Methods and compositions of biologically active agents
Lipids improve the delivery of bioactive agents to target locations, enhancing efficacy and reducing toxicity, addressing the challenge of effective delivery to cells and tissues.
Patent Information
- Application Number
- JP2025064806
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2016-10-07
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-23
AI Technical Summary
Many bioactive agents face challenges in effectively delivering to their target locations, such as cells, tissues, and organs, limiting their therapeutic use.
The use of lipids to facilitate the delivery of bioactive agents, particularly intracellularly, improving properties like pharmacokinetics, activity, and reducing toxicity.
Lipids enhance the delivery of bioactive agents to target locations, allowing for reduced dosing frequency and increased efficacy while minimizing toxicity.
Smart Images

Figure 2025108550000001_ABST
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 331,961, filed May 4, 2016, and U.S. Provisional Patent Application No. 62 / 405,810, filed October 7, 2016, the entire contents of each of which are hereby incorporated by reference.
Background Art
[0002] Many bioactive agents cannot be effectively delivered to their target locations, such as cells, tissues, organs, etc., and thus their use as therapeutic methods is limited. In the art, there has been a long - standing need to efficiently and / or effectively deliver bioactive agents to such target locations. In the art, there has been a particularly long - standing need to efficiently and / or effectively deliver bioactive agents intracellularly (i.e., to intracellular sites).
Summary of the Invention
[0003] In particular, the present disclosure encompasses the surprising recognition that lipids can effect and / or facilitate the delivery of bioactive agents to their target locations (such as cells, tissues, organs, etc.). In some embodiments, lipids can be used to efficiently improve the delivery of bioactive agents to their target locations in a subject, such as a mammalian or human subject. The present disclosure particularly describes surprising results regarding the efficient and / or effective delivery of bioactive agents intracellularly (i.e., to intracellular locations). In some embodiments, the present disclosure also describes the surprising result that lipids can improve many properties of bioactive agents, such as pharmacokinetics (e.g., half - life), activity, immunogenicity, etc. For example, in some embodiments, the present disclosure describes that the immune properties of bioactive agents can be efficiently improved by using lipids to modulate, for example, the immune response mediated by TLR9.
[0004] Based on the research results presented herein, one of ordinary skill in the art will recognize that the use of lipids can enable or facilitate the delivery of bioactive agents, particularly to intracellular locations. Further, based on the research results presented herein, one of ordinary skill in the art will recognize that the use of the lipids described herein enables or facilitates the delivery of an effective amount and / or a desired amount of a bioactive agent to its target location, such that, for example, the same level or a higher level of the bioactive agent than that observed when the bioactive agent is administered without lipids can reach the target location. In some embodiments, even when a smaller amount of the bioactive agent is administered with lipids than without lipids, the same level or a higher level of the bioactive agent can reach the target location. Alternatively, or additionally, based on the research results presented herein, one of ordinary skill in the art will recognize that the use of the lipids described herein can enable or facilitate an improvement in distribution (i.e., an increase in the relative level of the bioactive agent at the target location compared to non-target locations) as compared to an appropriate control (e.g., the level observed when a bioactive agent such as an oligonucleotide is administered equivalently without lipids). Further, based on the research results presented herein, one of ordinary skill in the art will recognize that the use of the lipids described herein can enable or facilitate an improvement in efficacy and / or a reduction in toxicity as compared to a relative control (e.g., without lipids). For example, in some embodiments, by improving properties (such as activity, pharmacokinetics, etc.), the unit dose can be reduced and / or the dosing frequency can be reduced. In some embodiments, an improvement in properties and / or a reduction in toxicity (e.g., improvement in pharmacokinetics, improvement in undesirable immune responses mediated by TLR9) can enable an increase in the unit dose and / or an increase in the dosing frequency, if desired. Further, based on the research results presented herein, one of ordinary skill in the art will recognize that the use of the lipids described herein can enable bioactive agents that would otherwise be considered inappropriate for therapeutic use to be effectively used for the treatment of various diseases, disorders, and / or conditions.
[0005] In some embodiments, the present disclosure encompasses certain surprising research results, including that certain lipids are particularly effective for the delivery of bioactive agents to specific types of cells and tissues, including, but not limited to, cells and tissues outside the liver (e.g., extrahepatic), such as muscle cells and muscle tissue. In some embodiments, the present disclosure provides techniques (compounds, compositions, methods, etc.) that are surprisingly effective for the delivery of bioactive agents to, for example, the heart, the muscle cells and muscle tissue of the diaphragm, the cells and tissues of skeletal muscle, the gastrocnemius muscle, the quadriceps muscle, the triceps muscle, and / or the cells and tissues of smooth muscle.
[0006] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid. Many lipids can be utilized in the techniques presented in accordance with the present disclosure. In some embodiments, the lipid contains a saturated aliphatic group or a partially unsaturated aliphatic group of C 10 -C 80 wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independent and as defined and described herein. In some embodiments, the lipid contains a saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 80 In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 80 In some embodiments, the lipid optionally contains one or more C1-4 C substituted with an aliphatic group 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an unsubstituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is one or fewer optionally substituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is two or more optionally substituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an optionally substituted C 10 -C 80 contains a saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an optionally substituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid optionally contains one or more C 1-4 C substituted with an aliphatic group 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an unsubstituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is one or fewer optionally substituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is two or more optionally substituted C 10 -C 80 contains a straight-chain saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an optionally substituted C 10 -C 40 contains a saturated or partially unsaturated aliphatic chain. In some embodiments, the lipid is an optionally substituted C 10 -C 40contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid optionally has one or more C 1-4 substituted with an aliphatic group C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is an unsubstituted C 10 -C 40 linear saturated aliphatic chain or contains a partially unsaturated aliphatic chain. In some embodiments, the lipid contains one or fewer optionally substituted C 10 -C 80 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains two or more optionally substituted C 10 -C 40 linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0007] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid. In the techniques presented in accordance with the present disclosure, many lipids can be utilized. In some embodiments, the lipid contains an optionally substituted C 10 -C 60 saturated aliphatic group or a partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, where each variable is independently as defined and described herein. In some embodiments, the lipid is an optionally substituted C 10 -C 80contains a saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted C 10 -C 80 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted with one or more C 1-4 aliphatic groups to form a C 10 -C 80 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains an unsubstituted C 10 -C 80 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain with one or fewer optionally substituted C 10 -C 80 In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain with two or more optionally substituted C 10 -C 80 In some embodiments, the lipid contains a saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 In some embodiments, the lipid contains a saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted with one or more C 1-4 aliphatic groups to form a C 10 -C 60 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains an unsubstituted C 10 -C 60 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain with one or fewer optionally substituted C 10 -C 60 In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain with two or more optionally substituted C 10 -C 60 linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains an optionally substituted C10 -C 40 contains a saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted with one or more C 1-4 aliphatic groups of C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is unsubstituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains one or fewer optionally substituted C 10 -C 60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid contains two or more optionally substituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0008] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid. In the techniques presented in accordance with the present disclosure, many lipids can be utilized. In some embodiments, the lipid is optionally substituted C 10 -C 40containing a saturated aliphatic group or a partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein. In some embodiments, the lipid is optionally substituted C 10 -C 80 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted with one or more C 1-4 aliphatic groups and is C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is unsubstituted C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is one or fewer optionally substituted C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is two or more optionally substituted C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted C 10 -C 40 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is optionally substituted C 10 -C60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid optionally has one or more C 1-4 substituted with an aliphatic group C 10 -C 60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is an unsubstituted C 10 -C 60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has one or fewer optionally substituted C 10 -C 60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has two or more optionally substituted C 10 -C 60 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has an optionally substituted C 10 -C 60 contains a saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has an optionally substituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid optionally has one or more C 1-4 substituted with an aliphatic group C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid is an unsubstituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has one or fewer optionally substituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipid has two or more optionally substituted C 10 -C 40 contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0009] In some embodiments, the present disclosure provides a bioactive agent and a C 10 -C 80To provide a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a composition comprising a bioactive agent and, optionally, one or more C 1-4 C substituted with an aliphatic group 10 -C 80 and relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 60 To provide a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a composition comprising a bioactive agent and, optionally, one or more C 1-4 C substituted with an aliphatic group 10 -C 60 and relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure provides a composition comprising a bioactive agent and a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 40 To provide a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a composition comprising a bioactive agent and, optionally, one or more C 1-4 C substituted with an aliphatic group 10 -C 40 and relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0010] In some embodiments, the present disclosure relates to a composition comprising a bioactive agent and a lipid selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, the lipid has any of the following structures:
Chemical formula
[0011] In some embodiments, the lipid is complexed with a bioactive agent. One of ordinary skill in the art will recognize that various techniques can be utilized to complex a lipid with a bioactive agent in accordance with the present disclosure. In some embodiments, the lipid is not complexed with a bioactive agent.
[0012] A variety of bioactive agents can be efficiently delivered to their targets in accordance with the present disclosure. In some embodiments, the bioactive agent is selected from the group consisting of small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, the nucleic acid comprises one or more nucleotides (e.g., natural nucleotides, modified It contains nucleotides, nucleotide analogs, etc. In some embodiments, the nucleic acid is an oligonucleotide, antisense oligonucleotide, RNAi agent, miRNA, immunomodulatory nucleic acid, aptamer, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), ribozyme, mRNA, IncRNA, ncRNA, antagomir (e.g., an antagonist to miRNA, IncRNA, ncRNA or other nucleic acid), plasmid, vector, or a part thereof. In some embodiments, the bioactive agent is an oligonucleotide. In some embodiments, the present disclosure provides a composition containing an oligonucleotide and a lipid. Such a composition is particularly surprisingly effective in delivering the oligonucleotide to its target location and, in some embodiments, delivers the oligonucleotide into the cells at the target location. In some embodiments, the technology provided is surprisingly effective in delivering oligonucleotides to muscle cells, tissues, etc. In some embodiments, the provided compounds, such as oligonucleotides complexed with lipids, have improved unexpected properties, such as improved activity, improved pharmacokinetics, reduced toxicity (e.g., reduced unwanted immune responses), improved delivery to targets (e.g., cells, tissues, organs, organisms, etc.). In some embodiments, the oligonucleotide is the oligonucleotide described in Patent Application Publication US20120316224, US20140194610, US20150211006, and WO2015107425, as well as U.S. Patent Nos. 9,243,245, 9,249,416, 9,175,286, 9,234,198, 8,895,309, 8,741,863, 8,097,596, 5,854,223, 5,756,476, and 8,871,918, and each of the oligonucleotide compositions thereof is incorporated herein by reference. In some embodiments, the oligonucleotide contains one or more chiral internucleotide linkages. In some embodiments, with respect to an oligonucleotide containing one or more chiral internucleotide linkages, the provided composition is a stereorandom composition of such oligonucleotides in that the stereochemistry of each of the chiral internucleotide linkages is not controlled.In some embodiments, the stereoregular composition is prepared by oligonucleotide synthesis without special efforts, for example, via chiral auxiliaries for controlling the stereochemistry of each chiral nucleotide - nucleotide bond. In some embodiments, with respect to an oligonucleotide containing one or more chiral nucleotide - nucleotide bonds, the provided composition is a chirally - controlled oligonucleotide composition of such oligonucleotides in that the stereochemistry of at least one of the chiral nucleotide - nucleotide bonds is controlled. In some embodiments, the stereochemistry of each of the chiral nucleotide - nucleotide bonds is independently controlled, and the provided composition is a fully chirally - controlled oligonucleotide composition. In some embodiments, the stereochemistry of one or more chiral nucleotide - nucleotide bonds is controlled (chirally - controlled nucleotide - nucleotide bonds), while the stereochemistry of one or more chiral nucleotide - nucleotide bonds is not controlled (stereorandom / unchirally - controlled nucleotide - nucleotide bonds), and the provided composition is a partially chirally - controlled oligonucleotide composition. In some embodiments, the chirally - controlled oligonucleotide composition can be prepared by oligonucleotide synthesis including the stereoselective formation of one or more, or all, chiral nucleotide - nucleotide bonds, using techniques such as those described in patent application publications US20120316224, US20140194610, US20150211006, and WO2015107425, each of which is incorporated herein by reference. In some embodiments, the provided composition contains lipids and a chirally - controlled oligonucleotide composition as described in patent application publications US20120316224, US20140194610, US20150211006, and WO2015107425, each of which is incorporated herein by reference. In some embodiments, the lipid is complexed with an oligonucleotide containing stereochemically - controlled nucleotide - nucleotide bonds.
[0013] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, the composition containing a plurality of oligonucleotides sharing the following: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages, the levels of the plurality of oligonucleotides in the composition are pre-defined; one or more of the plurality of oligonucleotides are independently complexed with a lipid; and one or more of the plurality of oligonucleotides are optionally and independently complexed with a target component.
[0014] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, the composition containing a plurality of oligonucleotides sharing the following: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein: the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages, and at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the oligonucleotides in the composition sharing a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications share the same stereochemistry at one or more chiral internucleotide linkages; one or more of the plurality of oligonucleotides are independently complexed with a lipid; and one or more of the plurality of oligonucleotides are optionally and independently complexed with a target component.
[0015] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: A c -[-L LD -(R LD ) a b , or [(A c ) a -L LD b -R LD , wherein A c is a bioactive agent; a is from 1 to 1000; b is from 1 to 1000; each L LD is independently a linker moiety or a covalent bond; and each R LD is independently a lipid moiety or a targeting component.
[0016] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: A c -[-L LD -(R LD ) a b , or [(A c ) a -L LD b -R LD , wherein: A c is a bioactive agent; a is from 1 to 1000; b is from 1 to 1000; each L LD is independently a linker moiety; and each R LD is independently a lipid moiety or a targeting component, and in this case at least one R LD is a lipid moiety.
[0017] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides having the following structure: A c -[-L LD -(R LD ) a b , or [(A c ) a -L LD b -R LD , wherein: A c is a bioactive agent; a is from 1 to 1000; b is from 1 to 1000; each L LD is independently a covalent bond or an optionally substituted C1-C 80 saturated aliphatic group or partially unsaturated aliphatic group, in which case one or more methylene units are optionally and independently replaced by T LD , or a C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O- optionally substituted group selected from; each R LD is independently an optionally substituted C1-C 80 saturated aliphatic group or partially unsaturated aliphatic group, in which case one or more methylene units are optionally and independently replaced by a C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O- optionally substituted group selected from; T LD has the following structure: [Chemical formula] W is O, S or Se; each of X, Y and Z is independently -O-, -S-, -N(-L-R 1)-, or L; L is a covalent bond or a linear or branched C1-C 10 alkylene, where one or more methylene units of L are optionally and independently C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2--SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O- substituted by an optionally substituted group selected from; R 1 is hydrogen, R, or an optionally substituted C1-C 50 aliphatic, where one or more methylene units are optionally and independently C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2--SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O- substituted by an optionally substituted group selected from, each R’ is independently -R, -C(O)R, -CO2R, or -SO2R, or; two R’s together with the atoms sandwiched between them form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene; and each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl and heterocyclyl.
[0018] In some embodiments, A c is an oligonucleotide chain ([H] b -A c is an oligonucleotide). In some embodiments, [H] b -A c is any of the oligonucleotides in the table. In some embodiments, H-A c is a small molecule. In some embodiments, H-A c is a peptide. In some embodiments, H-A c is a protein.
[0019] In some embodiments, P in T LD is P * . In some embodiments, the complex has the structure of [(A c ) a -L LD b -R LD In some embodiments, the complex is (A c ) a -L LD -R LD It has the structure. In some embodiments, a is from 1 to 100. In some embodiments, a is from 1 to 50. In some embodiments, a is from 1 to 40. In some embodiments, a is from 1 to 30. In some embodiments, a is from 1 to 20. In some embodiments, a is from 1 to 15. In some embodiments, a is from 1 to 10. In some embodiments, a is from 1 to 9. In some embodiments, a is from 1 to 8. In some embodiments, a is from 1 to 7. In some embodiments, a is from 1 to 6. In some embodiments, a is from 1 to 5. In some embodiments, a is from 1 to 4. In some embodiments, a is from 1 to 3. In some embodiments, a is from 1 to 2. In some embodiments, a is 1. In some embodiments, a is 2. In some embodiments, a is 3. In some embodiments, a is 4. In some embodiments, a is 5. In some embodiments, a is 6. In some embodiments, a is 7. In some embodiments, a is 8. In some embodiments, a is 9. In some embodiments, a is 10. In some embodiments, a is greater than 10. In some embodiments, b is from 1 to 100. In some embodiments, b is from 1 to 50. In some embodiments, b is from 1 to 40. In some embodiments, b is from 1 to 30. In some embodiments, b is from 1 to 20. In some embodiments, b is from 1 to 15. In some embodiments, b is from 1 to 10. In some embodiments, b is from 1 to 9. In some embodiments, b is from 1 to 8. In some embodiments, b is from 1 to 7. In some embodiments, b is from 1 to 6. In some embodiments, b is from 1 to 5. In some embodiments, b is from 1 to 4. In some embodiments, b is from 1 to 3. In some embodiments, b is from 1 to 2. In some embodiments, b is 1. In some embodiments, b is 2. In some embodiments, b is 3. In some embodiments, b is 4. In some embodiments, b is 5. In some embodiments, b is 6. In some embodiments, b is 7. In some embodiments, b is 8. In some embodiments, b is 9.In some embodiments, b is 10. In some embodiments, b is greater than 10. In some embodiments, the complex is A. c -L LD -R LD has the structure of. In some embodiments, A c is complexed via one or more of its sugar, base, and / or internucleotide linkage moieties. In some embodiments, A c is complexed via its 5'-OH (5'-O-). In some embodiments, A c is complexed via its 3'-OH (3'-O-). In some embodiments, prior to complexation, A c -(H) b (b is an integer from 1 to 1000 depending on the valence of A c ) is one of the oligonucleotides described herein, for example, one of the oligonucleotides described in any one of the tables. In some embodiments, L LD is -L-. In some embodiments, L LD contains a phosphorothioate group. In some embodiments, L LD is -C(O)NH-(CH2)6-OP(=O)(S - )-O-. In some embodiments, the -C(O)NH terminus is linked to R LD , and the -O- terminus is linked to the oligonucleotide, for example, via the 5'-terminus or 3'-terminus. In some embodiments, R LD is optionally substituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 , or C 80 is aliphatic. In some embodiments, R LD is optionally substituted C 10-80 aliphatic. In some embodiments, R LD is optionally substituted C 20-80 aliphatic. In some embodiments, R LD is optionally substituted C 10-70 aliphatic. In some embodiments, R LD is optionally substituted C 20-70 aliphatic. In some embodiments, R LD is optionally substituted C 10-60 aliphatic. In some embodiments, R LD is optionally substituted C 20-60 aliphatic. In some embodiments, R LD is optionally substituted C 10-50 aliphatic. In some embodiments, R LD is optionally substituted C 20-50 aliphatic. In some embodiments, R LD is optionally substituted C 10-40 aliphatic. In some embodiments, R LD is optionally substituted C 20-40 aliphatic. In some embodiments, R LD is optionally substituted C 10-30 aliphatic. In some embodiments, R LD is optionally substituted C 20-30 aliphatic. In some embodiments, R LD is unsubstituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C24 or C 25 to C 20 C 21 C 22 C 23 C 24 C 25 C 26 C 27 C 28 C 29 C 30 C 35 C 40 C 45 C 50 C 60 C 70 or C 80 is aliphatic. In some embodiments, R LD is unsubstituted C 10-80 aliphatic. In some embodiments, R LD is unsubstituted C 20-80 aliphatic. In some embodiments, R LD is unsubstituted C 10-70 aliphatic. In some embodiments, R LD is unsubstituted C 20-70 aliphatic. In some embodiments, R LD is unsubstituted C 10-60 aliphatic. In some embodiments, R LD is unsubstituted C 20-60 aliphatic. In some embodiments, R LD is unsubstituted C 10-50 aliphatic. In some embodiments, R LD is unsubstituted C 20-50 aliphatic. In some embodiments, R LD is unsubstituted C 10-40 aliphatic. In some embodiments, R LD is unsubstituted C 20-40 aliphatic. In some embodiments, R LD is unsubstituted C 10-30 aliphatic. In some embodiments, R LD is unsubstituted C 20-30 aliphatic.
[0020] In some embodiments, multiple oligonucleotides share the same stereochemistry at one or more chiral internucleotide linkages (chirally controlled internucleotide linkages). In some embodiments, multiple oligonucleotides share the same stereochemistry at two or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at three or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at four or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at five or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at six or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at seven or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at eight or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at nine or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at ten or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at eleven or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at twelve or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at thirteen or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at fourteen or more chiral internucleotide linkages. In some embodiments, the multiple oligonucleotides share the same stereochemistry at 15 or more chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 10% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 20% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 30% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 40% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 50% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 60% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 70% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 80% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 90% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 95% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 96% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 97% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at 98% or more of the chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at each chiral internucleotide linkage.For those of ordinary skill in the art, as will be readily appreciated and as described in the examples, chiral internucleotide linkages in which multiple oligonucleotides share the same stereochemistry may independently be either Rp or Sp. For example, in the first chiral internucleotide linkage, multiple oligonucleotides may all be Rp, while at a second position, multiple oligonucleotides may all be Sp (RpSp; may alternatively be RpRp, SpSp, or SpRp if desired).
[0021] In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the oligonucleotides in a provided composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications share the same stereochemistry at one or more chiral nucleotide linkages. In some embodiments, this percentage is at least 0.5%. In some embodiments, this percentage is at least 1%. In some embodiments, this percentage is at least 2%. In some embodiments, this percentage is at least 3%. In some embodiments, this percentage is at least 4%. In some embodiments, this percentage is at least 5%. In some embodiments, this percentage is at least 6%. In some embodiments, this percentage is at least 7%. In some embodiments, this percentage is at least 8%. In some embodiments, this percentage is at least 9%. In some embodiments, this percentage is at least 10%. In some embodiments, this percentage is at least 20%. In some embodiments, this percentage is at least 30%. In some embodiments, this percentage is at least 40%. In some embodiments, this percentage is at least 50%. In some embodiments, this percentage is at least 60%. In some embodiments, this percentage is at least 70%. In some embodiments, this percentage is at least 75%. In some embodiments, this percentage is at least 80%. In some embodiments, this percentage is at least 81%. In some embodiments, this percentage is at least 82%. In some embodiments, this percentage is at least 83%. In some embodiments, this percentage is at least 84%. In some embodiments, this percentage is at least 85%. In some embodiments, this percentage is at least 86%. In some embodiments, this percentage is at least 87%. In some embodiments, this percentage is at least 88%. In some embodiments, this percentage is at least 89%.In some embodiments, this ratio is at least 90%. In some embodiments, this ratio is at least 91%. In some embodiments, this ratio is at least 92%. In some embodiments, this ratio is at least 93%. In some embodiments, this ratio is at least 94%. In some embodiments, this ratio is at least 95%. In some embodiments, this ratio is at least 96%. In some embodiments, this ratio is at least 97%. In some embodiments, this ratio is at least 98%. In some embodiments, this ratio is at least 99%.
[0022] In some embodiments, oligonucleotides sharing the same stereochemistry at a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and one or more chiral internucleotide linkages are enriched, for example, compared to oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications but do not share the same stereochemistry at one or more chiral internucleotide linkages. In some embodiments, as would be understood by one of ordinary skill in the art, the enrichment results from one or more uses of the provided techniques that allow each internucleotide linkage to be formed stereoselectively (chirally controlled) such that the oligonucleotides share the same stereochemistry.
[0023] In some embodiments, oligonucleotides sharing the same stereochemistry at a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and one or more chiral internucleotide linkages are enriched by at least 5-fold compared to a stereorandom preparation of oligonucleotides (such oligonucleotides being 5*(1 / 2 of oligonucleotides sharing a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications) nhas a proportion. In this case, n is the number of internucleotide linkages in which such oligonucleotides share the same stereochemistry; or oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications but do not share the same stereochemistry in one or more chiral internucleotide linkages are [1-(1 / 2 n )] / 5 or less of the oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications). In this case, the internucleotide linkages are not chirally controlled (nucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry in one or more chiral internucleotide linkages are often 1 / 2 n of the proportion of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications. In this case, n is the number of chiral internucleotide linkages in which the oligonucleotide shares the same stereochemistry. And oligonucleotides that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications but are not of a specific oligonucleotide type are often [1-(1 / 2 n)] is considered to have a ratio of). In some embodiments, this enrichment is at least 20-fold. In some embodiments, this enrichment is at least 30-fold. In some embodiments, this enrichment is at least 40-fold. In some embodiments, this enrichment is at least 50-fold. In some embodiments, this enrichment is at least 60-fold. In some embodiments, this enrichment is at least 70-fold. In some embodiments, this enrichment is at least 80-fold. In some embodiments, this enrichment is at least 90-fold. In some embodiments, this enrichment is at least 100-fold. In some embodiments, this enrichment is at least 200-fold. In some embodiments, this enrichment is at least 300-fold. In some embodiments, this enrichment is at least 400-fold. In some embodiments, this enrichment is at least 500-fold. In some embodiments, this enrichment is at least 600-fold. In some embodiments, this enrichment is at least 700-fold. In some embodiments, this enrichment is at least 800-fold. In some embodiments, this enrichment is at least 900-fold. In some embodiments, this enrichment is at least 1,000-fold. In some embodiments, this enrichment is at least 2,000-fold. In some embodiments, this enrichment is at least 4,000-fold. In some embodiments, this enrichment is at least 8,000-fold. In some embodiments, this enrichment is at least 10,000-fold. In some embodiments, this enrichment is at least 20,000-fold. In some embodiments, this enrichment is at least (1.5) n is. In some embodiments, this enrichment is at least (1.6) n is. In some embodiments, this enrichment is at least (1.7) n is. In some embodiments, this enrichment is at least (1.1) n is. In some embodiments, this enrichment is at least (1.8) n is. In some embodiments, this enrichment is at least (1.9) n is. In some embodiments, this enrichment is at least 2 n is. In some embodiments, this enrichment is at least 3 nIt is. In some embodiments, this enrichment is at least 4 n It is. In some embodiments, this enrichment is at least 5 n It is. In some embodiments, this enrichment is at least 6 n It is. In some embodiments, this enrichment is at least 7 n It is. In some embodiments, this enrichment is at least 8 n It is. In some embodiments, this enrichment is at least 9 n It is. In some embodiments, this enrichment is at least 10 n It is. In some embodiments, this enrichment is at least 15 n It is. In some embodiments, this enrichment is at least 20 n It is. In some embodiments, this enrichment is at least 25 n It is. In some embodiments, this enrichment is at least 30 n It is. In some embodiments, this enrichment is at least 40 n It is. In some embodiments, this enrichment is at least 50 n It is. In some embodiments, this enrichment is at least 100 n It is. In some embodiments, enrichment is measured by an increase in the proportion of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, and the same stereochemistry at one or more chiral nucleotide linkages. In some embodiments, enrichment is measured by a decrease in the proportion of oligonucleotides that share a common base sequence, a common pattern of backbone linkages, a common pattern of backbone phosphorus modifications, but do not share the same stereochemistry at one or more chiral nucleotide linkages.
