disclosed in this specification (including any appended claims, abstract and drawings), or to any novel one or any novel combination of steps of any method or process so disclosed. The attention of the reader is directed to all papers and documents filed simultaneously with or before this specification in connection with this application and published therewith, the contents of such papers and documents being hereby incorporated by reference into this specification.
Examples
[0287] 1. Materials and methods 1.1 P-PMO synthesis and preparation 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Wang resin pre-loaded with Fmoc-β-Ala-OH (0.19 or 0.46 mmol·g -1) was obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, methanol and synthetic grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Penzberg, Germany). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise described. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. A stock solution of α-cyano-4-hydroxycinnamic acid or sinapinic acid in 50% acetonitrile in water at 10 mg·mL -1 was used as a matrix. Error bars are ±0.1%.
[0288] 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a library of peptide variants The peptides were prepared on Wang resin (0.19 or 0.46 mmol·g) pre-loaded with Fmoc-β-Ala-OH -1, prepared on a 10 μmol scale using an Intavis Parallel Peptide Synthesizer by applying standard Fmoc chemistry and following the manufacturer's recommended procedures, or prepared on a 100 μmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK). When synthesizing using the Intavis Parallel Peptide Synthesizer, a double coupling step with a PyBOP / NMM coupling mixture was used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single coupling was performed for all amino acids except arginine, which was done by double coupling. Coupling was carried out once at 75 °C for 5 minutes with a microwave output of 60 watts, except for the arginine residue that was coupled twice. Each deprotection reaction was carried out twice at 75 °C, once for 30 seconds and then for 3 minutes with a microwave output of 35 watts. After synthesis was complete, the resin was washed with DMF (3 × 50 mL), and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride at room temperature in the presence of DIPEA. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment at room temperature for 3 hours with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3 - 10 mL). After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by the addition of cold diethyl ether (15 - 40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 minutes. The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. A linear gradient of CH3CN in 0.1% TFA / H2O was used at 15 mL·min-1 The peptide was purified by preparative HPLC using an RP-C18 column (10×250 mm, Phenomenex Jupiter) at a flow rate of -1 . Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to obtain the peptide as a white solid.
Table 1
[0289] b) Synthesis of a library of PMO-peptide conjugates The 25-mer PMO antisense sequence of mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) was used. The peptide was conjugated to the 3'-end of PMO by its C-terminal carboxyl group. This was achieved using 2.3 equivalents of DIPEA for the peptide and 2.5-fold excess of peptide in the presence of PMO dissolved in DMSO, and 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively. In a few examples, 2.3 equivalents of HBTU were used instead of PyBOP for the activation of the C-terminal carboxyl group of the peptide. Generally, to a solution of the peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 μL), PyBOP (19.2 μL of 0.3 M in NMP), HOAt in (16.7 μL of 0.3 M NMP), DIPEA (1.0 μL), and PMO (100 μL of 10 mM in DMSO) were added. The mixture was left at 40 °C for 2.5 h and the reaction was stopped by the addition of 0.1% TFA in H2O (300 μL). This solution was purified by ion-exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified using an ion-exchange column (Resource S 4 mL, GE Healthcare) at a flow rate of 4 mL·min-1 using a linear gradient of sodium chloride (0 - 1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN. Fractions containing the desired peptide were combined and lyophilized to obtain the peptide-PMO derivative as a white solid. Removal of excess salts from the peptide-PMO conjugate was performed by filtering the fractions recovered after ion-exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of the peptide-PMO was determined by the molar absorption at 265 nm of the conjugate in 0.1 N HCl solution. (See Table 2 for yields). [Table 2] Table 2. Yield of P-PMO conjugate for cell culture analysis (Yield is based on the dry weight of lyophilized purified pPMO. The purity of P-PMO was confirmed by normal-phase HPLC at 220 nm and 260 nm to be higher than 95%. (a) P-PMO was synthesized using HBTU activation instead of PyBOP).
