Nucleic acid-polypeptide compositions and methods of inducing exon skipping
Polynucleic acid molecule conjugates with 2' modified nucleotides and inverted abasic moieties correct missplicing in mRNA transcripts, producing functional proteins and treating diseases like muscular dystrophy.
Patent Information
- Application Number
- JP2025073667
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-09-22
- Filing Date
- 2025-04-25
- Publication Date
- 2025-08-05
AI Technical Summary
Existing therapeutic agents fail to effectively modulate RNA processing to treat diseases caused by misspliced mRNA transcripts, leading to dysfunctional proteins.
Development of polynucleic acid molecule conjugates with 2' modified nucleotides and inverted abasic moieties that induce exon skipping or inclusion in misspliced mRNA transcripts, enhancing protein function.
The conjugates promote the production of functional proteins by correcting missplicing errors in mRNA transcripts, effectively treating diseases such as muscular dystrophy and other genetic disorders.
Smart Images

Figure 2025114635000001_ABST
Abstract
Description
[Technical Field]
[0001] cross reference This application is a continuation of U.S. Provisional Patent Application No. 62 / 561,939, filed September 22, 2017. No. 62 / 443,514, filed January 6, 2017. The benefit of each of the above documents is claimed, each of which is incorporated herein by reference in its entirety. be absorbed.
[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format. , which is incorporated herein by reference in its entirety. Created December 22, 2017 A copy of the above ASCII code is in the file 45532-715_601_SL.txt The name is 210,534 bytes in size. [Background technology]
[0003] Regulation of RNA function is a developing area of therapeutic interest. Drugs that affect mRNA stability, such as nucleotides and small interfering RNAs, disrupt RNA function. Another group of oligonucleotides is one way to modulate the activity of the final gene product: to include or exclude specific regions of the pre-mRNA from the encoded protein. By altering pre-mRNA processing, RNA function can be modulated. Thus, oligonucleotide therapeutics offer a means of modulating protein expression in disease states. and therefore have utility as therapeutic agents. Summary of the Invention
[0004] Provided herein, in certain embodiments, are molecules and methods for modulating RNA processing. and pharmaceutical compositions are disclosed.
[0005] As used herein, in one embodiment, a subject's misspliced mRNA A method of treating a disease or disorder caused by a transcript is disclosed, the method comprising: administering to a subject a polynucleic acid molecule conjugate, wherein the polynucleic acid molecule conjugate is conjugated to a target binding moiety, wherein the polynucleotide optionally has at least one 2' modification nucleotide, at least one modified internucleotide bond, or at least one The polynucleic acid molecule conjugate comprises two inverted abasic moieties, wherein the polynucleic acid molecule conjugate is capable of transporting fully processed mRNA. exons in the mRNA transcript that are incorrectly spliced to produce the mis-spliced to induce kipping or exon inclusion Induce insertions, deletions, duplications, or modifications of mRNA transcripts, and The resulting processed mRNA transcript encodes a functional protein, thereby enhancing the function of the subject. In some embodiments, the disease or disorder further comprises treating the m In some embodiments, the disease or Disorders include neuromuscular disorders, genetic disorders, cancer, hereditary disorders, or cardiovascular diseases. In some embodiments, the disease or disorder is muscular dystrophy. In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In this study, exon skipping was performed on exons 8, 23, 35, 43, and 44 of the DMD gene. , 45, 50, 51, 52, 53, or 55. In some embodiments, In this case, exon skipping is of exon 23 of the DMD gene. In embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, at least one 2' modified nucleotide is a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-amino Propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2' -O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl Oxyethyl (2'-O-DMAEOE) or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotides. In some embodiments, at least Other 2' modified nucleotides include locked nucleic acid (LNA), ethylene nucleic acid (ENA), Alternatively, it comprises a peptide nucleic acid (PNA). In some embodiments, at least one In some embodiments, the 2' modified nucleotide comprises a morpholino. In some embodiments, at least one inverted base portion is at least one terminal. At least one modified internucleotide linkage is a phosphorothioate or dithioate linkage. In some embodiments, the polynucleic acid molecule comprises at least about 10 to about 10 phosphate linkages. In some embodiments, the polynucleic acid molecule is about 15 to 30 nucleotides in length. to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 20 to about 22 In some embodiments, the polynucleic acid molecule is at least one nucleotide in length. At least about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 In some embodiments, the polynucleic acid molecule comprises at least one of the following: including: about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about About 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: from about 10% to about 90% modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 50% to about 90% modification, about 60% to about 90% modification, about 70% to about 90% modification, % to about 90% modification, and about 80% to about 100% modification. In the polynucleic acid molecule, the polynucleic acid molecule contains at least one of the following: about 10% to about 80% modifications, about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 80% modification , about 50% to about 80% modified, about 60% to about 80% modified, and about 70% to about 80% modified. In some embodiments, the polynucleic acid molecule comprises at least one of the following: About 10% to about 70% modified, about 20% to about 70% modified, about 30% to about 70% modification, about 40% to about 70% modification, about 50% to about 70% modification, and about 60% In some embodiments, the polynucleic acid molecule comprises at least one of the following: including: about 10% to about 60% modification, about 20% to about 60% modification, about 30% to about 60% modification, about 40% to about 60% modification, and about 50% to about 60% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: from about 10% to about 50% modification, about 20% to about 50% modification, about 30% to about 50% modification, and about 4 0% to about 50% modifications. In some embodiments, the polynucleic acid molecule comprises at least the following: Also included are: about 10% to about 40% modification, about 20% to about 40% modification, and about 3 0% to about 40% modifications. In some embodiments, the polynucleic acid molecule comprises at least the following: Also included are: about 10% to about 30% modifications, and about 20% to about 30% modifications. In some embodiments, the polynucleic acid molecule contains about 10% to about 20% modifications. In some embodiments, the polynucleic acid molecules are from about 15% to about 90%, from about 20% to about 80%, from about Some embodiments include 30% to about 70%, or alternatively, about 40% to about 60% modifications. In the present invention, the polynucleic acid molecule is at least about 15%, 20%, 30%, 40%, 50%, 60%, %, 70%, 80%, 90%, 95%, or 99% modification. In the present invention, the polynucleic acid molecule is at least about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 1 0, approx. 11, approx. 12, approx. 13, approx. 14, approx. 15, approx. 16, approx. 17, approx. 18, approx. 19, approx. 2 In some embodiments, the polynucleic acid molecule comprises 0, about 21, or about 22 or more modifications. , at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11 , about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21 In some embodiments, the modified nucleotides are about 22 or more. In some embodiments, the polynucleic acid molecule comprises a single strand. In some embodiments, the polynucleic acid molecule comprises a double-stranded polynucleic acid molecule. To generate the first polynucleotide, a first polynucleotide is hybridized to the first polynucleotide. In some embodiments, the second polynucleotide In some embodiments, the first polynucleotide and and the second polynucleotide is an RNA molecule. The nucleotide and the second polynucleotide are siRNA molecules. In this embodiment, X and Y are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, In some embodiments, X is a single bond. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, Y is a C1-C6 alkyl group. , optionally conjugated to a C1-C6 alkyl group, a homobifunctional linker or a heterobifunctional In some embodiments, Y is a homobifunctional linker or In some embodiments, the binding moiety is an antibody or a binding In some embodiments, the antibody or binding fragment thereof is Humanized antibodies or binding fragments thereof, chimeric antibodies or binding fragments thereof, monoclonal antibodies Clonal antibodies or binding fragments thereof, monovalent Fab', divalent Fab2, single chain variable fragments (scFv), diabodies, minibodies, nanobodies antibody, single domain antibody (sdAb), or camelid antibody, or a binding fragment thereof In some embodiments, C is polyethylene glycol. In some embodiments, A-C has a molecular weight of about 5,000 Da. X is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In some cases, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In embodiments, AX, YC, or a combination thereof is conjugated to an internucleotide linkage group. In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or A. In some embodiments, D is a group of formula (IV): (II) conjugated to a molecular conjugate, (AXBYCc )-LD Formula IV During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker; Y consists of a single bond or a second linker; L consists of a single bond or a third linker; D consists of an endosomolytic moiety, and c is an integer between 0 and 1, wherein the polynucleotide comprises at least one 2'-modified nucleotide, at least one or at least one inverted abasic moiety, and and D is conjugated to any position of A, B, or C. In some embodiments, D is INF7 or melittin. In some embodiments, L is a homobifunctional alkyl group. In some embodiments, the method further comprises: and at least a second binding moiety A. In some embodiments, at least a second The linking moiety A is conjugated to A, B, or C.
[0006] In some embodiments, exons in misspliced mRNA transcripts misspliced to induce exon skipping or exon inclusion Methods for inducing insertions, deletions, duplications, or modifications of the encoded mRNA transcript are described herein. The method is disclosed in the document, wherein the method comprises the steps of: contacting a target cell with a polynucleic acid molecule conjugate, The polynucleotide may comprise at least one 2'-modified nucleotide, at least one modified a bond containing an internucleotide bond or at least one inverted abasic moiety and an exonuclease mis-spliced proteins to induce exon skipping or exon inclusion target cells to induce insertions, deletions, duplications, or modifications of the encoded mRNA transcripts. Hybridization of polynucleic acid molecule conjugates to incorrectly spliced mRNA transcripts within the The process of splicing mis-spliced mRNA transcripts to produce protein functions. The fully processed mRNA of the previous step can encode the form In some embodiments, the step of translating the transcript into a functional form of protein. In some embodiments, the target cell is a target cell of a subject. The resulting mRNA transcripts further induce a disease or disorder. In some cases, the disease or disorder is further characterized by one or more mutations in the mRNA. In some embodiments, the disease or disorder is a neuromuscular disease, a genetic disease, cancer, a hereditary disease, or In some embodiments, the disease or disorder is muscular dystrophy or cardiovascular disease. In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In some embodiments, exon skipping is performed on the DMD gene. Exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 In some embodiments, exon skipping is performed on an exon of the DMD gene. In some embodiments, the polynucleic acid molecule conjugate is of formula (I): The structure of AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In some embodiments, at least one 2' modified nucleotide is a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-amino Propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2' -O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl Oxyethyl (2'-O-DMAEOE) or 2'-ON-methylacetamide (2'-O-NMA) modified nucleotides. In some embodiments, at least Other 2' modified nucleotides include locked nucleic acid (LNA), ethylene nucleic acid (ENA), In some embodiments, at least one 2' modified In some embodiments, the modified nucleotide comprises a morpholino. In some embodiments, the inverted base portion is at least one terminal. The two modified internucleotide bonds are phosphorothioate and dithiophosphate bonds. In some embodiments, the polynucleic acid molecule is at least about 10 to about 30 nucleotides. In some embodiments, the polynucleic acid molecule is about 15 to about 30 , about 18 to about 25, about 18 to about 24, about 19 to about 23, about 20 to about 22 nucleosides In some embodiments, the polynucleic acid molecule is at least one of or about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides In some embodiments, the polynucleic acid molecule comprises at least one of the following: : about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100 % modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to from about 60% to about 100% modification; from about 70% to about 100% modification; About 80% to about 100% modification, and about 90% to about 100% modification. In embodiments, the polynucleic acid molecules comprise at least one of the following: about 10% to about 90% modified, about 20% to about 90% modified, about 30% to about 90% modified, about 40% to about 90 % modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to about 90% modification, and about 80% to about 100% modification. In some embodiments, The polynucleic acid molecule comprises at least one of the following: about 10% to about 80% modifications, about 20% to about about 30% to about 80% modified, about 40% to about 80% modified, about 50% to about 80% modified % to about 80% modification, about 60% to about 80% modification, and about 70% to about 80% modification. Modifications. In some embodiments, the polynucleic acid molecule comprises at least one of the following: 0% to about 70% modification, about 20% to about 70% modification, about 30% to about 70% modification, About 40% to about 70% modification, about 50% to about 70% modification, and about 60% to about 70% modification. 0% modification. In some embodiments, the polynucleic acid molecule comprises at least one of the following: : about 10% to about 60% modified, about 20% to about 60% modified, about 30% to about 60% modified modified, about 40% to about 60% modified, and about 50% to about 60% modified. In embodiments, the polynucleic acid molecules comprise at least one of the following: about 10% to about 50% modified, about 20% to about 50% modified, about 30% to about 50% modified, and about 40% to In some embodiments, the polynucleic acid molecule comprises at least one of the following: Contains: about 10% to about 40% modified, about 20% to about 40% modified, and about 30% to In some embodiments, the polynucleic acid molecule comprises at least one of the following: Contains: about 10% to about 30% modifications, and about 20% to about 30% modifications. In some embodiments, the polynucleic acid molecule contains about 10% to about 20% modifications. In some embodiments, the polynucleic acid molecules are from about 15% to about 90%, from about 20% to about 80%, from about 30% to about 90%. In some embodiments, the amino acid sequence comprises from about 40% to about 70%, or from about 40% to about 60% modifications. , the polynucleic acid molecule is at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, %, 80%, 90%, 95%, or 99% modification. , the polynucleic acid molecule may be at least about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 1 1, approx. 12, approx. 13, approx. 14, approx. 15, approx. 16, approx. 17, approx. 18, approx. 19, approx. 20, approx. 2 In some embodiments, the polynucleic acid molecule comprises at least one, about 22, or more modifications. All are approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12. , about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 In some embodiments, the polynucleotide comprises 1 or more modified nucleotides. A nucleic acid molecule comprises a single strand. In some embodiments, a polynucleic acid molecule comprises two or more strands. In some embodiments, the polynucleic acid molecule comprises a double-stranded polynucleic acid molecule. To achieve this, a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide are used. In some embodiments, the second polynucleotide comprises at least In some embodiments, the first polynucleotide and the second polynucleotide comprise at least one modification. In some embodiments, the first polynucleotide is an RNA molecule. The nucleotide and the second polynucleotide are siRNA molecules. wherein X and Y are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, or or a non-polymeric linker group. In some embodiments, X is a single bond. In some embodiments, X is a C1-C6 alkyl group. In some embodiments, X is optionally Homobifunctional or heterobifunctional linkers conjugated to C1-C6 alkyl groups In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the binding moiety is an antibody or a binding fragment thereof. In some embodiments, the antibody or binding fragment thereof is a humanized antibody. antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody monovalent Fab', bivalent Fab2, single chain variable fragment scFv, diabody, minibody, nanobody, single Includes domain antibodies (sdAb), or camelid antibodies, or binding fragments thereof. In some embodiments, C is polyethylene glycol. and C has a molecular weight of about 5,000 Da. In some embodiments, AX is In some embodiments, Y is conjugated to the 5' end of B, and YC is conjugated to the 3' end of B. -C is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In this case, AX, YC, or a combination thereof is conjugated to the internucleotide linkage group. In some embodiments, the method further comprises D. In some embodiments, D is C or or conjugated to A. In some embodiments, D is a group of formula (II) according to formula (IV): conjugated to a molecular conjugate of (AXBYC c )-LD Formula IV During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker; Y is a single bond or a second linker; L consists of a single bond or a third linker; D consists of an endosomolytic moiety, and c is an integer between 0 and 1, wherein the polynucleotide comprises at least one 2'-modified nucleotide, at least one or at least one inverted abasic moiety, and and D is conjugated to any position of A, B, or C. In some embodiments, D is INF7 or melittin. In some embodiments, L is a homobifunctional alkyl group. In some embodiments, the method further comprises: and at least a second binding moiety A. In some embodiments, at least a second In some embodiments, the method comprises conjugating the binding moiety A to A, B, or C. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method. In some embodiments, the subject is a human.
[0007] In some embodiments, the method comprises administering to the subject a therapeutically effective amount of ... Pharmaceutical compositions comprising the selected molecules and a pharmaceutically acceptable excipient are disclosed. In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. Therefore, the pharmaceutical composition may be administered parenterally, orally, intranasally, bucally, rectally, or is formulated for transdermal administration.
[0008] In certain embodiments, the composition obtained by any one of the methods disclosed herein is Disclosed herein are kits that include the
[0009] In certain embodiments, compositions comprising the polynucleic acid molecule conjugates disclosed herein are and the polynucleic acid molecule conjugate has at least 60 sequences corresponding to SEQ ID NO: 54-972. %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99%, or 100% sequence identity. In certain embodiments, compositions comprising the polynucleic acid molecule conjugates disclosed herein are wherein the polynucleic acid molecule conjugate has a sequence similar to at least SEQ ID NO: 54-972. 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% % sequence identity. The polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker. In certain embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, at least one 2'-modified nucleotide is a morpholino, 2'- O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2' -O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxy Ethyl (2'-O-DMAEOE) or 2'-ON-methylacetamide (2' In one embodiment, at least one 2'-O-NMA modified nucleotide is Modified nucleotides include morpholinos.
[0010] In certain embodiments, a method for treating a disease or disorder is disclosed herein, The method includes administering to a subject a polynucleic acid molecule conjugate, wherein the polynucleic acid molecule conjugate is administered to a target cell. a cell-binding portion and a targeted pre-mRNA-specific splice regulatory polynucleic acid portion. The target cell binding portion specifically binds to the targeted cell, and the targeted mRNA A precursor A-specific splice regulatory polynucleic acid portion is inserted into the target to generate an mRNA transcript. to induce splicing events in the targeted pre-mRNA transcript. Insertions, deletions, duplications, or deletions of targeted pre-mRNA transcripts in the target cells The mRNA transcripts are expressed in a manner comparable to that of the same protein in untreated target cells. The modified protein is then compared to the target gene, thereby treating the disease or disorder in the subject. In some embodiments, the splicing event is exon skipping. In some embodiments, the splicing event is an exon inclusion. In some cases, the disease or disorder is further characterized by one or more mutations in the pre-mRNA. In certain embodiments, the disease or disorder is a neuromuscular disease, a genetic disease, a cancer, a hereditary disease, or In certain embodiments, the disease or disorder is muscular dystrophy. In one embodiment, the disease or disorder is Duchenne muscular dystrophy. In one embodiment, the splicing event is in exons 8, 23, 35 of the DMD gene. , 43, 44, 45, 50, 51, 52, 53, or 55. In some embodiments, the splicing event is in exon 23 of the DMD gene. In morphology, splicing events occur in exons of the PAH, MSTN, or K-Ras genes. In one embodiment, the polynucleic acid molecule conjugate comprises a structure of formula (I): AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker. In certain embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (II): AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, the polynucleic acid molecule conjugate comprises a structure of formula (III): AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In one embodiment, the polynucleic acid molecule conjugate optionally comprises at least one 2'-modified nucleotide. nucleotide, at least one modified internucleotide bond, or at least one reverse In one embodiment, at least one 2'-modified nucleotide comprises an abasic portion. Morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2' -O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl Aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMA OE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethyl Aminoethyloxyethyl (2'-O-DMAEOE) or 2'-ON-methyl In some embodiments, the at least one nucleotide is an acetamide (2'-O-NMA) modified nucleotide. At least one 2'-modified nucleotide is a locked nucleic acid (LNA), an ethylene nucleic acid (EN A), or peptide nucleic acid (PNA). In one embodiment, at least one In one embodiment, the 2' modified nucleotide comprises a morpholino. In some embodiments, the inverted base portion is at least one terminal. The modified internucleotide linkages include phosphorothioate or dithiophosphate linkages. In certain embodiments, the polynucleic acid molecule comprises at least about 10 to about 30 nucleotides. In certain embodiments, the polynucleic acid molecule comprises at least about 15%, 20%, 30%, or %, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% qualification In some embodiments, the polynucleic acid molecule comprises a single strand. A polynucleic acid molecule comprises two or more strands. In certain embodiments, a polynucleic acid molecule is a double-stranded polynucleotide. A first polynucleotide and a nucleic acid molecule comprising a first polynucleotide and a second polynucleotide that is hybridized to the first polynucleotide to form a nucleic acid molecule. In one embodiment, the second polynucleotide comprises a hybridized second polynucleotide. The nucleotides include at least one modification. The nucleotide and the second polynucleotide comprise an RNA molecule. The polynucleotide and the second polynucleotide comprise an siRNA molecule. In some embodiments, X and Y are independently a single bond, a split bond, or a degradable linkers, non-degradable linkers, cleavable linkers, or non-polymeric linker groups. In some embodiments, X and Y are independently a single bond, a degradable linker, a non-degradable linker, or a In one embodiment, X is a cleavable linker, or a non-polymeric linker group. In one embodiment, X or Y is a C1-C6 alkyl group. In some embodiments, X or Y is a C1-C6 alkyl group. In certain embodiments, the binding moiety is an antibody or binding fragment thereof. In certain embodiments, the binding moiety is an antibody or a binding fragment thereof. The binding moiety is an antibody or a binding fragment thereof. In one embodiment, C is a polyether. In one embodiment, C is polyethylene glycol. In one embodiment, AX is conjugated to the 5' end of B and YC is conjugated to the 3' end of B. In one embodiment, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, the method further comprises D. In some embodiments, D is In some embodiments, the method further comprises conjugating to at least a second binding moiety. In some embodiments, the method further comprises at least a second binding moiety A. In some embodiments, the method further comprises at least a second binding moiety, A.
[0011] In one embodiment, splicing is performed on the targeted pre-mRNA transcript. Disclosed herein are methods for inducing a binding event, the methods comprising: (a) transfecting a target cell with a polynucleic acid molecule; contacting the conjugate, wherein the polynucleic acid molecule conjugate comprises a target cell binding moiety and a polynucleic acid molecule conjugate; (b) a targeted pre-mRNA splice regulating portion of the mRNA splicing of the pre-mRNA transcript targeted to produce the A transcript Polypeptides are introduced into targeted pre-mRNA transcripts in target cells to trigger a transcription event. hybridizing the targeted pre-mRNA splice regulating nucleic acid portion; (c) converting the mRNA transcripts of step (b) in a target cell to produce a protein. In one embodiment, the splicing event is exon skipping. In one embodiment, the splicing event is an exon inclusion. In one embodiment, the targeted pre-mRNA transcription product induces a disease or disorder. In certain embodiments, the disease or disorder is a neuromuscular disease, a genetic disease, cancer, a hereditary disease, Alternatively, the polynucleic acid molecule conjugate may be a) comprising the structure of formula (I), AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker; b) comprising the structure of formula (II), AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker, or c) comprising the structure of formula (III), AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In one embodiment, the polynucleic acid molecule conjugate optionally comprises at least one 2'-modified nucleotide. nucleotide, at least one modified internucleotide bond, or at least one reverse In one embodiment, at least one 2'-modified nucleotide comprises an abasic portion. Morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2' -O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl Aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMA OE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethyl Aminoethyloxyethyl (2'-O-DMAEOE) or 2'-ON-methyl In some embodiments, the at least one nucleotide is an acetamide (2'-O-NMA) modified nucleotide. At least one 2'-modified nucleotide is a locked nucleic acid (LNA), an ethylene nucleic acid (EN A) Peptide nucleic acids (PNAs) are used. In some embodiments, they contain at least one 2'-modified amino acid. The modified nucleotide comprises a morpholino. In some embodiments, at least one inverted base moiety In some embodiments, at least one modified The internucleotide linkages include phosphorothioate or dithiophosphate linkages. In an embodiment, the polynucleic acid molecule comprises at least about 10 to about 30 nucleotides in length. In certain embodiments, the polynucleic acid molecule is at least about 15%, 20%, 30%, 40%, %, 50%, 60%, 70%, 80%, 90%, 95%, or 99% qualification. In some embodiments, the polynucleic acid molecule comprises at least about 3, about 4, about 5, about 6, about 7, about 8, About 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about In one embodiment, X and Y comprise about 19, about 20, about 21, or about 22 or more modifications. are independently a single bond, a degradable linker, a non-degradable linker, a cleavable linker, or a non-poly In some embodiments, X is a single bond. In one embodiment, X is a C1-C6 alkyl group. In one embodiment, X is a hydroxyl group optionally conjugated to a C1-C6 alkyl group. In one embodiment, Y is a monobifunctional linker or a heterobifunctional linker. is a homobifunctional linker or a heterobifunctional linker. In one embodiment, C is a polynucleotide having a nucleotide sequence similar to that of an antibody or a binding fragment thereof. In one embodiment, AX is conjugated to the 5' end of B, YC is conjugated to the 3' end of B. In one embodiment, YC is conjugated to the 5' end of B. and AX is conjugated to the 3' end of B. In one embodiment, AX, YC, or The combination is conjugated to an internucleotide linkage group. In some embodiments, D is conjugated to C or A. In some embodiments, Thus, the method further comprises at least a second binding moiety A.