[0024] In some embodiments, a particular type of oligonucleotide in a chirally controlled oligonucleotide composition is structurally identical (including stereochemically identical), and is enriched by at least 5-fold compared to a stereorandom preparation of the oligonucleotide (the particular type of oligonucleotide has an oligonucleotide 5*(1 / 2 having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of the particular oligonucleotide typen ) and in this case n is the number of chiral nucleotide linkages. Or an oligonucleotide having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type but not being of the specific oligonucleotide type is [1-(1 / 2 n )] / 5 or less of an oligonucleotide having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type) (an oligonucleotide of a specific type is often considered to have a proportion of 1 / 2 n of an oligonucleotide having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type, and in this case n is the number of chiral nucleotide linkages. And an oligonucleotide having the base sequence, backbone linkage pattern, and backbone phosphorus modification pattern of the specific oligonucleotide type but not being of the specific oligonucleotide type is often [1-(1 / 2 n)] is considered to have a ratio of). In some embodiments, this enrichment is at least 20-fold. In some embodiments, this enrichment is at least 30-fold. In some embodiments, this enrichment is at least 40-fold. In some embodiments, this enrichment is at least 50-fold. In some embodiments, this enrichment is at least 60-fold. In some embodiments, this enrichment is at least 70-fold. In some embodiments, this enrichment is at least 80-fold. In some embodiments, this enrichment is at least 90-fold. In some embodiments, this enrichment is at least 100-fold. In some embodiments, this enrichment is at least 200-fold. In some embodiments, this enrichment is at least 300-fold. In some embodiments, this enrichment is at least 400-fold. In some embodiments, this enrichment is at least 500-fold. In some embodiments, this enrichment is at least 600-fold. In some embodiments, this enrichment is at least 700-fold. In some embodiments, this enrichment is at least 800-fold. In some embodiments, this enrichment is at least 900-fold. In some embodiments, this enrichment is at least 1,000-fold. In some embodiments, this enrichment is at least 2,000-fold. In some embodiments, this enrichment is at least 4,000-fold. In some embodiments, this enrichment is at least 8,000-fold. In some embodiments, this enrichment is at least 10,000-fold. In some embodiments, this enrichment is at least 20,000-fold. In some embodiments, this enrichment is at least (1.5) n is. In some embodiments, this enrichment is at least (1.6) n is. In some embodiments, this enrichment is at least (1.7) n is. In some embodiments, this enrichment is at least (1.1) n is. In some embodiments, this enrichment is at least (1.8) n is. In some embodiments, this enrichment is at least (1.9) n is. In some embodiments, this enrichment is at least 2 n is. In some embodiments, this enrichment is at least 3 nIt is. In some embodiments, this enrichment is at least 4 n It is. In some embodiments, this enrichment is at least 5 n It is. In some embodiments, this enrichment is at least 6 n It is. In some embodiments, this enrichment is at least 7 n It is. In some embodiments, this enrichment is at least 8 n It is. In some embodiments, this enrichment is at least 9 n It is. In some embodiments, this enrichment is at least 10 n It is. In some embodiments, this enrichment is at least 15 n It is. In some embodiments, this enrichment is at least 20 n It is. In some embodiments, this enrichment is at least 25 n It is. In some embodiments, this enrichment is at least 30 n It is. In some embodiments, this enrichment is at least 40 n It is. In some embodiments, this enrichment is at least 50 n It is. In some embodiments, this enrichment is at least 100 n It is. In some embodiments, the enrichment is measured by an increase in the proportion of oligonucleotides having a specific oligonucleotide type of base sequence, backbone linkage pattern, and backbone phosphorus modification pattern. In some embodiments, the enrichment is measured by a decrease in the proportion of oligonucleotides that have a specific oligonucleotide type of base sequence, backbone linkage pattern, and backbone phosphorus modification pattern but are not of the specific oligonucleotide type in the oligonucleotides having a specific oligonucleotide type of base sequence, backbone linkage pattern, and backbone phosphorus modification pattern.
[0025] In some embodiments, the composition further comprises a targeting component. The targeting component may or may not be complexed to a lipid or a bioactive agent. In some embodiments, the targeting component is complexed to a bioactive agent. In some embodiments, the bioactive agent is complexed to both a lipid and a targeting component. Various targeting components such as, for example, lipids, antibodies, peptides, carbohydrates, etc. can be used in accordance with the present disclosure.
[0026] In some embodiments, the present disclosure encompasses the use of a composition comprising a lipid and a bioactive agent. In some embodiments, the present disclosure provides a method for delivering a bioactive agent to a target site, comprising administering the provided composition. In some embodiments, the provided method delivers the bioactive agent to a cell. In some embodiments, the provided method delivers the bioactive agent to a muscle cell. In some embodiments, the provided method delivers the bioactive agent to a cell within a tissue. In some embodiments, the provided method delivers the bioactive agent to a cell within an organ. In some embodiments, the provided method delivers the bioactive agent into a cell within a subject and comprises administering the composition provided to the subject. In some embodiments, the provided method delivers the bioactive agent into the cytoplasm. In some embodiments, the provided method delivers the bioactive agent into the nucleus.
[0027] One embodiment relates to a method for the delivery of a bioactive agent to muscle cells or tissue, or muscle cells or tissue in a mammal (e.g., a human subject). The method relates to the use of a composition containing a bioactive agent, a lipid, and any one or more additional components selected from: polynucleotides, dyes, intercalating agents (e.g., acridine), carbonic anhydrase inhibitors, cross-linking agents (e.g., psoralen or mitomycin C), porphyrins (e.g., TPPC4, texaphyrin, or sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, or dihydrophenazine), artificial endonucleases, chelating agents, EDTA, alkylating agents, phosphates, aminos, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyaminos, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, vitamin E, or folic acid), synthetic ribonucleases, proteins, such as glycoproteins, or peptides, such as molecules having specific affinity for co-ligands, or antibodies, such as antibodies, hormones, hormone receptors, non-peptide species, lipids, lectins, carbohydrates, vitamins, cofactors, or drugs. In some embodiments, the disclosure relates to a composition containing a bioactive agent and a lipid containing a straight-chain saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 80 or a method related to the composition. In some embodiments, the disclosure relates to a composition containing a bioactive agent and a lipid containing a straight-chain saturated aliphatic chain or a partially unsaturated aliphatic chain of C 1-4 optionally substituted with one or more C 10 -C 80 or a method related to the composition. In some embodiments, the disclosure relates to a composition containing a bioactive agent and a lipid containing a straight-chain saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 60 or a method related to the composition. In some embodiments, the disclosure relates to a composition containing a bioactive agent and a lipid containing a straight-chain saturated aliphatic chain or a partially unsaturated aliphatic chain of C 1-4 optionally substituted with one or more C 10 -C 60A composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain, or a method related to the composition. In some embodiments, the present disclosure relates to a bioactive agent and a C 10 -C 40 A composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain, or a method related to the composition. In some embodiments, the present disclosure relates to a bioactive agent and optionally one or more C 1-4 A C substituted with an aliphatic group 10 -C 40 A composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain, or a method related to the composition. In some embodiments, the present disclosure provides a chiro-controlled oligonucleotide composition and a lipid selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl, wherein the composition is suitable for delivering the oligonucleotide to muscle cells or tissues, or muscle cells or tissues in a mammal (e.g., a human subject). In some embodiments, the bioactive agent is an oligonucleotide containing one or more chiral nucleotide linkages, and the provided composition is a chiro-controlled oligonucleotide composition of the oligonucleotide. In some embodiments, the bioactive agent is an oligonucleotide containing one or more chiral nucleotide linkages, and the provided composition is a non-chiro-controlled oligonucleotide composition of the oligonucleotide.
[0028] In some embodiments, the present disclosure relates to a method of delivering a bioactive agent to a cell or tissue, the method comprising: providing a composition containing a bioactive agent and a lipid; and contacting the composition with the cell or tissue. In some embodiments, the present disclosure relates to a method of administering a bioactive agent to a subject, the method comprising: providing a composition containing a bioactive agent and a lipid; and administering the composition to the subject. In some embodiments, the lipid contains a straight-chain saturated or partially unsaturated aliphatic chain of C 10 -C 80 . In some embodiments, the lipid optionally contains a straight-chain saturated or partially unsaturated aliphatic chain of C 1-4 substituted with one or more C 10 -C 80 aliphatic groups. In some embodiments, the lipid contains a straight-chain saturated or partially unsaturated aliphatic chain of C 10 -C 60 . In some embodiments, the lipid optionally contains a straight-chain saturated or partially unsaturated aliphatic chain of C 1-4 substituted with one or more C 10 -C 60 aliphatic groups. In some embodiments, the lipid contains a straight-chain saturated or partially unsaturated aliphatic chain of C 10 -C 40 . In some embodiments, the lipid optionally contains a straight-chain saturated or partially unsaturated aliphatic chain of C 1-4 substituted with one or more C 10 -C 40It contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In various embodiments, the lipid is selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, the bioactive agent is selected from the group consisting of small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, the nucleic acid is an oligonucleotide, an antisense oligonucleotide, an RNAi agent, an miRNA, an immunomodulatory nucleic acid, an aptamer, a Piwi-interacting RNA (piRNA), a small nucleolar RNA (snoRNA), a ribozyme, an mRNA, an IncRNA, an ncRNA, an antagomir (e.g., an antagonist to an miRNA, an IncRNA, an ncRNA, or other nucleic acid), a plasmid, a vector, or a portion thereof. In some embodiments, the provided composition is a chiral control oligonucleotide composition of a nucleic acid containing one or more chiral nucleotide linkages. In various embodiments, the extrahepatic cells or tissues are muscle cells or muscle tissue. In various embodiments, the muscle cells or muscle tissue are in a subject. In various embodiments, the muscle cells or muscle tissue are in a subject suffering from a muscle-related disease or disorder. In various embodiments, the muscle-related disorder is sarcopenia, muscle movement disorder, muscle atrophy-related disorder, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorder, malnutrition, and skeletal muscle degeneration caused by disease, muscle-related diseases associated with insulin-dependent signaling disorders, amyotrophic lateral sclerosis, spinal muscular atrophy, and spinal cord injury, and ischemic muscle diseases. In some embodiments, the present disclosure relates to a method of administering a nucleic acid (as a non-limiting example, an oligonucleotide or a stereodefined oligonucleotide) to muscle cells or muscle tissue in a subject, the subject suffering from a muscle-related disease or disorder, the method comprising the steps of: providing a composition containing a lipid and a nucleic acid, and administering a therapeutically effective amount of the composition to the subject.
[0029] In some embodiments, the bioactive agent is an oligonucleotide, and its sequence is or contains an element that is substantially complementary to a target element in a cellular nucleic acid. In some embodiments, the target element is or contains a sequence element associated with a muscle disease, disorder, or condition. In some embodiments, the muscle disease, disorder, or condition is DMD. In some embodiments, the cellular nucleic acid is or contains a transcript. In some embodiments, the cellular nucleic acid is or contains a primary transcript. In some embodiments, the cellular nucleic acid is or contains genomic nucleic acid.
[0030] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid.
[0031] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid, and the composition is characterized in that it delivers the bioactive agent into cells.
[0032] In some embodiments, the composition delivers the bioactive agent into the cytoplasm of the cell.
[0033] In some embodiments, the composition delivers the bioactive agent into the nucleus of the cell.
[0034] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid, and the composition delivers the bioactive agent into cells at a high level as compared to the level observed for the bioactive agent in the absence of the lipid.
[0035] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid, and the composition is characterized in that it delivers the bioactive agent into muscle cells.
[0036] In some embodiments, the composition delivers the bioactive agent into the cytoplasm of the muscle cell.
[0037] In some embodiments, the composition delivers a bioactive agent into the nucleus of a muscle cell.
[0038] In some embodiments, the composition is characterized in that when administered to a subject, the composition delivers a bioactive agent to the muscle cells of the subject.
[0039] In some embodiments, the composition delivers a bioactive agent into the cytoplasm of a muscle cell.
[0040] In some embodiments, the composition delivers a bioactive agent into the nucleus of a muscle cell.
[0041] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid for delivering the bioactive agent to muscle cells or muscle tissue.
[0042] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid selected from the list of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl.
[0043] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid selected from the following:
Chemical formula
[0044] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid, wherein the lipid is optionally a C 1-4 substituted with one or more C aliphatic groups 10 -C 40containing a linear saturated or partially unsaturated aliphatic chain, wherein the bioactive agent is selected from the group consisting of small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids.
[0045] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid for delivering the lipid to muscle cells or muscle tissue.
[0046] In some embodiments, the present disclosure provides an oligonucleotide composition containing a plurality of oligonucleotides sharing: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein one or more of the plurality of oligonucleotides are individually complexed with a lipid.
[0047] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition containing a plurality of oligonucleotides sharing: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone phosphorus modifications; wherein the composition is chirally controlled in that the plurality of oligonucleotides share the same stereochemistry at one or more chiral nucleotide linkages; one or more of the plurality of oligonucleotides are individually complexed with a lipid; and one or more of the plurality of oligonucleotides are optionally and individually complexed with a targeting compound or moiety.
[0048] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell.
[0049] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell in a subject.
[0050] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell, where the nucleic acid is genomic nucleic acid.
[0051] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell in a subject, where the nucleic acid is genomic nucleic acid.
[0052] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell, where the target element is mRNA or a portion thereof.
[0053] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell in a subject, where the target element is mRNA or a portion thereof.
[0054] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell, where the target element is associated with a disease or disorder.
[0055] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a cell in a subject, where the target element is associated with a disease or disorder.
[0056] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a muscle cell, where the target element is associated with a muscle-related disease or disorder.
[0057] In some embodiments, the oligonucleotide contains a sequence that is substantially complementary to the sequence of a target element in the nucleic acid of a muscle cell in a subject, where the target element is associated with a muscle-related disease or disorder.
[0058] In some embodiments, a plurality of oligonucleotides share the same stereochemistry at five or more chiral internucleotide linkages.
[0059] In some embodiments, a plurality of oligonucleotides share the same stereochemistry at ten or more chiral internucleotide linkages.
[0060] In some embodiments, a plurality of oligonucleotides share the same stereochemistry at each chiral internucleotide linkage, whereby the plurality of oligonucleotides share a common pattern of backbone chiral centers.
[0061] In some embodiments, one or more of the plurality of oligonucleotides are independently complexed to a lipid via a 5'-OH on the oligonucleotide.
[0062] In some embodiments, one or more of the plurality of oligonucleotides are independently complexed to a lipid via a 3'-OH on the oligonucleotide.
[0063] In some embodiments, each of the plurality of oligonucleotides is individually complexed to a lipid.
[0064] In some embodiments, each of the plurality of oligonucleotides is individually complexed to the same lipid.
[0065] In some embodiments, the present disclosure provides a composition containing a bioactive agent and a lipid, the agent being any agent disclosed herein and the lipid being any lipid disclosed herein.
[0066] In some embodiments, the present disclosure provides a method for delivering an oligonucleotide to muscle cells or muscle tissue in a human subject, the method comprising: (a) providing a composition or method of any one of the embodiments; and (b) administering the composition to the human subject, whereby the oligonucleotide is delivered to muscle cells or muscle tissue in the subject.
[0067] In some embodiments, the present disclosure provides a method for delivering a bioactive agent to muscle cells or muscle tissue, the method comprising preparing a composition according to any one of the embodiments and treating [contacting] the cells or tissue with the composition.
[0068] In some embodiments, the present disclosure provides a method for modulating the level of a transcript or gene product of a gene in a cell, the method comprising contacting the cell with a composition according to any one of the embodiments, wherein the bioactive agent is capable of modulating the level of the transcript or gene product.
[0069] In some embodiments, the present disclosure provides a method for inhibiting gene expression in muscle cells or muscle tissue, the method comprising preparing a composition according to any one of the embodiments and treating the muscle cells or muscle tissue with the composition.
[0070] In some embodiments, the present disclosure provides a method for inhibiting gene expression in muscle cells or muscle tissue in a mammal, the method comprising preparing a composition according to any one of the embodiments and administering the composition to the mammal.
[0071] In some embodiments, the present disclosure provides a method for treating a disease caused by overexpression of one or more proteins in muscle cells or muscle tissue in a subject, the method comprising administering to the subject a composition according to any one of the embodiments.
[0072] In some embodiments, the present disclosure provides a method of treating a disease caused by a decrease, suppression, or loss of expression of one or more proteins in a subject, the method comprising administering to the subject a composition according to any one of the embodiments.
[0073] In some embodiments, the present disclosure provides a method for eliciting an immune response in a subject, the method comprising administering to the subject a composition according to any one of the embodiments, wherein the bioactive compound is an immunomodulatory nucleic acid.
[0074] In some embodiments, the present disclosure provides a composition or method according to any one of the embodiments, and treating signs and / or symptoms of a disease, disorder, or condition in a subject selected from cancer, proliferative diseases, disorders, or conditions, metabolic diseases, disorders, or conditions, inflammatory diseases, disorders, or conditions, and viral infections by administering the composition to the subject.
[0075] In some embodiments, the present disclosure provides a method of modulating the amount of exon skipping in a cell, the method comprising contacting the cell with a composition according to any one of the embodiments, wherein the bioactive agent is capable of modulating the amount of exon skipping.
[0076] In some embodiments, the present disclosure provides a method of administering a bioactive agent to a subject in need thereof, the method comprising providing a composition containing the agent and a lipid, and administering the composition to the subject, wherein the agent is any agent disclosed herein and the lipid is any lipid disclosed herein.
[0077] In some embodiments, the present disclosure provides a method of treating a subject disease, the method comprising providing a composition containing an agent and a lipid, administering a therapeutically effective amount of the composition to the subject, wherein the agent is any agent disclosed herein, the lipid is any lipid disclosed herein, and the disease is any disease disclosed herein.
[0078] In some embodiments, the lipid contains a saturated or partially unsaturated aliphatic chain of C 10 -C 40 which may be optionally substituted.
[0079] In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 40 which may be optionally substituted.
[0080] In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 1-4 optionally substituted with one or more C 10 -C 40 which may be optionally substituted.
[0081] In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 40 which is unsubstituted.
[0082] In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 40 optionally substituted with one or fewer C
[0083] In some embodiments, the lipid contains a linear saturated or partially unsaturated aliphatic chain of C 10 -C 40 optionally substituted with two or more C
[0084] In some embodiments, the lipid does not contain a tricyclic or polycyclic moiety.
[0085] In some embodiments, the lipid has an R 1 -COOH structure, wherein R 1 is an optionally substituted C 10 -C 40 saturated aliphatic chain or partially unsaturated aliphatic chain.
[0086] In some embodiments, the lipid is complexed via its carboxyl group.
[0087] In some embodiments, the lipid is selected from:
Chemical formula
[0088] In some embodiments, the lipid is complexed with a bioactive agent.
[0089] In some embodiments, the lipid is directly complexed with a bioactive agent.
[0090] In some embodiments, the lipid is complexed with a bioactive agent via a linker.
[0091] In some embodiments, the linker is selected from an uncharged linker, a charged linker, an alkyl-containing linker, a phosphate-containing linker, a branched linker, an unbranched linker, a linker containing at least one cleavage group, a linker containing at least one redox cleavage group, a linker containing at least one phosphate-based cleavage group, a linker containing at least one acid cleavage group, a linker containing at least one ester-based cleavage group, and a linker containing at least one peptide-based cleavage group.
[0092] In some embodiments, the nucleic acid is an oligonucleotide, an antisense oligonucleotide, an RNAi agent, an miRNA, a splice switching oligonucleotide (SSO), an immunomodulatory nucleic acid, an aptamer, a ribozyme, an mRNA, an IncRNA, an ncRNA, an antagomir (e.g., an antagonist to an miRNA, IncRNA, ncRNA, or other nucleic acid), a plasmid, a vector, or a portion thereof.
[0093] In some embodiments, the RNAi agent is an siRNA, an shRNA, an miRNA, a sisiRNA, a meroduplex RNA (mdRNA), a DNA-RNA chimera, an siRNA containing two mismatches (or more mismatches), a neutral siRNA, an aiRNA, or an siRNA containing a terminal or internal spacer.
[0094] In some embodiments, each oligonucleotide among a plurality of oligonucleotides is individually complexed with the same lipid at the same position.
[0095] In some embodiments, the lipid is complexed with the oligonucleotide via a linker.
[0096] In some embodiments, one or more oligonucleotides among a plurality of oligonucleotides are independently complexed with a targeting compound or a targeting moiety.
[0097] In some embodiments, one or more oligonucleotides among a plurality of oligonucleotides are independently complexed with a lipid, and a targeting compound or a targeting moiety.
[0098] In some embodiments, one or more oligonucleotides among a plurality of oligonucleotides are independently complexed with a lipid at one end and a targeting compound or a targeting moiety at the other end.
[0099] In some embodiments, a plurality of oligonucleotides share the same chemical modification pattern.
[0100] In some embodiments, a plurality of oligonucleotides share the same chemical modification pattern that contains one or more base modifications.
[0101] In some embodiments, a plurality of oligonucleotides share the same chemical modification pattern that contains one or more sugar modifications.
[0102] In some embodiments, the common base sequence can hybridize to a transcript in muscle cells, and that transcript contains a mutation associated with a muscle disease, or a mutation in its level, activity, and / or distribution that is associated with a muscle disease.
[0103] In some embodiments, the common base sequence can hybridize to a transcript in muscle cells, and the composition is characterized in that it changes the splicing of the transcript when contacted with the transcript in a transcription splicing system, as compared to what is observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.
[0104] In some embodiments, the common base sequence hybridizes to a transcript of dystrophin, myostatin, huntingtin, myostatin receptor, ActRIIB, ActRIIA, DMPK, Malat1, SMN2, dystrophia myotonica protein kinase (DMPK), proprotein convertase subtilisin / kexin type 9 (PCSK9), SMAD7 or keratin 14 (KRT14).
[0105] In some embodiments, the common base sequence hybridizes to a transcript of dystrophin.
[0106] In some embodiments, the common base sequence hybridizes to a dystrophin transcript, and the composition increases the production of one or more functional or partially functional proteins encoded by dystrophin.
[0107] In some embodiments, the oligonucleotide is a splice-switching oligonucleotide.
[0108] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more 2'-F.
[0109] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more contiguous 2'-F.
[0110] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more contiguous 2'-F within 10 nucleotides of the 5' end.
[0111] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more 2'-F within 10 nucleotides of the 5' end.
[0112] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more contiguous 2'-F at the 5' end.
[0113] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing five or more contiguous 2'-F within the first 10 nucleotides of the 3' end.
[0114] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing five or more 2'-F within 10 nucleotides of the 3' end.
[0115] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing seven or more consecutive 2'-F at the 3' end.
[0116] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more consecutive 2'-F at the 5' end, three or more consecutive 2'-F at the 3' end, and three or more 2'-OR between the 2'-F modification at the 5' end and the 2'-F modification at the 3' end.
[0117] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more 2'-F at the 5' end, three or more 2'-F at the 3' end, and three or more 2'-OR between the 2'-F modification at the 5' end and the 2'-F modification at the 3' end and sharing a common pattern of sugar modification.
[0118] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing five or more 2'-F within 10 nucleotides at the 5' end.
[0119] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing three or more consecutive 2'-F at the 5' end.
[0120] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing seven or more 2'-F within 10 nucleotides at the 3' end.
[0121] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing five or more consecutive 2'-F within 10 nucleotides at the 3' end.
[0122] In some embodiments, the plurality of oligonucleotides share a common pattern of sugar modification, the pattern containing seven or more consecutive 2'-F at the 3' end.
[0123] In some embodiments, the plurality of oligonucleotides contain a 5'-wing-core-wing-3' structure, wherein in this case each wing region independently contains 3 to 10 nucleosides, and the core region independently contains 3 to 10 nucleosides.
[0124] In some embodiments, the core contains at least one chirally controlled internucleotide linkage (e.g., Sp or Rp configuration), and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the core contains at least one internucleotide linkage that is a phosphorothioate with a chirally controlled Sp configuration, and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, each wing region contains an unmodified sugar moiety. In some embodiments, the core region contains one or more native phosphate linkages. In some embodiments, each internucleotide linkage after the core nucleoside is a native phosphate linkage. In some embodiments, the wing contains at least one chirally controlled internucleotide linkage (e.g., phosphorothioate in Sp or Rp configuration), and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wing contains at least one internucleotide linkage that is a phosphorothioate with a chirally controlled Sp configuration, and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wing contains one or more modified internucleotide linkages. In some embodiments, each internucleotide linkage after the core nucleoside is a modified internucleotide linkage.
[0125] In some embodiments, the 5'-wing region contains three or more 2'-F.
[0126] In some embodiments, the 5'-wing region contains three or more consecutive 2'-Fs.
[0127] In some embodiments, the 5'-wing region contains 10% or more 2'-F.
[0128] In some embodiments, each sugar of the 5'-wing region contains 2'-F.
[0129] In some embodiments, the 5'-wing region contains three or more chiral nucleotide linkages.
[0130] In some embodiments, the 5'-wing region contains three or more consecutive nucleotide linkages.
[0131] In some embodiments, the 5'-wing region contains 10% or more nucleotide linkages.
[0132] In some embodiments, each nucleotide linkage of the 5'-wing region is chiral.
[0133] In some embodiments, each nucleotide linkage of the 5'-wing region is a phosphorothioate linkage.
[0134] In some embodiments, the 5'-wing region contains five or more Rp chiral nucleotide linkages.
[0135] In some embodiments, the 5'-wing region contains five or more Rp consecutive nucleotide linkages.
[0136] In some embodiments, the 5'-wing region contains 10% or more Rp nucleotide linkages.
[0137] In some embodiments, each nucleotide linkage of the 5'-wing region is Rp.
[0138] In some embodiments, the 3'-wing region contains three or more 2'-F.
[0139] In some embodiments, the 3'-wing region contains five or more consecutive 2'-F.
[0140] In some embodiments, the 3'-wing region contains 10% or more of 2'-F.
[0141] In some embodiments, each sugar in the 3'-wing region contains 2'-F.
[0142] In some embodiments, the 3'-wing region contains three or more chiral nucleotide linkages.
[0143] In some embodiments, the 3'-wing region contains five or more consecutive nucleotide linkages.
[0144] In some embodiments, the 3'-wing region contains 10% or more of nucleotide linkages.
[0145] In some embodiments, each nucleotide linkage in the 3'-wing region is chiral.
[0146] In some embodiments, each nucleotide linkage in the 3'-wing region is a phosphorothioate linkage.
[0147] In some embodiments, the 3'-wing region contains three or more Rp chiral nucleotide linkages.
[0148] In some embodiments, the 3'-wing region contains five or more Rp consecutive nucleotide linkages.
[0149] In some embodiments, the 3'-wing region contains 10% or more of Rp nucleotide linkages.
[0150] In some embodiments, each nucleotide linkage in the 3'-wing region is Rp.
[0151] In some embodiments, the 5'-wing and 3'-wing have the same length, chemical modification pattern, backbone nucleotide linkage pattern, and backbone chiral center pattern.
[0152] In some embodiments, the nucleotide linkage between the 5'-wing region and the core region is a chiral nucleotide linkage.
[0153] In some embodiments, the nucleotide linkage between the 5'-wing region and the core region is a phosphorothioate linkage.
[0154] In some embodiments, the nucleotide linkage between the 5'-wing region and the core region is an Rp phosphorothioate linkage.
[0155] In some embodiments, the nucleotide linkage between the 3'-wing region and the core region is a chiral nucleotide linkage.
[0156] In some embodiments, the nucleotide linkage between the 3'-wing region and the core region is a phosphorothioate linkage.
[0157] In some embodiments, the nucleotide linkage between the 3'-wing region and the core region is an Rp phosphorothioate linkage.
[0158] In some embodiments, the core region contains three or more 2'-ORs.
[0159] In some embodiments, the core region contains five or more consecutive 2'-ORs.
[0160] In some embodiments, the core region contains 10% or more 2'-ORs.
[0161] In some embodiments, each sugar in the core region contains 2'-OR.
[0162] In some embodiments, the core region contains three or more chiral nucleotide linkages.
[0163] In some embodiments, the core region contains five or more consecutive nucleotide linkages.
[0164] In some embodiments, the core region contains 10% or more of the nucleotide linkages.
