Chitin-based composite
Cross-linking chitin-binding proteins in a chitin-based composite addresses the strength limitations of chitin materials, resulting in a durable material suitable for diverse applications.
Patent Information
- Application Number
- JP2024006319
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-01-18
- Publication Date
- 2025-07-31
AI Technical Summary
Chitin-based materials suffer from low mechanical strength, limiting their utilization in various technical fields.
A chitin-based composite is formed by cross-linking chitin-binding proteins via covalent bonds, utilizing proteins with specific amino acid sequences and cross-linking enzymes like laccase or peroxidase to enhance mechanical strength.
The composite exhibits significantly improved mechanical strength, making it suitable for applications requiring enhanced durability.
Smart Images

Figure 2025112174000004 
Figure 2025112174000005 
Figure 2025112174000006
Abstract
Description
Technical Field
[0001] The present invention relates to a chitin-based composite.
Background Art
[0002] Chitin is a nitrogen-containing polysaccharide polymer formed by the linkage of a large number of N-acetyl-D-glucosamine units. Since chitin is a natural polymer obtained from insects, shrimps, crabs, etc., it is known as a material with excellent biocompatibility and biodegradability, and is used in various technical fields such as the pharmaceutical field of artificial skin, surgical sutures, artificial dialysis membranes, various therapeutic aids, etc., the industrial fields of fibers, cosmetics, daily necessities, wastewater treatment, photographic films, dyes, paper making, biodegradable plastics, etc., and the agricultural fields of soil conditioners, fertilizers, pollution-free pesticides, feeds, etc. For example, in the medical field, non-woven fabrics of chitin fibers having an epidermal cell growth promoting effect (Patent Document 1), cotton-like substances of chitin (Patent Document 2), etc. are used as wound covering and protecting materials.
[0003] However, materials using chitin alone have the disadvantage of low strength. In order to expand the utilization range of chitin, which is a natural resource, the development of chitin materials with improved strength has been demanded.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Patent Document 2
Summary of the Invention
Problems to be Solved by the Invention
[0005] An object of the present invention is to provide a chitin-based composite having improved mechanical strength.
Means for Solving the Problems
[0006] To solve the above problems, as a result of intensive research by the present inventors, it has been found that in a complex containing chitin and a plurality of chitin-binding proteins, and in which the chitin-binding proteins are cross-linked to each other, the mechanical strength is improved.
[0007] The present invention has been completed based on these findings, and includes inventions in the broad aspects shown below. Item 1. A complex comprising chitin and a plurality of chitin-binding proteins bound to the chitin, wherein at least a part of the plurality of chitin-binding proteins are cross-linked to each other via a covalent bond. Item 2. The cross-linking is a cross-linking between tyrosine in one chitin-binding protein and tyrosine in another chitin-binding protein, or a cross-linking derived from an oxide of catecholamines bound to histidine or lysine in the chitin-binding protein, the complex according to Item 1. Item 3. Each of the plurality of chitin-binding proteins is a protein consisting of an amino acid sequence containing 10 to 20% tyrosine in the full-length amino acid sequence, and / or a protein consisting of an amino acid sequence containing 10 to 20% histidine and lysine in total in the full-length amino acid sequence, the complex according to Item 1. Item 4. The chitin-binding protein is any one of the following proteins (1) to (3): the complex according to Item 1: (1) A protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, (2) A protein containing an amino acid sequence in which one or several amino acids are substituted, added, or deleted in a motif involved in chitin binding in the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity, (3) A protein containing an amino acid sequence having 20% or more identity with the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity. Item 5. The complex is a sheet-like complex in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet, and the maximum stress obtained by displacing the center of the complex having a width of 5 mm, a length of 15 mm, and a thickness of 0.2 mm by 0.5 mm to 1 mm in a three-point bending test exceeds 0.20 N. The complex according to claim 1. Item 6. The complex is a sheet-like complex in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet, and the stress obtained by displacing the center of the complex having a width of 5 mm, a length of 15 mm, and a thickness of 0.2 mm by 0.5 mm to 1 mm in a three-point bending test is 2 times or more as compared with the maximum stress required to displace the complex without the crosslinking by 1 mm. The complex according to claim 1. Item 7. A method for producing a complex according to any one of claims 1 to 6, comprising crosslinking at least a part of a plurality of chitin-binding proteins in a complex containing chitin and a plurality of chitin-binding proteins bound to the chitin via a covalent bond with each other.
