Nucleic acids encoding anchor modified antibodies and uses thereof

By introducing nucleic acid molecules into non-human animals to modify the immunoglobulin polypeptide and increasing its binding power with receptors, the problem that monoclonal antibodies are difficult to bind to disease targets is solved, and the effectiveness of antibody treatment is improved.

JP2025116078APending Publication Date: 2025-08-07REGENERON PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025087440
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-07-08
Filing Date
2025-05-26
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Existing monoclonal antibodies are difficult to effectively bind and approach certain disease targets, and new antibody therapy methods are needed.

Method used

By introducing nucleic acid molecules into non-human animals, the immunoglobulin polypeptide is modified so that it contains a receptor binding part as an anchor structure, thereby increasing the affinity of the immunoglobulin with its receptor and forming an anchor-engineered immunoglobulin.

Benefits of technology

It enhances the binding properties of immunoglobulins to their receptors and improves the effectiveness of antibody therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025116078000001_ABST
    Figure 2025116078000001_ABST
Patent Text Reader

Abstract

To provide nucleic acids encoding anchor modified antibodies and uses thereof.SOLUTION: Described herein are anchor-modified immunoglobulin polypeptides, wherein the anchor moors the immunoglobulin polypeptide to a receptor of interest. The anchor-modified immunoglobulin polypeptides are generally characterized at the N-terminus with an anchor, e.g., the receptor binding portion of a ligand that binds a receptor. Non-human animals genetically modified with recombinant immunoglobulin segments that encode the anchor-modified immunoglobulin polypeptides are capable of making the anchor-modified immunoglobulin polypeptides. Such non-human animals also provided, along with methods and compositions for making and using the non-human animals. Methods for producing anchor-modified immunoglobulins from non-human animals are also provided, as well as anchor-modified immunoglobulins generated therefrom.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Patent Application No. 63 / 129,893, filed December 23, 2020, and U.S. Provisional Patent Application No. 63 / 219,402, filed July 8, 2021, each of which is incorporated herein by reference.

[0002] Sequence Listing The sequence listing set forth in file 10507WO01_ST25.txt is 47 kilobytes, was created on December 17, 2021, and is incorporated herein by reference in its entirety. [Background technology]

[0003] Monoclonal antibody products have revolutionized the biopharmaceutical industry and have led to major advances in the treatment of several diseases. Despite these advances and knowledge gained through the use of monoclonal antibodies for therapeutic use, there are still diseases associated with targets that are difficult for monoclonal antibodies to bind and / or to access, and it is believed that different approaches are required to develop effective treatments. Summary of the Invention [Means for solving the problem]

[0004] Disclosed herein is the recognition that it is desirable to engineer non-human animals as improved in vivo systems for identifying and developing new antibody-based therapeutics, in some embodiments antibodies (e.g., monoclonal antibodies and / or fragments thereof), that can be used to treat a variety of diseases. The nucleic acids, non-human animals, methods, and polypeptides disclosed herein relate to anchor-modified immunoglobulins. The anchors described herein generally comprise a receptor-binding portion of a non-immunoglobulin polypeptide that binds to its cognate receptor. The anchor added to an immunoglobulin serves to increase the affinity of the immunoglobulin for its cognate receptor, thereby improving the binding characteristics of the immunoglobulin. Described herein are nucleic acid molecules that encode anchor-modified immunoglobulins and / or nucleic acid molecules that can be used to modify non-human animals so that the non-human animals can de novo produce anchor-modified immunoglobulins.

[0005] The anchor-modified immunoglobulins described herein comprise, at least in part, an Ig leader sequence and a heavy chain variable region (e.g., an immunoglobulin (Ig) heavy chain variable region (V)) modified to encode an anchor in operable linkage between and with the framework (FR) and complementarity-determining regions (CDR) of a germline V segment. H ) segment or light chain variable region (V L It may be encoded by a variable region (V) segment, such as a .alpha.- ...

[0006] Thus, nucleic acid molecules comprising targeting vectors and non-human animal genomes that comprise unrearranged or rearranged modified Ig V segments are also described herein. Also described herein are non-human animal genomes, non-human animal cells, and non-human animals that comprise the nucleic acid molecules described herein.

[0007] A recombinant nucleic acid molecule described herein may comprise a modified immunoglobulin (Ig) variable (V) segment encoding an anchor modified Ig polypeptide, wherein the modified Ig V segment comprises a nucleic acid sequence encoding an anchor between a nucleic acid sequence encoding an Ig signal peptide and a nucleic acid sequence encoding framework region (FR)1, complementarity determining region (CDR1), FR2, CDR2, FR3, and CDR3 of a germline Ig V segment or a variant thereof, wherein the anchor modified Ig polypeptide comprises, in operative linkage, (i) an Ig signal peptide, (ii) an anchor, and (iii) FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a germline Ig V segment or a variant thereof, wherein the anchor comprises a receptor-binding portion of a non-immunoglobulin polypeptide of interest that binds to a cognate receptor, optionally wherein the recombinant nucleic acid molecule lacks any other V segments. The recombinant nucleic acid molecules described herein may contain one or more (un)rearranged Ig diversity (D) segments, one or more (un)rearranged Ig joining (J) segments, and / or one or more Ig constant region (C) genes.

[0008] In some embodiments, the Ig signal peptide is the Ig signal peptide of a germline Ig V segment or a variant thereof. In some embodiments, the Ig signal peptide comprises the sequence MDWTWRFLFVVAAATGVQS (SEQ ID NO: 7). In some embodiments, the anchor comprises a linker that connects the receptor-binding portion of the non-immunoglobulin polypeptide of interest to FR1, CDR1, FR2, CDR2, FR3, and CDR3 of the germline Ig V segment or a variant thereof. In some linker embodiments, the linker comprises the sequence GGGGS (SEQ ID NO: 5).

[0009] In some embodiments, the germline Ig V segment or variant thereof is a germline Ig heavy chain variable (V H) segment or variant thereof, e.g., a human (h) germline Ig V segment or variant thereof, e.g., a germline human (h) V H 1-2 segments, germline hV H 1-3 segments, germline hV H 1-8 segments, germline hV H 1 18-segment germline hV H 1-24 segments, germline hV H 1-45 segments, germline hV H 1-46 segments, germline hV H 1-58 segment, germline hV H 1-69 segment, germline hV H 2-5 segments, germline hV H 2-26 segments, germline hV H 2-70 segment, germline hV H 3-7 segments, germline hV H 3-9 segments, germline hV H 3-11 segments, germline hV H 3 13-segment germline hV H 3-15 segments, germline hV H 3-16 segments, germline hV H 3-20 segments, germline hV H 3-21 segments, germline hV H 3-23 segments, germline hV H 3-30 segments, germline hV H 3-30-3 segment, germline hV H 3-30-5 segment, germline hV H 3-33 segments, germline hV H 3-35 segments, germline hV H 3-38 segments, germline hV H 3-43 segments, germline hV H 3-48 segments, germline hV H 3-49 segments, germline hV H 3-53 segment, germline hVH 3-64 segment, germline hV H 3-66 segments, germline hV H 3-72 segment, germline hV H 3-73 segment, germline hV H 3-74 segment, germline hV H 4-4 segment, germline hV H 4-28 segments, germline hV H 4-30-1 segment, germline hV H 4 30-2 segment, germline hV H 4-30-4 segment, germline hV H 4-31 segments, germline hV H 4-34 segments, germline hV H 4-39 segment, germline hV H 4-59 segment, germline hV H 4-61 segment, germline hV H 5-51 segment, germline hV H 6-1 segment, germline hV H 7-4-1 segment, germline hV H In some embodiments, the germline Ig V segment or variant thereof is a germline hV H 1-69 segment or a variant thereof. In some embodiments, the variant is an allelic variant.

[0010] In some embodiments, a recombinant nucleic acid molecule may comprise a heavy chain variable region locus, e.g., may comprise, in operable linkage, from 5' to 3': (I) a modified Ig V H (II) one or more Ig heavy chain diversity (D H ) segment, and (III) one or more Ig heavy chain binding (J H ) segment. In some embodiments, the Ig D H One or more of the segments may be human Ig D Hand / or (III) Ig J H One or more of the segments is a human Ig J H In some embodiments, the IgD segment of (II) is one, more, or all of the IgD segments. H (III) one or more of the Ig J segments; H One or more of the gene segments are recombined and rearranged into Ig D. H / J H The recombinant nucleic acid molecule thus comprises, in operable linkage and from 5' to 3', the following: H gene segments and rearranged Ig D H / J H array.

[0011] In some embodiments, the modified Ig V H gene segments and rearranged Ig D H / J H The sequence is recombined and rearranged into Ig V H / D H / J H and forming a sequence encoding an anchor-modified Ig heavy chain variable domain, wherein the anchor-modified Ig heavy chain variable domain comprises, in operable linkage, (i) an Ig signal peptide, (ii) an anchor, and (iii) a rearranged Ig V H / D H / J H It includes FR1, complementarity determining region (CDR1), FR2, CDR2, FR3, CDR3, and FR4, which are encoded by the sequence.

[0012] In some embodiments, the modified Ig V H The segment is an unrearranged modified Ig V H It is a gene segment.

[0013] In some embodiments, the recombinant nucleic acids disclosed herein comprise an Ig heavy chain constant region (C H), wherein the nucleic acid sequence encoding Ig C H The nucleic acid sequence encoding the modified Ig V H segment, (II) Ig D H (III) one or more of the Ig J segments; and H In some embodiments, the Ig C segment is downstream of and operably linked to one or more of the Ig C segments. H The nucleic acid sequence encoding the IgV comprises an Igμ gene encoding an IgM isotype, an Igδ gene encoding an IgD isotype, an Igγ gene encoding an IgG isotype, an Igα gene encoding an IgA isotype, and / or an Igε gene encoding an IgE isotype. In some embodiments, a recombinant nucleic acid molecule described herein comprises a nucleic acid sequence encoding an anchor-modified Ig heavy chain, wherein the anchor-modified Ig heavy chain comprises, in operable linkage, (i) an Ig signal peptide, (ii) an anchor, (iii) a rearranged IgV H / D H / J H an Ig heavy chain variable domain comprising FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence: H In some embodiments, Ig C H is a non-human Ig C H , e.g., rodent Ig C H , e.g., rat Ig C H or mouse Ig C H is.

[0014] In some embodiments, the germline Ig V segment or variant thereof is a germline Ig light chain variable (V L ) segment or variants thereof. In some embodiments, the recombinant nucleic acid molecule may comprise a light chain variable region locus, e.g., may comprise, in operable linkage, from 5' to 3': (I) a modified Ig V L segment, and (II) Ig light chain binding (J L ) segments.

[0015] In some embodiments, the modified Ig V L segment, and Ig J L Ig V, in which one or more of the segments have been rearranged and rearranged L / J L The sequence encodes an anchor-modified Ig light chain variable domain, wherein the anchor-modified Ig light chain variable domain comprises, in operative linkage, (i) an Ig signal peptide, (ii) an anchor, and (iii) a rearranged Ig V L / J L It includes FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, which are encoded by the sequences.

[0016] In some embodiments, the recombinant nucleic acid molecule comprises a light chain variable region locus and an Ig light chain constant region (C L ), in which case the Ig C L is downstream of and operably linked to: (I) a modified Ig V L segment, and (II) Ig light chain binding (J L In some embodiments, the anchor-modified Ig light chain comprises, in operative linkage, one or more of: (i) an Ig signal peptide; (ii) an anchor; (iii) a rearranged Ig V segment; L / J L an Ig light chain variable domain including FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence: L In some embodiments, Ig C L is a non-human Ig C L , e.g., rodent Ig C L , e.g., rat Ig C L or mouse Ig C L is.

[0017] In some light chain variable region locus embodiments, the germline Ig V LThe segment or variant thereof is a germline Ig light chain variable kappa (Vκ) segment or variant thereof. Thus, in some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage and from 5' to 3', the following: (I) a modified Ig Vκ segment, and (II) one or more Ig light chain binding kappa (Jκ) segments. In some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage and from 5' to 3', the following: (I) a modified Ig Vκ segment, (II) one or more Ig light chain binding kappa (Jκ) segments, and (III) a nucleic acid sequence encoding an Ig light chain constant kappa region (CK).

[0018] In some light chain variable region locus embodiments, the germline Ig V L The segment or variant thereof is a germline Ig light chain variable lambda (Vλ) segment or variant thereof. Thus, in some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage and from 5' to 3', the following: (I) a modified Ig Vλ segment, and (II) one or more Ig light chain joining lambda (Jλ) segments. In some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage and from 5' to 3', the following: (I) a modified Ig Vλ segment, (II) one or more Ig light chain joining lambda (Jλ) segments, and a nucleic acid sequence encoding an Ig light chain constant lambda region (Cλ).

[0019] In some embodiments, a recombinant nucleic acid molecule described herein comprises the sequence set forth as SEQ ID NO: 8 or a degenerate variant thereof, or SEQ ID NO: 10 or a degenerate variant thereof.

[0020] Targeting vectors, non-human animal cells (eg, host cells, embryonic stem cells, etc.), and non-human animals that contain the nucleic acid molecules are also described.

[0021] Also described are targeting vectors comprising embodiments of the recombinant nucleic acid molecules disclosed herein. In some targeting vector embodiments, the targeting vector further comprises 5' and 3' homology arms that target a non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus transfers the recombinant nucleic acid molecule to a non-human Ig C at the non-human Ig heavy chain locus. H and optionally wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus, and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and is operably linked to an endogenous Ig V H , D H and / or J H In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule comprises a non-human V gene segment deletion at the non-human Ig heavy chain locus. H In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig heavy chain locus. H Segment, all non-human D H segments, and all non-human J H In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule replaces one non-human V segment at the non-human Ig heavy chain locus. H All or all non-human V except for segment H Segment, all non-human D H segments, and all non-human J HIn some embodiments, upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig heavy chain regulatory sequence at the non-human Ig heavy chain locus. In some embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig heavy chain regulatory sequence of the non-human Ig heavy chain locus, optionally wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus in a rodent or rodent cell (e.g., a rodent embryonic stem cell), and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and is operably linked to an endogenous Ig V H , D H and / or J H or a combination thereof, and optionally wherein upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule comprises one or more non-human V gene segments at the non-human Ig heavy chain locus. H Segment, all non-human D H gene segments, all non-human J H gene segment, and one or more non-human C H In some embodiments, the 5' homology arm comprises the sequence set forth as SEQ ID NO:11 and / or the 3' homology arm comprises the sequence set forth as SEQ ID NO:12.

[0022] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus comprises the recombinant nucleic acid molecule upstream of and operably linked to a non-human Ig CL of the non-human Ig light chain locus, optionally in which case the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or in which the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and an endogenous Ig V L and / or J L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule comprises a non-human V gene segment deletion at the non-human Ig light chain locus. L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule replaces all non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J HIn some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain regulatory sequence at the Ig light chain locus. In some embodiments, the targeting vector described herein comprises a nucleic acid molecule described herein and 5' and 3' homology arms, which target the non-human Ig light chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig light chain regulatory sequence at the non-human Ig light chain locus, optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V L and / or J L or a combination thereof, and optionally wherein upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig light chain locus. L Segment, J L gene segment, and replaces the non-human CL gene.

[0023] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises the recombinant nucleic acid molecule upstream of and operably linked to a non-human Ig Cκ of the non-human Ig light chain κ locus, optionally wherein the non-human Ig light chain κ locus is an endogenous rodent Ig light chain κ locus, and / or wherein the non-human Ig light chain κ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vκ and / or Jκ gene segment, or comprises a combination thereof. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces a non-human Vκ segment at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces one or more non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces all non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus.In some targeting vector embodiments, the targeting vector comprises a nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig light chain κ regulatory sequence of the Ig light chain κ locus, optionally in which case, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces the non-human Vκ segment, all Jκ gene segments, and the non-human CK gene at the non-human Ig light chain κ locus.

[0024] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises the recombinant nucleic acid molecule upstream of and operably linked to a non-human Ig Cλ of the non-human Ig light chain locus, optionally wherein the non-human Ig light chain λ locus is an endogenous rodent Ig light chain λ locus, and / or wherein the non-human Ig light chain λ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vλ and / or Jλ gene segment, or comprises a combination thereof. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces a non-human Vλ segment at the non-human Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces one or more non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces all non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus. In some embodiments, the targeting vector comprises a nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus.In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces the non-human Vλ segment, all of the non-human Jλ gene segments, and the non-human Cλ gene at the non-human Ig light chain λ locus.

[0025] Also described herein are non-human animal genomes comprising the recombinant nucleic acid molecules and / or targeting vectors described herein. In some non-human animal genome embodiments, the non-human animal genome comprises a recombinant nucleic acid molecule described herein at an endogenous Ig locus of the non-human animal genome, for example, the non-human animal genome comprises a targeting vector described herein, wherein the targeting vector comprises 5' and 3' homology arms that target the endogenous Ig locus. In some embodiments, the non-human animal genome is a rodent genome. In some embodiments, the non-human animal genome is a rat genome. In some embodiments, the non-human animal genome is a mouse genome.

[0026] Also described herein are non-human animals or non-human animal cell genomes that comprise the recombinant nucleic acid molecules, targeting vectors, and / or non-human animal genomes described herein. In some non-human animal embodiments, the non-human animals described herein comprise the recombinant nucleic acid molecules, targeting vectors, or non-human animal genomes described herein in their germline, e.g., germ cells, and can, e.g., pass on the recombinant nucleic acid molecules, targeting vectors, and / or non-human animal genomes described herein to their offspring.

[0027] Also described are methods of producing non-human cells, non-human embryos, and / or non-human animals in vitro using recombinant nucleic acid molecules, such as the targeting vectors described herein. In some embodiments, the in vitro method of modifying an isolated cell includes introducing a recombinant nucleic acid molecule described herein into the isolated cell, for example, by contacting the cell with a targeting vector described herein. In some method embodiments, the cell is a host cell. In some embodiments, the cell is an embryonic stem (ES) cell. In some embodiments, the cell described herein or produced according to the methods described herein is a rodent cell, for example, in which the rodent cell is a rat cell or a mouse cell.

[0028] Also described are methods for making anchor-modified antigen-binding proteins using the nucleic acid molecules, non-human cells, and / or non-human animals described herein. Also described are non-human animal embryos and animals that may comprise the embryonic stem cells described herein and / or that can be developed (e.g., generated) from the embryonic stem cells described herein. Such embryos or non-human animals can be developed by a method comprising implanting an ES cell described herein into an embryo and / or implanting an embryo containing ES cells into a suitable host and maintaining the host under appropriate conditions during the development of the ES cells or the embryo to produce viable offspring.

[0029] In some non-human animal embodiments described herein (e.g., embodiments in which the non-human animal comprises a recombinant nucleic acid molecule, targeting vector, and / or genome described herein and / or is generated according to the methods described herein), the non-human animal comprises, compared to a control non-human animal: (a) a comparable number of mature B cells in the spleen, (b) a comparable number of kappa-positive B cells in the spleen, (c) a comparable number of lambda-positive B cells in the spleen, (d) a comparable level of serum IgG, and / or (e) a comparable level of serum IgM. In some embodiments, the non-human animal described herein is capable of mounting an immune response comparable to the control non-human animal. In some embodiments, the non-human animal described herein comprises multiple antigen-binding proteins, each of which comprises an anchor and / or is derived from a recombinant nucleic acid molecule, targeting vector, and / or non-human animal described herein. In some embodiments, the non-human animal described herein further comprises a cognate receptor for a non-immunoglobulin polypeptide of interest, wherein the receptor-binding portion of the non-immunoglobulin polypeptide of interest serves as an anchor. In some non-human animal embodiments, the non-human animals described herein comprise multiple antigen binding proteins, each of which specifically binds to a cognate receptor of the non-immunoglobulin polypeptide of interest, and the receptor-binding portion of the non-immunoglobulin polypeptide of interest serves as an anchor.