[0165] In some embodiments, each nucleotide linkage in the core region is chiral.
[0166] In some embodiments, each nucleotide linkage in the core region is a phosphorothioate linkage.
[0167] In some embodiments, the core region contains three or more Sp chiral nucleotide linkages.
[0168] In some embodiments, the core region contains five or more Sp consecutive nucleotide linkages.
[0169] In some embodiments, the core region contains 10% or more of the Sp nucleotide linkages.
[0170] In some embodiments, each nucleotide linkage in the core region is Sp.
[0171] In some embodiments, the 5'-wing region contains five or more Sp chiral nucleotide linkages.
[0172] In some embodiments, the 5'-wing region contains five or more Sp consecutive nucleotide linkages.
[0173] In some embodiments, the 5'-wing region contains 10% or more of the Sp nucleotide linkages.
[0174] In some embodiments, each nucleotide bond in the 5'-wing region is Sp.
[0175] In some embodiments, the 3'-wing region contains three or more Sp chiral nucleotide bonds.
[0176] In some embodiments, the 3'-wing region contains five or more Sp consecutive nucleotide bonds.
[0177] In some embodiments, the 3'-wing region contains 10% or more Sp nucleotide bonds.
[0178] In some embodiments, each nucleotide bond in the 3'-wing region is Sp.
[0179] In some embodiments, the nucleotide bond between the 5'-wing region and the core region is an Sp phosphorothioate bond.
[0180] In some embodiments, the nucleotide bond between the 3'-wing region and the core region is an Sp phosphorothioate bond.
[0181] In some embodiments, the nucleic acid is a splice-switching oligonucleotide (SSO).
[0182] In some embodiments, the nucleic acid is a splice-switching oligonucleotide (SSO) that targets dystrophin.
[0183] In some embodiments, the nucleic acid is a splice-switching oligonucleotide (SSO) that targets exon 51, 45, 53, or 44 of dystrophin.
[0184] In some embodiments, the nucleic acid is a splice-switching oligonucleotide (SSO) that targets exon 51 of dystrophin.
[0185] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide.
[0186] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide that can stimulate a TLR9-mediated or TLR9-related immune response.
[0187] In some embodiments, the immunomodulatory nucleic acid is a CpG oligonucleotide that can antagonize a TLR9-mediated or TLR9-related immune response.
[0188] In some embodiments, the oligonucleotide contains a strand of about 14 to about 49 nucleotides.
[0189] When the oligonucleotide further contains a second strand.
[0190] In some embodiments, the oligonucleotide contains at least one modification to a base, sugar, or internucleoside linkage.
[0191] In some embodiments, the modification is a sugar modification at the 2'-carbon.
[0192] In some embodiments, the modification is a sugar modification at the 2'-carbon selected from: 2'-MOE, 2'-OMe, and 2'-F.
[0193] In some embodiments, the bioactive agent is a nucleic acid.
[0194] In some embodiments, the bioactive agent is an immunomodulatory nucleic acid.
[0195] In some embodiments, the bioactive agent is a CpG oligonucleotide that stimulates or antagonizes an immune response.
[0196] In some embodiments, the bioactive agent is a CpG oligonucleotide that stimulates or antagonizes a TLR9-mediated or TLR9-related immune response.
[0197] In some embodiments, the bioactive agent is a small molecule, and in this case the small molecule is hydrophobic.
[0198] In some embodiments, the bioactive agent is a hydrophobic small molecule selected from the group consisting of sterols and hydrophobic vitamins.
[0199] In some embodiments, the bioactive agent is cholesterol.
[0200] In some embodiments, the bioactive agent is a protein selected from the group consisting of nuclear proteins, mucoproteins, lipoproteins, synthetic polypeptides, small molecules linked to proteins, and glycoproteins.
[0201] In some embodiments, the bioactive agent is a nucleic acid in the form of a single-stranded or partially double-stranded oligomer, or a polymer composed of ribonucleotides.
[0202] In some embodiments, the bioactive agent is a nucleic acid selected from the group consisting of miRNA, antisense oligonucleotides, siRNA, immunostimulatory oligonucleotides, aptamers, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), ribozymes, and plasmids encoding specific genes or siRNA.
[0203] In some embodiments, the cell or tissue is a muscle cell or muscle tissue.
[0204] In some embodiments, the bioactive agent is a nucleic acid.
[0205] In some embodiments, the bioactive agent is an oligonucleotide.
[0206] In some embodiments, the bioactive agent is an oligonucleotide that regulates exon skipping.
[0207] In some embodiments, the bioactive agent is a stereoregular oligonucleotide that regulates exon skipping.
[0208] In some embodiments, the disease or disorder is a muscle-related disease or disorder.
[0209] In some embodiments, the muscle-related disorder is sarcopenia, muscle movement disorder, muscle atrophy-related disorder, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorder, malnutrition and skeletal muscle degeneration caused by disease, muscle-related diseases associated with insulin-dependent signaling disorders, amyotrophic lateral sclerosis, spinal muscular atrophy and spinal cord injury, ischemic muscle disease.
[0210] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereoregular oligonucleotide that is a splice-switching oligonucleotide, and the subject has a muscle disorder.
[0211] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereoregular oligonucleotide that is a splice-switching oligonucleotide, and the subject has muscular dystrophy.
[0212] In some embodiments, the cell or tissue is a muscle cell or muscle tissue, in which case the bioactive agent is a stereoregular oligonucleotide that is a splice-switching oligonucleotide, and the subject has Duchenne muscular dystrophy.
[0213] In some embodiments, the lipid is optionally substituted C 10 -C 80containing a saturated aliphatic group or a partially unsaturated aliphatic group, wherein in this case one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein in this case each variable is independently as defined and described herein.
[0214] In some embodiments, the lipid is an optionally substituted C 10 -C 80 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0215] In some embodiments, the lipid is an optionally substituted C 10 -C 80 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0216] In some embodiments, the lipid is an optionally substituted C 10 -C 60 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0217] In some embodiments, the lipid is an optionally substituted C 10 -C 60 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0218] In some embodiments, the lipid is an optionally substituted C 10 -C 40 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0219] In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 .
[0220] In some embodiments, the lipid contains an optionally substituted saturated aliphatic group or a partially unsaturated aliphatic group of C 10 -C 60 , wherein one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein each variable is independently as defined and described herein.
[0221] In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 80 .
[0222] In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 60 .
[0223] In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 40 .
[0224] In some embodiments, the lipid contains a linear saturated aliphatic chain or a partially unsaturated aliphatic chain of optionally substituted C 10 -C 40containing a saturated aliphatic group or a partially unsaturated aliphatic group, wherein in this case one or more methylene units are optionally and independently replaced by an optionally substituted group selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, wherein in this case each variable is independently as defined and described herein.
[0225] In some embodiments, the lipid is an optionally substituted C 10 -C 40 containing a saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0226] In some embodiments, the lipid is an optionally substituted C 10 -C 40 containing a linear saturated aliphatic chain or a partially unsaturated aliphatic chain.
[0227] In some embodiments, the composition further comprises one or more additional components selected from the following: polynucleotide, carbonic anhydrase inhibitor, dye, intercalator, acridine, crosslinker, psoralen, mitomycin C, porphyrin, TPPC4, texaphyrin, sapphyrin, polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, artificial endonuclease, chelating agent, EDTA, alkylating agent, phosphate, amino, mercapto, PEG, PEG-40K, MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled marker, enzyme, hapten biotin, transport / absorption promoter, aspirin, vitamin E, folic acid, synthetic ribonuclease, protein, glycoprotein, peptide, molecule having specific affinity for a co-ligand, antibody, hormone, hormone receptor, non-peptide species, lipid, lectin, sugar, vitamin, cofactor, or drug.
[0228] In some embodiments, the lipid contains a straight-chain saturated aliphatic chain or a partially unsaturated aliphatic chain of C 10 -C 80
[0229] In some embodiments, the composition further comprises a linker that links the bioactive agent and the lipid, where the linker is selected from an uncharged linker, a charged linker, a linker containing alkyl, a linker containing phosphate, a branched linker, an unbranched linker, a linker containing at least one cleavable group, a linker containing at least one redox cleavable group, a linker containing at least one phosphate-based cleavable group, a linker containing at least one acid cleavable group, a linker containing at least one ester-based cleavable group, a linker containing at least one peptide-based cleavable group.
[0230] In some embodiments, the bioactive agent consists of, or is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition.
[0231] In some embodiments, the bioactive agent consists of, consists of, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of any oligonucleotide described herein.
[0232] In some embodiments, the bioactive agent consists of, consists of, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of any oligonucleotide listed in Table 4A.
[0233] In some embodiments, the bioactive agent consists of, consists of, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of the sequence of a splice-switching oligonucleotide.
[0234] In some embodiments, the bioactive agent consists of, consists of, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of a sequence that can skip or mediate the skipping of an exon of the dystrophin gene.
[0235] In some embodiments, the bioactive agent consists of, consists of, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains or consists of a sequence that can skip or mediate the skipping of exon 51 of the dystrophin gene, or consists of.
[0236] In some embodiments, the bioactive agent consists of, or is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains, or consists of, a sequence capable of skipping exon 51, 45, 53, or 44 of the dystrophin gene, or intervening in the skipping.
[0237] In some embodiments, the bioactive agent consists of, or is, or contains an oligonucleotide, or an oligonucleotide composition, or a chiral control oligonucleotide composition, wherein the sequence of the oligonucleotide contains, or consists of, any of the following sequences: WV-887, WV-896, WV-1709, WV-1710, WV-1714, WV-2095, WV-2100, WV-2106, WV-2107, WV-2108, WV-2109, WV-2223, WV-2224, WV-2225, WV-2226, WV-2227, WV-2228, WV-2229, WV-2230, WV-2438, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2529, WV-2530, WV-2531, WV-2533, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, or WV-3546.
[0238] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 30 bases. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 40 bases. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 50 bases. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 30 bases. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 40 bases. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 50 bases. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 30 bases. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 40 bases. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of at most 50 bases.
[0239] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center.In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center.
[0240] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate with an Sp configuration.In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 30 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate of the Sp configuration. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 40 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate of the Sp configuration. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 50 bases, and the common pattern of backbone chiral centers contains at least one chiral control center that is a phosphorothioate of the Sp configuration.
[0241] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least three chiral control centers.In some embodiments, the common base sequence contains a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least 3 chiral control centers. In some embodiments, the common base sequence contains a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least 3 chiral control centers.
[0242] Some embodiments In one form, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration.In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 30 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 40 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration. In some embodiments, the common base sequence contains a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of at most 50 bases, and the common pattern of backbone chiral centers contains at least 5 chiral control centers that are each phosphorothioates in the Sp configuration.
[0243] In some embodiments, the common pattern of the backbone chiral centers is selected from: SSS, SSSS, SSSSS, SOS, SSOSS, SSSOSSS, SSSSOSSSS, SSSSSOSSSSS, SSSSSSOSSSSSS, SSSSSSSOSSSSSSS, SSSSSSSSOSSSSSSSS, SSSSSSSSSOSSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSOSSS, SSSSOSOSOSOSSSS, SSSSSOSOSOSOSSSSS, SSSSSSOSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSOSSOOSSS, SSSSOSOSSOOSSSS, SSSSSOSOSSOOSSSSS, SSSSSSOSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSSOSOOSOOSSSSS, SSSSSSOSOOSOOSSSSSS, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOOSSS, OSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOS, OOSSSSSSOSOSSOOSS, OOSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSSS, and OOSSSSSSOSOSSOOSSSSSS, where O is an achiral center and S is a chiral center with an Sp configuration. In some embodiments, the achiral center is a phosphodiester. In some embodiments, the chiral center with an Sp configuration is a phosphorothioate.
[0244] In some embodiments, the oligonucleotide sequence comprises any one or more of the following: nucleotide sequence (including length); pattern of chemical modifications to the sugar and base moieties; pattern of backbone linkages; pattern of native phosphate linkages, phosphorothioate linkages, phosphorothioate triesters, and combinations thereof; pattern of backbone chiral centers; pattern of the stereochemistry (Rp / Sp) of chiral internucleotide linkages; pattern of backbone phosphorus modifications; pattern of modifications on the phosphorus atom between nucleotides, e.g., -S of formula I - and -L-R 1 .
[0245] In some embodiments, the muscle cell or muscle tissue is selected from: skeletal muscle, smooth muscle, cardiac muscle, diaphragm, gastrocnemius, quadriceps femoris, triceps, and / or heart.
[0246] In some embodiments, the method delivers a bioactive agent into the cytoplasm of a cell.
[0247] In some embodiments, the method delivers a bioactive agent into the nucleus of a cell.
[0248] In some embodiments, the chiral internucleoside linkage is a phosphorothioate.
[0249] In some embodiments, the common nucleotide sequence hybridizes to the transcript of dystrophin, myostatin, huntingtin, myostatin receptor, ActRIIB, ActRIIA, DMPK, Malat1, SMN2, dystrophia myotonica protein kinase (DMPK), proprotein convertase subtilisin / kexin type 9 (PCSK9), SMAD7 or keratin 14 (KRT14). BRIEF DESCRIPTION OF THE DRAWINGS
[0250]
Figure 1
[0251]
Figure 2
[0252]
Figure 3
[0253]
Figure 4
[0254]
Figure 5
[0255]
Figure 6
[0256]
Figure 7
[0257]
Figure 8
[0258]
Figure 9A
Figure 9B
Figure 9C
Figure 9D
Figure 9E
[0259]
Figure 10A
Figure 10B
[0260]
Figure 11A
Figure 11B
[0261]
Figure 12A
Figure 12B
[0262]
Figure 13A
Figure 13B
[0263]
Figure 14A
Figure 14B
[0264]
Figure 15
[0265]
Figure 16A
Figure 16B
[0266]
Figure 17
[0267]
Figure 18
[0268]
Figure 19
[0269]
Figure 20
[0270]
Figure 21
[0271]
Figure 22
[0272]
Figure 23
[0273]
Figure 24
[0274]
Figure 25
[0275]
Figure 26
[0276]
Figure 27
[0277]
Figure 28
[0278]
Figure 29
[0279]
Figure 30
[0280]
Figure 31A
Figure 31B
Figure 31C
Figure 31D
Mode for Carrying Out the Invention
[0281] 1. Definitions Unless otherwise indicated, the following definitions apply as used herein. For the purposes of the present disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Edition. Further, general principles of organic chemistry are described in “Organic Chemistry”, Thomas Sorrell, University Science Books, Sausalito: 1999, and “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, M.B and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference.
[0282] Aliphatic: As used herein, “aliphatic” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or contains one or more unsaturated units, or a substituted or unsubstituted monocyclic, bicyclic or polycyclic hydrocarbon ring that is completely saturated or contains one or more unsaturated units (not aromatic), or combinations thereof. Unless otherwise specified, an aliphatic group contains from 1 to 100 aliphatic carbon atoms. In some embodiments, the aliphatic group contains from 1 to 20 aliphatic carbon atoms. In another embodiment, the aliphatic group contains from 1 to 10 aliphatic carbon atoms. In another embodiment, the aliphatic group contains from 1 to 9 aliphatic carbon atoms. In another embodiment, the aliphatic group contains from 1 to 8 aliphatic carbon atoms. In another embodiment, the aliphatic group contains from 1 to 7 aliphatic carbon atoms. In another embodiment, the aliphatic group contains from 1 to 6 aliphatic carbon atoms. In yet another embodiment, the aliphatic group contains from 1 to 5 aliphatic carbon atoms, and in still other embodiments, the aliphatic group contains 1, 2, 3 or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, straight-chain or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof.
[0283] Alkenyl: As used herein, the term "alkenyl" refers to an alkyl group having one or more double bonds as defined herein.
[0284] Alkyl: As used herein, the term "alkyl" has its ordinary meaning in the art and can include saturated aliphatic groups including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, alkyl has from 1 to 100 carbon atoms. In certain embodiments, a straight-chain or branched-chain alkyl has about 1 to 20 (e.g., C1-C 20 in the case of straight-chain, C2-C 20 ) or about 1 to 10 carbon atoms in its main chain. In some embodiments, the cycloalkyl ring has about 3 to 10 carbon atoms in its ring structure, where the ring is monocyclic, bicyclic or polycyclic, or has about 5, 6 or 7 carbons in the ring structure. In some embodiments, the alkyl group may be a lower alkyl group, and a lower alkyl group includes 1 to 4 carbon atoms (e.g., C1-C4 in the case of straight-chain lower alkyl).
[0285] Alkynyl: As used herein, the term "alkynyl" refers to an alkyl group having one or more triple bonds as defined herein.
[0286] Animal: As used herein, the term "animal" refers to anything in the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically modified animal, and / or a clone.
[0287] Antibody: As used herein, the terms "antibody," "immunoglobulin," and related terms primarily refer to proteins (or fragments thereof, or biologically active fragments thereof) produced by plasma cells, which are used by the immune system to recognize, identify, and / or neutralize specific antigens, epitopes, structures, pathogens, nucleic acids, and other molecules. In some embodiments, an antibody recognizes the unique molecules of a harmful entity, the so-called antigen, via the variable region. In some embodiments, antibodies include, but are not limited to, monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions having multi-epitope specificity, multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain molecules), and antibody fragments. In some embodiments, an antibody is a monoclonal antibody, such as an antibody obtained from a substantially homogeneous group of antibodies. In some embodiments, an antibody is a chimeric antibody, where a portion of the heavy chain and / or light chain is identical or homologous to the corresponding sequence in an antibody derived from a particular species, or in an antibody belonging to a particular antibody class or subclass, while the remaining portion of the chain is from an antibody derived from a different species, or from an antibody belonging to a different antibody class or subclass, and is identical or homologous to the corresponding sequence in such antibody fragments as long as such antibody fragments exhibit the desired biological activity. Chimeric antibodies herein include, but are not limited to, "primatized" antibodies containing variable domain antigen-binding sequences derived from non-human primates (e.g., Old World monkeys such as macaques), and human constant region sequences. In some embodiments, an antibody fragment contains a portion of the intact antibody, preferably the antigen-binding region and / or variable region of the intact antibody. Non-limiting examples of antibody fragments include Fab, Fab’, F(ab’)2, and Fc fragments; diabodies; linear antibodies; nanobodies; single-chain antibody molecules formed from antibody fragments, and multispecific antibodies.In some embodiments, the antibody may be any of the five classes, IgA, IgD, IgE, IgG, and IgM, each of which may be encoded by mRNA containing heavy chains designated alpha, delta, epsilon, gamma, and mu, respectively. In some embodiments, any antibody. Subclasses may be encoded in whole or in part and may include the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. In various embodiments, antibodies can be used to treat conditions or diseases in many therapeutic areas, including but not limited to, for example, blood, cardiovascular, CNS, poisoning (including antitoxins), skin, endocrine, gastrointestinal, medical imaging, skeletal muscle, cancer, immune, respiratory, sensory organs, and anti-infection fields. In some embodiments, the antibody is any of the antibody variants, including but not limited to substitution variants, conservative amino acid substitutions, insertion variants, deletion variants, and / or covalent variants. In one embodiment, the main constructs and / or mmRNAs disclosed herein may encode an immunoglobulin Fc region. In another embodiment, the main constructs and / or mmRNAs may encode a variant immunoglobulin Fc region. In some embodiments, the main constructs and / or mmRNAs may encode an antibody having a variant immunoglobulin Fc region as described in U.S. Patent No. 8,217,147.
[0288] Antisense oligonucleotide: As used herein, the term "antisense oligonucleotide" or "ASO" refers to an oligonucleotide or the like that has, contains, or consists of a base sequence or the like that enables the oligonucleotide or the like to hybridize to a target molecule, such as another nucleic acid, a modified nucleic acid, or a nucleic acid analog, for example, by Watson-Crick base pairing or non-Watson-Crick base pairing. In some embodiments, the antisense oligonucleotide is completely or nearly completely complementary to the target molecule. In some embodiments, any type of oligonucleotide described herein or known in the art can be used as an antisense oligonucleotide. In various embodiments, the antisense oligonucleotide can be implemented or participate in various arbitrary biological functions, such as RNA interference, RNaseH-mediated cleavage, exon skipping, inhibition of exon skipping, enhancing or inhibiting the binding of a subject (such as a protein, RNA, protein-RNA complex, or any other molecule) to another nucleic acid, or any other biological function described herein or known in the art that is performed by the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is an oligonucleotide that participates in RNaseH-mediated cleavage. For example, the antisense oligonucleotide hybridizes to a portion of the target mRNA in a sequence-specific manner, whereby the mRNA is targeted for its own RNaseH cleavage. In some embodiments, the antisense oligonucleotide can distinguish between the wild-type and mutant alleles of the target. In some embodiments, the antisense oligonucleotide specifically participates in the RNaseH-mediated cleavage of the mutant allele but hardly participates in the RNaseH-mediated cleavage of the wild-type allele (for example, does not specifically participate in the RNaseH-mediated cleavage of the wild-type allele of the target).
[0289] Approximately: As used herein, the term "approximately" or "about" when associated with a number generally includes numbers within the range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of that number (except where such number is a value that can be less than 0% or greater than 100%) unless otherwise specified or otherwise apparent from the context. In some embodiments, use of the term "about" when associated with a dosage means ±5 / mg / kg / day.
[0290] Aptamer: As used herein, the term "aptamer" refers to a nucleic acid molecule, such as a molecule containing RNA, DNA, or nucleotide analogs that can bind to a specific molecule with high affinity and specificity (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). In various embodiments, ligands that bind to aptamers include, but are not limited to, small molecules such as drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, nucleic acids, and toxins. In some embodiments, aptamers may bind to proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors, and natural and synthetic polymers such as cell surface substances such as cell walls and cell membranes. In some embodiments, the aptamer is about 10 to about 300 nucleotides in length. In some embodiments, the aptamer is about 30 to about 100 nucleotides in length. In some embodiments, aptamers are made that bind a wide variety of molecules. Each of these molecules can be used as a regulator of gene expression. In some embodiments, organic molecules, nucleotides, amino acids, polypeptides, target functions on the cell surface, ions, metals, salts, and saccharides have all been shown to be suitable for the isolation of aptamers that can specifically bind to each ligand. For example, organic dyes such as Hoechst 33258 have been reported to be used as target ligands in in vitro aptamer selection (Werstuck and Green, Science 282:296-298 (1998)). Other organic small molecules such as dopamine, theophylline, sulforhodamine B, and cellobiose have also been reported as ligands in aptamer isolation. In some embodiments, aptamers against antibiotics such as kanamycin A, lividomycin, tobramycin, neomycin B, viomycin, chloramphenicol, and streptomycin are isolated. For an overview of aptamers that recognize small molecules, see Famulok, Science 9:324-9 (1999).In some embodiments, the ligand of the aptamer of the nucleic acid controlled by the aptamer of the present invention is a cell-permeable small organic molecule. For translation, a small organic molecule having no general inhibitory effect may be used as the ligand. The small molecule can also exhibit sufficient in vivo persistence to achieve the desired level of translation inhibition. The molecule can be screened to identify those that are bioavailable, for example, after oral administration. In some embodiments, the ligand is non-toxic. The ligand can optionally be a drug such as a steroid. In some embodiments, in part of the method for controlling gene expression, the ligand may be pharmacologically inactive. In some embodiments, the ligand is a polypeptide whose presence in the cell is an indicator of a disease or pathological condition. In other embodiments, the ligand for the aptamer is an antibiotic such as chloramphenicol. In another embodiment, the ligand of the aptamer is an organic dye such as Hoechst 33258 dye. In yet another embodiment, the ligand may be a metal ion. In certain embodiments, the aptamer domain of the nucleic acid controlled by the aptamer reacts to binding to caffeine. In some embodiments, aptamers are developed to bind to specific ligands by using known in vivo or in vitro (most typically in vitro) selection techniques known as SELEX (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)).Methods for making aptamers are also described, for example, in U.S. Patent No. 5,582,981, PCT International Patent Application Publication WO00 / 20040, U.S. Patent No. 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Nat’l. Acad. Sci. USA 96:3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34:656-665 (1995), PCT International Patent Application Publications WO99 / 54506, WO99 / 27133, WO97 / 42317, and U.S. Patent No. 5,756,291. In some embodiments, aptamers include those targeting any of the following: VEGF, tissue factor pathway inhibitor (TFPI), factor IXa, complement component 5 (C5), HIV Tat protein, and HIV Rev protein.
[0291] Aryl: As used herein, the term "aryl," alone or as part of a larger moiety within "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, with at least 1 ring within the system being aromatic. In some embodiments, the aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, with at least 1 ring within the system being aromatic, and each ring in the system containing 3 to 7 ring members. In some embodiments, the aryl group is a biaryl group. The term "aryl" may be used interchangeably with the term "aryl ring." In some embodiments of the present disclosure, "aryl" includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, etc., and may have one or more substituents, referring to an aromatic ring system. Also included within the scope of the term "aryl" as used herein are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, etc. In some embodiments, the aryl group has a radical or a point of attachment on the aromatic ring.
