Modified phenylalanine dehydrogenase
Amino acid mutations in phenylalanine dehydrogenase enhance substrate specificity and solubility, addressing measurement inaccuracies and enzyme aggregation, enabling precise phenylalanine detection for clinical and food analysis.
Patent Information
- Application Number
- JP2025065143
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-10-11
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2040-10-09
AI Technical Summary
Wild-type phenylalanine dehydrogenase exhibits low substrate specificity, leading to inaccurate phenylalanine measurements due to reactivity with tyrosine, and low water solubility causing enzyme aggregation and measurement inaccuracies.
A modified phenylalanine dehydrogenase with specific amino acid mutations in motifs (1) to (6) improves substrate specificity, solubility, and enzyme activity, enhancing measurement accuracy.
The modified enzyme enables rapid, highly accurate, and sensitive phenylalanine measurement, suitable for clinical diagnosis and food analysis, with improved solubility preventing enzyme segregation.
Smart Images

Figure 2025106504000016 
Figure 2025106504000017 
Figure 2025106504000018
Abstract
Description
Technical Field
[0001] The present invention relates to a modified phenylalanine dehydrogenase and a method for analyzing phenylalanine using the same.
Background Art
[0002] Phenylalanine, which is a kind of amino acid, is a biomarker that accumulates in large amounts in the blood and urine of patients with phenylketonuria (a hereditary phenylalanine metabolism disorder), and the measurement of phenylalanine is extremely important in clinical diagnosis. In addition, patients with phenylketonuria require a diet restricted in phenylalanine content, and the measurement of phenylalanine content in foods is also important. As a method for measuring phenylalanine, an enzymatic measurement method using phenylalanine dehydrogenase derived from Thermoactinomyces intermedius (for example, Patent Document 1) is known.
[0003] As a method for measuring phenylalanine, an enzymatic measurement method using phenylalanine dehydrogenase derived from Thermoactinomyces intermedius (for example, Patent Document 1) is known. In addition, analysis of amino acid residues involved in the activity etc. of phenylalanine dehydrogenase has been carried out (Non-Patent Documents 1 to 4).
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Non-Patent Documents
[0005]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Summary of the Invention
Problems to be Solved by the Invention
[0006] In the measurement of phenylalanine using the aforementioned enzyme, it is desirable that the characteristics of the enzyme related to the measurement of phenylalanine (e.g., substrate specificity, solubility, and enzyme activity) be excellent. However, wild-type phenylalanine dehydrogenase has a problem that its substrate specificity is low because it shows reactivity with, for example, tyrosine, resulting in low measurement accuracy of phenylalanine. In addition, wild-type phenylalanine dehydrogenase is provided in a suspension state because of its low water solubility, and segregation of the enzyme usage amount occurs due to aggregation or the like, raising concerns about the influence on the measurement accuracy of phenylalanine. Therefore, when putting it into practical use for more accurate measurement of phenylalanine, an enzyme having higher substrate specificity, solubility, and enzyme activity is required.
[0007] An object of the present invention is to provide a modified phenylalanine dehydrogenase suitable for practical use for more accurate measurement of phenylalanine.
Means for Solving the Problems
[0008] As a result of intensive studies, the present inventors conceived that the phenylalanine concentration may be measured by using an enzyme with improved characteristics (e.g., substrate specificity, solubility, and enzyme activity) related to the measurement of phenylalanine, and succeeded in developing a phenylalanine dehydrogenase with such improved characteristics, thus completing the present invention.
[0009] That is, the present invention is as follows. [(1)] In phenylalanine dehydrogenase containing at least one motif selected from the group consisting of motifs (1) to (6) (wherein X represents any amino acid), at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6) is mutated, which has phenylalanine dehydrogenase activity and at least one property selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity is higher than that of wild-type phenylalanine dehydrogenase, a modified phenylalanine dehydrogenase: Motif (1): GPALGGXRM (SEQ ID NO: 3) motif; Motif (2): GRFXTGTDMGT (SEQ ID NO: 4) motif; Motif (3): DF motif; Motif (4): GXANN (SEQ ID NO: 5) motif; Motif (5): RH motif; Motif (6): VNXGGLIQV (SEQ ID NO: 6) motif. [(2)] The modified phenylalanine dehydrogenase according to [(1)], wherein the mutation is one or more substitutions selected from the group consisting of the following in the amino acid sequence of phenylalanine dehydrogenase: (a) Substitution of leucine in the GPALGGXRM (SEQ ID NO: 3) motif; (b) Substitution of threonine, which is the 7th amino acid residue in the GRFXTGTDMGT (SEQ ID NO: 4) motif; (c) Substitution of phenylalanine in the DF motif; (d) Substitution of asparagine, which is the 4th amino acid residue in the GXANN (SEQ ID NO: 5) motif; (e) Substitution of arginine in the RH motif; (f) Substitution of asparagine in the VNXGGLIQV (SEQ ID NO: 6) motif; (g) Substitution of leucine in the VNXGGLIQV (SEQ ID NO: 6) motif; (h) Substitution of glutamine in the VNXGGLIQV (SEQ ID NO: 6) motif; and (i) Substitution of valine, which is the 9th amino acid residue in the VNXGGLIQV (SEQ ID NO: 6) motif. [3] The modified phenylalanine dehydrogenase according to [2], wherein the mutation is one or more substitutions selected from the group consisting of the following in the amino acid sequence of phenylalanine dehydrogenase: (a) Substitution of leucine with tryptophan, phenylalanine, tyrosine, or methionine in the GPALGGXRM (SEQ ID NO: 3) motif; (b) Substitution of threonine, which is the 7th amino acid residue in the GRFXTGTDMGT (SEQ ID NO: 4) motif, with serine; (c) Substitution of phenylalanine with leucine or isoleucine in the DF motif; (d) Substitution of asparagine, which is the 4th amino acid residue in the GXANN (SEQ ID NO: 5) motif, with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine with aspartic acid or glutamic acid in the RH motif; (f) Substitution of asparagine with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine in the VNXGGLIQV (SEQ ID NO: 6) motif; (g) Substitution of leucine with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine in the VNXGGLIQV (SEQ ID NO: 6) motif; (h) Substitution of glutamine with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine in the VNXGGLIQV (SEQ ID NO: 6) motif; and (i) Substitution of valine, which is the 9th amino acid residue in the VNXGGLIQV (SEQ ID NO: 6) motif, with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine. 〔4〕The phenylalanine dehydrogenase is a modified phenylalanine dehydrogenase according to any one of 〔1〕 to 〔3〕, which contains all of the motifs (1) to (6) in this order. 〔5〕The phenylalanine dehydrogenase is a modified phenylalanine dehydrogenase according to any one of 〔1〕 to 〔4〕, which is derived from the genus Thermoactinomyces. 〔6〕The phenylalanine dehydrogenase (A) an amino acid sequence represented by SEQ ID NO: 1, (B) an amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, or (C) an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1 The modified phenylalanine dehydrogenase according to any one of 〔1〕 to 〔5〕, which contains 〔7〕The following: (A) an amino acid sequence represented by SEQ ID NO: 1, (B) an amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, or (C) an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1 In the phenylalanine dehydrogenase containing any one of the amino acid sequences of The following: R2, R10, Y11, C19, L41, G42, G43, C44, A50, S51, M66, C70, F77, K90, Y112, T115, D116, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, K216, K220, Q222, N227, R228, C234, C240, R255, C256, L257, N264, R271, Q277, K278, R279, S280, C282, N290, G293, L294, Q296, V297, R326, K328, N329, N331, C335, R340, K347, and K348 Containing a mutation of an amino acid residue corresponding to one or more amino acid residues selected from having phenylalanine dehydrogenase activity and having improved one or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity modified phenylalanine dehydrogenase. [8] The modified phenylalanine dehydrogenase according to [7], comprising substitution of an amino acid residue corresponding to one or more amino acid residues selected from the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, A50D, A50E, S51D, S51E, M66I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, K90E, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K144G, T147A, T147S, T147N, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, C256S, L257K, N264G, N264Q, N264T, N264K, N264P, N264S, R271D, R271E, Q277D, K278D, K278E, R279D, R279E, S280D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N290I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, R326E, K328E, K328D, N329D, N331E, N331D, C335A, C335S, R340D, R340E, K347D, and K348E. 〔9〕 A method for analyzing phenylalanine, comprising measuring phenylalanine contained in a test sample using a modified phenylalanine dehydrogenase according to any one of 〔1〕 to 〔8〕. 〔10〕 Mixing the test sample with nicotinamide adenine dinucleotide (NAD + ) and, by the action of the modified phenylalanine dehydrogenase, NAD +The method of [9], which includes detecting NADH generated therefrom. The method for producing phenylpyruvate, which includes producing phenylpyruvate from phenylalanine using any one of the modified phenylalanine dehydrogenases of [1] to [8]. The polynucleotide encoding any one of the modified phenylalanine dehydrogenases of [1] to [8]. The expression vector containing the polynucleotide of
[12] . The transformant containing the expression unit of the polynucleotide encoding any one of the modified phenylalanine dehydrogenases of [1] to [8]. The method for producing a modified phenylalanine dehydrogenase, which includes producing a modified phenylalanine dehydrogenase in which at least one amino acid residue is mutated so as to improve one or more characteristics selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity, using the transformant of
[14] . The kit for phenylalanine analysis, which includes any one of the modified phenylalanine dehydrogenases of [1] to [8]. The kit for phenylalanine analysis of
[16] , which further includes at least one of a reaction buffer or buffer salt, and nicotinamide adenine dinucleotide (NAD + ). The enzyme sensor for phenylalanine analysis, which includes (a) a detection electrode, and (b) any one of the modified phenylalanine dehydrogenases of [1] to [8] fixed or disposed on the detection electrode.