[0030] As described herein, the subject non-immunoglobulin polypeptide (wherein the receptor-binding portion of the subject non-immunoglobulin polypeptide serves as an anchor) can include atrial natriuretic peptide (ANP). In some embodiments, the c-terminal tail of ANP (e.g., NSFRY (SEQ ID NO: 3)) can serve as an anchor for the cognate receptor. In some embodiments, the cognate receptor includes a natriuretic peptide receptor (NPR), e.g., NPR3, or a portion thereof.

[0031] In some non-human animal embodiments, when a non-human animal described herein is immunized with a cognate receptor for a non-immunoglobulin polypeptide of interest (optionally in which the cognate receptor comprises a natriuretic peptide receptor (NPR), e.g., NPR3), whose receptor-binding portion (e.g., NSFRY (SEQ ID NO: 3)) serves as an anchor described herein, the non-human animal described herein further comprises a plurality of antigen-binding proteins that bind to their cognate receptors, each of which binds to at least 1 x 10 9 KD less than and / or t > 30 min 1 / 2 In some embodiments, at least 15% of the plurality of antigen binding proteins are capable of and / or block binding of a cognate receptor to a non-immunoglobulin polypeptide of interest. In some embodiments, more than 50% of the plurality of antigen binding proteins bind to a cognate receptor expressed on the cell surface.

[0032] In some non-human animal embodiments described herein, the non-human animal is a rodent. In some non-human animal embodiments described herein, the non-human animal is a rat. In some non-human embodiments, the non-human animal is a mouse.

[0033] Also described are anchor-modified antigen binding proteins encoded by the nucleic acid molecules described herein or produced by the non-human animals described herein.

[0034] Described herein are methods for producing an antigen-binding protein or obtaining a nucleic acid encoding the same, comprising: (i) immunizing a non-human animal described herein, or a non-human animal produced according to the methods described herein (e.g., a non-human animal comprising an engineered immunoglobulin (Ig) variable (V) segment encoding an anchor-modified Ig polypeptide), with an antigen (e.g., a cognate receptor for a non-immunoglobulin polypeptide of interest, wherein a receptor-binding portion of the non-immunoglobulin polypeptide of interest serves as an anchor); and (ii) generating an immune response in the non-human animal against the antigen, comprising an antibody that binds the antigen, or a nucleic acid encoding the antibody. Some embodiments further comprise recovering the antigen-binding protein or nucleic acid encoding the protein from the non-human animal or non-human animal cells, such as B cells, and optionally fusing the B cells with myeloma cells to form hybridomas. Some embodiments further comprise cloning the recovered nucleic acid into an expression construct and, optionally, expressing the expression construct in a host cell. In some cloning embodiments, the method further comprises cloning the recovered nucleic acid, wherein the recovered nucleic acid encodes an Ig variable domain in frame with a sequence encoding a human Ig constant region. Also described herein are B cells, hybridomas fused with B cells, or host cells expressing nucleic acid recovered from B cells. In some embodiments, the mass of each antigen binding protein confirms the presence of an anchor-modified Ig polypeptide. In some embodiments, the mass of each antigen binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry. In some embodiments, the mass of each antigen binding protein confirms the presence of an anchor-modified Ig polypeptide, and the mass of each antigen binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry.

[0035] Also described herein are anchor-modified Ig polypeptides that are (a) encoded by a recombinant nucleic acid molecule described herein, a targeting vector described herein, or a non-human animal genome described herein; (b) expressed by a non-human animal or a non-human animal cell described herein; (c) expressed by a non-human animal or a non-human animal cell made according to the methods described herein; and / or (d) made by any of the methods described herein.

[0036] Other features, objects, and advantages of the non-human animals, cells, nucleic acids, and compositions disclosed herein will become apparent from the detailed description of specific embodiments that follows. However, it should be understood that the following detailed description, while indicating specific embodiments, is given by way of illustration only and not by way of limitation. [Brief explanation of the drawings]

[0037] The drawings contained herein, which consist of the following figures, are for illustration purposes only and not for limitation purposes.

[0038] [Figure 1] Figure 1 shows a non-limiting example of an embodiment of an ANP-modified VH gene segment useful as donor DNA for Cas9 / GA modification, not to scale. Also shown are restriction enzyme recognition sites (XhoI, Mrel, EcoRI, AvrII, Mrel) and the spectinomycin resistance gene (SPEC). In this non-limiting embodiment, a human VH1-69 gene segment is modified with a sequence encoding the C-terminal tail of atrial natriuretic protein (ANP) (NSFRY, SEQ ID NO: 3) to form a donor DNA comprising an ANP-modified VH1-69 gene segment. Generally, open regions represent human sequences, and solid regions represent mouse sequences. Stippled regions represent non-human, non-mouse sequences.

[0039] [Figure 2-1]FIG. 2 shows an example of a non-limiting embodiment of the DNA donor (set forth as SEQ ID NO: 10) used to modify the VH1-69 gene in BAC clone VI504.The following characteristics are demonstrated: - a sense DNA sequence comprising: (a) the last seven codons of the bipartite signal peptide (see "signal peptide" labeled split arrow) encoded by the germline human VH1-69 segment; the nucleotide sequence encoding the entire signal polypeptide is set forth as SEQ ID NO:6; and the amino acid sequence of the entire signal polypeptide is set forth as SEQ ID NO:7; (b) the germline Ig VH1-69 segment (see "VH" labeled split arrow just above the DNA sequence) including exon 1, intron 1, and exon 2; (c) the germline Ig VH1-69 segment including exon 1, intron 1, and exon 2; (d) nucleotide sequence encoding the C-terminal tail of atrial natriuretic peptide (ANP) (SEQ ID NO: 3) and G4S linker (SEQ ID NO: 5); (e) portion of the germline VH1-69 segment encoding FR1, CDR1 (patterned box), FR2, CDR2 (patterned box), FR3, and CDR3 (patterned box), and the amino acid sequence of the same (see split arrow labeled IgHV1-69); and (f) a 23-mer recombination signal sequence (RS-23 split); - conceptual translation of the ANP-modified VH1-69 segment (labeled ANP-G4S-VH1-69) including the leader sequence; - crRNA binding site used to cleave VI504 in vitro with Cas9 (labeled 5'VH1-69 Cas9 and PAM); - Gibson sequence of VI504 and donor The 5' and 3' overlaps used for assembly (black arrowhead lines labeled "5'VH1-69 overlap" and "3'VH1-69," respectively) - restriction enzyme sites indicated by hatched boxes below the sequences: EcoRI and AvrII sites used to ligate the spectinomycin resistance cassette into the donor, an XhoI site used to remove the donor from the pUC vector backbone, and an MreI site used to remove the Spec cassette from the modified BAC before seamless repair by joiner oligo-mediated Gibson assembly. [Figure 2-2] Same as above.

[0040] [Figure 3] FIG. 3 shows a diagram, not to scale, of a non-limiting exemplary embodiment in which an ANP-modified VH1-69 segment was inserted into BAC clone VI504 according to Example 1 to generate targeting vector VI748. Generally, unfilled text represents human sequences (e.g., unfilled triangles represent human VH1-69, D, and JH segments), filled text represents mouse sequences (e.g., filled triangles represent endogenous mouse VH segments (unlabeled), filled arrows represent mouse Adam6a "a" and Adam6b "b" genes, filled ovals represent Ig enhancers, and filled arrows represent mouse Igμ gene "IgM"), and stippled text represents non-human and non-mouse sequences (e.g., chloramphenicol resistance gene "CM", site-specific recombinase recognition site "Frt", hygromycin resistance gene "HYG", and spectinomycin resistance gene "SPEC").

[0041] [Figure 4]4 shows a diagram, not to scale, of an example non-limiting embodiment of inserting a targeting vector into the immunoglobulin heavy chain variable region locus in the genome of a mouse ES cell by electroporation. After electroporation, this example non-limiting embodiment retains the endogenous VH segment, shown as a filled triangle, upstream of the Adam6a ("a") gene. Generally, unfilled text represents human sequences (e.g., unfilled triangles represent human VH1-69, D, and JH segments), filled text represents mouse sequences (e.g., filled triangles represent endogenous mouse VH segments (unlabeled), filled arrows represent mouse Adam6a "a" and Adam6b "b" genes, filled ovals represent Ig enhancers, and filled arrows represent mouse Igμ gene "IgM"), and stippled text represents non-human and non-mouse sequences (e.g., chloramphenicol resistance gene "CM", site-specific recombinase recognition site "Frt", hygromycin resistance gene "HYG", and spectinomycin resistance gene "SPEC").

[0042] [Figure 5A]Figures 5A-5F show graphs comparing spleen cell populations from ANP-VH1-69 modified mice with control VELOCIMMUNE® mice, results related to non-limiting embodiments of the invention. Figures 5A-B show (A) the total number of cells per spleen (y-axis), the number of CD19+ cells / spleen (y-axis), or (B) the percentage of lymphocytes (CD19+ cells) per spleen (y-axis) for mice modified with the ANP-modified VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (Control). Figures 5C-5D show (C) the total number of mature B cells (CD19+IgDhiIgMint) and transitional B cells (CD19+IgDintIgMhi) per spleen (y-axis) or (D) the percentage of mature B cells (CD19+IgDhiIgMint) and transitional B cells (CD19+IgDintIgMhi) per spleen (y-axis) from mice engineered with the ANP-modified VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (Control). Figures 5E-F show (E) the total number of CD19+kappa+ cells and CD19+lambda+ cells per spleen (y-axis) or (F) the percentage of CD19+κ+ cells and CD19+λ+ cells per spleen (y-axis) from mice engineered with the ANP-modified VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (Control). [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 5E] Same as above. [Figure 5F] Same as above.

[0043] [Figure 6A]Figures 6A-6F show graphs of bone marrow cell populations isolated from femurs of ANP-VH1-69 modified mice compared to control VELOCIMMUNE® mice, according to non-limiting embodiments of the invention. Figures 6A-B show (A) the total number of cells per femur (y-axis) and the number of CD19+ B cells per femur (y-axis), or (B) the percentage of lymphocytes (CD19+ cells) per femur (y-axis) for mice modified with the ANP-VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (Control). Figures 6C-D show (C) the total number of CD43+ckit+ pro-B cells (y-axis) and the number of CD43-ckit- pre-B cells (y-axis) per femur, or (D) the percentage of CD43+ckit+ pro-B cells or CD43-ckit- pre-B cells per femur, from mice engineered with the ANP-modified VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (control). Figures 6E-F show (E) the total number of immature and mature B cells (y-axis) per femur, or (F) the percentage of immature and mature B cells (y-axis) per femur, from mice engineered with the ANP-modified VH1-69 segment (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (control). [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 6E] Same as above. [Figure 6F] Same as above.

[0044] [Figure 7] FIG. 7 shows results related to a non-limiting embodiment of the present invention, showing serum IgG levels from ANP-VH1-69 modified animals and control VELOCIMMUNE® control animals analyzed by Western blot analysis.

[0045] [Figure 8A]Figures 8A-B show the concentrations (μg / mL, y-axis) of (A) serum mouse (m)IgG or (B) serum mIgM isolated from ANP-VH1-69 modified animals (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (control), results related to non-limiting embodiments of the present invention. [Figure 8B] Same as above.

[0046] [Figure 9] Figure 9 shows a graph comparing immune responses (antibody titers, y-axis) to protein antigens in ANP-VH1-69 modified animals (ANP) or control VELOCIMMUNE® animals containing humanized Ig loci (control), results related to a non-limiting embodiment of the invention. Of the sera tested, for ANP-VH1-69 modified mice, three samples were from the bleed after the third boost and one sample was from the bleed after the fifth boost. For VELOCIMMUNE® control mice, two serum samples were from the bleed after the sixth boost and one sample was from the bleed after the ninth boost.

[0047] [Figure 10] Figure 10 shows a graph comparing immune responses (antibody titers, y-axis) to protein antigens in ANP-VH1-69 modified animals (ANP) or control VELOCIMMUNE® animals containing humanized Ig loci (control), results related to a non-limiting embodiment of the invention. Of the sera tested, for ANP-VH1-69 modified mice, three samples were from the bleed after the third boost and one sample was from the bleed after the fifth boost. For VELOCIMMUNE® control mice, two serum samples were from the bleed after the sixth boost and one sample was from the bleed after the ninth boost.

[0048] [Figure 11]Figure 11 shows results related to a non-limiting embodiment of the present invention, using a box plot comparing the KD values (y-axis) of hNPR3-MMH binding to NPR3 monoclonal antibodies (mAbs) isolated from ANP-VH1-69 modified mice (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (control) against protein antigen at 25°C.

[0049] [Figure 12] Figure 12 shows results related to a non-limiting embodiment of the present invention, using a boxplot comparing the t1 / 2 values (y-axis) of hNPR3-MMH binding to NPR3 monoclonal antibodies (mAbs) isolated from ANP-VH1-69 modified mice (ANP) or control VELOCIMMUNE® animals containing a humanized Ig locus (control) against protein antigen at 25°C. DETAILED DESCRIPTION OF THE INVENTION

[0050] definition The scope of the present invention is defined by the claims appended hereto, and is not limited by the specific embodiments described herein. Those skilled in the art will recognize, upon reading this disclosure, various modifications that may be equivalent to such described embodiments or that may otherwise be within the scope of the claims. Generally, terminology follows its art-understood meaning unless clearly indicated otherwise. Explicit definitions of certain terms are provided herein and below, but the meaning of these and other terms in specific instances throughout the specification will be apparent to those skilled in the art from the context. Further definitions of the following terms, and other terms, are set forth throughout the specification. References cited within this specification, or relevant portions thereof, are incorporated herein by reference in their entirety.

[0051] The use of ordinal terms such as "first," "second," "third," etc. to modify the claims does not, in itself, imply any priority, precedence, or order of one claim element over another, or the chronological order in which acts of a method are performed, but is used solely as a marker to distinguish one claim element with a particular name from another element with the same name (other than the use of ordinal terms).

[0052] In this specification and the claims, the articles "a" and "an" should be understood to include plural referents unless clearly indicated otherwise. A claim or statement including "or" between one or more elements of a group is satisfied when one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless otherwise indicated or otherwise clear from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which two or more, or the entire group member, is present in, employed in, or otherwise relevant to a given product or process. Furthermore, the invention should be understood to cover all variations, combinations, and permutations of one or more limitations, elements, phrases, descriptive terms, etc. from one or more of the claims described herein that are introduced into another claim (or any other related claim) relying on the same base claim, unless otherwise specified or unless a contradiction or inconsistency would arise apparent to one of ordinary skill in the art. Where elements are present as recited (e.g., in a Markush group or similar format), each subgroup of elements is also disclosed, and any element can be removed from the group. It will be understood that, generally, when the invention, or aspects of the invention, are referred to as including particular elements, features, etc., an embodiment of the invention or aspect of the invention consists of, or consists essentially of, such elements, features, etc. For the sake of brevity, these embodiments will not in all instances be specifically described in so many words herein. It will also be understood that any embodiment or aspect of the invention may be explicitly excluded from the claims, regardless of whether a specific exclusion is recited in the specification.

[0053] As used herein, the terms "about" and "approximately" are used interchangeably. Any numbers used herein, with or without about / approximately, are intended to cover any normal variation understood by one of ordinary skill in the art, for example, + / - 5%.

[0054] Administration: refers to the administration of a composition to a subject or system (e.g., a cell, organ, tissue, organism, or related component or components thereof). One of skill in the art will recognize that the route of administration can vary depending, for example, on the subject or system to which the composition is administered, the nature of the composition, the purpose of administration, etc.

[0055] For example, in some embodiments, administration to an animal subject (e.g., a human or rodent) may be by bronchial (including bronchial infusion), buccal, enteral, intradermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, intranasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including intratracheal infusion), transdermal, vaginal, and / or intravitreal administration. In some embodiments, administration may include intermittent dosing. In some embodiments, administration may include continuous dosing (e.g., perfusion) over at least a selected period of time. In some embodiments, antibodies produced by a non-human animal disclosed herein may be administered to a subject (e.g., a human subject or a rodent). In some embodiments, a pharmaceutical composition comprises an antibody produced by a non-human animal disclosed herein. In some embodiments, the pharmaceutical composition may comprise a buffer, a diluent, an excipient, or any combination thereof. In some embodiments, the pharmaceutical composition comprising the antibody produced by the non-human animal disclosed herein may be contained in a container for storage or administration, such as, for example, a vial, a syringe (e.g., an IV syringe), or a bag (e.g., an IV bag).

[0056] Affinity refers to the strength of the interaction between an antigen-binding protein and its binding partner, e.g., the interaction between an antibody and a specific epitope. An antibody that specifically binds to an epitope typically has an affinity of about 10 for its target epitope. -9 M or less (e.g., about 1x10 -9 Medium, 1x10 -10 Medium, 1x10 -11 M, or approximately 1x10 -12 M)'s KD K D can be measured by surface plasmon resonance, eg, BIACORE™, enzyme-linked immunosorbent assay (ELISA), or other known methods.

[0057] Antibody refers to an immunoglobulin antigen-binding protein. A tetrameric antibody comprises four polypeptide immunoglobulin (Ig) chains, e.g., two Ig heavy chains (H) and two Ig light chains (L), interconnected by disulfide bonds. Each heavy chain contains an Ig heavy chain variable domain and an Ig heavy chain constant region or domain (C). H The heavy chain constant region comprises C H 1. C H 2, and C H Each light chain contains three domains: an Ig light chain variable domain and an Ig light chain constant region (C L ) is included.

[0058] The Ig heavy and light chain variable domains can each be further subdivided into regions of hypervariability called complementarity-determining regions (CDRs), which are interspersed with more conserved regions called framework regions (FRs). The Ig heavy and light chain variable domains each contain three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs may also be abbreviated as HCDR1, HCDR2, and HCDR3, and light chain CDRs may also be abbreviated as LCDR1, LCDR2, and LCDR3).

[0059] Antigen-binding proteins refer to immunoglobulins, antibodies, and binding proteins, such as, for example, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFvs), single-chain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFvs), intrabodies, minibodies, diabodies, and anti-idiotypic (anti-Id) antibodies, as well as epitope-binding fragments of any of the above. The terms "antibody" and "antibody antibodies" also refer to covalently linked diabodies, such as those disclosed in U.S. Patent No. 20070004909, and Ig-DARTS, such as those disclosed in U.S. Patent No. 20090060910, both of which are incorporated by reference in their entireties.

[0060] Biological activity refers to the characteristic of any agent that has activity in a biological system, in vitro or in vivo (e.g., in an organism). For example, an agent is considered to be biologically active if it has a biological effect in an organism when it is present in that organism.

[0061] In certain embodiments, if a protein or polypeptide is biologically active, a portion of the protein or polypeptide that confers at least one biological activity of the protein or polypeptide is generally referred to as a "biologically active" portion.

[0062] Cognate refers to two biomolecules that typically interact (eg, a receptor and its ligand).

[0063] Equivalent means two or more agents, entities, situations, groups of conditions, etc. that may not be identical to one another, but that are similar enough to permit a comparison that allows reasonable conclusions to be made based on observed differences or similarities. Those of skill in the art will understand the degree of identity required in a given situation for two or more such agents, entities, situations, groups of conditions, etc. to be considered equivalent within the context.

[0064] Conservative refers to conservative amino acid substitutions, i.e., the replacement of an amino acid residue with another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). Generally, conservative amino acid substitutions do not substantially alter the functional properties of the protein of interest, such as the ability of the subject non-immunoglobulin polypeptide to bind to its cognate receptor. Examples of amino acid groups with side chains with similar chemical properties include: aliphatic side chains such as glycine, alanine, valine, leucine, and isoleucine; aliphatic-hydroxyl side chains such as serine and threonine; amide-containing side chains such as asparagine and glutamine; aromatic side chains such as phenylalanine, tyrosine, and tryptophan; basic side chains such as lysine, arginine, and histidine; acidic side chains such as aspartic acid and glutamic acid; and sulfur-containing side chains such as cysteine and methionine. Conservative amino acids substitution groups include, for example, valine / leucine / isoleucine, phenylalanine / tyrosine, lysine / arginine, alanine / valine, glutamic acid / aspartic acid, and asparagine / glutamine.