[0292] Bioactive agent: As used herein, the term "bioactive agent" refers to any entity (including, but not limited to, active ingredients) that has, mediates, or participates in biological activity. In various embodiments, the bioactive agent may be organic or inorganic. Non-limiting examples of bioactive agents include small molecules, peptides, proteins, components of the CRISPR-Cas system, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, bioactive agents include small molecules, peptides (e.g., cell-penetrating peptides), carbohydrates (including monosaccharides, oligosaccharides, and polysaccharides), proteins (including nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides, or small molecules linked to proteins, glycoproteins), steroids, nucleic acids, lipids, hormones, or combinations thereof, which are inorganic or organic molecules that exert a biological effect when administered in vivo to animals, including, but not limited to, mammals such as birds and humans. In some embodiments, the bioactive agent is charged. In some embodiments, the bioactive agent has a positive charge. In some embodiments, the bioactive agent has a negative charge. In some embodiments, the bioactive agent is selected from: 16-alpha fluoroestradiol, 16-alpha gittoxin, 16-epiestriol, 17-alpha dihydroekirenin, 17-alpha estradiol, 17-beta estradiol, 17-hydroxyprogesterone, 1-alpha-hydroxyvitamin D2, 1-dodecpyrrolidinone, 20-epi-1,25-dihydroxyvitamin D3, 22-oxacalcitriol, 2CW , 2'-nor-cGMP, 3-isobutyl GABA, 5-ethynyluracil, 6-FUDCA, 7-methoxytacrine, abamectin, abanoquil, abecarnil, abiraterone, ablcast, ablcast sodium, acadisin, acamprosate, acarbose, acebutolol, Acecamide Hydrochloride, aceclidine, aceclofenac, acedapsone, aceglutamide aluminum, aceman nan, acetaminophen, acetazolamide, acetohexamide, acetohydroxamic acid, acetomepregenol, acetophenazine maleate, acetosulfone sodium, acetylcholine chloride, acetylcysteine, acetyl-L-carnitine, acetylmethadol, acifran, acipimox, acitemate, acitretin, acivicin, aclarubicin, acratonium, acodazole hydrochloride, aconiazide, acrisorcin, acrivastine, acronine, actisomide, actodigin, acyclovir, acylfulvene, adaphenoxate, adapalene, adapalene, adantanserin, adantanserin hydrochloride, adesipenol, adesipenol, adefovir, adelmidrol, ademetionine, adenosine, adinazolam, adipheinine hydrochloride, adiposin, adozelesin, adrafinil, adrenalone, airbutamine, alacepril, alamecin, alanine, alaproclate, alapide, albendazole, albolabrin, albuterol, albutoin, alclofenae, alclometasone dipropionate, alcloxa, aldecalmycin, aldesleukin, aldrithiol, alendronate sodium, alendronate, alentemol, alentemol hydrobromide, aletamine hydrochloride, aleuronium chloride, alexidine, alfacalcidol, alfentanil hydrochloride, alfuzosin, algestone acetonide, argulase, alifurane, arinastine, aripamide, allantoin,Allobarbital, Allopurinol, ALL-TK antagonist, Allonimid, Allosetron, Hydrochloride Allosetron, Allobudine, Alpeltine, Alpha-Amylase, Alpha idosone, Alpideum, Alprazolam, Hydrochloride Alprenolol, Hydrochloride Alprenoxime, Alprostadil, Arlestatin Sodium, Altanserine Tartrate, Alteplase, Altiazide, Altretamine, Altromycin B, Alverinc Citrate, Alvircept Sudotox, Amazinone Acetate, Amantadine Hydrochloride, Ambamustine, Ambomycin, Ambucycline, Ambufylline, Ambuside, Amcinafal, Amcinonide, Amdinocillin, Amdinocillin pivoxyl, Amedalin Hydrochloride, Amelometasone, Ameltride, Amesergide, Ametantrone Acetate, Amidinium Methyl Sulfate, Amphibromethamon, Anfenac Sodium, Amflutizole, Amiciclin, Amidefrin Mesylate, Amidox, Amifloxacin, Amifostine, Amikacin, Amiloride Hydrochloride, Aminacrine Hydrochloride, Potassium Aminobenzoate, Sodium Aminobenzoate, Aminocaproic Acid, Aminoglutethimide, Sodium Aminohippurate, Aminolevulinic Acid, Aminophylline, Aminorex, Sodium Aminosalicylate, Aminosalicylic Acid, Amiodarone, Amiprilose Hydrochloride, Amikicin Hydrochloride, Amisulpride, Amitraz, Amitriptyline Hydrochloride, Unreloxanox, Amlodipine, Amobarbital Sodium, Amodiaquine, Hydrochloride Amodiaquine, Amorolfine, Amoxapine, Amoxicillin, Amphecloral, Amphetamine Sulfate, Amphomycin, Amphotericin B, Ampicillin, Ampiroxicam, Ampidine Sulfate, Amquinate, Amrinone, Aminone, Amrubicin, Amsacrine, Amylin, Amithiamycin, Anagestone Acetate, Anagrelide, Anakinra, Ananine, Analitide, Analitide Acetate, Anastrozole, Anazolene Sodium, Ancrod, Andrographolide, Androstenedione, Angiogenesis inhibitor, Angiotensin amide, Anidoxime, Anileridine, Anilopam Hydrochloride, Anilacetam, Anilorac,Methylanisotropine Bromide, Anistreplase, Anitrazafen, Arnoldoline, Antagonist D, Antagonist G, Antarellex, Antazoline Phosphate, Antelmicin, Anthralin, Anthramycin, Antiandrogen Agent, Acecladapsone, Felbamate, Antiestrogen Agent, Antineoplaston, Antipyrine, Antisense Oligonucleotide, Apadrine, Apafant, Aparcilin Sodium, Apaxifylline, Apazone, Aphidicolin Glycinate, Apixifylline, Apomorphine Hydrochloride, Apraclonidine, Apraclonidine Hydrochloride, Apramycin, Aprindine, Aprindine Hydrochloride, Aprosartan Sodium, Aprotinin, Aptazapine Maleate, Aptiganel, Aprinic Acid, Aranidipine, Alanosine, Albaprostil, Arbekicin, Arbidol, Albutamine Hydrochloride, Alclofenine, Aldeparin Sodium, Argatroban, Arginine, Arginipressin Tannate, Allyldone, Aripiprazole, Allopurinol, Arpinocid, Arteflene, Altiride Fumarate, Asimadoline, Aspartone, Asparaginase, Aspartic Acid, Aspartocin, Asperfuran, Aspirin, Aspoxicillin, Asprelin, Astemizole, Astromicin Sulfate, Aslacrin, Atamestane, Atenolol, Atevirdine, Atipamezole, Atiprosin Maleate, Atorid, Atorvastatin Calcium, Atosiban, Atracurium Besylate, Attrimustine, Atriinositol, Atropine, Auranofin, Aureobasidin A, Aurothioglucose, Avilamycin, Avoparcin, Abrizine, Axid, Axinasatine 1, Axinasatine 2, Axinasatine 3, Azabon, Azacitidine, Azachloridine Hydrochloride, Azaconazole, Azadirachtine, Azalastat Dihydrochloride, Azaloxan Fumarate, Azanatol Maleate, Azanidazole, Azaperone, Azaribine, Azaserine, Azasetron,Azathidine maleate, Azathioprine, Azathioprine sodium, Azatoxin, Azatyrosine, Azelaic acid, Azelastine, Azelnidipine, Azepindole, Azetepa, Adimirdol, Adisromycin, Azurosirine, Azolimine, Azosemide, Azotomycin, Azotreonam, Azomolen sodium, Bacampicillin hydrochloride, Baccatin III, Bacitracin, Baclofen, Bacoside A, Bacoside B, Bactobolin, Baranol, Barasipone, Balhimycin, Balofloxacin, balsalazide, Bambemycin, Bambuterol, Bamethan sulfate, Bamifylline hydrochloride, Bamidazole, Baofuoside 1, Barmastine, Barnidipine, Basifungin, Batopride hydrochloride, Bateblasto, Baterapin maleate, Batimastat, Bobelisine, Becantone hydrochloride, Becapreermin, Biclonazole, Beclometasone dipropionate, Befloxatone, Beinserazide, Berofosdil, Belladonna, Beroxamide, Bemesetron, Bemithradine, Bemoladan, Benapryzine hydrochloride, Benazepril hydrochloride, Benazeprilat, Bendacalol mesylate, Bendazac, Bendroflumethiazide, Benflumetol, Benidipine, Benorterone, Benoxaprofen, Benoxaprofen, Benoxynate hydrochloride, Benperidol, Bentazepam, Bentylomid, Benurestat, Benzbromarone, Benzethonium chloride, Benzethimide hydrochloride, Benzilonium bromide, Benzindopyrine hydrochloride, Benzisoxazole, Benzocaine, Benzchlorin, Benzoctamine hydrochloride, Benzodepa, Benzoidazoxan, Benzonatate, Benzoyl peroxide, Benzoyl pascalcium, Benzoyl staurosporine, Benzquinamide, Benzthiazide, Benztropine, Benztropine mesylate, Benzydamine hydrochloride, Benzylpenicilloyl polylysine, Beptilid, Beptilid hydrochloride, Beractant, Beraprost, Berefrin, Berlaphenone, Bertosamil, Berisromycin, Besipiridine, Beta-aretin, Betaclamycin B, Betamethasone, Betamipron,Betaxolol, Betaxolol Hydrochloride, Bethanechol Chloride, Bethanidine Sulfate, Betulinic Acid, Bebantrol, Bebantrol Hydrochloride, Bezafibrate, bFGF Inhibitor, Bialamicol Hydrochloride, Biapenem, Bicalutamide, Bischophazine Hydrochloride, Biclodil Hydrochloride, Bisdoride, Bifemelane, Bifonazole, Bimakalim, Bimithil, Bindarit, Biniramycin, Vinospirone, Bioxalomycin Alpha2, Bipenamol Hydrochloride, Biperiden, Biphenamine Hydrochloride, Biriperone, Bisantrene, Bisaramide, Bisaziridinyl Spermine, Bis-Benzimidazole A, Bis-Benzimidazole B, Bisnafide, Bisobrin Lactate, Bisoprolol, Bispyrithione Magsulfex, Bistramide D, Bistramide K, Bistraten A, Bithionolate Sodium, Vitolterol Mesylate, Vivaldine, Vizelesin, Bleomycin Sulfate, Bolandiol Dipropionate, Bolasterone, Boldenone Undecylenate, Boldine, Bolenol, Bolmantarate, Bopindolol, Bosentan, Boxidine, Brefeldin, Brefolate, Brequinal Sodium, Bretazenil, Bretylium Tosylate, Briventanyl Hydrochloride, Brimonidine, Brinolase, Brocresin, Brocrinat, Brofoxine, Bromadoline Maleate, Bromazepam, Bromchlorenone, Bromelain, Bromfenac, Brominidione, Bromocriptine, Bromodiphenhydramine Hydrochloride, Bromoxamide, Bromperidol, Bromperidol Decanoate, Brompheniramine Maleate, Broperamol, Broprimine, Brotizolam, Bucamide Maleate, Bucindolol, Bucridine Hydrochloride, Bucromarone, Budesonide, Buzepine, Budotitane, Bformine, Bumetamide, Bunaprolast, Bunazosin, Bunolol Hydrochloride, Bupicomide, Bupivacaine Hydrochloride,Buprenorphine hydrochloride, Bupropion hydrochloride, Bramastine, Buserelin acetate, Buspirone hydrochloride, Busulfan, Butabarbital, Butacetin, Butaclamol hydrochloride, Butarbital, Butanbene, Butamirate citrate, Butaperazine, Butaprost, Butedronate tetrasodium (butedronate te, trasodium), butenafine, buteridin, butionine sulfoximine, buticacin, butylphenine, butirosin sulfate, butixirate, butixocort propionate, butoconazole nitrate, butonate, butopamine, buteprozin hydrochloride, butorphanol, butoxamine hydrochloride, butriptyline hydrochloride, cactinomycin, cadexomer iodine, caffeine, calanolide A, calcifediol, calcipotriene, calcipotriol, calcitonin, calcitriol, calcium undecylenate, calphostin C, calusterone, cambendazole, camonagrel, camptothecin derivatives, canarypox IL-2, candesartan, candicidin, candoxatril, candoxatrilat, caniglibose, potassium canrenoate, canrenone, capecitabine, sodium capobenate, capobenic acid, capreomycin sulfate, capromab, capsaicin, captopril, caprylyl, caracemide, carbachol, carbodox, carbamazepine, carbamide peroxide, carbantel lauryl sulfate, carbaspirin calcium, carbazeran, carbazomycin C, carbenicillin potassium, carbenoxolone sodium, carbetimer, carbethocin, carbidopa, carbidopa-levodopa, carbinoxamine maleate, carbinoxamine hydrochloride, carbochloral, carbocysteine, carbol-fuchsin, carboplatin, carboprost, carbovir, carboxamide-amino-triazole, carboxamide triazole, carboxymethylated beta-1,3-glucan, carbuterol hydrochloride, CaRest M3, carfentanil citrate, carisoprodol, carmantadine, carmustine, CARN 700, camidazole, caroxazone, carperitide, carfenazine maleate, caprofen, calfactonin succinate, cartazolate, carteolol, carteolol hydrochloride, cartilage-derived inhibitor, carvicine hydrochloride, carmonam sodium, carvedilol, carbotrolin, carbotrolin hydrochloride, carzelesin, casein kinase inhibitor (ICOS), castanospermine, caurumonam, sevaletam,Cecropin B, Sedefingol, Cefaclor, Cefadroxil, Cefamandole, Cefaparole, Cefatrizine, Cefazafuril Sodium, Cefazolin, Cefbuperazone, Cefcapene Pivoxil, Cefdaloxime Pentexil Tosilate, Cefdinir, Cefditoren Pivoxil, Cefepime, Cefetamet, Cefetecol, Cefixime, Cefluprenam, Cefinenoxime Hydrochloride, Cefinetazole, Cefminlox, Cefodizime, Cefonicid Sodium, Cefoperazone Sodium, Ceforamide, Cefoseris, Cefotaxime Sodium, Cefotetan, Cefothiam, Cefoxitin, Cefozopran, Cefpimizole, Cefpiramide, Cefpiron, Cefpodoxime Proxetil, Cefprozil, Cefroxadine, Cefurosine, Cefotazidime, Cefteram, Cefibuten, Ceftezoxime Sodium, Cefotriaxone, Cefroxime, Cerastrol, Sericarium, Seriprool, Cepacidiine A, Cefacetrile Sodium, Cefalexin, Cefaloglycin, Cefaloridine, Cefalothin Sodium, Cefapyrin Sodium, Cefradine, Sericlamine, Serbastatin, Seronapril, Certoparin Sodium, Certred, Cetaben Sodium, Cetalkonium Chloride, Cetamolol Hydrochloride, Cethiedyl, Cethridine, Cethophenylol, Cetraxate Hydrochloride, Cetrorelix, Cetylpyridinium Chloride, Kenodiole, Clorfenidianoil Hydrochloride, Chloral Betaine, Chlorambucil, Chloramphenicol, Chlorazodin, Chlordiazepoxide, Chlorhexidine Gluconate, Chlorine, Chloromadinone Acetate, Chloroorienticin A, Chloroprocaine Hydrochloride, Chloropropamide, Chloroquine, Chlorquinoxaline Sulfonamide, Chlorothiazide, Chlorotrianisene, Chloroxine, Chloroxylenol, Chlorphenesin Carbamate, Chlorpheniramine Maleate, Chlorpromazine, ChloropropamideChlorprothixene, Chlorotetracycline Bisulfate, Chlorthalidone, Chlorzoxazone, Cholestyramine Resin, Chromonar Hydrochloride, Sibenzoline, Cicaprost, Cyclafrine Hydrochloride, Ciclazindol, Ciclesonide, Cicletanine, Ciclopirox, Cicloprofen, Cicloprolol, Sidofovir, Cidoxepin Hydrochloride, Sifennaline, Siglitazone, Siradopa Hydrochloride, Silansetron, Sirazastatin Sodium, Sirazapril, Silnidipine, Cilobamine Mesylate, Silobradine, Silofungin, Sirostazol, Simaterol, Cimetidine, Methoctramine Bromide, Sinalcust, Cinanserin Hydrochloride, Cinepazet Maleate, Simflumide, Singestol, Sinitapride, Sinamedrine, Sinnalidine, Sinorazepam, Sinoxacin, Simpelen, Sinromide, Sintazon, Sintriamide, Sioteronel, Sipamfilin, Cyprefadol Succinate, Cyprosinonide, Ciprofibrate, Ciprofloxacin, Cyprostene, Ciramadol, Cirolemycin, Cisapride, Cisatracurium Besylate, Cisconazole, Cisplatin, Cis-Porphyrin, Cistinexine, Citalopram, Citename, Citicoline, Citreamicin Alpha, Cladribine, Clamoxyquine Hydrochloride, Clarithromycin, Clausenamide, Potassium Clavulanate, Clazolam, Clazoline, Clebopride, Clemastine, Clenethazem Maleate, Crimidine Bromide, Clinafloxacin, Clindamycin, Clioquinol, Clioxamide, Criprofen, Clobazam, Clobetasol Propionate, Clobetasone Butyrate, Crocortolone Acetate, Clodanolen, Clodazone Hydrochloride, Clodronic Acid, Clofazimine, Clofibrate, Phosphorus Clophyllium, Clogestone Acetate, Chromacuran Phosphate, Cromegestone Acetate, Clometherone, Clomethiazole, Clomiphene Analog, Crominex, Clomiphene, Clomipramine Hydrochloride, Clonazepam, Clonidine, Clonitrate, Clonixylyl, Clonixin, Clopamide, Clopentixol,Cloperidone Hydrochloride, Clopidogrel, Clopimidol, Clopipazan Mesylate, Clopyrac, Cloprednol, Cloprostenol Sodium, Clazepate Dipotassium, Chlorate, Chloroxolone, Cloperidone Hydrochloride, Chlorprenaline Hydrochloride, Chlorothiazide, Chlorterolamine Hydrochloride, Clotiazepam, Clorsulon, Clotiazepam, Aceclofenac, Crotiapine, Clotixamide Maleate, Clobetasone Propionate, Clotrimazole, Cloxacillin Benzathine, Cloxikin, Clozapine, Cocaine, Cocoxydine, Codeine, Codoxime, Colchicine, Cholestyramine, Cholestyramine Hydrochloride, Colestolone, Colforsin, Colfosceril Palmitate, Colistimethate Sodium, Colistin Sulfate, Colistimethate A, Colistimethate B, Cortolol Mesylate, Combretastatin A4, Combretastatin Analogs, Combretastatin, Conagenin, Conorphone Hydrochloride, Contignasterol, Contortrostatin, Cormetasone Acetate, Corticoliberin Octreotide Trifluoroacetate, Corticotropin, Cortisone Acetate, Cortivazol, Cortodoxone, Cosalan, Costatride, Cosyntropin, Cotinine, Coumadin, Coumermycin, Cranberrysidin 816, Krilivastatin, Crisnatol, Cromitrile Sodium, Cromolyn Sodium, Clotamiton, Cryptophycin 8, Cucumarioside, Cuprimyxin, Krasin A, Cardlan Sulfate, Curiosin, Cyclacillin, Cyclazosin, Cyclazosin, Cyclic HPMPC, Cyclindole, Cycliramine Maleate, Cyclizine, Cyclobenzaprine, Cyclobutane A, Cyclobutane G, Cyclocapron, Cycloguanil Pamoate, Cycloheximide, Cyclopentanthraquinone, Cyclopenthiazide, Cyclopentolate Hydrochloride, Cyclophenazine Hydrochloride, Cyclophosphamide, Cycloplatam, Cyclopropane, Cycloserine,Cyclocine, Cyclosporine, Cyclothiazide, Cyclothiazide, Cyclothiazomycin, Cicheptamide, Cipemamycin, Cipenamine Hydrochloride, Ciprazepam, Cyproheptadine Hydrochloride, Cyprolidol Hydrochloride, Cyproterone, Ciproximide, Cysteamine, Cysteine Hydrochloride, Cystine, Cytarabine, Cytarabine Hydrochloride, Cytarabine Ocfosfate, Cytochalasin B, Cytolytic Factor, Cytostatic, Dacarbazine, Daclizumab, Dactinomycin, Dactinomycin, Daidzein, Daredalin Tosylate, Dalfopristin, Dalteparin Sodium, Dartroban, Dalbavancin, Danaparoid, Danazol, Dantrolene, Daphlnodorin A, Dapiprazole, Dapitant, Dapoxetine Hydrochloride, Dapsone, Daptomycin, Darglitazone Sodium, Dalfenacin, Darucin A, Darolazine, Darsidomine, Daunorubicin Hydrochloride, Dazadrol Maleate, Dazepinyl Hydrochloride, Dazmegrel, Dazopride Fumarate, Dazoxiben Hydrochloride, Debrisoquine Sulfate, Decitabine, Deferiprone, Deflazacort, Dehydrocholic Acid, Dehydrodidemnin B, Dehydroepiandrosterone, Delapril, Delapril Hydrochloride, Delavirdine Mesylate, Derecamine, Delfaprazine, Dermazinone Acetate, Dermopinol, Delfinidine, Demecarium Bromide, Demecycline, Desmethacycline, Demoxepam, Denofungin, Deoxypyridinoline, Depakote, Deprodone, Deprostil, Depsidomycin, Delamcyclan, Dermatan Sulfate, Descyclovir, Desonolone Acetonide, Desflurane, Desipramine Hydrochloride, Desyldine, Deslanoside, Deslorelin, Desmopressin, Desogestrel, Desonide, Desoxymethasone, Desoxyamiodarone, Desoxycorticosterone Acetate, Detajmium Bitartrate, Deterenol Hydrochloride, Detirelix Acetate, Debazepide, Dexamethasone, Dexamisole, Dexbrompheniramine Maleate, Dexchlorpheniramine Maleate, Dexclamol Hydrochloride, Dexetimide, Dexfenfluramine Hydrochloride,Dexifosfamide, deximafen, dexibacaine, dexketoprofen, dexloxiglumide, dexmedetomidine, dexormaplatin, dexoxadrol hydrochloride, dexapanthenol, dexpe-medrolac, dex hydrochloride, Supropranolol, Dexrazoxane, Dexsotalol, Dextrin Sulfate, Dexamphetamine, Dextromethorphan, Dextrorphan Hydrochloride, Sodium Dextrothyroxine, Dexverapamil, Dezaguanine, Dinamide, Dezocine, Diacetolol Hydrochloride, Diamocaine Cyclamate, Diapamide, Meglumine Diatrizoate, Diatrizoic Acid, Diabelline, Diazepam, Diazicoumarol, Diazoxide, Dibenzepin Hydrochloride, Dibenzothiophene, Dibucaine, Dichlorvos, Dichloralphenazone, Dichlorphenamide, Disilenone, Diclofenac Sodium, Dicloxacillin, Dicranin, Dicumarol, Dicyclomine Hydrochloride, Didanosine, Didemin B, Dodox, Dienestrol, Dienogest, Diethylcarbamazine Citrate, Diethylhomospermine, Diethylnorspermine, Diethylpropion Hydrochloride, Diethylstilbestrol, Diphenoxymide Hydrochloride, Diphenoxin, Diflorasone Diacetate, Difloxacin Hydrochloride, Difulanine Hydrochloride, Diflucortolone, Difludidone Sodium, Diflunisal, Diflucortolone Valerate, Diphtalone, Digitalis, Digitoxin, Digoxin, Dihexylverine Hydrochloride, Dihydroxydine, Dihydro-5-azacytidine, Dihydrocodeine Bitartrate, Dihydroergotamine Mesylate, Dihydrotestosterone, Dihydrostreptomycin Sulfate, Dihydrotachysterol, Dihydrotaxol, 9-, Dilantin, Dilevalol Hydrochloride, Diltiazem Hydrochloride, Dimfadane, Dimefline Hydrochloride, Dimenhydrinate, Dimercaprol, Dimethadione, Dimethindene Maleate, Dimethyltestosterone, Dimethyl Prostaglandin A1, Dimethyl Sulfoxide, Dimethylhomospermine, Dimyracetam, Dimoxamine Hydrochloride, Dinoprost, Dinoprostone, Dioxadrol Hydrochloride, Dioxamycin, Diphenhydramine Citrate, Diphenidol, Diphenoxylate Hydrochloride, Diphenyl Spiromustine, Dipivefrin Hydrochloride, Dipivefrin,dipliencyprone, diprafenone, dipropylnorspermine, dipyridamole, dipyrithione, dipyrone, dirithromycin, discodermolide, disobutamide, disophenin, disopyramide, disoxaril, disulfuram, ditecrem, divalproex sodium, dithiazirpine maleate, dobutamine, docarpamine, dosebenone, docetaxel, doconazole, docosanol, dofetilide, dolasetron, ebastine, ebiratide, ebrotidine, ebselen, eptacog alfa, eptacog beta, eptacog delta, ecdisteron, echicetin, exatin, echothiophate iodide, eclanamine maleate, eclamastine, ecomustine, econazole, ecteinascidin 722, edarabone, edatrexate, edelfosine, edrophonium acetate, edobacomab, edoxudine, edrecolomab, edrophonium chloride, edroxyprogesterone acetate, efegatran, efloxatin, efonidipine, egualcen, elantrine, eleatonin, element, eletriptan, ergodipine, eriprodil, elsamitrucin, eltenae, elcain, emalkalim, emedastine, emetine hydrochloride, emiglitate, emiritide tosylate, emitefur, emoctakin, enadoline hydrochloride, enalapril, enalaprilat, enalalkylene, enazadrem, ensiprate, endralazine mesylate, endrisone, enfurane, englitazone, enilconazole, enisoprost, enlimomab, enloplatin, enoxaprost, enolicam sodium, enoxacin, enoxaparin sodium, enoximon, enpyrin phosphate, enprofylline, enpromate, entacapone, enterostatin, enviracedine, enviraxime, ephedrine,Epicillin, Epimestrol, Epinephrine, Epinephrine borate, Epipropidine, Epirizole, Epirubicin, Epitetracycline hydrochloride, Epithiazide, Epopoietin alpha, Epopoietin beta, Epoprostol, Epoprostol sodium, Epoxymexrenone, Epristeride, Eprosartan, Eptastigmine, Exerelin, Exilirin, Elbrozole, Eldostein, Ergoloid mesylate, Ergobovine maleate, Ergotamine tartrate, Elsentirolide, Ersofermin, Erythritol, Erythrityl tetranitrate, Erythromycin, Esmolol hydrochloride, Esorubicin hydrochloride, Esproquine hydrochloride, Estazolam, Estradiol, Estramustine, Estramustine analog, Estradiol enanthate, Estriol, Estrone sulfate, Estrogen agonist, Estrogen antagonist, Estrogen, Esterified conjugated estrogen, Estrone, Estropipate, Estroprone, Etaphedrine hydrochloride, Ethanidazole, Etanterol, Etautomer, Etazolate hydrochloride, Eterobarb, Ethacizin, Ethacrynic acid sodium, Ethacrynic acid, Ethanbutol hydrochloride, Etamivan, Ethanolamine oleate, Etoclorvinol, Ether, Ethinyl estradiol, Ethyl ester of iodinated keshi oil, Ethionamide, Ethylamine nitrate, Ethopropazine hydrochloride, Ethosuximide, Ethotoin, Ethoxazene hydrochloride, Ethibenzotropine, Ethyl chloride, Ethyl dibunate, Ethyl estrenol, Ethyndiol, Ethinelon, Ethyndiol diacetate, Etibendazole, Ethidocaine, Sodium etidronate, Etidronic acid, Ethiphenin, Ethintidine hydrochloride, Etizolam, Etodolac, Etofenamate, Etformin hydrochloride, Etomidate, Ethnorgestrel, Etoperidone hydrochloride, Etoposide, Etoprine, Etoxadrol hydrochloride, Etazolamine, Etrabamine, Etretinate, Etritramine acetate, Octatropine hydrochloride, Eugenol, Oiprosin hydrochloride, Eveminomicin, Exametazime, Examorelin, Exaprorelol hydrochloride,Exemestane, ezetimibe, estrone, estropipate, espron, etafedrine hydrochloride, etanidazole, etanterol, etalloten, etazolate hydrochloride, eterobarb, ethacizin, sodium etacrynate, etacrylic acid, ethambutol hydrochloride, ethamivan, ethanolamine oleate, etoclbuvinol, ether, ethinyl estradiol, ethyl ester of iodinated keshi oil, ethionamide, ethynam nitrate, etopropazine hydrochloride, ethosuximide, etotoin, ethoxazene hydrochloride, etibenzotropine, ethyl chloride, ethyl dibunate, ethyl estrenol, ethyndiol, ethenolone, ethynodiol diacetate, etibendazole, etidocaine, disodium etidronate, etidronic acid, etiphenin, etintidine hydrochloride, etizolam, etodolac, etofenamate, ethoform hydrochloride, etomidate, etonogestrel, etoperidone hydrochloride, etoposide, etoprine, etoxadrol hydrochloride, etozoline, etrabamine, etretinate, etriptamine acetate, oicatropine hydrochloride, eugenol, oi-procin hydrochloride, eveminomicin, examethidium, examorelin, exaprorelol hydrochloride, exemestane, fadrozole, feriefungin, famciclovir, famotidine, fanpridine, fantofaron, fantridone hydrochloride, faropenem, fasidotril, fasudil, fazarabine, fedotozine, felbamate, felbinac, felodipine, feripresin, phenaramide, phenamol, fenbendazole, fenbufen, fencibutirol, fenclofenac, fenclonine, fenclorac, fendosal, fenestrel, phenethylamine hydrochloride, fenfluramine hydrochloride, fengabine, phenimid, phenisorex, fenmetozole hydrochloride, fenmetramide, phenobarb, phenoctimine sulfate, fenofibrate, phenolodopam, fenoprofen, phenoterol, fenpiparon, fenprinast hydrochloride, fenprostalene, fenquzone, fenretinide, fenspiride, fentanyl citrate,Fenchiazac, Fenchlor, Fenchiconazole, Fenphenylpol Hydrochloride, Feprazinol, Ferphosartonatrium, Ferristene, Ferrixan, Ferrous Sulfate Dried, Ferimoxide, Ferimoxyl, Fetoxylate Hydrochloride, Fexofenadine, Phenozolamine Fumarate, Fiacitabine, Fialuridine, Fibrinogen I 125, Filgrastim, Philippines, Finasteride, Flavodilol Maleate, Flavopiridol, Flavoxate Hydrochloride, Flutaron, Flecamide, Flerobuterol, Fleroxacin, Fresinoxan, Fresterol Sulfate, Fretazepam, Frezastine, Flurbufen, Flutafenin, Flomoxef, Flordipine, Florfenicol, Florifenine, Flosatidyl, Flosekinan, Floxaciniline, Floxuridine, Fluasterone, Fluazacort, Fluvanilate Hydrochloride, Flubendazole, Flucindole, Flucronid, Fluconazole, Flucytosine, Fludarabine, Fludarabine Phosphate, Fludazonium Chloride, Fluorodeoxyglucose F 18, Fludrex, Fluocortolone Acetate, Flufenamic Acid, Flufenisal, Flumazenil, Flumethinol, Flumethin, Flumeridone, Flumethasone, Flumetramide, Flumethazepine, Fluminorex, Flumizole, Flumoxonide, Flunarisine, Flunidazole, Flunisolide, Flunitrazepam, Flunixin, Fluocalcitriol, Fluocinonide Acetonide, Fluocinonide, Fluocortolone Butyl, Fluocortolone, Fluorescein, Fluorodaunorubicin Hydrochloride, Fluorodopa F18, Fluorometholone, Fluorouracil, Fluotracene Hydrochloride, Fluoxetine, Fluoxymesterone, Fluparoxan, Fluperamide, Fluperolone Acetate, Fluphenazine Decanoate, Flupyrazine, Fluprednisolone, Fluproquazone, Fluprostenol Sodium, Fluprazone, Fluradoline Hydrochloride, Flurandrenolide, Flurazepam