Advantages of the Invention
[0010] The modified phenylalanine dehydrogenase of the present invention is useful for the rapid, highly accurate, and highly sensitive measurement of phenylalanine and / or the production of phenylpyruvate because its substrate specificity has been improved. The modified phenylalanine dehydrogenase of the present invention is also useful for the uniform and highly accurate measurement of phenylalanine because its solubility has been improved, and segregation of the amount of enzyme used due to aggregation or the like does not occur. The modified phenylalanine dehydrogenase of the present invention is further useful for the rapid and highly sensitive measurement of phenylalanine and / or the production of phenylpyruvate because its phenylalanine dehydrogenase activity has been improved. The modified phenylalanine dehydrogenase of the present invention is particularly useful as a liquid reagent. The analysis method of the present invention is useful for the diagnosis of diseases such as phenylketonuria and the measurement of the phenylalanine content in foods, for example.
Brief Description of the Drawings
[0011]
Figure 1
Figure 2
Figure 3
Mode for Carrying Out the Invention
[0012] The present invention provides a modified phenylalanine dehydrogenase. The modified phenylalanine dehydrogenase of the present invention has at least one amino acid residue mutated so as to improve one or more characteristics related to the measurement of phenylalanine, selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity (hereinafter, also simply referred to as "enzyme activity" or "activity").
[0013] Examples of the mutation of the amino acid residue include substitution, deletion, addition, and insertion, with substitution being preferred.
[0014] The amino acid residue to be mutated is a natural L-α-amino acid, L-alanine (A), L-asparagine (N), L-cysteine (C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S), L-threonine (T), L-tryptophan (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R), L-histidine (H), or L-lysine (K), or glycine (G). When the mutation is substitution, addition, or insertion, the amino acid residue to be substituted, added, or inserted is the same as the amino acid residue to be mutated described above. Hereinafter, the notations of L and α may be omitted for amino acids.
[0015] Phenylalanine dehydrogenase (sometimes denoted as PheDH) is an oxidoreductase that catalyzes the following reaction (EC 1.4.1.20). L-phenylalanine + NAD + + H2O ←→ Phenylpyruvate + NH4 + + NADH
[0016] As the phenylalanine dehydrogenase from which the modified phenylalanine dehydrogenase of the present invention is derived, for example, enzymes derived from any organism (e.g., microorganisms such as bacteria, actinomycetes, and fungi, as well as insects, fish, animals, and plants) can be used. For example, phenylalanine dehydrogenases derived from bacteria of the genus Thermoactinomyces (e.g., Thermoactinomyces intermedius, Thermoactinomyces sp.), bacteria of the genus Lihuaxuella (e.g., Lihuaxuella thermophile), bacteria of the genus Baia (e.g., Baia soyae), bacteria of the genus Caldalkalibacillus (e.g., Caldalkalibacillus thermarum), bacteria of the genus Bacillus (e.g., Bacillus badius, Bacillus sp., Bacillus halodurans, Lysinibacillus sphaericus (also called Bacillus sphaericus)), bacteria of the genus Fictibacillus (e.g., Fictibacillus nanhaiensis), bacteria of the genus Lysinibacillus (e.g., Lysinibacillus sphaericus (also called Bacillus sphaericus)), bacteria of the genus Sporosarcina (e.g., Sporosarcina ureae), bacteria of the genus Rhodococcus (e.g., Rhodococcus sp.) and related genera can be mentioned. Among the above bacteria, bacteria of the genus Thermoactinomyces are preferred, and Thermoactinomyces intermedius is more preferred. Examples of wild-type phenylalanine dehydrogenase are shown in Table 1 below.
[0017]
Table 1
[0018] Examples of wild-type phenylalanine dehydrogenase include wild-type phenylalanine dehydrogenases containing at least one (e.g., 1, 2, 3, 4, 5, or 6) motif selected from the group consisting of the following motifs (1) to (6). The wild-type phenylalanine dehydrogenase preferably contains a plurality (e.g., 2, 3, 4, 5, or 6) of motifs selected from the group consisting of motifs (1) to (6) in this order (the "order" refers to the order from the N-terminus to the C-terminus in the amino acid sequence), more preferably may contain all of motifs (1) to (6), and even more preferably may contain all of motifs (1) to (6) in this order. Hereinafter, the motifs are represented by one-letter amino acid sequences, and X represents any amino acid (any of the 20 amino acids constituting a protein, namely alanine (A), asparagine (N), cysteine (C), glutamine (Q), isoleucine (I), leucine (L), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), valine (V), aspartic acid (D), glutamic acid (E), arginine (R), histidine (H), lysine (K), and glycine (G)). Motif (1): GPALGGXRM (SEQ ID NO: 3) motif; Motif (2): GRFXTGTDMGT (SEQ ID NO: 4) motif; Motif (3): DF motif; Motif (4): GXANN (SEQ ID NO: 5) motif; Motif (5): RH motif; Motif (6): VNXGGLIQV (SEQ ID NO: 6) motif.
[0019] Motifs (1), (2), (4), and (6) include the following motifs (1a), (2a), (4a), (6a), and (6b) as motifs represented by shorter amino acid sequences. Therefore, wild-type phenylalanine dehydrogenase may be a wild-type phenylalanine dehydrogenase containing at least one (e.g., 1, 2, 3, 4, 5, 6, or 7) motif selected from the group consisting of, for example, motifs (1a), (2a), (3), (4a), (5), (6a), and (6b), preferably a plurality (e.g., 2, 3, 4, 5, 6, or 7) of motifs selected from the group consisting of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) in this order, more preferably including all of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b), and even more preferably including all of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) in this order. Motif (1a): the GPALGG (SEQ ID NO: 7) motif in motif (1); Motif (2a): the TGTDMGT (SEQ ID NO: 8) motif in motif (2); Motif (4a): the ANN motif in motif (4); Motif (6a): the VN motif in motif (6); Motif (6b): the GGLIQV (SEQ ID NO: 9) motif in motif (6).
[0020] The modified phenylalanine dehydrogenase of the present invention has at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6) (for example, at least one amino acid residue in at least one motif selected from the group consisting of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b)) mutated in the above-described wild-type phenylalanine dehydrogenase, has phenylalanine dehydrogenase activity, and at least one property selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity is higher than that of the wild-type phenylalanine dehydrogenase. It may be a modified phenylalanine dehydrogenase.
[0021] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of leucine, the fifth amino acid residue glycine, or the sixth amino acid residue glycine in the motif (1) (GPALGGXRM (SEQ ID NO: 3) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (1) is composed of nine consecutive amino acid residues of GPALGGXRM (SEQ ID NO: 3) (X represents any amino acid residue). Also, the amino acid residue to be substituted can be specified as leucine, the fifth amino acid residue glycine, or the sixth amino acid residue glycine in motif (1a) (GPALGG (SEQ ID NO: 7) motif) represented by a shorter amino acid sequence in motif (1). The positions of motif (1) or (1a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the positions of motif (1) or (1a) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can specify the positions of leucine or glycine (the fifth or sixth) to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (1) is within the amino acid region at positions 38 to 46, motif (1a) is within the amino acid region at positions 38 to 43, the leucine to be substituted is at position 41, the glycine (the fifth) to be substituted is at position 42, and the glycine (the sixth) to be substituted is at position 43 (see, for example, Table 2, Figure 1).
[0022]
Table 2
[0023] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of the threonine that is the 7th amino acid residue in the motif (2) (GRFXTGTDMGT (SEQ ID NO: 4) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (2) is composed of 11 consecutive amino acid residues of GRFXTGTDMGT (SEQ ID NO: 4) (X represents any amino acid residue). Also, the amino acid residue to be substituted can be specified as the threonine that is the 3rd amino acid residue in motif (2a) (TGTDMGT (SEQ ID NO: 8) motif) represented by a shorter amino acid sequence in motif (2). The positions of motif (2) or (2a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the positions of motif (2) or (2a) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can specify the position of the threonine to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (2) is within the amino acid region at positions 109 to 119, motif (2a) is within the amino acid region at positions 113 to 119, and the threonine to be substituted is at position 115 (see, for example, Table 3, Figure 2).
[0024]
Table 3
[0025] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of phenylalanine in the motif (3) (DF motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (3) is composed of two consecutive amino acid residues of DF. The position of motif (3) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the position of motif (3) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can identify the position of the phenylalanine to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (3) is within the amino acid region at positions 123 to 124, and the phenylalanine to be substituted is at position 124 (see, for example, Table 4 and Figure 2).
[0026] [Table 4]
[0027] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of asparagine, which is the fourth amino acid residue in motif (4) (GXANN (SEQ ID NO: 5) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (4) is composed of five consecutive amino acid residues of GXANN (SEQ ID NO: 5) (where X represents any amino acid residue). Also, the amino acid residue to be substituted can be specified as asparagine, which is the second amino acid residue in motif (4a) (ANN motif) represented by a shorter amino acid sequence in motif (4). The positions of motif (4) or (4a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the positions of motif (4) or (4a) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can specify the position of asparagine to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (4) is within the amino acid region at positions 261 to 265, motif (4a) is within the amino acid region at positions 263 to 265, and the asparagine to be substituted is at position 264 (see, for example, Table 5, Figure 3).
[0028]
Table 5
[0029] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of arginine in motif (5) (RH motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (5) is composed of two consecutive amino acid residues of RH. The position of motif (5) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the position of motif (5) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can identify the position of the arginine to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (5) is within the amino acid region at positions 271 to 272, and the arginine to be substituted is at position 271 (see, for example, Table 6, Figure 3).