Advantages of the Invention
[0008] According to the present invention, a chitin-based complex with improved mechanical strength can be provided.
Brief Description of the Drawings
[0009]
Figure 1
Figure 2
Figure 3
Figure 4
Mode for Carrying Out the Invention
[0010] The present invention provides a complex comprising chitin and a plurality of chitin-binding proteins bound to the chitin. At least a part of the plurality of chitin-binding proteins in the complex has a structure in which they are cross-linked to each other via covalent bonds.
[0011] The method for obtaining the chitin used in the present invention is not particularly limited. For example, it may be obtained by removing calcium, protein, etc. from crustaceans such as insects, shrimps, and crabs, or it may be a commercially available product. Also, either α-chitin or β-chitin can be used.
[0012] The form of the chitin is not particularly limited. For example, it may be in any form such as fibrous, granular, flaky, sheet-like, or powdery. From the viewpoint of improving strength, it is preferably fibrous. Even if the fibrous chitin forms a non-woven fabric and becomes sheet-like, it is acceptable.
[0013] The molecular weight of the chitin is not particularly limited, but for example, it is preferably about 5,000 to 1,000,000, and more preferably about 10,000 to 500,000.
[0014] The chitin-binding protein is not particularly limited as long as it has chitin-binding activity, and examples include Cpr76, Cpr92F, Cp62Bc, BMCP30, HCCP12, etc., and their homologs. A protein containing an amino acid sequence having one or several substitutions, additions, insertions, or deletions in the motif related to chitin binding (search site for functional sequence motif: chitin_bind_4 defined by Pfam = Pfam00379) (Rebers and Willis, 2001)) in the amino acid sequence of the above-listed proteins, and having chitin-binding activity, or a protein having an amino acid sequence having a sequence identity of, for example, 20% or more, preferably 50% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, particularly preferably 99% or more with respect to the amino acid sequence of the above-listed proteins, and having chitin-binding activity is also included.
[0015] From the viewpoint that the intermolecular cross-linking reaction by the cross-linking enzyme easily proceeds, the chitin-binding protein is preferably a protein consisting of the amino acid sequence of the following (i) and / or (ii). Hereinafter, unless otherwise specified, the ratio of a specific amino acid in the amino acid sequence refers to the ratio of the number of the specific amino acid in the total number of amino acids constituting the amino acid sequence. (i) An amino acid sequence containing a total of 10 to 20% of histidine and lysine in the full-length amino acid sequence. (ii) An amino acid sequence containing 10 to 20% of tyrosine in the full-length amino acid sequence.
[0016] Examples of the chitin-binding protein satisfying (i) and / or (ii) include Cpr76, Cpr92F, Cp62Bc, BMCP30, HCCP1, etc., and their homologs.
[0017] The total content ratio of histidine and lysine in the chitin-binding protein is preferably 10 to 30%, more preferably 20 to 30%. Also, the content ratio of tyrosine in the chitin-binding protein is preferably 10 to 20%, more preferably 15 to 30%.
[0018] The chitin-binding protein is preferably any one of the following proteins (1) to (3). (1) A protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, (2) A protein containing an amino acid sequence in which one or several amino acids are substituted, added, or deleted in the motif related to chitin binding (chitin_bind_4 defined by Pfam = Pfam00379) in the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity, (3) A protein containing an amino acid sequence having 20% or more identity with the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity.
[0019] In the above (1), the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 is Cpr76 contained in the exoskeleton of Drosophila melanogaster, an insect. The protein consisting of the amino acid sequence represented by SEQ ID NO: 2 is Cpr92F contained in the exoskeleton of Drosophila melanogaster, an insect. The amino acid sequences of Cpr76 and Cpr92F are shown in FIG. 1.