[0290] 1.3 Cell culture Mouse H2k mdx myoblasts were cultured at 33 °C in 10% CO2 in Dulbecco's Modified Eagle Medium (DMEM PPA laboratories) supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold, PAA laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN, Gibco), and 3 pg / μL of γ-interferon (Roche) in gelatin (0.01%)-coated flasks. Cells were seeded at a density of 2 × 10 5 cells / mL into gelatin (0.01%)-coated 24-well plates and left at 33 °C, 10% CO2 for 2 days. After differentiation into myotubes, cells were further grown at 37 °C in 5% CO2 for 2 days in DMEM supplemented with 5% horse serum (Sigma) and 1% PSN.
[0291] 1.4 Cell transfection Cells were incubated with the peptide-PMO conjugate prepared as described above, made in serum-free Opti-MEM, and 350 μL was added in duplicate to each well and incubated at 37 °C for 4 h. The transfection medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN, and the cells were incubated for a further 20 h at 37 °C. Cells were washed with PBS and 0.5 mL of TRI RNA (Sigma) isolation reagent was added to each well. Cells were frozen at -80 °C for 1 h.
[0292] 1.5 RNA extraction and nested RT-PCR analysis Total cellular RNA was extracted using TRI reagent and further precipitated with ethanol. The purified RNA was quantified using a Nanodrop® ND-1000 (Thermo Scientific). RNA (400 ng) was used as a template for RT-PCR using the OneStep RT-PCR Kit (Roche, Indianapolis, USA). See Table 4 for primer sequences. The cycle conditions for the first reverse transcription were 1 cycle of 50 °C for 30 minutes and 94 °C for 7 minutes, followed by 30 cycles of 94 °C for 20 seconds, 55 °C for 40 seconds, and 68 °C for 80 seconds. 1 microliter of the RT-PCR product was used as a template for the second PCR step. Amplification was carried out using 0.5 U of SuperTAQ for 25 cycles at 94 °C for 30 seconds, 55 °C for 1 minute, and 72 °C for 1 minute. The products were separated by electrophoresis using a 1.5% agarose gel. The image of the agarose gel was taken with a Molecular Imager ChemiDoc™ XRS + imaging system (BioRad, UK) and the images were analyzed using Image Lab (V4.1). The exon skipping assay data were analyzed and plotted using Microsoft Excel and represented as the percentage of exon 23 skipping from at least three independent experiments.
[0293] 1.6 Synthesis of PMO-peptide conjugates for testing in H2k mdx mice a) Synthesis of peptide variants The CEM Liberty Blue (trademark) microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry were used to synthesize peptides on a 100 μmol scale following the manufacturer's recommended procedures. The side-chain protecting groups used were unstable to trifluoroacetic acid treatment, and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol) activated with PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% v / v in DMF) was used to remove the N-Fmoc protecting group. Couplings were performed once at 75 °C for 5 minutes with a microwave power output of 60 watts, except for arginine residues which were coupled twice. Each deprotection reaction was carried out twice at 75 °C, once for 30 seconds and then once for 3 minutes with a microwave power output of 35 watts. Upon completion of synthesis, the resin was washed with DMF (3 × 50 mL), and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride at room temperature in the presence of DIPEA. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%, 10 mL) for 3 hours at room temperature. Excess TFA was removed by sparging with nitrogen. The cleaved peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 minutes. The crude peptide pellet was washed three times with cold diethyl ether (3 × 40 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. The peptide was purified by semi-preparative HPLC using a RP-C18 column (10 × 250 mm, Phenomenex Jupiter) at a flow rate of 15 mL·min -1 using a linear gradient of CH3CN in 0.1% TFA / H2O. Detection was performed at 220 nm and 260 nm.