[0065] In some embodiments, conservative amino acid substitutions can be substitutions of any native residue in a protein, including alanine, such as those used in alanine-scanning mutagenesis. In some embodiments, conservative substitutions are made that have a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet, GH et al., 1992, Science 256:1443-1445, which is incorporated herein by reference in its entirety. In some embodiments, the substitution is a moderately conservative substitution, in which the substitution has a non-negative value in the PAM250 log-likelihood matrix.

[0066] Control refers to the art-known meaning of "control," a standard against which results are compared. Generally, controls are used to increase the integrity of an experiment by isolating a variable in order to draw conclusions about such a variable. In some embodiments, a control is a reaction or assay performed simultaneously with a test reaction or assay to provide a comparator. "Control" may refer to a "control animal." A "control animal" may have a modification described herein, a modification different from those described herein, or be unmodified (i.e., a wild-type animal). In one experiment, the "test" (i.e., the variable being tested) is administered. In a second experiment, which is the "control," the variable being tested is not administered. A control may be a positive or negative control.

[0067] In some embodiments, the control is a historical control (i.e., of a previously performed test or assay, or of a previously known amount or result). In some embodiments, the control is or includes a printed or otherwise kept record.

[0068] A degenerate variant of a reference nucleic acid molecule has the same amino acid sequence as the amino acid sequence encoded by the reference nucleic acid, and encodes a polypeptide that has substantially the same nucleic acid sequence as the reference nucleic acid molecule, but that has differences due to the degeneracy of the genetic code.

[0069] Disruption refers to the result of a homologous recombination event with a DNA molecule (eg, an endogenous homologous sequence such as a gene or locus).

[0070] In some embodiments, the disruption may achieve or exhibit an insertion, deletion, substitution, replacement, missense mutation, or frameshift of a DNA sequence, or any combination thereof. The insertion may include the insertion of an entire gene, a fragment of a gene (e.g., an exon), which may be of a source other than the endogenous sequence (e.g., a heterologous sequence), or a coding sequence derived from or isolated from a particular gene of interest. In some embodiments, the disruption may increase the expression and / or activity of a gene or gene product (e.g., of a protein encoded by the gene). In some embodiments, the disruption may decrease the expression and / or activity of a gene or gene product. In some embodiments, the disruption may alter the sequence of a gene or encoded gene product (e.g., the encoded protein). In some embodiments, the disruption may alter the sequence of a chromosome or chromosomal location within a genome. In some embodiments, the disruption may truncate or fragment a gene or encoded gene product (e.g., the encoded protein). In some embodiments, the disruption may extend a gene or encoded gene product. In some such embodiments, the disruption may enable the assembly of a fusion protein. In some embodiments, the disruption may affect the level of the gene or gene product but not its activity. In some embodiments, the disruption may affect the activity of the gene or gene product but not its level. In some embodiments, the disruption may have no significant effect on the level of the gene or gene product. In some embodiments, the disruption may have no significant effect on the activity of the gene or gene product. In some embodiments, the disruption may have no significant effect on either the level or activity of the gene or gene product. In some embodiments, a significant effect can be measured by, for example, but not limited to, a Student's T-test.

[0071] Endogenous locus or endogenous gene refers to the locus of a gene present in a parent or reference organism (or cell) prior to the introduction of an alteration, disruption, deletion, insertion, modification, substitution or replacement as described herein.

[0072] In some embodiments, the endogenous locus comprises, in whole or in part, a sequence found in nature. In some embodiments, the endogenous locus is a wild-type locus. In some embodiments, the reference organism is a wild-type organism. In some embodiments, the reference organism is a genetically engineered organism. In some embodiments, the reference organism is a laboratory-bred organism (wild-type or genetically engineered).

[0073] An endogenous promoter refers to a promoter that is naturally associated with an endogenous gene or gene locus, e.g., in a wild-type organism.

[0074] The term "engineered" generally refers to a state in which something has been manipulated by the hand of man. As is common and understood by those skilled in the art, the progeny of an engineered polynucleotide or cell are typically considered "engineered," even if the actual manipulation was performed on a previous entity. Furthermore, as will be appreciated by those skilled in the art, a variety of techniques are available through which the "manipulation" described herein can be achieved. A polynucleotide may be considered "engineered" when two or more sequences that are not linked together in natural order have been manipulated by the hand of man to be directly linked to each other in the engineered polynucleotide. In some embodiments, an engineered polynucleotide may include a regulatory sequence that is naturally operably linked to a first coding sequence but not to a second coding sequence, and that has been linked by the hand of man to be operably linked to the second coding sequence. Alternatively, or in addition, in some embodiments, a first nucleic acid sequence and a second nucleic acid sequence, each encoding a polypeptide element or domain that is not naturally linked to each other, may be linked to each other in a single engineered polynucleotide. Similarly, in some embodiments, a cell or organism may be considered "engineered" if it has been manipulated to thereby alter its genetic information (e.g., by introducing new genetic material not previously present, or by altering or removing genetic material previously present).

[0075] For example, in some embodiments, "manipulation" may include selection or design (e.g., of nucleic acid sequences, polypeptide sequences, cells, tissues, and / or organisms) through the use of a computer system programmed to analyze or compare, or otherwise analyze recommended and / or selected sequences. Alternatively, or additionally, in some embodiments, "manipulation" may include the use of in vitro chemical synthesis techniques and / or recombinant nucleic acid techniques, such as nucleic acid amplification hybridization (e.g., via the polymerase chain reaction), mutation, transformation, transfection, and / or the use of any of a variety of controlled mating methods. As will be recognized by those skilled in the art, a variety of established such techniques (e.g., recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection, etc.)) are known in the art and are described in various general and detailed references, which are cited and / or discussed throughout this specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, which is incorporated herein by reference in its entirety.

[0076] Gene refers to a DNA sequence in a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product). For clarity, the term "gene" generally refers to a portion of a nucleic acid that encodes a polypeptide; the term may optionally include regulatory sequences, which should be clear to one skilled in the art from the context. This definition is not intended to exclude the application of the term "gene" to expression units that encode non-proteins, but is intended to clarify that as used herein, the term often refers to nucleic acids that encode polypeptides.

[0077] In some embodiments, a gene includes coding sequences (i.e., sequences that encode a particular product). In some embodiments, a gene includes non-coding sequences. In some embodiments, a gene includes both coding sequences (e.g., exon sequences) and non-coding sequences (e.g., intron sequences). In some embodiments, a gene may include one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences that, for example, can control or influence one or more aspects of gene expression (e.g., cell-type specific expression, inducible expression, etc.).

[0078] The variable domain of an immunoglobulin antigen receptor, e.g., an antibody, is encoded by a set of gene segments, also referred to herein as "segments." The segments are arranged contiguously along a chromosome and undergo somatic recombination to form a complete variable domain exon. The organization of inherited human gene segments, e.g., the germline configuration of human gene segments, e.g., the order of human gene segments in a human germline genome (e.g., the genome passed on to the next generation), is found in Lefranc, M.-P., Exp. Clin. immunogenet., 18, 100-116 (2001), which is incorporated herein by reference in its entirety, and which also shows the functional gene segments and pseudogenes found within the human immunoglobulin heavy chain locus in the germline configuration. Gene segments are classified as variable (V) gene segments (each of which may also be individually referred to as a V segment), diversity (D) gene segments (each of which may also be individually referred to as a D segment), or joining (J) segments (each of which may also be individually referred to as a J segment). Although there are multiple copies of each type of gene segment in germline DNA, only one is expressed for each type of receptor chain in receptor-bearing lymphocytes.

[0079] A series of recombination events involving several genetic components helps assemble immunoglobulins from an ordered sequence of gene segments (e.g., V, D, and J). This assembly of gene segments is known as imprecise; therefore, immunoglobulin diversity is achieved both by combining different gene segments and by forming unique combinations through imprecise combinations. Furthermore, diversity is generated through a process known as somatic hypermutation, in which immunoglobulin variable region sequences are modified to increase affinity and specificity for antigens. As used herein, Ig gene segments, e.g., Ig V segments, include germline Ig V segment variants. Germline Ig segment variants, e.g., germline Ig V segment variants, include polymorphisms, such as alleles, variants thereof, somatic hypermutation variants thereof, recombination variants thereof, and degenerate variants thereof.

[0080] Sequence polymorphisms in the coding regions of Ig segments, for example, sequences of allelic variants of germline Ig segments, are described in Pallares, N. et al. (1998) Exp. Clin. Immunogenet., 15, 8-18; Barbie, V. and Lefranc, M.-P. (1998) Exp. Clin. Immunogenet., 15, 171-183; Martinez, C. and Lefranc, M.-P. (1998) Exp. Clin. Immunogenet., 15, 184-193; Pallares, N. et al. (1999) Exp. Clin. Immunogenet., 16, 36-60 (1999), and Ruiz, M. et al. (1999) Exp. Clin. Immunogenet., 16, 173-184. Each of these references is incorporated herein by reference in its entirety. Representations of allelic germline Ig segments can also be found on the web in two formats at imgt.org / IMGTrepertoire / Proteins / #B and imgt.org / IMGTrepertoire / Proteins / #C. The former provides an alignment of all known sequences assigned to various alleles by comparison with allele *01, while the latter provides a description of the nucleotide variations and corresponding amino acid changes of various alleles by comparison with allele *01. See also European Patent No. 3128009, which is incorporated herein by reference in its entirety.

[0081] An Ig V segment can be considered a recombinant or somatic hypermutated variant of a germline Ig V segment if it contains at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% nucleic acid sequence homology to a germline segment over one or more regions of FR1, FR2, and / or FR3, and encodes amino acids with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% amino acid sequence homology to the amino acid sequence encoded by the germline Ig V segment.

[0082] In some embodiments, an Ig V segment can be considered a recombinant or somatic hypermutated variant of a germline Ig V segment if it has 80%-99% nucleic acid sequence identity to the germline segment over one or more regions within FR1, FR2, and / or FR3. In some embodiments, an Ig V segment can be considered a recombinant or somatic hypermutated variant of a germline Ig V segment if it has 85%-99% nucleic acid sequence identity to the germline segment over one or more regions within FR1, FR2, and / or FR3. In some embodiments, an Ig V segment can be considered a recombinant or somatic hypermutated variant of a germline Ig V segment if it has 90%-99% nucleic acid sequence identity to the germline segment over one or more regions within FR1, FR2, and / or FR3. In some embodiments, an Ig V segment can be considered a recombinant or somatically hypermutated variant of a germline Ig V segment if it has 95% to 99% nucleic acid sequence homology to the germline segment over one or more regions of FR1, FR2, and / or FR3.

[0083] An Ig V segment can be considered a recombinant or somatically hypermutated variant of a germline Ig V segment if it encodes amino acids with 80% to 99% amino acid sequence identity to the amino acid sequence encoded by the germline Ig V segment over one or more regions within FR1, FR2, and / or FR3. An Ig V segment can be considered a recombinant or somatically hypermutated variant of a germline Ig V segment if it encodes amino acids with 85% to 99% amino acid sequence identity to the amino acid sequence encoded by the germline Ig V segment over one or more regions within FR1, FR2, and / or FR3. An Ig V segment can be considered a recombinant or somatically hypermutated variant of a germline Ig V segment if it encodes amino acids with 90% to 99% amino acid sequence identity to the amino acid sequence encoded by the germline Ig V segment over one or more regions within FR1, FR2, and / or FR3. An Ig V segment can be considered a recombinant or somatically hypermutated variant of a germline Ig V segment if it encodes amino acids with 95% to 99% amino acid sequence identity to the amino acid sequence encoded by the germline Ig V segment in one or more regions of FR1, FR2, and / or FR3.

[0084] Immunoglobulin molecules are Y-shaped polypeptides composed of two identical heavy chains and two identical light chains, each of which has two structural components, one variable domain and one constant domain. It is the variable domains of the heavy and light chains that are formed by the assembly of gene segments, while the constant domains are fused to the variable domains through RNA splicing. The mechanism for assembling (or joining) the gene segments is similar for heavy and light chains, but only one joining event is required for the light chain (i.e., V to J), while two events are required for the heavy chain (i.e., D to J and V to DJ).

[0085] Generally, immunoglobulin heavy chain variable domains are characterized by immunoglobulin heavy chain diversity (DH ) gene segment (D H (also called the J segment) and the immunoglobulin heavy chain-binding H Gene segment (J H immunoglobulin heavy chain variable (V) segments H ) gene segment (V H Generally, immunoglobulin light chain variable domains are encoded by variable domain exons formed by somatic recombination of immunoglobulin light chain joining (J) segments. L ) gene segment (J L The immunoglobulin light chain variable (V L ) gene segment (V L The variable domains are encoded by variable domain exons formed by somatic recombination of exons (also called segments).

[0086] The assembly of gene segments for heavy and light chain variable regions (referred to as VDJ recombination and VJ recombination, respectively) is guided by conserved non-coding DNA sequences flanking each gene segment, called recombination signal sequences (RSSs), which ensure DNA rearrangement at precise locations relative to the V, D, and J coding sequences (see, e.g., Ramsden, DA et al., 1994, Nuc. Acids Res. 22(10):1785-96; incorporated herein by reference in its entirety). Each RSS consists of a coding sequence (e.g., a V, D, or J segment), followed by a conserved block of seven nucleotides (heptamers) contiguous with a spacer (either 12 bp or 23 bp), and a second conserved block of nine nucleotides (nonamers). Although considerable sequence variance is permitted in the 12 bp or 23 bp spacers between individuals, the lengths of these sequences typically do not vary. Recombination between immunoglobulin gene segments follows what is commonly referred to as the 12 / 23 rule, in which a gene segment flanked by RSSs having a 12-bp spacer (or 12-mer) typically joins with a gene segment flanked by a 23-bp spacer (or 23-mer; see, e.g., Hiom, K. and M. Gellert, 1998, Mol. Cell., 1(7):1011-9, incorporated herein by reference in its entirety).

[0087] Unless otherwise indicated, or unless a contradiction or inconsistency would be apparent to one of skill in the art, an unrearranged gene segment, without reference to an RSS, is presumed to comprise two RSSs with which the gene segments are naturally associated, e.g., adjacent, optionally operably linked, etc. In some embodiments, an unrearranged gene segment herein refers to a gene segment in its germline (e.g., wild-type) configuration, e.g., a germline V RSS, each flanked on both sides by a 23-mer RSS. H Gene segments and germline J H In contrast, germline D HGene segments, e.g., unrearranged D H The gene segment is flanked on each side by a 12-mer RSS.

[0088] Thus, an unrearranged gene segment also refers to a gene segment in its germline configuration, including any RSSs associated with such germline configuration. Furthermore, multiple gene segments in their germline configuration generally refer not only to each individual gene segment in its germline (e.g., unrearranged) configuration, but also to the order and / or position of functional gene segments. See, e.g., Lefranc, M.-P., Exp. Clin. Immunogenet., 18, 100-116 (2001), which is incorporated herein by reference in its entirety for its discussion of the germline configuration of human V, D, and J gene segments.

[0089] Each V segment contains a nucleic acid sequence encoding an Ig signal or Ig leader (L) peptide operably linked to a nucleic acid sequence encoding FR1, CDR1, FR2, CDR2, FR3, and a portion of CDR3 of an immunoglobulin variable domain. Each D gene segment contributes CDR3 of an immunoglobulin heavy chain variable domain. Each J gene segment also contributes CDR3 and FR4 of an immunoglobulin variable domain. The amino acid positions of FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 are based on the unique numbering described in Lefranc et al. (2003) Dev. Comp. Immunol. 27:55-77 and can also be viewed at www.imgt.org.

[0090] Heterologous: refers to a substance or entity from a different source. For example, when used in reference to a polypeptide, gene, or gene product present in a particular cell or organism, the term clarifies that the related polypeptide or fragment thereof, gene or fragment thereof, or gene product or fragment thereof (1) has been genetically manipulated by the hand of man, (2) has been introduced into the cell or organism (or a precursor thereof) by the hand of man (e.g., by genetic manipulation), and / or (3) is not naturally produced by or occurs in the related cell or organism (e.g., related cell type or organism type). Another example includes a polypeptide or fragment thereof, gene or fragment thereof, or gene product or fragment thereof that is normally present in a particular native cell or organism under the control of a regulatory element (e.g., a promoter) with which it is not naturally associated, and in some embodiments, is non-endogenous, but that has been altered, for example, by mutation or substitution.

[0091] A host cell refers to a cell into which a heterologous (e.g., exogenous) nucleic acid or protein has been introduced. Those skilled in the art will understand upon reading this disclosure that such terms are used to refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in subsequent generations due to mutation or environmental influences, such progeny may not be identical to the parent cell, but are still included within the scope of the term "host cell."

[0092] In some embodiments, the host cell is or comprises a prokaryotic or eukaryotic cell. In some embodiments, the host cell is or comprises a mammalian cell. Generally, a host cell is any cell suitable for receiving and / or producing a heterologous nucleic acid or protein, regardless of the species to which the cell is designated. Exemplary cells include prokaryotic and eukaryotic (unicellular or multicellular) cells, bacterial cells (e.g., Escherichia coli), and the like. coli, Bacillus spp., Streptomyces spp., etc.), mycobacterial cells, fungal cells, yeast cells (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Pichia methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusion products such as hybridomas or quadromas.

[0093] In some embodiments, the cells are human, monkey, ape, hamster, rat, or mouse cells. In some embodiments, the cell is a eukaryotic cell and is selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT 060562, Sertoli cells, BRL 3A cells, HT1080 cells, myeloma cells, tumor cells, and cell lines derived from the foregoing cells. In some embodiments, the cell comprises one or more viral genes, e.g., a retinal cell (e.g., a PER.C6® cell) expressing a viral gene. In some embodiments, the host cell is or comprises an isolated cell. In some embodiments, the host cell is part of a tissue. In some embodiments, the host cell is part of an organism.

[0094] Humanized refers to molecules (e.g., nucleic acids, proteins, etc.) that are non-human in origin and in which portions thereof have been replaced with corresponding portions of a corresponding human molecule such that the modified (e.g., humanized) molecule retains its biological function and / or maintains a structure that performs the retained biological function. In contrast, "human" and the like encompasses molecules that are of exclusively human origin, e.g., have human nucleotides or proteins that contain exclusively human nucleotide and amino acid sequences, respectively. The term "human (humanized)" is used to reflect that the human (humanized) molecule can be (a) a human molecule or (b) a humanized molecule.

[0095] Identity: In relation to the comparison of sequences, means identity as determined by a variety of algorithms known in the art that can be used to measure nucleotide and / or amino acid sequence identity.

[0096] In some embodiments, identity as described herein is determined using ClustalW v.1.83 (slow) alignment using a Gonnet similarity matrix (MACVECTOR™ 10.0.2, MacVector Inc., 2008) with a gap opening penalty of 10.0, a gap extension penalty of 0.1.

[0097] Immunoglobulin refers to certain polypeptides present in serum or expressed on B cells of the immune system that function as antibodies, eg, antigen-binding proteins, and nucleic acids encoding such polypeptides.

[0098] A non-immunoglobulin polypeptide refers to a ligand, e.g., a polypeptide, that binds to a cognate receptor. Exemplary and known non-immunoglobulin polypeptide:cognate receptor pairs include, but are not limited to, non-immunoglobulin polypeptides that bind to cognate G protein-coupled receptors (GPCRs). Examples of GPCRs include, but are not limited to, chemokine receptors, glucagon receptors (e.g., GLP1:GLP1R), calcitonin receptors, and melanocortin receptors. These and other cognate GPCRs, including non-immunoglobulin polypeptides that bind to the same receptors, are known in the art. See, for example, Wu et al. See, e.g., S. et al. (2017) J. Mol. Biol. 429:2726-45, which is incorporated herein by reference in its entirety. Additional non-limiting and exemplary non-immunoglobulin polypeptide (ligand):cognate receptor pairs include: a. Ligands that bind to the tyrosine kinase of their cognate receptors, including but not limited to epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and the like; b.DLL:Notch receptor pair, c.B7:CD28 / CLTA4 / PD1 receptor pair, d. Semaphorin:plexin receptor pair, e.PCSK9 / LDLR pair, f.HLA:LILR pair, g.HLA:KIR pair, h. RGD-ligand:integrin pair, i. Amylin: CALCR / RAMP, e.g., RAMP1 / 2 / 3 pair j. Natriuretic peptides (e.g., ANP, BNP, CNP, etc.): natriuretic peptide receptor (NPR, NPR3, etc.) pairs. Ligand:receptor pairs can also include proteases and inhibitors.