[0020] In the above (2), the number of one or several amino acids to be substituted, deleted, added, or inserted is not particularly limited as long as it is an integer of 1 or more. For example, it can be about 1 to several tens, preferably about 1 to 30, more preferably about 1 to 15, still more preferably about 1 to 10, and particularly preferably about 1 to 5.
[0021] In the above (3), the identity of the amino acid sequence can be 20% or more, preferably 50% or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, and particularly preferably 99% or more. The identity of the amino acid sequence can be less than 100%. The identity between amino acid sequences can be determined using known algorithms such as BLAST. Proteins containing an amino acid sequence having an identity of 20% or more with the amino acid sequence represented by SEQ ID NO: 1 or 2 and having chitin-binding activity are included.
[0022] In one aspect, in the nucleotide sequence encoding the chitin-binding protein, the number of one or more nucleotides to be substituted, added or deleted is such that it does not impair the chitin-binding motif contained in the amino acid sequence represented by SEQ ID NO: 1 or 2. With respect to the nucleotide sequence encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, it can be about 1 to 30, preferably about 1 to 26 so that the sequence identity is 95% or more, more preferably about 1 to 10 so that the identity is 98% or more, and particularly preferably about 1 to 5 so that the identity is 99% or more.
[0023] The method for obtaining the chitin-binding protein is not particularly limited, and it may be cell-derived or obtained from in vitro translation. The cell-derived protein may be an endogenous protein or an overexpressed protein in the cell. Also, commercially available products may be used.
[0024] When using an endogenous protein, it can be obtained from, for example, silkworms, beetles, locusts, etc.
[0025] When overexpressing a chitin-binding protein intracellularly, known methods can be used without particular limitation. For example, it can be carried out by introducing a vector for overexpressing a protein into cells and synthesizing the protein intracellularly. The cells used are not particularly limited, and examples include cells derived from mammals such as humans, mice, and rats, and Escherichia coli. Examples of such overexpression vectors include plasmid vectors and viral vectors. As methods for introducing an overexpression vector into cells, known gene introduction methods such as the calcium phosphate method, lipofection method, DEAE dextran method, electroporation method, microinjection method, and virus infection method can be mentioned. The protein overexpressed intracellularly is preferably a fusion protein having a tag such as GST, His, FLAG, HA, Myc, etc. By having such a tag, it becomes easier to isolate the protein. The types of cells, vectors, promoters, and tags for overexpression, the method of introducing the vector, etc. can be appropriately selected by those skilled in the art.
[0026] Also, when extracting a chitin-binding protein from cells, known methods can be used without particular limitation. For example, it can be extracted from a cell lysate. Such methods include, for example, a method of lysing cells with a buffer containing a surfactant such as NP40 or Triton. The protein may be further isolated from the obtained cell lysate. Methods for isolating the protein include, for example, an isolation method using an antigen-antibody reaction, an immobilized metal ion affinity chromatography method, and a method using a carrier such as sepharose.
[0027] Regarding in vitro translation, it can be carried out using known methods such as the TNT T7 Quick Coupled Transcription / Translation System (Promega) and PUREfrex (Gene Frontier).
[0028] In the composite of the present invention, from the viewpoint of improving strength, it is preferable that the chitin-binding protein is contained in an amount of 5 to 10 parts by mass, more preferably 10 to 20 parts by mass, per 100 parts by mass of chitin.
[0029] Regarding the cross-linking of chitin-binding proteins, it is not particularly limited as long as two or more chitin-binding proteins are cross-linked via a covalent bond. The cross-linking may be such that functional groups in two or more chitin-binding proteins directly form a covalent bond, or may be bonded via a polyvalent (for example, divalent, trivalent, tetravalent, etc.) linker.
[0030] In addition to the chitin-binding proteins that bind to chitin and are cross-linked to each other via a covalent bond, the composite of the present invention may include chitin-binding proteins that do not directly bind to chitin but bind to chitin via cross-linking with other chitin-binding proteins.
[0031] Examples of the cross-linking method include enzymatic cross-linking, thermal cross-linking, cross-linking with aldehydes (for example, formaldehyde, glutaraldehyde, etc.), cross-linking with condensing agents (for example, carbodiimide, cyanamide, etc.), photo-cross-linking, and the like. Among these, enzymatic cross-linking is preferable from the viewpoint that the cross-linking reaction easily proceeds under mild conditions.