[0030] [Table 6]
[0031] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is a substitution of asparagine, the fifth amino acid residue glycine, leucine, glutamine, or valine, the ninth amino acid residue in the motif (6) (VNXGGLIQV (SEQ ID NO: 6) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (6) is composed of nine consecutive amino acid residues of VNXGGLIQV (SEQ ID NO: 6) (X represents any amino acid residue). Also, the amino acid residue to be substituted can be specified as asparagine in motif (6a) (VN motif) represented by a shorter amino acid sequence in motif (6), or glycine, leucine, glutamine, or valine, the second amino acid residue in motif (6b) (GGLIQV (SEQ ID NO: 9) motif) represented by a shorter amino acid sequence in motif (6). The positions of motif (6), (6a), or (6b) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the positions of motif (6), (6a), or (6b) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus can specify the positions of asparagine, glycine, leucine, glutamine, or valine to be substituted. Usually, in the amino acid sequence of phenylalanine dehydrogenase, motif (6) is within the amino acid region at positions 289 to 297, motif (6a) is within the amino acid region at positions 289 to 290, motif (6b) is within the amino acid region at positions 292 to 297, the asparagine to be substituted is at position 290, the glycine to be substituted is at position 293, the leucine to be substituted is at position 294, the glutamine to be substituted is at position 296, and the valine to be substituted is at position 297 (see, for example, Table 7, Figure 3).
[0032]
Table 7
[0033] The modified phenylalanine dehydrogenase of the present invention can be prepared by introducing mutations into a wild-type enzyme having one or more motifs selected from motifs (1) to (6). The wild-type enzyme may have two motifs selected from motifs (1) to (6), may have three motifs, may have four motifs, may have five motifs, or may have six motifs. Further, the modified phenylalanine dehydrogenase of the present invention can be prepared by introducing mutations into a wild-type enzyme having one or more motifs selected from motifs (1a), (2a), (3), (4a), (5), (6a), and (6b). The wild-type enzyme may have two motifs selected from motifs (1a), (2a), (3), (4a), (5), (6a), and (6b), may have three motifs, may have four motifs, may have five motifs, may have six motifs, or may have seven motifs.
[0034] Properties of phenylalanine dehydrogenase related to the measurement of phenylalanine include substrate specificity, solubility, and enzyme activity. The modified phenylalanine dehydrogenase of the present invention may have only one of the above-described properties, or may have two or three of the above-described properties in combination.
[0035] The amino acid residues specified by motifs (1) to (6) may be specified by motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) based on the above-described correspondence.
[0036] Examples of mutations in the above six motifs that improve at least one property selected from substrate specificity, solubility, and enzyme activity (single mutations or combinations with other mutations) include, for example: (a) Substitution of leucine in motif (1) with tryptophan, phenylalanine, tyrosine, or methionine; Substitution of glycine, the 5th amino acid residue in the (a+) motif (1), with alanine; Substitution of glycine, the 6th amino acid residue in the (a++) motif (1), with alanine; Substitution of threonine, the 7th amino acid residue in the (b) motif (2), with serine; Substitution of phenylalanine in the (c) motif (3) with leucine or isoleucine; Substitution of asparagine, the 4th amino acid residue in the (d) motif (4), with glycine, glutamine, threonine, lysine, proline, or serine; Substitution of arginine in the (e) motif (5) with aspartic acid or glutamic acid; Substitution of asparagine in the (f) motif (6) with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; Substitution of glycine, the 5th amino acid residue in the (g-) motif (6), with alanine; Substitution of leucine in the (g) motif (6) with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; Substitution of glutamine in the (h) motif (6) with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and Substitution of valine, the 9th amino acid residue in the (i) motif (6), with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine.
[0037] When the modified phenylalanine dehydrogenase of the present invention is one in which two or more amino acid residues of the above-mentioned phenylalanine dehydrogenase are mutated, at least one, preferably at least two, of the amino acid residue mutations may be selected from the mutations of the amino acid residues described above. Even more preferably, all of the amino acid residue mutations may be selected from the mutations of the amino acid residues described above.
[0038] When the modified phenylalanine dehydrogenase contains two or more mutations, it preferably contains one or more mutations selected from the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, which is the 7th amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, which is the 9th amino acid residue in motif (6). When the modified phenylalanine dehydrogenase contains two or more mutations, it preferably contains one or more combinations of mutations selected from the following: (1) Substitution of asparagine in motif (6) (f) and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), (e) Substitution of arginine in motif (5), (h) Substitution of glutamine in motif (6), or (i) Substitution of valine, which is the 9th amino acid residue in motif (6) in combination; (2) Substitution of phenylalanine in motif (3) (c) and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), (g) Substitution of leucine in motif (6), (h) Substitution of glutamine in motif (6), or (i) Substitution of valine, which is the 9th amino acid residue in motif (6) Combination; (3)(b) Substitution of threonine, which is the 7th amino acid residue in motif (2), and (g) Substitution of leucine in motif (6), or (h) Substitution of glutamine in motif (6) Combination; (4)(h) Substitution of glutamine in motif (6) and (i) Combination of substitution of valine, which is the 9th amino acid residue in motif (6).
[0039] When the modified phenylalanine dehydrogenase contains two or more mutations, it is more preferable to contain one or more mutations selected from the following: (a) Substitution of leucine in motif (1) with tryptophan; (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine; (e) Substitution of arginine in motif (5) with aspartic acid; (f) Substitution of asparagine in motif (6) with aspartic acid, methionine, glutamine, or cysteine; (g) Substitution of leucine in motif (6) with glutamine or asparagine; (h) Substitution of glutamine in motif (6) with aspartic acid; and (i) Substitution of valine, which is the 9th amino acid residue in motif (6), with glycine, phenylalanine, or arginine. When the modified phenylalanine dehydrogenase contains two or more mutations, it is more preferable to contain a combination of one or more mutations selected from the following: (1) (f) Substitution of asparagine in motif (6) with aspartic acid, methionine, glutamine, or cysteine, and (b) Substitution of the 7th amino acid residue threonine in motif (2) with serine, (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine, (e) Substitution of arginine in motif (5) with aspartic acid, (h) Substitution of glutamine in motif (6) with aspartic acid, or (i) Substitution of the 9th amino acid residue valine in motif (6) with glycine, phenylalanine, or arginine in combination; (2) (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine and (b) Substitution of the 7th amino acid residue threonine in motif (2) with serine, (g) Substitution of leucine in motif (6) with glutamine or asparagine, (h) Substitution of glutamine in motif (6) with aspartic acid, or (i) Substitution of the 9th amino acid residue valine in motif (6) with glycine, phenylalanine, or arginine in combination; (3) (b) Substitution of the 7th amino acid residue threonine in motif (2) with serine and (g) Substitution of leucine in motif (6) with glutamine or asparagine, or (h) Substitution of glutamine in motif (6) with aspartic acid in combination; (4) (h) Substitution of glutamine in motif (6) with aspartic acid and (i) Substitution of the 9th amino acid residue valine in motif (6) with glycine, phenylalanine, or arginine in combination.
[0040] When the modified phenylalanine dehydrogenase of the present invention is obtained by mutating three or more amino acid residues of the above-mentioned phenylalanine dehydrogenase, at least one, preferably at least two, more preferably at least three of the amino acid residue mutations may be selected from the mutations of the amino acid residues described above. Even more preferably, all of the amino acid residue mutations may be selected from the mutations of the amino acid residues described above.
[0041] When the modified phenylalanine dehydrogenase contains three or more mutations, it preferably contains one or more mutations selected from the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, which is the 7th amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); and (i) Substitution of valine, which is the 9th amino acid residue in motif (6). When the modified phenylalanine dehydrogenase contains three or more mutations, it preferably contains the following combination of mutations: (f) Substitution of asparagine in motif (6) and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), or (e) Substitution of arginine in motif (5) combination.
[0042] When the modified phenylalanine dehydrogenase contains three or more mutations, it is more preferable to contain one or more mutations selected from the following: (a) Substitution of leucine in motif (1) with tryptophan; (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with isoleucine; (e) Substitution of arginine in motif (5) with aspartic acid; (f) Substitution of asparagine in motif (6) with aspartic acid or methionine; and (i) Substitution of valine, which is the 9th amino acid residue in motif (6), with phenylalanine. When the modified phenylalanine dehydrogenase contains 3 or more mutations, it is more preferable to include the following combination of mutations: (f) Substitution of asparagine in motif (6) with aspartic acid or methionine and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine, (c) Substitution of phenylalanine in motif (3) with isoleucine, or (e) Substitution of arginine in motif (5) with aspartic acid in combination.
[0043] When the modified phenylalanine dehydrogenase of the present invention is one in which 4 or more amino acid residues of the above phenylalanine dehydrogenase are mutated, at least 1, preferably at least 2, more preferably at least 3, and even more preferably at least 4 of the mutations of the amino acid residues may be selected from the mutations of the above amino acid residues. Even more preferably, all of the mutations of the amino acid residues may be selected from the mutations of the above amino acid residues.
[0044] When the modified phenylalanine dehydrogenase contains 4 or more mutations, it preferably contains 1 or more mutations selected from the following: (b) Substitution of threonine, which is the 7th amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); and (f) Substitution of asparagine in motif (6). When the modified phenylalanine dehydrogenase contains 4 or more mutations, it preferably contains the following combination of mutations: (f) Substitution of asparagine in motif (6) and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), or (e) Substitution of arginine in motif (5) Combination.
[0045] When the modified phenylalanine dehydrogenase contains 4 or more mutations, it is more preferable to contain one or more mutations selected from the following: (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with isoleucine; (e) Substitution of arginine in motif (5) with aspartic acid; (f) Substitution of asparagine in motif (6) with aspartic acid. When the modified phenylalanine dehydrogenase contains 4 or more mutations, it is more preferable to contain the following combination of mutations: (f) Substitution of asparagine in motif (6) with aspartic acid and (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine, (c) Substitution of phenylalanine in motif (3) with isoleucine, or (e) Substitution of arginine in motif (5) with aspartic acid Combination.