Hydrochloride, Flurubiprofen, Fluretofen, Flurithromycin, Fluorocitabine, Fluorofamide, Fluogestone Acetate,Flurotyl, fluoro xene, fluspiprone, fluspyrene, fluticasone propionate, flutrimazole, flutroline, fluvastatin, fluvastatin sodium, fluvoxamine, fludioxonil, folic acid, follicle regulatory protein, folliculostatin, fomepizole, me, Honazin silicate, furosartan, forfenimex, forfenirmex, formestane, hormocortal, formoterol, hosalylate, hosazepam, phosphonoformate sodium, fosfomycin, phosphonate sodium, fosinopril, fosinoprilat, fosphenyloin, hoscidon, hostedyl, hostriecin, hostemicin, basic fuchsine, fumoxysillin, fungimycin, fluprofen, furazolidone, furazolidium chloride, freglerate sodium, flobufen, flodazole, furosemide, sodium fusidate, fusidic acid, gabapentin, gadobenic acid dimeglumine, gadobenic acid, gadobutrol, gadodiamide, gadolinium texaphyrin, gadopentetate dimegiumine, gadoteric acid, gadoteridol, gadoxetamide, galantamine, galdansetron, galdansetron hydrochloride, galamine triethiodide, gallium nitrate, gallopamil, galocitabine, gamfexine, gamolenic acid, ganciclovir, ganirelix, gelatinase inhibitor, gemcadiol, gemcitabine, gemeprost, gemfibrozil, gentamicin sulfate, gentian violet, gepirone, gestaclone, gestoden, gestonorone caproate, gestrinone, gebotrolin hydrochloride, gilospam, glaspimod, glaucocalyxin A, gremanserin, gliamiride, glibornuride, glyceritanil sodium, gliflumide, glimepiride, glipizide, gloximonam, glucagon, glutapyron, glutathione inhibitor, glutethimide, glibride, glycopine, glycopril, glycopyrrolate, glyhexamide, sodium glymidine, gliocetamide, gliparamide, colloidal gold Au 198, gonadoctrinins, gonadorelin, gonadotropin, goserelin, gramicidin, granisetron, grepafloxacin, glisofulvin, guaiapate, guaicylline, guanabenz,Guanabenz acetate, guanadrel sulfate, guanidine, guanethidine monosulfate, guanfacine hydrochloride, guanisodine sulfate, guanoclor sulfate, guanocitine hydrochloride, guanoxabenz, guanoxan sulfate, guanoxyfen sulfate, gusperimus trihydrochloride, halazepam, halcinonide, halicondrin B, halobetasol propionate, halofantrine, halofantrine hydrochloride, halofenate, halofuginone hydrobromide, halomon, halopemide, haloperidol, halopredone, haloprogesterone, haloprozine, halothane, halquinol, hamamycin, human menopausal gonadotropins, hatomamicin, hatomarmycin A, hatomarmycin B, hatomarmycin C, hatomarmycin D, heparin sodium, hepsulfam, heregulin, hetacillin, heteronium bromide, hexachlorophene: hydrogen peroxide, hexafluorenium bromide, hexamethylenebisacetamide, hexetidine, hexobenzene, hexoprenaline sulfate, hexylresorcinol, histamine phosphate, histidine, histoplasmin, histrelin, homatropine hydrobromide, hokidil hydrochloride, human chorionic gonadotropin, hicanton, hydralazine hydrochloride, hydralazine polistirex, hydrochlorothiazide, hydrocodone bitartrate, hydrocortisone, hydroflumethiazide, hydromorphone hydrochloride, hydroxyamphetamine hydrobromide, hydroxychloroquine sulfate, hydroxyphenamate, hydroxyprogesterone caproate, hydroxyurea, hydroxyzine hydrochloride, hymecromone, hyoscyamine, hypericin, ibafloxacin, ibandronic acid, ibogaine, ibopamine, ibudilast, ibufenac, ibuprofen, ibutilide fumarate, icatibant acetate, icatolmol, icotidine, idarubicin, idoxifen, idoxuridine, idramantane, iemefloxacin, iesopitron, ifetroban, ifosfamide, ilepeimide, ilimaquinone, ilomhosinIromustat, ironidap, iropelidone, iloprost, imafen hydrochloride, imazodan hydrochloride, imidapril, imidazenil, imidazoacridone, imidesyl iodine, imidocarb hydrochloride, imidoline hydrochloride, imidourea, imiroxane hydrochloride, imipenem, imipramine hydrochloride, imiquimod, immunostimulatory peptide, impropromazine hydrochloride, indacrinone, indapamide, indecamide hydrochloride, indeloxazine hydrochloride, indigo carmine disodium sulfate, indinavir, indocyanine green, indolapril hydrochloride, indridan, indomethacin, indomethacin sodium, indoprofen, indolamine, indrenate hydrochloride, indoxole, indoline hydrochloride, inocoterone, inogatran, inolimomab, inositol nicotinate, insulin, interferon, interleukin, intrazole, intriptyline hydrochloride, iovenbuengan, iobenzamic acid, iobitridol, meglumine iocarmate, iocarmic acid, iosetamic acid, iodamide, iodine, meglumine iopamidol, ioxagol, iodoamiloride, iodoantipyrine I 131, iocholesterol I 131, iododoxorubicin, sodium iodo-hippurate I 131, iopirace I 125, iodoquinol, meglumine iodoxamate, iodoxamic acid, ioglycic acid, iofetamine hydrochloride I 123, ioflatol, ioglucol, ioglucamide, ioglycamic acid, iogulamide, iohexyl, iomeprol, iomethin I 125, iopamidol, iopanoic acid, iopentol, iophengedylate, ioprosemic acid, iopromide, iopronic acid, iopidol, iopidon, iopyrol, iosefamic acid, ioselic acid, meglumine ioslamide, iosmet acid, iotasul, iotetric acid, sodium iotalamate, iotalamic acid, iotriside, iotrolan, iotroxate, iothyrosine I 131, iobelsol, sodium ioxaglate, meglumine ioxaglate, ioxaglic acid, ioxilan, ioxotrizoic acid, ipazilide,Ipenoxazone, ipidacrine, calcium ipodate, ipomeanol, 4-, ipratropium bromide, ipriflavone, iprindole, iprofenin, ipronidazole, iproplatin, iroxamine hydrochloride, ipsapiron, irbesartan, irinotecan, irloxacin, iroplact, iloprost, irtemazole, isalsutin, isamoxole, isbogrel, isepamicin, isobenzazole, isobutamben, isocarboxazid, isoconazole, isoetharine, isoflupredone acetate, isoflurane, isofluorophate, isohomohalicondrin B, isoleucine, isomazole hydrochloride, isomiram hydrochloride, isoniazid, isopropamide iodide, isopropyl alcohol, isopropyl unoprostone, isoproterenol hydrochloride, isosorbide, isosorbide mononitrate, isotiquimide, isotretinoin, isoxepac, isoxicam, isoxsuprine hydrochloride, isradipine, itamerin, itacetron, itazigrel, itopride, itraconazole, ivermectin, jasplakinolide, josamycin, kahalalide F, calafungin, kanamycin sulfate, ketamine hydrochloride, ketanserin, ketazolosin, ketazolam, ketoxal, ketipramine fumarate, ketoconazole, ketoprofen, ketorfanol, ketorolac, ketotifen fumarate, kitasamycin, labetalol hydrochloride, lacidipine, lactitol, lactivicin, laennec, rafudine, lamellarin - n triacetate, lamifiban, lamivudine, lamotrigine, lanoconazole, ranolazine, lampelizone, lanreotide, lansoprazole, latanoprost, lateritin, laurocapram, lauryl isquinolinium bromide, labotrigine succinate, lazabemide, resimibide, reynamycin, remirdipine, reminoprazole, renecept, renin kinase, lenograstim, remperone, lentinan sulfate, leptin, leptostatin, relcainidipine, ergolytrile, relisertion, lethimide hydrochloride, retrasil, retrozole, leucineLeucomycin, leuprorelin acetate, leuprorelin + estrogen + progesterone-, leuprorelin, levamfetamine succinate, levamisole, levobupivacaine lactate, levcromakalim, levetiracetam, leveycloserine, levobetaxolol, levobunolol, levobupivacaine, levocabastine, levocarnitine, levodopa, levodropropizine, levofloxacin, levoflaltadone, levoleucovorin calcium, levomethadyl acetate, levomethadyl acetate hydrochloride, levobmolol, levonantradol hydrochloride, levonordefrin, levonorgestrel, levopropoxyphene napsylate, levopropylcillin potassium, levormeloxifene, levorphanol tartrate, levosimendan, levosulpride, levothyroxine sodium, levoxadrol hydrochloride, lexicant, lexicithromycin, rialozole, lisinopril, lidamidine hydrochloride, lidocaine, lidiphenine, lidifradine, rifalazidine, rifibrate, rifibrol, retinoic acid, lincomycin, linear polyamine analog, linogliride, linopirdine, linitroban, lincosamide, lintitript, lintopride, liothyronine I 125, liothyronine sodium, liotrix, lirexapride, lisinopril, risoclinamide 7, rexazidinone sulfate, lobaplatin, lobenzarit sodium, lobucavir, lodelaben, lodoxamide, lofemizole hydrochloride, lofentanyl oxalate, lofepramine hydrochloride, lofexidine hydrochloride, lombricin, lomefloxacin, lomerizine, lometraline hydrochloride, lometrexol, lomofungin, lomoxicam, lomustine, lonaparen, lonazolac, lonidamine, loperamide hydrochloride, loracarbef, lorazumin hydrochloride, loratadine, lorazepam, lorbamate, lorcamide hydrochloride, lorecrezol, loreinadol, lorglumide, lormetazepam, lomoxicam, lomoxicam, lortalam, lorzafone, losartan, rosigamon,Losoxantrone, Rosladine Hydrochloride, Loteprednol, Lovastatin, Lobeline, Loxapine, Loxoribine, Ruberzol, Lucanthone Hydrochloride, Rufilonil, Lulotetracen Hydrochloride, Luteinizing Hormone, Lutetium, Lutrelin Acetate, Rudindole, Liapolate Sodium, Resetamine, Rigicamycin, Lydimycin, Linestrenol, Represin, Lysine, Lysophillin, Lysostaphin, Soluble Peptide, Maduramycin, Mafenide, Magainin 2 Amide, Magnesium Salicylate, Magnesium Sulfate, Magnolol, Mycotansin, Malethamer, Marotocromen, Marotojaponin, Marotilate, Marotilate, Mangafodipir, Manidipine, Maniwamycin A, Mannitol, Mannostatin A, Mannumycin E, Mannumycin F, Mapinastine, Maprotiline, Marimastat, Martek 158708, Martek 92211, Masoprocol, Maspin, Macetridol, Matrilysin Inhibitor, Maytansin, Mazzaperone Succinate, Majindol, Mebendazole, Mebeverine Hydrochloride, Mebrofenin, Mebutamate, Me camylamine Hydrochloride, Mechlorethamine Hydrochloride, Meclocycline, Meclofenamic Acid Sodium, Meclocarone, Mecrolisone Dibutyrate, Medazepam Hydrochloride, Medroxyprogesterone, Medrogestone, Medroxalol, Medroxyprogesterone, Medrysone, Meclizine Hydrochloridehydrochloride), mefenamic acid, mephenidyl, mefenorex hydrochloride, mefexamide, mefloquine hydrochloride, mefluside, potassium megalomicin phosphate, megestrol acetate, meglumine, meglitol, melengestrol acetate, meritracen hydrochloride, melphalan, memotine hydrochloride, menadiol sodium phosphate, menoctone, menogaril, menotropin, meobentine sulfate, mepartricin, mepenzolate bromide, meperidine hydrochloride, mefentermine sulfate, mephenytoin, mephobarbital, mepivacaine hydrochloride, meprobamate, meptazinol hydrochloride, mequindox, melarazine sodium, melbarone, mercaptopurine, mercurophénol chloride, mercury, ammoniated mercury, merthiolate Hg197, meropenem, mesalamine, mesecrazone, mesoridazine, mestosterone, mestranol, mesprine hydrochloride, metolol hydrochloride, metaproterenol polistirex, metaraminol bitartrate, metaxalone, meteneprost, metereoline, metformin, methacholine chloride, metacycline, methadone hydrochloride, metadyl acetate, metalozide, methamphetamine hydrochloride, metacalone, metazolamide, methdilazine, methenamine, metenolone acetate, metetoin, methicillin sodium, methimazole, methioninase, methionine, methisazone, methixene hydrochloride, methocarbamol, methohexital sodium, methotrexate, methotrexate, metotrimeprazine, methoxatone, methoxyflurane, methsuximide, methyclothiazide, methyl palmitoxylate, methylatropine nitrate, methylbenzethonium chloride, methyldopa, methyldopa hydrochloride, methylene blue, methylergonovine maleate, R-α-methylhistamine, methylinosine monophosphate, methylphenidate hydrochloride, methylprednisolone, methyltestosterone, methynodiol diacetate (methynodioldiacelate), methylcellulose, methylcellulose maleate, methiamide, methiapin, methioprim, metipamide, metopranolol, methylchlorothiazide, metokeclamide acetate, metoclopramide, methyclothiazide iodide, metogest, metrazone, metopimazine, methoprim, metoprolol, methoxydine, metrifonate, metrizamide, sodium metrizoate, metronidazole, meturedepa, methylrapone, methylosin, mexiletine hydrochloride, potassium mexirenate, mezlocillin, amphonelic acid, mianserin hydrochloride, mibefradil, mibefradil dihydrochloride, mibolerone, miceramine B, miconazole, microcortin A, midafuryl, midazolam hydrochloride, midodrine, mifepristone, mifobart, miglitol, mirazide, miramerin, milidronate, milenperone, miliperitine, milnacipran, milrinone, miltefosine, minapram hydrochloride, minaprine, minaxolone, minochromil, minocycline, minoxidil, myofradil hydrochloride, myocamycin, mipragoside, milfentanyl, millimostim, millicamycin hydrochloride, mirisetron maleatemaleate), mirtazapine, mismatched double-stranded RNA, misonidazole, misoprostol, mitindomide, mitocarcin, mitocromin, mitogirin, mitoguazone, mitolactol, mitomalcin, mitomycin, mitonafide, mitosper, mitotane, mitoxantrone, mivacurium chloride, mibazolol, mexampril, mixidine, mizolastine, mizoribine, moclobemide, modafinil, modafinil sulfate, modecamide, moexipril, mofarotene, mophegyline hydrochloride, mofezolac, molgramostim, molinazone, molindone hydrochloride, molsidomine, mometasone, montelukast sodium, montirelin, mopidamol, moracidin, morantel tartrate, moricidin, moliniflumate, morphine sulfate, sodium molinate, mosapramine, mosapride, motilide, motretinide, moxalactam disodium, moxazosin, moxiraprine, moxnidazole, moxonidine, mumps skin test antigen, mustard anticancer agent, muzolimine, mycoperooxide B, mycophenolic acid, myriaporon, nabazenil, navelon, navitane hydrochloride, naboctate hydrochloridehydrochloride), nabumetone, N-acetyl dinarine, nadide, nadifloxacin, nadolol, nandrolone phenylpropionate, nadroparin calcium, nafadotride, nafamostat, nafarelin, nafcillin sodium, nafenopin, naphimidone hydrochloride, naphrocort, nahomin malate, naproxidine hydrochloride, nafronyl oxalate, naftifine hydrochloride, naphthopyridyl, naglivan, nagrestip, nalbuphine hydrochloride, nalidixic acid sodium, nalidixic acid, nalmefene, naloxone methanesulfonate, naloxone + pentazocine, naltrexone, namoxyrate, nandrolone phenylpropionate, nantradol hydrochloride, napactadine hydrochloride, napadisylate, napamezol hydrochloride, napaviin, naphazoline hydrochloride, naphterpin, naproxen, naproxol, napsagatran, naranol hydrochloride, narasin, naratriptan, nartograstim, nasa lase, natamycin, nateplase, naxagolide hydrochloride, nebivolol, nebramycin, nedaplatin, nedocromil, nefazodone hydrochloride, neflumozide hydrochloride, nefopam hydrochloride, nelezaprine maleatemaleate), nemazoline hydrochloride, nemorubicin, neomycin palmitate, neostigmine bromide, neridronic acid, netilmicin sulfate, neutral endopeptidase, neutramycin, nevirapine, nexicamidine hydrochloride, niacin, nibroxan, nicardipine hydrochloride, nicergoline, niclosamide, nicorandil, nicotinyl alcohol, nicotine, nifedipine, nifirmerone, nifluride, nifradene, nifraldazone, nifrate, niflatrone, nifurdazil, nifurimide, niflumic acid, nifurquinazol, nifurthiazole, nilutamide, nilvadipine, nimazon, nimodipine, niperotidine, nilabolin, niridazole, nisamycin, nisbuterol mesylate, niacin, nisobamate, nisoldipine, nisoxetine, nisterime acetate, nitarson, nitazoxamide, nitecapone, nitrafudam hydrochloride, nitralamine hydrochloride, nitramisole hydrochloride, nitrazepam, nitrendipine, nitrocycline, nitrodan, nitrofurantoin, nitrofurazone, nitroglycerin, nitromersol, nitromide, nitromifene citrate, nitrous oxide, nitrogen oxide antioxidant, nitrullyn, nibaazole, nivimedone sodium, nizatidine, novastigmine, nocodazole, nogalamycin, nolinium bromidebromide), nomifensine maleate, noracymethadol hydrochloride, norethandrolone, norepinephrine bitartrate, norethindrone, norethynodrel, norfloxacin, norflurane, norgestimate, norgestomet, norgestrel, nortriptyline hydrochloride, noscapine, novobiocin sodium, N-substituted benzamides (benzaimides), nufepoxole, nylestriol, nystatin, O6-benzylguanine, obidoxime chloride, ocaperidone, octaphentyl hydrochloride, osinaplon, octanoic acid, octazamide, octenidine hydrochloride, octodrine, octreotide, octriptyline phosphate, ofloxacin, oformine, oxenone, olanzapine, oligonucleotide, oropatadine, orprinone, olsalazine, olsalazine sodium, orvanil, omeprazole, onapristone, ondansetron, ontazolast, egg maturation inhibitory factor, opipramol hydrochloride, oracin, orconazole nitratenitrate), orotate, orlistat, ormaplatin, ormetoprim, ornidazole, orpanoxin, orphenadrine citrate, osaterone, otenzepad, oxacillin sodium, oxagrelate, oxaliplatin, oxamaline hydrochloride, oxamisole, oxamunine, oxandrolone, oxantel pamoate, oxaprotiline hydrochloride, oxaprozin, oxalbazole, oxatomide, oxaunomycin, oxazepam, oxcarbazepine, oxendolone, oxesazain, oxetorone fumarate, oxfendazole, oxyphenisine, oxybendazole, oxiconazole, oxydopamine, oxydronic acid, oxyfungin hydrochloride, oxolorphan, oxymonam, oxymonam sodium, oxypeperomide, oxiracetam, oxylamide, oxysuran, oxymethidine hydrochloride, oxodipine, oxogestone phenpropionate, oxolinic acid, oxprenolol hydrochloride, oxotriphylline, oxybutynin chloride, oxyclorene, oxycodone, oxymetazoline hydrochloride, oxymetron, oxymorphone hydrochloride, oxypeptin, oxyphenbutazone, oxypurinol, oxytetracycline, oxytocin, ozagrel, ozolinone, paclitaxel, parauramine, pardimycin, parinavir, palmitoyl lysocine, sodium palmitoxylate, pamaqueside, pama trol sulfate, pamidogrel, disodium pamidronate, pamidronic acid, panadiplon, panamesine, panaxytriol, pancopride, pancuronium bromide, panipenem, pannolin, panomifene, pantethine, pantoprazole, papaverine hydrochloride, parabactin, parachlorophenol, paraldehyde, paramethasone acetate, paranilyl hydrochloride, parapenzolate bromide, pararosaniline pamoate, parbendazole, parconazole hydrochloride, paregoric, pareptide sulfate, pargyline hydrochloride, parnaparin sodium, paromomycin sulfate, paroxetine, parthenolide, partricin, pauromycin, pazelliptin, padinacrone, pazoxide, pazufloxacin, pefloxacin, pegaspargase, pegolorotate (p egorgotein), peranserin hydrochloride, perdesin, peliomycin, pelretin, perlinone hydrochloride, pemedolac, pemeride nitrate, pemirolast, pemoline, penameserin, penbutolol sulfate, penciclovir, penfluridol, penicillin G benzathine, penicillin G potassium, penicillin G procaine, penicillin G sodium, penicillin V, penicillin V benzathine, penicillin V hydrabamine, penicillin V potassium, pentabamate, pentaerythritol tetranitrate, pentafuside, pentamidine, pentamolphone, pentamustine, pentapiperium methylsulfate, pentazocine, pentetate, pentiapin maleate, pentigetide, pentisomicin, pentizidone sodium, pentobarbital, pentomone, pentopril, pentosan, pentostatin, pentoxifylline, pentrinitrol, pentrozole, pepromycin sulfate, pepstatin, perflubron, perfofamide, perfosfamide, pergolide, perhexyline maleate, perillyl alcohol, perindopril, perindoprilat, perlapine, permethrin, perospirone, perphenazine, phenacemide, phenalizine, phenazinomycin, phenazopyridine hydrochloride, phenylbutazone sodium glycerolate, phencarbamide, fenciclonium hydrochloride, phentermine tartrate, fenethazine sulfate, fenmetrazine hydrochloride, phenobarbital, phenoxybenzamine hydrochloride, fenprocumone, fenserin, phensuccinal, phensuximide, phentermine, phentermine hydrochloride, phentolamine mesylate, phentoxifylline, phenylaminosalicylic acid, phenyl acetate, phenylalanine, phenylalanine ketoconazole, phenylbutazone, phenylephrine hydrochloride, phenylpropanolamine hydrochloride, phenylpropanolamine polistirex, pheniramidol hydrochloride, phenyloin, phosphatase inhibitor, physostigmine,Pisenadol, Pishibanil, Picotrinjiolamine, Picroliv, Picumeterol, Pidotimod, Pifamine, Pilocarpine, Pilsicamide, Pimagedin, Pimethine Hydrochloride, Pimylprost, Pimobendan, Pimodide, Pinacidil, Pinadrine, Pindolol, Pinnenol, Pinocebrin, Pinoxepin Hydrochloride, Pioglitazone, Pipanperon, Pipazetate, Pipercuronium Bromide, Piperacetazine, Piperacillin Sodium, Piperamide Maleate, Piperazine, Pipobroman, Piposulfan, Pipothiazine Palmitate, Pipoxolan Hydrochloride, Piprozoline, Picindone Hydrochloride, Picizil Hydrochloride, Piracetam, Pyrandamine Hydrochloride, Pirarubicin, Pyrazomonam Sodium, Pyrazolac, Pirbenicillin Sodium, Pirbuterol Acetate, Pyrenperon, Pyrenzepine Hydrochloride, Pyretanide, Phenylidone, Pyridicillin Sodium, Piridronate Sodium, Pyriprostone, Pyrithioxime, Pirrimycin Hydrochloride, Pirindolol, Pirmagrel, Pirenol Hydrochloride, Pirnabin, Piroctone, Pirodavil, Pirodast, Pyroglylide Tartrate, Piroxolate, Piroxazamide, Piroxantrone Hydrochloride, Piroxicam, Piroximon, Priloprofen, Pilquinol, Pirsidimine, Prenylamine, Pitavastatin, Posterior Pituitary, Pivampicillin Hydrochloride, Pivopril, Pizotiline, Placetin A, Platinum Compound, Platinum-Triamine Complex, Prikamycin, Promestane, Podcast Edamine, Podophyllox, Urushi Extract, Poldine Methylsulfate, Poliglusam, Polignate Sodium, Polymyxin B Sulfate, Polythiazide, Ponaresat, Porfimer Sodium, Porfiromycin, Potassium Chloride, Potassium Iodide, Potassium Permanganate, Povidone Iodine, Pracaterol, Pralidoxime Chloride, Pramiracetam Hydrochloride, Pramoxine Hydrochloride, Planorium Chloride, Pravadoline Maleate, Pravastatin (Pravachol), Prazeepam, Prazosin, Prazosin Hydrochloride,Prednazate, prednicarbate, prednimustine, prednisone, prednisolone, prednibaral, pregnenolone succinate, prenalterol hydrochloride, preddefin hydrochloride, prifelone, prilocaine hydrochloride, prilosec, primaquine phosphate, primidone, prinivil, prinomidomide tromethamine, prinoxodan, pridilol hydrochloride, proadifen hydrochloride, probenecid, probicromil calcium, probucol, procainamide hydrochloride, procaine hydrochloride, procarbazine hydrochloride, procaterol hydrochloride, prochlorperazine, procionide, proclonol, procyclidine hydrochloride, prodridine hydrochloride, prodolic acid, profadol hydrochloride, progabide, progesterone, proglymid, human proinsulin, proline, prolintane hydrochloride, promazine hydrochloride, promethazine hydrochloride, propafenone hydrochloride, propagermanium, propanidide, propantheline bromide, proparacaine hydrochloride, propatyl nitrate, propentophylline, propenzolate hydrochloride, propicain, propio-mazine, propionic acid, propionyl carnitine, L-, propiram, propiram + paracetamol, propiverine, propofol, propoxycaine hydrochloride, propoxyphene hydrochloride, propanolol hydrochloride, propulsid, propylbis-acridone, propylhexedrine, propyriodon, propylthiouracil, procazon, prolenoate potassium, proloxan hydrochloride, prossilaridine, prostalene, prostratin, protamine sulfate, protegrin, protirelin, protosufloxacin, protriptyline hydrochloride, proxazole, proxazole citrate, proxymir, proxol sulfan tartrate, pullrifloxacin, pseudoephedrine hydrochloride, puromycin, purpurin, pyrabrom, pyrantel, pamoate, pyrazinamide, pyrazofurin, pyrazoloacridine, pyridostigmine bromide, pyrilamine maleate, pyrimethamine, pyrinoline, sodium pyrithione, zinc pyrithione, pyrovaberon hydrochloride, pyroxamine maleate, pyrocaine, pyrilifen hydrochloridepyrroinitrin, pyruvinium pamoate, quanadazolium mesylate, quazepam, quazinone, quazodine, quazolast, quetiapine, kiflapone, quinagolide, quinaldine blue, quinapril, quinaprilat, quinazosin hydrochloride, kinboron, quinctolate, kindamine acetate, kindonium bromide, cinepazide maleate, labetalol sodium, latamoxef, racepinephrine, raf antagonist, rafoxamide, laritrin, lasofoxifene, larotrectinib, ramatroban, ramipril, ramoplanin, ramoserpine, ranolazine, rauwolfia serpentina, recainam, recainam hydrochloride, reclazepam, regorafenib, regabulin, regramostim, relaxin, relomycin, remacemide hydrochloride, remifentanil hydrochloride, remiprostol, remoxipride, repirinast, reproterol hydrochloride, reserpine, resinferatoxin, resorcinol, demethylretriepin, reticulon, reviparin sodium, revidinone, rhenium re 186 etidronate, risoxin, ribaminol, ribavirin, riboprine, ribozyme, ricaboserpine, ridogrel, rifabutin, rifametin, rifamexil, rifamide, rifampin, rifapentine, rifaximin, retinamid, rilopirox, riluzole, rimantadine, limcaazole hydrochloride, mexyloxolone, limiterol hydrobromide, rimoprogin, riodipine, rioprostil, lipazepam, ripisartan, risedronate sodium, risedronate, risocaine, lisotridine hydrochloride, rispendepine, risperdal, risperidone, ritanserin, liripenem, ritodrine, litorch,ritonavir, rizatriptan benzoate, locastatin hydrochloride, loxapine bromide, rhodocaine, roflurane, logretimide, rohitukine, rokitamycin, roletamicide, lorgamidine, loliciprin, loliplum, lolitetracycline, llorodin, romazarit, romurtide, ronidazole, ropinirole, lopitoin hydrochloride, ropivacaine, ropidine, roquinimex, rosamicin, losoxacine, lotoxamine, roxaitidine, roxarsone, loxindole, Roxithromycin, rubiginone B1, ruboxyl, lomefloxacin, rupatidine, lutamycin, luzadran, saberzol, safingol, safironyl, sintopine, salbutamol, R--, salcolex, saretamide maleate, salicyl alcohol, salicylamide, meglumine salicylate, salicylic acid, salmeterol, salnacediin, salsalate, sameridine, sanpatrilat, sancycline, sanfetrineum, sanguinarine chloride, saperconazole, saprisartan, sapropterin, saquinavir, sarafloxacin hydrochloride, saralasin acetate, SarCNU, sarcophytol A, sargramostim, salmoxicillin, salpicillin, salpogrelate, salylase, saterinone, satigrel, satumomab pendetide, Schick test control, scopafungin, scopolamine hydrobromide, scrazaipine hydrochloride, sdi 1 mimetic, secalciferol, secobarbital, seelzone, seglitide acetate, selegiline, selegiline hydrochloride, selenium sulfide, selenomethionine se 75, selhotel, sematilide, senduramycin, semotiadil, semustine, sense oligonucleotide, sepazoniun chloride, seperidol hydrochloride, seprilose, seproxetine hydrochloride, seractide acetate, sergolexole maleate, serine, selmetacin, sermorelin acetate, sertaconazole, sertindole, sertraline, cetiprilin, cetoperone,Sevirumab, sevoflurane, sezolamide, sibopilzine, sibutramine hydrochloride, signal