[0099] In vitro refers to events that occur not within a multicellular organism but rather in an artificial environment such as a test tube or reaction vessel, cell culture, etc.

[0100] In vivo refers to events that occur within a multicellular organism, such as, for example, a human and / or a non-human animal. In the context of cell-based systems, the term can also be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0101] Isolated refers to (1) a substance and / or entity that has been separated from at least some of the components with which it was associated when originally created (either in natural and / or experimental environments) and / or (2) a substance and / or entity that has been designed, created, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10 or more other components with which they were originally associated. In some embodiments, an isolated factor is at least about 80% or more pure. A substance is "pure" if it is substantially free of other components. In some embodiments, as one of skill in the art will understand, a substance may still be considered "isolated" or even "pure" even after being combined with certain other components, such as, for example, one or more carriers or excipients (e.g., buffers, solvents, water, etc.); in such embodiments, the percent isolation or purity of the substance is calculated without including such carriers or excipients.

[0102] For example, in some embodiments, a naturally occurring biological polymer, such as a polypeptide or polynucleotide, is considered "isolated" when (a) its origin or source is free from association with some or all of the components that accompany it in its natural state in nature, (b) it is substantially free from other polypeptides or nucleic acids of the same species that produces it in nature, or (c) it is expressed by or is otherwise associated with components from a cell or other expression system other than the species that produces it in nature. Thus, for example, in some embodiments, a polypeptide that is chemically synthesized or synthesized in a cellular system different from that which produces it in nature is considered an "isolated" polypeptide. Alternatively, or additionally, in some embodiments, a polypeptide that has been subjected to one or more purification techniques can be considered an "isolated" polypeptide so long as it is separated from a) other components with which it is associated in nature and / or b) other components with which it was associated when originally produced.

[0103] A leader sequence or signal peptide refers to an immunoglobulin signal or leader (L) peptide, which directs immunoglobulin heavy or light chains to the endoplasmic reticulum and is subsequently cleaved from the heavy or light chain before final antibody assembly. It can also refer to a nucleic acid sequence encoding a signal or leader peptide. Each V gene segment contains a leader sequence encoded by exons 1 and 2 of the segment, immediately upstream of the exon 2 sequence encoding FR1, CDR1, FR2, CDR2, FR3, and CDR3 of the germline Ig V segment (see, e.g., Figure 2). Ig signal sequences or Ig leader sequences are known in the art. See, e.g., Lefranc et al. (2003) Dev. Comp. Immunol. 27:55-77, which is incorporated herein by reference in its entirety. They can also be viewed online at imgt.org. See also Lefranc and Lefranc (2020) Biomedicines 8(9):1-117.

[0104] Non-human animals refer to any vertebrate organism that is not a human. Non-human animals can be cyclostomes, bony fish, cartilaginous fish (e.g., sharks or rays), amphibians, reptiles, mammals, and birds. In some embodiments, non-human mammals can be primates, goats, sheep, pigs, dogs, cattle, or rodents. In some embodiments, non-human animals can be rats or mice.

[0105] Nucleic acid, in its broadest sense, refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain and is generally interchangeable with nucleic acid molecule, nucleic acid sequence, nucleotide molecule, and nucleotide molecule, and these terms are interchangeable.

[0106] In some embodiments, a "nucleic acid" is an oligonucleotide chain or a compound and / or substance that can be incorporated into an oligonucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides), as is clear from the context. In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" is or comprises RNA, and in some embodiments, "nucleic acid" is or comprises DNA. In some embodiments, "nucleic acid" comprises or consists of one or more naturally occurring nucleic acid residues. In some embodiments, "nucleic acid" comprises or consists of one or more nucleic acid analogs. In some embodiments, nucleic acid analogs differ from "nucleic acids" in that they do not utilize a phosphodiester backbone. For example, in some embodiments, a "nucleic acid" is, comprises, or consists of one or more "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, and are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a "nucleic acid" has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester linkages. In some embodiments, a "nucleic acid" is or consists of one or more naturally occurring nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, a "nucleic acid" is or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalating bases, and combinations thereof). In some embodiments, a "nucleic acid" comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to those in naturally occurring nucleic acids. In some embodiments, a "nucleic acid" has a nucleotide sequence that encodes a functional gene product such as RNA or a protein. In some embodiments, a "nucleic acid" has a nucleotide sequence that encodes a polypeptide fragment (e.g., a peptide). In some embodiments, a "nucleic acid" comprises one or more introns. In some embodiments, a "nucleic acid" comprises one or more exons. In some embodiments, a "nucleic acid" comprises one or more coding sequences. In some embodiments, a "nucleic acid" is prepared by one or more of: isolation from a natural source; enzymatic synthesis (in vivo or in vitro) by polymerization based on a complementary template; replication in a recombinant cell or system; and chemical synthesis. In some embodiments, a "nucleic acid" is at least three or more residues in length. In some embodiments, a "nucleic acid" is single-stranded; in some embodiments, a "nucleic acid" is double-stranded. In some embodiments, a "nucleic acid" has a nucleotide sequence that includes at least one element that encodes, or is the complement of, a sequence that encodes a polypeptide or a fragment thereof. In some embodiments, a "nucleic acid" has enzymatic activity.

[0107] Operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.

[0108] In other embodiments, operably linked does not require contiguousity. For example, unrearranged variable region gene segments "operably linked" to each other can rearrange to form a rearranged variable region gene, and the unrearranged variable region gene segments are not necessarily contiguous to each other. Unrearranged variable region gene segments operably linked to each other and to contiguous constant region genes are capable of rearranging to form a rearranged variable region gene that is expressed in conjunction with the constant region gene as a polypeptide chain of an antigen-binding protein. A control sequence "operably linked" to a coding sequence is linked such that expression of the coding sequence is achieved under conditions compatible with the control sequence. "Operably linked" sequences include both expression control sequences adjacent to a gene of interest and expression control sequences that act in trans or at a distance to regulate the gene of interest.

[0109] The term "expression control sequence" refers to polynucleotide sequences necessary to effect expression and processing of coding sequences to which they are ligated. "Expression control sequences" include appropriate transcription initiation, termination, promoter and enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak sequences), sequences that enhance protein stability, and, if desired, sequences that enhance protein secretion. The nature of such control sequences varies depending on the host organism. For example, in prokaryotes, such control sequences generally include a promoter, a ribosomal binding site, and a transcription termination sequence, while in eukaryotes, such control sequences typically include a promoter and a transcription termination sequence. The term "control sequence" is intended to include elements whose presence is essential for expression and processing, and can also include additional elements whose presence is advantageous, such as leader sequences and fusion partner sequences.

[0110] Physiological conditions include those conditions known in the art that refer to conditions under which a cell or organism survives and / or reproduces. In some embodiments, the term refers to external or internal environmental conditions that may occur in nature for an organism or cell system. In some embodiments, physiological conditions are conditions found within the body of a human or non-human animal, particularly conditions at and / or within a surgical site. Physiological conditions typically include, for example, temperatures ranging from 20-40°C, 1 atmosphere of pressure, pH 6-8, glucose concentrations of 1-20 mM, atmospheric levels of oxygen, and gravity as occurs on Earth. In some embodiments, laboratory conditions are manipulated and / or maintained at physiological conditions. In some embodiments, physiological conditions are those found within an organism (e.g., a non-human animal).

[0111] A polypeptide refers to any polymeric chain of amino acids.

[0112] In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that includes portions that occur naturally separately from one another (i.e., from two or more different organisms, e.g., human and non-human portions). In some embodiments, a polypeptide has an amino acid sequence that is engineered, in that it is designed and / or produced through the action of man. In some embodiments, a polypeptide may contain or consist of multiple fragments, each of which is found in the same parent polypeptide in a different spatial arrangement from one another than found in the subject polypeptide (e.g., fragments that are directly linked in the parent polypeptide may be spatially separated in the subject polypeptide, or vice versa, and / or fragments may be in a different order in the subject polypeptide than in the parent polypeptide), thereby making the subject polypeptide a derivative of its parent polypeptide.

[0113] Recombinant refers to nucleic acids and / or polypeptides that are designed, engineered, prepared, expressed, produced, or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell, polypeptides isolated from a recombinant combinatorial human polypeptide library (Hoogenboom HR, 1997 TIB Tech. 15:62-70; Hoogenboom H., and Chames P., 2000, Immunology Today 21:371-378; Azzazy H., and Highsmith WE, 2002, Clin. Biochem. 35:425-445; Gavilondo JV, and Larrick JW, 2002, BioTechniques 29:128-145), antibodies isolated from animals (e.g., mice) that are transgenic for human immunoglobulin genes (e.g., Taylor, LD, et al., 1992, Nucl. Acids Res.20:6287-6295;Little M. et al., 2000, Immunology Today 21:364-370; Kellermann SA and Green LL, 2002, Current Opinion in Biotechnology 13:593-597; Murphy, AJ, et al., 2014, Proc. Natl. Acad. Sci. USA 111(14):5153-5158, each of which is incorporated herein by reference in its entirety), or any other means involving intersplicing of selected sequence elements.

[0114] In some embodiments, one or more of such selected sequence elements occur in nature. In some embodiments, one or more of such selected sequence elements are designed in silico. In some embodiments, one or more such selected sequence elements arise, for example, from mutagenesis (e.g., in vivo or in vitro) of known sequence elements of natural or synthetic origin. For example, in some embodiments, the recombinant polypeptide comprises a sequence found in the genome (or polypeptide) of a source organism of interest (e.g., human, mouse, etc.). In some embodiments, the recombinant polypeptide comprises a sequence that occurs naturally separately from one another in two different organisms (e.g., a human and a non-human organism) (i.e., derived from two or more different organisms, e.g., a human and a non-human portion). In some embodiments, the recombinant polypeptide has an amino acid sequence that arises from mutagenesis (e.g., in vitro or in vivo in a non-human animal), and thus the amino acid sequence of the recombinant polypeptide is a sequence that is derived from and related to the polypeptide sequence, but may not naturally occur in the genome of the non-human animal in vivo.

[0115] Reference refers to a standard or control agent, animal, cohort, individual, population, sample, sequence, or value to which an agent, animal, cohort, individual, population, sample, sequence, or value of interest is compared. "Reference" or "control" can also refer to a "reference animal" or "control animal." A "reference animal" can have a modification described herein, a modification different from those described herein, or be unmodified (i.e., a wild-type animal). Generally, as will be understood by one of skill in the art, a reference agent, animal, cohort, individual, population, sample, sequence, or value will be determined or characterized under conditions equivalent to those used to determine or characterize the agent, animal (e.g., mammal), cohort, individual, population, sample, sequence, or value of interest.

[0116] In some embodiments, a reference agent, animal, cohort, individual, population, sample, sequence, or value is tested and / or calculated substantially simultaneously with the testing or calculation of an agent, animal, cohort, individual, population, sample, sequence, or value of interest. In some embodiments, the reference agent, animal, cohort, individual, population, sample, sequence, or value is a known reference, optionally embodied in a tangible medium. In some embodiments, a reference may refer to a control. A "control VELOCIMMUNE®" or "control," e.g., as a reference animal, such as a "VELOCIMMUNE® control," refers to a VELOCIMMUNE® mouse comprising a humanized heavy chain and kappa variable region locus, where the mouse can be bred. These VELOCIMMUNE® control mice are reviewed in Macdonald et al. (2014) Proc. Natl. Acad. Sci. USA 111:5147-52 and supplementary information, which is incorporated herein by reference in its entirety.

[0117] Somatic recombination is the process of V recombination at the immunoglobulin heavy chain locus. H , D H , and J. H Recombination of gene segments or V at the immunoglobulin light chain locus L and J. L This refers to the recombination of gene segments. Somatic recombination occurs before antigen contact during B cell development in the bone marrow. At the heavy chain locus, one D joins another in a process called DJ joining. H and one J H are randomly recombined and all intervening DNA is removed. Then, a random V H The segment is reconstructed. H J H Recombination at the immunoglobulin light chain locus occurs in a similar manner. V segments are recombined in a process called V-J joining. L Gene segments and J L The gene segments are joined and recombined, removing all DNA between them.

[0118] Substantially refers to the qualitative condition of exhibiting the complete or nearly complete extent or degree of a characteristic or property of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or to a perfect state or achieve or avoid an absolute result. Thus, the term "substantially" is used to capture the possible lack of completeness inherent in many biological and chemical phenomena.

[0119] Substantial homology refers to similarity between amino acid or nucleic acid sequences. As one of ordinary skill in the art will appreciate, two sequences are generally considered to be "substantially homologous" if they contain homologous residues at corresponding positions. Homologous residues may be identical residues. Alternatively, homologous residues may be non-identical residues with reasonably similar structural and / or functional characteristics. For example, as known to those of ordinary skill in the art, certain amino acids are generally classified as "hydrophobic" or "hydrophilic" amino acids and / or as having "polar" or "non-polar" side chains. Often, substitution of one amino acid for another of the same type can be considered a "homologous" substitution. Common amino acid classifications are summarized below. [Table 1] [Table 2]

[0120] As is known in the art, amino acid or nucleic acid sequences can be compared using any of a variety of algorithms, including those available in commercially available computer programs such as BLASTN and BLASTP for nucleotide sequences, gapped BLAST, and PSI-BLAST for amino acid sequences. Examples of such programs are described in Altschul, S. F. et al., 1990, J. Mol. Biol., 215(3):403-410; Altschul et al., 1996, Methods Enzymol. 266:460-80; Altschul, S. F. et al., 1997, Nucleic Acids Res., 25:3389-402; Baxevanis, A. D. and B. F. F. Feuillette (eds.) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley, 1998; and Misener et al. (eds.) Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press, 1998. In addition to identifying homologous sequences, the above-mentioned programs typically provide an indication of the degree of homology.

[0121] In some embodiments, two sequences are considered to be substantially homologous if at least 95% or more of the corresponding residues are homologous over a relevant stretch of residues. In some embodiments, the relevant stretch is a complete sequence. In some embodiments, the relevant stretch is at least 9 or more residues. In some embodiments, the relevant stretch includes adjacent residues along the complete sequence. In some embodiments, the relevant stretch includes non-contiguous residues along the complete sequence, e.g., non-adjacent residues brought together by the folded structure of the polypeptide or portion thereof. In some embodiments, the relevant stretch is at least 10 or more residues.

[0122] Substantial identity refers to the similarity between amino acid or nucleic acid sequences. As will be understood by those skilled in the art, two sequences are generally considered to be "substantially identical" if they contain the same residues at corresponding positions. As is known in the art, amino acid or nucleic acid sequences can be compared using any of a variety of algorithms, including those available in commercially available computer programs, such as BLASTN and BLASTP for nucleotide sequences, gapped BLAST, and PSI-BLAST for amino acid sequences. Examples of such programs are described in Altschul, S. F. et al., 1990, J. Mol. Biol., 215(3):403-410; Altschul et al., 1996, Methods Enzymol. 266:460-80; Altschul, S. F. et al., 1997, Nucleic Acids Res., 25:3389-3402; Baxevanis, A. D. and B. F. F. Feuillette (eds.) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley, 1998; and Misener et al. (eds.) Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press, 1998. In addition to identifying identical sequences, the above-mentioned programs typically provide an indication of the degree of identity.

[0123] In some embodiments, two sequences are considered to be substantially identical if at least 95% or more of the corresponding residues over the relevant stretch of residues are identical. In some embodiments, the relevant stretch is the complete sequence. In some embodiments, the relevant stretch is at least 10 or more residues.

[0124] Targeting vector or targeting construct refers to a polynucleotide molecule that contains a targeting region.The targeting region contains the same or substantially the same sequence as the sequence of target cell, tissue or animal, and the targeting construct is integrated into the location in the genome of cell, tissue or animal by homologous recombination.Also included are targeting regions that use site-specific recombinase recognition sites (for example, loxP sites or Frt sites).

[0125] In some embodiments, the targeting constructs described herein further comprise a nucleic acid sequence or gene of particular interest, a selectable marker, control and / or regulatory sequences, and other nucleic acid sequences that enable recombination mediated by the exogenous addition of proteins that assist or promote recombination involving such sequences. In some embodiments, the targeting constructs described herein further comprise all or a portion of a gene of interest, where the gene of interest is a heterologous gene that encodes all or a portion of a polypeptide with a similar function to the protein encoded by the endogenous sequence. In some embodiments, the targeting constructs described herein further comprise all or a portion of a humanized gene of interest, where the humanized gene of interest encodes all or a portion of a polypeptide with a similar function to the polypeptide encoded by the endogenous sequence. In some embodiments, the targeting construct (or targeting vector) may comprise a nucleic acid sequence that has been engineered by human beings. For example, in some embodiments, the targeting construct (or targeting vector) may be constructed to comprise an engineered or recombinant polynucleotide that includes two or more sequences that are not linked to each other in nature but have been engineered by human beings to be directly linked to each other in the engineered or recombinant polynucleotide.

[0126] A transgene or transgene construct refers to a nucleic acid sequence (e.g., a sequence encoding all or part of a polypeptide of interest) that has been introduced into a cell by the hand of man (e.g., using the methods described herein). A transgene may be partially or wholly heterologous, i.e., foreign to the transgenic animal or cell into which it is introduced. A transgene may include one or more transcriptional control sequences, e.g., introns or promoters, and any other nucleic acid that may be required for expression of a selected nucleic acid sequence. A transgene may include one or more selectable markers to allow subsequent selection of progeny (e.g., cells) that have incorporated the transgene.

[0127] Transgenic Animals, Transgenic Non-Human Animals, or Tg + are used interchangeably herein to refer to any non-naturally occurring non-human animal, wherein one or more of the cells of the non-human animal contain a heterologous nucleic acid and / or gene encoding all or part of a polypeptide of interest.

[0128] In some embodiments, heterologous nucleic acid sequences and / or genes are introduced directly or indirectly into cells by introduction into progenitor cells via deliberate genetic manipulation, such as by microinjection or infection with a recombinant virus. The term genetic manipulation does not include traditional breeding techniques, but rather covers the introduction of a recombinant DNA molecule. This molecule may be integrated into a chromosome or may be extrachromosomally replicating DNA. "Tg + The term includes animals that are heterozygous or homozygous for the heterologous nucleic acid and / or gene, and / or that have a single copy or multiple copies of the heterologous nucleic acid and / or gene.

[0129] A targeting vector refers specifically to a nucleic acid molecule capable of transporting an associated nucleic acid of interest for the purpose of targeted insertion of the nucleic acid of interest into another nucleic acid molecule, e.g., a donor plasmid, a non-human animal genome, etc.

[0130] In some embodiments, vectors are capable of extrachromosomal replication and / or expression of linked nucleic acids in host cells, such as eukaryotic and / or prokaryotic cells. Vectors capable of directing the expression of operably linked genes are referred to herein as "expression vectors" or "constructs."

[0131] Wild-type has the meaning known in the art to refer to an entity having a structure and / or activity that exists in a "normal" state (as opposed to mutated, affected, manipulated, altered, etc.) Those skilled in the art will understand that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0132] Other features, objects, and advantages of the present invention will be apparent from the following detailed description of several embodiments. However, it should be understood that, while the detailed description indicates several embodiments of the present invention, they are presented by way of illustration and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Mode for Carrying Out the Invention]

[0133] While antibody-based therapeutics have offered great hope for the treatment of several diseases, the development of particularly effective antibody agents that bind to difficult targets remains a challenge. Described herein are anchor-modified immunoglobulins (Igs), and modified Ig V segments encoding same, where the anchor comprises at least a receptor-binding portion of a ligand (e.g., a non-immunoglobulin polypeptide) that binds to a cognate receptor. Animals equipped with modified Ig V segments can produce a diverse repertoire of anchor-modified immunoglobulins in response to immunization with the cognate receptor for the anchor.