[0046] The phenylalanine dehydrogenase before mutation may be a phenylalanine dehydrogenase containing any of the following amino acid sequences (A) to (C). (A) The amino acid sequence represented by SEQ ID NO: 1, (B) An amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, or (C) An amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1.
[0047] The amino acid sequence represented by SEQ ID NO: 1 is the wild-type phenylalanine dehydrogenase (TiPheDH(wt)) derived from Thermoactinomyces intermedius, and is encoded, for example, by the codon-optimized nucleotide sequence (SEQ ID NO: 2) of TiPheDH(wt).
[0048] In the present invention, the amino acid residues that are the subject of mutations such as substitution, deletion, insertion, addition, etc. are usually natural L-α-amino acids, L-alanine (A), L-asparagine (N), L-cysteine (C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S), L-threonine (T), L-tryptophan (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R), L-histidine (H), or L-lysine (K), or glycine (G). When the mutation is a substitution, addition or insertion, the amino acid residue to be substituted, added or inserted is the same as the amino acid residue to be mutated described above. In this specification, the notations of L and α for amino acids may be omitted.
[0049] The amino acid sequence in (B) above may contain mutations (e.g., substitution, deletion, insertion, and addition) of one or several amino acid residues. The number of mutations is, for example, 1 to 50, preferably 1 to 45, 1 to 40, 1 to 35, 1 to 30, or 1 to 25, more preferably 1 to 20, even more preferably 1 to 15, and most preferably 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10).
[0050] The amino acid sequence in (C) above may have at least 90% or more amino acid sequence identity to the amino acid sequence represented by SEQ ID NO: 1. The percentage of amino acid sequence identity may preferably be 91% or more, 92% or more, 93% or more, or 94% or more, more preferably 95% or more or 96% or more, even more preferably 97% or more, and most preferably 98% or more or 99% or more.
[0051] When the proteins specified by the amino acid sequences of (B) and (C) are measured under the same conditions, they preferably have an activity of 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the phenylalanine dehydrogenase activity of the protein having the amino acid sequence of (A) above.
[0052] In this specification, the identity of amino acid sequences can be determined using, for example, the algorithm BLAST by Karlin and Altschul (Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)), and FASTA by Pearson (Methods Enzymol., 183, 63 (1990)). Based on this algorithm BLAST, a program called BLASTP has been developed (see http: / / www.ncbi.nlm.nih.gov), and the identity of amino acid sequences may be calculated using these programs with default settings. Also, as the identity of amino acid sequences, for example, using the software GENETYX Ver7.0.9 of Genetics Co., Ltd. which employs the Lipman-Pearson method, using the entire length of the polypeptide portion encoded by the ORF, the value obtained when calculating Similarity as a percentage with the setting of "Gaps are NOT taken into account" or the setting of Unit Size to Compare = 2 may be used. As the identity of amino acid sequences, the lowest value among the values derived from these calculations may be adopted.
[0053] (B) An amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, and (C) For the preparation of an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1, a mutation of an amino acid residue is introduced into the amino acid sequence represented by SEQ ID NO: 1, and when such a mutation of the amino acid residue is a substitution, such a substitution of the amino acid residue may be a conservative substitution. As used herein, the term "conservative substitution" refers to substituting a given amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are well known in the art. For example, such families include amino acids having a basic side chain (e.g., lysine, arginine, histidine), amino acids having an acidic side chain (e.g., aspartic acid, glutamic acid), amino acids having an uncharged polar side chain (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having a nonpolar side chain (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having a β-branched side chain (e.g., threonine, valine, isoleucine), amino acids having an aromatic side chain (e.g., tyrosine, phenylalanine, tryptophan, histidine), amino acids having a side chain containing a hydroxyl group (e.g., alcoholic, phenolic) (e.g., serine, threonine, tyrosine), and amino acids having a sulfur-containing side chain (e.g., cysteine, methionine). Amino acids having an uncharged polar side chain and amino acids having a nonpolar side chain may be collectively referred to as neutral amino acids. Preferably, conservative substitutions of amino acids may be substitutions between aspartic acid and glutamic acid, substitutions between arginine, lysine, and histidine, substitutions between tryptophan and phenylalanine, substitutions between phenylalanine and valine, substitutions between leucine, isoleucine, and alanine, and substitutions between glycine and alanine.
[0054] When the phenylalanine dehydrogenase before mutation is a phenylalanine dehydrogenase containing any one of (A) to (C) described above, the modified phenylalanine dehydrogenase of the present invention preferably has the following: R2, R10, Y11, C19, L41, G42, G43, C44, A50, S51, M66, C70, F77, K90, Y112, T115, D116, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, K216, K220, Q222, N227, R228, C234, C240, R255, C256, L257, N264, R271, Q277, K278, R279, S280, C282, N290, G293, L294, Q296, V297, R326, K328, N329, N331, C335, R340, K347, and K348 It may be a modified phenylalanine dehydrogenase that contains a mutation of an amino acid residue corresponding to one or more amino acid residues selected from the above, has enzyme activity, and has one or more characteristics improved from the group consisting of substrate specificity, solubility, and enzyme activity.
[0055] When the phenylalanine dehydrogenase before mutation is a phenylalanine dehydrogenase containing any one of (A) to (C) described above, the modified phenylalanine dehydrogenase of the present invention is more preferably the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, A50D, A50E, S51D, S51E, M66I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, K90E, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K144G, T147A, T147S, T147N, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, C256S, L257K, N264G, N264Q, N264T, N264K, N264P, N264S, R271D, R271E, Q277D, K278D, K278E, R279D, R279E, S280D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N290I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, R326E, K328E, K328D, N329D, N331E, N331D, C335A, C335S, R340D, R340E, K347D, and K348E It may be a modified phenylalanine dehydrogenase that contains substitutions of amino acid residues corresponding to one or more amino acid residues selected from the group consisting of, has enzyme activity, and has one or more properties improved from the group consisting of substrate specificity, solubility, and enzyme activity.
[0056] In one embodiment, as a property of phenylalanine dehydrogenase related to the measurement of phenylalanine, the substrate specificity (substrate specificity of phenylalanine dehydrogenase for phenylalanine) is improved. The improvement in the substrate specificity of phenylalanine dehydrogenase for phenylalanine means that the reactivity of the modified phenylalanine dehydrogenase with respect to phenylalanine is more improved than that of the wild-type enzyme. In other words, it means that the reactivity of the modified phenylalanine dehydrogenase with respect to amino acids other than phenylalanine decreases. Examples of amino acids other than phenylalanine include L-α-amino acids other than phenylalanine. Specifically, examples of L-α-amino acids other than phenylalanine include 19 L-α-amino acids other than phenylalanine that constitute proteins, as well as cystine, taurine, citrulline, ornithine, and α-aminobutyric acid. The substrate specificity is measured using as an index the low level of reactivity (relative activity) of phenylalanine dehydrogenase with respect to amino acids other than phenylalanine (e.g., tyrosine) compared to the reactivity of phenylalanine dehydrogenase with respect to phenylalanine. The reactivity of phenylalanine dehydrogenase may be measured based on the amount of NADH produced in the enzyme reaction. The degree of improvement in the substrate specificity of the modified phenylalanine dehydrogenase relative to the wild-type enzyme preferably exceeds 1 when the wild-type property is set to 1, more preferably exceeding 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, or 12.0, respectively.
[0057] Mutations suitable for improving substrate specificity preferably include the following: (I) A mutation (e.g., substitution) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6); (II) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, which is the 7th amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (d) Substitution of asparagine, which is the 4th amino acid residue in motif (4); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, which is the 9th amino acid residue in motif (6). (III) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10, Y11, C19, L41, G42, G43, C44, M66, C70, F77, Y112, T115, D116, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, Q222, R228, C234, C240, R255, C256, N264, R271, K278, C282, N290, G293, L294, Q296, V297, and C335.
[0058] Mutations suitable for improving substrate specificity preferably include the following: (I) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine in motif (1) with tryptophan, phenylalanine, tyrosine, or methionine; (b) Substitution of threonine, which is the 7th amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine; (d) Substitution of asparagine, which is the 4th amino acid residue in motif (4), with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine in motif (5) with aspartic acid; (f) Substitution of asparagine in motif (6) with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; (g) Substitution of leucine in motif (6) with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; (h) Substitution of glutamine in motif (6) with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine. (II) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10D, Y11E, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, M66I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K144G, T147A, T147S, T147N, K173E, C200A, C210S, C210A, Q222D, R228E, C234A, C234S, C240S, C240A, R255E, C256A, C256S, N264G, N264Q, N264T, N264K, N264P, N264S, R271D, K278D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N290I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, C335A, and C335S.
[0059] In another embodiment, as a property of phenylalanine dehydrogenase related to the measurement of phenylalanine, the solubility of phenylalanine dehydrogenase is improved. The improvement in the solubility of phenylalanine dehydrogenase means that the solubility of the modified phenylalanine dehydrogenase is more improved than that of the wild-type enzyme. Specifically, the solubility of phenylalanine dehydrogenase can be measured, for example, using the concentration of the supernatant when the phenylalanine dehydrogenase aqueous solution is concentrated until aggregation occurs as an index. The degree of improvement in the solubility of the modified phenylalanine dehydrogenase relative to the wild-type enzyme is preferably greater than 1 when the wild-type property is set to 1, and more preferably exceeds 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0 or 12.0, respectively.
[0060] Mutations suitable for improving solubility preferably include the following: (I) Mutations (e.g., substitutions) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (3), (5), and (6); (II) One or more substitutions selected from the following groups: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, which is the 7th amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); and (i) Substitution of valine, which is the 9th amino acid residue in motif (6). (III) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R2, R10, Y11, C19, L41, C44, A50, S51, C70, K90, T115, F124, K173, C200, C210, K216, K220, Q222, N227, R228, C240, R255, C256, L257, R271, Q277, K278, R279, C282, N290, V297, R326, N329, N331, C335, R340, and K348.