transduction inhibitor, silandron, silipide, silteplase, silver nitrate, simendan, simtrazene, simvastatin, sincalide, cinefungin, cynitrozil, sinapido (sin, nabidol), sipatrigine, sirolimus, sisomicin, sitoglucoside, sizofuran, sobuzoxane, sodium amylosulfate, sodium iodide I123, sodium nitroprusside, sodium oxybate, sodium phenylacetate, sodium salicylate, solverol, solaperceptine tartrate, somalapor, somatandine hydrochloride, somatomedin B, somatomedin C, somatrem, somatropin, somenopor, somidobove, sonermin, solvinyl, solibudine, sotolol, soterenol hydrochloride, sparfloxacin, sodium sparfosate, sparfosic acid, sparsomycin, sparteine sulfate, spectinomycin hydrochloride, spicamycin D, spiperone, spirapril mesylate, spiramycin, spirapril hydrochloride, spiraprilat, spirogermanium hydrochloride, spirothromycin, spironolactone, spiroplatin, spiroxasone, spreopenpentine, spongistatin 1, sprodiamide, squalamine, stallymcin hydrochloride, stannous pyrophosphate, stannous sulfur colloid, stanozolol, statolon, staurosporine, stubidine, stefimycin, stenbolone acetate, steptonine, stilbadium iodide, stilonium iodide, stipiamide, stilpentol, stobadine, streptomycin sulfate, streptonicozid, streptomycin, streptozocin, stromelysin inhibitor, strontium chloride Sr89. succibun, succimer, succinylcholine chloride, scralfurat, scrosophart potassium, sudoxicam, sufentanil, sufotidine, slazepam, sulbactam pivoxyl, sulconazole nitrate, sulfabenz, sulfabenzamide, sulfacetamide, sulfacitine, sulfadiazine, sulfadoxine, sulfalen, sulfamerazine, sulfameter, sulfamethazine, sulfamethizole, sulfamethoxazole, sulfamonomethoxine, sulfamoxole, zinc sulfanilate, sulfanitran, sulfasalazine, sulfasomizole, sulfazameth, sulfinallol hydrochloride, sulfinosine, sulfinpyrazone, sulfisoxazole, sulfomixin, sulfonterol hydrochloride, sulfoxamine, sulinldac, sulmarin, sulnidazole, sloctidyl, slophenur, slopenem, sloxifen oxalate, sulpiride, sulprostone, sultamicillin, sultiam, sultopride, sulcaste, sumaloten, sumatriptan, suncillin sodium, suproclone, suprofene, suradista, suramine, surfomer, suricamide maleate, sultizole, slonacrine maleate, skixemeride sulfate, swineonin, symakalim, simcroseen, cimetidine hydrochloride, synthetic glycosaminoglycan, taciamine hydrochloride, tacrine hydrochloride, tacrolimus, talampicillin hydrochloride, taleranole, talisomycin, talmustin, talmetacin, talniflumart, talopram hydrochloride, talosarate, tamedraline hydrochloride, tamoxifen, tampramine fumarate, tamsulosin hydrochloride, tandamine hydrochloride, tandospirone, tapgen, taprostene, tasosartan, tauromustin, taxane, taxoid, tazadrene succinate, tazanolast, tazarotene, tazifirin hydrochloride, tazobactam, tazopheron, tazolol hydrochloride, tebuferon, tebuquine, technetium Tc 99 mbicisate), tecrozan, tecogalan sodium, teecleukin, teflurane, tegafur, tegretol, teicoplanin, terenzepine, tellurapyrylium, termestane, telmisartan, telomerase inhibitor, teloxantrone hydrochloride, terodipine hydrochloride, temafloxacin hydrochloride, tematropium methylsulfate, temazepam, temelastine, temocapril, temocillin, temoporfin, temozolomide, tenidap, teniposide, tenosal, tenoxicam, tepirindole, tepoxalin, teprotide, terazosin, terbinafine, terbutaline sulfate, terconazole, terfenadine, terflavoxate, terguride, teriparatide acetate, terlakiren, terlipressin, terodiline, teroxaline hydrochloride, teroxirone, tertatrolol, tesicam, tesimide, testolactone, testosterone, tetracaine, tetrachlorodecaoxide, tetracycline, tetrahydrozoline hydrochloride, tetramizole hydrochloride, tetrazolast meglumine, tetrazomine, tetrophosmin, tetroquinone, tetroxoprim, tetridamine, taliblastine, thalidomide, theofilbrate, theophylline, thiabendazole, thiampurine, thiamphenicol, thiamylal, thiazecim hydrochloride, thiazinamium chloride, thietylperazine, thimerosal sodium, thimerosal, thiocholin, thiofedrine, thioguanine, thiomarinol, thiopental sodium, thioperamide, thioridazine, thiotepa, thiothixene, tifinamyl hydrochloride, tifensilin potassium, thiram, tozarinone, threonine, thrombin, thrombopoietin, thrombopoietin mimetic, thymalfasin, thymopoietin receptor agonist, thymotrinan, thymedan hydrochloride, thyroxine I 125, thyroxine I131. Tiakrilast, Sodium Tiakrilast, Tiagabine, Thiameninidine, Tianeptine, Tiapafant, Tiamipamil Hydrochloride, Thialamide Hydrochloride, Thiazofurin, Tibenelast Sodium, Tibolone, Tiburic Acid, Ticabeson Propionate, Ticarbodine, Ticalcillin Cresyl Sodium, Ticlaton, Ticlopidine, Ticlinafen, Thienoxolol, Tifurac Sodium, Tigemonam Dicoline, Tigestol, Thiretanamine Hydrochloride, Thiridin Hydrochloride, Thirisolol, Tilnoprofen Arbamel, Thiorolone Hydrochloride, Tiludronic Acid Disodium, Tiludronic Acid, Timefron, Timobeson Acetate, Timolol, Ethyl Ethiopurpurin Tin, Tinabinol, Timidazole, Tinzaparin Sodium, Thioconazole, Thiodazosin, Thiodonium Chloride, Thioperidone Hydrochloride, Thiopyrac, Thiaspirone Hydrochloride, Thiotidine, Tiotropium Bromide, Thioxidazole, Tipentosin Hydrochloride, Tipredan, Tiprenolol Hydrochloride, Tiprinast Meglumine, Tipropidyl Hydrochloride, Tiqueced, Tiquinamide Hydrochloride, Tirandalidigin, Tirapazamine, Thiralazad, Tirofiban, Tiroplamide, Titanocene Dichloride, Tixanox, Tixocortol Pivalate, Tizanidine Hydrochloride, Tobramycin, Tocamide, Tokanfil, Tofenacin Hydrochloride, Tramolol, Tramazide, Trazoline Hydrochloride, Tolbutamide, Tolcapone, Tolciclate, Tolfamide, Tolgabide, Lamotrigine, Tolimidone, Trinderat, Tolmetin, Tolnaftate, Tolpovidone I131. Tropiramide, Tolrestat, Tomecast, Tomoxetine Hydrochloride, Tamsulosin Mesylate, Topiramate, Topotecan, Topotecan Hydrochloride, Topseptin, Topterone, Tokidine, Trasemide, Toremifene, Torasemide, Tosifen, Tosufloxacin, Totipotent Stem Cell Factor, Tracazolate, Trafermin, Tralonide, Tramadol Hydrochloride, Tramazoline Hydrochloride, Trandolapril, Tranexamic Acid, Tranilast, Transcamide, Translation Inhibitor, Trazanolox, Trazodone Hydrochloride, Trazodone - HCL, Trebenzomine Hydrochloride, Trefentanyl Hydrochloride, Trolexinate, Trepipam Maleate, Trestolone Acetate, Tretinoin, Triacetin, Triacetyluridine, Triafungin, Triamcinolone, Triampicillin Sulfate, Triamterene, Triazolam, Tribenoside, Tricaprilin, Tricetamide, Trichlormethiazide, Tricohiarin, Triciribine, Tricitrate, Trichlorophenol Piperazine, Trichlorophos Sodium, Trclonide, Trientine, Triphenagrel, Triflavin, Triflocin, Triflubazam, Triflumidate, Trifluoperazine Hydrochloride, Trifluperidol, Trifluoperazine, Trifluoperazine Hydrochloride, Trifluridine, Trihexyphenidyl Hydrochloride, Trilostane, Trimazosin Hydrochloride, Trimegestone, Trimeprazine Tartrate, Trimethadione, Trimethaphan Camsylate, Trimethobenzamide Hydrochloride, Trimethoprim, Trimethidine, Trimethotrexate, Trimipramine, Trimoprostil, Trimoxamine Hydrochloride, Triolein I 125, Triolein I 131, Trioxifene Mesylatemesylate), tripamide, triperidamine hydrochloride, triprolidine hydrochloride, tryptoline, trisulfapyrimidines, troxerutin potassium, troglitazone, trolamine, troleandomycin, trombodipine, trometamol, tropanserin hydrochloride, tropicamide, tropine ester, tropisetron, trospetomycin, trovafloxacin, trolviridine, tryptophan, tuberculin, tubocurarine chloride, tubrolazole hydrochloride, tucarcsol, tulobuterol, tulosteride, tibamate, thyroglobulin, sodium tiopanoate, tyrosine, thyrothricin, tilorone, ubenimex, urazepam, undecylenic acid, uracil mustard, urapidil, urea, uredepa, uridine triphosphate, urofolitropin, urokinase, ursodeoxycholic acid, valaciclovir, valine, barnoctamide, sodium valproate, valproic acid, valsartan, bamicamide, vanadeine, vancomycin, vaminolol, vapiprost hydrochloride, vapreotide, variolin B, vasopressin, vecuronium bromide, veraresol, bernacrine maleate, venlafaxine, veradoline hydrochloride, veramine, verapamil hydrochloride, bergenin, bellirubin hydrochloride, berlukast, verophyllin, veroxan, verteporfin, besnarinone, bexibinol, vidarabine, vigabatrin, viroxazine hydrochloride, vincristine sulfate, vinblastine sulfate, vinburnine citrate, vincophos, vincanate, vindesine, vindesine sulfate, vinepidipine sulfate, vinglycinate sulfate, vinrosidine sulfate, vinorelbine, vinpocetine, vintoperol, vinxaltine, vinzolidine sulfate, biprostol, virginamycin, viridofulvin, viroxime, vitaxin, terazosin, voriconazole, vorozo Ru, boxelgolide, warfarin sodium, xamoterol, xanomeline, xanoxart sodium, xanthinol nicotinate, zemirofibane, xenalipin, xenbusine, xylobam, ximoprofen, xipamide, xolsulfanol mesylate, xylamidine tosylate, xylazine hydrochloride, xylometazoline hydrochloride, xylose, yohimbine, zabisopril, zacopride, zafirlukast, zalcitabine, zaleplon, zolospiron, zaltidine hydrochloride, zaltoprofen, zanamivir, zankiren, zanoterone, zantac, zafirlukast(zarirlukast), zatebradine, zatosetron, zatosetron maleate, zenerestat, zenazocine mesylate, zeniplatin, zeralanol, didomethacin, didobuzin, diflurosilone, diirantal, diirascorb, dirotone, dimelidine hydrochloride, zinc undecylenate, zindotrine, dinoconazole hydrochloride, dinostatin, dinterol hydrochloride, dinviroxime, diplasidone, zobolt, zofenopril calcium, zofenoprilato, zolamine hydrochloride, zolazepam hydrochloride, zoledronie acid, zolertine hydrochloride, sumatriptan, zolpidem, zomepirac sodium, zometapine, zoniclezole hydrochloride, zonisamide, zopiclone, zoporrestat, zorbamyciin, zolbysine hydrochloride, zotepine, zucapsaicin, JTT-501(PNU-182716)(reglitazar), AR-H039122, MCC-555(netoglitazone), AR-H049020(tesaglitazar), CS-011(CI-1037), GW-409544X, KRP-297, RG-12525, BM-15.2054, CLX-0940, CLX-0921, DRF-2189, GW-1929, GW-9820, LR-90, LY-510929, NIP-221, NIP-223, JTP-20993, LY 29311 Na, FK 614, BMS 298585, R 483, TAK 559, DRF 2725 (ragaglitazar), L-686398, L-168049, L-805645, L-054852, (demethyl asteriquinone) B1 (L-783281), L-363586, KRP-297, P32 / 98, CRE-16336, EML-1625, their pharmaceutically acceptable salts, or their biologically active fragments, variants or derivatives, or combinations thereof. In some embodiments, the bioactive agent is selected from leuprolide, octreotide, brimonidine, latanoprost, latanoprost acid, travoprost, travoprost acid, brinzolamide, dorzolamide, betaxolol, terbinafine, risperidone, and / or rapamycin, or combinations thereof.
[0293] Carbohydrate: As used herein, the term "carbohydrate" refers to a biomolecule containing carbon, oxygen, and hydrogen. In some embodiments, carbohydrates include saccharides, sugars, starches, or celluloses. In some embodiments, saccharides include monosaccharides, disaccharides, oligosaccharides, and polysaccharides. In some embodiments, polysaccharides act as structural components or substitute for energy storage. In some embodiments, carbohydrates are involved in the immune system, fertilization, inhibition of pathogenesis, blood clotting, and / or development. In some embodiments, the bioactive agent contains a carbohydrate.
[0294] Cell-Penetrating Peptide: As used herein, the terms "cell-penetrating peptide", "cell-penetrating protein", "CPP", etc. refer to a peptide or protein having the ability to cross the cell membrane. In various embodiments, the CPP is complexed with a bioactive agent to facilitate the transport of the agent across the membrane. In some embodiments, the CPP helps to facilitate the uptake of the agent across the cell membrane, such as the plasma membrane of mammalian cells, and / or the nuclear membrane of mammalian cells. In some embodiments, the CPP is internalized into the cell and can pass through cell membranes (including, in particular, the outer "boundary" cell membrane, commonly also referred to as the "plasma membrane", endosomal membranes, and membranes of the endoplasmic reticulum), and / or can direct the passage of a given agent or cargo across these cell membranes. In some embodiments, any possible internalization mechanism is predicted to include both energy-dependent (i.e., active) transport mechanisms (such as endocytosis) and energy-independent (i.e., passive) transport mechanisms (such as diffusion). In various embodiments, internalization includes the localization of at least a portion of the peptide that passes through the plasma cell membrane and into the cytoplasm (as opposed to localization in different cell compartments such as vesicles, endosomes, or the nucleus). A non-limiting example of a CPP is a peptide having the amino acid sequence GRKKRRQRRRPPQ (Vives; E. et al. (1997), supra).Non-limiting examples of CPPs include the HIV-1 TAT translocation domain (Green, M. and Loewenstein, P. M. (1988) Cell 55, 1179-1188), and the homeodomain of the antennapedia protein from Drosophila (Joliot, A. et al. (1991) Proc. Natl. Acad. Sci. USA 88, 1864-1868); the so-called penetratin or 16-amino acid sequence of pAntp of the antennapedia protein (Derossi, D. et al. (1994) J. Biol. Chem. 269, 10444-10450); the basic sequence of the HIV-1 TAT protein (Vives, E. et al. (1997) J. Biol. Chem. 272, 16010-16017). And the developed synthetic peptide is the amphipathic model peptide MAP (Oehlke, J. et al. (1998) Biochim. Biophys. Acta 1414, 127-139). Non-limiting additional examples of CPPs are described in U.S. Patent Nos. 9,303,076 and 9,302,014.
[0295] Characteristic portion: As used herein, the term "characteristic portion" of a protein or polypeptide is a portion that contains contiguous amino acids, or a collection of contiguous amino acids, both of which are characteristics of the protein or polypeptide. Each such contiguous chain will generally contain at least two amino acids. Further, those of ordinary skill in the art will generally recognize that at least 5, 10, 15, 20 or more amino acids are necessary for a portion to be characteristic of a protein. Generally, a characteristic portion is a portion that shares at least one functional characteristic with the relevant wild-type protein in addition to the sequence identity specified above.
[0296] Characteristic sequence: As used herein, a "characteristic sequence" is a sequence that is present in all constituent members of a family of polypeptides or nucleic acids and can thus be used by those of ordinary skill in the art to define the members of that family.
[0297] Characteristic structural element: As used herein, the term "characteristic structural element" refers to distinct structural elements (e.g., core skeleton, set of pendant moieties, sequence elements, etc.) that are present in all members of a family of polypeptides, small molecules, or nucleic acids, and can thus be used by one of ordinary skill in the art to define the members of that family.
[0298] Chemotherapeutic agent: As used herein, the term "chemotherapeutic agent" refers to a drug or agent that can kill proliferating cells, including cancer cells. Chemotherapeutic agents are frequently used to treat various forms of cancer. In some embodiments, non-limiting examples of chemotherapeutic agents include adriamycin, paclitaxel (Taxol), docetaxel (Taxotere), actinomycin D, doxorubicin, daunorubicin, valrubicin, idarubicin, epirubicin, bleomycin, plicamycin, camptothecin and its derivatives, bleomycin, etoposide, teniposide, mitomycin, vinca alkaloids such as vinblastine and vincristine, and platinum-based compounds such as cisplatin, gemcitabine. In some embodiments, the composition contains a lipid and a portion of a chemotherapeutic agent that can mediate at least one function of the chemotherapeutic agent.
[0299] Comparable: As used herein, the term "Comparable" is used in this specification to describe two (or more) settings of states or environments that are sufficiently similar to each other such that the results obtained or phenomena observed can be compared. In some embodiments, comparable settings of states or environments are characterized by a plurality of substantially identical features and one or a small number of modified features. One of ordinary skill in the art will recognize that settings of conditions are characterized by a sufficient number and type of substantially identical properties, and that differences in the results obtained and phenomena observed under those different settings of conditions or environmental settings are caused by, or are indicators of, changes in those modified properties, and will recognize that they are comparable to each other when it is justified to reasonably conclude so.
[0300] Complex: As used herein, the term "complex" refers to a composition containing two or more components, parts, or molecules that are physically linked to each other either directly or indirectly (using, for example, one or more linkers inserted between two adjacent components, parts, or molecules, as a non-limiting example) such as by a covalent bond. As used herein, the term "complexed" in relation to a composition containing two or more components, parts, or molecules refers to the state in which the two or more components, parts, or molecules are physically linked to each other. In some embodiments, the composition contains a lipid and a bioactive agent, in which case the lipid and the bioactive agent are complexed.
[0301] CRISPR and related terms: As used herein, the terms "CRISPR" and "CRISPR / Cas system" refer to a biological activity system that includes clustered regularly-interspaced short palindromic repeats (CRISPR), which is a segment of prokaryotic cell DNA containing short repeats of base sequences, or various artificial systems derived from or envisioned from natural prokaryotic cell systems. In some embodiments, the bioactive agent contains components of the CRISPR / Cas system. In some embodiments, the components of CRISPR / Cas include, but are not limited to, genes encoding Cas proteins (including, as non-limiting examples, Cas9, dCas9, and their variants, including both natural and artificial variants), or the proteins themselves; guide RNAs; any components of the CAS crRNA complex; cas (CRISPR-associated) genes or gene products; and any other bioactive molecules involved in natural or artificial CRISPR / Cas systems. See, for example, Jinek et al. 2012 Science 337:816-821; Cong et al. 2013 Science 339:819-823; U.S. Patent Application 20140234972; DiCarlo 2013 Nucl. Acids Res. 41:4336-43; Hwang et al. 2013 Nat. Biotech. 31:227-9; and Flowers et al. 2014 Development 141:2165-71.
[0302] Alicyclic: The term "alicyclic" as used herein, for example refers to a saturated or partially unsaturated aliphatic monocyclic, bicyclic, or polycyclic ring system having 3 to 30 ring members, and the aliphatic ring system may be substituted. Alicyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, the cycloalkyl has 3 to 6 carbons. The term "alicyclic" can also include an aliphatic ring fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl, where the radical or point of attachment is on the aliphatic ring. In some embodiments, the carbocyclic group is bicyclic. In some embodiments, the carbocyclic group is tricyclic. In some embodiments, the carbocyclic group is polycyclic. In some embodiments, "alicyclic" (or "carbocyclic" or "cycloalkyl") is a monocyclic C3-C6 hydrocarbon or C8-C 10 bicyclic hydrocarbon, or a C9-C that is fully saturated or contains one or more unsaturated units, but is not aromatic and has a single point of attachment to the remainder of the molecule 16 refers to a tricyclic hydrocarbon.
[0303] Dosing regimen: As used herein, "dosing regimen" or "treatment regimen" often refers to a set of unit doses (often two or more) that are individually administered to a subject over a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may include one or more doses. In some embodiments, a dosing regimen includes multiple administrations, each of which is separated from the others by a period of the same length. In some embodiments, a dosing regimen includes multiple administrations and at least two different periods separating the individual administrations. In some embodiments, all doses within a dosing regimen are the same unit dose. In some embodiments, the different doses within a dosing regimen are different amounts. In some embodiments, a dosing regimen is an initial administration at a first dose, followed by one or more additional administrations at a second dose different from the first dose. In some embodiments, a dosing regimen is an initial administration at a first dose, followed by one or more additional administrations at a second dose the same as the first dose.
[0304] Equivalent Agents: By reading this disclosure, one of ordinary skill in the art will recognize that the scope of useful agents in the context of the present invention is not limited to those specifically recited or exemplified herein. Specifically, one of ordinary skill in the art will recognize that active agents often have a structure consisting of a core and appended pendant moieties, and thus will understand that simple modifications to such a core and / or pendant moieties may not significantly change the activity of the agent. For example, in some embodiments, substitution of one or more pendant moieties having a base of equivalent three-dimensional structure and / or chemical reactivity characteristics may result in a substituted compound or moiety equivalent to the original reference compound or moiety. In some embodiments, addition or removal of one or more pendant moieties may result in a substituted compound equivalent to the original reference compound. In some embodiments, modification of the core structure by addition or removal of, for example, a small number of bonds (often 5, 4, 3, 2 or fewer, or 1 bond, and often single bonds only) may result in a substituted compound equivalent to the original reference compound. In many embodiments, equivalent compounds can be synthesized, for example, using readily available starting materials, reagents, and conventional or provided synthetic procedures, by the methods shown in the following general reaction schemes, or variations thereof. In these reactions, it is also possible to use variants that are known per se but not recited herein.
[0305] Equivalent dosage: As used herein, the term "equivalent dosage" is used herein to compare the dosages of pharmaceutically different active agents that produce the same biological result. The dosages of two different agents are considered "equivalent" to each other according to the present invention if they achieve equivalent levels or comparable biological results. In some embodiments, the equivalent dosages of different drugs for uses according to the present invention are determined using the in vitro and / or in vivo assays described herein. In some embodiments, one or more lysosome activators for uses according to the present invention are utilized at an equivalent dosage relative to the dosage of a reference lysosome activator. In some embodiments, a reference lysosome activator for such purposes is selected from the group consisting of small molecule allosteric activators (e.g., pyrazolopyrimidine), iminosugars (e.g., isofagomine), antioxidants (e.g., n-acetyl-cysteine), and cell transport regulators (e.g., Rab1a polypeptide).
[0306] Halogen: The term "halogen", as used herein, means F, Cl, Br, or I.
[0307] Heteroaliphatic: The term "heteroaliphatic" is given its ordinary meaning in the art and refers to the aliphatic groups described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH2, or CH3 are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, the heteroaliphatic group is a heteroalkyl. In some embodiments, the heteroaliphatic group is a heteroalkenyl.
[0308] Heteroalkyl: As used herein, the term "heteroalkyl" has its ordinary meaning in the art and refers to an aliphatic group described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.
[0309] Heteroaryl: As used herein, the terms "heteroaryl" and "heteroar-", used alone or as part of a larger moiety such as "heteroalkyl" or "heteroalkoxy", refer to monocyclic, bicyclic or polycyclic ring systems having a total of 5 to 30 ring members, at least one ring in the system being aromatic and at least one aromatic ring atom being a heteroatom. A heteroaryl group is, in some embodiments, a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), and in some embodiments, a group having 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 π electrons that are shared in a cyclic array and have 1 to 5 heteroatoms in addition to carbon atoms. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl and pteridinyl. In some embodiments, heteroaryl is a hetero-biaryl group, such as bipyridyl and the like. The terms "heteroaryl" and "heteroalkyl" as used herein also include groups in which the heteroaromatic ring is fused to one or more aryl, cycloaliphatic or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be monocyclic, bicyclic or polycyclic.The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring", "heteroaryl group", or "heteroaromatic", and any of these terms includes a ring which may be substituted. The term "heteroalkyl" refers to an alkyl group substituted with a heteroaryl group, and the alkyl portion and the heteroaryl portion may be independently substituted.