[0134] Without being bound by theory, the anchor acts to increase the affinity of newly generated antibodies in the animal in response to antigenic challenge with its cognate receptor, for example, by binding to the cognate receptor simultaneously with antibodies that specifically bind to the cognate receptor and / or by allowing affinity maturation of antibodies that would not normally be expanded in response to antigenic challenge with the cognate receptor to occur. Thus, the diverse repertoire of immunoglobulins produced by the non-human animals disclosed herein will include anchor-modified immunoglobulins that bind to their cognate receptors with high affinity, thereby increasing the immunoglobulin population in which lead candidates against previously intractable targets may be discovered. Nucleic acid molecules, including targeting vectors and animal genomes

[0135] The anchor-modified immunoglobulins described herein comprise, at least in part, an Ig leader sequence and a heavy chain variable region (V) of an immunoglobulin (Ig), e.g., an Ig, modified to encode an anchor between and in operable linkage with the framework (FR) and complementarity-determining regions (CDR) of a germline Ig V segment. H ) segment or light chain variable region (V L The Ig signal peptide may be encoded by a variable region (V) segment, such as a V segment. Nucleic acid sequences encoding immunoglobulin (Ig) signal peptides and germline V segments, e.g., human germline V segments, are known in the art, as are the encoded amino acid sequences. See, e.g., Lefranc, M.-P., Exp. Clin. Immunogenet., 18, 100-116 (2001), which is incorporated herein by reference in its entirety. See also the website at imgt.org on the web (www).

[0136] Nucleic acid molecules comprising targeting vectors and animal genomes described herein may contain nucleic acid sequences encoding any Ig signal peptide of a germline V segment. In some embodiments, the modified Ig V-segment contains a nucleic acid sequence encoding the signal peptide of a first germline Ig V-segment, a nucleic acid sequence encoding an anchor, and nucleic acids encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3 of a second germline Ig V-segment, where the first and second germline Ig V-segments are different germline Ig V-segments. In some embodiments, the modified Ig V-segment contains a nucleic acid sequence encoding the signal peptide of a first germline Ig V-segment, a nucleic acid sequence encoding an anchor, and nucleic acids encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3 of a second germline Ig V-segment, where the first and second germline Ig V-segments are the same germline Ig V-segment. In some embodiments, the Ig signal peptide comprises the sequence MDWTWRFLFVVAAATGVQS (SEQ ID NO: 7).

[0137] Human (h) germline V segments (e.g., human germline variable heavy chains (hV H or hIGVH) segments, human germline variable kappa (hVκ or hIGKV) segments, and human germline variable lambda (hVλ or hIGLV) segments), and the amino acid sequences of mouse (m) germline V segments (e.g., mouse germline variable heavy (mV Hor mIGVH) segment, mouse germline variable kappa (mVκ or mIGKV) segment, and mouse germline variable lambda (mVλ or mIGLV) segment) can be viewed at the web (www) addresses imgt.org / IMGTrepertoire / Proteins / SequenceLogos / human / and imgt.org / IMGTrepertoire / Proteins / SequenceLogos / mouse / , each of which is incorporated herein by reference in its entirety.

[0138] In some embodiments, the germline Ig V segment or variant thereof (e.g., a variant encoding FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a modified Ig V segment described herein) is a human (h) germline Ig V segment or variant thereof, e.g., a germline human (h) V H 1-2 segments, germline hV H 1-3 segments, germline hV H 1-8 segments, germline hV H 1 18 segments, germline hV H 1-24 segments, germline hV H 1-45 segments, germline hV H 1-46 segments, germline hV H 1-58 segments, germline hV H 1-69 segment, germline hV H 2-5 segments, germline hV H 2-26 segments, germline hV H 2 70-segment germline hV H 3-7 segments, germline hV H 3-9 segments, germline hV H 3 11-segment germline hV H 3 13-segment germline hV H 3-15 segments, germline hV H 3-16 segments, germline hV H 3-20 segments, germline hVH 3-21 segments, germline hV H 3-23 segments, germline hV H 3-30 segments, germline hV H 3-30-3 segment, germline hV H 3-30-5 segment, germline hV H 3-33 segments, germline hV H 3-35 segments, germline hV H 3-38 segments, germline hV H 3-43 segments, germline hV H 3-48 segments, germline hV H 3-49 segments, germline hV H 3-53 segment, germline hV H 3-64 segments, germline hV H 3-66 segments, germline hV H 3-72 segment, germline hV H 3-73 segment, germline hV H 3-74 segment, germline hV H 4-4 segment, germline hV H 4-28 segments, germline hV H 4-30-1 segment, germline hV H 4 30-2 segment, germline hV H 4-30-4 segment, germline hV H 4-31 segments, germline hV H 4-34 segments, germline hV H 4-39 segments, germline hV H 4-59 segment, germline hV H 4-61 segment, germline hV H 5-51 segment, germline hV H 6-1 segment, germline hV H 7-4-1 segment, germline hV H In some embodiments, the germline Ig V segment or variant thereof is a germline hV H The 1-69 segment or a variant thereof.

[0139] In some embodiments, the nucleic acid molecules described herein comprise a modified Ig hV. H segment only, e.g., without any additional hV H It does not include any segments or their variants.

[0140] In some embodiments, the nucleic acid molecules described herein comprise a modified Ig hV. H In addition to the segment, additional hV H Segments, e.g., V H 1-2, hV H 1-3, hV H 1-8, hV H 1 18, hV H 1-24, hV H 1-45, hV H 1-46, hV H 1-58, hV H 1-69, hV H 2-5, hV H 2-26, hV H 2 70, hV H 3-7, hV H 3-9, hV H 3 11, hV H 3 13, hV H 3-15, hV H 3-16, hV H 3-20, hV H 3-21, hV H 3-23, hV H 3-30, hV H 3-30-3, hV H 3-30-5, hV H 3-33, hV H 3-35, hV H 3-38, hV H 3-43, hV H 3-48, hV H 3-49, hV H 3-53, hV H 3-64, hV H 3-66, hV H 3-72, hV H 3-73, hV H 3-74, hV H 4-4, hVH 4-28、hV H 4-30-1、hV H 4 30-2、hV H 4-30-4、hV H 4-31、hV H 4-34、hV H 4-39、hV H 4-59、hV H 4-61、hV H 5-51、hV H 6-1、hV H 7-4-1、hV H 7-81 H 1-2、hV H 1-3、hV H 1-8、hV H 1 18、hV H 1-24、hV H 1-45、hV H 1-46、hV H 1-58、hV H 1-69、hV H 2-5、hV H 2-26、hV H 2 70、hV H 3-7、hV H 3-9、hV H 3 11、hV H 3 13、hV H 3-15、hV H 3-16、hV H 3-20、hV H 3-21、hV H 3-23、hV H 3-30、hV H 3-30-3、hV H 3-30-5、hV H 3-33、hV H 3-35、hV H 3-38、hV H 3-43、hV H 3-48、hV H 3-49、hV H 3-53、hV H 3-64、hV H 3-66、hV H 3-72、hV H 3-73、hVH 3-74, hV H 4-4, hV H 4-28, hV H 4-30-1, hV H 4 30-2, hV H 4-30-4, hV H 4-31, hV H 4-34, hV H 4-39, hV H 4-59, hV H 4-61, hV H 5-51, hV H 6-1, hV H 7-4-1, and hV H In some embodiments including more than one, or each, of the 7-81 segments, hV H The segments are in germline configuration.

[0141] In some embodiments, the nucleic acid molecules described herein (e.g., targeting vectors, non-human animal genomes, etc.) may comprise an Ig heavy chain variable region, e.g., an anchor-modified V-segment plus an additional (un)rearranged V H , D H and / or J H gene segments, and in some embodiments, additional (un)rearranged hV H , hD H and / or hJ H In some embodiments, the nucleic acid molecules described herein (e.g., targeting vectors, non-human animal genomes, etc.) may comprise (un)rearranged hV gene segments. H Only one segment, (un)reconstructed hD H One or more segments and (un)rearranged hJ H It contains one or more segments, in which case only one (un)reconstructed hV H The segment may be a modified hV comprising a nucleic acid sequence encoding an anchor as described herein. H It is a segment.

[0142] In some embodiments, the recombinant nucleic acids described herein (e.g., targeting vectors, non-human animal genomes, etc.) contain one or more human D H segments, e.g., hD H 1-1, hD H 1-7, hD H 1-14, hD H 1-20, hD H 1-26, hD H 2-2, hD H 2-8, hD H 2-15, hD H 2-21, hD H 3-3, hD H 3-9, hD H 3-10, hD H 3-16, hD H 3-22, hD H 4-4, hD H 4-11, hD H 4-17, hD H 4-23, hD H 5-5, hD H 5-12, hD H 5-18, hD H 5-24, hD H 6-6, hD H 6-13, hD H 6-19, hD H 6-25, hD H 7-27, and one, more, or each of their variants. H 1-1, hD H 1-7, hD H 1-14, hD H 1-20, hD H 1-26, hD H 2-2, hD H 2-8, hD H 2-15, hD H 2-21, hD H 3-3, hD H 3-9, hD H 3-10, hD H 3-16, hD H 3-22, hD H 4-4, hD H 4-11, hD H 4-17, hDH 4-23, hD H 5-5, hD H 5-12, hD H 5-18, hD H 5-24, hD H 6-6, hD H 6-13, hD H 6-19, hD H 6-25, and hD H In some embodiments, including a plurality of, or each of, 7-27, hD H The segments are in the germline configuration.

[0143] In some embodiments, the recombinant nucleic acids described herein (e.g., targeting vectors, non-human animal genomes, etc.) contain one or more human J H segments, e.g., hJ H 1. hJ H 2. hJ H 3. hJ H 4. hJ H 5, hJ H 6, and one, more, or each of their variants. H 1. hJ H 2. hJ H 3. hJ H 4. hJ H 5, and hJ H In some embodiments, the hJ comprises more than one or each of the six segments. H The segments are in the germline configuration.

[0144] In some embodiments, a recombinant nucleic acid molecule (e.g., a targeting vector, a non-human animal genome, etc.) may comprise a heavy chain variable region locus, e.g., may comprise, in operable linkage, from 5' to 3', the following: (I) a modified Ig V H (II) one or more Ig heavy chain diversity (D H ) segment, and (III) one or more all Ig heavy chain binding (J H ) segment. In some embodiments, the Ig D H One or more of the segments may be human Ig D Hand / or (III) Ig J H One or more of the segments is a human Ig J H In some embodiments, the IgD segment of (II) is one, more, or all of the IgD segments. H (III) one or more of the Ig J segments; H One or more of the gene segments are recombined and rearranged into Ig D. H / J H The recombinant nucleic acid molecule thus comprises, in operable linkage and from 5' to 3', the following: H gene segments and rearranged Ig D H / J H array.

[0145] In some embodiments, Ig V H gene segments and rearranged Ig D H / J H Rearranged and reconstituted Ig V H / D H / J H and forming a sequence encoding an anchor-modified Ig heavy chain variable domain, wherein the anchor-modified Ig heavy chain variable domain comprises, in operable linkage, (i) an Ig signal peptide, (ii) an anchor, and (iii) a rearranged Ig V H / D H / J H It includes FR1, complementarity determining region (CDR1), FR2, CDR2, FR3, CDR3, and FR4, which are encoded by the sequence.

[0146] In some embodiments, the modified Ig V H The segment is an unrearranged modified Ig V H It is a gene segment.

[0147] In some embodiments, the recombinant nucleic acid (e.g., targeting vector, non-human animal genome, etc.) described herein comprises an Ig heavy chain constant region (CH ), wherein the nucleic acid sequence encoding Ig C H The nucleic acid sequence encoding the modified Ig V H segment, (II) Ig D H (III) one or more of the Ig J segments; and H In some embodiments, the nucleic acid sequence is downstream of and operably linked to one or more of the segments. H and includes an Igμ gene encoding an IgM isotype, an Igδ gene encoding an IgD isotype, an Igγ gene encoding an IgG isotype, an Igα gene encoding an IgA isotype, and / or an Igε gene encoding an IgE isotype. In some embodiments, a recombinant nucleic acid molecule described herein comprises a nucleic acid sequence encoding an anchor-modified Ig heavy chain, wherein the anchor-modified Ig heavy chain comprises, in operative linkage, (i) an Ig signal peptide, (ii) an anchor, (iii) a rearranged Ig V H / D H / J H an Ig heavy chain variable domain comprising FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence: H In some embodiments, Ig C H is a non-human Ig C H , e.g., rodent Ig C H , e.g., rat Ig C H or mouse Ig C H is.

[0148] In some embodiments, a germline Ig V segment or variant thereof (e.g., a variant encoding FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a modified Ig V segment described herein) is a germline Ig light chain variable (V L) segment or variants thereof. In some embodiments, the recombinant nucleic acid molecule may comprise a light chain variable region locus, e.g., may comprise, in operable linkage, from 5' to 3': (I) a modified Ig V L segment, and (II) Ig light chain binding (J L ) segments. In some embodiments, the modified Ig V L segment, and Ig J L Ig V, in which one or more of the segments have been rearranged and rearranged L / J L The sequence encodes an anchor-modified Ig light chain variable domain, wherein the anchor-modified Ig light chain variable domain comprises, in operative linkage, (i) an Ig signal peptide, (ii) an anchor, and (iii) a rearranged Ig V L / J L In some embodiments, the recombinant nucleic acid molecule comprises a light chain variable region locus, and an Ig light chain constant region (CDR1), a CDR2, a CDR3, a CDR4, and a CDR5 encoded by the sequences: L ), in which case the Ig C L is downstream of and operably linked to: (I) a modified Ig V L segment, and (II) Ig light chain binding (J L In some embodiments, the anchor-modified Ig light chain comprises, in operative linkage, one or more of: (i) an Ig signal peptide; (ii) an anchor; (iii) a rearranged Ig V segment; L / J L an Ig light chain variable domain including FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence: L In some embodiments, Ig C L is a non-human Ig C L , e.g., rodent Ig C L , e.g., rat Ig C L or mouse Ig C Lis.

[0149] In some embodiments, the germline Ig V segment or variant thereof (e.g., a variant encoding FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a modified Ig V segment described herein) is a germline Ig light chain variable kappa (Vκ) segment or variant thereof, e.g., a human Vκ segment, e.g., an hVκ1-5 segment, hVκ 1-6 segment, hVκ1-8 segment, hVκ1D-8 segment, hVκ1-9 segment, hVκ1-12 segment, hVκ1D-12 segment, hVκ1-13 segment, hVκ1D-13 segment, hVκ1-16 segment, hVκ1D-16 segment, hVκ1-17 segment, hVκ1D-17 segment, hVκ1-27 segment, hVκ1-33 segment, hVκ1D-33 segment, hVκ1-37 segment, hVκ1D-37 segment, hVκ1-39 segment, hVκ1D-39, a hVκ1-NL1 segment, hVκ1D-42 segment, hVκ1D-43 segment, hVκ2-4 segment, hVκ2-18 segment, hVκ2D-18 segment, hVκ2-24 segment, hVκ2D-24 segment, hVκ2-28 segment, hVκ2D-28 segment, hVκ2-29 segment, hVκ2D-29 segment, hVκ2-30 segment, hVκ2D-30 segment, hVκ2-40 segment, hVκ2D-40 segment In some embodiments, the nucleic acid molecules described herein are selected from the group consisting of an hVκ2D-26 segment, an hVκ3-7 segment, an hVκ3D-7 segment, an hVκ3-11 segment, an hVκ3D-11 segment, an hVκ3-15 segment, an hVκ3D-15 segment, an hVκ3-20 segment, an hVκ3D-20 segment, an hVκ4-1 segment, an hVκ5-2 segment, an hVκ6-21 segment, an hVκ6D-21 segment, an hVκ6D-41 segment, an hVκ7-3 segment, and variants thereof. In addition to the hVκ segment, the hVκ fragment may further comprise an additional hVκ segment, for example, an hVκ1D-8 segment, an hVκ1-9 segment, an hVκ1-12 segment, an hVκ1D-12 segment, an hVκ1-13 segment, an hVκ1D-13 segment, an hVκ1-16 segment, an hVκ1D-16 segment, an hVκ1-17 segment, an hVκ1D-17 segment, an hVκ1-27 segment, an hVκ1-33 segment, an hVκ1D-33 segment, an hVκ1-37 segment, an hVκ1D-37 segment, an hVκ1-39 segment, an hVκ1D-39, hVκ1-NL1 segment, hVκ1D-42 segment, hVκ1D-43 segment, hVκ2-4 segment, hVκ2-18 segment, hVκ2D-18 segment, hVκ2-24 segment, hVκ2D-24 segment, hVκ2-28 segment, hVκ2D-28 segment, hVκ2-29 segment, hVκ2D-29 segment, hVκ2-30 segment, hVκ2D-30 segment, hVκ2-40 segment, hVκ2 Further comprising one, more, or each of a D-40 segment, an hVκ2D-26 segment, an hVκ3-7 segment, an hVκ3D-7 segment, an hVκ3-11 segment, an hVκ3D-11 segment, an hVκ3-15 segment, an hVκ3D-15 segment, an hVκ3-20 segment, an hVκ3D-20 segment, an hVκ4-1 segment, an hVκ5-2 segment, an hVκ6-21 segment, and an hVκ6D-21 segment.hVκ1D-8 segment, hVκ1-9 segment, hVκ1-12 segment, hVκ1D-12 segment, hVκ1-13 segment, hVκ1D-13 segment, hVκ1-16 segment, hVκ1D-16 segment, hVκ1-17 segment, hVκ1D-17 segment, hVκ1-27 segment, hVκ1-33 segment, hVκ1D-33 segment, hVκ1-37 segment, hVκ1D-37 segment, hVκ1-39 segment, hVκ1D-39,a hVκ1-NL1 segment, hVκ1D-42 segment, hVκ1D-43 segment, hVκ2-4 segment, hVκ2-18 segment, hVκ2D-18 segment, hVκ2-24 segment, hVκ2D-24 segment, hVκ2-28 segment, hVκ2D-28 segment, hVκ2-29 segment, hVκ2D-29 segment, hVκ2-30 segment, hVκ2D-30 segment, hVκ2-40 segment, hVκ2D-40 segment, hV In some embodiments comprising more than one or each of a κ2D-26 segment, an hVκ3-7 segment, an hVκ3D-7 segment, an hVκ3-11 segment, an hVκ3D-11 segment, an hVκ3-15 segment, an hVκ3D-15 segment, an hVκ3-20 segment, an hVκ3D-20 segment, an hVκ4-1 segment, an hVκ5-2 segment, an hVκ6-21 segment, and an hVκ6D-21 segment, the hVκ segments are in a germline configuration.

[0150] In some embodiments, a nucleic acid molecule described herein (e.g., a targeting vector, a non-human animal genome, etc.) may comprise an Ig light chain κ variable region, e.g., may comprise an additional (un)rearranged Jκ segment in addition to an anchor-modified hVκ segment, and in some embodiments, may comprise an additional (un)rearranged hJκ gene segment. Thus, in some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage, and from 5' to 3', one or more of: (I) a modified Ig Vκ segment, and (II) an Ig light chain-binding kappa Jκ segment. In some embodiments, a recombinant nucleic acid molecule described herein (e.g., a targeting vector, a non-human animal genome, etc.) may comprise one or more human Jκ segments. κ In some embodiments, the hJκ segments are in a germline configuration, e.g., one, more, or each of hJκ1, hJκ2, hJκ3, hJκ4, hJκ5, and variants thereof. In some embodiments, the hJκ segments are in a germline configuration, e.g., one, more, or each of hJκ1, hJκ2, hJκ3, hJκ4, hJκ5, and variants thereof.