[0012] In one embodiment, the target cell binding moiety and the targeted pre-mRNA specific splice are Disclosed herein are polynucleic acid molecule conjugate compositions comprising a target regulatory polynucleic acid moiety and a target regulatory polynucleic acid moiety. The pre-mRNA specific splice regulatory polynucleic acid portion identified as SEQ ID NO:5 At least 60%, 65%, 70%, 75%, 80%, 85%, 90% of 4-972 %, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In one embodiment, the polynucleic acid molecule conjugate comprises the sequence a) comprising the structure of formula (I), AXB Formula I During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, and X consists of a single bond or a first linker; b) comprising the structure of formula (II), AXBYC Formula II During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker, or c) comprising the structure of formula (III), AXCYB Formula III During the ceremony, A comprises a binding moiety; B consists of a polynucleotide, C is a polymer; X consists of a single bond or a first linker, and Y consists of a single bond or a second linker. In certain embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. [Brief explanation of the drawings]
[0013] [Figure 1] The phosphorodiamidate morpholino oligomer (PMO) sequence with extended terminal nucleotides is depicted (SEQ ID NO:28). [Figure 2A] The phosphorothioate antisense oligonucleotide (PS ASO) sequence with extended terminal nucleotides is depicted (SEQ ID NO:29). [Figure 2B-1] The fully extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-2] The fully extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-3] The fully extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 2B-4]The fully extended phosphorothioate antisense oligonucleotide (PS ASO) sequence (SEQ ID NO:29) is depicted. [Figure 3] 1 depicts the method used to quantify skipped DMD mRNA in total RNA using Taqman qPCR. [Figure 4] 1 depicts a chromatogram of the produced anti-CD71 mAb-PMO reaction mixture using hydrophobic interaction chromatography (HIC) method 2. [Figure 5A] 1 depicts a chromatogram of the produced anti-CD71 mAb using size exclusion chromatography (SEC) method 1. [Figure 5B] 1 depicts a chromatogram of the produced anti-CD71 mAb-PMODAR1,2 using size exclusion chromatography (SEC) method 1. [Figure 5C] 1 depicts a chromatogram of the produced anti-CD71 mAb-PMODAR>2 using size exclusion chromatography (SEC) method 1. [Figure 6A] 1 depicts a chromatogram of the produced anti-CD71 mAb using hydrophobic interaction chromatography (HIC) method 2. [Figure 6B] 1 depicts a chromatogram of the purified anti-CD71 mAb-PMODAR1,2 conjugate produced using hydrophobic interaction chromatography (HIC) method 2. [Figure 6C] 1 depicts a chromatogram of the purified anti-CD71 mAb-PMODAR>2 conjugate produced using hydrophobic interaction chromatography (HIC) method 2. [Figure 7A] 1 depicts a chromatogram of fast protein liquid chromatography (FPLC) purification of anti-CD71 Fab-PMO using hydrophobic interaction chromatography (HIC) method 3. [Figure 7B] 1 depicts a chromatogram of the produced anti-CD71 Fab using SEC method 1. [Figure 7C]1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR1 conjugate using SEC method 1. [Figure 7D] 1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR2 conjugate using SEC method 1. [Figure 7E] 1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR3 conjugate using SEC method 1. [Figure 7F] 1 depicts a chromatogram of the produced anti-CD71 Fab using HIC method 4. [Figure 7G] 1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR1 conjugate using HIC method 4. [Figure 7H] 1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR2 conjugate using HIC method 4. [Figure 7I] 1 depicts a chromatogram of the produced anti-CD71 Fab-PMO DAR3 conjugate using HIC method 4. [Figure 8A] 1 depicts a chromatogram of an anti-CD71 mAb-PS ASO reaction mixture produced using SAX Method 2. [Figure 8B] 1 depicts a chromatogram of the produced anti-CD71 mAb using SEC method 1. [Figure 8C] 1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR1 conjugate using SEC method 1. [Figure 8D] 1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR2 conjugate using SEC method 1. [Figure 8E] 1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR3 conjugate using SEC method 1. [Figure 8F] 1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR1 conjugate using SAX method 2. [Figure 8G]1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR2 conjugate using SAX method 2. [Figure 8H] 1 depicts a chromatogram of the produced anti-CD71 mAb-PS ASO DAR3 conjugate using SAX method 2. [Figure 9] Agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO and anti-CD71 mAb-PMO conjugate. [Figure 10] Agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO, anti-CD71 mAb-PMO, and anti-CD71 mAb-PMO conjugate. [Figure 11] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in differentiated C2C12 cells using PMO, ASO, DAR1 ("ASC-DAR1")-conjugated anti-CD71 mAb-ASO, DAR2 ("ASC-DAR2")-conjugated anti-CD71 mAb-ASO, and DAR3 ("ASC-DAR3")-conjugated anti-CD71 mAb-ASO. [Figure 12A] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in the gastrocnemius muscle of wild-type mice administered a single intravenous injection of anti-CD71 mAb-PMO conjugate. [Figure 12B] 1 is a graph of quantification of PCR products from gastrocnemius muscle. [Figure 12C] 13 is a graph of quantification of in vivo exon skipping using Taqman qPCR in gastrocnemius muscle from wild-type mice. [Figure 13A] 1 depicts an agarose gel of nested PCR detecting exon 23 skipping in wild-type mouse cardiac muscle after a single intravenous injection. [Figure 13B] 1 is a graph of quantification of PCR products from cardiac muscle. [Figure 14]Depicts sequencing data of DNA fragments from skipped and wild-type PCR products (SEQ ID NOS 976-977, respectively). [Figure 15A] 13 is a graph of quantification of in vivo exon skipping in wild-type mice in gastrocnemius muscle using Taqman qPCR. [Figure 15B] 13 is a graph of quantification of in vivo exon skipping in wild-type mice in gastrocnemius muscle using nested PCR. [Figure 15C] 13 is a graph of quantification of in vivo exon skipping in wild-type mice in diaphragm muscle using Taqman qPCR. [Figure 15D] 13 is a graph of quantification of in vivo exon skipping in wild-type mice in diaphragm muscle using nested PCR. [Figure 15E] 10 is a graph of quantification of in vivo exon skipping in wild-type mice in cardiac muscle using Taqman qPCR. [Figure 15F] 13 is a graph of quantification of in vivo exon skipping in wild-type mice in cardiac muscle using nested PCR. [Figure 16A] Agarose gel depicting PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in diaphragm muscle tissue in wild-type mice after a single intravenous (iv) injection. [Figure 16B] Agarose gel depicting PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in cardiac muscle tissue in wild-type mice after a single intravenous (iv) injection. [Figure 16C] Agarose gel depicting PCR detecting CD71 mAb-PMO conjugate induction of MSTN exon 2 skipping in gastrocnemius muscle tissue in wild-type mice after a single intravenous (iv) injection. [Figure 17] Agarose gel depicting PCR detecting ASGPR mAb-PMO conjugate induction of PAH exon 11 skipping in primary mouse hepatocytes. [Figure 18] Agarose gel depicting PCR detecting ASGPR mAb-PMO conjugate induction of PAH exon 11 skipping in the liver of wild-type mice after a single intravenous (iv) injection. DETAILED DESCRIPTION OF THE INVENTION
[0014] Nucleic acid (e.g., RNAi) therapy is a targeted therapy that boasts high selectivity and specificity. However, in some cases, nucleic acid therapeutics also suffer from poor cellular uptake and insufficient target cell proliferation. To address these issues, nucleic acid Various modifications of the composition, e.g., new formulations for better stabilization and / or lower toxicity, New linkers, increased target specificity and / or optimization of the binding moiety for targeted delivery, and nucleic acid polymer modifications for increased stability and / or reduced off-target effects. is being explored.
[0015] In some instances, one such region in which oligonucleotides are used is the region of muscular dystrophy. Muscular dystrophy is a condition that affects multiple muscles. Duchenne muscular dystrophy is a severe form of muscular dystrophy. It is caused by a mutation in the DMD gene. Mutations in the gene disrupt the translation reading frame, resulting in non-functional dystrophin. Provides protein.
[0016] In one embodiment, the enzyme used to restore the translation reading frame Inadvertently splicing to induce exon skipping or exon inclusion Nucleic acid synthesis to induce insertions, deletions, duplications, or modifications of isolated mRNA transcripts In some embodiments, the present invention relates to methods and compositions related to acid therapy. Methods and compositions for treating diseases or disorders characterized by deregulated mRNA transcripts are also provided. As described herein, after exon removal, the mRNA encodes a functional protein. In a further embodiment, the above diseases or disorders can be treated. Pharmaceutical compositions and kits for treating diseases or disorders are described herein.
[0017] RNA processing RNA plays a central role in regulating gene expression and cell physiology. Processing is important for translation of functional proteins. RNA mis-splicing Alterations in RNA processing, such as the result of splicing, can lead to disease. Mutations at the Rice site can result in the exposure of a premature stop codon, loss of an exon, or an introductory codon. In some instances, alterations in RNA processing lead to This can result in insertions, deletions, or duplications. In some cases, alterations in RNA processing This can result in the insertion, deletion, or duplication of exons. Depending on the mutation, this can result in the insertion, deletion, or duplication of an intron.
[0018] Alternative transcription or splicing events include, but are not limited to, exon skipping. , alternative 3' splice site selection, alternative 5' splice site selection, intron Retention, mutually exclusive exons, alternative promoter usage, and alternative polyadenylation In some embodiments, the splicing event includes, for example, exon schizotylation. Exon insertion, deletion, or duplication due to exon skipping or exon inclusion results.
[0019] Exon skipping Exon skipping is a form of RNA splicing. The mRNA is either skipped in the processed mRNA or Exon skipping occurs when a gene is spliced from another gene. As a result of this processing, the processed mRNA does not contain the skipped exon. In some instances, exon skipping results in the expression of an altered product.
[0020] In some instances, antisense oligonucleotides (AONs) inhibit exon skipping In some instances, AONs are used to target specific mRNAs or AONs are short nucleic acid sequences that bind to pre-mRNA sequences. For example, AONs are splice sites or In some cases, specific mRNAs or Binding of AONs to the RNA precursor sequence generates double-stranded regions. In some instances, the formation of the double-stranded region is associated with the spliceosome or spliceosome-associated proteins. This occurs where the protein would normally bind, causing exon skipping. In this example, exon skipping resulted in the restoration of the transcript reading frame. , allowing the production of a partially functional protein.
[0021] Exon inclusion In some instances, mutations in the RNA result in exon skipping. That is, mutations occur at, near, and beyond the splice site. In some instances, the mutation occurs at least one location away from the splice. inactivation or weakening of exon splice enhancers or introns Disruption of splice enhancers, and exon splice silencers or introns In some instances, the addition of a splice enhancer results in at least one of: In some cases, mutations alter the RNA secondary structure. This disrupts the accessibility of signals important for exon recognition.
[0022] In some instances, the use of AONs may result in the inclusion of skipped exons. In some instances, AONs may be located at splice sites, sites near splice sites, or , binds to at least one site away from the splice site. disruption of exon splice enhancers or intron splice enhancers In some cases, AONs bind to exon splices. To prevent the generation of splice silencers or intron splice silencers, R It binds to a site on NA.
[0023] Intron retention In some instances, mutations in the RNA result in intron retention. In some cases, retained introns result in introns remaining in the mature mRNA transcript. The presence of an intron prevents or reduces the translation of a functional protein. Intron retention can occur in coding regions, non-coding regions, 5'UTR, or 3'UTR When intron retention occurs in coding regions, in some instances the retained intron may encode amino acids in frame or may be out of frame, resulting in a stop codon or Frameshifting produces truncated or non-functional proteins. In some instances, the intron is located in the 5'UTR or in the 3'UTR. It is maintained between the two exons that place it.
[0024] In some instances, the AON partially initiates the removal of the retained intron. In some cases, the nucleotide sequence is used to hybridize the mRNA that has been processed into a nucleotide sequence. AONs are intron splicing enhancers or intron splicing In some instances, the AON hybridizes to a 5' splice site silencer. at, or at a distance from, the 5' splice site, at, or at the 3' splice site At a distance from the splice site, at the branch site, or at a distance from the branch site at or at a distance from the polypyrimidine tract , at or at a distance from the intron silencer site at or from cryptic intron splice sites At a distance, at or away from the false splice site, Or in the intron enhancer of the intron, or in the intron enhancer of the intron In some cases, AONs are introduced into It hybridizes to an internal region of the gene.
[0025] Signs In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein are used to treat diseases or disorders characterized by defective mRNA. In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein may be splicing Insertions, deletions, and deletions of mis-spliced mRNA transcripts induce transcription events. These compounds are used to treat diseases or disorders by inducing duplication or modification. In one embodiment, the splicing event is exon skipping or exon inclusion. In some embodiments, the splicing event is intron retention.
[0026] In some embodiments, the polynucleic acid molecules or pharmaceutical compositions described herein In order to induce exon skipping or exon inclusion, Inducing insertions, deletions, duplications, or modifications of spliced mRNA transcripts are used in the treatment of diseases or disorders.
[0027] The majority of human protein-coding genes are alternatively spliced. In the example, the mutations are improperly spliced or partially spliced m For example, mutations can cause RNA mutations in protein-coding genes, silencers, or The sequence of the enhancer, exon, or intron has a small number of splice sites. In some cases, mutations cause gene dysfunction. In some instances, the mutation causes a disease or disorder.
[0028] In some cases, improperly spliced or partially spliced Diseases or disorders caused by mRNA include, but are not limited to, neuromuscular diseases, genetic diseases, and cancers. , genetic disorders, or cardiovascular diseases.
[0029] In some instances, the genetic disease or disorder may be an autosomal dominant disorder, an autosomal recessive disorder, an X-linked disorder, or an X-linked disorder. X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial genetic disorders, or multifactorial or includes polygenic disorders.
[0030] In some instances, cardiovascular diseases such as hypercholesterolemia are caused by inappropriate splicing. Hypercholesterolemia is caused by mis-spliced or partially spliced mRNA. In this study, a single nucleotide polymorphism in exon 12 of the low-density lipoprotein receptor (LDLR) was found to be involved in It has been shown to promote chthon skipping.
[0031] In some cases, improperly spliced or partially spliced mRNA can cause cancer. For example, it can be improperly spliced or partially spliced. The lysed mRNAs are used to characterize various aspects of cancer, including, but not limited to, proliferation, motility, and drug response. In some cases, solid or hematologic cancers affect cellular processes involved in In some instances, the cancer may be bladder cancer, lung cancer, brain cancer, melanoma, breast cancer, non-Hodgkin's Cancer, cervical cancer, ovarian cancer, colon cancer, pancreatic cancer, esophageal cancer, prostate cancer, kidney cancer, skin cancer, leukemia , thyroid cancer, liver cancer, or uterine cancer.
[0032] In some cases, improperly spliced or partially spliced The mRNA causes a neuromuscular disease or disorder. Exemplary neuromuscular diseases include Duchenne Becker muscular dystrophy, Facioscapulohumeral muscular dystrophy , congenital muscular dystrophy, or myotonic dystrophy In some instances, the muscular dystrophy is genetic. Muscular dystrophies are caused by spontaneous mutations. Becker muscular dystrophy and Duchenne muscular dystrophy, which are caused by the DMD gene, which encodes the protein dystrophin. Mutations in genes have been shown to be involved in facioscapulohumeral muscular dystrophy. has been shown to be associated with mutations in the double homeobox 4 (DUX4) gene. There are.
[0033] In some cases, improperly spliced or partially spliced mRNA causes Duchenne muscular dystrophy. Phee is a DMD disease that causes severe muscle weakness and eliminates the production of functional dystrophin. It is caused by a mutation in a gene. In some cases, it is called Duchenne muscular dystrophy. The trophy is the result of a mutation in an exon in the DMD gene. Duchenne muscular dystrophy is caused by exons 1, 2, 3, 4, 5, and 6 of the DMD gene. , 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3 0, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 7 At least one of 0, 71, 72, 73, 74, 75, 76 77, 78, and 79 It is the result of a mutation. In some cases, Duchenne muscular dystrophy is also known as DMD. Exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, and 24 in the gene 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 3 8, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 It is the result of at least one mutation. In some cases, it is called Duchenne muscular dystrophy. Fee is a member of the DMD gene, with exons 8, 23, 35, 43, 44, 45, 50, 51, and 52, 53, and 55. Many exons are mutated. For example, mutations in exons 48-50 cause Duchenne In some cases, it is common in patients with Duchenne muscular dystrophy. The strophic syndrome is the result of a mutation in exon 51. In some cases, Duchenne Type 2 muscular dystrophies are the result of mutations in exon 23. In some cases, the mutation The mutation involves an exon deletion. In some cases, the mutation involves an exon duplication. In some cases, the mutation involves an exon. For example, some patients harbor nonsense point mutations in exon 51 of the DMD gene. It has been shown that there are some.
[0034] In some instances, the polynucleic acid molecules or pharmaceutical compositions described herein may be used to treat muscular dystrophy. In some instances, the polynucleic acid molecules described herein are used to treat trophies. Alternatively, the pharmaceutical composition may be used for treating Duchenne muscular dystrophy, Becker muscular dystrophy, or the like. , facioscapulohumeral muscular dystrophy, congenital muscular dystrophy or myotonic dystrophy In some instances, the polynucleic acid molecules described herein are used in the treatment of Alternatively, the pharmaceutical composition is used to treat Duchenne muscular dystrophy.
[0035] Polynucleic acid molecule In some embodiments, exon skipping or exon inclusion Insertions, deletions, duplications, and deletions of misspliced mRNA transcripts are introduced to induce Alternatively, polynucleic acid molecules that induce modifications are described herein. The nucleic acid molecule restores the translation reading frame. In some instances, the polynucleic acid molecule results in a functional and truncated protein.
[0036] In some instances, the polynucleic acid molecule targets an mRNA sequence. In some instances, the polynucleic acid molecule targets a splice site. In some instances, the polynucleic acid molecule targets a trans-regulatory factor. In some instances, the polynucleic acid molecule is an exon splice enhancer or an intron splice enhancer. In some instances, the polynucleic acid molecule targets an exon splice enhancer. Targeting splice silencers or intron splice silencers.
[0037] In some instances, the polynucleic acid molecule targets a sequence found in an intron or exon. For example, the polynucleic acid molecule may comprise a sequence in an exon that mediates splicing of said exon. In some instances, the polynucleic acid molecule targets an exon recognition sequence. In some instances, the polynucleic acid molecule targets a sequence upstream of an exon. In some instances, the polynucleic acid molecule targets a sequence downstream of an exon.
[0038] As described above, polynucleic acid molecules can be used to treat, but are not limited to, neuromuscular diseases, genetic diseases, cancer, misprocessed proteins that lead to diseases or disorders such as genetic or cardiovascular diseases Targets isolated mRNA transcripts.
[0039] In some instances, the polynucleic acid molecule comprises a mutation in a gene that causes a disease or disorder. Exemplary diseases or disorders include, but are not limited to, familial autonomic nervous system disorders. Neuropathy (FD), spinal muscular atrophy (SMA), medium-chain acyl-CoA dehydrogenase (MCD) AD deficiency, Hutchinson-Gilford progeria syndrome (HGPS), myotonic dystrophy Diabetes Mellitus type 1 (DM1), myotonic dystrophy type 2 (DM2), autosomal dominant retinal pigmentary Degeneration (RP), Duchenne muscular dystrophy (DMD), Microcephalic dysplasia primordial dwarfism microcephalic steodysplastic primordia Taybi-Linder syndrome type 1 (MOPD1) inder syndrome (TALS), Parkinson's syndrome-17 (FTDP) -17) associated with frontotemporal dementia, Fukuyama congenital muscular dystrophy (FCMD), and muscle atrophy These include amyotrophic lateral sclerosis (ALS), hypercholesterolemia, and cystic fibrosis (CF). Exemplary genes involved in a disease or disorder include, but are not limited to, IKBKAP, SMN2 , MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LD Including LR, CFTR, DMD, PAH, MSTN, and K-Ras. In some forms, the gene is DMD, PAH, MSTN, or K-Ras.
[0040] In some instances, the polynucleic acid molecules described herein are intended to be useful in treating a disease or disorder. It targets the region at the exon-intron junction of the exon of a gene. In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD , PAH, MSTN, or K-Ras. The polynucleic acid molecules described herein may be derived from exon 1, 2, or 3 of MSTN. In some embodiments, the present invention targets regions at transtron junctions. The polynucleic acid molecule described herein is an exon-intron junction of exon 2 of MSTN. In some embodiments, the polypeptides described herein target regions in the The nucleic acid molecule is a sequence encoding exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 of PAH. Exon 2, 13, 14, 15, 16, 17, 18, 19, 20, or 21 In some embodiments, the targeting of the region at the endothelial junction is carried out as described herein. The described polynucleic acid molecule is an exon-intron junction of exon 11 of PAH. Targets areas in the
[0041] In some instances, the polynucleic acid molecule is a fragment of an exon of a gene that causes a disease or disorder. At least one 5' intron-exon junction or 3' exon-intron junction hybridizes to the target region at either the transtron junction. In embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, In some embodiments, the nucleotides described herein are selected from the group consisting of MSTN and K-Ras. The polynucleic acid molecule is a 5' intron-exon fragment of exon 1, 2, or 3 of MSTN. Targeting either the exon-intron junction or the 3' exon-intron junction In some embodiments, the polynucleic acid molecules described herein are The 5' intron-exon junction or 3' exon-intron junction of exon 2 of In some embodiments, the target region is either a nucleotide or a nucleotide sequence. The polynucleic acid molecules described herein are derived from exons 1, 2, 3, 4, 5, 6, 7 of PAH. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and There are 21 5' intron-exon junctions or 3' exon-intron junctions. In some embodiments, the present invention targets a region that is either a junction or a fusion protein. The polynucleic acid molecule described herein comprises a 5' intron-exon of exon 11 of PAH. junction or 3' exon-intron junction. Target an area.
[0042] In some cases, the polynucleic acid molecule comprises a small number of exons of a gene causing a disease or disorder. Hybridize to the target region at least one 5' intron-exon junction. In some embodiments, the gene is IKBKAP, SMN2, MCAD , LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CF TR, DMD, PAH, MSTN, or K-Ras. The polynucleic acid molecules described herein may be selected from the group consisting of exons 1, 2, and 3 of MSTN. Targets the region at the 5' intron-exon junction. Several implementations In some embodiments, the polynucleic acid molecules described herein comprise a 5' end of exon 2 of MSTN. In some embodiments, the target region is located at the exon-on junction. The polynucleic acid molecules described herein are derived from exons 1, 2, 3, 4, 5, 6, 7 of PAH. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and targets the region at the 5' intron-exon junction of 21. In one embodiment, the polynucleic acid molecule described herein comprises a sequence encoding the 5'-nucleotide sequence of exon 11 of PAH. Targeting regions at intron-exon junctions.
[0043] In some cases, the polynucleic acid molecule comprises a small number of exons of a gene causing a disease or disorder. hybridize to the target region at at least one 3' exon-intron junction In some embodiments, the gene is IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFT R, DMD, PAH, MSTN, or K-Ras. Therefore, the polynucleic acid molecules described herein may be derived from exons 1, 2, or 3 of MSTN. In some embodiments, the target region is an exon-intron junction. In the present invention, the polynucleic acid molecule described herein is a polynucleotide that encodes the 3' exon 1 of exon 2 of MSTN. In some embodiments, the present invention targets regions at intron junctions. The polynucleic acid molecules described in the specification are those containing exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 Targeting the region at the 3' exon-intron junction of the gene. In some embodiments, the polynucleic acid molecules described herein comprise a 3' exon of exon 11 of PAH. It targets regions at intron-intron junctions.
[0044] In some cases, the polynucleic acid molecules described herein cause a disease or disorder. In some embodiments, the splice site of an exon of a gene is targeted. IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, F KTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K- In some embodiments, the polynucleic acid molecules described herein are Targets splice sites in exons 1, 2, or 3 of STN. In some embodiments, the polynucleic acid molecules described herein comprise a polynucleotide sequence encoding a splice of exon 2 of MSTN. In some embodiments, the polynucleic acid molecules described herein target a site. , PAH exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1 Targeting splice sites 4, 15, 16, 17, 18, 19, 20, or 21. In some embodiments, the polynucleic acid molecules described herein comprise an exon of a PAH. As used herein, a splice site is defined as: Inadvertently splicing to induce exon skipping or exon inclusion can induce insertions, deletions, duplications, or modifications of the isolated mRNA transcripts. canonical splice sites, cryptic splice sites, or alternative splice sites. include.
[0045] In some instances, the polynucleic acid molecules described herein are intended to be useful in treating a disease or disorder. at least 1000 nucleotides (nt) from (or 5' to) the exon of the gene; 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, The region 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream In some embodiments, the gene is IKBKAP, SMN2, MCA D, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, C FTR, DMD, PAH, MSTN, or K-Ras. The polynucleic acid molecules described herein may be fragments of exons 1, 2, or 3 of the MSTN gene. or 5') at least 1000nt, 500nt, 400nt, 300nt, 2 00nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt In some instances, the target region is located 1 nt, 10 nt, or 5 nt upstream. The polynucleic acid molecule described in At most 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 In some instances, the polynucleic acid molecules described herein target a region located nt upstream. The child has exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 of the PAH gene. , 13, 14, 15, 16, 17, 18, 19, 20, or 21 (or 5' to ) at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100 nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, In some instances, the polypeptides described herein target a region located 5 nt upstream. The nucleic acid molecule is at least 1000n from (or 5' to) exon 11 of the PAH gene. t, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60n t, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream Target the area.
[0046] In some instances, the polynucleic acid molecule is a fragment of an exon of a gene that causes a disease or disorder. Hybridizes to at least one upstream (or 5') target region. In an embodiment, the gene is IKBKAP, SMN2, MCAD, LMNA, DMP K, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PA In some instances, the polynucleic acid molecule is MST upstream (or 5') of at least one of exons 1, 2, or 3 of the N gene In some examples, the polynucleic acid molecule hybridizes to a target region of the MSTN gene. Approximately 5, 10, 15, 20, 50, 100, 200, 300 of at least one exon 2 , 400, or 500 bp upstream (or 5') of the target region. In some instances, the polynucleic acid molecule comprises exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 21 or hybridizes to a target region that is at least one upstream (5') of 21. In some examples, the polynucleic acid molecule comprises at least about a 5'-nucleotide sequence of exon 11 of the PAH gene. , 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') to the target region.
[0047] In some instances, the polynucleic acid molecules described herein are intended to be useful in treating a disease or disorder. at least 1000 nucleotides (nt) from (or 3' to) the exon of the gene; 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, The region located 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt downstream In some embodiments, the gene is IKBKAP, SMN2, MCA D, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, C FTR, DMD, PAH, MSTN, or K-Ras. The polynucleic acid molecules described herein may be fragments of exons 1, 2, or 3 of the MSTN gene. Alternatively, at least 1000 nucleotides (nt), 500 nt, or 400 nt from the 5' end , 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 3 Targeting regions 0 nt, 20 nt, 10 nt, or 3 nt downstream. In an example, the polynucleic acid molecules described herein may comprise a polynucleotide sequence encoding a ... (from 3') at least 1000 nucleotides (nt), 500 nt, 400 nt, 30 0nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt , 20nt, 10nt, or 5nt downstream. The polynucleic acid molecules described herein are selected from exons 1, 2, 3, 4, 5, and 6 of the PAH gene. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , or at least 1000 nucleotides (nt) from (or 3' to) 21, 500 nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50n Targeting regions 40nt, 30nt, 20nt, 10nt, or 5nt downstream In some instances, the polynucleic acid molecules described herein comprise exons of the PAH gene. At least 1000 nucleotides (nt), 500 nt, or 3' of sequence 11 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 4 It targets regions 0 nt, 30 nt, 20 nt, 10 nt, or 5 nt downstream.
[0048] In some instances, the polynucleic acid molecule is a fragment of an exon of a gene that causes a disease or disorder. hybridizes to at least one downstream (or 3') target region. In an embodiment, the gene is IKBKAP, SMN2, MCAD, LMNA, DMP K, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PA In some instances, the polynucleic acid molecule is MST Approximately 5, 10, 15, 20, or 5% of at least one of exons 1, 2, or 3 of the N gene 0, 100, 200, 300, 400, or 500 bp downstream (or 3') In some examples, the polynucleic acid molecule hybridizes to a target region of the MSTN gene. Approximately 5, 10, 15, 20, 50, 100, 200, 300 of at least one exon 2 , 400, or 500 bp downstream (or 3') of the target region. In some instances, the polynucleic acid molecule comprises exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , or at least one of about 5, 10, 15, 20, 50, 100, 200, 30 It hybridizes to a target region that is 0, 400, or 500 bp downstream (3'). In some examples, the polynucleic acid molecule comprises at least about a 5'-nucleotide sequence of exon 11 of the PAH gene. , 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') to the target region.
[0049] In some instances, the polynucleic acid molecules described herein are intended to be useful in treating a disease or disorder. In some embodiments, the gene is targeted to an internal region within an exon of the gene. , IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FK TN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or KR In some instances, the polynucleic acid molecules described herein are selected from the group consisting of the MSTN gene, In some instances, the targeting of the internal region within exon 1, 2, or 3 of The polynucleic acid molecule described in targets an internal region within exon 2 of the MSTN gene. In some instances, the polynucleic acid molecules described herein comprise a polynucleotide sequence encoding regions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 In some instances, the targeting of the internal region within the nucleotide sequences described herein is directed to a region within the nucleotide sequence of ... The polynucleic acid molecule targeted an internal region within exon 11 of the PAH gene.
[0050] In some cases, the polynucleic acid molecule may be misprocessed to cause a neuromuscular disease or disorder. In some cases, the neuromuscular disease or disorder is Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy dystrophy, congenital muscular dystrophy, or myotonic dystrophy. Therefore, the polynucleic acid molecule is useful for treating Duchenne muscular dystrophy, Becker muscular dystrophy, and dysphagia, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy Targets the misprocessed mRNA transcripts that cause dystrophy. In some cases, polynucleic acid molecules may be involved in the mistranslation of genes that cause Duchenne muscular dystrophy. Targets processed mRNA transcripts.
[0051] In some instances, the polynucleic acid molecule is a nucleic acid molecule encoding a D muscular dystrophy-causing gene. Targets the exon to be mutated in the MD gene. In some cases, Duchenne The typical exons mutated in the DMD gene causing muscular dystrophy are limited Exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, and 24 are not involved in the transcription. , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 5 1, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, and 63 In some instances, the polynucleic acid molecule targets the sequence adjacent to the mutated exon. For example, if there is a deletion of exon 50, exon 51 is skipped. In another example, the polynucleic acid molecule targets a sequence in exon 51. If there is a mutation, the polynucleotide molecule is exon-specific so that exon 23 is skipped. It targets sequences in sequence 22.