[0294] b) Synthesis of PMO-peptide conjugate The 25-mer PMO antisense sequence (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) of mouse dystrophin exon 23 was used. The peptide was conjugated to the 3'-end of PMO by its C-terminal carboxyl group. This was achieved using 2.3 equivalents of DIPEA for the peptide and 2.5-fold excess of peptide in the presence of PMO dissolved in DMSO, and 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively. In a few examples, HBTU (2.3 equivalents) was used instead of PyBOP for the activation of the C-terminal carboxyl group of the peptide. Generally, to a solution of peptide (10 μmol) in N-methylpyrrolidone (NMP, 100 μL), PyBOP (76.6 μL of 0.3 M in NMP), HOAt in (66.7 μL of 0.3 M NMP), DIPEA (4.0 μL), and PMO (400 μL of 10 mM in DMSO) were added. The mixture was left at 40 °C for 2 h and the reaction was stopped by the addition of 0.1% TFA (1 mL). The reaction product was purified using a cation exchange chromatography column (Resource S 6 mL column, GE Healthcare) at a flow rate of 6 mL·min−1 using a linear gradient of sodium chloride (0–1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN. Removal of excess salts from the peptide-PMO conjugate was performed by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. Prior to use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of the peptide-PMO was determined by the molar absorption at 265 nm of the conjugate in 0.1 N HCl solution. The overall yield (Table 3) was 25–36% based on PMO. [Table 3] Table 3 Yields of P-PMO conjugates synthesized on a larger scale for in vivo analysis (Yields are based on the dry weight of lyophilized purified PPMO. The purity of PPMO was confirmed by reverse-phase HPLC at 220 nm and 260 nm to be >95%. (a) PPMO was synthesized using HBTU activation instead of PyBOP).
[0295] 1.7 In vivo assessment of dystrophin repair by P-PMO Experiments were conducted in the Biomedical Sciences Unit at the University of Oxford in accordance with in-house ethical review under Home Office Project Licence authorisation. Mice were housed in a specific pathogen-free facility with temperature-controlled environment on a 12-hour light-dark cycle. Animals had free access to commercial rodent chow and water.
[0296] Experiments were performed on female 10–12-week-old mdx mice. After restraining the mdx mice, a single intravenous tail injection of 10 mg / kg of P-PMO was administered. One week after the injection, the mice were sacrificed, and the TA, heart, and diaphragm muscles were removed, snap-frozen in dry ice-cooled isopentane, and stored at -80 °C.
[0297] 1.8 Western blot analysis To assess the dystrophin repair period after single administration, one-third of the muscle (for TA and diaphragm) or 7 μm thick transverse frozen sections (for heart) were lysed in 300 μl of buffer (50 mM Tris pH8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS and protease / phosphatase inhibitors) and then centrifuged at 13,000 rpm for 10 minutes (Heraeus, #3325B). The supernatant was collected and heated at 100 °C for 3 minutes. Proteins were quantified by the BCA method and 40 μg of protein / sample was separated on a NuPage 3–8% Tris-acetate gel as previously described (19). Proteins were transferred to a PVDF membrane with a pore size of 0.45 μm at 30 V for 1 hour and then at 100 V for 1 hour and probed with monoclonal anti-dystrophin (1:200, NCL-DYS1, Novocastra) and anti-vinculin (loading control, 1:100,000, hVIN-1, Sigma) antibodies as previously described (37). The secondary antibody IRDye 800CW goat anti-mouse was used at a dilution of 1:20,000 (LiCOR).
[0298] The dystrophin repair level in P-PMO-treated mdx mice was expressed as the relative level to that of C57BL / 10 wild-type control mice considered as 100%. For this purpose, a standard curve was generated by including five serial dilutions of C57BL / 10 proteins in parallel with P-PMO-treated mdx samples. The dilution series was as follows: 75%, 40%, 15%, 5% or 0% of the total 40 μg of protein loaded per lane was from C57BL / 10 protein lysate and the remainder was from untreated mdx protein lysate. These standards were aliquoted and used for each western blot in parallel with treated mdx samples. For all standards and treated samples, quantification of dystrophin intensity was performed by Fluorescence Odyssey imaging system and normalized by calculating the ratio to vinculin fluorescence intensity in all samples. Standard normalized values were plotted against their known dystrophin concentrations to obtain the best-fitting formula, and this formula was used to interpolate the normalized values of each sample of P-PMO-treated mdx mice.