[0032] The enzyme that can be used for cross-linking is not particularly limited as long as it has a cross-linking action between proteins. Examples include peroxidase, laccase, transglutaminase, tyrosinase, and the like. Commercially available products of these enzymes can be used.
[0033] In one embodiment, peroxidase is used as the cross-linking enzyme. Peroxidase generates active oxygen such as superoxide anion from peroxide, and the generated active oxygen causes oxidative cross-linking (dityrosine cross-linking) of the tyrosine side chain as follows.
[0034]
Chemical formula
[0035] The origin of the peroxidase used in this embodiment is not particularly limited. For example, it includes bovine liver, horse blood cells, human blood cells, M. lysodeikticus, Japanese horseradish, soybean, radish, turnip, thyroid gland, milk, intestine, white blood cells, red blood cells, yeast, Caldariomyces fumago, Steptococcus faecalis, etc. Also, as commercially available products, for example, Japanese horseradish peroxidase (product number: 165 - 10793, manufactured by Fujifilm Wako Pure Chemical Corporation), peroxidase (from Japanese horseradish) (product number: 303 - 50991, manufactured by Oriental Yeast Co., Ltd.), peroxidase (SIGMA: SLCK5549), etc. can be used.
[0036] In another embodiment, laccase is used as the cross - linking enzyme. Laccase can catalyze the oxidation of various phenolic compounds to generate free radical species. The reactive free radicals can further undergo non - enzymatic polymerization or react with high redox potential substrate targets such as amino acid residues of proteins.
[0037] When using laccase as a cross-linking enzyme, catecholamines can be used as substrates for the oxidation reaction by laccase. Examples of catecholamines include N-acetyl dopamine (NADA), N-β-alanyl dopamine (NBAD), dopa, dopamine, adrenaline, noradrenaline, etc. After catecholamines are oxidized by laccase, a model has been proposed that the oxide can react with nucleophilic amino acid residues such as histidine and lysine in chitin-binding proteins, enabling cross-linking with multiple chitin-binding proteins. As models of the binding mode, it has been proposed that proteins are cross-linked in the form of "amino acid residue"-"catecholamine oxide"-"amino acid residue", or cross-linking between catecholamine oxides also occurs. Regarding the structure of catecholamines, in more detail, a model has been proposed in which covalent bonds occur at any site of the aromatic ring part, the α-carbon of the side chain, or the β-carbon, or multiple sites simultaneously (Andersen, 2010; Asano, 2023). Such cross-linking is cross-linking via the oxide of catecholamines by laccase, and the group derived from catecholamines serves as a polyvalent (e.g., divalent, trivalent, tetravalent, etc.) linker between chitin-binding proteins.
[0038]
Chemical formula
[0039] The origin of the laccase used in this embodiment is not particularly limited. Examples include insects such as silkworms and stag beetles, plants such as lacquer trees, mushrooms (such as earthstars and shiitake mushrooms), and fungi (such as Polyporus vericolor). As commercially available products, for example, laccase (derived from Myceliophthora thermophila, manufactured by Novozymes), laccase (derived from SIGMA: Trametes versicolor), etc. can be used.
[0040] In another embodiment, transglutaminase is used as the crosslinking enzyme. Transglutaminase catalyzes an acyl transfer reaction between the γ-carboxamide group of a glutamine residue and the ε-amino group of a lysine residue in a protein, forming a crosslink between the glutamine residue and the lysine residue.
[0041] Regarding the crosslinking between intermolecular chitin-binding proteins, there is no particular limitation as long as two or more chitin-binding proteins are crosslinked via a covalent bond. The crosslinking may be such that functional groups in two or more chitin-binding proteins directly form a covalent bond, or may be bonded via a polyvalent (e.g., divalent, trivalent, tetravalent, etc.) linker.