[0052] In some examples, the polynucleic acid molecules described herein comprise exon 3 of the DMD gene. , 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2 8, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, Exon-intron sequences 55, 56, 57, 58, 59, 60, 61, 62, or 63 In some instances, the polypeptides described herein target regions at the junction. The nucleic acid molecule is a sequence encoding exons 8, 23, 35, 43, 44, 45, 50, 51, and 52 of the DMD gene. Targeting regions at exon-intron junctions 52, 53, or 55 In some cases, the polynucleic acid molecules described herein may comprise a sequence encoding the sequence of exon 8 of the DMD gene. Targeting regions at exon-intron junctions. The polynucleic acid molecule described herein is an exon-intronic sequence of exon 23 of the DMD gene. In some cases, the polynucleic acid described herein targets a region that is in the junction. The molecule is located at the exon-intron junction of exon 35 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the DMD gene. Targets the region at the exon-intron junction of exon 43. Therefore, the polynucleic acid molecules described herein contain a sequence encoding exon 44 of the DMD gene. Targeting regions at intron junctions, in some cases as described herein The polynucleic acid molecule is an exon-intron junction of exon 45 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region in Targeting the region at the exon-intron junction of exon 48 of the DMD gene In some cases, the polynucleic acid molecules described herein may be derived from an exon of the DMD gene. 49 target regions at exon-intron junctions. The polynucleic acid molecule described herein is an exon-intrinsic fragment of exon 50 of the DMD gene. In some cases, the polypeptides described herein target regions at the junction. The nucleic acid molecule is located at the exon-intron junction of exon 51 of the DMD gene. In some cases, the polynucleic acid molecules described herein target a region that is involved in the DMD gene. It targets the region at the exon-intron junction of exon 52 of the gene. In some cases, the polynucleic acid molecules described herein may comprise a polynucleotide encoding the exon 53 of the DMD gene. Targeting regions at the exon-intron junction. The polynucleic acid molecule described in Target areas that are in contact with the
[0053] In some instances, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 1, 2, ...3, 4, 5, 6, 7, 1, 2, 3, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 5 9, 60, 61, 62, and 63, at least one 5' intron-exon dinucleotide junction or 3' exon-intron junction. In some instances, the polynucleic acid molecule is a nucleic acid molecule that encodes exons 8, 23, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 35, 43, 44, 45, 50, 51, 52, 53, or 55 5' intron-extrinsic Target region at exon-intron junction or 3' exon-intron junction hybridize to
[0054] In some cases, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 18 of the DMD gene. , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 4 5, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, and 63. Optionally, the polynucleic acid molecule hybridizes to a target region located at the D Exons 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, and or 55 hybridizes to a target region at the 5' intron-exon junction In some cases, the polynucleic acid molecule is a 5' intron of exon 8 of the DMD gene. Hybridizes to target regions at exon junctions. The nucleic acid molecule is a 5' intron-exon junction of exon 23 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region in the DMD gene. hybridized to the target region at the 5' intron-exon junction of exon 35 of Optionally, the polynucleic acid molecule is a 5' end of exon 43 of the DMD gene. Hybridizes to target regions at tron-exon junctions. The polynucleotide molecule is a 5' intron-exon-junction of exon 44 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region in the DNA section. The target region is located at the 5' intron-exon junction of exon 45 of the D gene. Optionally, the polynucleic acid molecule hybridizes to exon 50 of the DMD gene. Hybridizes to the target region at the 5' intron-exon junction. The polynucleic acid molecule is a 5' intron-exon of exon 51 of the DMD gene. hybridizes to a target region at the junction. In some cases, a polynucleic acid molecule is a target located at the 5' intron-exon junction of exon 52 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region of the DMD gene. hybridizes to the target region at the 5' intron-exon junction of gene 53 Optionally, the polynucleic acid molecule is a 5' intron of exon 55 of the DMD gene. Hybridizes to target regions located at exon junctions.
[0055] In some cases, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 18 of the DMD gene. , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 4 5, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, and 63 at least one 3' exon-intron transition Optionally, the polynucleic acid molecule hybridizes to a target region in the DNA section. Exons 8, 23, 35, 43, 44, 45, 50, 51, 52, and 53 of the D gene, hybridizes to a target region at the 3' exon-intron junction of 55 In some cases, the polynucleic acid molecule is a 3' exon-intrinsic fragment of exon 8 of the DMD gene. hybridizes to the target region at the junction of the polynucleic acid molecule. The offspring contained a target gene at the 3' exon-intron junction of exon 23 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region of the DMD gene. hybridizes to the target region at the 3' exon-intron junction of gene 35 In some cases, the polynucleic acid molecule is a 3' exon-in sequence of exon 43 of the DMD gene. hybridizes to a target region at a nucleotide junction. The molecule is located at the 3' exon-intron junction of exon 44 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region of the DMD gene. Hybridizes to the target region at the 3' exon-intron junction of nucleotide sequence 45. In some cases, the polynucleic acid molecule is a 3' exon 1 of exon 50 of the DMD gene. hybridizes to a target region at a transtron junction. The acid molecule is located at the 3' exon-intron junction of exon 51 of the DMD gene. Optionally, the polynucleic acid molecule hybridizes to a target region of the DMD gene. Hybridizes to a target region at the 3' exon-intron junction of exon 52 In some cases, the polynucleic acid molecule is a 3' exon 53 of the DMD gene. Hybridizes to the target region at the intron junction. The nucleic acid molecule is located at the 3' exon-intron junction of exon 55 of the DMD gene. It hybridizes to a target region.
[0056] In some examples, the polynucleic acid molecules described herein comprise exon 3 of the DMD gene. , 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2 8, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, Targets splice sites 55, 56, 57, 58, 59, 60, 61, 62, or 63 In some instances, the polynucleic acid molecules described herein comprise an exon of the DMD gene. Splats 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 In some cases, the polynucleic acid molecules described herein target the DMD Optionally, the splice site of exon 8 of the gene is targeted. The polynucleic acid molecule targets the splice site of exon 23 of the DMD gene. In some cases, the polynucleic acid molecules described herein may be fragments of exon 35 of the DMD gene. In some cases, the polynucleic acid molecules described herein target the DM Optionally, the target gene is a splice site in exon 43 of the D gene. The polynucleic acid molecule targeted the splice site of exon 44 of the DMD gene. In some cases, the polynucleic acid molecules described herein comprise a polynucleotide sequence encoding a sequence encoding the sequence of exon 45 of the DMD gene. In some cases, the polynucleic acid molecules described herein target splice sites. Targeting the splice site of exon 48 of the DMD gene. The polynucleic acid molecule described in
[0010] targets the splice site of exon 49 of the DMD gene. Optionally, the polynucleic acid molecules described herein may comprise a sequence encoding exon 5 of the DMD gene. 0 splice site. targets the splice site of exon 51 of the DMD gene. The polynucleic acid molecules described herein target the splice site of exon 52 of the DMD gene. In some cases, the polynucleic acid molecules described herein may be exons of the DMD gene. Optionally, the polynucleic acid described herein targets the splice site of gene 53. The molecule targets the splice site of exon 55 of the DMD gene. As can be seen, splice sites are involved in exon skipping or exon inclusion. Insertions, deletions, duplications, and deletions of misspliced mRNA transcripts are introduced to induce or canonical splice sites, cryptic splice sites, or or alternative splice sites.
[0057] In some embodiments, the polynucleic acid molecule comprises exons 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 3 2, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, Additional factors involved in Duchenne muscular dystrophy, such as 60, 61, 62, or 63 It targets a partially spliced mRNA sequence containing the exon.
[0058] In some examples, the polynucleic acid molecules described herein comprise exon 3 of the DMD gene. , 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2 8, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, At least 1000 of 55, 56, 57, 58, 59, 60, 61, 62, or 63 Nucleotide (nt), 500nt, 400nt, 300nt, 200nt, 100nt , 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or In some instances, the 5 nt upstream (or 5') region is targeted. The polynucleic acid molecule identified is a sequence encoding exons 8, 23, 35, 43, 44, 45, and 50 of the DMD gene. , 51, 52, 53, or 55 (or at least 1000 nt from) 50 0nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50 Targets regions located nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream In some instances, the polynucleic acid molecules described herein comprise an exon of the DMD gene. At least 1000nt, 500nt, 400nt, 30nt from (or 5') of Son 8 0nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt , 20nt, 10nt, or 5nt upstream. The polynucleic acid molecules described herein may be derived from a sequence encoding ... from) at least 1000nt, 500nt, 400nt, 300nt, 200nt, 1 00nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, Alternatively, the region 5 nt upstream is targeted. The polynucleic acid molecule comprises at least 100 sequences from (or 5' to) exon 35 of the DMD gene. 0nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 6 0 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt upstream In some instances, the polynucleic acid molecules described herein target the region of the DMD. At least 1000nt, 500nt, 4nt, or 5' of exon 43 of the gene 00nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40 It targets regions located nt, 30nt, 20nt, 10nt, or 5nt upstream. In some examples, the polynucleic acid molecules described herein comprise a polynucleotide sequence encoding the sequence of exon 44 of the DMD gene. (or from 5') at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20n In some instances, the target region is located 1 nt, 10 nt, or 5 nt upstream. The polynucleic acid molecule described herein is a small fragment of (or 5' to) exon 45 of the DMD gene. At least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt , 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or In some instances, the polynucleic acid described herein targets a region 5 nt upstream. The molecule is at least 1000 nucleotides from (or 5' to) exon 48 of the DMD gene. Otide (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80 nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt In some instances, the polynucleic acid molecules described herein target a region upstream of the , at least 1000 nucleotides from (or 5' to) exon 49 of the DMD gene (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream In some instances, the polynucleic acid molecules described herein target a region of interest. At least 1000 nucleotides (nt) from (or 5' of) exon 50 of the D gene ), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60n t, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream In some instances, the polynucleic acid molecules described herein target the DMD gene. At least 1000 nucleotides (nt) from (or 5' of) exon 51 of the offspring, 5 00nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 5 Target the region 0nt, 40nt, 30nt, 20nt, 10nt, or 5nt upstream. In some instances, the polynucleic acid molecules described herein target the DMD gene. At least 1000 nucleotides (nt) from (or 5' of) chthon 52, 500n t, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt , 40nt, 30nt, 20nt, 10nt, or 5nt upstream. In some examples, the polynucleic acid molecules described herein comprise exons of the DMD gene. 53 (or from 5') at least 1000nt, 500nt, 400nt, 300nt nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, Targeting regions 20 nt, 10 nt, or 5 nt upstream. The polynucleic acid molecules described herein are derived from exon 55 (or 5' to exon 55) of the DMD gene. et al.) at least 1000nt, 500nt, 400nt, 300nt, 200nt, 10 0nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, and Alternatively, it targets a region 5 nt upstream.
[0059] In some instances, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 1, 2, ...3, 4, 5, 6, 7, 1, 2, 3, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 5 9, 60, 61, 62, and a target that is upstream (or 5') of at least one of 63. In some instances, the polynucleic acid molecule hybridizes to an exon of the DMD gene. At least one of the following: 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 In some instances, the target region also hybridizes to a target region located upstream (or 5') of the target region. The polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 18, 19, 20, and 21 of the DMD gene. , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 4 8, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 , and ,63 at least one of about 5, 10, 15, 20, 50, 100, 200, 3 hybridize to a target region that is 0, 400, or 500 bp upstream (or 5') Zzz.
[0060] In some examples, the polynucleic acid molecules described herein comprise exon 3 of the DMD gene. , 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2 8, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, At least 1000 of 55, 56, 57, 58, 59, 60, 61, 62, or 63 Nucleotide (nt), 500nt, 400nt, 300nt, 200nt, 100nt , 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or In some instances, the target region is 5 nt downstream (or 3'). The described polynucleic acid molecule is located in exons 8, 23, 35, 43, 44, and 45 of the DMD gene. , 50, 51, 52, 53, or 55 (or 3' from) at least 1000 nucleotides Reotide (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 8 0nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5n In some instances, the polynucleic acid molecule described herein targets a region downstream of the is at least 1000 nucleotides from (or 3' to) exon 8 of the DMD gene (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt downstream In some instances, the polynucleic acid molecules described herein target a region of interest. At least 1000 nucleotides (nt) from (or 3' to) exon 23 of the D gene ), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60n t, 50nt, 40nt, 30nt, 20nt, 10nt, or 5nt downstream In some instances, the polynucleic acid molecules described herein target the DMD gene. At least 1000 nucleotides (nt) from (or 3' of) exon 35 of the offspring, 5 00nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 5 Target the region 0nt, 40nt, 30nt, 20nt, 10nt, or 5nt downstream In some instances, the polynucleic acid molecules described herein target the DMD gene. At least 1000 nucleotides (nt) from (or 3' of) chthon 43, 500n t, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt , 40nt, 30nt, 20nt, 10nt, or 5nt downstream. In some examples, the polynucleic acid molecules described herein comprise exons of the DMD gene. 44 (or 3') at least 1000 nucleotides (nt), 500 nt, 4 00nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40 Targets regions located nt, 30nt, 20nt, 10nt, or 5nt downstream. In some examples, the polynucleic acid molecules described herein comprise a polynucleotide sequence encoding the sequence of exon 45 of the DMD gene. (or from the 3' end) at least 1000 nucleotides (nt), 500 nt, 400 nt t, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, Target regions 30nt, 20nt, 10nt, or 5nt downstream. In one example, the polynucleic acid molecules described herein may be derived from a polypeptide of exon 48 of the DMD gene (a or 3') at least 1000 nucleotides (nt), 500 nt, 400 nt, 3 00nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30n Targeting regions located t, 20nt, 10nt, or 5nt downstream. The polynucleic acid molecules described herein are those encoding exon 49 (or 3) of the DMD gene. ' to) at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt t, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 2 In some cases, the target region is 0 nt, 10 nt, or 5 nt downstream. The polynucleic acid molecules described herein are derived from exon 50 (or 3' to ) at least 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 2 00nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt In some instances, the target region is located 1 nt, 10 nt, or 5 nt downstream. The polynucleic acid molecule described in is a fragment of at least one nucleic acid sequence from (or 3' to) exon 51 of the DMD gene. At most 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt t, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10 In some instances, the target region is a region 1 nt or 5 nt downstream. The polynucleic acid molecule comprises at least one sequence from (or 3' to) exon 52 of the DMD gene. 1000 nucleotides (nt), 500 nt, 400 nt, 300 nt, 200 nt, 1 00nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, Alternatively, the target region is 5 nt downstream. The polynucleic acid molecule comprises at least 100 bases from (or 3' to) exon 53 of the DMD gene. 0 nucleotide (nt), 500nt, 400nt, 300nt, 200nt, 100nt t, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or targets a region 5 nt downstream. The acid molecule is at least 1000 nucleotides from (or 3' to) exon 55 of the DMD gene. Reotide (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 8 0nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5n t target a region downstream.
[0061] In some instances, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 1, 2, ...3, 4, 5, 6, 7, 1, 2, 3, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 5 9, 60, 61, 62, and a target that is downstream (or 3') of at least one of 63. In some instances, the polynucleic acid molecule hybridizes to an exon of the DMD gene. 3, 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 5 5, 56, 57, 58, 59, 60, 61, 62, and 63. , 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream In some instances, the polynucleic acid molecule hybridizes to a target region that is 5' to the target region. The child has exons 8, 23, 35, 43, 44, 45, 50, 51, 52, and 60 of the DMD gene. 53, or at least one of about 5, 10, 15, 20, 50, 100, 200, Hybridize to the target region that is 300, 400, or 500 bp downstream (or 3'). To make.
[0062] In some examples, the polynucleic acid molecules described herein comprise exon 3 of the DMD gene. , 4, 5, 6, 7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2 8, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, Targeting internal regions within 55, 56, 57, 58, 59, 60, 61, 62, or 63 In some examples, the polynucleic acid molecules described herein comprise exons of the DMD gene. Inner areas within 8, 23, 35, 43, 44, 45, 50, 51, 52, 53, or 55 In some instances, the polynucleic acid molecules described herein target the DMD gene. In some instances, the polypeptides described herein target an internal region within exon 8 of The nucleic acid molecule targets an internal region within exon 23 of the DMD gene. The polynucleic acid molecules described herein target an internal region within exon 35 of the DMD gene. In some instances, the polynucleic acid molecules described herein target the DMD gene. In some instances, the polynuclear polypeptides described herein target an internal region within chthon 43. The acid molecule targets an internal region within exon 44 of the DMD gene. The polynucleic acid molecules described herein target an internal region within exon 45 of the DMD gene. In some instances, the polynucleic acid molecules described herein comprise an exon of the DMD gene. In some instances, the polynucleic acids described herein target an internal region within nucleotide sequence 48. The molecule targets an internal region within exon 49 of the DMD gene. The polynucleic acid molecules described herein target an internal region within exon 50 of the DMD gene. In some instances, the polynucleic acid molecules described herein comprise exons of the DMD gene. In some instances, the polynucleic acid molecules described herein target an internal region within region 51. The gene targets an internal region within exon 52 of the DMD gene. The polynucleic acid molecules described herein target an internal region within exon 53 of the DMD gene. In some examples, the polynucleic acid molecules described herein comprise exons of the DMD gene. Targeting the internal area within 55.
[0063] In some instances, the polynucleic acid molecule is selected from exons 3, 4, 5, 6, 7, 1, 2, ...3, 4, 5, 6, 7, 1, 2, 3, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 5 9, 60, 61, 62, and 63. In some instances, the polynucleic acid molecule is selected from exons 8, 23, 3 of the DMD gene. 5, 43, 44, 45, 50, 51, 52, 53, or 55 It hybridizes to a target region.
[0064] In some embodiments, the polynucleic acid molecules described herein contain exon 51. In some instances, the targeting of partially spliced mRNA sequences containing polynucleotides The nucleic acid molecule hybridizes to a target region that is upstream (or 5') to exon 51. In some examples, the polynucleic acid molecule comprises about 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') In some examples, the polynucleic acid molecule hybridizes to a target region located in exon 51. In some instances, the target region hybridizes to a region downstream (or 3') of the target region. The polynucleic acid molecule may comprise approximately 5, 10, 15, 20, 50, 100, 200, 30, or 40 amino acids of exon 51. Hybridizes to a target region that is 0, 400, or 500 bp downstream (or 3') do.
[0065] In some instances, the polynucleic acid molecule hybridizes to a target region within exon 51. In some cases, the polynucleic acid molecule may be a 5' intron-exon 51 junction. Alternatively, hybridize to the target region at the 3' exon 51-intron junction do.
[0066] In some embodiments, the polynucleic acid molecule has at least 5'-nucleotide sequence identity to a target sequence of interest. 0%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 9 These sequences include sequences with 6%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule is at least 50% identical to the target sequence of interest. In some embodiments, the polynucleic acid molecule comprises a sequence having a sequence identity of In some embodiments, the target sequence includes a sequence having at least 60% sequence identity to the target sequence. In some embodiments, the polynucleic acid molecule has at least 70% sequence identity to a target sequence of interest. In some embodiments, the polynucleic acid molecule comprises a sequence having a target sequence of interest. In some embodiments, the sequence has at least 75% sequence identity to The polynucleic acid molecule is a sequence having at least 80% sequence identity to a target sequence of interest. In some embodiments, the polynucleic acid molecule comprises at least one nucleic acid sequence selected from the group consisting of: In some embodiments, the polynucleic acid molecules comprise sequences that share 85% sequence identity with each other. The fragment contains a sequence that has at least 90% sequence identity to the target sequence of interest. In some embodiments, the polynucleic acid molecule has at least 95% affinity to the target sequence of interest. In some embodiments, the polynucleic acid molecule comprises a sequence having sequence identity to the target nucleic acid. The target sequence includes a sequence having at least 96% sequence identity to the target sequence. In some embodiments, the polynucleic acid molecule has at least 97% sequence identity to the target sequence of interest. In some embodiments, the polynucleic acid molecule comprises a sequence having a sequence that is complementary to a target sequence of interest. In some embodiments, the sequence comprises a sequence having at least 98% sequence identity to the sequence of The polynucleic acid molecule comprises a sequence having at least 99% sequence identity to a target sequence of interest. In some embodiments, the polynucleic acid molecule consists of a target sequence of interest.
[0067] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some examples, the first polynucleotide comprises a target sequence of interest. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some instances, the second polynucleotide comprises a sequence having a sequence corresponding to a target sequence of interest. and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 9 0%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some instances, the polynucleic acid molecule comprises a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, A first polynucleotide having 96%, 97%, 98%, 99%, or 100% sequence identity nucleotides and at least 50%, 55%, 60%, 65%, 7% or more of the target sequence of interest. 0%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and Alternatively, it may comprise a second polynucleotide having 100% sequence identity.
[0068] In some embodiments, the polynucleic acid molecules described herein are RNA or DNA. A. In some cases, the polynucleic acid molecule comprises RNA. In some instances, the RNA is Small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA NA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal In some cases, the nucleus contains ribosomal RNA (rRNA), heterogeneous nuclear RNA (hnRNA), or heterogeneous nuclear RNA (hnRNA). In some instances, the RNA comprises an shRNA. In some instances, the RNA comprises an miRNA. In some instances, the RNA comprises dsRNA. In some instances, the RNA comprises tRNA. In some instances, the RNA comprises rRNA. In some instances, the RNA comprises hnRNA. In some examples, the RNA comprises an siRNA. In some examples, the polynucleic acid molecule comprises Contains siRNA.
[0069] In some embodiments, the nucleic acid polymer is about 10 to about 50 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises from about 10 to about 30, from about 15 to about 30 , about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 It is a length of nucleotides.
[0070] In some embodiments, the polynucleic acid molecule is about 50 nucleotides in length. In some examples, the polynucleic acid molecule is about 45 nucleotides in length. In some instances, the polynucleic acid molecule is about 40 nucleotides in length. In some instances, the polynucleic acid molecule is about 30 nucleotides in length. In some instances, the polynucleic acid molecule is about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 20 nucleotides in length. In some instances, the polynucleic acid molecule is about 19 nucleotides in length. In some instances, the polynucleic acid molecule is about 17 nucleotides in length. In some instances, the polynucleic acid molecule is about 16 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 nucleotides in length. In some instances, the polynucleic acid molecule is about 14 nucleotides in length. In some instances, the polynucleic acid molecule is about 12 nucleotides in length. In some instances, the polynucleic acid molecule is about 11 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 nucleotides in length. The nucleic acid molecule is about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is about 10 to about 45 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 40 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 35 nucleotides in length. In some instances, the polynucleic acid molecule is about 10 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 20 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 30 nucleotides in length. In some examples, the polynucleic acid molecule is about 12 to about 30 nucleotides in length.
[0071] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide. In some instances, the polynucleic acid molecule comprises a second polynucleotide. The acid molecule comprises a first polynucleotide and a second polynucleotide. The first polynucleotide is a sense strand or a passenger strand. The second polynucleotide is the antisense strand or guide strand.
[0072] In some embodiments, the polynucleic acid molecule is the first polynucleotide. In some embodiments, the first polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the first polynucleotide comprises from about 10 to about 30, about 1 5 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 2 It is from 0 to about 22 nucleotides in length.
[0073] In some examples, the first polynucleotide is about 50 nucleotides in length. In some examples, the first polynucleotide is about 45 nucleotides in length. In examples, the first polynucleotide is about 40 nucleotides in length. In some instances, the first polynucleotide is about 35 nucleotides in length. In some instances, the first polynucleotide is about 30 nucleotides in length. The nucleotides are about 25 nucleotides in length. In some instances, the first polynucleotide is about 20 nucleotides in length. In some examples, the first polynucleotide is about 19 nucleotides in length. In some instances, the first polynucleotide is about 17 nucleotides in length. In some examples, the first polynucleotide is about 16 nucleotides in length. In some examples, the first polynucleotide is about 15 nucleotides in length. In some examples, the first polynucleotide is about 14 nucleotides in length. In some examples, the first polynucleotide is about 13 nucleotides in length. In some examples, the first polynucleotide is about 12 nucleotides in length. In some examples, the first polynucleotide is about 11 nucleotides in length. In some instances, the first polynucleotide is about 10 nucleotides in length. The polynucleotide of interest is about 10 to about 50 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 45 nucleotides in length. In some embodiments, the first polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the first polynucleotide is from about 10 to about 35 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the first polynucleotide is about 15 to about 25 nucleotides. In some examples, the first polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 12 to about 30 nucleotides in length. The length of the leotide.
[0074] In some embodiments, the polynucleic acid molecule is a second polynucleotide. In some embodiments, the second polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the second polynucleotide is from about 10 to about 30, about 1 5 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 2 It is from 0 to about 22 nucleotides in length.
[0075] In some examples, the second polynucleotide is about 50 nucleotides in length. In some examples, the second polynucleotide is about 45 nucleotides in length. In examples, the second polynucleotide is about 40 nucleotides in length. In some instances, the second polynucleotide is about 35 nucleotides in length. In some instances, the second polynucleotide is about 30 nucleotides in length. The nucleotide is about 25 nucleotides in length. In some instances, the second polynucleotide is about 20 nucleotides in length. In some instances, the second polynucleotide is about 19 nucleotides in length. In some instances, the second polynucleotide is about 17 nucleotides in length. In some instances, the second polynucleotide is about 16 nucleotides in length. In some instances, the second polynucleotide is about 15 nucleotides in length. In some instances, the second polynucleotide is about 14 nucleotides in length. In some examples, the second polynucleotide is about 13 nucleotides in length. In some instances, the second polynucleotide is about 12 nucleotides in length. In some examples, the second polynucleotide is about 11 nucleotides in length. In some instances, the second polynucleotide is about 10 nucleotides in length. The two polynucleotides are about 10 to about 50 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 45 nucleotides in length. In some embodiments, the second polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the second polynucleotide is from about 10 to about 35 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the second polynucleotide is about 15 to about 25 nucleotides. In some examples, the second polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 12 to about 30 nucleotides in length. The length of the leotide.
[0076] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the polynucleic acid molecule may further comprise blunt ends, overhangs, or oligonucleotides. In some instances, the blunt ends include 5' blunt ends, 3' blunt ends, or combinations thereof. ' blunt ends, or both. In some cases, the overhangs are 5' overhangs. overhang, 3' overhang, or both. In some cases, overhang contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base paired nucleotides. In some cases, the overhang may consist of 1, 2, 3, 4, 5, or 6 non-base paired nucleosides. In some cases, the overhang contains 1, 2, 3, or 4 non-base paired nucleotides. In some cases, the overhang contains one non-base-paired nucleotide. In some cases, the overhang contains two non-base-paired nucleotides. In some cases, the overhang contains three non-base-paired nucleotides. The amino acid sequence contains four non-base paired nucleotides.
[0077] In some embodiments, the sequence of the polynucleic acid molecule is a target sequence described herein. At least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80% %, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary. In some embodiments, the sequence of the polynucleic acid molecule is at least as similar to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is 50% complementary to the sequence of the polynucleic acid molecule described herein. In some embodiments, the target sequence is at least 60% complementary to the target sequence set forth in The sequence of the polynucleic acid molecule is at least 70% complementary to the target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least partially similar to the target sequence described herein. In some embodiments, the sequences of the polynucleic acid molecules are at least 80% complementary. In some embodiments, the target sequence is at least 90% complementary to the target sequence described herein. Therefore, the sequence of the polynucleic acid molecule is at least 95% complementary to the target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule is at least 99% complementary to the sequence described herein. It is 100% complementary to the target sequence shown.
[0078] In some embodiments, the sequence of the polynucleic acid molecule corresponds to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has five or fewer mismatches. The string has no more than four mismatches to the target sequence described herein. In this case, the sequence of the polynucleic acid molecule has no more than three mismatches with the target sequence described herein. In some cases, the sequence of the polynucleic acid molecule corresponds to a target sequence described herein. Optionally, the sequence of the polynucleic acid molecule may be any of the sequences described herein. It has no more than one mismatch to the target sequence described.
[0079] In some embodiments, a polypeptide that hybridizes to a target sequence described herein is The specificity of the polynucleic acid molecule for the target sequence is 95%, 98%, 99%, 99% 0.5%, or 100% sequence complementarity. In some instances, hybridization The hybridization conditions are highly stringent.
[0080] In some embodiments, the polynucleic acid molecule has reduced off-target effects. In some instances, "off-target" or "off-target effect" refers to a substance that is not a given target. The target polynucleic acid polymer is a molecule that binds to another mRNA sequence, a DNA sequence, or a cellular protein. Unintended effects may occur due to direct or indirect interaction with the quality or other parts of the system. In some cases, other transcripts and polynucleic acid molecules by partial homology or complementarity between the sense and / or antisense strands of "Off-target effects" occur when there is simultaneous degradation of other transcripts.