[0061] Mutations suitable for improving solubility include, more preferably, the following: (I) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine with tryptophan in motif (1); (b) Substitution of threonine, the 7th amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine with isoleucine in motif (3); (e) Substitution of arginine with aspartic acid or glutamic acid in motif (5); (f) Substitution of asparagine with aspartic acid or methionine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6), with phenylalanine. (II) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, C44A, C44S, A50D, A50E, S51D, S51E, C70A, C70S, K90E, T115S, F124I, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C240S, C240A, R255E, R255D, C256A, L257K, R271D, R271E, Q277D, K278D, K278E, R279E, C282S, C282A, N290D, N290M, V297F, R326E, N329D, N331E, N331D, C335A, C335S, R340D, and K348E.
[0062] In yet another embodiment, as a characteristic of phenylalanine dehydrogenase related to the measurement of phenylalanine, the activity of phenylalanine dehydrogenase with respect to phenylalanine is improved. The improvement in the activity of phenylalanine dehydrogenase with respect to phenylalanine means that the activity of the modified phenylalanine dehydrogenase with respect to phenylalanine is more improved than that of the wild-type enzyme. Specifically, the improvement in the activity of phenylalanine dehydrogenase with respect to phenylalanine can be achieved when the activity of the wild-type phenylalanine dehydrogenase with respect to phenylalanine at a predetermined concentration (for example, either a low concentration or a high concentration) is set to 100, and the activity of the modified phenylalanine dehydrogenase with respect to phenylalanine at the same concentration is greater than 100. Such a modified phenylalanine dehydrogenase enables rapid and sensitive measurement of phenylalanine and, as a result, is useful for the measurement of phenylalanine. The degree of improvement in the activity of the modified phenylalanine dehydrogenase with respect to the wild-type enzyme preferably exceeds 1 when the wild-type characteristics are set to 1, and more preferably exceeds 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, or 12.0, respectively.
[0063] Mutations suitable for improving activity preferably include the following: (I) Mutation (e.g., substitution) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (3), (5), and (6); (II) One or more substitutions selected from the following group: (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). (III) Mutation (e.g., substitution) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10, Y11, C19, F77, F124, T147, K173, C200, C210, K216, K220, Q222, N227, R228, C234, C240, R255, C256, R271, K278, R279, S280, C282, N290, L294, Q296, V297, K328, N329, N331, C335, R340, and K347.
[0064] More preferably, mutations suitable for improving activity include the following: (I) One or more substitutions selected from the following group: (c) Substitution of phenylalanine in motif (3) with isoleucine; (e) Substitution of arginine in motif (5) with aspartic acid or glutamic acid; (f) Substitution of asparagine in motif (6) with aspartic acid, threonine, or cysteine; (g) Substitution of leucine in motif (6) with glutamine; (h) Substitution of glutamine in motif (6) with aspartic acid or glutamic acid; and (i) Substitution of the valine, which is the 9th amino acid residue in the motif (6), with threonine or glycine. (II) Mutation (e.g., substitution) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10D, Y11E, C19S, F77L, F124I, T147S, K173E, K173D, C200A, C200S, C210S, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, R271D, R271E, K278D, R279D, R279E, S280D, C282S, N290D, N290T, N290C, L294Q, Q296D, Q296E, V297T, V297G, K328E, K328D, N329D, N331D, C335A, R340E, and K347D.
[0065] The modified phenylalanine dehydrogenase of the present invention may include an amino acid sequence having at least 90% or more amino acid sequence identity to the amino acid sequence of the phenylalanine dehydrogenase before mutation (wild type) by having the above-described mutation alone or both the above-described mutation and additional mutations. The percentage of amino acid sequence identity may preferably be 92% or more, more preferably 95% or more, even more preferably 97% or more, and most preferably 98% or more or 99% or more.
[0066] The modified phenylalanine dehydrogenase of the present invention may also have other peptide components (e.g., tag portions) at the C-terminus or N-terminus. Examples of other peptide components that can be added to the modified phenylalanine dehydrogenase of the present invention include, for example, peptide components that facilitate the purification of the target protein (e.g., tag portions such as histidine tags, Strep-tag II; proteins commonly used for the purification of target proteins such as glutathione-S-transferase, maltose-binding protein), peptide components that improve the solubility of the target protein (e.g., Nus-tag), peptide components that act as chaperones (e.g., trigger factor), and peptide components as linkers that connect other proteins or protein domains or both.
[0067] The amino acid sequence identity can be determined, for example, using the algorithms BLAST by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)) and FASTA by Pearson (Methods Enzymol., 183, 63 (1990)). Based on this BLAST algorithm, a program called BLASTP has been developed (see http: / / www.ncbi.nlm.nih.gov), and the amino acid sequence identity may be calculated using these programs with default settings. Further, as the amino acid sequence identity, for example, using the software GENETYX Ver7.0.9 of Genetics Co., Ltd. that employs the Lipman-Pearson method, using the entire length of the polypeptide portion encoded by the ORF, the value when calculating Similarity as a percentage with the setting of Unit Size to Compare = 2 may be used. As the amino acid sequence identity, the lowest value among the values derived from these calculations may be adopted.
[0068] The positions of amino acid residues into which additional mutations can be introduced in an amino acid sequence are apparent to those skilled in the art. For example, additional mutations can be introduced with reference to an alignment of amino acid sequences. Specifically, those skilled in the art can 1) compare the amino acid sequences of multiple homologs (e.g., the amino acid sequence represented by SEQ ID NO:1 and the amino acid sequences of other homologs), 2) identify relatively conserved regions and relatively non-conserved regions, and then 3) predict regions that can play an important role in function and regions that cannot play an important role in function from the relatively conserved regions and relatively non-conserved regions, respectively, so that the structure-function correlation can be recognized. Further, for phenylalanine dehydrogenase, since the results of the three-dimensional structure analysis have been reported as described above, those skilled in the art can introduce additional mutations based on the results of the three-dimensional structure analysis so as to retain the above-described characteristics. The site into which the additional mutation is introduced may be an amino acid residue other than the above-described amino acid residue.
[0069] When the additional mutation of an amino acid residue is a substitution, such substitution of the amino acid residue may be a conservative substitution. The term "conservative substitution" refers to substituting a given amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are well known in the art. For example, such families include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having nonpolar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having β-branched side chains (e.g., threonine, valine, isoleucine), amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine), amino acids having side chains containing a hydroxyl group (e.g., alcoholic, phenolic) (e.g., serine, threonine, tyrosine), and amino acids having sulfur-containing side chains (e.g., cysteine, methionine). Preferably, conservative substitutions of amino acids may be substitutions between aspartic acid and glutamic acid, substitutions between arginine, lysine, and histidine, substitutions between tryptophan and phenylalanine, substitutions between phenylalanine and valine, substitutions between leucine, isoleucine, and alanine, and substitutions between glycine and alanine.
[0070] The present invention also provides a polynucleotide encoding the modified phenylalanine dehydrogenase of the present invention. The polynucleotide of the present invention may be DNA or RNA, but is preferably DNA.
[0071] The modified phenylalanine dehydrogenase of the present invention can be prepared using the transformant of the present invention that expresses the modified phenylalanine dehydrogenase of the present invention, or using a cell-free system or the like. The transformant of the present invention can be prepared, for example, by preparing the expression vector of the present invention and then introducing this expression vector into a host.
[0072] The present invention provides an expression vector. The expression vector of the present invention contains the polynucleotide of the present invention, or a polynucleotide encoding the modified phenylalanine dehydrogenase of the present invention.
[0073] The expression vector of the present invention contains the polynucleotide (e.g., DNA, RNA) of the present invention encoding the modified phenylalanine dehydrogenase of the present invention. In addition to the polynucleotide of the present invention, the expression vector of the present invention can further contain regions such as a promoter, a terminator, and a region encoding a drug (e.g., tetracycline, ampicillin, kanamycin, hygromycin, phosphinothricin) resistance gene. The expression vector of the present invention may be a plasmid or an integrative vector. The expression vector of the present invention may also be a viral vector or a vector for a cell-free system. The expression vector of the present invention may further contain a polynucleotide encoding another peptide component that can be added to the modified phenylalanine dehydrogenase of the present invention on the 3' or 5' end side with respect to the polynucleotide of the present invention. Examples of the polynucleotide encoding another peptide component include a polynucleotide encoding a peptide component that facilitates the purification of the target protein as described above, a polynucleotide encoding a peptide component that improves the solubility of the target protein as described above, a polynucleotide encoding a peptide component that functions as a chaperone, and a polynucleotide encoding a peptide component that serves as a linker connecting other functional proteins or protein domains or those. Various expression vectors containing a polynucleotide encoding another peptide component are available. Therefore, such an expression vector may be used for the production of the expression vector of the present invention. For example, an expression vector containing a polynucleotide encoding a peptide component that facilitates the purification of the target protein (e.g., pET-15b, pET-51b, pET-41a, pMAL-p5G), an expression vector containing a polynucleotide encoding a peptide component that improves the solubility of the target protein (e.g., pET-50b), an expression vector containing a polynucleotide encoding a peptide component that functions as a chaperone (e.g., pCold TF), and an expression vector containing a polynucleotide encoding a peptide component that serves as a linker connecting other functional proteins or protein domains or those can be used.To enable cleavage of the modified phenylalanine dehydrogenase of the present invention and other peptide components added thereto after protein expression, the expression vector of the present invention may contain a region encoding a cleavage site by a protease between the polynucleotide encoding the modified phenylalanine dehydrogenase of the present invention and the polynucleotide encoding other peptide components.