[0042] Among the multiple chitin-binding proteins in the complex of the present invention, the higher the proportion of those that form crosslinks with another chitin-binding protein, the greater the mechanical strength of the complex. The proportion of chitin-binding proteins in the complex that form crosslinks with another chitin-binding protein is not particularly limited, but is preferably 50% or more, more preferably 80% or more, based on the total number of chitin-binding proteins.
[0043] The degree of crosslinking of a chitin-binding protein with another chitin protein is preferably about 1 to 10 sites per molecule of chitin-binding protein, more preferably about 5 to 20 sites. This includes cases where crosslinking occurs at one or more sites between two chitin-binding proteins.
[0044] Also, the chitin-binding proteins in the complex of the present invention may form the above-described crosslinks within a single chitin-binding protein.
[0045] In one embodiment, chitin is provided in the form of a sheet containing chitin, and the composite is a sheet-like composite in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet. The chitin-containing sheet may be a sheet containing chitin fibers, and such a sheet may be produced by a known method, or any shape created using a 3D printer or the like may be used. Commercially available products may also be used. Preferably, the chitin-binding protein is bound to 80% or more, 90% or more, or 100% of the total surface area of the surface of the chitin-containing sheet. The details of chitin, chitin-binding protein, and cross-linking between chitin-binding proteins are as described above. Such a sheet composite has better mechanical strength than a sheet having non-crosslinked chitin-chitin-binding protein. Such a sheet composite has mechanical strength at least comparable to that of a sheet of chitin alone, and may even have better mechanical strength than a sheet of chitin alone. The thickness of the sheet is not particularly limited, but is, for example, 50 μm to 1 mm.
[0046] In one embodiment, the composite is a sheet-like composite in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet, and the maximum stress obtained by displacing the center of the composite having a width of 5 mm, a length of 15 mm, and a thickness of 0.2 mm by 0.5 mm to 1 mm exceeds 0.20 N.
[0047] In one embodiment, the composite is a sheet-like composite in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet, and the maximum stress required to displace the composite by 0.5 mm to 1 mm is at least twice that required to displace the composite without the cross-linking by 0.5 mm to 1 mm.
[0048] In one embodiment, the composite is a sheet-like composite in which a plurality of chitin-binding proteins are bound to the surface of the chitin-containing sheet, and the maximum stress required to displace the composite by 0.5 mm to 1 mm is 2.5 times or more that required to displace the composite without the cross-linking by 0.5 mm to 1 mm.
[0049] The method for producing the complex of the present invention is not particularly limited as long as it is a method in which at least some of the chitin-binding proteins among the plurality of chitin-binding proteins in the complex containing chitin and a plurality of chitin-binding proteins bound to chitin are cross-linked via a covalent bond.
[0050] The complex containing chitin and a plurality of chitin-binding proteins bound to chitin can be produced by various known methods.
[0051] The step of binding chitin and a chitin-binding protein (step (i)) can be carried out, for example, by immersing chitin in an aqueous solution of the chitin-binding protein. The concentration of the aqueous solution of the chitin-binding protein is preferably 1 to 10 mg / ml, more preferably 5 to 10 mg / ml. The aqueous solution of the chitin-binding protein may contain additives such as solubilizing agents such as urea and guanidine; and buffering agents such as Tris hydrochloride and phosphate as required. The pH of the aqueous solution of the chitin-binding protein is preferably 6 to 9, more preferably 7 to 8. The reaction temperature is preferably 4 to 30°C.
[0052] Regarding the step of cross-linking at least a part of the plurality of chitin-binding proteins in the complex containing chitin and a plurality of chitin-binding proteins bound to chitin via a covalent bond with each other (step (ii)), it can be carried out by reacting a cross-linking enzyme or the like with the reactant of the above step (i).
[0053] In one embodiment, when peroxidase is used as the crosslinking enzyme, the reaction of step (i) can be carried out by immersing the reactant in an aqueous solution containing peroxidase and hydrogen peroxide. The concentration of peroxidase in the aqueous solution is appropriately adjusted according to the amount of chitin-binding protein bound to chitin, and is not particularly limited, but is preferably 0.1 to 10 U / μL, and more preferably 0.5 to 5 U / μL. Further, per 1 g of chitin-binding protein, the amount of peroxidase is preferably 10 to 1000 U, and more preferably 50 to 1000 U. Note that the unit "U" representing enzyme activity can be calculated from the amount of enzyme required for a predetermined reaction. For peroxidase, the amount of enzyme when oxidizing 1 mg of pyrogallin at pH 6.0 (20 °C) is defined as "1 U".