[0081] In some embodiments, the polynucleic acid molecule may be composed of natural, synthetic, or artificial nucleotides. In some cases, polynucleic acid molecules may be composed of DNA, RNA, and and / or nucleotide analogs. In some instances, synthetic or human The nucleotide analog or base of the nucleotide is a ribose moiety, a phosphate moiety, a nucleoside moiety, The compound may be modified with one or more of the following:
[0082] In some embodiments, the nucleotide analog or artificial nucleotide base is , including nucleic acids having modifications at the 2' hydroxyl group of the ribose moiety. In some instances, the modifications are H, including OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where: R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogen, Sulfur, thiol, thioether, thioester, amine (primary, secondary, or tertiary), Some examples include amides, ethers, esters, alcohols, and oxygen. The alkyl moiety further comprises a modification. In some instances, the modification is an azo group, a keto group, an aldehyde group, or the like. hydroxyl groups, carboxyl groups, nitro groups, nitroso groups, nitrile groups, heterocycles (e.g., imidazo hydroxyl, hydrazino, or hydroxylamino) groups, isocyanate or cyanate groups, or sulfur-containing groups (e.g., sulfoxide, sulfone, sulfide, and disulfide) In some instances, the alkyl moiety further comprises heterosubstitution. In some examples, the carbon of the heterocyclic group is replaced by nitrogen, oxygen, or sulfur. Examples of heterocyclic substituents include, but are not limited to, morpholino, imidazole, and pyrrolidin. Including Gino.
[0083] In some cases, the modification of the 2' hydroxyl group is a 2'-O-methyl modification or a 2' 2'-O-Methoxyethyl (2'-O-MOE) modification. The methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while the 2'O-methionine The methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Representative examples of 2'-O-methyl modifications of adenosine molecules and 2'O-methoxyethyl modifications of uridine Typical chemical structures are illustrated below.
[0084] [ka]
[0085] In some embodiments, the modification of the 2' hydroxyl group is carried out by extending the 2' hydroxyl group with a propyl linker. The modified amine group is a 2'-O-aminopropyl modification that attaches the amine group to the 2' oxygen. In some instances, this modification involves the introduction of one positive charge from an amine group per sugar. neutralizing the overall negative charge of the oligonucleotide molecule from the phosphate groups, thereby Its zwitterionic properties improve cellular uptake properties. A typical chemical structure of a creoside phosphoramidite is illustrated below.
[0086] [ka]
[0087] In some instances, the 2' hydroxyl modification is a locked or bridged ribose modification (e.g., LNA or L-blocked nucleic acid), where the oxygen molecule borders the 2' carbon by a methylene group. and attached to the 4' carbon, thus forming a 2'-C, 4'-C-oxy-methylene-linked bicyclic It forms ribonucleotide monomers. A representative example of the chemical structure of LNA is illustrated below. The representative example shown in highlights the chemical bond nature of the LNA monomer. The representative example shown on the right is This highlights the locked 3'-endo (3E) structure of the furanose ring of the LNA monomer. do.
[0088] LNA (Locked Nucleic Acid)
[0089] [ka]
[0090] In some embodiments, the modification at the 2' hydroxyl group converts the sugar structure to a 3'-endo sugar. sugar puckering conformation Ethylene nucleic acids (ENA), such as 2'-4'-ethylene bridged nucleic acids, ENAs are part of the bridged nucleic acid class of modified nucleic acids, which also includes LNAs. Exemplary chemical structures of ENAs and cross-linked nucleic acids are illustrated below.
[0091] [ka]
[0092] In some embodiments, the additional modification at the 2' hydroxyl group is 2'-deoxy, T -Deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O -Dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DM AEOE), or 2'-ON-methylacetamide (2'-O-NMA).
[0093] In some embodiments, the nucleotide analogs include, but are not limited to, 5-propyl Uridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N, N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine nucleotides, and other nucleotides with modifications at the 5-position, such as 5-(2-amino)propyl nucleotides. Lysine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine adenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methyl Guanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylamino Deazanucleotides such as thiazolinone, 5-methoxyuridine, and 7-deaza-adenosine 6-Azouridine, 6-Azocytidine, 6-Azothymidine, 5-methyl-2-thiol Lysine, 2-thiouridine and 4-thiouridine, and other thiouridines such as 2-thiocytidine Base, dihydrouridine, pseudouridine, queusine, archaeosine, naphthyl and O- and N-alkylation of substituted naphthyl groups, such as N6-methyladenosine Purines and pyrimidines, 5-methylcarbonylmethyluridine, uridine, 5-hydroxy Acetic acid, pyridin-4-one, pyridin-2-one, phenyl, and aminophenol or modified phenyl groups such as 2,4,6-trimethoxybenzene, G-clamp nucleotides Modified cytosines, 8-substituted adenines and guanines, 5-substituted Substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleoside nucleotides, carboxyalkylaminoalkylnucleotides, and alkylcarbonyl Modified nucleotides also include modified bases such as alkylated nucleotides. Modifications to the sugar moiety are similar to nucleotides with non-saccharin sugars or their analogs. For example, in some cases, the sugar moiety is mannose, arabinose, or sugars, glucopyranose, galactopyranose, 4'-thioribose, and other sugars They are or have as their bases cyclic, heterocyclic, or carbocyclic rings. The term also includes what are known in the art as universal bases. Universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, and contains nebularine.
[0094] In some embodiments, the nucleotide analogs are morpholinos, peptide nucleic acids (PN A), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'- Fluoro N3-P5'-phosphoramidite, 1',5'-anhydrohexitol nucleic acid (H NA), or a combination thereof. Polymorpholino oligos (PMOs) are synthetic molecules whose structure is similar to that of normal sugars and phosphates. It mimics the natural nucleic acid structure by deviating from the structure. In this example, the five-membered ribose ring contains four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomer is substituted with a six-membered morpholino ring. Instead of the hydroxyl group, the backbone is linked by a phosphorodiamidate group. is a cellular delivery agent, such as that used by charged oligonucleotides. They can cross cell membranes without the aid of delivery agents. Remove all positive and negative charges making the morpholino a neutral molecule.
[0095] [ka]
[0096] In some embodiments, peptide nucleic acids (PNAs) contain both sugar backbone rings and phosphate linkages. The bases are linked and properly spaced by molecules such as oligoglycines, so In this way, the backbone charge is removed.
[0097] [ka]
[0098] In some embodiments, one or more modifications optionally occur at an internucleotide linkage. In some instances, the modified internucleotide linkage may be, but is not limited to, a phosphorothioate. phosphate, dithiophosphoric acid, methylphosphonic acid, 5'-alkylene phosphonate, 5'-methyl Phosphonates, 3'-alkylene phosphonates, boron trifluoride boranophosphates), 3'-5' or 2'-5' linked boranophosphate esters and selenophosphates, phosphate triesters, thionoalkylphosphotriesters, hydrogen Phosphonate bond, alkyl phosphonate, alkyl phosphorothioate, aryl phosphonate Phosphorothioates, phosphoroselenoates, phosphorodiselenoates, phosphinates, Phosphoramidates, 3'-alkylphosphoramidates, aminoalkylphosphoramidates Phosphorothioates, thionophosphoramidates, phosphoropiperazidates, phosphoroanilothioates esters, phosphoranilidates, ketones, sulfones, sulfonamides, carbonates, carbamates , methylenehydrazo, methylenedimethyldimethylhydrazo, formacetal, thioform Acetal, oxime, methyleneimino, methylenemethylimino, thioamidate, riboate Cetyl bonds, aminoethylglycine, silyl, or siloxane bonds, e.g., saturated or unsaturated and / or substituted and / or containing heteroatoms Alkyl or cycloalkyl bonds with or without 10 carbon heteroatoms, molybdenum, The bond with the phospholino structure, amide, or base is directly or indirectly bonded to the aza nitrogen of the backbone. or combinations thereof. Antisense oligonucleotides (PS ASOs) are antisense oligonucleotides containing phosphorothioate bonds. Exemplary PS ASOs are described below.
[0099] [ka]
[0100] In some instances, the modification is a methylphosphonate or thiolphosphonate modification. Which methyl or thiol modifications are typical of thiol phosphonate nucleotides (left)? ) and methylphosphonate nucleotides (right) are illustrated below.
[0101] [ka]
[0102] In some examples, modified nucleotides include, but are not limited to, the following: 2'-fluoro N3-P5'-phosphoramidites, including:
[0103] [ka]
[0104] In some examples, modified nucleotides include, but are not limited to, the following: Hexitol nucleic acid (also known as 1',5'-anhydrohexitol nucleic acid (HNA)) ) including:
[0105] [ka]
[0106] In some embodiments, one or more modifications further include a ribose moiety, a phosphate backbone, , and nucleoside modifications or nucleotide analog modifications at the 3' or 5' end For example, the 3' terminus optionally includes a 3' cationic group, or the 3'-3' bond By inverting the nucleoside at the 3'-terminus, a 3' cationic group is included. In some embodiments, the 3'-terminus may optionally be an aminoalkyl group, e.g., a 3'C5-aminoalkyl group. In a further alternative, the 3'-end is optionally conjugated to an abasic site, e.g., apurinic In some instances, the 5'-terminus is conjugated to an amino acid or a pyrimidinic acid moiety. In some cases, the 5'- The terminus is coupled to an abasic site, such as an apurinic or apyrimidinic site.
[0107] In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide sequence described herein. In some instances, the polynucleic acid molecules described herein comprise one or more of the following analogs: ,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16, It includes 17, 18, 20, 25 or more artificial nucleotide analogs described herein. In some embodiments, the artificial nucleotide analog is 2'-O-methyl, 2'-O- Methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T -Deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O -Dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DM AEOE), or modified 2'-ON-methylacetamide (2'-O-NM A) LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides , thiol phosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite In some embodiments, the polynucleic acid molecule comprises a 2' -O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropanol Pyr, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2 '-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O -Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyloxy dimethyl (2'-O-DMAEOE) or modified 2'-ON-methylacetate Amide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, methyl Phosphonate nucleotides, thiol phosphonate nucleotides, 2'-fluoro N3- P5'-phosphoramidites, or combinations thereof , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20 In some embodiments, the polynucleic acid molecule comprises 25 or more artificial nucleotide analogs. are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 20, 25 or more 2'-O-methyl modified nucleotides. In embodiments, the polynucleic acid molecule is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 20, 25 or more 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides. In some instances, the nucleotides described herein include The polynucleic acid molecule is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1 Contains 4, 15, 16, 17, 18, 20, 25 or more thiol phosphonate nucleotides nothing.
[0108] In some instances, the polynucleic acid molecule comprises at least one of the following: about 5% to about 100% % modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to from about 40% to about 100% modification; from about 50% to about 100% modification; About 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100 % modification, and about 90% to about 100% modification.
[0109] In some instances, the polynucleic acid molecule comprises at least one of the following: from about 10% to about 90% % modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 90% modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to to about 90% modified, and about 80% to about 100% modified.
[0110] In some instances, the polynucleic acid molecule comprises at least one of the following: about 10% to about 80% % modification, about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 80% modification, about 50% to about 80% modification, about 60% to about 80% modification, and about 70% to about 80% qualified.
[0111] In some instances, the polynucleic acid molecule comprises at least one of the following: about 10% to about 70% % modification, about 20% to about 70% modification, about 30% to about 70% modification, about 40% to about 70% modification, about 50% to about 70% modification, and about 60% to about 70% modification.
[0112] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 6% 0% modification, about 20% to about 60% modification, about 30% to about 60% modification, about 40% to About 60% modified, and about 50% to about 60% modified.
[0113] In some instances, the polynucleic acid molecule comprises at least one of the following: about 10% to about 50% % modification, about 20% to about 50% modification, about 30% to about 50% modification, and about 40% to approximately 50% modification.
[0114] In some instances, the polynucleic acid molecule comprises at least one of the following: about 10% to about 40% % modification, about 20% to about 40% modification, and about 30% to about 40% modification.
[0115] In some instances, the polynucleic acid molecule comprises at least one of the following: about 10% to about 30% % modification, and about 20% to about 30% modification.
[0116] Optionally, the polynucleic acid molecule contains about 10% to about 20% modifications.
[0117] In some cases, the polynucleic acid molecules are about 15% to about 90%, about 20% to about 80%, about 30% to about 90%. It includes 0% to about 70%, or alternatively about 40% to about 60% modifications.
[0118] In further instances, the polynucleic acid molecule is at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, Includes 0%, 60%, 70%, 80%, 90%, 95%, or 99% qualification.
[0119] In some embodiments, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5 , about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16 , about 17, about 18, about 19, about 20, about 21, about 22, or more modifications.
[0120] In some examples, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6 , about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 1 7, about 18, about 19, about 20, about 21, about 22, or more modified nucleotides Includes do.
[0121] In some instances, about 5% to about 100% of the polynucleic acid molecules are derived from a human polynucleotide described herein. In some instances, about 5%, 10%, 10% or 20% of the polynucleic acid molecule comprises a nucleotide analog. 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 6 5%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% are defined herein. In some instances, the artificial nucleotide analogs described in % includes an artificial nucleotide analog described herein. Approximately 10% of nucleic acid molecules contain the artificial nucleotide analogs described herein. In some instances, about 15% of the polynucleic acid molecules contain artificial nucleotide analogs as described herein. In some instances, about 20% of the polynucleic acid molecules comprise an artificial nucleic acid described herein. In some instances, about 25% of the polynucleic acid molecules comprise a nucleotide analog as described herein. In some instances, the polynucleic acid molecule comprises about 30 of the artificial nucleotide analogs described above. % includes an artificial nucleotide analog described herein. Approximately 35% of nucleic acid molecules contain the artificial nucleotide analogs described herein. In some instances, about 40% of the polynucleic acid molecules contain artificial nucleotide analogs as described herein. In some instances, about 45% of the polynucleic acid molecules comprise an artificial nucleic acid described herein. In some instances, about 50% of the polynucleic acid molecules comprise a nucleotide analog as described herein. In some instances, the polynucleic acid molecule comprises an artificial nucleotide analogue as described above. % includes an artificial nucleotide analog described herein. Approximately 60% of nucleic acid molecules contain the artificial nucleotide analogs described herein. In one example, about 65% of the polynucleic acid molecules contain artificial nucleotide analogs described herein. In some instances, about 70% of the polynucleic acid molecules comprise an artificial nucleic acid described herein. In some instances, about 75% of the polynucleic acid molecules comprise a nucleotide analog as described herein. In some instances, the polynucleic acid molecule comprises about 80 of the artificial nucleotide analogs described herein. % includes an artificial nucleotide analog described herein. Approximately 85% of nucleic acid molecules contain the artificial nucleotide analogs described herein. In some instances, about 90% of the polynucleic acid molecules contain artificial nucleotide analogs as described herein. In some instances, about 95% of the polynucleic acid molecules comprise the artificial nucleic acid sequences described herein. In some instances, about 96% of the polynucleic acid molecules comprise nucleotide analogs as described herein. In some instances, the polynucleic acid molecule comprises an artificial nucleotide analog as described above. % includes an artificial nucleotide analog described herein. Approximately 98% of nucleic acid molecules contain the artificial nucleotide analogs described herein. In some instances, about 99% of the polynucleic acid molecules contain artificial nucleotide analogs as described herein. In some instances, about 100% of the polynucleic acid molecules comprise an artificial nucleic acid sequence described herein. In some embodiments, the artificial nucleotide analog comprises: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-amino Propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2' -O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl Oxyethyl (2'-O-DMAEOE) or modified 2'-ON-methyl Acetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpholino, Thiolphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N 3-P5'-phosphoramidites, or combinations thereof.
[0122] In some embodiments, the polynucleic acid molecule comprises from about 1 to about 25 modifications, wherein the modifications The decoration comprises an artificial nucleotide analog described herein. In some embodiments, In accordance with the present invention, the polynucleic acid molecule comprises about one modification, wherein the modification is an artificial nucleotide as described herein. In some embodiments, the polynucleic acid molecule comprises about two modifications. , where the modifications include artificial nucleotide analogs as described herein. In embodiments, the polynucleic acid molecule comprises about three modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. wherein the modification includes an artificial nucleotide analog as described herein. In some embodiments, the polynucleic acid molecule comprises about 5 modifications, wherein the modifications are In some embodiments, the artificial nucleotide analogs include those described in the literature. The acid molecule contains about six modifications, where the modifications are artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 7 modifications, wherein: Modifications include artificial nucleotide analogs described herein. In one embodiment, the polynucleic acid molecule comprises about 8 modifications, wherein the modifications are artificial nucleotides described herein. In some embodiments, the polynucleic acid molecule comprises about 9 modifications. where the modifications include artificial nucleotide analogs as described herein. In an embodiment, the polynucleic acid molecule comprises about 10 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. and about 11 modifications, wherein the modifications are artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 12 modifications, wherein the modifications comprises an artificial nucleotide analog described herein. The polynucleic acid molecule comprises about 13 modifications, wherein the modifications are artificial nucleotides described herein. In some embodiments, the polynucleic acid molecule comprises about 14 modifications. where the modifications include artificial nucleotide analogs as described herein. In an embodiment, the polynucleic acid molecule comprises about 15 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. and about 16 modifications, wherein the modifications are artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 17 modifications, wherein the modifications comprises an artificial nucleotide analog described herein. The polynucleic acid molecule comprises about 18 modifications, wherein the modifications are artificial nucleotides described herein. In some embodiments, the polynucleic acid molecule comprises about 19 modifications. where the modifications include artificial nucleotide analogs as described herein. In an embodiment, the polynucleic acid molecule comprises about 20 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. and about 21 modifications, wherein the modifications are artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 22 modifications, wherein the modifications comprises an artificial nucleotide analog described herein. The polynucleic acid molecule contains about 23 modifications, where the modifications are artificial nucleotides described herein. In some embodiments, the polynucleic acid molecule comprises about 24 modifications. where the modifications include artificial nucleotide analogs as described herein. In an embodiment, the polynucleic acid molecule comprises about 25 modifications, wherein the modifications are as described herein. It includes artificial nucleotide analogs.
[0123] In some embodiments, the polynucleic acid molecule is composed of two separate polynucleotides. wherein one polynucleotide comprises the sense strand and the second polynucleotide In another embodiment, the sense strand is linked to a linker molecule. Thus, the antisense strand is connected to the polynucleotide linker, which in some instances is - or a non-nucleotide linker.
[0124] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, The pyrimidine nucleotides in the sense strand are 2'-O-methylpyrimidine nucleotides. The purine nucleotides in the sense strand include 2'-deoxypurine nucleotides. In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein: The pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoropyrimidines. purine nucleotides present in the sense strand are 2'-deoxypurine nucleotides Contains phosphorus nucleotides.
[0125] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and pyrimidine nucleotides, when present in the antisense strand, are 2'-deoxy 2'-fluoropyrimidine nucleotides, and purine nucleotides are the antisense nucleotides. When present in the base strand, they are 2'-O-methyl purine nucleotides.
[0126] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and pyrimidine nucleotides, when present in the antisense strand, are 2'-deoxy 2'-fluoropyrimidine nucleotides, and purine nucleotides are the antisense nucleotides. When present in the base strand, it contains 2'-deoxy-purine nucleotides.
[0127] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, The sense strand can be the 5'-end, the 3'-end, or both the 5' and 3' ends of the sense strand. In other embodiments, the terminal cap moiety comprises an inverted deoxy abasic moiety. minutes.
[0128] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, In some cases, the antisense strand contains a phosphate backbone modification at the 3' end of the antisense strand. In an example, the phosphate backbone modification is phosphorothioate.
[0129] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand contains a glyceryl modification at the 3' end of the antisense strand.
[0130] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the sense strand is one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioates internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy -2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6 , 7, 8, 9, 10 or more) and / or universal base modified nucleotides, etc. and optionally at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the sense strand. and the antisense strand comprises about 1 to about 10, particularly , about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or is one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal and optionally the 3'-end, 5'-end, and Alternatively, it contains end cap molecules at both the 3'- and 5'-ends. , one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more, centimeters The pyrimidine nucleotides of the sense and / or antisense strands are 2'-deoxy, 2' -O-methyl, and / or 2'-deoxy-2'-fluoro nucleotides, Alternatively, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phospho Thiothioate internucleotide linkages and / or 3′-nucleotides present on the same or different strands End-capping molecules at the 3'-end, 5'-end, or both the 3'- and 5'-ends The amino acid sequence may be chemically modified with or without cleavage.
[0131] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the sense strand is about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioates and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy oxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and optionally End-capping of the 3'-end, 5'-end, or both the 3'- and 5'-ends of the base strand and the antisense strand comprises about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more (e.g. , about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2' -O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g. (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) and, optionally, the 3'-end, 5'-end, or 3'- and 5'-end of the antisense strand. In other embodiments, one or more, e.g., About 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more sense and / or amino acid sequences The pyrimidine nucleotides of the antisense strand are 2'-deoxy, 2'-O-methyl, and and / or from about 1 to about 25 or more 2'-deoxy-2'-fluoronucleotides , for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1 5, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and and / or 3'-terminus, 5'-terminus, or 3'-terminus present on the same or different strands. and 5'-ends are chemically modified with or without end-capping molecules. .
[0132] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand is one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioates ate internucleotide linkages, and / or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'- deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally End-capping is performed at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the sense strand. and the antisense strand comprises about 1 to about 10, particularly about 1, 2, 3 , 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) (above) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) Universal base-modified nucleotides, and optionally the 3'-end, 5'- In other embodiments, the nucleotides may contain end cap molecules at either the termini or both the 3'- and 5'-termini. In the above, one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20 or more, sense strand and / or The pyrimidine nucleotides of the antisense strand are 2'-deoxy, 2'-O-methyl, and and / or 2'-deoxy-2'-fluoronucleotides, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide bonds and / or 3'-end, 5'-end, or Chemically modified with or without end-capping molecules at both the 3' and 5' ends will be done.
[0133] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand is about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more hosts Holothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3 , 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and Optionally, at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the sense strand The antisense strand comprises a cap molecule, and the antisense strand comprises from about 1 to about 25, e.g., about 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 1 8, 19, 20 or more phosphorothioate internucleotide linkages, and / or one or more above (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-deoxy oxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modifications nucleotides, and optionally the 3'-end, 5'-end, or 3'-end of the antisense strand. In other embodiments, one or more , e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more sense strands and and / or the pyrimidine nucleotides of the antisense strand are 2'-deoxy, 2'-O-methyl and / or 2'-deoxy-2'-fluoronucleotides, 5, e.g., about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and and / or 3'-terminus, 5'-terminus, or 3'-terminus present on the same or different strands. and 5'-ends are chemically modified with or without end-capping molecules. .
[0134] In some embodiments, the polynucleic acid molecules described herein are In each chain, about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioates The short interfering nucleic acid molecule is a chemically modified short interfering nucleic acid molecule having a nucleotide internucleotide bond.
[0135] In another embodiment, the polynucleic acid molecules described herein have 2'-5' internucleotide bonds. In some instances, the 2'-5' internucleotide linkage is at the 3'-terminus, 5'-terminus, or both the 3'-terminus and 5'-terminus of The 2'-5' internucleotide bond is present in one or both of the sequence strands, and various other and pyrimidine nucleotides in one or both strands of a polynucleic acid molecule. Approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of all internucleotide bonds in the , containing 2'-5' internucleotide linkages, or one or both strands of a polynucleic acid molecule Approximately 1, 2, 3, 4, 5, 6, and 7 internucleotide bonds in purine nucleotides , 8, 9, 10 or more contain 2'-5' internucleotide linkages.
[0136] In some embodiments, the polynucleic acid molecule mediates RNAi activity in a cell or A single-stranded polynucleic acid molecule reconstituted in an in vitro system, wherein the polynucleic acid molecule is a target nucleic acid molecule. The nucleic acid sequence of the nucleic acid is a single-stranded polynucleotide having a complementarity to the nucleic acid sequence of the nucleic acid. At least one pyrimidine nucleotide is a 2'-deoxy-2'-fluoropyrimidine nucleotides (e.g., where pyrimidine nucleotides are all 2'-deoxy -2'-fluoropyrimidine nucleotides, or alternatively, multiple pyrimidines The pyrimidine nucleotide is a 2'-deoxy-2'-fluoropyrimidine nucleotide), and Any purine nucleotide present in the polynucleic acid may be converted to a 2'-deoxypurine nucleotide. nucleotides (e.g., all purine nucleotides are 2'-deoxypurine nucleotides) Alternatively, the plurality of purine nucleotides may be 2'-deoxypurine nucleotides. The terminal cap modification is at the 3'-end of the antisense sequence, 5'-end of the antisense sequence, and A polynucleic acid molecule may optionally be present at the 3'-end or at both the 3' and 5'-ends. about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxy groups at the 3' end of the acid molecule; Optionally, the terminal nucleotide may further comprise one or more ribonucleotides. containing the above (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages , and the polynucleic acid molecule optionally further comprises a terminal phosphate group, such as a 5'-terminal phosphate group.
[0137] In some cases, one or more of the artificial nucleotide analogs described herein are naturally occurring. compared to polynucleic acid molecules, e.g., ribonucleases such as RNase H, DNase Deoxyribonucleases such as 5'-3' exonucleases and 3'-5' Resistant to nucleases such as exonucleases In some instances, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE ), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2' -O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O -DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO- Dimethylaminoethyloxyethyl (2'-O-DMAEOE), or modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, H NA, morpholino, methylphosphonate nucleotide, thiolphosphonate nucleotide 2'-fluoroN3-P5'-phosphoramidite, or a combination thereof Artificial nucleotide analogs containing ribonucleases such as RNase H and DNase Which deoxyribonuclease or 5'-3' exonuclease or 3'-5' endonuclease It is resistant to nucleases, such as exonucleases, such as xonucleases. In some instances, the 2'-O methyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease Nuclease-resistant). In some instances, 2'O-methoxyethyl (2'-O- MOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase , 5'-3' exonuclease, or 3'-5' exonuclease resistant) In some instances, 2'-O-aminopropyl modified polynucleic acid molecules are nuclease resistant. Resistance (e.g., to RNase H, DNase, 5'-3' exonuclease, or 3 In some instances, 2'-deoxy modified polynucleotides are used. The nucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' endonucleases, etc.). xonuclease, or 3'-5' exonuclease resistant). In an example, the T-deoxy-2'-O-fluoro modified polynucleic acid molecule is nuclease resistant ( For example, RNase H, DNase, 5'-3' exonuclease, or 3'-5 In some instances, 2'-O-aminopropyl ( 2'-O-AP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, D Nase, 5'-3' exonuclease, or 3'-5' exonuclease resistance In some instances, 2'-O-dimethylaminoethyl (2'-O-DMAO E) The modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 3'-3' exonuclease or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified poly The nucleic acid molecule may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exon, exonuclease-resistant or 3'-5' exonuclease-resistant). Then, TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified poly The nucleic acid molecule may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exon, exonuclease-resistant or 3'-5' exonuclease-resistant). In this study, 2'-ON-methylacetamide (2'-O-NMA) modified polynucleic acid molecules were used to nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease) In some instances, LNA modifications may be used. The modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3 'exonuclease, or 3'-5' exonuclease resistant). In some instances, the ENA-modified polynucleic acid molecule is nuclease-resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant In some instances, the HNA modified polynucleic acid molecule is nuclease resistant (e.g., For example, RNase H, DNase, 5'-3' exonuclease, or 3'-5' In some instances, the morpholino is nuclease resistant. Resistance (e.g., to RNase H, DNase, 5'-3' exonuclease, or 3 In some instances, PNA-modified polynucleic acid molecules are The product is resistant to nucleases (e.g., RNase H, DNase, 5'- 3' exonuclease or 3'-5' exonuclease resistant). In an example, the methylphosphonate nucleotide modified polynucleic acid molecule is nuclease resistant (e.g., For example, RNase H, DNase, 5'-3' exonuclease, or 3'-5' In some instances, thiolphosphonate nucleosides are used. The tide-modified polynucleic acid molecules are nuclease-resistant (e.g., RNase H, DNase, 5 3'-3' exonuclease or 3'-5' exonuclease resistant). In some instances, a polynucleic acid molecule comprising a 2'-fluoro N3-P5'-phosphoramidite nuclease-resistant (e.g., RNase H, DNase, 5'-3' exonuclease) In some cases, the The 5' conjugates described herein inhibit 5'-3' exonucleolytic cleavage. In some instances, the 3' conjugates described herein inhibit 3'-5' exonucleolytic cleavage. To harm.