[0074] As hosts for expressing the modified phenylalanine dehydrogenase of the present invention, various prokaryotic cells such as bacteria of the genus Escherichia [e.g., Escherichia coli], bacteria of the genus Corynebacterium [e.g., Corynebacterium glutamicum], and bacteria of the genus Bacillus [e.g., Bacillus subtilis], and various eukaryotic cells such as bacteria of the genus Saccharomyces [e.g., Saccharomyces cerevisiae], bacteria of the genus Pichia [e.g., Pichia stipitis], and bacteria of the genus Aspergillus [e.g., Aspergillus oryzae] can be used. As the host, a strain lacking a predetermined gene may be used. Examples of transformants include transformants having an expression vector in the cytoplasm and transformants having the target gene introduced into the genome.
[0075] The transformant of the present invention is a host cell that can produce the modified phenylalanine dehydrogenase of the present invention or can express the polynucleotide of the present invention to produce the modified phenylalanine dehydrogenase. Specifically, the transformant of the present invention is a host cell containing an expression unit containing the polynucleotide of the present invention. Examples of the host cell containing the expression unit containing the polynucleotide of the present invention include a host cell into which the expression vector of the present invention is introduced as a whole, and a host cell into which the expression unit in the expression vector of the present invention is introduced into its genome. The host cell is not particularly limited as long as it can express the modified phenylalanine dehydrogenase of the present invention. The host cell may be homologous or heterologous to the modified phenylalanine dehydrogenase of the present invention and the polynucleotide of the present invention, but is preferably heterologous. The host cell may also be homologous or heterologous to the above promoter, but is preferably heterologous. Examples of the host cell include animal cells, plant cells, insect cells, and microorganisms, and microorganisms are preferred. More preferably, the host cell used in the present invention is a bacterium or a fungus. The bacterium may be a gram-positive bacterium or a gram-negative bacterium.
[0076] The transformant of the present invention can be cultured, for example, in a medium having the composition described below using a predetermined culture apparatus (e.g., test tube, flask, jar fermenter). The culture conditions can be set appropriately. Specifically, the culture temperature may be 10°C to 37°C, the pH may be 6.5 to 7.5, and the culture time may be 1 h to 100 h. Also, the culture may be carried out while controlling the dissolved oxygen concentration. In this case, the dissolved oxygen concentration (DO value) in the culture solution may be used as an index for control. The aeration and agitation conditions can be controlled so that the relative dissolved oxygen concentration DO value when the oxygen concentration in the atmosphere is 21% does not fall below, for example, 1% to 10%, preferably 3% to 8%. Also, the culture may be batch culture or fed-batch culture. In the case of fed-batch culture, a solution serving as a sugar source or a solution containing phosphoric acid can be continuously or discontinuously added to the culture solution sequentially to continue the culture.
[0077] The host to be transformed is as described above. For Escherichia coli, which will be described in detail below, it can be selected from Escherichia coli JM109 strain, DH5α strain, HB101 strain, BL21(DE3) strain, etc., which are subspecies of Escherichia coli K12 strain. The methods for performing transformation and selecting transformants are also described in Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor press (2001 / 01 / 15), etc. Hereinafter, a method for producing transformed Escherichia coli and using it to produce a predetermined enzyme will be described more specifically as an example.
[0078] As the promoter for expressing the polynucleotide of the present invention, a promoter usually used for heterologous protein production in E. coli can be used. For example, strong promoters such as PhoA, PhoC, T7 promoter, lac promoter, trp promoter, trc promoter, tac promoter, PR promoter of lambda phage, PL promoter, T5 promoter, etc. can be mentioned, and PhoA, PhoC, and lac are preferred. As the vector, for example, pUC (e.g., pUC19, pUC18), pSTV, pBR (e.g., pBR322), pHSG (e.g., pHSG299, pHSG298, pHSG399, pHSG398), RSF (e.g., RSF1010), pACYC (e.g., pACYC177, pACYC184), pMW (e.g., pMW119, pMW118, pMW219, pMW218), pQE (e.g., pQE30), and its derivatives, etc. may be used. As other vectors, phage DNA vectors may be utilized. Furthermore, an expression vector containing a promoter and capable of expressing the inserted DNA sequence may be used. Preferably, the vector may be pUC, pSTV, or pMW.
[0079] In addition, a terminator, which is a transcription termination sequence, may be ligated downstream of the polynucleotide of the present invention. Examples of such terminators include a T7 terminator, an fd phage terminator, a T4 terminator, a terminator of a tetracycline resistance gene, and a terminator of an Escherichia coli trpA gene.
[0080] As a vector for introducing the polynucleotide of the present invention into Escherichia coli, a so-called multicopy type is preferable, and examples include plasmids having a replication origin derived from ColE1, such as pUC-based plasmids, pBR322-based plasmids, or derivatives thereof. Here, the "derivative" means a plasmid modified by base substitution, deletion, insertion, and / or addition.
[0081] In addition, in order to select a transformant, it is preferable that the vector has a marker such as an ampicillin resistance gene. As such plasmids, expression vectors having a strong promoter are commercially available [e.g., pUC series (manufactured by Takara Bio Inc.), pPROK series (manufactured by Clontech Laboratories, Inc.), pKK233-2 (manufactured by Clontech Laboratories, Inc.)].
[0082] By transforming Escherichia coli with the obtained expression vector of the present invention and culturing this Escherichia coli, the modified phenylalanine dehydrogenase of the present invention can be obtained.
[0083] As the medium, a medium usually used for culturing Escherichia coli, such as an M9-casamino acid medium or an LB medium, may be used. The medium may contain a predetermined carbon source, nitrogen source, coenzyme (e.g., pyridoxine hydrochloride). Specifically, peptone, yeast extract, NaCl, glucose, MgSO4, ammonium sulfate, potassium dihydrogen phosphate, ferric sulfate, manganese sulfate, etc. may be used. In addition, the culture conditions and production induction conditions are appropriately selected according to the type of the marker, promoter, host bacterium, etc. of the vector used.
[0084] To recover the modified phenylalanine dehydrogenase of the present invention, there are methods such as the following. After recovering the transformant of the present invention, the modified phenylalanine dehydrogenase of the present invention can be obtained as a disrupted product and a lysate by disrupting the cells (e.g., sonication, homogenization) or lysing (e.g., lysozyme treatment). By subjecting such disrupted products and lysates to techniques such as extraction, precipitation, filtration, column chromatography, etc., the modified phenylalanine dehydrogenase of the present invention can be obtained.
[0085] The present invention provides a method for analyzing phenylalanine. The analysis method of the present invention may include measuring phenylalanine contained in a test sample using the modified phenylalanine dehydrogenase of the present invention.
[0086] The test sample is not particularly limited as long as it is a sample suspected of containing phenylalanine. For example, it includes bio-derived samples (e.g., blood, urine, saliva, tears, etc.) and food and beverage products (e.g., nutritional drinks, amino acid drinks, etc.). The phenylalanine in the test sample may be at a low concentration (e.g., a concentration less than 1 mM such as 1 μM or more and less than 1 mM) or at a high concentration (e.g., a concentration of 1 mM or more such as 1 mM or more and less than 1 M).
[0087] The analysis method of the present invention is not particularly limited as long as phenylalanine can be measured using the modified phenylalanine dehydrogenase of the present invention. For example, under alkaline or neutral conditions, preferably in an alkaline buffer solution, the test sample is mixed with nicotinamide adenine dinucleotide (NAD + ), then the mixed sample is subjected to an enzymatic reaction using the modified phenylalanine dehydrogenase of the present invention, and finally, phenylalanine is measured by detecting NADH generated from NAD + by the action of the modified phenylalanine dehydrogenase of the present invention. Specifically, nicotinamide adenine dinucleotide (NAD +In the presence of (), by allowing a modified phenylalanine dehydrogenase to act on a test sample in an alkaline buffer solution, the amino group of the substrate contained in the biological sample is oxidatively deaminated, and nicotinamide adenine dinucleotide (NAD + ) is reduced to reduced form (NADH). Therefore, by detecting NADH by absorbance (340 nm) or the like, phenylalanine can be quantified. A method for measuring amino acids by such a methodology is known (see, for example, Ueatrongchit T, Asano Y, Anal Biochem. 2011 Mar 1;410(1):44-56). Also, by reducing a dye with the generated NADH and detecting the color development of the reduced dye as absorbance or the like, phenylalanine can be measured. Furthermore, detection of NADH by an electrochemical method is also possible. For example, under alkaline or neutral conditions, the NADH generated by allowing a modified phenylalanine dehydrogenase to act on a test sample is electrochemically oxidized, and the oxidation current is measured. Alternatively, by reducing a coexisting electron mediator with the generated NADH and measuring the electrochemical oxidation current of the reduced electron mediator, phenylalanine can be measured. A catalyst may be involved in the electron transfer between NADH and the electron mediator. The measurement of phenylalanine is preferably carried out by the rate method (initial velocity method).
[0088] The modified phenylalanine dehydrogenase of the present invention does not react with amino acids other than phenylalanine or has low reactivity thereto. Therefore, even when the test sample contains not only phenylalanine but also other amino acids, the amount of phenylalanine in the test sample can be evaluated by using the modified phenylalanine dehydrogenase of the present invention.
[0089] Furthermore, the present invention includes a kit for phenylalanine analysis containing the modified phenylalanine dehydrogenase of the present invention. The kit of the present invention contains a buffer solution or buffer salt for reaction, and nicotinamide adenine dinucleotide (NAD +It can further include at least one of ( )
[0090] The reaction buffer or buffer salt is used to maintain the pH in the reaction solution at a value suitable for the target enzyme reaction. The reaction buffer or buffer salt is, for example, alkaline or neutral, preferably alkaline.
[0091] When the kit of the present invention contains nicotinamide adenine dinucleotide (NAD + )), the kit of the present invention may further contain a dye reduced by NADH. In this case, the dye is reduced by NADH generated from NAD + by the action of the modified phenylalanine dehydrogenase of the present invention, and the color development of the reduced dye can be detected by absorbance or the like. Substances that act as electron mediators may be involved in the reduction of the dye.