[0054] The concentration of hydrogen peroxide is appropriately adjusted according to the amount of chitin-binding protein bound to chitin, and is not particularly limited, but is preferably 0.01 to 1%, and more preferably 0.1 to 1%. Further, per 1 g of chitin-binding protein, the amount of hydrogen peroxide is preferably 0.06 to 6 mmol, and more preferably 0.6 to 3 mmol.
[0055] The above aqueous solution may contain additives such as buffers such as phosphates as required. The pH is preferably 6 to 9, and more preferably 7 to 8. The reaction temperature is preferably 4 to 30 °C. The reaction time is preferably 1 to 24 hours, and more preferably 5 to 15 hours.
[0056] In another embodiment, when using laccase as the cross-linking enzyme, the reaction in step (i) can be carried out by immersing the reactant in an aqueous solution containing laccase and catecholamines. The concentration of laccase in the aqueous solution is appropriately adjusted according to the amount of chitin-binding protein bound to chitin, and is not particularly limited, but is preferably 0.01 to 10 U / μL, and more preferably 0.1 to 10 U / μL. Also, per 1 g of chitin-binding protein, the amount of laccase is preferably 200 U or more, and more preferably 500 U or more. Note that the enzyme activity of laccase is defined as "1 U" as the amount of enzyme when oxidizing 1 μg of catechol at pH 5.0.
[0057] As the catecholamines, those listed above are preferably used. The concentration of catecholamines is appropriately adjusted according to the amount of chitin-binding protein bound to chitin, and is not particularly limited, but is preferably 0.1 to 10 mM, and more preferably 2 to 5 mM. Also, per 1 g of chitin-binding protein, the amount of catecholamines is preferably 3 to 300 μmol, and more preferably 60 to 300 μmol.
[0058] The above aqueous solution may contain additives such as buffers such as phosphates as necessary. The pH is preferably 5 to 7, and more preferably 6 to 7. The reaction temperature is preferably 4 to 30°C. The reaction time is preferably 1 to 24 hours, and more preferably 5 to 15 hours.
[0059] The complex of the present invention obtained as described above can be used after washing with a buffer such as phosphate and drying as necessary.
[0060] Figure 2 is an example of a manufacturing scheme for the composite of the present invention. First, a chitin-binding protein is bound to a commercially available chitin sheet (step (i)). Next, a complex containing chitin and a plurality of chitin-binding proteins bound to the chitin is reacted with laccase, which is a cross-linking enzyme, to cross-link at least a part of the plurality of chitin-binding proteins via covalent bonds with each other (step (ii)). The cross-linking of the chitin-binding proteins in the complex can be confirmed by the reaction of laccase with catecholamine added as a substrate.
[0061] The composite of the present invention has extremely excellent mechanical strength as compared with a single chitin or a composite composed of chitin and a chitin-binding protein that does not have a cross-linked structure. Therefore, the composite of the present invention is expected to be applied as a plastic alternative material or the like.
Examples
[0062] Hereinafter, the present invention will be further described with reference to Examples and Comparative Examples, but it goes without saying that the present invention is not limited to these Examples.
[0063] <Synthesis of chitin-binding protein in Escherichia coli> Cpr76 and Cpr92F, which are one type of chitin-binding protein, were synthesized using Escherichia coli by the following method.