[0299] 1.9 RT-qPCR analysis of Dmd exon 23 skipping in vivo Using skeletal muscle and heart tissues treated with peptide-PMO, quantification of exon 23 exclusion from mouse Dmd transcripts was performed. Briefly, RNA was extracted from homogenized tissues using a Trizol-based extraction method and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify the region spanning exons 23 - 24 representing the non-skipped product (mDMD23-24, see Table 4) or designed to specifically amplify transcripts lacking exon 23 using a probe spanning the junction of exon 22 and exon 24 (mDMD22-24). Each transcript level was calibrated against a standard curve generated using known transcript amounts and the skipping percentage was derived by [skip] / [skip + non-skip].
Table 4
[0300] 1.10 Toxicological evaluation of peptide-PMO Female C57BL / 6 mice at 8 - 10 weeks of age were administered a single dose of 30 mg / kg of peptide-PMO in 0.9% saline by bolus intravenous injection into the tail vein. On the 2nd and 7th days after administration, after housing in metabolic cages (Tecniplast, UK) for 20 hours, urine was non-invasively collected under cooling conditions. At necropsy on the 7th day, serum was collected from the jugular vein, and anterior tibialis muscle, diaphragm, and heart tissues were also collected.
[0301] The same procedure was followed with different single dosing amounts of peptide-PMO in 0.9% saline from 2.5 mg / kg to 50 mg / kg by intravenous injection into the tail vein.
[0302] After appropriately diluting the urine to fit the standard curve, the urinary levels of KIM-1 (kidney injury molecule-1) and NGAL (neutrophil gelatinase-associated lipocalin) were quantified by ELISA (KIM-1 R&D catalog number MKM100, NGAL R&D catalog number MLCN20). The values were normalized against urinary creatinine levels quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK. Serum blood urea nitrogen levels were quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK.
[0303] All levels were quantified using an AU680 Clinical Chemistry Analyser, Beckman Coulter.
[0304] The effectiveness of exon skipping was determined by quantitative RT-PCR of the 23rd exon skipped and non-skipped transcripts and expressed as a percentage of the total (skipped and non-skipped) transcripts for the sequence (see Table 4).
[0305] 2. Results The results provided here demonstrate a clear dose-response effect of the peptide-PMO conjugates generated here on exon skipping activity in cells (Figs. 1, 2, and 12). These figures also emphasize that all of the DPEP1 and DPEP3 systems, i.e., the peptides of the present invention, have sufficient cell permeability effectiveness into cells for therapeutic use considerations.
[0306] The results provided here further emphasize the activity of the peptide-PMO conjugates in vivo in an appropriate mouse model of the disease (Figs. 3 - 4). Overall, these results suggest that the activity of such conjugates is greatest in the tibialis anterior muscle, followed by the diaphragm, and then the heart. These figures demonstrate that the DPEP peptide conjugates of the present invention have good exon skipping activity in vivo and result in an increase in dystrophin protein expression in vivo. Furthermore, the DPEP conjugates of the present invention are comparable to previous cell-penetrating peptides such as the "PIP" peptide and R6Gly in both respects when using the same conjugates.
[0307] It is also demonstrated here that the levels of KIM-1 and NGAL (which are indicators of nephrotoxicity) after administration of the DPEP peptide conjugate compounds are significantly lower than those with conjugates with previous cell-penetrating peptides. The DPEP 1.9 and 3.8 conjugates showed the lowest levels of such markers (Figures 5, 6 and 11). Serum blood urea nitrogen levels (another marker of renal dysfunction) also increased only for the conjugate with Pip9b2 and not for the conjugates with the DPEP peptides of the present invention (Figure 7). The second major finding is that 7 days after administration, the KIM-1 and NGAL levels decrease to near saline levels for all DPEP peptide conjugates, suggesting that there is also some reversal and improvement of kidney-related toxicity. Such an effect was not seen with conjugates using previous cell-penetrating peptides. This reversal effect of toxicity is seen with the DEDP peptides of the present invention even when given at a high dose of 50 mg / kg (Figure 11). Previous cell-penetrating peptides did not show a decrease in toxicity after 7 days and the toxicity markers remained much higher throughout.