[0310] Heteroatom: As used herein, the term "heteroatom" means an atom that is neither carbon nor hydrogen. In some embodiments, the heteroatom is (any oxidized form of nitrogen, sulfur, phosphorus, or silicon, any basic nitrogen or quaternized form of a substitutable nitrogen of a heterocyclic ring (e.g., N in 3,4-dihydro-2H-pyrrolyl), (NH in pyrrolidinyl), or (NR in N-substituted pyrrolidinyl) + etc.) oxygen, sulfur, nitrogen, phosphorus, or silicon.
[0311] Heterocyclyl: As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic radical", and "heterocyclic ring" are used interchangeably and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., 3 to 30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, the heterocyclyl group is a saturated or partially unsaturated, stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety having one or more, preferably 1 to 4, of the heteroatoms defined above in addition to carbon atoms. When used with respect to the ring atoms of a heterocycle, the term "nitrogen" includes substituted nitrogen. By way of example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, nitrogen is (N in 3,4-dihydro-2H-pyrrolyl), (NH in pyrrolidinyl), or (in N-substituted pyrrolidinyl) +It can be NR. The heterocyclic ring can be attached to the pendant group by any heteroatom or carbon atom that provides a stable structure, and any ring atom may be substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle", "heterocyclyl", "heterocyclic ring", "heterocyclic group", "heterocyclic moiety", "heterocyclic portion", and "heterocyclic radical" are used interchangeably herein, and the heterocyclic ring includes groups fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. The heterocyclyl group may be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted with heterocyclyl, and the alkyl portion and the heterocyclyl portion may be independently substituted.
[0312] Immunomodulatory Nucleic Acids and CpG Oligonucleotides and Related Terms: As used herein, the term "immunomodulatory nucleic acid" refers to, for example, a nucleic acid that modulates an immune response in a mammalian, e.g., human, subject. refers to nucleic acids that can. In various embodiments, the immunomodulatory nucleic acid can stimulate (agonize) an immune response. In other embodiments, different immunomodulatory nucleic acids can reduce (antagonize) an immune response. By way of non-limiting example, CpG oligonucleotides are included as immunomodulatory nucleic acids. As used herein, the term "CpG oligonucleotide" refers to an oligonucleotide containing an unmethylated CpG motif, in which case the oligonucleotide can contain nucleotides, modified nucleotides, and / or nucleotide analogs. In some embodiments, the CpG oligonucleotide can stimulate TLR9-mediated and / or TLR9-related immune responses in at least one assay. In some embodiments, the CpG oligonucleotide can antagonize an immune response in at least one assay. Otherwise, neither is done. In some embodiments, the CpG oligonucleotide can optionally contain modifications of the sugar, base, or phosphate (phosphodiester), as well as secondary and tertiary structures. See, for example, Vollmer et al. 2009 Adv. Drug. Del. Rev. 61:195-204. In some embodiments, an example of a modified phosphodiester is phosphorothioate. In some embodiments, one or more phosphorothioates (PS) are incorporated into the backbone of the CpG oligonucleotide (instead of phosphodiester or PO). PS has been reported to reduce nuclease degradation and, in at least some examples, enhance the immunogenic activity of CpG oligonucleotides 10- to 100-fold. See Vollmer et al. 2009 Adv. Drug Del. Rev. 61:195-204. In some embodiments, the CpG oligonucleotide can contain all phosphodiesters in the backbone. Or it can contain a mixture of phosphodiesters and internucleoside linkers in the backbone. Or it can contain all internucleoside linkers in the backbone.For example, WO2015 / 108047 reports CpG oligonucleotides with a mixture of phosphodiester and nucleoside (e.g., phosphorothioate) linkages. In this example, the CpG region motif contains phosphodiester along with phosphorothioate adjacent to the CpG region motif. In various embodiments, the CpG oligonucleotide may contain phosphorothioates in the Rp configuration or the Sp configuration. As used in the literature and as used herein, the term "CpG ODN" or "CpG oligodeoxynucleotide" is not strictly limited to oligonucleotides, where in this case "p" is phosphate. These terms have been previously used in the literature and herein are used to include oligonucleotides that contain one or more phosphorothioates instead of phosphodiesters, or even contain all phosphorothioates in their backbone and / or contain other modifications. In some embodiments, "immunomodulatory" CpGs can stimulate an immune response. In some embodiments, the CpG oligonucleotide may contain one strand, or optionally may further contain a second or other additional strand. In some embodiments, the CpG oligonucleotide may further contain other components that are not nucleotides or may be complexed therewith. In some embodiments, the composition contains a lipid and a portion of an immunomodulatory nucleic acid that can modulate at least one function of the immunomodulatory nucleic acid.
[0313] Intraperitoneal: As used herein, the terms "intraperitoneal administration" and "administered intraperitoneally" have the meaning understood in the art and refer to the administration of a compound or composition into the peritoneum of a subject.
[0314] In vitro: As used herein, the term "in vitro" refers to events that occur not within an organism (e.g., an animal, a plant, and / or a microorganism), but in an artificial environment, such as in a test tube or reactor, in cell culture medium, etc.
[0315] In vivo: As used herein, the term "in vivo" refers to events occurring within an organism (e.g., an animal, a plant, and / or a microorganism).
[0316] Linker: As used herein, the term "linker" refers to a moiety that connects two parts of a composition. By way of non-limiting example, a linker physically connects a bioactive agent to a lipid. Non-limiting examples of suitable linkers include uncharged linkers, charged linkers, alkyl-containing linkers, phosphate-containing linkers, branched linkers, unbranched linkers, linkers containing at least one cleavable group, linkers containing at least one redox-cleavable group, linkers containing at least one phosphate-based cleavable group, linkers containing at least one acid-cleavable group, linkers containing at least one ester-based cleavable group, and linkers containing at least one peptide-based cleavable group. Other non-limiting examples of linkers are described herein or are detailed in FIG. 7.
[0317] Lower alkyl: As used herein, the term "lower alkyl" refers to a straight or branched alkyl group of C 1-4 Examples of lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.
[0318] Lipid: As used herein, the term "lipid" refers to any member of a large group of molecules that are generally at least partially hydrophobic or amphiphilic, and specifically includes phospholipids, triglycerides, diglycerides, monoglycerides, fat-soluble vitamins, sterols, fats, and waxes. In some embodiments, lipids include fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids, polyketides, and other molecules. In some embodiments, the present disclosure relates to a bioactive agent and C 10 -C 80Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a bioactive agent and optionally one or more C 1-4 C substituted with an aliphatic group 10 -C 80 Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a bioactive agent and a C 10 -C 60 Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a bioactive agent and optionally one or more C 1-4 C substituted with an aliphatic group 10 -C 60 Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a bioactive agent and a C 10 -C 40 Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the present disclosure relates to a bioactive agent and optionally one or more C 1-4 C substituted with an aliphatic group 10 -C 40Relates to a composition containing a lipid having a linear saturated aliphatic chain or a partially unsaturated aliphatic chain. In some embodiments, the lipids include, but are not limited to, lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl. In some embodiments, the lipids include, but are not limited to, amino lipids; amphiphilic lipids; anionic lipids; apolipoproteins; cationic lipids; low molecular weight cationic lipids; cationic lipids such as CLinDMA and DLinDMA; ionizable cationic lipids; cloaking components; helper lipids; lipopeptides; neutral lipids; neutral zwitterionic lipids; hydrophobic low molecules; hydrophobic vitamins; PEG-lipids; uncharged lipids modified with one or more hydrophilic polymers; phospholipids; phospholipids such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine; stealth lipids; sterols; cholesterol; and targeted lipids; and any other lipids described herein or reported in the art. In some embodiments, the composition includes a lipid and a portion of another lipid that can mediate at least one function of the another lipid. In various embodiments, the compositions of the present disclosure contain any one or more of the lipids described herein or known in the art.
[0319] lncRNA: As used herein, the terms "long non-coding RNA" and "lncRNA" refer to non-protein-coding RNA transcripts that are longer than about 200 nucleotides. This numerical limitation distinguishes long non-coding RNAs from small regulatory RNAs such as, for example, microRNAs (miRNAs), short interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and other short RNAs. In some embodiments, lncRNAs have one or more of the characteristics of mRNAs, including 5' capping, splicing, and polyadenylation, but have little or no open reading frame (ORF). In some embodiments, the lncRNA is Air or Xist. In some embodiments, the lncRNA functions in the regulation of the expression of another gene. In some embodiments, the lncRNA is an lncRNA listed in any lncRNA database including, but not limited to: ChIPBase, C-It-Loci, LNCipedia, lncRNABase, lncRNAdb, lncRNome, MONOCLdb, NONCODE, and NRED. In some embodiments, the composition comprises a lipid and a portion of an lncRNA that can mediate at least one function of the lncRNA.
[0320] mRNA: As used herein, terms such as "messenger RNA", "mRNA" refer to any large family of RNA molecules that transfer genetic information from DNA to ribosomes, where the mRNA specifies the amino acid sequence of the protein product of gene expression. In various embodiments, after transcription of the primary transcript of mRNA (known as pre-mRNA) by RNA polymerase, the processed mature mRNA is translated into an amino acid polymer: protein, as summarized in the central dogma of molecular biology. In some embodiments, the mRNA includes modified mRNA or mmRNA. U.S. Patent No. 9,220,792. In some embodiments, the mRNA encodes any of the following: an allergen, a blood component, a gene therapy product, a human tissue or cell product used in transplantation, a vaccine, an antibody, a cytokine, a growth factor, an enzyme, a thrombolytic agent, or an immunomodulatory substance. In some embodiments, the composition includes a lipid and a portion of the mRNA that can mediate at least one function of the mRNA.
[0321] Muscle: As used herein, the term "muscle" refers to a type of tissue present in animals, including but not limited to mammals including humans. Muscle tissue is a type of fibrous tissue that has the ability to contract, move, or maintain the position of body parts. Muscle cells or muscle tissue can be any skeletal muscle cells or skeletal muscle tissue, cardiac muscle cells or cardiac muscle tissue, smooth muscle cells or smooth It includes slip tendon tissue and / or myoepithelial cells or myoepithelial tissue. In some embodiments, the muscle cells or muscle tissue include cardiomyocytes or cardiac muscle tissue. In some embodiments, the muscle cells or muscle tissue include diaphragm muscle cells or diaphragm muscle tissue. In some embodiments, the muscle cells or muscle tissue include skeletal muscle cells or skeletal muscle tissue. In various embodiments, the muscle cells or muscle tissue are selected from the following: abductor digiti minimi (foot), abductor digiti minimi (hand), abductor pollicis, abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anconeus, articularis cubiti, aryepiglotticus, aryjordanicus, auricularis muscles, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, bulbocavernosus, constrictor muscles of the hypopharynx, constrictor muscles of the midpharynx, constrictor muscles of the upper pharynx, coracobrachialis, corrugator supercilii, cremaster, cricothyroid, dartos, deep transverse perinei, deltoid, depressor anguli oris, depressor labii inferioris, diaphragm, digastric, digastric (anterior view), erector spinae - spinalis, erector spinae - iliocostalis, erector spinae - longissimus, extensor carpi radialis brevis, extensor carpi radialis longus, extensor carpi ulnaris, extensor digiti minimi (hand), extensor digitorum (hand), extensor digitorum brevis (foot), extensor digitorum longus (foot), extensor hallucis longus, extensor indicis, extensor pollicis brevis, extensor pollicis longus, external oblique abdominis, flexor carpi radialis, flexor carpi ulnaris, flexor digiti minimi brevis (foot), flexor digiti minimi brevis (hand), flexor digitorum brevis, flexor digitorum longus (foot), flexor digitorum profundus, flexor digitorum superficialis, flexor hallucis brevis, flexor hallucis longus, flexor pollicis brevis, flexor pollicis longus, frontalis, gastrocnemius, inferior gemellus, superior gemellus, genioglossus, geniohyoid, gluteus maximus, gluteus medius, gluteus minimus, gracilis, hyoglossus, iliocostalis, inferior oblique, inferior rectus, infraspinatus, external intercostal muscles, innermost intercostal muscles, internal intercostal muscles, internal oblique abdominis, dorsal interossei of the hand, dorsal interossei of the foot, palmar interossei of the hand, plantar interossei of the foot, interspinales, intertransversarii, intrinsic muscles of the tongue, ischiocavernosus, lateral cricoarytenoid, lateral pterygoid, lateral rectus, latissimus dorsi, levator anguli oris, levator ani - coccygeus, levator ani - iliococcygeus, levator ani - pubococcygeus, levator ani - puborectalis, levator ani - pubovaginalis, levator labii superioris, levator labii superioris alaeque nasi, levator palpebrae superioris, levator scapulae, levator veli palatini, levator costarum, longus capitis, longus colli, lumbricals (4) of the foot, lumbricals of the hand, masseter, medial pterygoid, medial rectus, mentalis, palatoglossus, nasalis, oblique arytenoid, inferior oblique head,Superior oblique muscle, external sphincter muscle, internal sphincter muscle (A), internal sphincter muscle (B), omohyoid muscle, opponens digiti minimi (hand), opponens pollicis, orbicularis oculi, orbicularis oris, palatoglossus, palatopharyngeus, palmaris brevis, palmaris longus, pectineus, pectoralis major, pectoralis minor, peroneus brevis, peroneus longus, peroneus tertius, piriformis (A), piriformis (B), plantar fascia, platysma, popliteus, posterior cricoarytenoid, nasalis, quadratus rotundus internus, orbicularis internus, iliopsoas major, iliopsoas minor, pyramidalis, quadratus femoris, quadratus lumborum, quadratus plantae, rectus abdominis, rectus anterior, rectus lateralis, rectus capitis posterior major, rectus capitis posterior minor, rectus femoris, rhomboideus major, rhomboideus minor, risorius, salpingopharyngeus, sartorius, scalenus anterior, scalenus medius, scalenus minimus, scalenus posterior, semimembranosus, semitendinosus, serratus anterior, serratus posterior inferior, serratus posterior superior, soleus, sphincter ani, sphincter urethrae, splenius capitis, splenius cervicis, abductor digiti minimi, sternocleidomastoid, sternohyoid, sternothyroid, stylohyoid, stylohyoid (front view), stylopharyngeus, subclavius, subcostalis, subscapularis, superficial transverse perineal, superior oblique, superior rectus, lateral rectus, supraspinatus, temporalis, temporoparietalis, tensor fasciae latae, tensor tympani, tensor veli palatini, teres major, teres minor, thyroarytenoid and vocalis, thyrohyoid membrane, thyrohyoid, tibialis anterior, tibialis posterior, transverse arytenoid, transversospinalis - multifidus, transversospinalis - rotatores, transversospinalis - semispinalis, transversus abdominis, transversus thoracis, mitral valve, triceps, vastus intermedius, vastus lateralis, vastus medialis, zygomaticus major and zygomaticus minor. In some embodiments, the muscle cells or muscle tissue are smooth muscle cells or smooth muscle tissue. In various embodiments, the muscle cells or muscle tissue are selected from muscle cells or muscle tissue present in any of the following: esophagus, stomach, intestine, bronchus, uterus, urethra, bladder, blood vessel, and arrector pili muscle of the skin. In various embodiments, the muscle cells or muscle tissue include any structure or substructure that is part of a muscle including, but not limited to, the following: epimysium, muscle cell, sarcomere, tendon, fascicle, muscle fiber, perimysium, collagen, collagen fiber, muscle spindle, muscle fiber sheath, sarcoplasmic reticulum, thin filament, thick filament, Z disk, H zone, I band, A band, or M line. In some embodiments, the muscle cells or muscle tissue are healthy. In some embodiments, the muscle cells or muscle tissue are suffering from a disease or disorder.,
[0322] Muscle-related disorders, etc.: As used herein, terms such as "muscle-related disorder" and "muscle-related disease" refer to diseases or disorders related to muscle cells or tissues, including skeletal muscle cells or tissues, cardiac muscle cells or tissues, smooth muscle cells or tissues, or myoepithelial cells or tissues, or other muscle cells or tissues. In various embodiments, the present disclosure relates to methods related to compositions containing lipids and bioactive agents, where the compositions are administered to a subject suffering from a muscle-related disorder. In various embodiments, the muscle-related disorder is sarcopenia, muscle movement disorder, muscle atrophy-related disorder, muscle degeneration, muscle weakness, muscular dystrophy, Duchenne muscular dystrophy, heart failure, respiratory disorder, malnutrition, and skeletal muscle degeneration caused by disease, muscle-related diseases related to insulin-dependent signaling disorders, amyotrophic lateral sclerosis, spinal muscular atrophy, and spinal cord injury, ischemic muscle disease. In some embodiments, the muscle-related disorder includes, for example, stiff shoulders, frozen shoulder (age-related stiff shoulders), rheumatoid arthritis, myositis, neck muscle stiffness, shoulder-hand syndrome, cervical spondylosis syndrome, sprains, tenosynovitis, low back pain syndrome, skeletal muscle atrophy, etc. In some embodiments, the muscle movement disorder includes teeth grinding, periodic limb movement disorder, restless leg syndrome, muscular dystrophy, myositis, pinched nerve, peripheral nerve injury, amyotrophic lateral sclerosis, myasthenia gravis, and conditions related to one or more of herniated discs, sleep-related involuntary muscle movement disorder. In some embodiments, the muscle wasting-related disorder is a disease or condition including symptoms such as a gradual loss of muscle mass.In some embodiments, muscle wasting is due to any of a variety of causes, including genetic predisposition; age-related diseases such as hypertension, impaired glucose tolerance, diabetes, obesity, dyslipidemia, atherosclerosis, and cardiovascular disease; chronic diseases such as cancer, autoimmune diseases, infectious diseases, AIDS, chronic inflammatory diseases, arthritis, malnutrition, kidney disease, chronic obstructive pulmonary disease, emphysema, kuru, chronic lower back pain, peripheral nerve injury, central nerve injury, and chemical injury; prolonged immobilization such as in the case of non-responsive conditions like fractures or trauma, and bed rest after surgery; and the progressive decrease in the amount and strength of skeletal muscle that occurs with aging. Muscle wasting-related diseases can lead to a weakening of the physical condition, which in turn can lead to a deterioration of health and an inability to perform physical activity. In some embodiments, sarcopenia is the gradual decrease in skeletal muscle mass due to aging, which can directly cause a decrease in muscle strength and lead to a decline and impairment of various body functions. In some embodiments, muscular dystrophy is a disorder in which strength and muscle mass gradually decrease.Non-limiting examples of muscular dystrophy diseases include Becker muscular dystrophy, tibial muscular dystrophy, Duchenne muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy, sarcoglycanopathy, congenital muscular dystrophy, such as congenital muscular dystrophy due to partial LAMA2 deficiency, merosin-deficient congenital muscular dystrophy, congenital muscular dystrophy type 1D, Fukuyama-type congenital muscular dystrophy, limb-girdle type 1A muscular dystrophy, limb-girdle type 2A muscular dystrophy, limb-girdle type 2B muscular dystrophy, limb-girdle type 2C muscular dystrophy, limb-girdle type 2D muscular dystrophy, limb-girdle type 2E muscular dystrophy, limb-girdle type 2F muscular dystrophy, limb-girdle type 2G muscular dystrophy, limb-girdle type 2H muscular dystrophy, limb-girdle type 2I muscular dystrophy, limb-girdle type 2J muscular dystrophy, limb-girdle type 2K muscular dystrophy, limb-girdle type IC muscular dystrophy, myotonic dystrophy with epidermolysis bullosa simplex, oculopharyngeal muscular dystrophy, Ullrich congenital muscular dystrophy, and Ullrich scleroatonic muscular dystrophy. In some embodiments, the subject has Duchenne muscular dystrophy. In some embodiments, the muscle degeneration is caused by injury, a degenerative muscle disease or disorder, or a disease, disorder or injury to the nervous system that results in denervation of the muscle. Such diseases or disorders include, but are not limited to, for example, muscular dystrophy, myotonic dystrophy, facioscapulohumeral dystrophy, limb-girdle dystrophy, distal muscular dystrophy, or myositis, or degenerative or inflammatory muscle diseases such as diabetic neuropathy, acute transient nerve conduction disorder, nerve transection, or peripheral neuropathy associated with axonal transection.Furthermore, the methods described herein can be used to diagnose or monitor neurodegenerative diseases, particularly diseases associated with motor neuron degeneration, such as amyotrophic lateral sclerosis, spinal muscular atrophy, post-polio syndrome, infantile muscular atrophy, poliomyelitis virus infection, or Charcot-Marie-Tooth disease, or inflammatory or demyelinating nerve diseases or disorders, such as Guillain-Barré syndrome or chronic inflammatory demyelinating polyneuropathy. The methods of the present invention can be used to diagnose or monitor degeneration caused by nerve injury, such as carpal tunnel syndrome, compression, mechanical transection of the nerve, or nerve injury associated with a tumor. Furthermore, the methods disclosed herein can be utilized to diagnose nervous system tumors or non-nervous system tumors.
[0323] ncRNA: As used herein, the term "ncRNA" refers to non-coding RNA and there are several types, including but not limited to lncRNA (long non-coding RNA). In some embodiments, ncRNA is involved in the regulation of gene or protein or gene product expression. Wahlestedt 2013 Nat.Rev.Drug Disc.12:433-446. Antagonists to ncRNA have been reported. Meng et al.2015 Nature 518:409-412; and Ling et al.2013 Nature Rev.Drug Discov.12:847-865. In some embodiments, the composition contains a bioactive agent and a lipid, where the bioactive agent is a nucleic acid or other antagonist to ncRNA. In some embodiments, the composition includes a lipid and a portion of an lncRNA that can mediate at least one function of the lncRNA.
[0324] Optionally substituted: As described herein, for example, the oligonucleotides of the present disclosure may contain optionally substituted and / or substituted moieties. In general, the term "substituted", whether or not preceded by the term "optionally", means that one or more hydrogens of the designated moiety are replaced by a suitable substituent. Unless otherwise indicated, a "may be substituted" group may have a suitable substituent at each substitutable position of the group, and if two or more positions in any given structure are to be substituted with two or more substituents selected from a particular group, the substituents may be the same or different at each position. In some embodiments, the optionally substituted group is unsubstituted. Combinations of substituents contemplated by the present disclosure are preferably substituents that result in the formation of stable or chemically feasible compounds. As used herein, the term "stable" refers to a compound that is substantially unmodified when subjected to the conditions necessary for its production, detection, and in some embodiments, its recovery, purification, and use for one or more of the purposes disclosed herein. When exposed to conditions that allow it, refers to a compound that is substantially unmodified.
[0325] Suitable monovalent substituents include halogen; -(CH2) 0-4 R o ; -(CH2) 0-4 OR o ; -O(CH2) 0-4 R o , -O-(CH2) 0-4 C(O)OR°; -(CH2) 0-4 CH(OR o )2; -(CH2) optionally substituted with R° 0-4 Ph; -(CH2) optionally substituted with R° 0-4 O(CH2) 0-1 Ph; -CH=CHPh optionally substituted with R°; -(CH2) optionally substituted with R° 0-4 O(CH2) 0-1 -pyridyl; -NO2; -CN; -N3; -(CH2) 0-4 N(R o )2; -(CH2) 0-4 N(R o )C(O)R o;-N(R o )C(S)R o ;-(CH2) 0-4 N(R o )C(O)NR o 2;-N(R o )C(S)NR o 2;-(CH2) 0-4 N(R o )C(O)OR o ;-N(R o )N(R o )C(O)R o ;-N(R o )N(R o )C(O)NR o 2;-N(R o )N(R o )C(O)OR o ;-(CH2) 0-4 C(O)R o ;-C(S)R o ;-(CH2)& 0-4 C(O)OR o ;-(CH2) 0-4 C(O)SR o ;-(CH2) 0-4 C(O)OSiR o 3;-(CH2) 0-4 OC(O)R o ;-OC(O)(CH2) 0-4 SR,-SC(S)SR°;-(CH2) 0-4 SC(O)R o ;-(CH2) 0-4 C(O)NR o 2;-C(S)NR o 2;-C(S)SR°;-SC(S)SR°,-(CH2) 0-4 OC(O)NR o 2;-C(O)N(OR o )R o ;-C(O)C(O)R o ;-C(O)CH2C(O)R o ;-C(NOR o )R o ;-(CH2) 0-4 SSR o ;-(CH2) 0-4 S(O)2R o ;-(CH2) 0-4 S(O)2ORo ;-(CH2) 0-4 OS(O)2R o ;-S(O)2NR o 2;-(CH2) 0-4 S(O)R o ;-N(R o )S(O)2NR o 2;-N(R o )S(O)2R o ;-N(OR o )R o ;-C(NH)NR o 2;-P(O)2R o ;-P(O)R o 2;-OP(O)R o 2;-OP(O)(OR o )2;-SiR o 3;-OSiR o 3;-(C 1-4 (linear or branched alkylene)O-N(R o )2; or, -(C 1-4 (linear or branched alkylene)C(O)O-N(R o )2, (wherein each R o may be optionally substituted as defined below and is independently hydrogen, C 1-20 aliphatic, nitrogen, oxygen, sulfur, silicon and phosphorus independently selected from 1 to 5 heteroatoms having a C 1-20 , heteroaliphatic, -CH2-(C 6-14 aryl), -O(CH2) 0-1 (aryl), (C 6-14 aryl), -CH2-(5- to 14-membered heteroaryl ring), a 5- to 20-membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, regardless of the above definition, two o that appear independently together with the intervening atoms form a 5- to 20-membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be optionally substituted as defined below) is included.
[0326] Suitable R o The above monovalent substituent (or the ring formed by two R°s that appear independently together with the intervening atoms) is independently halogen, -(CH2) 0-2 R●, -(haloR●), -(CH2) 0-2 OH, -(CH2) 0-2 OR●, -(CH2) 0-2 CH(OR●)2; -O(haloR●), -CN, -N3, -(CH2) 0-2 C(O)R●, -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR●, -(CH2) 0-2 SR●, -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR●, -(CH2) 0-2 NR●2, -NO2, -SiR●3, -OSiR●3, -C(O)SR● 、 -(C 1-4 linear or branched alkylene)C(O)OR●, or -SSR●, (wherein each R● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and independently, C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or selected from 5- to 6-membered, saturated, partially unsaturated, or aryl rings having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur). Suitable divalent substituents on the saturated carbon atoms of R° include =O and =S.
[0327] Suitable divalent substituents are =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O-, or -S(C(R * 2)) 2-3 S-, (wherein each R that appears independently *is hydrogen, C which may be substituted as defined below 1-6 aliphatic, or unsubstituted 5- to 6-membered, saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur). Suitable divalent substituents bonded to an adjacent replaceable carbon of a "may be substituted" group are -O(CR * 2) 2-3 O-, (wherein each R * appearing independently is hydrogen, C which may be substituted as defined below 1-6 aliphatic, or unsubstituted 5- to 6-membered, saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur).
[0328] R * Suitable substituents on the aliphatic group of are halogen, -R●, -(haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2, or -NO2, wherein each R● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and independently, C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5- to 6-membered, saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0329] In some embodiments, suitable substituents on replaceable nitrogen are -R † , -NR † 2, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH2C(O)R † , -S(O)2R † , -S(O)2NR † 2, -C(S)NR † 2, -C(NH)NR † 2, or -N(R † )S(O)2R †are mentioned, where each R † is independently hydrogen, C 1-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5- to 6-membered, saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, regardless of the above definition, two independently occurring R † together with the intervening atoms form an unsubstituted 3- to 12-membered, saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0330] R † Suitable substituents on the aliphatic group of are independently halogen, -R●, -(haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2, or -NO2, where each R● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and independently, C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5- to 6-membered, saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0331] Oral: As used herein, the terms "oral administration" and "administered orally" have the meaning understood in the art and refer to oral administration of a compound or composition.