[0138] In some embodiments, one of the artificial nucleotide analogs described herein These have increased binding affinity for their mRNA targets compared to comparable natural polynucleic acid molecules. 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'- O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-amino 2'-O-dimethylaminoethyl (2'-O-DMAO) E), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminopropyl Aminoethyloxyethyl (2'-O-DMAEOE) or modified 2'-O- N-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, mol phosphonate nucleotides, methylphosphonate nucleotides, thiolphosphonate nucleotides, or An artificial nucleotide analogue containing 2'-fluoro N3-P5'-phosphoramidite Polynucleic acid molecules containing the above have a higher affinity for their mRNA targets than comparable naturally occurring polynucleic acid molecules. In some instances, 2'-O-methyl modified polynucleic acid molecules have increased binding affinity to , which has increased binding affinity for its mRNA target compared to a comparable naturally occurring polynucleic acid molecule. In some instances, 2'-O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules The molecule has increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some instances, the 2'-O-aminopropyl modified polynucleic acid molecule is a polynucleotide having a similar structure to the natural equivalent. The polynucleic acid molecules have increased binding affinity to their mRNA targets compared to other polynucleic acid molecules. In this example, a 2'-deoxy modified polynucleic acid molecule has a higher affinity than a comparable naturally occurring polynucleic acid molecule. In some instances, T-deoxy-2 '-Fluoro modified polynucleic acid molecules have a lower affinity for their mRNA targets than comparable natural polynucleic acid molecules. In some instances, 2'-O-aminopropyl (2 '-O-AP) modified polynucleic acid molecules have a lower mRNA content than comparable natural polynucleic acid molecules. In some instances, 2'-O-dimethylaminoethyl esters were used to increase the binding affinity to the target. 2'-O-DMAOE modified polynucleic acid molecules have a higher cleavage rate than comparable natural polynucleic acid molecules. In some instances, 2'-O-diaminobenzoates increased the binding affinity for their mRNA targets. Methylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules are similar to the natural polynucleic acid molecules. In some cases, the binding affinity of the nucleotides to their mRNA targets was increased compared to the acid molecules. , 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynuclear The nucleic acid molecule exhibits a higher binding affinity for its mRNA target than a comparable natural polynucleic acid molecule. In some instances, 2'-ON-methylacetamide (2'-O-NMA ) modified polynucleic acid molecules have a lower affinity for their mRNA targets than comparable natural polynucleic acid molecules. In some instances, the LNA modified polynucleic acid molecules have increased binding affinity compared to the equivalent natural Compared to polynucleic acid molecules, they have increased binding affinity to their mRNA targets. In an example, an ENA-modified polynucleic acid molecule may have a reduced mRNA content compared to a comparable natural polynucleic acid molecule. In some instances, the PNA modified polynucleic acid molecule has increased binding affinity to the target. Increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule In some instances, HNA modified polynucleic acid molecules have a lower affinity for nucleotides than comparable naturally occurring polynucleic acid molecules. In some instances, the morpholino modification increased the binding affinity to its mRNA target. A polynucleic acid molecule has a higher binding affinity to its mRNA target than a comparable naturally occurring polynucleic acid molecule. In some instances, methylphosphonate nucleotide-modified polynucleic acid molecules The molecule has increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some instances, the thiol phosphonate nucleotide modified polynucleic acid molecule The binding affinity for its mRNA target has been increased compared to naturally occurring polynucleic acid molecules such as In some instances, a polynucleic acid molecule comprising a 2'-fluoro N3-P5'-phosphoramidite has increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some cases, increased affinity may be due to a lower Kd, a higher melting temperature (Tm), or other Illustrated in combination.
[0139] In some embodiments, the polynucleic acid molecules described herein are chirally pure (or or stereopure polynucleic acid molecules, or polynucleic acid molecules containing a single enantiomer. In some instances, the polynucleic acid molecule comprises L-nucleotides. In some instances, the polynucleic acid molecule comprises D-nucleotides. The product is 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, or 2%, or even 1% or less. In some cases, the polynucleic acid molecule composition is a racemic mixture. 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% or more of In some examples, the polynucleic acid molecule is a nucleic acid molecule as described in U.S. Patent Application Publication No. 2014 / 194 610 and 2015 / 211006; polynucleic acids described in WO2015107425 It is a molecule.
[0140] In some embodiments, the polynucleic acid molecules described herein are aptamer-conjugated. In some instances, the aptamer-conjugated moiety is further modified to include a DNA moiety. In some instances, the aptamer-conjugated moiety is an Alphame r (Centauri Therapeutics), which targets specific cell surfaces and a portion that displays a specific epitope for binding to circulating antibodies. In some instances, the polynucleic acid molecules described herein include those disclosed in U.S. Pat. Nos. 8,604,184, 8,591,910, and 7,850,975 The compound is further modified to include an aptamer-conjugated moiety such as
[0141] In additional embodiments, the polynucleic acid molecules described herein may be modified to increase their stability. In some embodiments, the polynucleic acid molecule is an RNA (e.g., an siRNA). In some instances, the polynucleic acid molecule may be modified with one of the methods described above to increase its stability. Optionally, the polynucleic acid molecule is modified by one or more of the modifications listed above. '-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl ( 2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl 2'-O-DMAEOE), or 2'-ON-methylacetamide ( 2'-O-NMA) modifications, or locked or bridged ribose structures (e.g., LNA In some cases, the poly(2-hydroxyl) The nucleic acid molecules are bound to 2'-O-methyl and / or 2'-O-methoxyethyl ribose. In some cases, the polynucleic acid molecule is further modified with a nucleotide sequence to increase its stability. , morpholino, PNA, HNA, methylphosphonate nucleotide, thiol phosphonate nucleotides, and / or 2'-fluoro N3-P5'-phosphoramidites In some instances, the polynucleic acid molecule is a chirally pure (or stereopure) polynucleic acid. In some instances, chirally pure (or stereopure) polynucleic acid molecules. has been modified to increase its stability. Suitable modifications of A will be apparent to those skilled in the art.
[0142] In some embodiments, the polynucleic acid molecules described herein include, but are not limited to, , IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FK TN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or KR Regulating the expression of RNA encoded by genes involved in diseases or disorders such as In some examples, the polynucleic acid molecules described herein have RNAi activity. KBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN , TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or K-Ras a double-stranded siRNA molecule that downregulates the expression of at least one of One strand of the double-stranded siRNA molecule binds to IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD At least one of PAH, MSTN, or K-Ras, or IKBKAP, S MN2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43 , LDLR, CFTR, DMD, PAH, MSTN, or K-Ras A nucleotide sequence complementary to the nucleotide sequence of the RNA encoded by one of the and the second strand of the double-stranded siRNA molecule comprises an IKBKAP, SM N2, MCAD, LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, At least one of LDLR, CFTR, DMD, PAH, MSTN, or K-Ras , or IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF9, MAP T, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MSTN, or is an RNA encoded by at least one of the K-Ras, or a portion thereof, In some cases, the nucleic acid sequence may be substantially similar to the nucleic acid sequence described herein. The polynucleic acid molecules used are IKBKAP, SMN2, MCAD, LMNA, DMPK, ZNF 9, MAPT, FKTN, TDP-43, LDLR, CFTR, DMD, PAH, MST Double-stranded siR that downregulates the expression of at least one of N- and K-Ras siRNA molecules, wherein each strand of the siRNA molecule is about 15-25, 18-24 or 19 to about 23 nucleotides, and each strand is connected to the nucleotides of the other strand. The nucleic acid sequence comprises at least about 14, 17, or 19 nucleotides complementary to the nucleic acid sequence. In some cases, the polynucleic acid molecules described herein may be selected from the group consisting of IKBKAP, SMN2, MCAD, , LMNA, DMPK, ZNF9, MAPT, FKTN, TDP-43, LDLR, CF Downregulation of at least one of TR, DMD, PAH, MSTN, or K-Ras a double-stranded siRNA molecule that regulates the expression of a nucleotide sequence, wherein each strand of the siRNA molecule Each strand contains about 19 to about 23 nucleotides, and each strand is separated from the nucleotides of the other strand. In some instances, the RNAi activity In another example, RNAi activity occurs in a reconstituted in vitro system.
[0143] In some embodiments, the polynucleic acid molecules described herein include, but are not limited to, , DMD, DUX4, DYSF, EMD, or LMNA muscular dystrophies They have RNAi activity, which regulates the expression of RNA encoded by genes that affect them. In some examples, the polynucleic acid molecules described herein are selected from the group consisting of DMD, DUX4, DYSF, E Double-stranded siR that downregulates the expression of at least one of MD and LMNA NA molecule, wherein one strand of the double-stranded siRNA molecule is a DMD, DUX4, DY At least one of SF, EMD, or LMNA, or DMD, DUX4, or DYS RNA encoded by at least one of F, EMD, or LMNA, or wherein the double-stranded siRNP comprises a nucleotide sequence complementary to a portion of the nucleotide sequence of The second strand of the A molecule contains a small amount of DMD, DUX4, DYSF, EMD, or LMNA. At least one of DMD, DUX4, DYSF, EMD, or LMNA substantially identical to the nucleotide sequence of an RNA encoded by at least one of the In some cases, the polynucleic acid molecules described herein contain similar nucleotide sequences. express at least one of DMD, DUX4, DYSF, EMD, or LMNA. down-regulating double-stranded siRNA molecules, wherein each of the siRNA molecules The strand contains about 15 to 25, 18 to 24, or 19 to about 23 nucleotides, and and each strand has at least about 14, 17, or more nucleotides complementary to the other strand. or 19 nucleotides. In some cases, the polynucleic acid molecules described herein , DMD, DUX4, DYSF, EMD, or LMNA. wherein each of the siRNA molecules is a double-stranded siRNA molecule that downregulates the Each strand contains about 19 to about 23 nucleotides, and each strand is connected to the nucleotides of the other strand. In some instances, the RNAi The activity occurs intracellularly. In another example, the RNAi activity occurs in a reconstituted in vitro system. .
[0144] In some embodiments, the polynucleic acid molecules described herein are directed to the DMD gene. Thus, it has RNAi activity that regulates the expression of the encoded RNA. The polynucleic acid molecules described herein are single-stranded siRs that downregulate the expression of DMD. A single-stranded siRNA molecule, wherein the single-stranded siRNA molecule is a DMD or encoded by a DMD. The nucleic acid sequence of the target RNA is complementary to the nucleotide sequence of the target RNA or a portion thereof. In some cases, the polynucleic acid molecules described herein downregulate the expression of DMD. and a single-stranded siRNA molecule that binds to the nucleotide sequence of about 15-25, 18-2 4, or 19 to about 23 nucleotides. The polynucleic acid molecule is a single-stranded siRNA molecule that downregulates the expression of DMD, In some instances, the siRNA molecule comprises about 19 to about 23 nucleotides. Ai activity occurs intracellularly. In other instances, RNAi activity occurs in reconstituted in vitro systems. Jiru.
[0145] In some instances, the polynucleic acid molecule comprises self-complementary sense and antisense regions. a double-stranded polynucleotide molecule, including a target nucleic acid molecule, wherein the antisense region is The sense region comprises a nucleotide sequence complementary to a nucleotide sequence in the target region or a portion thereof. In some instances, the target nucleic acid sequence has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. A nucleic acid molecule is assembled from two separate polynucleotides, one strand being the sense strand. and the other strand is the antisense strand, where the antisense and sense strands are self-correlated. complementary (e.g., each strand contains nucleotides that are complementary to the nucleotide sequence of the other strand) When the antisense and sense strands form a duplex or double-stranded structure, For example, the double-stranded region is about 19, 20, 21, 22, 23 or more base pairs; The sense strand contains a nucleotide sequence complementary to the nucleotide sequence of a target nucleic acid molecule or a portion thereof. The sense strand comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, the polynucleic acid molecule may be assembled from a single oligonucleotide, The self-complementary sense and antisense regions can be linked by a nucleic acid-based or non-nucleic acid-based linker. are joined by
[0146] In some cases, the polynucleic acid molecule has self-complementary sense and antisense regions. duplex, asymmetric duplex, hairpin, or asymmetric hairpin secondary structures wherein the antisense region is a polynucleotide having the following structure: The sense region contains a nucleotide sequence complementary to a part of the nucleotide sequence of the target nucleic acid. In other cases, the nucleic acid molecule has a nucleotide sequence corresponding to the nucleic acid sequence or a portion thereof. The fragment contains two or more loop structures and a base containing self-complementary sense and antisense regions. wherein the antisense region is a circular single-stranded polynucleotide having a target nucleic acid sequence. The sense region contains a nucleotide sequence complementary to the nucleotide sequence of the nucleic acid molecule or a portion thereof. The region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and The tides are then transfected in vivo to generate active polynucleic acid molecules capable of mediating RNAi. In a further instance, the polynucleic acid molecule is further treated with a target nucleic acid molecule. A single-stranded polynucleotide having a nucleotide sequence complementary to the nucleotide sequence of the nucleic acid fragment or a portion thereof. Such polynucleic acid molecules include nucleic acid fragments that target a target nucleic acid sequence or a portion thereof. (It is not necessary that the corresponding nucleotide sequence be present within a polynucleic acid molecule), Nucleotides can also be converted to 5'-phosphates (e.g., Martinez et al., 20 02, Cell.,110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568) or 5' , containing a terminal phosphate group such as 3'-diphosphate.
[0147] In some instances, the antisense region and the nucleotide or non-nucleotide The linear polynucleic acid molecule is asymmetric, comprising a loop portion and a sense region, and the sense region has a nucleotide sufficiently complementary to the base pair having the antisense region, and forms a loop The antisense region contains fewer nucleotides than the antisense region, so that it forms a duplex with the For example, asymmetric hairpin-shaped polynucleic acid molecules can induce RNAi in cells or in vitro. An antisense region having a length sufficient to mediate a loop region containing about 4 to about 8 nucleotides, and an antisense region It contains a sense region having about 3 to about 18 complementary nucleotides. The symmetric hairpin polynucleic acid molecule further comprises a chemically modified 5'-terminal phosphate group. In a further instance, the loop portion of the asymmetric hairpin polynucleic acid molecule may comprise nucleotides , non-nucleotide, linker molecules, or conjugate molecules.
[0148] In some embodiments, the asymmetric duplex comprises a sense region and an antisense region. A polynucleic acid molecule having two separate strands containing a sense region, wherein the sense region is an antisense region. It has sufficient complementary nucleotides to base pair with the transsense region and form a duplex. The antisense region contains fewer nucleotides than the antisense region. The duplex polynucleic acid molecule is of sufficient length to mediate RNAi in cells or in vitro systems. an antisense region (e.g., about 19 to about 22 nucleotides) having an antisense sequence It contains a sense region having about 3 to about 18 nucleotides complementary to the sense region.
[0149] In some cases, natural DNA / RNA bases are barely distinguishable from universal bases. Nucleotide base analogs that form base pairs with each of the universal bases are non-limiting examples of universal bases. Examples include C-phenyl, C-naphthyl, and other aromatic derivatives known in the art. Conductors, inosine, azole carboxamide, and 3-nitropyrrole, 4-nitro Nitroazoles such as indole, 5-nitroindole, and 6-nitroindole Derivatives (e.g., Loakes, 2001, Nucleic Acids Res (See Earch, 29, 2437-2447).
[0150] Polynucleic acid molecule synthesis In some embodiments, the polynucleic acid molecules described herein are Constructed using chemical synthesis and / or enzymatic ligation reactions using known procedures. For example, polynucleic acid molecules may be constructed using naturally occurring nucleotides or by To increase the biostability of the molecule, or to enhance the affinity of the nucleic acid formed between the polynucleic acid molecule and the target nucleic acid. Various modified nucleotides designed to increase the physical stability of the resulting duplex were used. Exemplary methods are described in U.S. Patents 5,142,047; 5,185 ,444; No. 5,889,136; No. 6,008,400; and No. 6,111 ,086; PCT Publication No. WO2009099942; or European Publication No. 1579015. Additional exemplary methods include those described below. Griffey et al., “2'-O-aminopropyl r ibonucleotides: a zwitterionic modificat ion that enhances the exonuclease resist ance and biological activity of antisensors e oligonucleotides,” J. Med. Chem. 39(26 ):5100-5109 (1997)); Obika, et al. hesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides ha ving a fixed C3, -endo sugar puckering”. Tetrahedron Letters 38 (50): 8735 (1997 ); Koizumi, M. “ENA oligonucleotides as therapeutics”.Current opinion in molecu lar therapeutics 8 (2): 144-149 (2006); and Abramova et al., “Novel oligonucleot ide analogues based on morpholino nucleo side subunits-antisense technologies: ne w chemical possibilities,” Indian Journa l of Chemistry 48B:1721-1726 (2009) Alternatively, The polynucleic acid molecule may be an expression vector into which the polynucleic acid molecule has been subcloned in an antisense orientation. (i.e., the transcribed RNA of the inserted polynucleic acid molecule is (in the antisense orientation relative to the desired target polynucleic acid molecule).
[0151] In some embodiments, the polynucleic acid molecule is synthesized by a tandem synthesis method, Here, both strands are bound to a single adjacent oligonucleotide fragment separated by a cleavable linker. It is synthesized as fragments or strands that are subsequently cleaved to form the double strand. This results in separate fragments or strands that allow for purification of the duplex.
[0152] In some instances, polynucleic acid molecules are also composed of two distinct nucleic acid strands or fragments. wherein one fragment contains the sense region and the second fragment contains the It contains the antisense region of
[0153] Further modification methods, for example to incorporate sugar, base, and phosphate modifications, include: Includes: Eckstein et al., International Public ation PCT No. WO 92 / 07065; l. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Bi°Chem. Sci., 1992, 17, 334-339; Usman et al. ional Publication PCT No. WO 93 / 15187; proat, US Pat. No. 5,334,711 and Beige lman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International P CT publication No. WO 97 / 26270; Beigelma n et al., US Pat. No. 5,716,824; Usman et al., US Pat. No. 5,627,053; Woolf et al., International PCT Publication No. WO 98 / 13526; Thompson et al., US Ser No. 60 / 082,404 which was filed on Apr. 20, 1998; Karpeisky et al., 1998, Tetra hedron Lett., 39, 1131; Earnshaw and Gai t, 1998, Biopolymers (Nucleic Acid Science ces), 48, 39-55; Verma and Eckstein, 199 8, Annu. Rev. Bi°Chem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem. , 5, 1999-2010. The above publication discloses a method for directing a nucleic acid molecule to a nucleic acid molecule without regulating catalytic activity. Methods and strategies for determining locations for incorporating sugar, base, and / or phosphate modifications The technique is described.
[0154] In some instances, phosphorothioates, dithiophosphates, and / or 5'-methyl Chemical modification of internucleotide linkages of polynucleic acid molecules with phosphonate linkages improves stability On the other hand, excessive modification often leads to toxicity or reduced activity. When designing a molecule, the amount of these internucleotide bonds is sometimes minimized. In such cases, reducing the concentration of these bonds reduces the toxicity of these molecules and increases their effectiveness. Increased efficacy and high specificity.
[0155] Nucleic Acid Polypeptide Conjugates In some embodiments, the polynucleic acid molecule further comprises a polypeptide that is delivered to a desired site. Optionally, the polynucleic acid molecule is conjugated to polypeptide A and optionally a polymer Conjugate to part.
[0156] In some instances, at least one polypeptide A is conjugated to at least one B. In some instances, at least one polypeptide A is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, is conjugated to at least one B. In some embodiments, at least one A is , conjugated to the 5' end of B, the 3' end of B, an internal site of B, or any combination thereof. In some instances, at least one polypeptide A is conjugated to at least two Bs. In some examples, at least one polypeptide A has at least 2, 3, 4, 5 , conjugate to 6, 7, 8 or more Bs.
[0157] In some embodiments, at least one polypeptide A is linked to at least one B. conjugated at one end of the ABC conjugate, while at least one C is In some instances, at least one B is conjugated to the opposite end of the One polypeptide A is conjugated at one end to at least one B, while at least one C At least one is conjugated to an internal site of at least one B. In some instances, at least Another polypeptide A is directly conjugated to at least one C. In some instances, at least At least one B is bound to at least one C to form an ACB conjugate. Indirectly conjugated to at least one polypeptide A.
[0158] In some examples, at least one B and / or at least one C, and Optionally, at least one D is conjugated to at least one polypeptide A. In an example, at least one B is attached to at least one polypeptide A at a terminal (e.g., 5' or at an internal site to at least one polypeptide A. In some cases, at least one C is conjugated through at least one polypeptide. conjugated directly to peptide A or indirectly through at least one B. By at least one B, at least one C is at the same end as polypeptide A, at the opposite end from at least one polypeptide A, or are independently conjugated at internal sites. In some instances, at least one additional polypeptide The peptide A is further conjugated to at least one polypeptide A, B, or C. In some examples, at least one D is optionally linked to at least one polypeptide A, at least Conjugate directly or indirectly to one B or at least one C. When conjugated to at least one polypeptide A, at least one D is also ADB-conjugated. Optionally conjugated to at least one B to form a complex, or ADBC complex Optionally conjugate at least one B and at least one C to form a bond. In some instances, to form a DABC conjugate, at least one D must be present. directly to one polypeptide A, and to at least one B and at least one C When indirectly conjugated to at least one polypeptide A, at least and one D is optionally conjugated to at least one B to form an ABD conjugate. or at least one B and at least one C to form an ABDC conjugate. In some instances, at least one additional D may be further conjugated to at least one C. Conjugated to at least one polypeptide A, B, or C.
[0159] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0160] [ka]
[0161] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0162] [ka]
[0163] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0164] [ka]
[0165] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0166] [ka]
[0167] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0168] [ka]
[0169] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0170] [ka]
[0171] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0172] [ka]
[0173] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0174] [ka]
[0175] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0176] [ka]
[0177] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0178] [ka]
[0179] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0180] [ka]
[0181] In some embodiments, the polynucleic acid molecule conjugate comprises a construct as exemplified :
[0182] [ka]
[0183] As shown above
[0184] [ka] are for illustrative purposes only and include humanized antibodies or binding fragments thereof, chimeric antibodies or a monoclonal antibody or a binding fragment thereof, a monovalent Fab ', bivalent Fab2, single-chain variable fragment (scFv), diabody, minibody ( minibody), nanobody, single domain antibody (sdAb), or camelid antibody, or binding fragments thereof.
[0185] joining part In some embodiments, binding moiety A is a polypeptide. The polypeptide is an antibody or a fragment thereof. Optionally, the fragment is In some examples, the antibody or binding fragment thereof is a human antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody antibody or its binding fragment, monoclonal antibody or its binding fragment monovalent Fab', bivalent Fab2, F(ab)'3 fragment, single chain variable fragment (scFv), bis-scFv (scFv)2, diabody, minibody, nanobody , triabodies, tetrabodies, disulfide-stabilized Fv proteins (dsFv), Single domain antibodies (sdAb), Ig NAR, camelid antibodies or their binding fragments Antibodies, bispecific antibodies or binding fragments thereof, or chemically modified derivatives thereof Including the body.
[0186] In some examples, A is an antibody or a binding fragment thereof. A is a humanized antibody or a binding fragment thereof, a murine antibody or a binding fragment thereof antibody, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof fragments, monovalent Fab', bivalent Fab2, F(ab)'3 fragments, single chain variable fragments fragment (scFv), bis-scFv (scFv)2, diabody, minibody, Nanobodies, triabodies, tetrabodies, disulfide-stabilized Fv proteins (" dsFv), single domain antibody (sdAb), Ig NAR, camelid antibody or similar a binding fragment thereof, a bispecific antibody or a binding fragment thereof, or a chemical In some instances, A is a humanized antibody or binding fragment thereof. In some examples, A is a mouse antibody or a binding fragment thereof. In some examples, A is a chimeric antibody or binding fragment thereof. A is a monoclonal antibody or binding fragment thereof. In some examples, A is a bivalent Fab'. In some examples, A is a bivalent Fab2. is a single chain variable fragment (scFv).
[0187] In some embodiments, binding moiety A is a bispecific antibody or binding fragment thereof In some instances, the bispecific antibody is a trifunctional antibody or a bispecific miniantibody. In some cases, the bispecific antibody is a trifunctional antibody. A functional antibody is a full-length monoclonal antibody that contains binding sites for two different antigens. be.
[0188] In some cases, the bispecific antibody is a bispecific miniantibody. Bispecific miniantibodies include bivalent Fab2, F(ab)'3 fragments, bis-scFv (s cFv)2, diabody, minibody, triabody, tetrabody, or bibody In some embodiments, the bispecific T cell engager (BiTE) Specific T cell engagers consist of two scFvs targeting epitopes on two different antigens. It is a fusion protein containing two single-chain variable fragments (scFvs) that target the target.
[0189] In some embodiments, binding moiety A is a bispecific miniantibody. In some examples, A is a bispecific Fab2. In some examples, A is a bispecific F(ab)' Optionally, A is a bispecific bis-scFv. Optionally, A is a bispecific bis-scFv. Thus, in some embodiments, A is a bispecific (scFv). In some embodiments, A is a bispecific minibody. In some embodiments, A is a bispecific triabody. In other embodiments, A is In another embodiment, A is a bispecific tetrabody. The device is called BiTE.
[0190] In some embodiments, binding moiety A is a trispecific antibody. Trispecific antibodies include F(ab)'3 fragments or trispecific antibodies. In some instances, A is a trispecific F(ab)'3 fragment. In some embodiments, A is a trispecific antibody. ,“Development of a trispecific antibody designed to simultaneously and efficiently ly target three different antigens on tu mor cells,” Mol. Pharmaceutics, 12(9): 34 90-3501(2015).
[0191] In some embodiments, binding moiety A is an antibody or is a binding fragment thereof. In some instances, binding moiety A binds to a cell surface molecule on a muscle cell. The antibody or its binding fragment recognizes the protein. Exemplary cell surface proteins recognized by the fragment include, but are not limited to, Sca -1, CD34, Myo-D, myogenin, MRF4, NCAM, CD43, and CD Includes 95 (Fas).
[0192] In some instances, the cell surface protein is a cluster of differentiation (CD) cell surface marker. Exemplary CD cell surface markers include, but are not limited to, CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b , CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23 , CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31 , CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39 , CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD 45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, C D49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD 53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, C D61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64 , CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD103, C D104, CD125 (IL5RA), CD134(OX40), CD137(4-1 BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1 ), CD319 (SLAMF7), CD326 (EpCAM), etc.
[0193] In some instances, the limiting moiety A is an antibody or a binding fragment thereof, recognizes CD cell surface markers. In some instances, binding moiety A recognizes CD1, CD2 , CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, C D15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22 , CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30 , CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38 , CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45 RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD 49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD 52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD w60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63 , CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e , CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD 103, CD104, CD125(IL5RA), CD134(OX40), CD137 (4-1BB), CD152(CTLA-4), CD221, CD274, CD279( PD-1), CD319 (SLAMF7), CD326 (EpCAM), or The antibody or binding fragment thereof recognizes the combination of
[0194] In some embodiments, the binding moiety A is non-specifically conjugated to the polynucleic acid molecule (B). In some instances, binding moiety A binds to a lysine residue or cis- In some instances, the binding moiety A is conjugated to the polynucleic acid molecule (B) via a tein residue. It is conjugated to the polynucleic acid molecule (B) via a lysine residue in a non-site-specific manner. Thus, the binding moiety A binds to the polynucleic acid molecule via a cysteine residue in a non-site-specific manner. Conjugate to (B).
[0195] In some embodiments, binding moiety A binds to the polynucleic acid molecule in a non-site-specific manner. In some instances, the binding moiety A is conjugated to a lysine residue in a site-specific manner. at the 5'-terminus, at the 3'-terminus, via a cysteine residue, an unnatural amino acid, or Enzyme-modified or enzyme-catalyzed residues are conjugated to the polynucleic acid molecule (B). Some examples: In the example, a binding moiety A is attached to a polynucleic acid molecule (B) via a lysine residue in a site-specific manner. In some instances, binding moiety A is conjugated to a cysteine residue in a site-specific manner. In some instances, the binding moiety A is conjugated to the polynucleic acid molecule (B) via a site-specific In some instances, the binding moiety A is conjugated to the polynucleic acid molecule (B) at its 5' end. , is conjugated at its 3' end to a polynucleic acid molecule (B) in a site-specific manner. , the binding moiety A is attached to the polynucleic acid molecule (B) via the unnatural amino acid in a site-specific manner. In some instances, the binding moiety A is conjugated to an enzyme modification or enzyme in a site-specific manner. It is conjugated to a polynucleic acid molecule (B) via the catalyzed residue.