[0064] Total RNA extracted from Drosophila pupae using TRIzol was used as a template, and reverse transcription reaction was performed using oligo dT as a primer. Here, Primescript Super Mix III (Thermo) was used for the reaction. PCR reaction was performed using the obtained cDNA as a template to amplify DNA fragments having sequences encoding Cpr76 and Cpr92F. The primers used were as follows. Cpr76> Forward: AGAAGGAGATATACCATGCATGGTGGACACGCCACCAGCTAC (SEQ ID NO: 3) Reverse: AGTGGTGGTGGTGGTGGTGGCTGCTGTGCAGCTGCTTCACGCTTACGTA (SEQ ID NO: 4) Cpr92F> Forward: AGAAGGAGATATACCATGCACGGAGCCGTCTCCACACAGTAC (SEQ ID NO: 5) Reverse: AGTGGTGGTGGTGGTGGTGGCTGCTATAGTGGTCATAGTGCGCGTGGTA (SEQ ID NO: 6) The obtained fragment was Forward: AGCAGCCACCACCACCACCACCACTGAGATCC (SEQ ID NO: 7) Reverse: CATGGTATATCTCCTTCTTAAAG (SEQ ID NO: 8) Subcloned into the linearized pet28 vector amplified with two primers of
[0065] using infusion (TAKARA BIO).
[0066] Using the obtained plasmid, Escherichia coli (BL21 strain) was transformed, and the synthesis was induced with IPTG to synthesize the target protein in Escherichia coli. The pellet of Escherichia coli containing the target protein was suspended in 0.1 M Tris-HCl buffer (pH 7.5, containing 0.15 M NaCl), sonicated, and then centrifuged at 10,000 x g to remove the residue. Ni-NTA (Fuji film) was suspended in the supernatant and reacted at 25°C for 12 hours, and then the protein bound was eluted with 0.1 M Tris-HCl buffer (pH 7.5, containing 0.15 M NaCl) containing 0.3 M imidazole.
[0067] <Example 1> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) containing 5 mg / ml of Cpr76 synthesized above, 1 M of urea, and 0.15 M of NaCl at 25°C for 12 hours to bind Cpr76 to chitin. Thereafter, the Cpr76-bound chitin sheet was immersed in a potassium phosphate buffer solution (pH 6.2) containing 2 U / μL of laccase and 5 mM of N-acetyl dopamine at 25°C for 12 hours to carry out a cross-linking reaction. Thereafter, the sheet was washed with a potassium phosphate buffer solution and placed in a plastic petri dish to dry.
[0068] <Example 2> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) containing 5 mg / ml of Cpr76 synthesized above, 1 M of urea, and 0.15 M of NaCl at 25°C for 12 hours to bind Cpr76 to chitin. Thereafter, the Cpr76-bound chitin sheet was immersed in a potassium phosphate buffer solution (pH 6.2) containing 10 U / μL of peroxidase and 0.5% of hydrogen peroxide at 25°C for 12 hours to carry out a cross-linking reaction. Thereafter, the sheet was washed with a potassium phosphate buffer solution and dried.
[0069] <Example 3> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) containing 5 mg / ml of Cpr92F synthesized above and 0.15 M of NaCl at 25°C for 12 hours to bind Cpr92F to chitin. Thereafter, the Cpr92F-bound chitin sheet was immersed in a potassium phosphate buffer solution (pH 6.2) containing 2 U / μL of laccase and 5 mM of N-acetyl dopamine at 25°C for 12 hours to carry out a cross-linking reaction. Thereafter, the sheet was washed with a potassium phosphate buffer solution and dried.
[0070] <Example 4> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) in which 5 mg / ml of the synthesized Cpr92F and 0.15 M of NaCl were dissolved at 25°C for 12 hours to bind Cpr92F to chitin. Thereafter, the Cpr92F-bound chitin sheet was immersed in a potassium phosphate buffer solution (pH 6.2) in which 10 U / μL of peroxidase and 0.5% of hydrogen peroxide were dissolved at 25°C for 12 hours to conduct a crosslinking reaction. Thereafter, the sheet was washed with a potassium phosphate buffer solution and dried.
[0071] <Comparative Example 1> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) in which 5 mg / ml of the synthesized Cpr76, 1 M of urea, and 0.15 M of NaCl were dissolved at 25°C for 12 hours to bind Cpr76 to chitin. Thereafter, the sheet was washed with a Tris-HCl buffer solution and dried.
[0072] <Comparative Example 2> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was immersed in a 0.1 M Tris-HCl buffer solution (pH 7.5) in which 5 mg / ml of the synthesized Cpr92F and 0.15 M of NaCl were dissolved at 25°C for 12 hours to bind Cpr92F to chitin. Thereafter, the sheet was washed with a Tris-HCl buffer solution and dried.