[0151] Additionally, in some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage, from 5' to 3', the following: (I) a modified Ig Vκ segment, and (II) a nucleic acid sequence encoding one or more of an Ig light chain binding kappa (Jκ) and an Ig light chain constant kappa region (Cκ).

[0152] In some embodiments, a germline Ig V segment or a variant thereof (e.g., a modified Ig V segment described herein) is used. The V segment (or variants encoding FR1, CDR1, FR2, CDR2, FR3, and CDR3) is a germline Ig light chain variable lambda (Vλ) segment or a variant thereof, e.g., a human Vλ segment, e.g., an hVλ1-36 segment, an hVλ1-40 segment, an hVλ1-41 segment, an hVλ1-44 segment, an hVλ1-47 segment, an hVλ1-50 segment, an hVλ1-51 segment, an hVλ1-62 segment, an hVλ2-5 segment, an hVλ2-8 segment, an hVλ2-11 segment, an hVλ2-14 segment, an hVλ2-18 segment, an hVλ2-23 segment, an hVλ2-33 segment, an hVλ2-34 segment, an hVλ3-1 segment, an hVλ3-9 segment, an hVλ3-10 segment, or any of the following: segment, hVλ3-12 segment, hVλ3-13 segment, hVλ3-16 segment, hVλ3-19 segment, hVλ3-21 segment, hVλ3-22 segment, hVλ3-25 segment, hVλ3-27 segment, hVλ3-31 segment, hVλ3-32 segment, hVλ4-3 segment, hVλ4-60 segment, hVλ4-69 segment, hVλ5-37 segment, hVλ5-39 segment, hVλ5-45 segment, hVλ5-48 segment, hVλ5-52 segment, hVλ6-57 segment, hVλ7-43 segment, hVλ7-46 segment, hVλ8-61 segment, hVλ9-49 segment, hVλ10-54 segment, hVλ11-55 segment, and variants thereof.In some embodiments, the nucleic acid molecules described herein further comprise additional hVλ segments in addition to the modified Ig hVλ segment, e.g., an hVλ1-36 segment, an hVλ1-40 segment, an hVλ1-41 segment, an hVλ1-44 segment, an hVλ1-47 segment, an hVλ1-50 segment, an hVλ1-51 segment, an hVλ1-62 segment, an hVλ2-5 segment, an hVλ2-8 segment, an hVλ2-11 segment, an hVλ2-14 segment, an hVλ2-18 segment, an hVλ2-23 segment, an hVλ2-33 segment, an hVλ2-34 segment, an hVλ3-1 segment, an hVλ3-9 segment, an hVλ3-10 segment, an hVλ3-12 segment, an hVλ3-13 segment, an hVλ3-16 segment, and hVλ11-55 segment, hVλ12-56 segment, hVλ13-57 segment, hVλ14-59 segment, hVλ15-60 segment, hVλ16-61 segment, hVλ17-62 segment, hVλ18-63 segment, hVλ19-10 segment, hVλ19-21 segment, hVλ19-22 segment, hVλ10-54 segment, and hVλ11-55 segment.hVλ1-36 segment, hVλ1-40 segment, hVλ1-41 segment, hVλ1-44 segment, hVλ1-47 segment, hVλ1-50 segment, hVλ1-51 segment, hVλ1-62 segment, hVλ2-5 segment, hVλ2-8 segment, hVλ2-11 segment, hVλ2-14 segment, hVλ2-18 segment, hVλ2-23 segment, hVλ2-33 segment, hVλ2-34 segment, hVλ3-1 segment, hVλ3-9 segment, hVλ3-10 segment, hVλ3-12 segment, hVλ3-13 segment, hVλ3-16 segment, hVλ3-19 segment, hVλ3-21 segment, h In some embodiments comprising more than one or each of the Vλ3-22 segment, the hVλ3-25 segment, the hVλ3-27 segment, the hVλ3-31 segment, the hVλ3-32 segment, the hVλ4-3 segment, the hVλ4-60 segment, the hVλ4-69 segment, the hVλ5-37 segment, the hVλ5-39 segment, the hVλ5-45 segment, the hVλ5-48 segment, the hVλ5-52 segment, the hVλ6-57 segment, the hVλ7-43 segment, the hVλ7-46 segment, the hVλ8-61 segment, the hVλ9-49 segment, the hVλ10-54 segment, and the hVλ11-55 segment, the hVλ segments are in a germline configuration.

[0153] In some embodiments, a nucleic acid molecule described herein (e.g., a targeting vector, a non-human animal genome, etc.) can comprise an Ig light chain λ variable region, e.g., can comprise an additional (un)rearranged Jλ segment in addition to an anchor-modified hVλ segment, and in some embodiments, can comprise an additional (un)rearranged hJκλ gene segment. Thus, in some embodiments, a recombinant nucleic acid molecule described herein comprises, in operative linkage and from 5' to 3', the following: (I) a modified Ig Vλ segment, and (II) one or more Ig light chain-binding kappa Jλ segments. In some embodiments, a recombinant nucleic acid described herein (e.g., a targeting vector, a non-human animal genome, etc.) can comprise one or more human Jλ segments, e.g., one, more, or each of the hJλ1, hJλ2, hJλ3, hJλ4, hJλ5, hJλ6, and hJλ7 segments, and variants thereof. In some embodiments, including more than one or each of the hJλ1, hJλ2, hJλ3, hJλ4, hJλ5, hJλ6, and hJλ7 segments, the hJλ segments are in a germline configuration. In some embodiments, a recombinant nucleic acid molecule described herein comprises, in operable linkage, from 5' to 3', the following: (I) a modified Ig Vλ segment, (II) one or more Ig light chain joining lambda (Jλ) segments, and a nucleic acid sequence encoding an Ig light chain constant lambda region (Cλ).

[0154] anchor

[0155] As described herein, the anchor comprises a ligand (or a portion thereof) that binds to a cognate receptor. In some embodiments, the ligand may be a non-immunoglobulin polypeptide. Thus, as described herein, the anchor may comprise a non-immunoglobulin polypeptide, e.g., a receptor-binding portion of a non-immunoglobulin polypeptide. The anchor modifications described herein may be useful for increasing the affinity of an antigen-binding protein, e.g., an antibody, with a troublesome receptor.

[0156] Exemplary and known non-immunoglobulin polypeptide:cognate receptor pairs include, but are not limited to, non-immunoglobulin polypeptides that bind to cognate G protein-coupled receptors (GPCRs). Examples of GPCRs include, but are not limited to, chemokine receptors, glucagon receptors (e.g., GLP1 (GLP1R)), calcitonin receptors, and melanocortin receptors. These and other cognate GPCRs, including non-immunoglobulin polypeptides that bind to the same receptors, are known in the art. See, for example, Wu et al. (2017) J. Mol. Biol. 429:2726-45, which is incorporated herein by reference in its entirety. Additional non-limiting and exemplary non-immunoglobulin polypeptide (ligand):cognate receptor pairs include: a. Ligands that bind to the tyrosine kinase of their cognate receptors, including but not limited to epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and the like; b.DLL:Notch receptor pair, c.B7:CD28 / CLTA4 / PD1 receptor pair, d. Semaphorin:plexin receptor pair, e.PCSK9 / LDLR pair, f.HLA:LILR pair, g. HLA:KIR pair, h. RGD-ligand:integrin pair, i. Natriuretic peptide (e.g., ANP, BNP, CNP, etc.): natriuretic peptide receptor (NPR, NPR3, etc.) pairs. Ligand:receptor pairs can also include proteases and inhibitors.

[0157] In some embodiments, the anchor comprises a natriuretic peptide (NP), e.g., a receptor-binding portion of NP. NP comprises at least eight structurally related amino acid peptides conserved as three distinct prohormones: atrial natriuretic peptide (ANP) prohormone, B-type natriuretic peptide (BNP) prohormone, and C-type natriuretic peptide (CNP) prohormone. Recently, a dendroaspis natriuretic peptide, D-type natriuretic peptide (DNP), was discovered, the role of which in humans is still unknown.

[0158] The ANP prohormone (proANP) is a 126-amino acid polypeptide primarily expressed by cardiac myocytes, producing several peptides with hypotensive, natriuretic, diuretic, and / or kaliuretic properties. These peptides derived from the ANP prohormone are distinguished by the amino acid sequence beginning at the N-terminus of the ANP prohormone. For example, proANP 1-30 contains a long-acting NP, proANP 31-67 has vasodilatory properties, proANP 79-98 contains a kaliuretic peptide, and amino acids 99-126 (also called ANP) are present. In the kidney, proANP undergoes different processing, resulting in the addition of four additional amino acids to the N-terminus, for example, proANP 95-126 (also called urodilatin).

[0159] The BNP prohormone (proBNP) is a 108-amino acid polypeptide primarily expressed by cardiac myocytes. The BNP prohormone undergoes processing in the human heart to form BNP (e.g., amino acids 77-108 of the 108-amino acid prohormone) and NT-proBNP (e.g., amino acids 1-76, both of which circulate in humans). BNP is a reliable biomarker of ventricular dilation. Pandit et al. (2011) Ind. J. Endocrinol. Metab. 15(4) S345-53, which is incorporated herein by reference in its entirety.

[0160] Unlike ANP and BNP, CNP is expressed primarily by endothelial cells and renal epithelial cells. Two CNP molecules have been identified in the circulation. Although CNP appears to lack natriuretic function, it likely functions as a regulator of vascular tone and growth in a paracrine or autocrine manner, and there are some indications that CNP may play a role in bone growth.

[0161] NP exerts its biological functions by specifically binding to cell surface receptors. Three specific receptors have been identified in mammalian tissues: two guanylyl cyclase-coupled receptors (GC-A and GC-B, also called NP receptor (NPR)-A and NPR-B, respectively). NPR-A and NPR-B act through activation of a cGMP-dependent signaling cascade. In contrast, the third type C receptor (also called NPR-C) is not guanylyl cyclase-coupled and is thought to be primarily involved in the clearance of NP. All three receptors bind ANP, BNP, and CNP with different affinities. The rank order of ligand selectivity for GC-A is ANP ≥ BNP >> CNP; for GC-B, it is CNP ≫ ANP ≥ BNP; and for NPR-C, it is ANP > CNP > BNP. Jaubert et al. (1999) PNAS 96(18)10278-283, which is incorporated herein by reference in its entirety.

[0162] NP receptors may be useful targets for the treatment of hypertension and cardiovascular disease. However, ANP and BNP have important diuretic, natriuretic, and hypotensive properties, while CNP may play a role in bone growth. Therefore, any antibody-based targeting of NP receptors must take into account the differential binding affinity of the receptors for NP.

[0163] In some embodiments, the anchor comprises an ANP sequence or a portion thereof. The nucleic acid sequence encoding human ANP is described in NCBI accession number NM_006172.4 and herein as SEQ ID NO: 1. The amino acid sequence of human ANP is described in NCBI accession number NP_006163 and herein as SEQ ID NO: 2. In some embodiments, the anchor described herein comprises a receptor-binding portion of ANP, for example, the C-terminal tail of ANP. In some embodiments, the receptor-binding portion of ANP comprises the amino acid sequence NSFRY (SEQ ID NO: 3).

[0164] Linker

[0165] In some embodiments, the anchor comprises a linker that connects the receptor-binding portion of the non-immunoglobulin polypeptide of interest to FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a germline Ig V-segment or variant thereof. In some embodiments, the linker may be 1 amino acid in length. In some embodiments, the linker may be 2 amino acids in length. In some embodiments, the linker may be 3 amino acids in length. In some embodiments, the linker may be 4 amino acids in length, e.g., the linker may comprise the sequence GLSG (SEQ ID NO: 13). In some embodiments, the linker may be 5 amino acids in length, e.g., the sequence GGGGS (SEQ ID NO: 5). In some embodiments, the linker may be 6 amino acids in length, e.g., the sequence GLSGSG (SEQ ID NO: 14). In some embodiments, the linker may be 7 amino acids in length. In some embodiments, the linker may comprise the sequence GLSGLSGS (SEQ ID NO: 15). In some embodiments, the linker may be 9 amino acids in length. In some embodiments, the linker may be 10 amino acids in length and may comprise, for example, the sequence GLSGLSGLSG (SEQ ID NO: 16) or the sequence GLSGGSGLSG (SEQ ID NO: 17). In some embodiments, the first and second linkers are identical in length, and each is greater than 10 amino acids in length.

[0166] In some embodiments, a recombinant nucleic acid molecule described herein comprises the sequence set forth as SEQ ID NO: 8 or a degenerate variant thereof, or SEQ ID NO: 10 or a degenerate variant thereof.

[0167] Targeting Vector

[0168] Further provided are targeting vectors employed in the methods for producing genetically modified non-human animals, cells, tissues or embryos provided herein.

[0169] In one embodiment, a targeting vector is provided that includes an insert nucleic acid, e.g., a recombinant nucleic acid molecule comprising a modified Ig V segment described herein flanked by 5' and 3' homology arms, which are capable of homologous recombination with a locus of interest, e.g., an Ig heavy or light chain variable region locus. Exemplary targeting vectors and components of targeting vectors (i.e., insert nucleic acids, polynucleotides of interest, expression cassettes, etc.) are described in detail herein below.

[0170] A homologous arm and a target site (i.e., a cognate genomic region) are "complements" or "complementary" to one another if the two regions share a sufficient level of sequence identity with each other to act as substrates for a homologous recombination reaction. "Homology" refers to a DNA sequence that is identical to or shares sequence identity with a corresponding or "complementary" sequence. The sequence identity between a given target site and the corresponding homologous arm present on the targeting vector can be any degree of sequence identity that allows homologous recombination to occur. For example, the amount of sequence identity shared by a homology arm (or fragment thereof) of a targeting vector and a target site (or fragment thereof) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity such that the sequences undergo homologous recombination. Furthermore, the complementary region of homology between a homology arm and a complementary target site can be of any length sufficient to promote homologous recombination at the cleaved recognition site. For example, a given homologous arm and / or complementary target site may be at least 5-10 kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb, 50-60 kb, 60-70 kb, 70-80 kb, 80-90 kb, 90-100 kb in length such that the homologous arm has sufficient homology to undergo homologous recombination with a corresponding target site in the cellular genome. The targeting vector may comprise a homologous complementary region of 100-110 kb, 110-120 kb, 120-130 kb, 130-140 kb, 140-150 kb, 150-160 kb, 160-170 kb, 170-180 kb, 180-190 kb, 190-200 kb, 200 kb to 300 kb or more (e.g., as described in the vectors described elsewhere herein). For ease of reference, the homologous arms are referred to herein as 5' and 3' homologous arms. This terminology relates to the relative position of the homologous arms to the insert nucleic acid within the targeting vector.

[0171] Therefore, the homologous arms of the targeting vector are designed to be complementary to the target site of the target locus. Thus, the homologous arms may be complementary to a locus native to the cell, or may be complementary to a region of a heterologous or foreign DNA segment integrated into the cell genome, including but not limited to a transgene, an expression cassette, or a heterologous or foreign region of genomic DNA. Alternatively, the homologous arms of the targeting vector may be complementary to a region of a human artificial chromosome, or any other engineered genomic region contained in a suitable host cell. Furthermore, the homologous arms of the targeting vector may be complementary to or derived from a region of a BAC library, a cosmid library, or a P1 phage library. Thus, in certain embodiments, the homologous arms of the targeting vector are complementary to a genomic locus of a eukaryote, non-human, mammal, non-human mammal, human, rodent, mouse, or rat that is native, heterologous, or foreign to a given cell. In one embodiment, the homology arms are derived from synthetic DNA.

[0172] In some targeting vector embodiments, the targeting vector further comprises 5' and 3' homology arms that target the non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus is integrated into the recombinant nucleic acid molecule (e.g., modified Ig V H segment, and optionally Ig D H Segmental and / or Ig J H a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig heavy chain locus H and optionally wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus, and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and is operably linked to an endogenous Ig V H , D H and / or J HIn some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule comprises a non-human V gene segment deletion at the non-human Ig heavy chain locus. H In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig heavy chain locus. H Segment, all non-human D H segments, and all non-human J H In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig heavy chain locus, the recombinant nucleic acid molecule replaces one non-human V segment at the non-human Ig heavy chain locus. H All or all non-human V except for segment H Segment, all non-human D H segments, and all non-human J H In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig heavy chain regulatory sequence at the non-human Ig heavy chain locus.

[0173] In some embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus is integrated into the recombinant nucleic acid molecule (e.g., a modified Ig V H segment, and optionally Ig D H Segment, Ig J H Segmental and / or Ig C Hand / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence, wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus in a rodent or rodent cell (e.g., a rodent embryonic stem cell), and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence. H , D H and / or J H or a combination thereof, and optionally wherein upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule comprises one or more non-human V gene segments at the non-human Ig heavy chain locus. H Segment, all non-human D H gene segments, all non-human J H gene segment, and one or more non-human C H Replace the gene.

[0174] In some embodiments, the 5' homology arm comprises the sequence set forth as SEQ ID NO:12 and / or the 3' homology arm comprises the sequence set forth as SEQ ID NO:13.

[0175] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus is integrated into the recombinant nucleic acid molecule (e.g., a modified Ig V locus described herein). L segment, and optionally an Ig J L a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig light chain locus L and optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig VL and / or J L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule comprises a non-human V gene segment deletion at the non-human Ig light chain locus. L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J L In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain locus, the recombinant nucleic acid molecule replaces all non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J H In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain regulatory sequence at the Ig light chain locus.

[0176] In some embodiments, the targeting vectors described herein comprise a nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus is integrated into the recombinant nucleic acid molecule (e.g., a modified Ig V locus described herein). L segment, and optionally an Ig J L segment, and / or Ig C L and a recombinant nucleic acid molecule comprising a human Ig light chain regulatory sequence (e.g., a recombinant nucleic acid molecule comprising a human Ig light chain regulatory sequence) operably linked to a non-human Ig light chain locus, optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V L and / or J Lor a combination thereof, and optionally wherein upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig light chain locus. L Segment, J L gene segments, and non-human C L Replace the gene.

[0177] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment, and optionally an Ig Jκ segment, described herein) upstream of and operably linked to a non-human Ig Cκ of the non-human Ig light chain κ locus, optionally in which the non-human Ig light chain κ locus is an endogenous rodent Ig light chain κ locus, and / or in which the non-human Ig light chain κ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vκ and / or Jκ gene segment, or comprises a combination thereof. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces a non-human Vκ segment at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces one or more non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces all non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus.

[0178] In some targeting vector embodiments, the targeting vector comprises a nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment described herein, and optionally an Ig Jκ segment, and / or an Ig CK gene) operably linked to a non-human Ig light chain κ regulatory sequence of the Ig light chain κ locus; optionally in this case, upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces the non-human Vκ segment, all Jκ gene segments, and the non-human CK gene at the non-human Ig light chain κ locus.

[0179] In some targeting vector embodiments, the targeting vector comprises a recombinant nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vλ segment, and optionally an Ig Jλ segment) upstream of and operably linked to a non-human Ig Cλ of the non-human Ig light chain locus, optionally in which the non-human Ig light chain λ locus is an endogenous rodent Ig light chain λ locus, and / or in which the non-human Ig light chain λ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vλ and / or Jλ gene segment, or comprises a combination thereof. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces a non-human Vλ segment at the non-human Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces one or more non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces all non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and a non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus.

[0180] In some embodiments, the targeting vector comprises a nucleic acid molecule described herein and 5' and 3' homology arms that target a non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vλ segment, and optionally an Ig Jλ segment, and / or an Ig Cλ gene) operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces the non-human Vλ segment, all of the non-human Jλ gene segments, and the non-human Cλ gene at the non-human Ig light chain λ locus.