[0196] In some embodiments, one or more polynucleic acid molecules (B) are conjugated to a binding moiety A. In some instances, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16 or more polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 1 polynucleic acid molecule is conjugated to one binding moiety A. In some instances, about 2 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 3 polynucleic acid molecules are conjugated to one binding moiety A. Nucleic acid molecules are conjugated to one binding moiety A. In some instances, about 4 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 5 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 6 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 7 polynucleic acid molecules are conjugated to one binding moiety A. About 8 polynucleic acid molecules are conjugated to one binding moiety A. In some examples, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 11 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 13 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 14 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 15 The polynucleic acid molecule is conjugated to one binding moiety A. In some examples, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, one or more polynucleic acid molecules are the same In other instances, one or more of the polynucleic acid molecules are different.
[0197] In some embodiments, the number of polynucleic acid molecules (B) conjugated to binding moiety A is in the ratio In some instances, the ratio is referred to as the DAR (drug-to-antibody) ratio, and is used herein In some instances, the drug as referred to in the above is a polynucleic acid molecule (B). The DAR ratio of the polynucleic acid molecule (B) to the In some instances, the linking moiety A may be 0, 11, 12, 13, 14, 15, 16 or more. The DAR ratio of the polynucleic acid molecule (B) to the nucleotide sequence of the polynucleic acid molecule (B) is about 1 or greater. The DAR ratio of polynucleic acid molecule (B) to molecule A is about 2 or greater. The DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 3 or greater. In this case, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 4 or more. In one example, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 5 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 6 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 7 In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is In some examples, the DAR of the polynucleic acid molecule (B) relative to the binding moiety A is about 8 or greater. In some instances, the ratio of the polynucleic acid molecule (B) to the binding moiety A is greater than or equal to about 9. The DAR ratio is greater than or equal to about 10. In some examples, the polynucleic acid molecule to binding moiety A The DAR ratio of (B) is about 11 or greater. The DAR ratio of the nucleic acid molecule (B) is about 12 or greater.
[0198] In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 2 In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is: In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 4. , about 5. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is is about 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is In some instances, the DAR of the polynucleic acid molecule (B) relative to the binding moiety A is about 7. The ratio is about 8. In some examples, the DA of the polynucleic acid molecule (B) to the binding moiety A is The R ratio is about 9. In some instances, the D of the polynucleic acid molecule (B) to the binding moiety A The AR ratio is about 10. In some instances, the ratio of the polynucleic acid molecule (B) to the binding moiety A is The DAR ratio of the polynucleic acid molecule ( B) has a DAR ratio of about 12. In some instances, the DAR ratio of the polynucleic acid moiety to the binding moiety A is about 12. The DAR ratio of the molecule (B) is about 13. In some instances, the polynuclear to binding moiety A The DAR ratio of the acid molecule (B) is about 14. In some instances, the DAR ratio of the acid molecule (B) to the binding moiety A is about 14. The DAR ratio of the nucleic acid molecule (B) to the binding moiety A is about 15. The DAR ratio of the polynucleic acid molecule (B) is about 16.
[0199] In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 4. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 12. do.
[0200] In some instances, compared to a conjugate comprising a polynucleic acid molecule (B) without a binding moiety A, In some instances, conjugates comprising a polynucleic acid molecule (B) and a binding moiety (A) have improved activity. The improved activity may be an enhancement of a biologically relevant function, for example, the treatment of a disease state or This results in improved stability, affinity, binding, functional activity, and efficacy in prophylaxis. In some instances, the disease state is the result of one or more mutated exons of a gene. In some instances, the polynucleic acid molecule (B) is more readily attached to the nucleic acid molecule than the conjugate containing the polynucleic acid molecule (B) without the binding moiety A. A conjugate comprising a nucleic acid molecule (B) and a binding moiety (A) binds one or more mutated exons. In some instances, the polynucleic acid molecule without binding moiety A may be Exon skipping is achieved by combining polynucleic acid molecules (B) with exon skipping compared to conjugates containing polynucleic acid molecules (B). In conjugates containing moiety A, at least or about 5%, 10%, 20%, 25%, 30%, %, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% Increase.
[0201] In some embodiments, the antibodies or binding fragments thereof, alone or in combination, In combination with conventional techniques known in the art, e.g., amino acid deletions can be By using deletions, insertions, substitutions, additions, and / or recombinations, and / or or other modifications known in the art (e.g., translational modifications such as glycosylation and phosphorylation). In some instances, the modification is F c receptor. In some instances, one or more The modifications include, for example, those described in International Publication No. WO97 / 34631, discloses the amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. The nucleic acid sequence underlying the amino acid sequence of the antibody or binding fragment thereof may contain such Methods for introducing modifications are well known to those skilled in the art.
[0202] In some instances, the antibody-binding fragment further includes derivatives thereof, and may comprise at least one It comprises a polypeptide sequence comprising two CDRs.
[0203] In some instances, the term "single chain" as used herein refers to a bispecific single chain. The first and second domains of the chain construct are preferably encoded by a single nucleic acid molecule. This means that the amino acids are covalently linked in the form of a colinear amino acid sequence.
[0204] In some instances, the bispecific single chain antibody construct comprises binding domains from two antibodies. In such an embodiment, the bispecific single chain antibody construct comprises a tandem bi In some instances, the scFv is a linker peptide or a diabody. In some instances, the linker comprises a VH and a VL domain connected by a linker. Each of the first and second domains retains its differential binding specificity independently of the other. The length and sequence are sufficient to allow
[0205] In some embodiments, as used herein, a bond with or by Interaction defines the binding / interaction of at least two antigen interaction sites with each other. In some instances, the antigen interaction site is identified as a specific antigen or a specific group of antigens. Define motifs of polypeptides that exhibit the ability to interact with other molecules. In some cases, binding / interaction Interaction is also understood to define specific recognition. In such cases, specific recognition is achieved by antibodies or or the binding fragment is specific for at least two amino acids of each of the target molecules. It refers to the ability to interact and / or combine. For example, a particular recognition , which refers to the specificity of an antibody molecule, or its ability to distinguish a particular range of target molecules. In this example, the specificity of the antigen interaction site and its specific interaction with the antigen can be determined by, for example, the position of the antigen. This leads to signal initiation by inducing conformational changes and oligomerization of antigens. In one embodiment, the coupling is based on the "key-lock-principle" Thus, in some instances, the antigen interaction site and Certain motifs in the amino acid sequence of the antigen, as well as the result of a second modification of the structure, , bind to each other as a result of their primary, secondary, or tertiary structure. In such cases, antigens The specific interaction of the interaction site with its specific antigen allows for easy binding of the site to the antigen. bring about.
[0206] In some instances, the specific interaction may further result in a reduction of the antibody or binding fragment thereof. This refers to less cross-reactivity or reduced off-target effects. peptide / protein but does not bind essentially to any other polypeptides The antibody or binding fragment thereof is specific for the desired polypeptide / protein. Specificity of the antigen interaction site Examples of specific interactions with antigens include ligands The specificity of the antibody with its receptor, e.g., the antigen-binding site of an antibody, This includes interactions with the position.
[0207] conjugation chemistry In some embodiments, polynucleic acid molecule B is conjugated to a binding moiety. The binding moiety can be an amino acid, peptide, polypeptide, protein, antibody, antigen, toxin, or phosphatase. Luminol, lipids, nucleotides, nucleosides, sugars, carbohydrates, polyethylene glycol and polymers such as polypropylene glycol, as well as all of these classes of substances. Additional examples of binding moieties include cholesterol, phospholipids, and the like. Proteins, diacylglycerols and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or substituted), enzyme substrates, biotin, digoxigenin, and polysaccharides In some instances, the binding moiety is an antibody or a binding fragment thereof. In some instances, the polynucleic acid molecule is further conjugated to a polymer, optionally Conjugated to an endosomolytic moiety.
[0208] In some embodiments, the polynucleic acid molecules are synthesized by a chemical ligation process. In some instances, the polynucleic acid molecule is conjugated to the binding moiety by native ligation. In some instances, the conjugation is performed as described in Dawson, et al. Synthesis of proteins by native chemical ligation,” Science 1994, 266, 776-779; Dawson, et al. in Native Chemical Ligation through the Use of Thiol Additives,” J. Am. Chem. S oc. 1997, 119, 4325-4329; Hackeng, et al “Protein synthesis by native chemical ligation: Expanded scope by using straig htforward methodology.,” Proc. Natl. Aca d. Sci. USA 1999, 96, 10068-10073; or Wu , et al. “Building complex glycopeptides : Development of a cysteine-free native chemical ligation protocol,” Angew. Chem As described in Int. Ed. 2006, 45, 4116-4125. In some instances, the conjugate is as described in U.S. Pat. No. 8,936,910. In some embodiments, the polynucleic acid molecule is ligated via native ligation chemistry. and conjugates to the binding moiety in a site-specific or non-specific manner.
[0209] In some instances, the polynucleic acid molecule may be a "traceless" Conjugation to binding moieties in a site-directed manner using ring technology (PhiloChem) In some instances, the "traceless" coupling technique is used to prepare polymers containing aldehyde groups. It utilizes the N-terminal 1,2-aminothiol group of the binding moiety which is then conjugated to a nucleic acid molecule. (Casi et al., “Site-specific traceless c oupling of potent cytotoxic drugs to rec ombinant antibodies for pharmacodelivery ,” JACS 134(13): 5887-5892 (2012)
[0210] In some instances, the polynucleic acid molecule utilizes unnatural amino acids introduced into the binding moiety. In some instances, the unnatural amino acid is conjugated to the binding moiety in a site-directed manner. p-acetylphenylalanine (pAcPhe). In some instances, pAcPhe The keto group of e is selected for the alkoxy-amine derived conjugated moiety to form an oxime bond. (Axup et al., "Synthesis of sit e-specific antibody-drug conjugates usin g unnatural amino acids,” PNAS 109(40): 16101-16106 (2012).
[0211] In some instances, polynucleic acid molecules are synthesized in a site-directed manner utilizing an enzyme-catalyzed process. In some instances, the site-directed method utilizes SMARTag™ technology. In some instances, SMARTag™ technology utilizes Formylglycine-generating enzyme (FGE) via an oxidation process in the presence of an aldehyde tag Formation of formylglycine (FGly) residue from cysteine by hydrazino -Alkylhydra via Pictet-Spengler (HIPS) ligation The subsequent conjugation of FGly to a nucleotide-functionalized polynucleic acid molecule (Wu et al., “Site-specific chemical modification of recombinant proteins produced in mammals an cell by using the genetically encoded d aldehyde tag,” PNAS 106(9): 3000-3005 (2009); Agarwal, et al., “A Pictet-Speng ler ligation for protein chemical modification cation,” PNAS 110(1): 46-51 (2013)
[0212] In some instances, the enzyme-catalyzed process involves the use of microbial transglutaminase (mTG). In some instances, the polynucleic acid molecule is selected from the group consisting of a microbial transglutaminase-catalyzed process In some instances, mTG is conjugated to a binding moiety using the amino acid sequence of glutamine in the recognition sequence. The amide side chains catalyze the formation of covalent bonds between the amide side chains and primary amines of functionalized polynucleic acid molecules. In some instances, mTG has been shown to be effective against Streptomyces mobaraensis (Streptomyces ces mobarensis) (Strop et al., "L location matters: site of conjugation mod stability and pharmacokinetics of antibody drug conjugates,” Chemistry an d Biology 20(2) 161-167 (2013)
[0213] In some instances, the polynucleic acid molecule is a W molecule that utilizes a sequence-specific transpeptidase. The conjugated moiety is conjugated by the method described in WO2014 / 140317.
[0214] In some instances, the polynucleic acid molecule is a nucleic acid molecule as described in U.S. Patent Publication No. 2015 / 0105539 and and 2015 / 0105540.
[0215] Production of antibodies or their binding fragments In some embodiments, the polypeptides described herein are used in combination with other polypeptides (e.g., antibodies). The binding fragments thereof are in particular derived from polypeptides, either by chemical synthesis or by recombinant expression. Any method known in the art for the synthesis of peptides (e.g., antibodies) can be used. and preferably produced by recombinant expression techniques.
[0216] In some instances, the antibody or binding fragment thereof is recombinantly expressed and the antibody or The nucleic acid encoding the binding fragment can be prepared from a chemically synthesized oligonucleotide. Assembled (e.g., Kutmeier et al., 1994, BioTech (as described in Uniques 17:242), which involves PCR to generate a fragment encoding the antibody. Synthesis of overlapping oligonucleotide-containing segments, annealing of those oligonucleotides ligation and subsequent amplification of the ligated oligonucleotides This includes the synthesis of
[0217] Alternatively, the nucleic acid molecule encoding the antibody may contain sequences that hybridize to the 3' and 5' ends of the sequence. by PCR amplification using synthetic primers that can be used to identify specific gene sequences Cloning using oligonucleotide probes specific for the sequence allows for the identification of appropriate a variety of sources (e.g., antibody cDNA libraries or any cDNA libraries generated from tissues or cells of the target gene.
[0218] In some instances, the antibody or conjugate thereof is cultured in a rabbit culture medium to generate polyclonal antibodies. or more preferably by immunizing animals such as geese, e.g., by immunizing the genomic DNA of a mammal, e.g., by immunizing ... r and Milstein (1975, Nature 256:495-497) or as described by Kozbor et al. (1983, Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R.L iss, Inc., pp. 77-96). Alternatively, at least the Fab fragment of the antibody may be generated by generating a Fab fragment of the antibody. The clones encoding the fragments were used to clone FAb fragments that bind to specific antigens. For this purpose, Fab expression libraries (e.g., Huse et al., 1989, Sci ence 246:1275-1281). or antibody libraries (Clackson et al., 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937) can be obtained at will by
[0219] In some embodiments, together with genes for suitable biologically active human antibody molecules, By splicing genes from mouse antibody molecules of appropriate antigen specificity, mela antibody" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al. , 1984, Nature 312:604-608; Takeda et al. ., 1985, Nature 314:452-454) Chimeric antibodies are antibodies in which different portions are derived from a mouse monoclonal antibody. and animal species having human immunoglobulin constant regions (e.g., humanized antibodies). It is a molecule derived from a variety of animal species.
[0220] In some embodiments, single chain antibodies (US Pat. No. 4,694, 778; Bird, 1988, Science 242:423-42; ton et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989 The techniques described for the production of single chain antibodies (Nature 334:544-54) are Single chain antibodies are suitable for producing the heavy chain or heavy chains of the Fv region separated by an amino acid bridge. is formed by joining fragments of the light chain to give a single polypeptide chain Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (S Kerra et al., 1988, Science 242:1038-104 1).
[0221] In some embodiments, an expression vector comprising the nucleotide sequence of an antibody or The nucleotide sequence of the vector can be introduced into the host cell using conventional techniques (e.g., electroporation, liposome transfer, etc.). and calcium phosphate precipitation reaction) into host cells. The transfected cells are then cultured by conventional techniques to produce the antibody. In certain embodiments, antibody expression is constitutive, inducible, or tissue-specific. is regulated by the motor.
[0222] In some embodiments, various host-expression vector systems can be used to express the antibodies described herein. Such host expression systems are utilized to express the polypeptides or binding fragments thereof. The coding sequence of the antibody represents the vehicle by which it is generated and subsequently purified, but the appropriate nucleotide sequence When modified or transfected with a coding sequence, the antibody or its binding fragment These include, but are not limited to, recombinant bacteria. phage DNA, plasmid DNA, or antibodies or binding fragments thereof Bacteria (e.g., E. coli and Bacillus subtilis) transformed with cosmid DNA expression vectors containing the cosmid sequence Microorganisms such as Bacillus subtilis; recombinant yeast containing antibody or binding fragment coding sequences; Yeast (e.g., Saccharomyces pichia) transformed with the present vector; antibodies or Insect cell lines infected with recombinant viral expression vectors containing the binding fragment coding sequence of (e.g., baculovirus); recombinant viral expression vectors (e.g., cauliflower mosaic); infected with CaMV and tobacco mosaic virus (TMV), and a recombinant plasmid expression vector containing an antibody or binding fragment thereof coding sequence plant cell lines transformed with (e.g., Ti plasmids); or mammalian cells (e.g., For example, the metallothionein promoter) or the genome of a mammalian virus (e.g., For example, the promoter derived from the adenovirus late promoter; the vaccinia virus 7.5K promoter Mammalian cell lines (e.g., COS) that harbor recombinant expression constructs containing the promoter , CHO, BH, 293, 293T, 3T3 cells).
[0223] For long-term, high-yield production of recombinant proteins, stable expression is preferred. In some instances, cell lines that stably express the antibody are optionally engineered. Rather than using expression vectors containing an origin of replication, the host cell must contain appropriate expression control elements. Elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation The transformant is transformed with DNA controlled by a selectable marker (e.g., a gene encoding the exogenous D After NA introduction, cells are engineered to grow in enriched media for 1-2 days, then transferred to selective media. The selectable marker in the recombinant plasmid confers resistance to selection, The cells are allowed to stably integrate the plasmid into their chromosomes and are then cloned and spread into cell lines. This method involves the use of antibodies or their binding fragments to form foci that are sensitive to the antibody. This can be advantageously used to engineer cell lines that preferentially express the desired fragment.
[0224] Some examples include, but are not limited to, tk-, hgprt-, or apr-, respectively. Herpes simplex virus thymidine kinase (HSV-THK) is recruited by T-cells (Wigler et al. ., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyl lysyltransferase (Szybalska & Szybalski, 192, P roc. Natl. Acad. Sci. USA 48:202), and adenosine phosphoribosyltransferase (Lowy et al., 1980, Cell Many selection systems are used, including the genotype (I 22:817). Sex is used as a selection criterion for the following genes: resistance to methotrexate dhfr (Wigler et al., 1980, Proc. Natl Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527 ); gpt (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:207 2); neo (Clinical P harmacy 12:488-505; Wu and Wu, 1991, Bio therapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mul Ligan, 1993, Science 260:926-932; rgan and Anderson, 1993, Ann. Rev. Bioch em. 62:191-217; May, 1993, TIB TECH 11(5 ):155-215), and hygro (San Terre et al., 1984, Gene 30:147). Known methods in the art of DNA technology are generally described in Ausubel et al. al. (eds., 1993, Current Protocols in M Olecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expre. ssion, A Laboratory Manual, Stockton Pre ss, NY; and in Chapters 12 and 13, Draco poli et al. (eds), 1994, Current Protocol ls in Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1).
[0225] In some instances, antibody expression levels are increased by vector amplification (see for review). For example, Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammals ian cells in DNA cloning, Vol. 3. (Acade (See Microbiol. Press, New York, 1987). Antibody-expressing vectors When the marker in the system is amplifiable, the level of inhibitor present in the host cell culture The increase in the number of copies of the marker gene increases the number of copies of the amplified region. Because of the sequence relatedness, antibody production also increases (Crouse et al., 19 83, Mol. Cell Biol. 3:257).
[0226] In some instances, methods known in the art for purifying or analyzing antibodies or antibody conjugates are used. Any known method may be used, for example, chromatography (e.g., ion exchange, affinity chromatography, etc.). The affinity to specific antigens after protein A and sizing columns chromatography), centrifugation, differential solubility, or other methods for protein purification. Exemplary chromatographic methods include, but are not limited to, those used by standard techniques. However, strong anion exchange chromatography, hydrophobic interaction chromatography, These include size exclusion chromatography, and fast protein liquid chromatography. can be.
[0227] Polymer conjugated moiety In some embodiments, the polymer moiety C further comprises a polynuclear polymer as described herein. The compound may be conjugated to an acid molecule, a binding moiety described herein, or a combination thereof. In some instances, the polymer moiety C is conjugated to a polynucleic acid molecule. Moiety C is conjugated to a binding moiety. In other cases, polymer moiety C is a polynucleic acid molecule binding moiety. In further cases, the polymer moiety C is conjugated as illustrated above.
[0228] In some examples, the polymer portion C may comprise a branched or unbranched monomer, and and / or natural or synthetic polymers consisting of long chains of cross-linked networks of two- or three-dimensional monomers. In some examples, the polymer moiety C is a polysaccharide, lignin, rubber, or a synthetic polymer. , or polyalkylene oxides (e.g., polyethylene glycol). In some examples, at least one polymer moiety C may include, but is not limited to, alpha, omega, -dihydroxyl polyethylene glycol, a biodegradable lactone-based polymer, e.g. For example, polyacrylic acid, polylactide acid (PLA), poly(glycolic acid) (PGA), Polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, Polyimide, polyethylene terephthalate (PET, PETG), polyethylene terephthalate Polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethane As used herein, a mixture includes a block copolymer, a cyclohexyl ether ... As in the context of polymers, it refers to the use of various polymers within the same compound. Thus, a block copolymer is a polymer in which at least one portion of a polymer is a unit of another polymer. In some examples, the polymer moiety C is a polymer constructed from a polyalkylene In some examples, polymer moiety C comprises PEG. The polymer moiety C is polyethylene imide (PEI) or hydroxyethyl starch. (HES) included.
[0229] In some instances, C is a PEG moiety. In some instances, the PEG moiety is a polynucleic acid. The binding moiety is conjugated at the 5' end of the molecule, while the binding moiety is conjugated at the 3' end of the polynucleic acid molecule. In this example, the PEG moiety is conjugated at the 3' end of the polynucleic acid molecule, while the conjugation moiety is In some instances, the PEG moiety is conjugated to an internal site of the polynucleic acid molecule. In some instances, the PEG moiety, the linking moiety, or a combination thereof, is linked to a polynucleic acid. Conjugation to an internal site of the molecule. In some instances, the conjugate is a direct conjugate. In some instances, conjugation is via native ligation.
[0230] In some embodiments, the polyalkylene oxide (e.g., PEG) is polydisperse or In some instances, polydisperse materials have an average weight (weight average) size of It includes a dispersed distribution of materials of different molecular weights, characterized by size and dispersity. Some examples In some embodiments, C is a monodisperse PEG containing molecules of one size. Polydisperse or monodisperse polyalkylene oxides (e.g., PEG) with the indicated molecular weights represents the average molecular weight of the polyalkylene oxide (eg, PEG) molecules.
[0231] In some embodiments, the molecular weight of the polyalkylene oxide (e.g., PEG) is Approximately 200, 300, 400, 500, 600, 700, 800, 900, 1000, 11 00, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 18 00, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 26 00, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 37 50, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 60 00, 6500, 7000, 7500, 8000, 10,000, 12,000, 20, 000, 35,000, 40,000, 50,000, 60,000, or 100,0 00 Da.
[0232] In some embodiments, C is a polyalkylene oxide (e.g., PEG), Approximately 200, 300, 400, 500, 600, 700, 800, 900, 1000, 11 00, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 18 00, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 26 00, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 37 50, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 60 00, 6500, 7000, 7500, 8000, 10,000, 12,000, 20, 000, 35,000, 40,000, 50,000, 60,000, or 100,0 In some embodiments, C is PEG and has a molecular weight of 200 Da. , 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1 200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1 900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2 700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4 000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6 500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 D In some instances, C has a molecular weight of about 200 Da. In some examples, the molecular weight of C is about 300 Da. In some examples, the molecular weight of C is about 400 Da. In some examples, the molecular weight of C is about 500 Da. In some examples, C has a molecular weight of about 600 Da. In some instances, C has a molecular weight of about 700 Da. In some instances, the molecular weight of C is about 800 Da. In some instances, the molecular weight of C is In some instances, the molecular weight of C is about 1000 Da. In some examples, the molecular weight of C is about 1100 Da. In some instances, the molecular weight of C is about 1300 Da. In some instances, the molecular weight of C is about 1400 Da. In some instances, the molecular weight of C is about 1450 Da. In some instances, the molecular weight of C is about 1500 Da. In some instances, the molecular weight of C is about 1600 Da. In some instances, the molecular weight of C is about 1800 Da. In some instances, C has a molecular weight of about 2000 Da. In some instances, the molecular weight of C is about 2100 Da. In some instances, C has a molecular weight of about 2200 Da. In some instances, C has a molecular weight of about 2300 Da. In some instances, the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2500 Da. In some instances, the molecular weight of C is about 2600 Da. In some instances, the molecular weight of C is about 2700 Da. In some instances, the molecular weight of C is about 2900 Da. In some examples, the molecular weight of C is about 3000 Da. In some instances, the molecular weight of C is about 3350 Da. In some instances, the molecular weight of C is about 3500 Da. In some instances, the molecular weight of C is about 3750 Da. In some instances, the molecular weight of C is about 4000 Da. In some instances, the molecular weight of C is about 4250 Da. In some instances, the molecular weight of C is about 4600 Da. In some instances, C has a molecular weight of about 5000 Da. In some instances, the molecular weight of C is about 5500 Da. In some instances, C has a molecular weight of about 6500 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7500 Da. In some instances, the molecular weight of C is about 8000 Da. In some instances, the molecular weight of C is about 10,000 Da. In some instances, the molecular weight of C is In some instances, the molecular weight of C is about 20,000 Da. In some instances, the molecular weight of C is about 35,000 Da. In some instances, the molecular weight of C is about 50,000 Da. In some instances, the molecular weight of C is about 60,000 Da. The amount is approximately 100,000 Da.
[0233] In some embodiments, the polyalkylene oxide (e.g., PEG) may be a polyalkylene oxide having separate esters. Some contain ethylene oxide units (e.g., 4 to about 48 ethylene oxide units). In some instances, the polyalkylene oxide containing discrete ethylene oxide units is linear. In an example, the polyalkylene oxide comprising discrete ethylene oxide units is branched.
[0234] In some examples, the polymer moiety C is a polyalkylene containing discrete ethylene oxide units. Optionally, the polymer moiety C is from about 4 to about 48 ethylene oxide (e.g., PEG). In some cases, polymer portion C comprises about 4, about 5, about 6, about 7 , about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, approx. 19, approx. 20, approx. 21, approx. 22, approx. 23, approx. 24, approx. 25, approx. 26, approx. 27, approx. 28, approx. 29, approx. 30, approx. 31, approx. 32, approx. 33, approx. 34, approx. 35, approx. 36, approx. 37, approx. 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, or about 48 ethylene oxide units.
[0235] In some examples, polymer portion C contains, for example, about 4 to about 48 ethylene oxide units. In some cases, the polymer moiety C may comprise another PEG having, for example, about 4, about 5, about 6, Approx. 7, Approx. 8, Approx. 9, Approx. 10, Approx. 11, Approx. 12, Approx. 13, Approx. 14, Approx. 15, Approx. 16, Approx. 17 , about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27 , about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37 , about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47 or about 48 ethylene oxide units. The polymer moiety C is, for example, a discrete PEG containing about 4 ethylene oxide units. Thus, polymer portion C may be, for example, a discrete PEG containing about 5 ethylene oxide units. In some cases, the polymer portion C may be another polymer containing, for example, about 6 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 7 ethylene oxide units. In some cases, the polymer moiety C is a discrete PEG containing, for example, about 8 ethyl units. In some cases, polymer portion C is a discrete PEG containing ethylene oxide units, e.g. For example, a discrete PEG containing about 9 ethylene oxide units. Moiety C is, for example, a discrete PEG containing about 10 ethylene oxide units. where polymer moiety C is, for example, a discrete PEG containing about 11 ethylene oxide units. In some cases, polymer portion C may be a separate polymer containing, for example, about 12 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 13 ethylene oxide PEG. In some cases, the polymer moiety C is a discrete PEG containing, for example, about 14 ethylene units. In some cases, polymer moiety C is a discrete PEG containing ethylene oxide units, e.g. For example, a discrete PEG containing about 15 ethylene oxide units. - Moiety C is, for example, a discrete PEG containing about 16 ethylene oxide units. Thus, polymer portion C may be, for example, a discrete PEG containing about 17 ethylene oxide units. In some cases, polymer portion C contains, for example, about 18 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 19 ethylene oxide. In some cases, the polymer moiety C is a separate PEG containing a hydroxyl group unit, e.g., about 2 0 ethylene oxide units. In some cases, polymer moiety C is For example, discrete PEGs containing about 21 ethylene oxide units. The polymer moiety C is, for example, a discrete PEG containing about 22 ethylene oxide units. In some cases, polymer portion C may be a discrete PE copolymer containing, for example, about 23 ethylene oxide units. G. In some cases, the polymer moiety C contains, for example, about 24 ethylene oxide units. In some cases, the polymer moiety C is a separate PEG containing, for example, about 25 ethylenediamines. In some cases, polymer moiety C is a discrete PEG containing an oxide unit, e.g. A separate PEG containing about 26 ethylene oxide units. C is, for example, a discrete PEG containing about 27 ethylene oxide units. , polymer moiety C is, for example, a discrete PEG containing about 28 ethylene oxide units. In some cases, polymer portion C may be a separate polymer containing, for example, about 29 ethylene oxide units. PEG. In some cases, the polymer moiety C is, for example, about 30 ethylene oxide units. In some cases, polymer moiety C is a separate PEG containing, for example, about 31 ethyl groups. In some cases, polymer portion C is a discrete PEG containing ethylene oxide units, e.g. For example, a discrete PEG containing about 32 ethylene oxide units. Moiety C is, for example, a discrete PEG containing about 33 ethylene oxide units. In this case, polymer portion C is, for example, a discrete PEG containing about 34 ethylene oxide units. In some cases, polymer portion C may be another polymer containing, for example, about 35 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 36 ethyleneoxy In some cases, the polymer portion C is a discrete PEG containing, for example, about 37 Optionally, polymer moiety C is a discrete PEG containing ethylene oxide units. For example, a discrete PEG containing about 38 ethylene oxide units. The mer moiety C is, for example, a discrete PEG containing about 39 ethylene oxide units. Thus, polymer moiety C may be, for example, a discrete PEG containing about 40 ethylene oxide units. In some cases, polymer portion C contains, for example, about 41 ethylene oxide units. In some cases, the polymer moiety C is a discrete PEG containing, for example, about 42 ethylene oxide. In some cases, the polymer moiety C is a discrete PEG containing an oxide unit, e.g., about 43 ethylene oxide units. In some cases, polymer moiety C is a discrete PEG containing, for example, about 44 ethylene oxide units. Polymer portion C is, for example, a discrete PEG containing about 45 ethylene oxide units. In some cases, the polymer portion C may be a discrete P copolymer containing, for example, about 46 ethylene oxide units. EG. In some cases, polymer portion C is, for example, about 47 ethylene oxide units. In some cases, the polymer moiety C is a separate PEG comprising, for example, about 48 ethylene The PEGs are separate PEGs containing carboxylate units.