[0092] The present invention also provides an enzyme sensor for phenylalanine analysis, comprising (a) a detection electrode and (b) the modified phenylalanine dehydrogenase of the present invention fixed or disposed on the detection electrode. The modified phenylalanine dehydrogenase of the present invention is fixed or disposed directly or indirectly on the electrode.
[0093] As the detection electrode, for example, a biosensor that directly or indirectly detects a product or by-product (NH3 + NADH + H + ) generated from phenylalanine by the modified phenylalanine dehydrogenase of the present invention can be used. More specifically, examples include a detection electrode using the modified phenylalanine dehydrogenase of the present invention and nicotinamide adenine dinucleotide (NAD + ). As such a detection electrode, for example, those described in International Publication No. 2005 / 075970 and International Publication No. 00 / 57166 can be used.
Examples
[0094] The present invention will be described in more detail by the following examples, but the present invention is not limited to the following examples.
[0095] Example 1: Construction of Plasmid for Expression of PheDH (Wild Type) A recombinant expression system for PheDH using Escherichia coli was constructed. First, a plasmid for recombinant expression was constructed. As the insertion sequence for pET-24a (Merck), in the nucleotide sequence (codon-optimized PheDH, SEQ ID NO: 2) encoding the amino acid sequence of wild-type PheDH derived from Thermoactinomyces intermedius (SEQ ID NO: 1), a nucleotide sequence (CATATGCATCACCATCACCACCAC, SEQ ID NO: 113) containing an NdeI site + start codon + His-tag coding sequence at the 5' end and a nucleotide sequence (TAATGAGGATCC, SEQ ID NO: 114) containing a stop codon + BamHI site at the 3' end were added. The DNA fragment (SEQ ID NO: 112) was prepared by chemical synthesis and incorporated into the NdeI and BamHI restriction enzyme sites of pET-24a to obtain a plasmid for expression of PheDH (wild type). Using this plasmid as a template and a standard DNA sequence analysis method, the insertion of the target gene into the plasmid was confirmed. A transformant of Escherichia coli BL21(DE3) was obtained according to a standard method.
[0096] Hereafter, a plasmid containing the PheDH sequence with a His-tag added to the N-terminus (amino acid sequence is SEQ ID NO: 111, nucleotide sequence is SEQ ID NO: 112) (plasmid for PheDH expression) is called pET24a-PheDH, and a transformant of BL21(DE3) by pET24a-PheDH is called pET24a-PheDH-BL21(DE3).
[0097] Example 2: Construction of Plasmid for Expression of PheDH Mutant The PheDH variants were prepared as follows. Using KAPA HiFi HS ReadyMix (Kapa Biosystems), site-directed mutagenesis was performed on the PheDH gene according to a standard method with pET24a-PheDH as a template. When introducing multiple mutations, additional mutations were sequentially introduced using the plasmid with the introduced mutation as a template. Using each expression plasmid as a template and a standard DNA sequence analysis method, the introduction of the target mutation into the plasmid was confirmed. Transformants of Escherichia coli BL21(DE3) were obtained according to a standard method.
[0098] [Example 3] Preparation of PheDH (Preparation of PheDH for Substrate Specificity Evaluation) The PheDH for substrate specificity evaluation was prepared as follows. First, inoculate from the glycerol stocks of the various Escherichia coli BL21(DE3) transformants obtained in Example 1 and Example 2 onto an LB plate containing 25 μg / mL kanamycin, and statically culture at 37 °C overnight. Put 2 mL of LB liquid medium containing 25 μg / mL kanamycin into a 14 mL volume tube, inoculate a single colony on the LB plate, and culture at 37 °C overnight with reciprocal shaking. Add 50 μL of the culture solution to 4 mL of LB liquid medium containing 25 μg / mL kanamycin, and culture with reciprocal shaking at 37 °C until the OD600 value reaches about 0.9. Let it stand at 30 °C for 30 minutes, add IPTG to a final concentration of 0.5 mM, culture with reciprocal shaking at 30 °C overnight, and then collect the bacteria in a 2 mL tube.
[0099] Suspend the cells in disruption buffer (200 mM Tris-HCl, pH 8.0), and disrupt using an ultrasonic disruptor (BIORUPTOR, manufactured by Cosmo Bio Co., Ltd.). Centrifuge this disrupted solution at 6,000×g for 10 minutes, and recover the target protein PheDH as the supernatant.
[0100] (Preparation of PheDH for Solubility and Activity Evaluation) The preparation of PheDH for solubility and activity evaluation was carried out as follows. First, inoculate from the glycerol stocks of various transformants of Escherichia coli BL21(DE3) obtained in Example 1 and Example 2 onto an LB plate containing 25 μg / mL kanamycin, and statically culture at 37 °C overnight. Put 2 mL of LB liquid medium containing 25 μg / mL kanamycin into a 14 mL capacity tube, inoculate a single colony on the LB plate, and culture at 37 °C overnight with reciprocal shaking. Add 300 μL of the culture solution to 30 mL of LB liquid medium containing 25 μg / mL kanamycin, and culture with reciprocal shaking at 37 °C until the OD600 value reaches about 0.9. Let it stand at 30 °C for 30 minutes, add IPTG to a final concentration of 0.5 mM, culture with reciprocal shaking at 30 °C overnight, and then collect the bacteria in a 50 mL tube.
[0101] Suspend the cells in Wash buffer (50 mM HEPES, 500 mM NaCl, 50 mM imidazole, pH 7.5), and disrupt them using an ultrasonic disruptor (BIORUPTOR, manufactured by Cosmo Bio Co., Ltd.). Centrifuge this disrupted solution at 14,000×g for 10 minutes, collect the supernatant, and then add it to Ni Sepharose 6 Fast Flow (manufactured by GE Healthcare Japan) equilibrated with Wash buffer. Gently invert and mix at room temperature for 5 minutes, and then remove the solution by natural dripping using an Econospin (trademark) empty column (manufactured by Gene Design). Subsequently, wash with Wash buffer, and then elute the target protein PheDH with elution buffer (50 mM HEPES, 500 mM NaCl, 500 mM imidazole, pH 7.5). The PheDH solution was subjected to solvent replacement with stock buffer (100 mM Tris-HCl, pH 8.0) by ultrafiltration.
[0102] 〔Example 4〕Evaluation of the Substrate Specificity of PheDH The evaluation of the substrate specificity of each enzyme prepared in Example 3 was carried out according to the following procedure. Prepare PheDH to be 0.5 mg / mL. For 20 μL of PheDH, add 100 μL of 200 mM Glycine-KCl-KOH, pH 10.0, and 50 mM NAD +4 μL of [manufactured by FUJIFILM Wako Pure Chemical Corporation], 20 μL of 10 mM L-phenylalanine aqueous solution or 10 mM L-tyrosine aqueous solution, and 56 μL of ultrapure water were added, and the change in absorbance over time at a wavelength of 340 nm of the solution was measured for 5 minutes using a microplate reader (SpectraMax M2e, manufactured by Molecular Devices). For wild-type and mutants, Table 8 and 9 show the relative activities during the measurement of the L-tyrosine aqueous solution when the absorbance value after 5 minutes during the measurement of the L-phenylalanine aqueous solution was set to 100%. The results in Table 8 and 9 were calculated from the average values when the same sample was experimented twice. The value of WT used the average value of the results of preparing and evaluating the substrate specificity of wild-type PheDH 16 times. When showing a mutant PheDH with multiple mutations introduced, the introduced mutations are separated by / and described continuously. For example, C19S / N290D means a mutant PheDH having two mutations, C19S and N290D. WT means wild-type.
[0103] From the results in Table 8, it can be seen that by introducing the mutations shown in Table 8, the reactivity of PheDH with respect to L-tyrosine can be suppressed. Furthermore, from the results in Table 9, it can be seen that by introducing multiple mutations shown in Table 9, the reactivity of PheDH with respect to L-tyrosine can be suppressed.
[0104]
Table 8
[0105]
Table 9-1
[0106]
Table 9-2
[0107] 〔Example 5〕Evaluation of the solubility of PheDH The solubility of each enzyme prepared in Example 3 was evaluated according to the following procedure. PheDH with the solvent replaced in the stock buffer was concentrated by ultrafiltration until aggregation occurred. 30 μL of PheDH was placed in a 1.5-mL tube and centrifuged at 18,500×g for 60 minutes, and the supernatant was collected. The concentrations of the centrifuged supernatants of the wild type and mutants thus collected were taken as the solubility. The results compared with the solubility of wild-type PheDH are shown in Tables 10 and 11.
[0108] From the results in Table 10, it can be seen that the solubility of PheDH has increased due to the introduction of the mutations shown in Table 10. Furthermore, from the results in Table 11, it can be seen that the solubility of PheDH has increased due to the introduction of multiple mutations shown in Table 11.
[0109] [Table 10]
[0110] [Table 11-1]
[0111] [Table 11-2]
[0112] [Example 6] Evaluation of the enzyme activity of PheDH The activity of each enzyme prepared in Example 3 was evaluated according to the following procedure. PheDH with the solvent replaced in the stock buffer was prepared to be 0.1 mg / mL. To 20 μL of PheDH, 100 μL of 200 mM Glycine-KCl-KOH, pH 10.0 and 50 mM NAD +The absorbance change over time at a wavelength of 340 nm of a solution prepared by adding 4 μL of [manufactured by FUJIFILM Wako Pure Chemical Corporation], 20 μL of 10 mM L-phenylalanine aqueous solution, and 56 μL of ultrapure water was measured for 5 minutes using a microplate reader (SpectraMax M2e, manufactured by Molecular Devices). The relative activities compared with the value of wild-type PheDH as a control are shown in Tables 12 and 13. The results in Tables 12 and 13 were calculated from the average values when the same sample was experimented twice.