[0073] <Comparative Example 3> The chitin sheet (BES-CHITIN W, manufactured by Nipro Corporation) was used for a three-point bending test without treatment.
[0074] <Three-point Bending Test> A three-point bending test was conducted on each of the dried sheets obtained in Examples 1 to 4 and Comparative Examples 1 to 2, and the chitin sheet of Comparative Example 3.
[0075] Under the following conditions, each test piece was measured three times. For the maximum stress obtained, the average value of the three results is shown. As the measurement direction, pressure was applied in the direction in which the indenter contacts at a right angle to the long side.
[0076] Measuring instrument: For Autograph 50N (manufactured by Shimadzu Corporation) Dimensions of test piece: 5 mm in length × 15 mm in width × 0.2 mm in height (thickness) Test speed: 1 mm / min Span distance: 2 mm Radius of indenter: 0.1 mm Radius of fulcrum: 0.1 mm
[0077]
Table 1
[0078] The results are shown in Figure 3, Figure 4, and Table 1. By comparing the results of Examples 1 and 2 and Comparative Example 1 in Figure 3, and by comparing the results of Examples 3 and 4 and Comparative Example 2 in Figure 4, it can be seen that the maximum stress increases when the chitin-binding protein is reacted with laccase or peroxidase in the chitin-chitin-binding protein complex as compared with the complex without the enzyme reaction. This is presumably because the histidine residues, lysine residues, and tyrosine residues contained in the chitin-binding protein are crosslinked by the reactions catalyzed by laccase and peroxidase, respectively. Furthermore, from Table 1, it can be seen that for Examples 1, 3, and 4, the maximum stress is higher than that of the chitin monomer of Comparative Example 3.
Claims
1. A complex comprising chitin and a plurality of chitin-binding proteins bound to the chitin, wherein at least a part of the plurality of chitin-binding proteins are cross-linked to each other via a covalent bond.
2. The cross-linking is a cross-linking between tyrosine in one chitin-binding protein and tyrosine in another chitin-binding protein, or a cross-linking derived from an oxide of catecholamines bound to histidine or lysine in the chitin-binding protein. The complex according to claim 1.
3. Each of the plurality of chitin-binding proteins is a protein consisting of an amino acid sequence containing 10 to 20% tyrosine in the full-length amino acid sequence, and / or a protein consisting of an amino acid sequence containing 10 to 20% histidine and lysine in total in the full-length amino acid sequence. The complex according to claim 1.
4. The chitin-binding protein is any one of the following proteins (1) to (3). The complex according to claim 1: (1) A protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, (2) A protein containing an amino acid sequence in which one or several amino acids are substituted, added, or deleted in the motif involved in chitin binding in the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity, (⑶) A protein containing an amino acid sequence having 20% or more identity with the amino acid sequence represented by SEQ ID NO: 1 or 2, and having chitin-binding activity.
5. The complex is a sheet-like complex in which a plurality of chitin-binding proteins are bound to the surface of the sheet containing the chitin. The maximum stress obtained by displacing the center of the complex having a width of 5 mm, a length of 15 mm, and a thickness of 0.2 mm by 0.5 mm to 1 mm in a three-point bending test exceeds 0.20 N. The complex according to claim 1.
6. The complex is a sheet-like complex in which a plurality of chitin-binding proteins are bound to the surface of the sheet containing the chitin. The stress obtained by displacing the center of the complex having a width of 5 mm, a length of 15 mm, and a thickness of 0.2 mm by 0.5 mm to 1 mm in a three-point bending test is 2 times or more compared to the maximum stress required to displace the complex without the cross-linking by 1 mm. The complex according to claim 1.
7. The method for producing a complex according to any one of claims 1 to 6, comprising cross-linking at least a part of a plurality of chitin-binding proteins in a complex comprising chitin and a plurality of chitin-binding proteins bound to the chitin via covalent bonds with each other.
Citation Information
Patent Citations
Wound covering protective material
JP1986240963A
Web of chitin
JP1992371161A