[0332] Parenteral: As used herein, the terms "parenteral administration" and "administered parenterally" have the meaning understood in the art and refer to a mode of administration usually by injection other than enteral and topical administration, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injections and infusions.
[0333] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to include groups with multiple sites of unsaturation, but is not intended to include either aryl or heteroaryl moieties.
[0334] Peptide: As used herein In some embodiments, the term "peptide" refers to a molecule that contains multiple amino acids linked together via peptide bonds. In some embodiments, peptides include dipeptides, tripeptides, oligopeptides, and polypeptides. In some embodiments, dipeptides contain 2 amino acids. Tripeptides contain 3 amino acids. And oligopeptides contain from about 2 to about 50 or more amino acids. In some embodiments, peptides contain more than about 50 amino acids. In some embodiments, polypeptides and proteins are also molecules that contain multiple amino acids linked together via peptide bonds. In some embodiments, peptides include any therapeutic peptide listed in the SATPdb database of therapeutic peptides. Singh et al. 2015 Nucl.Acids Res.doi:10.1093 / nar / gkv1114. In some embodiments, the composition includes a lipid and a portion of the peptide that can mediate at least one function of the peptide.
[0335] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage suitable for administration in a therapeutic regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those adapted for: oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, such as tablets targeted for buccal, sublingual, and systemic absorption, bolus administration, powders, granules, pastes for application to the tongue; parenteral administration, such as subcutaneous, intramuscular, intravenous, or epidural injection as a sterile solution or suspension or sustained release formulation; topical administration, such as creams, ointments, or controlled release patches or sprays applied to the skin, lung, or oral cavity; vaginal or rectal administration, such as pessaries, creams, or foaming substances; sublingual administration; intraocular administration; transdermal administration; or nasal, pulmonary, and other mucosal surface administration.
[0336] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" means within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio, and suitable for use in contact with human and animal tissue without excessive toxicity, irritation, allergic response, or other problems or complications.
[0337] Pharmaceutically Acceptable Carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or medium such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material involved in the transport or delivery of the subject compound from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials that can be used as pharmaceutically acceptable carriers include the following: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; celluloses and their derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.
[0338] Pharmaceutically Acceptable Salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds that are suitable for use in a pharmaceutical context, i.e., within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio, and suitable for use in contact with human and lower animal tissues without undue toxicity, irritation, allergic response, etc. Pharmaceutically acceptable salts are known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or formed with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed by other methods such as ion exchange using sugars. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Representative salts of alkali or alkaline earth metals include sodium, lithium, potassium, calcium, magnesium, etc.In some embodiments, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl having 1 to 6 carbon atoms, sulfonates, and arylsulfonates.
[0339] Plasmid: As used herein, the term "plasmid" refers to extrachromosomal (separate from the chromosome) lengths of DNA. Plasmids are generally circular and can generally replicate independently, although this is not the case for, for example, linear plasmids and plasmids that are unable to replicate independently (including, but not limited to, suicide vectors). In some embodiments, a plasmid is extrachromosomal under some conditions (e.g., in the laboratory), but can also integrate into the chromosome (e.g., act as a suicide vector that can integrate into the chromosome in a cell or subject). Plasmids are present in nature in many organisms, including bacteria and some eukaryotic organisms, are commonly engineered to carry genes within organisms, and are artificially manufactured. Plasmids are generally double-stranded, or can be single-stranded, or partially single-stranded and double-stranded, or have other strand-forming properties. Artificial plasmids are commonly used in genetic engineering. Examples of plasmids include, but are not limited to, plasmids that can encode or express nucleic acids such as mRNA, RNAi agents or their precursors, antagonists to another nucleic acid (including, but not limited to, antagonists to miRNA, RNAi agents, mRNA, etc.) or their precursors, or other nucleic acids with therapeutic benefit. The additional portions of the plasmid are optional and may include one or more copies of any one or more components selected from the following: genes encoding proteins related to replication, origins of replication, genes encoding replication initiation proteins, replication origin enhancers, genes encoding nucleic acids with therapeutic benefit (or their precursors), one or more promoters, one or more transcription enhancers, one or more transcription terminators, one or more marker genes (e.g., genes encoding resistance to antibiotics, or genes encoding enzymes required for survival and / or growth under certain experimental conditions). In some embodiments, the plasmid is a suicide vector. A suicide vector may lack any of the following: an origin of replication, a gene encoding a DNA replication initiation protein, or any other component required for independent replication.In some embodiments, the two plasmids may be physically separated, but they produce products that act synergistically. For example, one plasmid may encode a gene for a transcriptional enhancer that enhances the transcription of a gene encoded on the other plasmid. In another example, one plasmid may comprise a gene encoding a DNA replication initiation protein that initiates replication at the origin of DNA replication on the other plasmid. A variety of plasmids are known in the art. In some embodiments, the composition comprises a lipid and a portion of a plasmid that can mediate at least one function of the plasmid.
[0340] Protecting group: As used herein, the term "protecting group" is known in the art and is described in Protecting Groups in Organic Synthesis, T.W. Greene and P.G.M. Wuts, 3 rdincludes protecting groups as detailed in the 1999 edition, John Wiley & Sons. This document is hereby incorporated by reference in its entirety. Also included are protecting groups that are particularly suitable for nucleoside and nucleotide chemistry as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al., 06 / 2012. The entire Chapter 2 of this document is hereby incorporated by reference. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC ) 1 - adamantyl (Adoc) carbamate, vinyl (Voc) carbamate, allyl (Alloc) carbamate, 1 - isopropylallyl (Ipaoc) carbamate, cinnamyl (Coc) carbamate, 4 - nitrocinnamyl (Noc) carbamate, 8 - quinolinyl carbamate, N - hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl (Cbz) carbamate, p - methoxybenzyl (Moz) carbamate, p - nitrobenzyl carbamate, p - bromobenzyl carbamate, p - chlorobenzyl carbamate, 2,4 - dichlorobenzyl carbamate, 4 - methylsulfinylbenzyl (Msz) carbamate, 9 - anthrylmethyl carbamate, diphenylmethyl carbamate, 2 - methylthioethyl carbamate, 2 - methylsulfonylethyl carbamate, 2 - (p - toluenesulfonyl)ethyl carbamate, [2 - (1,3 - dithianyl)]methyl (Dmoc) carbamate, 4 - methylthiophenyl (Mtpc) carbamate, 2,4 - dimethylthiophenyl (Bmpc) carbamate, 2 - phosphonioethyl (Peoc) carbamate, 2 - triphenylphosphonioisopropyl (Ppoc) carbamate, 1,1 - dimethyl - 2 - cyanoethyl carbamate, m - chloro - p - acyloxybenzyl carbamate, p - (dihydroxyboryl)benzyl carbamate, 5 - benzisoxazolylmethyl carbamate, 2 - (trifluoromethyl) - 6 - chromonylmethyl (Tcroc) carbamate, m - nitrophenyl carbamate, 3,5 - dimethoxybenzyl carbamate, o - nitrobenzyl carbamate, 3,4 - dimethoxy - 6 - nitrobenzyl carbamate, phenyl(o - nitrophenyl)methyl carbamate, phenothiazinyl - (10) - carbonyl derivative, N’ - p - toluenesulfonylaminocarbonyl derivative, N’ - phenylaminothiocarbonyl derivative, t - amyl carbamate, S - benzyl thiocarbamate, p - cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p - decyloxybenzyl carbamate, 2,2 - dimethoxycarbonylvinyl carbamate, o - (N,Benzyl (N,N-dimethylcarboxamide), 1,1-Dimethyl-3-(N,N-dimethylcarboxamide)propyl carbamate, 1,1-Dimethylpropynyl carbamate, Di(2-pyridyl)methyl carbamate, 2-Furanylmethyl carbamate, 2-Iodoethyl carbamate, Isobornyl carbamate, Isobutyl carbamate, Isonicotinyl carbamate, p-(p'-Methoxyphenylazo)benzyl carbamate, 1-Methylcyclobutyl carbamate, 1-Methylcyclohexyl carbamate, 1-Methyl-1-cyclopropylmethyl carbamate, 1-Methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-Methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-Methyl-1-phenylethyl carbamate, 1-Methyl-1-(4-pyridyl)ethyl carbamate, Phenyl carbamate, p-(Phenylazo)benzyl carbamate, 2,4,6-Tri-t-butylphenyl carbamate, 4-(Trimethylammonium)benzyl carbamate, 2,4,6-Trimethylbenzyl carbamate, Formamide, Acetamide, Chloroacetamide, Trichloroacetamide, Trifluoroacetamide, Phenylacetamide, 3-Phenylpropanamide, Picolinamide, 3-Pyridylcarboxamide, N-Benzoylphenylalanyl derivative, Benzamide, p-Phenylbenzamide, o-Nitrophenylacetamide, o-Nitrophenoxyacetamide, Acetoacetamide, (N'-Dithiobenzyl oxycarbonylamino)acetamide, 3-(p-Hydroxyphenyl)propanamide, 3-(o-Nitrophenyl)propanamide, 2-Methyl-2-(o-nitrophenoxy)propanamide, 2-Methyl-2-(o-phenylazophenoxy)propanamide, 4-Chlorobutanamide, 3-Methyl-3-nitrobutanamide, o-Nitrocinnamide, N-Acetylmethionine derivative, o-Nitrobenzamide, o-(Benzoyloxymethyl)benzamide, 4,5-Diphenyl-3-oxazolin-2-one, N-Phthalimide, N-Dithiasuccinimide (Dts), N-2,3-Diphenylmaleimide, N-2,5-Dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitropyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrroline-3-yl)amine, quaternary ammonium salt, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberlylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivative, N-diphenylboronic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphine amide (Dpp), dimethylthiophosphine amide (Mpt), diphenylthiophosphine amide (Ppt), dialkyl phosphoramidate, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide are mentioned.,
[0341] Suitably protected carboxylic acids include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), as well as 2- and 4-picolyl.
[0342] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyl-oxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxymethyl, 1-(2-chloroethoxy)methyl, 1-methyl-1-methoxymethyl, 1-methyl-1-benzyloxymethyl, 1-methyl-1-benzyloxy-2-fluoromethyl, 2,2,2-trichloromethyl, 2-trimethylsilylmethyl, 2-(phenylselenyl)methyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-1, (0-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), trimethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), dimethylisopropylsilyl (DEIPS), dimethyltexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xyluylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoyl formate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenyl propionate, 4-oxovalerate (levulinate), 4,4-(methylenedithio)valeric acid (levulinoyl dithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenyl benzoate, 2,4,6-trimethylbenzoate (mesitoate), alkylmethyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkylmethyl carbonate, 2,2,2-trichloroalkyl carbonate (Troc), 2-(trimethylsilyl)methyl carbonate (TMSEC), 2-(phenylsulfonyl)methyl carbonate (Psec), 2-(triphenylphosphonio)methyl carbonate (Peoc), alkylisobutyl carbonate, alkylvinyl carbonate, alkylallyl carbonate, alkyl p-nitrophenyl carbonate, alkylbenzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methyl valerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)methyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichlorophenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butanoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N’,N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzyl sulfonate, and tosylate (Ts). For the protection of 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidine orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N’-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanilidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronic esters, ethyl borate, and phenyl borate.,
[0343] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl groups.
[0344] In some embodiments, the phosphite protecting group is a group added to the internucleotide phosphite linkage throughout the oligonucleotide synthesis. In some embodiments, the phosphite protecting group is added to the sulfur atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphite protecting group is added to the oxygen atom of the internucleotide phosphorothioate linkage. In some embodiments, the phosphite protecting group is added to the oxygen atom of the internucleotide phosphate linkage. In some embodiments, the phosphite protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.
[0345] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked together by peptide bonds). In some embodiments, the protein comprises only naturally occurring amino acids. In some embodiments, the protein comprises one or more non-naturally occurring amino acids (e.g., moieties that form one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues in the protein chain comprise non-amino acid moieties (e.g., glycan, others). In some embodiments, the protein comprises two or more polypeptide chains linked, for example, by one or more disulfide bonds or associated by other means. In some embodiments, the protein comprises L-amino acids, D-amino acids, or both. In some embodiments, the protein comprises one or more amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, others. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a characteristic portion thereof.
[0346] Ribozyme: As used herein, the term "ribozyme" refers to a catalytic RNA that functions as an enzyme but does not require a protein for the catalytic reaction. In some embodiments, the ribozyme is a self-processing RNA that catalyzes RNA cleavage and ligation reactions. In some embodiments, the substrate recognition domain of the ribozyme is artificially engineered to stimulate site-specific cleavage in cis (the same nucleic acid strand) or in trans (non-covalently bound nucleic acids). Scherer et al. 2003 Nat Biotechnol. 21:1457-1465. In some embodiments, in vitro selection is performed on the ribozyme and it is directed to evolve for improved properties as a therapeutic and diagnostic reagent and to acquire new functions. In some embodiments, the ribozyme is engineered to be allosterically activated by an effector molecule, thereby leading to the development of artificial "riboswitches" as biosensors and synthetic biology tools. Wieland et al. 2010 Chem Biol. 17:236-242; Liang et al. 2011 Mol Cell. 43:915-926. In some embodiments, the ribozyme is derived from a "hammerhead type" or "hairpin / paperclip type" motif. In some embodiments, the ribozyme may be delivered to target cells in the form of RNA or transcribed from a therapeutic gene. In some embodiments, the ribozyme is chemically modified using any one or more of the following modifications: 5'-PS backbone linkage, 2'-O-Me, 2'-deoxy-2'-C-allyluridine, and terminal inverted deoxyabasic nucleotides. A non-limiting example of a ribozyme is Angiozyme (RPI.4610), which targets the mRNA of vascular endothelial growth factor receptor-1 (VEGFR-1) and inhibits angiogenesis and tumor growth. Kobayashi et al. 2005 Cancer Chemother Pharmacol. 56:329-336; Weng et al. 2005 Mol Cancer Ther. 4:948-955.Other non-limiting examples of ribozymes include Heptazyme, which is a synthetic ribozyme against hepatitis C virus (HCV). Sandberg et al. 2001 Hepatology 34:333a-333a; Tong et al. 2002 Hepatology 3. 6:360a-360a; Berk 2006 Hepatology 43:S13-S30. In some embodiments, ribozymes that target any of the following are also included: VEGFR-1, HCV IRES, HIV U5 and pol, HIV Tat and Vpr, CCR5, HIV Tat and Rev. In some embodiments, the composition includes a lipid and a portion of the ribozyme that can mediate at least one function of the ribozyme.
[0347] RNAi agent: As used herein, the term "RNAi agent" refers to a molecule capable of mediating RNA interference. This term encompasses various natural and artificial structures capable of mediating RNA interference, as well as various structures and forms including, but not limited to, siRNA (including those of the "canonical" structure). As used herein, the term "RNA interference" or "RNAi" refers to a post-transcriptional target gene silencing technology, which is a technology that uses an RNAi agent to degrade messenger RNA (mRNA) containing a sequence identical or very similar to the RNAi target. See the following: Zamore and Haley, 2005, Science, 309, 1519-1524; Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., PCT International Patent Application Publication WO 00 / 44895; Fire, PCT International Patent Application Publication WO99 / 32619; Mello and Fire, PCT International Patent Application Publication WO01 / 29058, etc. The process of RNAi occurs naturally when long dsRNA is introduced into a cell and cleaved by ribonuclease III (Dicer) into short fragments called siRNA. Naturally produced siRNA is often about 21 nucleotides in length and contains a double-stranded (the "canonical" structure) of about 19 base pairs with two 2-nt overhangs. One strand of the siRNA has been reported to be incorporated into the RNA-induced silencing complex (RISC). This strand (known as the antisense strand or guide strand) guides the RISC to the complementary mRNA. Subsequently, one or more nucleases in the RISC mediate the cleavage of the target mRNA, generating silencing. Cleavage of the target RNA has been reported to occur in the middle of the region complementary to the antisense strand.See the following: Nykanen, et al. 2001 Cell 107:309; Sharp et al. 2001 Genes Dev. 15:485; Bernstein, et al. 2001 Nature 409:363; Elbashir, et al. 2001 Genes Dev. 15:188. As various non-limiting examples, RNAi agents include the following: siRNA (including, but not limited to, those with a canonical structure), shRNA, miRNA, sisiRNA, meroduplex RNA (mdRNA), DNA-RNA chimeras, siRNA containing two mismatches (or more mismatches), neutral siRNA, aiRNA, or siRNA containing a terminal or internal spacer (e.g., 18mer-form siRNA). In various non-limiting examples, the RNAi agent is shRNA (small hairpin RNA or short hairpin RNA), which has been reported to form a tight hairpin turn and contain an RNA sequence that silences a target via RISC like siRNA. Thus, antisense and sense strands linked by a hairpin have been reported. shRNA has been reported to be expressed, for example, via plasmid delivery or via a viral or bacterial vector. Various types of shRNA have been reported in the art. See, for example: Xiang et al. 2006. Nature Biotech. 24:697-702; Macrae et al. 2006 Science 31 1:195-8. Lombardo et al. 2007. Nature Biotech. 25:1298-1306; Wang et al. 2011. Pharm.Res. 28:2983-2995; Senzer et al. 2011 Mol.Ther. 20:679-686. In various non-limiting examples, the RNAi agent is miRNA (microRNA), which has also been reported to be a small RNA molecule (approximately 22nt) that silences a target via RISC like siRNA. Native miRNA is encoded by the nuclear DNA of eukaryotic cells.miRNAs are refined by post-transcriptional RNA processing, function through base pairing with complementary sequences within mRNA molecules, and typically result in translational repression or target degradation or gene silencing. The human genome has been reported to encode over 1000 miRNAs, which can target approximately 60% of mammalian genes and are abundant in many human cell types. Various types of natural miRNAs, as well as artificial derivatives of miRNAs, have been reported in the art. See, for example: Lewis et al. 2003. Cell 115:787-798; Lim et al. 2003. Genes Dev. 17:991-1008; He et al. 2004. Nat. Rev. Genet. 5:522-31; Bentwich et al. 2005. Nat. Genet. 37:766-70; Lewis et al. 2005. Cell 120:15-20; Kusenda et al. 2006. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 150:205-15; Zhang et al. 2006. J. Gen. Gen. 36:1-6; Brodersen et al. 2008. Science 320:1185-90; Friedman et al. 2009. Genome Res. 19(1):92-105; Bartel 2009. Cell 136(2):215-33. In various non-limiting examples, the RNAi agent is a sisiRNA (small internally segmented interfering RNA), in which case the sense strand contains at least one single-stranded break (nick). This break reduces the uptake of the sense strand into the RISC complex, thereby reducing off-target effects. See: WO2007 / 107162. In various non-limiting examples, it is a DNA-RNA chimera, in which case the seed portion of each strand is DNA while the remaining portion of each strand is RNA. See: Yamato et al. 2011 Cancer Gene Ther. 18:587-597.In various non-limiting examples, the RNAi agent is an siRNA containing two mismatches, and in this case the molecule is reported to contain three short double-stranded regions. In one embodiment of this RNAi agent, the guide (antisense) strand is 22mer, while the sense strand is 20mer (only one 2nt overhang is generated on the 3' end of the antisense strand). The two mismatches are reported to generate double-stranded regions of 6, 8, and 4bp. See the following: US Patent Application 2009 / 0209626. In various embodiments, the RNAi agent is a neutral siRNA, and the negative charge of its phosphate backbone is reversibly hidden. Meade et al. 2014 Nat. Biotech. 32:1256-1261. In various non-limiting examples, the RNAi agent is an aiRNA (asymmetrical interfering RNA) containing a sense strand shorter than 19nt, whereby the antisense strand is preferentially incorporated into RISC and the off-target effect is reported to be reduced. In various embodiments of this RNAi agent, the antisense strand is 21nt in length, while the sense strand is only 15 or 16nt in length. See the following: Sun et al. 2008 Nature Biotech. 26:1379-1382; and Chu and Rana. 2008 RNA 14:1714-1719. In various non-limiting examples, the RNAi agent is an siRNA containing a terminal spacer or an internal spacer (e.g., an 18mer form of siRNA), and is reported to contain a shorter strand than a canonical siRNA, in which case the strand contains an internal spacer or a terminal spacer such as, for example, ribitol or other types of non-nucleotide spacers. See the following: WO2015 / 051366.In some embodiments, the RNAi agent includes those targeting any of the following: miR-122, VEGF, VEGF-R1, RTP801, caspase 2, KRT6A (N171K), ADRB2, TRPV1, Syk kinase, RSV nucleocapsid, beta-catenin, KRASG12D, Apo B, PLK1, KSP and VEGF, TTR, Bcr-Abl, PKN3, P53, RRM2, Furin and GM-CSF, LMP2, LMP7, MECL1, HIV Tat and Rev. In some embodiments, the composition contains a lipid and a portion of the RNAi agent that can mediate at least one function of the RNAi agent.
[0348] Sample: As used herein, "sample" is a particular organism or a substance obtained therefrom. In some embodiments, the sample is a biological sample obtained from or derived from a subject source as described herein. In some embodiments, the subject source contains an organism such as an animal or a human. In some embodiments, the biological sample contains biological tissue or a body fluid. In some embodiments, the biological sample is bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy sample; cell-containing body fluid; cell-free nucleic acid; sputum; saliva; urine; cerebrospinal fluid, ascites; pleural effusion; feces; lymph fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; lavage or wash fluid such as catheter wash or bronchoalveolar lavage fluid; aspirate; scrape; bone marrow specimen; tissue biopsy specimen; surgical specimen; feces, other body fluids, secretions, and / or excretions; and / or cells derived therefrom or containing the same. In some embodiments, the biological sample is or contains cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the subject source by any suitable means. For example, in some embodiments, the primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluids (e.g., blood, lymph fluid, feces, etc.). In some embodiments, as is apparent from the context, the term "sample" refers to a preparation obtained by processing the primary sample (e.g., by removing one or more of its components and / or adding one or more agents thereto). For example, filtration using a semi-permeable membrane. Such "processed sample" may contain nucleic acids or proteins extracted from the sample, or nucleic acids or proteins obtained by performing techniques such as amplification or reverse transcription of, for example, mRNA, isolation and / or purification of a component, etc. on the primary sample. In some embodiments, the sample is an organism. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is an organism other than a human.
[0349] Small molecule: As used herein, a "small molecule," or a "low molecular weight molecule," or a "LMW molecule." Terms such as "small molecule" refer to molecules having a relatively low molecular weight. As non-limiting examples, small molecules include molecules with molecular weights of less than about 7500, 7000, 6000, 5000, 4000, 3000, 2500, 2000, 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100. In some embodiments, the small molecule is a bioactive agent and inhibits or reduces the target gene or the product level, product, and / or activity of the target gene. Examples of small molecules include, but are not limited to, small organic molecules (e.g., Cane et al. 1998. Science 282:63) and natural product extract libraries. In another embodiment, the small molecule is a small organic non-peptide compound. In some embodiments, the small molecule inhibitor inhibits or reduces the target gene or the product level, product, and / or activity of the target gene directly or indirectly. In some embodiments, a composition comprises a lipid and a portion of a small molecule that can mediate at least one function of the small molecule.
[0350] Small nucleolar RNA (snoRNA): As used herein, the terms "small nucleolar RNA", "snoRNA" and the like refer to any of a class of small RNA molecules that induce, for example, chemical modification of other RNAs. In some embodiments, snoRNAs can induce chemical modification of other RNAs, including ribosomal RNA, transfer RNA, and small nuclear RNA. In some embodiments, snoRNAs are reported to have two major classes, C / D box snoRNAs involved in methylation and H / ACA box snoRNAs involved in pseudouridylation.
[0351] Splice Switching Oligonucleotide (SSO): As used herein, the term "splice switching oligonucleotide" or "SSO" refers to an oligonucleotide that can alter the splicing of messenger ribonucleic acid precursor (pre-mRNA). In non-limiting examples, an SSO can bind to a 5' or 3' splicing junction, or can bind to a splicing enhancer or silencing site. By doing so, an SSO can modify splicing in various ways, such as alternative exon usage, exon exclusion, or exon inclusion. In various embodiments, an SSO can skip an exon, and in other examples, can inhibit exon skipping. Crooke 2004 Curr. Mol. Med. 4:465-487; Bennett et al. 2010 Ann. Rev. Pharmacol. Toxicol. 50:259-293; and Kole et al. 2012 Nat. Rev. Drug Discov. 11:125-140. Non-limiting examples of SSOs are oligonucleotides that have been reported to be able to mediate exon skipping of dystrophin messenger ribonucleic acid precursor (pre-mRNA). A non-limiting example of an SSO is WV-942. Non-limiting examples of SSOs are oligonucleotides that can inhibit exon skipping of SMN2 messenger ribonucleic acid precursor. See Rigo et al. 2012 J. Cell Biol. 199:21-25; and Kaczmarek et al. 2015 Exp. Opin. Exp. Drugs 24:867-881. In some embodiments, the composition comprises a lipid and a portion of a snoRNA that can mediate at least one function of the snoRNA. In some embodiments, the SSO switches splicing in a gene associated with a muscle-related disorder. In some embodiments, the SSO can skip an exon or mediate exon skipping, where a mutation in the exon is associated with a muscle-related disorder.In some embodiments, the SSO can inhibit exon skipping or mediate inhibition of exon skipping, wherein the mutation in the exon is associated with a muscle-related disorder. In some embodiments, the SSO can effect or mediate exon skipping in the dystrophin gene. In some embodiments, the SSO can effect or mediate skipping of exon 51, 45, 53, or 44 in the dystrophin gene. In some embodiments, the SSO can inhibit exon skipping or mediate inhibition of exon skipping in a gene associated with SMA. In some embodiments, the SSO can inhibit exon skipping or mediate inhibition of exon skipping in the SMN2 gene. In some embodiments, the SSO can inhibit exon 7 skipping or mediate inhibition of exon 7 skipping in the SMN2 gene.
[0352] Stereochemical isomers: As used herein, the terms "stereochemical isomers" and "stereoisomers" refer to different compounds having different three-dimensional structures composed of the same atoms bonded by the same sequence of bonds, which are not interchangeable. In some embodiments of the present invention, the provided chemical composition may be or may contain a pure preparation of an individual stereochemical isomer of the compound. In some embodiments, the provided chemical composition may be or may contain a mixture of two or more stereochemical isomers of the compound. In one embodiment, such a mixture contains equal amounts of different stereochemical isomers. In one embodiment, such a mixture contains different amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may contain all of the diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may contain not all of the diastereomers and / or enantiomers of the compound. In some embodiments, when a particular enantiomer of the compound of the present invention is desired, the obtained mixture of diastereomers can be separated and the auxiliary group can be cleaved to obtain the desired enantiomer in pure water, for example, by asymmetric synthesis or by induction using a chiral auxiliary group. Alternatively, when the molecule contains a basic functional group such as an amino group, a diastereomeric salt is formed using an appropriate optically active acid and resolved, for example, by fractional recrystallization. In some embodiments, a stereorandom composition contains two or more stereoisomers.
[0353] Subjects and Related Terms: As used herein, the terms "subject," "human subject," "test subject," and related terms refer to any organism to which a compound or composition being provided is administered for, e.g., experimental, diagnostic, prophylactic, and / or therapeutic purposes, in accordance with the present invention. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; others) and plants. In some embodiments, the subject may be afflicted with and / or susceptible to a disease, disorder, and / or condition. In some embodiments, the subject is a human or another mammal. In some embodiments, the subject may be male or female. By way of non-limiting example, an animal is a vertebrate such as, e.g., a primate, rodent, livestock, or game animal. By way of non-limiting example, primates include chimpanzees, squirrel monkeys, spider monkeys, and macaque monkeys such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamster...
Claims
【Claim 1】 A composition comprising a lipid and a bioactive agent.