[0308] Exon skipping activity remains high in TA and diaphragm at higher doses of 30 and 50 mg / kg for all of the DPEP peptide conjugates (Figures 10 and 12), which is supported by the decreased levels of renal injury markers and suggests a wider therapeutic index for these compounds as the toxicity markers are several-fold lower. All of the DPEP peptide conjugates have higher activity than the known R6Gly comparator in the conjugate, and moreover, at least maintain similar toxicity marker levels, and have similar activity to the known PIP peptide comparator in the conjugate, and moreover, have much lower toxicity marker levels, which is also worthy of note. In some cases, the DPEP peptide conjugates of the present invention show not only an increase in activity but also a reduction in toxicity markers compared to the known R6Gly conjugate.
[0309] Therefore, the DPEP1 and 3 peptides of the present invention provide promising cell-permeable peptides for improving the effectiveness of therapeutic conjugates for the treatment of neuromuscular disorders in humans and reducing toxicity.
[0310] 3. Further Examples P-PMO Synthesis and Preparation 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Wang resin preloaded with Fmoc-β-Ala-OH (0.19 or 0.46 mmol·g -1 ) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthetic-grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis-grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise described. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. A stock solution of 10 mg·mL-1 α-cyano-4-hydroxycinnamic acid or sinapinic acid in 50% acetonitrile in water was used as the matrix. Error bars are ±0.1%.
[0311] Synthesis of P-PMO Peptides for Screening in Cells a) Preparation of a library of peptide variants The peptides were prepared on a 10 μmol scale using an Intavis Parallel Peptide Synthesizer by applying standard Fmoc chemistry following the manufacturer's recommended procedures, using Wang resin (0.19 or 0.46 mmol·g-1, Merck Millipore) pre-loaded with Fmoc-β-Ala-OH, or on a 100 μmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK). When synthesizing using the Intavis Parallel Peptide Synthesizer, a double coupling step with a PyBOP / NMM coupling mixture was used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single-chain coupling was performed for all amino acids except for arginine, which was done by double coupling. The coupling was carried out once at 75 °C for 5 minutes with a microwave output of 60 watts, except for the arginine residues that were coupled twice. Each deprotection reaction was carried out twice at 75 °C, once for 30 seconds and then for 3 minutes with a microwave output of 35 watts. After synthesis was complete, the resin was washed with DMF (3 × 50 mL), and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride at room temperature in the presence of DIPEA. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3 - 10 mL) for 3 hours at room temperature. After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by the addition of cold diethyl ether (15 - 40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 minutes.The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. A linear gradient of CH3CN in 0.1% TFA / H2O was used at a flow rate of 15 mL·min−1. -1 The peptide was purified by preparative HPLC using a RP-C18 column (10 × 250 mm, Phenomenex Jupiter) at a flow rate of -1 . Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to afford the peptide as a white solid (see Table 5 for yields).
Table 5
[0312] b) Synthesis of a library of peptide-PMO conjugates The 21-mer PMO antisense sequence of the triplet repeat sequence (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 107)), known as [CAG]7 alias, was used. The peptide was conjugated to the 3'-end of PMO by its C-terminal carboxyl group. This was achieved using 2.5 equivalents of DIPEA and 2.5-fold excess of peptide in the presence of PMO dissolved in DMSO, with 2.5 and 2 equivalents of PyBOP and HOAt in NMP, respectively. Generally, to a solution of peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 μL), PyBOP (19.2 μL of 0.3 M in NMP), HOAt (16.7 μL of 0.3 M NMP), DIPEA (1.0 mL), and PMO (180 μL of 10 mM in DMSO) were added. The mixture was left at 40 °C for 2.5 h and the reaction was stopped by the addition of 0.1% TFA in H2O (300 μL). This solution was purified by ion-exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified using an ion-exchange column (Resource S 4 mL, GE Healthcare) with a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN. The conjugate was eluted from the column at a flow rate of either 4 mL·min -1 or 6 mL·min -1 . The fractions containing the desired compound were combined and desalted immediately. Removal of excess salts from the peptide-PMO conjugate was performed by filtering the fractions collected after ion-exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of peptide-PMO was determined by the molar absorption at 265 nm of the conjugate in 0.1 N HCl solution. (See Table 6 for yields).