[0181] In some embodiments, the targeting vectors described herein may further comprise nucleotide sequences adjacent to the target sequence for site-specific recombination. It is recognized that any region within the targeting vector or a separate polynucleotide of interest may also flank such a site. The site-specific recombinase can be introduced into a cell by any method, including by introducing a recombinase polypeptide into the cell or by introducing a polynucleotide encoding the site-specific recombinase into a host cell. The polynucleotide encoding the site-specific recombinase may be located within the targeting vector or within a separate polynucleotide. The site-specific recombinase may be operably linked to a promoter active within the cell, including, for example, an inducible promoter, a promoter endogenous to the cell, a promoter heterologous to the cell, a cell-specific promoter, a tissue-specific promoter, or a developmental stage-specific promoter. Site-specific recombination target sequences that may flank a nucleotide sequence, or any polynucleotide of interest, in a targeting vector include, but are not limited to, loxP, lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71, attp, att, FRT, rox, or combinations thereof.

[0182] In some embodiments, the site-specific recombination sites flank the polynucleotide encoding the selectable marker in the targeting vector. In some instances, after integration of the targeting vector at the targeted locus, the nucleotide sequence between the site-specific recombination sites may be removed.

[0183] In some embodiments, the targeting vectors described herein comprise a selectable marker, which may be included in a selection cassette. Such a selectable marker may include, but is not limited to, neomycin phosphotransferase (neomycin phosphotransferase). r ), hygromycin B phosphotransferase (hyg r ), puromycin-N-acetyltransferase (puro r ), blasticidin S deaminase (bsr r ), xanthine / guanine phosphoribosyltransferase (gpt), or herpes simplex virus thymidine kinase (HSV-k), or a combination thereof. In one embodiment, the polynucleotide encoding the selectable marker is operably linked to a promoter active in the cell. In one embodiment, the polynucleotide encoding the selectable marker is flanked by site-specific recombination target sequences.

[0184] Non-human animal genomes

[0185] Also described herein are non-human animal genomes comprising the recombinant nucleic acid molecules and / or targeting vectors described herein. In some non-human animal genome embodiments, the non-human animal genome comprises a recombinant nucleic acid molecule described herein at an endogenous Ig locus of the non-human animal genome, for example, the non-human animal genome comprises a targeting vector described herein, wherein the targeting vector comprises 5' and 3' homology arms that target the endogenous Ig locus. In some embodiments, the non-human animal genome is a rodent genome. In some embodiments, the non-human animal genome is a rat genome. In some embodiments, the non-human animal genome is a mouse genome.

[0186] In embodiments of non-human animal genomes, the genome may be comprised of a recombinant nucleic acid molecule (e.g., a modified Ig V H segment, and optionally Ig D H Segmental and / or Ig J H a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig heavy chain locus H and a non-human Ig heavy chain locus comprising an endogenous Ig V H , D H and / or J H In some embodiments, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig heavy chain locus, a deletion of a gene segment, or a combination thereof. H In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig heavy chain locus. H Segment, all non-human D H segments, and all non-human J H In some embodiments, the recombinant nucleic acid molecule replaces one non-human V segment at the non-human Ig heavy chain locus. H All or all non-human V except for segment H Segment, all non-human D H segments, and all non-human J H In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig heavy chain regulatory sequence at a non-human Ig heavy chain locus.

[0187] In some embodiments, the non-human Ig heavy chain locus is expressed as a recombinant nucleic acid molecule (e.g., a modified Ig V H segment, and optionally Ig D H Segment, Ig J H Segmental and / or Ig C Hand / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence, wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus in a rodent or rodent cell (e.g., a rodent embryonic stem cell), and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence. H , D H and / or J H or a combination thereof, and optionally in which case the recombinant nucleic acid molecule contains one or more non-human V gene segments at the non-human Ig heavy chain locus. H Segment, all non-human D H gene segments, all non-human J H gene segment, and one or more non-human C H Replace the gene.

[0188] In embodiments of a non-human animal genome, the genome comprises a recombinant nucleic acid molecule (e.g., a modified Ig V gene described herein). L segment, and optionally an Ig J L a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig light chain locus L and a non-human Ig light chain locus comprising an endogenous Ig V light chain variable region, optionally in which the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or in which the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V light chain variable region. L and / or J L In some embodiments, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig light chain locus, a deletion of a gene segment, or a combination thereof. L In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J LIn some embodiments, the recombinant nucleic acid molecule replaces all non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J H In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain regulatory sequence at an Ig light chain locus.

[0189] In embodiments of the non-human animal genome, the Ig light chain locus is expressed as a recombinant nucleic acid molecule (e.g., a modified Ig V gene described herein). L segment, and optionally an Ig J L segment, and / or Ig C L and a recombinant nucleic acid molecule comprising a human Ig light chain regulatory sequence (e.g., a recombinant nucleic acid molecule comprising a human Ig light chain regulatory sequence) operably linked to a non-human Ig light chain locus, optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V L and / or J L or a combination thereof, and optionally in which case the recombinant nucleic acid molecule contains a non-human V at the non-human Ig light chain locus. L Segment, J L gene segments, and non-human C L Replace the gene.

[0190] In embodiments of a non-human animal genome, the genome comprises a non-human Ig light chain κ locus comprising a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment, and optionally an Ig Jκ segment, described herein) upstream of and operably linked to a non-human Ig Cκ of the non-human Ig light chain κ locus, optionally in which case the non-human Ig light chain κ locus is an endogenous rodent Ig light chain κ locus, and / or in which the non-human Ig light chain κ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vκ and / or Jκ gene segment, or a combination thereof. In some embodiments, the recombinant nucleic acid molecule replaces a non-human Vκ segment at the non-human Ig light chain κ locus. In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, the recombinant nucleic acid molecule replaces all non-human VK segments and all non-human JK segments at the non-human Ig light chain κ locus, hi some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus.

[0191] In some embodiments, a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment described herein, and optionally an Ig Jκ segment, and / or an Ig CK gene) is operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus, and optionally the recombinant nucleic acid molecule replaces the non-human Vκ segment, all non-human Jκ gene segments, and non-human CK gene at the non-human Ig light chain κ locus.

[0192] In embodiments of a non-human animal genome, the genome comprises a non-human Ig light chain λ locus comprising a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vλ segment, and optionally an Ig Jλ segment) upstream of and in operable linkage with a non-human Ig Cλ of the non-human Ig light chain locus, optionally in which case the non-human Ig light chain λ locus is an endogenous rodent Ig light chain λ locus, and / or in which the non-human Ig light chain λ locus comprises a human or humanized immunoglobulin light chain variable region and is linked to an endogenous Ig The recombinant nucleic acid molecule may comprise a deletion of a Vλ and / or a Jλ gene segment, or a combination thereof. In some embodiments, the recombinant nucleic acid molecule replaces a non-human Vλ segment at the non-human Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces all non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus.

[0193] In some non-human animal genome embodiments, the non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vλ segment described herein, and optionally an Ig Jλ segment, and / or an Ig Cλ gene) operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule replaces the non-human Vλ segment, all of the non-human Jλ gene segments, and the non-human Cλ gene at the non-human Ig light chain λ locus.

[0194] Non-human animal cells, non-human animals, and methods for producing them Non-human animals and non-human animal cells

[0195] For example, an Ig heavy chain variable region (V) engineered to encode an anchor operably linked between and to an Ig leader sequence and the framework (FR) and complementarity determining region (CDR) sequences of a germline V segment. H ) segment or Ig light chain variable region (V L

[0013] Non-human animals and non-human animal cells are provided that express anchor-modified immunoglobulins from Ig loci that have been modified to contain recombinant nucleic acid molecules described herein, including modified Ig V segments, such as ) segments. Accordingly, non-human animals, embryos, cells are provided that contain the recombinant nucleic acid molecules, targeting constructs, and / or animal genomes described herein.

[0196] In some non-human animal or non-human animal cell embodiments, the non-human animal or cell is engineered to encode a recombinant nucleic acid molecule described herein (e.g., an Ig heavy chain variable region (V)) that has been randomly placed within the genome of the animal and that encodes an anchor operably linked between and to the framework (FR) and complementarity determining region (CDR) sequences of a germline V segment. H ) segment or Ig light chain variable region (V L In some embodiments, the non-human animal or cell comprises a recombinant nucleic acid molecule described herein at an endogenous Ig locus of the non-human animal (e.g., an Ig heavy chain variable region (V) that has been modified to encode an Ig leader sequence and an anchor operably linked between and to the framework (FR) and complementarity-determining region (CDR) sequences of a germline V segment). H ) segment or Ig light chain variable region (V L) segment). For example, the non-human animal comprises a targeting vector described herein, where the targeting vector comprises 5' and 3' homology arms that target an endogenous Ig locus. In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal cell is a rodent cell. In some embodiments, the non-human animal is a rat. In some embodiments, the non-human animal cell is a rat cell. In some embodiments, the non-human animal is a mouse. In some embodiments, the non-human animal cell is a mouse cell.

[0197] In some embodiments, the non-human animal or non-human animal cell is a recombinant nucleic acid molecule (e.g., a modified Ig V H segment, and optionally Ig D H Segmental and / or Ig J H a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig heavy chain locus H and a non-human Ig heavy chain locus comprising an endogenous Ig V H , D H and / or J H In some embodiments, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig heavy chain locus, a deletion of a gene segment, or a combination thereof. H In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig heavy chain locus. H Segment, all non-human D H segments, and all non-human J H In some embodiments, the recombinant nucleic acid molecule replaces one non-human V segment at the non-human Ig heavy chain locus. H All or all non-human V except for segment H Segment, all non-human D Hsegments, and all non-human J H In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig heavy chain regulatory sequence at a non-human Ig heavy chain locus.

[0198] In some embodiments, the non-human Ig heavy chain locus is expressed as a recombinant nucleic acid molecule (e.g., a modified Ig V H segment, and optionally Ig D H Segment, Ig J H Segmental and / or Ig C H and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence, wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus in a rodent or rodent cell (e.g., a rodent embryonic stem cell), and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and an endogenous Ig V regulatory sequence. H , D H and / or J H or a combination thereof, and optionally in which case the recombinant nucleic acid molecule contains one or more non-human V gene segments at the non-human Ig heavy chain locus. H Segment, all non-human D H gene segments, all non-human J H gene segment, and one or more non-human C H Replace the gene.

[0199] In some embodiments, the non-human animal or non-human animal cell contains a recombinant nucleic acid molecule (e.g., a modified Ig V described herein). L segment, and optionally an Ig J L a recombinant nucleic acid molecule comprising a non-human Ig C segment at the non-human Ig light chain locus Land a non-human Ig light chain locus comprising an endogenous Ig V light chain variable region, optionally in which the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or in which the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V light chain variable region. L and / or J L In some embodiments, the recombinant nucleic acid molecule comprises a non-human V at the non-human Ig light chain locus, a deletion of a gene segment, or a combination thereof. L In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J L In some embodiments, the recombinant nucleic acid molecule replaces all non-human V segments at the non-human Ig light chain locus. L Segment and all non-human J H In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain regulatory sequence at an Ig light chain locus.

[0200] In some embodiments, the Ig light chain locus is expressed as a recombinant nucleic acid molecule (e.g., a modified Ig V gene described herein). L segment, and optionally an Ig J L segment, and / or Ig C L and a recombinant nucleic acid molecule comprising a human or humanized immunoglobulin light chain variable region (e.g., a recombinant nucleic acid molecule comprising a human or humanized immunoglobulin light chain variable region) in operably linked to a non-human Ig light chain regulatory sequence of the non-human Ig light chain locus, optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to a non-human Ig light chain regulatory sequence of the non-human Ig light chain locus. V L and / or J L or a combination thereof, and optionally in which case the recombinant nucleic acid molecule contains a non-human V at the non-human Ig light chain locus. L Segment, J L gene segments, and non-human C LReplace the gene.

[0201] In some embodiments, the non-human animal or non-human animal cell comprises a non-human Ig light chain κ locus comprising a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment, and optionally an Ig Jκ segment, described herein) upstream of and operably linked to a non-human Ig Cκ of the non-human Ig light chain κ locus, optionally in which case the non-human Ig light chain κ locus is an endogenous rodent Ig light chain κ locus, and / or in which the non-human Ig light chain κ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vκ and / or Jκ gene segment, or a combination thereof. In some embodiments, the recombinant nucleic acid molecule replaces a non-human Vκ segment at the non-human Ig light chain κ locus. In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. In some embodiments, the recombinant nucleic acid molecule replaces all non-human VK segments and all non-human JK segments at the non-human Ig light chain κ locus, hi some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus.

[0202] In some embodiments, a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vκ segment described herein, and optionally an Ig Jκ segment, and / or an Ig CK gene) is operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus, and optionally the recombinant nucleic acid molecule replaces the non-human Vκ segment, all non-human Jκ gene segments, and non-human CK gene at the non-human Ig light chain κ locus.

[0203] In some embodiments, the non-human animal or non-human animal cell comprises a non-human Ig light chain λ locus comprising a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule comprising a modified Ig Vλ segment, and optionally an Ig Jλ segment) upstream of and operably linked to a non-human Ig Cλ of the non-human Ig light chain locus, optionally in which the non-human Ig light chain λ locus is an endogenous rodent Ig light chain λ locus, and / or in which the non-human Ig light chain λ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vλ and / or Jλ gene segment, or comprises a combination thereof. In some embodiments, the recombinant nucleic acid molecule replaces a non-human Vλ segment at the non-human Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule replaces one or more non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain locus. In some embodiments, upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces all non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule is operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus.

[0204] In some embodiments, the non-human Ig light chain λ locus is comprised of a recombinant nucleic acid molecule (e.g., a modified Ig Vλ segment, and optionally an Ig Jλ segment, and / or an Ig λ segment described herein) operably linked to a non-human Ig light chain λ regulatory sequence of the Ig light chain λ locus. In some embodiments, the recombinant nucleic acid molecule replaces a non-human Vλ segment, all of the non-human Jλ gene segments, and a non-human Cλ gene at the non-human Ig light chain λ locus.

[0205] Methods for Producing Non-Human Animals or Non-Human Animal Cells

[0206] Also described are methods of producing non-human cells, e.g., non-human embryos, and / or non-human animals in vitro using recombinant nucleic acid molecules, e.g., targeting vectors, described herein. In some embodiments, the in vitro method of modifying an isolated cell includes introducing a recombinant nucleic acid molecule described herein into the isolated cell, e.g., by contacting the cell with a targeting vector described herein. In some method embodiments, the cell is a host cell. In some embodiments, the cell is an embryonic stem (ES) cell. In some embodiments, the cell described herein or produced according to the methods described herein is a rodent cell, e.g., in which the rodent cell is a rat cell or a mouse cell.

[0207] Also described are methods for making anchor-modified antigen-binding proteins using the nucleic acid molecules, non-human cells, and / or non-human animals described herein. Also described are non-human animal embryos and animals that may comprise the embryonic stem cells described herein and / or that can be developed (e.g., generated) from the embryonic stem cells described herein. Such embryos or non-human animals can be developed by a method comprising implanting an ES cell described herein into an embryo and / or implanting an embryo containing ES cells into a suitable host and maintaining the host under appropriate conditions during the development of the ES cells or the embryo to produce viable offspring.

[0208] As described herein, targeting vectors can be used to target Ig loci with human or humanized immunoglobulin variable regions. Immunoglobulin loci containing human variable region gene segments are known in the art and are described, for example, in U.S. Patent Nos. 5,633,425, 5,770,429, 5,814,318, 6,075,181, 6,114,598, 6,150,584, 6,998,514, 7,795,494, 7,910,798, 8,232,449, 8,502,018, 8,697,940, 8,703,485, 8,754,28 Nos. 7, 8,791,323, 8,809,051, 8,907,157, 9,035,128, 9,145,588, 9,206,263, 9,447,177, 9,551,124, 9,580,491, and 9,475,559, each of which is incorporated herein by reference in its entirety, and U.S. Patent Application Publication Nos. 6,111,169, 6,112,169, 6,113,169, 6,114,169, 6,115,169, 6,116,169, 6,117,169, 6,118,169, 6,118,169, 6,119,170, 6,120,171, 6,121,121, 6,122,122, 6,123,123, 6,124,124, 6,125,125, 6,126,126, 6,127,127, 6,128,128, 6,130,131, 6,132,132, 6,133,133, 6,134,134, 6,135,135, 6,136,136, 6,137,137, 6,138,138, 6,139,140, 6,141,142, 6,142,143, 6,143,144, 6,144,177, 6,145,588, 6,145, Nos. 20100146647, 20110195454, 20130167256, 20130219535, 20130326647, 20130096287, and 2015 / 0113668, each of which is incorporated by reference in its entirety, and found in PCT Application Publication Nos. 2007117410, 2008151081, 2009157771, 2010039900, 2011004192, 2011123708, and 2014093908, each of which is incorporated by reference in its entirety.

[0209] In some embodiments, the non-human animals disclosed herein comprise an exogenous, fully human immunoglobulin transgene comprising a modified Ig V segment described herein, which segment has the ability to rearrange in mouse precursor B cells (Alt et al., 1985, Immunoglobulin genes in transgenic mice, Trends Genet 1:231-236, incorporated herein by reference in its entirety). In these embodiments, a fully human immunoglobulin transgene comprising a modified Ig V segment as described herein may be inserted (randomly) and the endogenous immunoglobulin gene may be knocked out (Green et al., 1994, Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs, Nat Genet 7:13-21; Lonberg et al., 1994, Antigen-specific human antibodies from mice comprising four distinct genetic modifications, Nature 368:856-859; Jakobovits et al., 2007, From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice, Nat Biotechnol 25:1134-1143; each of these publications is incorporated herein by reference in its entirety). For example, in this case, the endogenous immunoglobulin heavy chain and kappa light chain loci are inactivated, e.g., by targeted deletion of a small but essential portion of each endogenous locus, followed by introduction of human immunoglobulin gene loci as randomly integrated large transgenes or minichromosomes (Tomizuka et al., 2000, Double trans-chromosomic mice: maintenance of two individual human chromosome fragments containing Ig heavy and kappa loci and expression of fully human antibodies, PNAS USA 97:722-727, herein incorporated by reference in its entirety).

[0210] In some embodiments, the heavy and light chain loci of a human or humanized immunoglobulin comprising a modified Ig V segment described herein are at the heavy and light chain loci, respectively, of an endogenous immunoglobulin. H Gene segments and human V H It has been shown that even gene segment replacements can generate immune responses involving humanized immunoglobulin variable domains. See, e.g., Tien et al. (2016) Cell 166:1471-84, incorporated herein by reference in its entirety.

[0211] Methods for large-scale in situ gene replacement of mouse germline immunoglobulin variable gene loci with human germline immunoglobulin variable gene loci while maintaining the reproductive ability of the mice have been reported. See, for example, U.S. Patent Nos. 6,596,541 and 8,697,940, each of which is incorporated herein by reference in its entirety. Specifically, the precise replacement of six megabases of both the mouse heavy and kappa light chain immunoglobulin variable loci with their human counterparts while leaving the mouse constant regions intact has been described. As a result, mice have been generated that have precise replacement of their entire germline immunoglobulin variable repertoire with equivalent human germline immunoglobulin variable sequences while maintaining the mouse constant regions. The human variable regions are then combined with the mouse constant regions to form chimeric human-mouse immunoglobulin loci that are expressed at physiologically relevant levels. The expressed antibodies are "reverse chimeras," i.e., they contain human variable region sequences and mouse constant region sequences.

[0212] In some embodiments, mice with humanized immunoglobulin variable regions that express antibodies with human or humanized variable regions and mouse constant regions are referred to as VELOCIMMUNE® mice. VELOCIMMUNE® humanized mice exhibit a fully functional humoral immune system essentially indistinguishable from wild-type mice. They exhibit normal cell populations at all stages of B cell development. They exhibit normal lymphoid organ morphology. Antibody sequences in VELOCIMMUNE® mice exhibit normal V(D)J rearrangements and normal somatic hypermutation frequencies. Antibody populations in these mice reflect the isotype distribution resulting from normal class switching (e.g., normal isotype switching). Immunization of VELOCIMMUNE® mice generates a stable humoral immune response that generates a large and diverse antibody repertoire with human immunoglobulin variable domains suitable for use as therapeutic candidates. This platform provides an abundant source of natural affinity-matured human immunoglobulin variable region sequences for generating pharmaceutically acceptable antibodies and other antigen-binding proteins. By precisely substituting mouse immunoglobulin variable sequences for human immunoglobulin variable sequences, the human immunoglobulin variable sequences are operably linked to endogenous non-human constant region gene sequences in a reverse chimeric manner to create VELOCIMMUNE® mice.