[0113] From the results in Table 12, it can be seen that the reactivity of PheDH with respect to L-phenylalanine can be improved by introducing the mutations shown in Table 12. Furthermore, from the results in Table 13, it can be seen that the reactivity of PheDH with respect to L-phenylalanine can be improved by introducing multiple mutations shown in Table 13.
[0114]
Table 12
[0115]
Table 13
Industrial Applicability
[0116] The modified phenylalanine dehydrogenase of the present invention is useful for rapid, highly accurate, and highly sensitive measurement of phenylalanine and / or production of phenylpyruvate. The modified phenylalanine dehydrogenase of the present invention is also useful as a liquid reagent. The modified phenylalanine dehydrogenase of the present invention is particularly useful as a liquid reagent. The analysis method of the present invention is useful for diagnosis of diseases such as phenylketonuria and measurement of phenylalanine content in foods, for example.
Sequence Listing Free-Text
[0117] SEQ ID NO: 1 shows the amino acid sequence of Thermoactinomyces intermedius phenylalanine dehydrogenase (PheDH). SEQ ID NO: 2 shows the codon-optimized nucleotide sequence encoding the amino acid sequence of Thermoactinomyces intermedius PheDH (SEQ ID NO: 1). SEQ ID NOs: 3-6 show the amino acid sequences of each motif in PheDH. SEQ ID NOs: 7-9 show the amino acid sequences of each motif represented by shorter amino acid sequences in PheDH. SEQ ID NOs: 10-12 show the amino acid sequences near each motif in Thermoactinomyces intermedius PheDH. SEQ ID NOs: 13-15 show the consensus amino acid sequences (amino acid sequences with high commonality) near each motif in PheDH. SEQ ID NOs: 16, 26, 35, 44, 54, 62, 70, 79, 88, 97, and 106 show the amino acid sequences of PheDHs derived from each species. SEQ ID NOs: 17-22, 27-31, 36-40, 45-50, 55-58, 63-66, 71-75, 80-84, 89-93, 98-102, and 107 show the amino acid sequences of the conserved regions corresponding to each motif in PheDHs derived from each species. SEQ ID NOs: 23-25, 32-34, 41-43, 51-53, 59-61, 67-69, 76-78, 85-87, 94-96, 103-105, and 108-110 show the amino acid sequences near each motif in PheDHs derived from each species. SEQ ID NO: 111 shows the amino acid sequence of Thermoactinomyces intermedius PheDH with an His-tag added to the N-terminus. SEQ ID NO: 112 shows the codon-optimized nucleotide sequence encoding the amino acid sequence of Thermoactinomyces intermedius PheDH with an His-tag added to the N-terminus (SEQ ID NO: 111). Array number 113 shows the linker nucleotide sequence (NdeI site + start codon + His-tag coding sequence) added to the 5'-end of the nucleotide sequence of SEQ ID NO: 2 to form a DNA fragment consisting of the nucleotide sequence of SEQ ID NO: 112. Array number 114 shows the linker nucleotide sequence (stop codon + BamHI site) added to the 3'-end of the nucleotide sequence of SEQ ID NO: 2 to form a DNA fragment consisting of the nucleotide sequence of SEQ ID NO: 112.
Claims
1. In a phenylalanine dehydrogenase comprising at least one motif selected from the group consisting of motifs (1) to (6) (where X represents any amino acid), at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6) is mutated, it has phenylalanine dehydrogenase activity, and at least one property selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity is higher than that of the wild-type phenylalanine dehydrogenase, a modified phenylalanine dehydrogenase: Motif (1): GPALGGRXM (SEQ ID NO: 3) motif; Motif (2): GRFXTGTDMGT (SEQ ID NO: 4) motif; Motif (3): DF motif; Motif (4): GXANN (SEQ ID NO: 5) motif; Motif (5): RH motif; Motif (6): VNXGGLIQV (SEQ ID NO: 6) motif.
2. The modified phenylalanine dehydrogenase according to claim 1, wherein the mutation is one or more substitutions selected from the group consisting of the following in the amino acid sequence of phenylalanine dehydrogenase: a) Substitution of leucine in the GPALGGRXM (SEQ ID NO: 3) motif; b) Substitution of threonine, which is the 7th amino acid residue, in the GRFXTGTDMGT (SEQ ID NO: 4) motif; c) Substitution of phenylalanine in the DF motif; d) Substitution of asparagine, which is the 4th amino acid residue, in the GXANN (SEQ ID NO: 5) motif; e) Substitution of arginine in the RH motif; f) Substitution of asparagine in the VNXGGLIQV (SEQ ID NO: 6) motif; g) Substitution of leucine in the VNXGGLIQV (SEQ ID NO: 6) motif; h) Substitution of glutamine in the VNXGGLIQV (SEQ ID NO: 6) motif; and i) Substitution of valine, which is the 9th amino acid residue, in the VNXGGLIQV (SEQ ID NO: 6) motif.
3. The modified phenylalanine dehydrogenase according to claim 2, wherein the mutation is one or more substitutions selected from the group consisting of the following in the amino acid sequence of phenylalanine dehydrogenase: a) Substitution of leucine in the GPALGGRXM (SEQ ID NO: 3) motif with tryptophan, phenylalanine, tyrosine, or methionine; b) Substitution of threonine, which is the 7th amino acid residue, in the GRFXTGTDMGT (SEQ ID NO: 4) motif with serine; (c) Substitution of phenylalanine in the DF motif with leucine or isoleucine; (d) Substitution of asparagine, which is the 4th amino acid residue in the GXANN (SEQ ID NO: 5) motif, with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine in the RH motif with aspartic acid or glutamic acid; (f) Substitution of asparagine in the VNXGGLIQV (SEQ ID NO: 6) motif with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; (g) Substitution of leucine in the VNXGGLIQV (SEQ ID NO: 6) motif with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; (h) Substitution of glutamine in the VNXGGLIQV (SEQ ID NO: 6) motif with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and (i) Substitution of valine, which is the 9th amino acid residue in the VNXGGLIQV (SEQ ID NO: 6) motif, with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine.
4. The phenylalanine dehydrogenase is the modified phenylalanine dehydrogenase according to any one of Claims 1 to 3, which contains all of the motifs (1) to (6) in this order.
5. The modified phenylalanine dehydrogenase according to any one of Claims 1 to 4, wherein the phenylalanine dehydrogenase is derived from the genus Thermoactinomyces.
6. The phenylalanine dehydrogenase is (A) the amino acid sequence represented by SEQ ID NO: 1, (B) an amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, or (C) an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1 The modified phenylalanine dehydrogenase according to any one of Claims 1 to 5, which contains.
7. The following: (A) the amino acid sequence represented by SEQ ID NO: 1, (B) an amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID NO: 1, or (C) an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 1 in a phenylalanine dehydrogenase containing any of the amino acid sequences, the following: R2, R10, Y11, C19, L41, G42, G43, C44, A50, S51, M66, C70, F77, K90, Y112, T115, D116, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, K216, K220, Q222, N227, R228, C234, C240, R255, C256, L257, N264, R271, Q277, K278, R279, S280, C282, N290, G293, L294, Q296, V297, R326, K328, N329, N331, C335, R340, K347, and K348 contains a mutation of an amino acid residue corresponding to one or more amino acid residues selected from has phenylalanine dehydrogenase activity, and one or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity are improved, a modified phenylalanine dehydrogenase.
8. The modified phenylalanine dehydrogenase according to claim 7, comprising substitution of an amino acid residue corresponding to one or more amino acid residues selected from the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, A50D, A50E, S51D, S51E, M66I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, K90E, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K144G, T147A, T147S, T147N, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, C256S, L257K, N264G, N264Q, N264T, N264K, N264P, N264S, R271D, R271E, Q277D, K278D, K278E, R279D, R279E, S280D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N290I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, R326E, K328E, K328D, N329D, N331E, N331D, C335A, C335S, R340D, R340E, K347D, and K348E.
9. A method for analyzing phenylalanine, comprising measuring phenylalanine contained in a test sample using a modified phenylalanine dehydrogenase according to any one of claims 1 to 8.
10. The method according to claim 9, comprising mixing a test sample with nicotinamide adenine dinucleotide (NAD+) and detecting NADH generated from NAD+ by the action of a modified phenylalanine dehydrogenase.
11. A method for producing phenylpyruvate, comprising generating phenylpyruvate from phenylalanine using a modified phenylalanine dehydrogenase according to any one of claims 1 to 8.
12. A polynucleotide encoding a modified phenylalanine dehydrogenase according to any one of claims 1 to 8.
13. An expression vector comprising the polynucleotide according to claim 12.
14. A transformant comprising an expression unit of a polynucleotide encoding a modified phenylalanine dehydrogenase according to any one of claims 1 to 8.
15. A method for producing a modified phenylalanine dehydrogenase, comprising generating a modified phenylalanine dehydrogenase in which at least one amino acid residue is mutated so as to improve one or more characteristics selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity, using the transformant according to claim 14.
16. A kit for phenylalanine analysis, comprising a modified phenylalanine dehydrogenase according to any one of claims 1 to 8.
17. The kit for phenylalanine analysis according to claim 16, further comprising at least one of a reaction buffer or buffer salt and nicotinamide adenine dinucleotide (NAD+).
18. An enzyme sensor for phenylalanine analysis, comprising (a) a detection electrode and (b) a modified phenylalanine dehydrogenase according to any one of claims 1 to 8 fixed or disposed on the detection electrode.
Citation Information
Patent Citations
Amino acid dehydrogenase mutant and preparation method and application thereof
CN108795893A
Thin film magnetic head and its production
JP1995114713A
Function-modified phenylalanine dehydrogenase, and method for analysis of amino acid in biological sample using the enzyme
WO2008029921A1