Table 6
[0313] Peptide-PMO conjugate synthesis. Peptides were synthesized and conjugated to PMO as described above. The PMO sequence targeting CUG / CTG expansion repeats (5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 107)) was purchased from Gene Tools LLC. This is referred to herein elsewhere as [CAG]7 PMO.
[0314] Cell culture and peptide-PMO treatment Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of a mixture of M199:DMEM (1:4 ratio, Life technologies) supplemented with 20% FBS (Life technologies), 50 μg / ml gentamicin (Life technologies), 25 μg / ml fetuin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). Confluent cell cultures were induced to differentiate by switching to DMEM medium supplemented with 5 μg / ml insulin (Sigma-Aldrich) for myoblasts. For treatment, WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO conjugates at concentrations of 1, 2, 5, 10, 20, or 40 μM. Cells were harvested for analysis 48 hours after treatment. Two days after transfection of 40 μM into human hepatocytes or 1, 2, 5, 10, 20, or 40 μM concentration of peptide-PMO into human myoblasts, cell viability in human hepatocytes and human myoblasts was quantified using a fluorescence-based assay (Promega).
[0315] RNA Isolation, RT-PCR, and qPCR Analysis. For mouse tissues: Prior to RNA extraction, muscle was disrupted with TriReagent (Sigma-Aldrich) using a Fastprep system and Lysing Matrix D tubes (MP biomedicals). For human cells: Prior to RNA extraction, cells were lysed in protein kinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS, and 0.5 mg / ml protein kinase K) at 55 °C for 45 minutes. Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using a total of 20 μL of M-MLV first-strand synthesis system (Life Technologies) according to the manufacturer's instructions. Subsequently, 1 microliter of the cDNA preparation was used in semi-quantitative PCR analysis according to the standard protocol (ReddyMix, Thermo Scientific). PCR amplification was performed for 25 - 35 cycles within the linear amplification range for each gene. The PCR products were separated on a 1.5 - 2% agarose gel, stained with ethidium bromide, and quantified using ImageJ software. The exon inclusion rate was quantified as the percentage of inclusion relative to the total intensity of the isoform signal. Primers are shown in Table 7 below.
Table 7
[0316] Toxicology Toxicological evaluations were conducted as described in Section 1.10 above.
[0317] Results Muscle cells (myoblasts) derived from treated DM1 patients showed that DPEP1 or the 3 - peptide - [CAG]7 PMO conjugate specifically targeted the mutant CUGexp - DMPK transcript, suppressing the harmful sequestration of the MBNL1 splicing factor by nuclear RNA foci and the resulting decrease in MBNL1 function, which cause splicing defects and muscular dystrophy. The DPEP1 / 3 - peptide - [CAG]7 PMO conjugate permeated cells and induced splicing normalization with high efficacy (Figure 13). These newly generated so - called "DPEP1 and DPEP3" peptides showed high efficacy in correcting splicing defects in vitro when conjugated with the CAG7 repeat antisense oligonucleotide PMO, indicating that it may be potentially used for the treatment of DM1.
[0318] Furthermore, preliminary toxicological evaluations of conjugates formed using DPEP1 / 3 showed that ALP, ALT, AST, KIM - 1, BUN, NGAL, and creatinine levels were similar to saline control injections, in contrast to the fold increases typically induced by currently available peptide carriers from the Pip system. This preliminary data revealed that conjugates formed from the DPEP peptide and [CAG]7 PMO are as active as conjugates formed using previous peptides such as Pip6a but have a lower toxicity and thus a broader therapeutic window (Figures 15 - 19).
Claims
**Claim 1** Two or more cationic domains each containing at least 4 amino acid residues, and One or more hydrophobic domains each containing at least 3 amino acid residues A peptide having a total length of 40 amino acid residues or less, comprising A peptide that does not contain artificial amino acid residues.
Citation Information
Patent Citations
peptide
JP2011523557A
Cell-permeable peptides and their use
JP2013531988A
peptides
WO2013030569A2
Peptide conjugates
WO2015022504A2