[0236] In some cases, polymer moiety C is dPEGR (Quanta Biodesign Ltd).
[0237] In some embodiments, the polymer moiety C is a cationic mucic acid-based polymer. In some instances, the cMAP comprises at least one repeating subunit. The subunit structure is represented by the formula (∨):
[0238] [ka]
[0239] where m, in each occurrence, is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 and n is, in each occurrence, independently, 0. , 1, 2, 3, 4, or 5. In some embodiments, m and n are, for example, It is about 10.
[0240] In some instances, cMAP is further conjugated to a PEG moiety, resulting in a cMAP-PEG copolymer. mer, mPEG-cMAP-PEGm triblock polymer, or cMAP-PEG In some instances, the PEG moiety is about 500 In some instances, the PEG moiety ranges from about 50 Da to about 50,000 Da. 0 Da to approximately 1000 Da, 1000 Da or more to approximately 5000 Da, 5000 Da or more to approximately 10,000 Da, 10,000 or more to approximately 25,000 Da, 25,000 or more to approximately 50,000 Da, or any combination of two or more of these ranges.
[0241] In some examples, the polymer moiety C is a cMAP-PEG copolymer, mPEG-cMAP-PEG copolymer, AP-PEGm triblock polymer or cMAP-PEG-cMAP triblock In some cases, polymer moiety C is a cMAP-PEG copolymer. In other cases, polymer segment C is an mPEG-cMAP-PEGm triblock polymer. In a further case, the polymer moiety C is a cMAP-PEG-cMAP triblock. It is a copolymer.
[0242] In some embodiments, the polymer moiety C is a polynucleic acid moiety, as exemplified above. The molecule is conjugated to a binding moiety and, optionally, an endosomolytic moiety.
[0243] Endosomolytic moiety In some embodiments, the molecule of formula (I): AXBYC further comprises an additional In some instances, the additional conjugated moiety is an endosomolytic moiety. In some cases, the endosomolytic moiety is transported to endosomes, lysosomes, or the endoplasmic reticulum (ER). ), Golgi apparatus, microtubules, peroxisomes, or other endoplasmic reticulum with cells. compounds that can be released from any of the cell compartments known in the art. In some cases, the endosomolytic moiety is a cellular compartment-releasing component. endosomolytic polypeptides, endosomolytic polymers, endosomolytic lipids, or enzymes In some cases, the endosomolytic moiety comprises an endosomolytic small molecule. In other cases, the endosomolytic moiety comprises an endosomolytic polypeptide. Contains a degradable polymer.
[0244] Endosomolytic Polypeptides In some embodiments, the molecule of formula (I), AXBYC, further comprises endo Optionally, the endosomolytic polypeptide is conjugated to an endosomolytic polypeptide. The polypeptides are pH-dependent membrane-active peptides. In some cases, endosomolytic polypeptides In additional cases, the endosomolytic polypeptide is an amphipathic polypeptide. In some instances, the endosomolytic polypeptide is a peptide mimetic. , melittin, mucin (meucin), or their respective derivatives. In one example, the endosomolytic polypeptide comprises INF or its respective derivative. In other cases, the endosomolytic polypeptide is melittin or its respective derivative. In further instances, the endosomolytic polypeptide is a mucin or its derivatives. This includes derivatives of each.
[0245] In some instances, INF7 is a 24-residue polypeptide, and these sequences are IFGEIEELIEEGLENLIDWGNA (SEQ ID NO: 1), or Contains GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO: 2) In some examples, INF7 or a derivative thereof comprises the following sequence: GLFEAIE GFIENGWEGMIWDYGSGSCG (SEQ ID NO: 3), GLFE AIEGFIENGWEGMIDG WYG-(PEG)6-NH2 (SEQ ID NO: 4), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K (GalNAc)2 (SEQ ID NO: 5).
[0246] In some cases, melittin is a 26-residue polypeptide, and this sequence is LKVLATGLPTLISWIKNKRKQ (SEQ ID NO: 6), or G Contains IGAVLKVLTTGLPALISWIKRKRQQ (SEQ ID NO: 7) In some instances, melittin may be a polypeptide as described in U.S. Pat. No. 8,501,930. It contains a peptide sequence.
[0247] In some instances, mucins are found in the venom of the scorpion Mesobuthus eupeus. In some cases, mucins are mucin-13, an antimicrobial peptide (AMP) derived from the mucin gland. These sequences are IFGAIAGLLKNIF-NH2 (SEQ ID NO: 1) The mucin-18 sequence contains FFGHLFKLATKIIPSLFQ (SE Q ID NO:9).
[0248] In some instances, the endosomolytic polypeptide has a sequence similar to that of INF7 or At least 50%, 60%, 70%, 80%, 90%, 95% or more of its derivatives or a polypeptide having 99% or more sequence identity with melittin or a derivative thereof, or In some instances, the endosomolytic moiety comprises an IFN-γ receptor or a derivative thereof. 7 or its derivatives, melittin or its derivatives, or mucin or its derivatives nothing.
[0249] In some examples, the endosomolytic moiety is INF7 or a derivative thereof. In some instances, the endosomolytic moiety is at least as strong as SEQ ID NOs: 1-5. 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% Polypeptides with 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a nucleotide sequence similar to that of SEQ ID NO:1. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, with 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some examples, the endosomolytic moiety comprises a polypeptide having SEQ ID NO: At least 50%, 55%, 60%, 65%, 70%, 75% for 2-5, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to Optionally, the endosomolytic moiety comprises SEQ ID NO: 1. Optionally, the endosomolytic moiety comprises SEQ ID NOS:2-5. Optionally, the endosomolytic moiety comprises SEQ ID NO:2- It consists of 5.
[0250] In some instances, the endosomolytic moiety is melittin or a derivative thereof. In some instances, the endosomolytic moiety has a low affinity to SEQ ID NO:6 or 7. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, Polynucleotides with 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a peptide of SEQ ID NO: At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% of 6 %, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a polypeptide having SEQ At least 50%, 55%, 60%, 65%, 70%, 75% of ID NO:7, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to Optionally, the endosomolytic moiety comprises SEQ ID NO:6. Optionally, the endosomolytic moiety comprises SEQ ID NO: 6. Optionally, the endosomolytic moiety consists of SEQ ID NO:7. do.
[0251] In some instances, the endosomolytic moiety is a mucin or a derivative thereof. In some instances, the endosomolytic moiety may be at least 5'-amino-2'-methyl-1'-propanol relative to SEQ ID NO:8 or 9. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 9 Polypeptides with 5%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a peptide of SEQ ID NO:8 At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety includes a polypeptide having SEQ ID NO: 1. D NO:9 at least 50%, 55%, 60%, 65%, 70%, 75%, 8 0%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to S Optionally, the endosomolytic moiety comprises SEQ ID NO:8. Optionally, the endosomolytic moiety comprises SEQ ID NO:8. Optionally, the endosomolytic moiety consists of SEQ ID NO:9. .
[0252] In some examples, the endosomolytic moiety comprises a sequence as illustrated in Table 1.
[0253] [Table 1-1]
[0254] [Table 1-2]
[0255] In some cases, the endosomolytic moiety inhibits Bcl-2 and / or Bcl-xL Bak BH3 polypeptide induces apoptosis through antagonism of inhibitory gene targets such as In some instances, the endosomolytic moiety comprises a hydroxylase inhibitor such as those described in Albarran, et al. al., “Efficient intracellular delivery o fa pro-apoptotic peptide with a pH-resp onsive carrier,” Reactive & Functional P Polymers 71: 261-265 (2011) Contains lipids.
[0256] In some instances, the endosomolytic moiety is a compound described in PCT Publication WO2013 / 166 155 or WO2015 / 069587 (e.g. , cell-penetrating polypeptides).
[0257] Linker In some embodiments, the linkers described herein are cleavable linkers or In some instances, the linker is a cleavable linker. In other instances, the linker is a non-cleavable linker.
[0258] In some cases, the linker is a non-polymeric linker. A non-polymeric linker is a polymeric linker. refers to a linker that does not contain repeating units of the monomers produced by the process. Examples of the polymer linker include, but are not limited to, C1-C6 alkyl groups (e.g., C5, C4 , C3, C2, or C1 alkyl group), homobifunctional cross-linker, heterobifunctional Cross-linker, peptide linker, traceless linker, self-immolative linker, maleimide In some cases, non-poly The mer linker may be a C1-C6 alkyl group (e.g., C5, C4, C3, C2, or C 1 alkyl group), homobifunctional cross-linker, heterobifunctional cross-linker, peptide linker linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or includes combinations thereof. In further cases, the non-polymeric linker may comprise more than two Linkers of the same type, e.g., more than two homobifunctional cross-linkers, or two In further cases, the non-polymeric linker may optionally include a peptide linker of more than Contains one or more reactive functional groups.
[0259] In some instances, the non-polymeric linker does not include a polymer as described above. In some examples, the non-polymeric linker comprises a polymer surrounded by polymer moieties C. In some cases, the non-polymeric linker is a polyalkylene oxide (e.g., PE G). In some cases, the non-polymeric linker does not include PEG.
[0260] In some examples, the linker comprises a homobifunctional linker. The anchor may be, but is not limited to, Lomant's reagent dithiobis(succinimidyl propionate). nate) DSP, 3',3'-dithiobis(sulfosuccinimidyl proprionate (D TSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) Suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinate Imidyl tartrate (Sulfo-DST), Ethylene glycobis(succinimidyl succinate) Disuccinimidyl glutarate (DSG) (EGS))), N,N'-disuccinimidyl glutarate Dimethyl adipimidate (DMA), dimethyl pimelimide Dimethyl suberimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3 '-Dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridinyl) Dithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH ), for example, 1,5-difluoro-2,4-dinitrobenzene, 1,3-difluoro-4 Aryl halide-containing compounds such as 4,6-dinitrobenzene (DFDNB), 4,4' -difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-( 4-Azidosalicylamido)ethyl]disulfide (BASED), formaldehyde, Glutaraldehyde, 1,4-butanediol diglycidyl ether, adipate dihydrogen phosphate hydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine Diiodo-p-xylene sulfonic acid, N, N'-ethylene-bis(iodoacetamide) or N,N'-hexamethylene- Contains bis(iodoacetamide).
[0261] In some embodiments, the linker comprises a heterobifunctional linker. Bifunctional linkers include, but are not limited to, amine-reactive and sulfhydryl-crosslinking linkers. , for example, N-succinimidyl 3-(2-pyridyldithio)propionate (sPD P), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC- sPDP), a water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)propionate Phosphate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl- α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[α -methyl-α-(2-pyridyldithio)toluamide]hexanoate (sulfoLC-sMP T), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxamide sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexyl methyl ester (sMCC), Sulfo-sMCC, m-maleimidobenzoyl-N-hydro m-Maleimidobenzoyl-N-hydroxysuccinimide esters (MBs), m-Maleimidobenzoyl-N-hydroxysuccinimide esters (MBs), sulfosuccinimide ester (sulfo-MB), N-succinimidyl (4-iodoacetate) 4-iodobenzoic acid (sIAB), sulfosuccinimidyl (4-iodobenzoate) Succinimidyl-4-(p-maleimidyl)aminobenzoate (sulfo-sIAB), succini ... Sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), N-(γ-maleimidobutyryloxy)succinimide ester (GM B) (Sulfo-sMPB)-N-(γ-maleimidobutyryloxy)sulfosuccinimide Iodoester (Sulfo-GMB), Succinimidyl 6-((iodoacetyl)amino) ) hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)acetate amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-( ((Iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC) , succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexa (sIACX), p-nitrophenyl iodide Acetate (NPIA), 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH) , 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8( M2C2H), 3-(2-pyridyldithio)propionylhydrazide (PDPH), etc. Carbonyl-reactive and sulfhydryl-reactive cross-linkers, amine-reactive and photoreactive reactive cross-linkers, such as N-hydroxysuccinimidyl-4-azidosalicylate (NH-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylate (S sulfosuccinimidyl-(4-azidosalicylamide) hexa Phosphate (sulfo-NH-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosuccinimidyl) Lithylamido)ethyl-1,3'-dithiopropionate (sAsD), N-hydroxy Succinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinate Imidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-( 4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfos Succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (S sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide ( ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamide N-succinimidyl- 4(4-azidophenyl) 1,3'-dithiopropionate (sADP), N-sulfosulfonyl Chuccinimidyl (4-azidophenyl)-1,3'-dithiopropionate (sulfo-s ADP), sulfosuccinimidyl 4-(ρ-azidophenyl)butyrate (sulfo-sA PB), sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetate Amido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimide 7-Azido-4-methylcoumarin-3-acetate (sulfo-sAMCA), ρ-nitro Phenyl diazopyruvate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3 ,3-trifluoropropionate (PNP-DTP), sulfhydryl-reactive and photo- Reactive cross-linkers, such as 1-(ρ-azidosalicylamido)-4-(iodoacetate) N-[4-(ρ-azidosalicylamido)butyl]-3 '-(2'-pyridyldithio)propionamide (APDP), benzophenone-4-iodo Benzophenone-4-maleimidocarbonyl reactive and photoreactive Cross-linkers, e.g., ρ-azidobenzoylhydrazide (ABH), carboxylate reactions and photoreactive cross-linkers, e.g., 4-(ρ-azidosalicylamido)butyl azide. amine (AsBA), and arginine reactive and photoreactive cross-linkers, e.g., Contains p-azidophenylglyoxal (APG).
[0262] In some instances, the linker comprises a reactive functional group. In some instances, the reactive functional group is , which contains a nucleophilic group reactive with an electrophilic group present in the binding moiety. Exemplary electrophilic groups are aldehydes, amides, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides In some embodiments, the reactive functional group comprises a carbonyl group such as an aldehyde. Exemplary nucleophilic groups are hydrazide, oxime, amino, hydrazine, thiosemicarbamates, and the like. These include arylhydrazides, hydrazine carboxylates, and arylhydrazides.
[0263] In some embodiments, the linker comprises a maleimide group. The maleimide group is also called a maleimide spacer. In some instances, the maleimide group may further comprise Caproic acid is included to form maleimidocaproyl (mc). The linker comprises maleimidocaproyl (mc). In some cases, the linker is maleimidocaproyl (mc). In another example, the maleimide group is a succinimide group as described above. 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1- Contains a maleimidomethyl group, such as carboxylate (sulfo-sMCC).
[0264] In some embodiments, the maleimide group is a self-stabilizing maleimide. In the example, the self-stabilizing maleimide is the intramolecular catalysis of thiosuccinimide ring hydrolysis. To provide this, diaminopropyl ether was added to incorporate a basic amino group adjacent to the maleimide. The maleimide is eliminated by retro-Michael reaction using dicarboxylic acid (DPR). In some instances, the self-stabilizing maleimide is L yon, et al., “Self-hydrolyzing maleimide s improve the stability and pharmacology cal properties of antibody-drug conjugat es,” Nat. Biotechnol. 32(10):1059-1062 ( 2014). In some instances, the linker is a self-stabilizing maleimide group. In some instances, the linker is a self-stabilizing maleimide.
[0265] In some embodiments, the linker comprises a peptide moiety. A peptide may contain at least 1, 2, 3, 4, 5, 6, 7, 8 or more amino acid residues. In some examples, the peptide moiety may be a cleavable peptide moiety (e.g., enzymatically or chemically cleavable). In some instances, the peptide moiety is a non-cleavable peptide moiety. In some examples, the peptide moiety is Val-Cit (Valine-Citrulline), Gly-Gl y-Phe-Gly (SEQ ID NO: 973), Phe-Lys, Val-L ys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-A rg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-C it, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 9 74), or Gly-Phe-Leu-Gly (SEQ ID NO: 975) In some examples, the linker comprises a peptide moiety such as: Val-Cit ( valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 9 73), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe- Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu- Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala- Leu (SEQ ID NO: 974), or Gly-Phe-Leu-Gly (SEQ ID NO: 975) Optionally, the linker comprises Val-Cit. In some cases, the linker is Val-Cit.
[0266] In some embodiments, the linker comprises a benzoic acid group or a derivative thereof. In some examples, the benzoic acid group or its derivatives include para-aminobenzoic acid (PABA). In some instances, the benzoic acid group or its derivatives include gamma-aminobutyric acid (GABA). nothing.
[0267] In some embodiments, the linker is a maleimide group, in any combination. , a peptide moiety, and / or a benzoic acid group. In the present invention, the linker is a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In some examples, the maleimide group is maleimidocaproyl (mc). In some instances, the peptide group is val-cit. In some instances, benzoic acid In some instances, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. The car contains the mc-val-cit-PABA group.
[0268] In some embodiments, the linker is a self-immolative or self-eliminating linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-immolative linker. In some instances, the linker is a self-excluding linker (e.g., a cyclized self-excluding linker). , U.S. Patent No. 9,089,614 or PCT Publication WO2015038426 Including the linkers described.
[0269] In some embodiments, the linker is a dendritic linker. Dendritic linkers include branched multifunctional linker moieties. In some examples, dendritic linkers is used to increase the molar ratio of polynucleotide B to binding moiety A. In this example, the dendritic linker comprises a PAMAM dendrimer.
[0270] In some embodiments, the linker is a traceless linker, or After cleavage, the binding moiety A, the polynucleotide B, the polymer C, or the endosomolytic a linker that does not leave a linker moiety (e.g., atom or linker group) to moiety D; Exemplary traceless linkers include, but are not limited to, germanium linkers, silicon Boron linker, sulfur linker, selenium linker, nitrogen linker, phosphorus linker, boron phosphorus linker, chromium linker, or phenylhydrazide linker. The linker is a compound according to Hejesen, et al., “A traceless aryl -triazene linker for DNA-directed chemis try,” Org Biomol Chem 11(15): 2493-2497 (2013). In some examples, the linker may be a nucleotide sequence similar to that described by Blaney, et al., "Traceless solid-phase organic synthesis,” Chem. R ev. 102: 2607-2024 (2002) In some instances, the linker is a It is a traceless linker.
[0271] In some instances, Lincoln has been involved in U.S. Patents 6,884,869; 7,498, No. 298; No. 8,288,352; No. 8,609,105; or No. 8,697 ,688; U.S. Patent Publication Nos. 2014 / 0127239; 2013 / 028919 ;No.2014 / 286970;No.2013 / 0309256;No.2015 / 0373 No. 60; or No. 2014 / 0294851; or PCT Publication WO201 5057699;WO2014080251;WO2014197854;WO2014 145090; or a linker described in WO2014177042.
[0272] In some embodiments, X, Y, and L are independently a single bond or a linker. In some instances, X, Y, and L are independently a single bond. Y and L are independently a linker.
[0273] In some examples, X is a single bond or a linker, e.g., a non-polymeric linker. In some examples, X is a single bond. In some examples, X is a non-polymeric linker. In some examples, the non-polymeric linker is a C1-C6 alkyl group. That is, X is, for example, a C1- group such as a C5, C4, C3, C2, or C1 alkyl group. Optionally, the C1-C6 alkyl group is an unsubstituted C1-C6 alkyl group. In the context of non-polymeric linkers, especially in the context of X, As shown, alkyl is a saturated straight or branched chain carbon atom containing up to six carbon atoms. In some instances, X represents a homobifunctional linker as described above. or a heterobifunctional linker. Optionally, X is a heterobifunctional linker. In some instances, X includes sMCC. In other instances, X includes C1-C6 alkyl. In another example, X is a C1-C6 alkyl group. In a further example, X is encapsulated by the polymer moiety C. This does not include polymers that are included, for example, X is a polyalkylene oxide (e.g., a PEG molecule). ) is not included.
[0274] In some examples, Y is a single bond or a linker, e.g., a non-polymeric linker. In some instances, Y is a single bond. In other instances, Y is a non-polymeric linker. In some embodiments, Y is a C1-C6 alkyl group. Y is a homobifunctional linker or heterobifunctional linker as described above. In some examples, Y is a homobifunctional linker as described above. and Y is a heterobifunctional linker as described above. In some examples, Y is Maleimide groups such as maleimidocaproyl (mc) described above, or self-stabilizing maleimide groups In some instances, Y comprises a peptide moiety such as Val-Cit. In some examples, Y includes a benzoic acid group, such as PABA. The benzoic acid group may comprise a combination of an amido group, a peptide moiety, and / or a benzoic acid group. , Y comprises an mc group. In a further example, Y comprises an mc-val-cit group. , Y comprises a val-cit-PABA group. In a further example, Y comprises mc-val-cit- Optionally, Y may be a polymer encompassed by polymer moiety C. It does not include, for example, Y does not include polyalkylene oxides (eg, PEG molecules).
[0275] In some examples, L comprises a single bond or a linker, optionally a non-polymeric linker. In some cases, L is a single bond. In other cases, L is optionally a linker, optionally a non-polymeric In some embodiments, L is a C1-C6 alkyl group. In some instances, L is a homobifunctional linker or heterobifunctional linker as described above. In some examples, L is a homobifunctional linker as described above. In some examples, L is a heterobifunctional linker as described above. where L is a maleimide group such as maleimidocaproyl (mc) as described above, or In some instances, L is a peptide such as Val-Cit. In some examples, L includes a benzoic acid group, such as PABA. In the present invention, L contains a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In an additional example, L includes an mc group. In an additional example, L includes an mc-val-cit group. In an additional example, L includes a val-cit-PABA group. In an additional example, L includes an mc- Optionally, L may be optionally linked to a non-polymeric linker. In the case where Y is a polymer moiety, it does not include the polymer encompassed by polymer moiety C, e.g., Y does not include polyalkylene oxides (eg, PEG molecules).
[0276] Pharmaceutical preparations In some embodiments, the pharmaceutical formulations described herein include, but are not limited to, non- Oral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, topical, rectal, or transdermal In some instances, the compound is administered to a subject by multiple routes of administration, including The pharmaceutical compositions described herein can be administered parenterally (e.g., intravenously, subcutaneously, intramuscularly, intraarterially, intraperitoneally, In other examples, the present invention is formulated for administration (intrathecal, intrathecal, intracerebral, intraventricular, intracranial). The pharmaceutical compositions described herein are formulated for oral administration. The pharmaceutical compositions described herein are formulated for nasal administration.
[0277] In some embodiments, the pharmaceutical composition may be, but is not limited to, an aqueous dispersion, a self-emulsifying Dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release Release formulations, fast dissolve formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsed release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and combination immediate-release and controlled-release formulations. include.
[0278] In some instances, the pharmaceutical formulation comprises a multiparticulate formulation. In some instances, the pharmaceutical formulation comprises a nanoparticulate formulation. In some instances, the nanoparticles include cMAP, cyclodextrin, or In some cases, the nanoparticles are solid lipid nanoparticles, polymer nanoparticles, self-assembled nanoparticles, or polymer nanoparticles. These include self-emulsifying nanoparticles, liposomes, microemulsions, or micellar solutions. Exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, and the like. nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (covalently bonded metal chelates) nanofibers, nanohorns, nanoonions, nanorods, nano In some examples, the nanoparticles include metal nanoparticles, e.g., For example, scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, Copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, Palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium Sm, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, Zinc, thallium, lead, bismuth, magnesium, calcium, strontium, barium, Lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, ammonium and nanoparticles of thimon, and combinations thereof, alloys thereof or oxides thereof.
[0279] In some instances, the nanoparticles may have a core or, as in core-shell nanoparticles, It contains a core and a shell.
[0280] In some instances, the nanoparticles may comprise a nucleic acid molecule (e.g., a polynucleic acid molecule or further coated with molecules for attachment of functional elements (having one or more binding moieties) In some instances, the coating may be chondroitin sulfate, dextran sulfate, carbohydrate, or the like. Dimethyldextran, alginic acid, pectin, carrageenan, fucoidan, agarose Cutin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, Glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, poly(amino acid) Aspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsin Lypsinogen, α-chymotrypsin, polylysine, polyarginine, histones, prota Some contain dextrin or cyclodextrin. In one example, the nanoparticles include graphene-coated nanoparticles.
[0281] In some cases, the nanoparticles are at least about 500 nm, 400 nm, 300 nm, 20 0 nm or less than 100 nm.
[0282] In some instances, the nanoparticle formulations include paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, and the like. molecules, fullerene-like materials, inorganic nanotubes, dendrimers (covalently bound metal chelates) nanofibers, nanohorns, nanoonions, nanorods, nanolows, etc. In some examples, the polynucleic acid molecules described herein include Alternatively, the binding moiety may be directly or indirectly conjugated to the nanoparticle. At least 1, 5, 10, 15, 20, 30, 40, 50, 60, 7 0, 80, 90, or 100 or more polynucleic acid molecules or binding moieties may be directly attached to the nanoparticles. Conjugate directly or indirectly.
[0283] In some embodiments, the pharmaceutical formulation is a delivery vector, e.g., a polynuclear agent, for delivery into cells. In some instances, the recombinant vector comprises a DNA molecule. In another example, the recombinant vector is a viral vector. Typical viral vectors are adeno-associated viruses, retroviruses, adenoviruses, and In some instances, the polynucleic acid molecule may be a vector derived from a virus or an alphavirus. The recombinant vector capable of expression leads to stable expression in the target cell. In another example, viral vectors are used that provide for transient expression of polynucleic acid molecules.
[0284] In some embodiments, the pharmaceutical formulation is compatible with the compositions disclosed herein. and the carrier or carrier material selected based on the release profile characteristics of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrating agents, fillers, surfactants, These include additives, solubilizers, stabilizers, lubricants, humectants, diluents, etc. Pharmaceutically compatible Suitable carrier materials include acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, and Calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinyl Dimethicone (PVP), cholesterol, cholesterol esters, sodium caseinate Um, soy lecithin, taurocholic acid, phosphatidylcholine, sodium chloride, phosphate Tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugar stearoyl Sodium lactate (sugars sodium stearoyl lactylate ), carrageenan, monoglycerides, diglycerides, pregelatinized starch, etc. See, for example, Remington: The Science and Pr actice of Pharmacy, Nineteenth Ed(Easton ,Pa.: Mack Publishing Company, 1995), Hoo ver,John E.,Remington's Pharmaceutical S sciences,Mack Publishing Co.,Easton,Penns ylvania 1975, Liberman, HA and Lachman, L. ,Eds.,Pharmaceutical Dosage Forms, Marce Decker, New York, NY, 1980, and Pharmac eutical Dosage Forms and Drug Delivery S ystems, Seventh Ed.(Lippincott Williams & Wilkins1999)(Lippincott Williams & Wil kins1999).
[0285] In some examples, the pharmaceutical formulation further comprises acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and Acids such as hydrochloric acid; sodium hydroxide, sodium phosphate, sodium borate, citric acid Sodium, sodium acetate, sodium lactate, and trishydroxymethylaminomethyl Bases such as ethanol, as well as citrate / dextrose, sodium bicarbonate, and salt pH adjusters or buffers, including acids, salts, and buffers such as ammonium chloride. The bases and buffers are added in amounts required to maintain the pH of the composition in an acceptable range. Included.
[0286] In some instances, the pharmaceutical formulation may be added in an amount necessary to bring the osmolality of the composition into an acceptable range. Such salts include one or more salts of sodium, potassium, or ammonium. Thione, as well as chloride, citrate, ascorbate, borate, phosphate, and carbonated water Suitable salts include sodium chloride, sulfate, thiosulfate, or bisulfite anions. Sodium, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate Contains monium.
[0287] In some instances, pharmaceutical formulations provide a more stable environment for the compound. It also contains diluents used to stabilize the solution. The methods for the treatment of pulmonary arthritis (which may also result in the maintenance of pulmonary arthritis) include, but are not limited to, phosphate buffered saline. In certain instances, the diluent may be used to facilitate compression or to enhance the To create sufficient bulk for homogeneous mixing for capsule filling, the composition Such compounds include, for example, lactose, starch, mannitol, cellulose, sorbitol, dextrose, microcrystalline cellulose such as Avicel® Calcium hydrogen phosphate, calcium phosphate dihydrate, tricalcium phosphate, phosphate Calcium; Anhydrous Lactose, Spray-Dried Lactose; Pregelatinized Starch, Di-Pac (registered trademark) Compressible sugars such as Amstar; mannitol, hydroxypropyl methylcellulose, Cellulose, hydroxypropyl methylcellulose acetate stearate, sucrose Diluents for sugar-based products, powdered sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; milk Calcium carbonate trihydrate, dextrates; hydrolyzed cereals Solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannite Contains ethanol, sodium chloride; inositol, bentonite, etc.
[0288] In some cases, pharmaceutical formulations contain disintegrants to facilitate the breakdown or disintegration of the material. integration agents or disintegrants The term "disintegrate" includes both dissolution and dispersion of the dosage form upon contact with gastrointestinal fluids. Examples of disintegrants include starches, such as natural starches, e.g., corn starch or potato starch, pregelatinized starch, e.g. National 1551 or Ami jel®, or sodium starch glycolate, e.g. Promogel (registered trademark) or Explotab (registered trademark), cellulose, e.g. wood products, methyl Microcrystalline cellulose, e.g., Avicel®, Avicel® PH10 1, Avicel (registered trademark) PH102, Avicel (registered trademark) PH105, El cema® P100, EmcoCel®, Vivacel® (trademark), Min Tia®, and Solka-Fl°C®), methyl cellulose, croscarmellose, or crosslinked cellulose, e.g., crosslinked carboxymethylcellulose Sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carboxymethylcellulose cross-linked starches, such as sodium starch, e.g., croscarmellose, or cross-linked croscarmellose Glycolates, cross-linked polymers such as crospovidone, cross-linked polyvinylpyrrolidone, alginate Phosphates, for example alginic acid or salts of alginic acid such as sodium alginate, Veeg Clays such as um(registered trademark) HV (magnesium aluminum silicate), rubber (agar, (such as peanuts, locust bean, karaya, pectin, or tragacanth), sodium starch glycolate, bentonite, natural sponge, surfactant, cation exchange resin, etc. Lauryl sulphate, a combination of resin, citrus pulp, sodium lauryl sulphate and starch sodium sulfate, etc.
[0289] In some instances, the pharmaceutical formulation may comprise lactose, calcium carbonate, calcium phosphate, Calcium diphosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose Sucrose, dextrate, dextran, starch, pregelatinized starch, sucrose, xylitol titol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol Contains fillers such as recall.
[0290] Lubricants and glidants are also used herein to prevent, reduce or inhibit adhesion or friction of materials. Typical lubricants include, for example, stearic acid, hydroxypropyl methylcellulose, methylcellulose, methylcellulose, methylcellulose powder ... Calcium chloride, talc, sodium stearyl fumarate, mineral oil and other hydrocarbons, water hydrogenated vegetable oils such as enriched soybean oil (Sterotex®), higher fatty acids, and Alkali metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, Zinc, stearic acid, sodium stearate, glycerol, talc, wax, St earowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride sodium, leucine, polyethylene glycol (e.g., PEG-4000) or methoxy Polyethylene glycols, such as Carbowax™, sodium oleate, Sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium lauryl sulfate Colloidal silica such as sodium or lauryl sulfate, Syloid™ , Cab-O-Sil®, starch such as corn starch, silicone Contains oils, surfactants, etc.
[0291] Plasticizers act by softening the microencapsulated material or film coating. Suitable plasticizers include compounds used to reduce the brittleness of plastics. 0, PEG400, PEG600, PEG1450, PEG3350, and PEG80 0, polyethylene glycol, stearic acid, propylene glycol, oleic acid, Contains triethyl cellulose, triacetin. Plasticizers also function as dispersants or wetting agents. do.
[0292] Solubilizers include triacetin, triethyl citrate, ethyl oleate, and ethyl caprylate. , Sodium Lauryl Sulfate, Sodium Docusate, Vitamin E TPGS, Dimethyl Acetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone rolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, Polyethylene glycol 200-600, glycofurol, transcutol, propylene These include compounds such as ethylene glycol, and dimethyl isosorbide.
[0293] Stabilizers include any antioxidant, buffer, acid, preservative, and like compounds.
[0294] Suspending agents include polyvinylpyrrolidones, e.g., polyvinylpyrrolidone K12 ... Polyvinylpyrrolidone K17, Polyvinylpyrrolidone K25, or Polyvinylpyrrolidone K 30, vinylpyrrolidone / vinyl acetate copolymer (S630), polyethylene glycol (For example, polyethylene glycols may range from about 300 to about 6000, from about 3350 to about 4000, or from about 7000 to about 5400), sodium calcium hydroxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, Hydroxymethylcellulose stearate acetate, polysorbate 80, hydroxyethyl cellulose cellulose, sodium alginate, e.g., gum tragacanth, gum arabic, gum Gums, sugars, cellulosics, e.g., xanthan, including arginine gum and xanthan gum; Sodium carboxymethylcellulose, methylcellulose, sodium carboxymethyl cellulose, hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyethylene Resorbate 80, sodium alginate, polyethoxylated sorbitan monolaurate , polyethoxylated sorbitan monolaurate, povidone, and other compounds.
[0295] Surfactants include sodium lauryl sulfate, sodium docusate, Tween 60, or 80, Triacetin, Vitamin E TPGS, Sorbitan Monooleate, Polyoxyethylene ethylene sorbitan monooleate, polysorbate, poloxamer ), bile salts, glyceryl monostearate, ethylene oxide and propylene oxide copolymers, including compounds such as Pluronic® (BASF) Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils (e.g., poly Polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkyl ether ethers and alkyl phenyl ethers, e.g., Octoxynol 10, Octoxynol 4 0. Often surfactants are used to enhance physical stability or for other purposes. is included for the purposes of
[0296] Viscosity enhancers include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxy Hydroxypropyl methylcellulose acetate stearate, Hydroxypropyl methylcellulose Sulfate, Carbomer, Polyvinyl Alcohol, Alginate, Acacia, Chitosan and combinations thereof.
[0297] Humectants include oleic acid, glyceryl monostearate, sorbitan monooleate, and Sorbitan monolaurate, triethanolamine oleate, polyoxyethylene monooleate Ethylene sorbitan, polyoxyethylene sorbitan monolaurate, sodium doxate Calcium, Sodium Oleate, Sodium Lauryl Sulfate, Docusate Sodium, Triglyceride Contains compounds such as acetin, Tween 80, Vitamin E TPGS, and ammonium salts .
[0298] Treatment regimen In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic use. In some embodiments, the pharmaceutical composition is administered once daily, twice daily, or The pharmaceutical composition may be administered daily, every other day, five days a week, or more than three times a day. , 1 day a week, 1 week apart, 2 weeks per month, 3 weeks per month, 1 day per month, 2 days per month, 1 day per month The pharmaceutical composition may be administered three or more times per month. month, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months , administered for 18 months, 2 years, 3 years, or longer.
[0299] In some embodiments, one or more pharmaceutical compositions may be administered simultaneously, sequentially, or over a period of time. In some embodiments, one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. The pharmaceutical compositions are administered at time intervals (e.g., the first administration of the first pharmaceutical composition is and on day 1, and thereafter at least 1, 2, 3, or 4 days prior to administration of at least a second pharmaceutical composition. (4, 5 days or more apart).
[0300] In some embodiments, two or more different pharmaceutical compositions are co-administered. In some instances, two or more different pharmaceutical compositions are administered simultaneously. In other cases, the two different pharmaceutical compositions are administered simultaneously in succession with no interval between administrations. The above different pharmaceutical compositions are administered at intervals of about 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, or the like between administrations. , administered consecutively at intervals of 1 or 2 days.
[0301] If the patient's condition improves, at the physician's discretion, administration of the composition may be continued; alternatively, In this case, the dose of the composition being administered may be temporarily reduced or temporarily reduced for a specific period of time. In some cases, the length of the drug holiday is For example, the 2nd, 3rd, 4th, 5th, 6th, 7th, 10th, 12th, 15th, and 20th , 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days 2 days, including days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days Dose reductions during drug holidays can vary from 10% to 1 year, by way of example only. , 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% , 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including 10% -100%.
[0302] Once the patient's condition improves, maintenance doses are administered as needed. The dosage and / or frequency of administration may vary depending on the symptoms and the severity of the improved disease, disorder, or condition. It can be reduced to a level where the disease persists.
[0303] In some embodiments, the amount of a given drug corresponding to such an amount is determined by the amount of the particular compound, Factors such as the severity of the disease, the nature of the subject or host requiring treatment (e.g., weight), etc. Nevertheless, it depends on factors such as the specific drug being administered, the route of administration, etc. According to the specific circumstances surrounding the case, including the tract, and the subject or host being treated. In some instances, the desired dosage is determined routinely by methods known in the art. The same may be administered as a single dose or, for example, as 2, 3, or 4 or more subdoses per day. divided doses given at once (or over a short period of time) or at appropriate intervals It is conveniently presented as
[0304] Due to the large number of variables associated with individual treatment regimens, the ranges presented above are only suggestive. However, significant deviations from these recommendations are not uncommon. The dosage will depend, but is not limited to, the activity of the compound used, the disease or disorder being treated, the dosage regimen, and the dosage regimen. The type, requirements of the individual subject, the severity of the disease or illness being treated, and the physician's It is subject to change depending on many variables, including judgment.
[0305] In some embodiments, the toxicity and therapeutic efficacy of such treatment regimens are limited. However, the LD50 (lethal dose to 50% of the population) and ED50 (lethal dose to 50% of the population) Standard pharmaceutical procedures in cell cultures or experimental animals, including determination of the therapeutically effective dose The dose ratio between toxic and therapeutic effects is the therapeutic index, which is the LD5 Therapeutic indices are expressed as a ratio between ED50 and ED50. Compounds that exhibit high therapeutic indices are preferred. Data obtained from culture assays and animal studies are used to formulate a range of dosages for use in humans. The dosage of such compounds is preferably below the ED5 with minimal toxicity. The dose will lie within a range of circulating concentrations that includes 0. The dose will vary depending on the dosage form used and the route of administration utilized. It varies within this range depending on the
[0306] Kits / Products In some embodiments, the compositions may be used in conjunction with one or more of the compositions and methods described herein. Disclosed herein are kits and articles of manufacture that can be used to administer the drug. Such kits can include vials, tubes, and the like. This includes a carrier, package, or container that is partitioned to accommodate one or more containers, such as tubes, each The container comprises one of the separate components for use in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In configuration, the containers may be formed from a variety of materials such as glass or plastic.
[0307] The products provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to: but not blister packs, bottles, tubes, bags, containers, jars, and selected formulations Any packaging material suitable for the intended mode of administration and treatment is included.
[0308] For example, the container contains a target nucleic acid molecule described herein. Other descriptions or labels or instructions for use in the methods described herein Optionally includes calligraphy.
[0309] Kits typically include a label listing the contents and / or instructions for use, and instructions for use. A set of instructions is also typically included.
[0310] In one embodiment, a label is on or associated with the container. The letters, numbers or other indicia forming the label are affixed to or molded into the container itself. If the label is engraved or inscribed, the label is attached to the container. Attached to the container when present in the receptacle or carrier that holds the container as a package insert. In this embodiment, the label indicates that the contents are to be used for a particular therapeutic application. The label is used to indicate that the product is , may be used to indicate instructions for use with the contents.
[0311] In certain embodiments, the pharmaceutical composition comprises one or more unit dosage forms comprising a compound provided herein. The compositions may be presented in a pack or dispenser device containing the formulation. In an embodiment, the pack comprises: For example, it may contain metal or plastic foil, such as a blister pack. In such cases, the pack or dispenser device may be accompanied by instructions for administration. In another embodiment, the pack or dispenser contains instructions for manufacturing, using, or dispensing pharmaceutical products. or the notice accompanying the container in a form prescribed by a government agency controlling its sale. This notice is the agency's approval of the drug form for human or animal administration. In embodiments, such notice may be provided, for example, at the time of prescription or is the labeling approved by the U.S. Food and Drug Administration for approved product inserts. In one embodiment, a compound provided herein formulated in a compatible pharmaceutical carrier is and a composition containing the compound may be prepared, placed in an appropriate container, and labeled for treatment of an indicated disease. will be done.
[0312] Specific Terms Unless otherwise specified, all technical and scientific terms used herein are intended to be used in conjunction with the The above general terms have the same meaning as commonly understood by those skilled in the art. The general description and the following detailed description are exemplary and explanatory only and are not intended to be limiting of any particular subject matter. It will be understood that in this application, the use of the singular refers to the As used in the specification and the appended claims, the singular forms "a," "an," "the ... and "the" refers to plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including" means "in "include," "includes," and "included" )" is not as restrictive as other forms such as
[0313] As used herein, ranges and amounts can be expressed as "about" a particular value or range. "About" also includes the exact amount. Therefore, "about 5 μL" can be used to mean "about 5 μL" and " In general, the term "about" includes amounts that are expected to be within experimental error. There are.
[0314] The section headings used herein are for organizational purposes only and do not affect the subject matter described. This document should not be construed as limiting the scope of the present disclosure.
[0315] As used herein, the terms "individual," "subject," and "patient" refer to any mammal. In some embodiments, the mammal is a human. In some forms, mammals are non-human. Supervision (e.g., regular supervision of nurses, bedside nurses, physician assistants, nursing assistants, or hospice personnel) The term "periodic or intermittent" refers to situations characterized by:
[0316] As used herein, the terms "DMD," "DMD gene," and equivalents thereof refers to the DMD gene, which encodes the protein dystrophin. The term "DMD gene" is used interchangeably, and both terms refer to the dystrophin gene Refers to... [Example]
[0317] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims. isn't it.
[0318] Example 1. Antisense Oligonucleotide Sequences and Synthesis
[0319] Phosphorodiamidate morpholino oligomers (PMOs), phosphorothioate antisense oligomers Sense oligonucleotides (PS ASOs), and antisense oligonucleotides (A SO) was synthesized.
[0320] The PMO sequence is 5'GGCCAAACCTCGGCTTACCTGAAAT3' The amino acid sequence (SEQ ID NO:28) is shown in FIG. 1 with the terminal nucleotides extended. PMOs contain a C3-NH2 conjugate handle at the 3' end of the molecule to be conjugated. , assembled entirely on solid phase using standard solid phase synthesis protocols, and purified by HPLC was done.
[0321] The PS ASO sequence is amine-C6-GGCCAAACCUCGGCUUACCU(SE Q ID NO:29) and is seen in Figures 2A-2B with the terminal nucleotide extended. The structure of PS ASO has a phosphate backbone that is 100% phosphorothioate bonded. All of the ribose sugars contained 2'2'OMe modifications. The conjugated molecule contained a C6-NH2 conjugate handle at the 5' end. Fully assembled on solid phase using versatile solid-phase phosphoramidite chemistry and purified by HPLC It was.
[0322] ASOs are assembled entirely on the solid phase using standard solid-phase phosphoramidite chemistry. The ASO was conjugated to a C6-NH2 conjugate at the 5' end of the molecule. It included dollars.
[0323] Example 2: Detection of DMD exon skipping
[0324] A method for assessing DMD exon 23 skipping in differentiated C1C12 cells law
[0325] Mouse myoblast C2C12 cells were cultured in 0.5 mL of 10% FBS RPMI 1640 medium. Plated at 50,000-100,000 / well in 24-well plates in soil, with 5% The cells were incubated overnight at 37 °C with CO2. On day 2, the cells were transferred to differentiation medium ( Transfer the cells to RPMI 1640 supplemented with 2% horse serum and 1 μM insulin and incubate for 3-5 days. After incubation, the samples were added and incubated for 24 hours. After the pull treatment, 1 mL of fresh medium (without compounds) was changed every day for 2 days. At 72 hours after the initiation of the initiation, cells were harvested using the InviTrap RNA Cell HTS 96 Kit ( B-Bridge International #7061300400) using R NAs were isolated and transfected with a High Capacity cDNA Reverse Transcription Kit (ThermoF The reverse transcription was performed using a DreamTaq™ PCR kit (Piercer #4368813). PCR reactions were performed using a master mix (ThermoFisher #K1072). The protocol in Table 2 was used to perform skipped and unskipped PCR. To amplify the untranslated molecule, the primary PCR was performed using exon 20 (Ex20F 5'-CAG AATTCTGCCAATTGCTGAG) (SEQ ID NO: 30) and exo 26(Ex26R 5'-TTCTTCAGCTTGTGTCATCC)(SEQ I Primers were used in the following sequence: D NO:31).
[0326] [Table 2]
[0327] For nested PCR, dilute the primary PCR reaction 100X with water and add it to the nested PCR 5 μl was used in the reaction (50 μl total reaction volume). Nested PCR to amplify skipped and non-skipped molecules exon 20 (Ex20F2: 5'- ACCCAGTCTACCACCCTAT C) (SEQ ID NO:32) and exon 25 (Ex25R: 5'- CTC TTTATCTTCTGCCCACCTT) (SEQ ID NO: 33) was used.
[0328] [Table 3]
[0329] PCR reactions were analyzed using a 4% TAE agarose gel. The DMD product was the expected size of 788 base pairs with a skipped length of 575 base pairs. The mutant had DMDΔ23.
[0330] animal
[0331] Animal studies are based on the Guide for the Care and Use of "Community Animals" as well as the USDA Animal Welfare Explora BioLabs Institute, which adheres to the rules outlined in the Act. tional Animal Care and Use Committee(I All mice were cultured according to a protocol based on the Charles Ribeye Institute of Technology (ACUC). Ver Laboratories or Harlan Laboratories I got it from somewhere.
[0332] In vivo mouse model
[0333] WT CD-1 mice (4-6 weeks old) were injected with the indicated antisense conjugates (ASC) and The doses were administered by intravenous (iv) injection. After 4, 7, or 14 days, the cardiac Liver and gastrocnemius tissues were harvested and flash frozen in liquid nitrogen. RNA was extracted using Trizol and Isolation was performed using the RNeasy Plus 96 Kit (Qiagen, #74192). High Capacity cDNA Reverse transcription Reverse transcription was performed using a kit (ThermoFisher #4368813). The PCR reactions were performed as described. The PCR reactions were analyzed by densitometry. The results were analyzed in a 4% (or 1%) TAE agarose gel and quantified.
[0334] To confirm exon 23 skipping in treated mice, DNA Flag The fragments were isolated from a 4% agarose gel and sequenced.
[0335] To quantitatively determine the copy number of skipped DMD mRNA, qPCR was performed. The primer / probe set was designed to detect the skipped and WT DMD mRNA (Figure 1). 3) was designed to quantify the qPCR quantification standards, as seen in Table 4. The following PCR primers were used to generate the WT and DMD fragments: For the qPCR standard, after PCR, a 733 base pair fragment was isolated from the agarose gel. The skipped DMA qPCR standard was isolated from a nested platform. Immer was used.
[0336] The amplification efficiency of the qPCR primer / probe was determined to be within 10% of the expected efficiency. qPCR reactions were performed using a QuantStudio 7 and 8 according to the manufacturer's instructions. and Taqman™ PCR Universal Mastermix II (T The study was performed using a NIRS-based NIRS (Human Imaging Systems, Inc., HermoFisher #4440041).
[0337] [Table 4]
[0338] Example 3: Conjugate synthesis
[0339] Analytical and purification methods
[0340] Analytical and purification methods were performed according to Tables 5-11.
[0341] [Table 5]
[0342] [Table 6]
[0343] [Table 7]
[0344] [Table 8]
[0345] [Table 9]
[0346] [Table 10]
[0347] [Table 11]
[0348] Anti-transferrin receptor antibody
[0349] The anti-mouse transferrin receptor antibody, i.e., anti-CD71 mAb, used was a mouse Rat I binds to mouse CD71, mouse transferrin receptor 1 (mTfR1) The antibody was a gG2a subclass monoclonal antibody produced by BioXcell. and is commercially available (Cat. # BE0175).
[0350] Anti-CD71 antibody morpholino antisense oligonucleotide conjugate (anti-CD71 mAb) b-PMO)
[0351] Anti-CD71 mAb-PMO conjugate
[0352] Borate buffer (25 mM sodium tetraborate, 25 mM NaCl, 1 mM diene Anti-CD71 antibody (10 mg / mL) in ethylenetriaminepentaacetic acid (pH 8.0) adding 4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water, and The reduction was achieved by incubating at 37°C for 4 hours. PMO (50 mg / mL) in DMSO with 0 equivalents of SMCC (10 mg / mL) Incubation of 4(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC) was converted to phosphorodiamidate morpholino. The unconjugated SMCC was conjugated to a primary amine at the 3' end of the polymerized SMCC oligomer (PMO). Using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 100 Da The PMO-SMCC was dissolved in a buffered acetate solution (10 mM sodium acetate, The reduced antibody was washed three times with sodium chloride, pH 6.0, and used immediately. The mixture was mixed with 0.25 equivalents of PMO-SMCC and incubated overnight at 4°C. The pH of the reaction mixture was reduced to 7.5, and 8 equivalents of N-ethylmaleimide was added for 30 min at room temperature. This was added to the mixture to quench any unreacted cysteine. Analysis of the reaction mixture by HIC method 2 revealed the antibody-PMO along with unreacted antibody and PMO. Figure 4 shows the anti-CD71 mAb produced by HIC method 2. Chromatogram of the -PMO reaction mixture shows the free antibody peak (1), the free PMO peak (2), (2), DAR 1(3), DAR 2(4), DAR 3(5), DAR>3(6) "DAR" refers to the drug-to-antibody ratio. The numbers in parentheses indicate the peaks in the chromatogram. Refers to the work.
[0353] purification
[0354] The reaction mixture was purified on an AKTA Explorer FPLC using HIC method 1. Fractions containing conjugates with drug-to-antibody ratios of 1 (DAR1) and 2 (DAR2) were synthesized. Conjugates with a DAR greater than 2 were combined and separated using a MWCO of 50 kDa. The conjugate was concentrated using an Amicon Ultra 15 centrifugal filter unit. Before use, an Amicon Ultra15 centrifugal filter unit was used to filter the PBS (pH 7. 4) and the buffer solution was exchanged.
[0355] Analysis of purified conjugates
[0356] The isolated conjugate was characterized by steric exclusion chromatography (SEC) and HIC. To confirm the absence of polymer aggregates and unconjugated PMO (Figures 5A-5C), To achieve this, SEC method 1 was used. Figure 5A shows the anti-CD71 antibody produced using SEC method 1. Figure 5B shows the chromatogram of the anti-CD mAb produced using SEC method 1. Figure 5C shows the chromatograms of 71 mAb-PMO DAR 1 and 2. Chromatography of two or more anti-CD71 mAb-PMO DARs produced using Method 1 "DAR" refers to the drug-to-antibody ratio.
[0357] The purity of the conjugate was assessed by analytical HPLC using HIC method 2 (Figure 6A- 6C). Figure 6A shows the chromatogram of anti-CD71 mAb produced using HIC method 2. Figure 6B shows the anti-CD71 mAb-PMO produced using HIC method 2. Figure 6C shows the chromatogram of DAR 1 and 2 conjugates using HIC method 2. Chromatograms of anti-CD71 mAb-PMO DAR>2 conjugates produced by ELISA are shown. The 260 / 280 nm UV absorbance ratio of each sample was measured to confirm the DAR. The antibody was compared to a standard curve of known ratios. Samples with DAR 1 and 2 had an average of ~1.6. While most samples had a DAR greater than 2, the average DAR was ~3.7. "DAR" refers to the drug-to-antibody ratio.
[0358] Anti-CD71 Fab morpholino antisense oligonucleotide conjugate (anti-CD71 F ab-PMO)
[0359] Antibody digestion with pepsin
[0360] Anti-CD71 antibody (5 mg / mL) in ...
Claims
1. A polynucleic acid molecule conjugate comprising a full-length anti-CD71 monoclonal antibody and a single-stranded oligonucleotide, wherein the anti-CD71 monoclonal antibody recognizes CD71 on the cell surface of a muscle cell, and the single-stranded oligonucleotide hybridizes to an acceptor splice site, a donor splice site, or an exon splice enhancer element of a targeted pre-mRNA transcript of the DMD gene, or the single-stranded oligonucleotide hybridizes to an internal region within an exon of the DMD gene.
2. A polynucleic acid molecule conjugate as described in claim 1, wherein the internal region is at least 80 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20 nt, 10 nt, or 5 nt from the 5' end of the exon of the DMD gene.
3. A polynucleic acid molecule conjugate described in claim 1 or 2, wherein the single-stranded oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO).
4. A polynucleic acid molecule conjugate described in any one of claims 1 to 3, wherein the single-stranded oligonucleotide induces exon skipping in exon 44, 45, 50, 51, 52, 53, 55, 8, 23, 35, or 43 of the DMD gene.
5. The polynucleic acid molecule conjugate of formula (I): A-X-B Formula I wherein: A comprises the anti-CD71 monoclonal antibody; B consists of said single-stranded oligonucleotide; and The polynucleic acid molecule conjugate of any one of claims 1 to 4, wherein X consists of a single bond or a first linker.
6. A polynucleic acid molecule conjugate described in any one of claims 1 to 5, wherein the polynucleic acid molecule conjugate optionally comprises at least one 2'-modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
7. The polynucleic acid molecule conjugate of claim 6, wherein the at least one 2'-modified nucleotide comprises a morpholino, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-O-N-methylacetamide (2'-O-NMA) modified nucleotide, locked nucleic acid (LNA), ethylene nucleic acid (ENA), or peptide nucleic acid (PNA).
8. A polynucleic acid molecule conjugate described in claim 6 or 7, wherein at least one reverse abasic portion is at least one end.
9. A polynucleic acid molecule conjugate described in any one of claims 6 to 8, wherein at least one modified internucleotide bond comprises a phosphorothioate bond or a dithiophosphate bond.
10. A polynucleic acid molecule conjugate described in any one of claims 1 to 9, wherein the polynucleic acid molecule conjugate has a ratio of single-stranded oligonucleotide to antibody of about 1:1, 2:1, 3:1, or 4:
1.
11. The polynucleic acid molecule conjugate of any one of claims 5 to 10, wherein X is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, a C1-C6 alkyl group, and combinations thereof.
12. 12. The polynucleic acid molecule conjugate of any one of claims 1 to 11, wherein the single-stranded oligonucleotide comprises a sequence selected from SEQ ID NOs: 225-227, 252-263, 268-272, 352-427, 768-827, and 939-972.
Citation Information
Patent Citations
Multiple exon skipping compositions for DMD
JP2012506703A