[0213] Mice modified in a reverse chimeric manner include, but are not limited to, mice engineered to contain a human (humanized) variable region (e.g., comprising a (D), J, and one or more human V gene segments) operably linked to an endogenous constant region at an endogenous immunoglobulin locus, such as, for example, (a) the endogenous heavy chain locus; (i) A mouse that has been modified to contain an unrearranged human (humanized) immunoglobulin heavy chain variable region operably linked to an endogenous heavy chain constant region, wherein the unrearranged human (humanized) immunoglobulin heavy chain variable region comprises a plurality of unrearranged human heavy chain variable region Vs. Hgene segments (e.g., all functional human unrearranged human V H gene segment), one or more unrearranged immunoglobulin heavy chains D H gene segment, and one or more unrearranged immunoglobulin heavy chain J H comprising a gene segment, Optionally, in this case, the one or more unrearranged immunoglobulin heavy chains D H a gene segment and one or more unrearranged immunoglobulin heavy chain J H The gene segment may comprise one or more unrearranged human immunoglobulin heavy chain D H gene segments (e.g., all functional human D H gene segments) and / or one or more unrearranged human immunoglobulin heavy chain J H gene segments (e.g., all functional human J H gene segment), (ii) A mouse modified to contain a limited unrearranged human (humanized) heavy chain variable region operably linked to an endogenous heavy chain constant region, wherein the limited unrearranged human (humanized) heavy chain variable region is one or more unrearranged immunoglobulin heavy chain D H a gene segment and one or more unrearranged immunoglobulin heavy chain J H A single unrearranged human heavy chain variable region V operably linked to a gene segment H and optionally, in which case the one or more unrearranged immunoglobulin heavy chain D gene segments are H a gene segment and one or more unrearranged immunoglobulin heavy chain J H Each gene segment encodes one or more unrearranged human immunoglobulin heavy chain D H gene segments and / or one or more unrearranged human immunoglobulin heavy chain J H A gene segment, (iii) A mouse modified to comprise a histidine-modified, unrearranged human (humanized) heavy chain variable region operably linked to an endogenous heavy chain constant region, wherein the histidine-modified, unrearranged human (humanized) heavy chain variable region comprises an unrearranged immunoglobulin heavy chain variable gene sequence comprising a substitution of at least one non-histidine codon for a histidine codon or an insertion of at least one histidine codon in the complementarity-determining region 3 (CDR3) coding sequence. (iv) A mouse modified to contain a heavy chain-only immunoglobulin coding sequence comprising an unrearranged human (humanized) heavy chain variable region operably linked to an endogenous heavy chain constant region, wherein the endogenous heavy chain constant region comprises: (1) an intact endogenous IgM gene encoding an IgM isotype that associates with a light chain; and (2) a non-IgM gene, e.g., an IgG gene, lacking a sequence encoding a functional CH1 domain, wherein the non-IgM gene encodes a non-IgM isotype that lacks a CH1 domain that can be covalently linked to a light chain constant domain. and / or (b) the endogenous light chain locus; (i) A mouse modified to contain an unrearranged human (humanized) immunoglobulin light chain variable region operably linked to an endogenous light chain constant region, wherein the unrearranged human (humanized) immunoglobulin light chain variable region comprises a plurality of unrearranged human light chain variable region Vs. L gene segments (e.g., all functional human unrearranged human V L gene segment), and one or more unrearranged immunoglobulin heavy chain J L comprising a gene segment, Optionally, in this case, the one or more unrearranged immunoglobulin light chains J L The gene segment may comprise one or more unrearranged human immunoglobulin light chain J L gene segments (e.g., all functional human J H L gene segment), Optionally, in this case, the endogenous immunoglobulin light chain locus is an endogenous immunoglobulin light chain kappa (κ) locus, and the unrearranged human (humanized) immunoglobulin light chain variable region is a human variable κ (V κ ) and bond κ(J κ ) gene segments, and wherein the endogenous light chain constant region is an endogenous κ chain constant region sequence, and / or wherein the endogenous immunoglobulin light chain locus is an endogenous immunoglobulin light chain lambda (λ) and the unrearranged human (humanized) immunoglobulin light chain variable region is a human variable λ (V λ ) gene segments and combined λ(J λ ) gene segments, wherein the endogenous light chain constant region is an endogenous λ chain constant region sequence, optionally wherein the endogenous immunoglobulin light chain λ locus comprises (a) one or more human V λ (b) one or more human J gene segments; λ gene segment, and (c) one or more human C λ gene segments, wherein (a) and (b) are linked to (c) and a rodent immunoglobulin light chain constant (C λ ) gene segment, and wherein the endogenous immunoglobulin λ light chain locus comprises one or more rodent immunoglobulin λ light chain enhancers (Eλ), and one or more human immunoglobulin λ light chain enhancers (Eλ), optionally comprising three human Eλ; (ii) A mouse modified to contain a consensus light chain coding sequence comprising a reshaped human (humanized) light chain variable region sequence operably linked to an endogenous light chain constant region, wherein the reshaped human (humanized) light chain variable region sequence is an immunoglobulin light chain J L Gene segments and rearranged human light chain variable region V L including gene segments, (iii) A mouse modified to contain a defined unrearranged human (humanized) light chain variable region operably linked to an endogenous light chain constant region, wherein the defined unrearranged human (humanized) light chain variable region is one or more unrearranged human immunoglobulin light chain binding (J) chains.L up to two unrearranged human immunoglobulin light chain variable (V) gene segments operably linked to L ) gene segments, (iv) A mouse modified to comprise a histidine-modified, unrearranged human (humanized) light chain variable region operably linked to an endogenous light chain constant region, wherein the histidine-modified, unrearranged human (humanized) light chain variable region comprises an unrearranged human (humanized) immunoglobulin light chain variable gene sequence comprising a substitution of at least one non-histidine codon for a histidine codon, or an insertion of at least one histidine codon, in the complementarity-determining region 3 (CDR3) coding sequence. (v) A mouse modified to contain a histidine-modified reshaped human (humanized) light chain variable region operably linked to an endogenous light chain constant region, wherein the histidine-modified reshaped human (humanized) light chain variable region comprises a reshaped human (humanized) immunoglobulin light chain variable gene sequence comprising a substitution of at least one non-histidine codon for a histidine codon, or an insertion of at least one histidine codon, in the complementarity-determining region 3 (CDR3) coding sequence. Optionally, the mouse further comprises: (i) comprises a human (humanized) immunoglobulin heavy chain locus containing a functional ADAM6 gene, whereby the mouse exhibits wild-type fertility of a non-human animal; and / or (ii) containing an exogenous terminal deoxynucleotidyl transferase (TdT) gene to increase antigen receptor diversity, optionally whereby at least 10% of the reconstructed variable region genes contain non-templated additions; Such mice have been previously reported. See, for example, U.S. Patent Nos. 8,697,940, 8,754,287, 9,204,624, 9,334,334, 9,801,362, 9,332,742, and 9,516,868; U.S. Patent Application Publication Nos. 20110195454, 20120021409, 20120192300, 20130045492, 20150289489, 20180125043, 20180244804; PCT Patent Application Publication Nos. 2019 / 113065, 2017210586, and 2011163314; Lee et al. (2014) Nature Biotechnology 32:356, each of which is incorporated herein by reference in its entirety.

[0214] Those skilled in the art will appreciate that any mouse or mouse cell (e.g., a mouse ES cell modified in a reverse chimeric manner) may be modified to contain a modified Ig V segment as described herein. In some embodiments, genetically modified non-human animals are described herein, wherein the genome of the animal, e.g., the germline genome, Modification V of the present invention H Gene segment, human D H gene segments, and human J H an endogenous immunoglobulin locus comprising an immunoglobulin heavy chain variable region comprising a gene segment, wherein the immunoglobulin heavy chain variable region is operably linked to a constant region; and / or Modification V of the present invention L segment, and human J L It includes an endogenous chain locus comprising an immunoglobulin light chain variable region comprising a gene segment, wherein the immunoglobulin light chain variable region is operably linked to a constant region.

[0215] In some embodiments, the non-human animal, e.g., a rodent, e.g., a rat or mouse, contains one or more human Vs in its genome. H , D H , and J. Hsegment and one or more endogenous V of the endogenous immunoglobulin heavy chain locus H , D H , and J. H segment substitution, in which case one or more of the human V H , D H , and J. H The segment may be a modified human V H and optionally, an unrearranged or rearranged human V gene segment, operably linked to an endogenous immunoglobulin heavy chain gene. L Segment and human J L The segment may be a non-human or human immunoglobulin light chain constant (C) fragment, e.g., at an endogenous non-human light chain locus, e.g., a rodent, e.g., mouse or rat. L ) region gene is operably linked.

[0216] In certain embodiments, the genetically modified non-human animal comprises in its genome, e.g., germline genome, an immunoglobulin locus (exogenous or endogenous) that contains an immunoglobulin variable region comprising one or more unrearranged human immunoglobulin variable region gene segments that comprise a modified Ig V gene segment described herein, and an immunoglobulin constant region comprising an immunoglobulin constant region gene, wherein the one or more unrearranged human immunoglobulin variable region gene segments are operably linked to the immunoglobulin constant region gene.

[0217] Generally, a genetically modified immunoglobulin locus comprises an immunoglobulin variable region (comprising an immunoglobulin variable region gene segment) operably linked to an immunoglobulin constant region. In some embodiments, the genetically modified immunoglobulin locus comprises a modified Ig V gene segment described herein operably linked to a heavy chain constant region gene. HIn some embodiments, the genetically modified immunoglobulin locus comprises one or more human unrearranged immunoglobulin heavy chain variable region gene segments, comprising a modified Ig Vκ gene segment. In some embodiments, the genetically modified immunoglobulin locus comprises a human unrearranged immunoglobulin variable region κ gene segment, comprising a modified Ig Vκ gene segment described herein, operably linked to a κ chain constant region gene. In some embodiments, the genetically modified immunoglobulin locus comprises a human unrearranged immunoglobulin variable region λ gene segment, comprising a modified Ig Vλ gene segment described herein, operably linked to a κ chain constant region gene. In some embodiments, the genetically modified immunoglobulin locus comprises a human unrearranged immunoglobulin variable region λ gene segment, comprising a modified Ig Vλ gene segment described herein, operably linked to a λ chain constant region gene.

[0218] In certain embodiments, the non-human animal comprises a modified Ig V gene as described herein operably linked to an endogenous heavy chain constant region at the endogenous heavy chain locus. H In some embodiments, the immunoglobulin variable region comprises one or more unrearranged human Ig heavy chain variable region gene segments, and in some embodiments, the one or more unrearranged human Ig variable region gene segments are selected from the group consisting of modified Ig V and modified Ig V heavy chain variable region gene segments. H gene segment, one or more immunoglobulin heavy chain diversity (D H ) segment, and one or more immunoglobulin heavy chain joining (J H ) segment (optionally one or more unrearranged human J H In some embodiments, the modified Ig V described herein comprises a H The gene segment is the only Ig V gene present in the heavy chain variable region. H In some embodiments, the unrearranged human Ig gene segment is a functional human D H In some embodiments, the unrearranged human Ig gene segments include all of the functional human J gene segments. HExamples of variable region containing Ig heavy chain gene segments are reviewed, for example, in Macdonald et al., Proc. Natl. Acad. Sci. USA 111:5147-52 and supplementary information, which is incorporated herein by reference in its entirety.

[0219] In some embodiments, the non-human animals provided herein comprise a limited unrearranged human (humanized) heavy chain variable region operably linked at an endogenous heavy chain locus to an endogenous heavy chain constant region comprising at least a non-human IgM gene, wherein the limited unrearranged human (humanized) heavy chain variable region is a single human V H A gene segment (e.g., a single modified Ig V gene segment described herein) H gene segments), multiple D H Gene segments (e.g., human D H gene segments) and multiple J H Gene segments (e.g., human J H and wherein the defined immunoglobulin heavy chain locus can rearrange to form multiple distinct rearrangements, wherein the rearrangements are a single human V H Gene segment, D H One of the segments, and D H In some embodiments, the rearrangement encodes a different heavy chain variable domain (as described in U.S. Patent Publication 20130096287, which is incorporated by reference in its entirety). H The gene segment is V H 1-2 or V H It is 1-69.

[0220] In certain embodiments, the non-human animal is harboring a modified Ig V gene as described herein operably linked to an endogenous light chain locus constant region at the endogenous light chain locus. LIn some embodiments, the unrearranged human (humanized) immunoglobulin light chain variable region comprises an unrearranged human Igκ variable region gene segment. In some embodiments, the unrearranged human (humanized) immunoglobulin variable region comprises one or more unrearranged human Vκ segments, which may include a modified Ig Vκ segment and one or more unrearranged human Jκ segments as described herein. In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises all of the human Jκ segments. In some embodiments, the immunoglobulin variable region gene segment comprises four functional Vκ segments and all of the human Jκ segments. In some embodiments, the immunoglobulin variable region gene segment comprises 16 functional Vκ segments and all of the human Jκ segments (e.g., all of the functional human Vκ and Jκ segments). In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises all of the human Vκ segments and all of the human Jκ segments. Examples of variable regions comprising Ig kappa gene segments are provided, for example, in Macdonald et al., Proc. Natl. Acad. Sci. USA 1 11:5147-52 and supplementary information, which are incorporated herein by reference in their entirety.

[0221] In some embodiments, the limited unrearranged human (humanized) light chain variable region operably linked to an endogenous light chain constant region is one in which the unrearranged human (humanized) light chain variable region comprises no more than two human V L Gene segments and multiple J L and characterized in that it contains no more than two human V gene segments (e.g., dual light chain mouse, or DLC, as described in U.S. Pat. No. 9,796,788, which is incorporated by reference herein in its entirety). L One of the gene segments is a modified Ig V gene as described herein. L In some embodiments, V LThe gene segment is a Vκ gene segment. L The gene segments are Vλ gene segments. In some embodiments, the Vκ gene segments are IGKV3-20 and IGKV1-39. In some embodiments, the non-human animal comprises exactly two unrearranged human Vκ gene segments and five unrearranged human Jκ gene segments operably linked to a mouse light chain constant region at an endogenous κ light chain locus of the mouse, optionally wherein the exact two unrearranged human Vκ gene segments are a human Vκ1-39 gene segment and a human Vκ3-20 gene segment, and the five unrearranged human Jκ gene segments are a human Jκ1 gene segment, a human Jκ2 gene segment, a human Jκ3 gene segment, a human Jκ4 gene segment, and a human Jκ5 gene segment, and the unrearranged human kappa light chain gene segments are capable of rearranging and encoding a human variable domain of an antibody, and optionally further, the non-human animal does not comprise endogenous Vκ gene segments capable of rearranging to form an immunoglobulin light chain variable region.

[0222] In certain embodiments, the unrearranged human (humanized) immunoglobulin light chain variable region operably linked to the endogenous light chain constant region contains an unrearranged human Igλ variable region gene segment, comprising a modified Igλ segment as described herein. In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises multiple human Vλ segments and one or more human Jλ segments. In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises one or more human Vλ segments, one or more human Jλ segments, and one or more human Cλ constant region sequences. In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises all of the human Vλ segments. In some embodiments, the unrearranged human immunoglobulin variable region gene segment comprises all of the human Jλ segments. Examples of variable regions comprising Igλ gene segments are provided, for example, in U.S. Patent Nos. 9,035,128 and 6,998,514, which are incorporated herein by reference in their entireties. In some embodiments, the unrearranged human (humanized) immunoglobulin light chain variable region operably linked to an endogenous light chain constant region comprises (a) one or more human Vλ gene segments, (b) one or more human Jλ gene segments, and (c) one or more human Cλ gene segments, wherein (a) and (b) are operably linked to (c) and an endogenous (e.g., rodent) Cλ gene segment, and wherein the endogenous immunoglobulin λ light chain locus further comprises one or more rodent immunoglobulin λ light chain enhancers (Eλ), and one or more human immunoglobulin λ light chain enhancers (Eλ), optionally including three human Eλ.

[0223] In certain embodiments, the unrearranged human (humanized) immunoglobulin light chain variable region operably linked to an endogenous light chain constant region comprises an unrearranged human Ig λ variable region gene segment, such as a modified Ig λ segment described herein, operably linked to an endogenous (e.g., rodent or rat or mouse) Cκ gene, such that the non-human animal expresses an immunoglobulin light chain comprising human λ variable domain sequences derived from Vλ and Jλ gene segments fused to an endogenous κ constant domain. See, e.g., U.S. Patent No. 9,226,484, incorporated herein by reference in its entirety.

[0224] In some embodiments, a humanized immunoglobulin κ light chain locus, e.g., a humanized immunoglobulin endogenous κ locus, comprises one or more human Vλ gene segments (e.g., modified human Vλ segments described herein) and one or more human Jλ gene segments upstream of (e.g., operably linked to) a Cλ gene, which may, for example, replace an endogenous Cκ gene. In some embodiments, the Cλ gene is a rodent (e.g., rat or mouse) Cλ gene. In some embodiments, the Cλ gene is a mouse Cλ1 gene. In some embodiments, the Cλ gene comprises one or more human Cλ genes. In some embodiments, the one or more human Jλ gene segments and one or more Cλ genes of such a humanized immunoglobulin κ light chain locus are present in a Jλ-Cλ cluster. In some embodiments, the genetically modified rodent (e.g., rat or mouse) is homozygous for such a humanized immunoglobulin κ light chain locus. In some embodiments, the genetically modified rodent (e.g., rat or mouse) is heterozygous for such a humanized immunoglobulin κ light chain locus. In some embodiments, the genetically modified rodent (e.g., rat or mouse) comprising such a humanized immunoglobulin κ light chain locus produces, inter alia, antibodies comprising a λ light chain, e.g., in response to antigenic challenge, wherein each λ light chain comprises a human λ light chain variable domain operably linked to a human λ light chain constant domain.

[0225] In some embodiments, the immunoglobulin variable region comprising an unrearranged human immunoglobulin variable region gene segment also comprises a human immunoglobulin variable region intergenic sequence. In some embodiments, the immunoglobulin variable region comprises a non-human (e.g., rodent, rat, mouse) Ig variable region intergenic sequence. In some embodiments, the intergenic sequence is an intergenic sequence of endogenous species origin.

[0226] In some embodiments, the immunoglobulin variable region is a rearranged light chain variable region (a common light chain variable region). In some embodiments, the rearranged Ig light chain variable region gene is a human rearranged Ig light chain variable region gene. Exemplary rearranged Ig light chain variable regions are provided in, for example, U.S. Patent Nos. 9,969,814, 10,130,181, and 10,143,186, and U.S. Patent Application Publication Nos. 20120021409, 20120192300, 20130045492, 20130185821, 20130302836, and 20150313193, which are incorporated herein by reference in their entireties. In some embodiments, bispecific antibodies are produced using non-human organisms that contain a common light chain variable region (a "common light chain" organism). In some embodiments, the common light chain coding sequence comprises a single rearranged human immunoglobulin light chain Vκ / Jκ sequence operably linked to an endogenous light chain constant region. In some embodiments, the Vκ / Jκ sequence of the single rearranged human immunoglobulin light chain is modified such that the single rearranged human immunoglobulin light chain sequence encodes an anchor described herein operably linked to a universal light chain. In some embodiments, the single rearranged human immunoglobulin light chain Vκ / Jκ sequence is either (i) a human Vκ1-39 / Jκ5 sequence comprising a human Vκ1-39 gene segment fused to a human Jκ5 gene segment, or (ii) a human Vκ3-20 / Jκ1 sequence comprising a human Vκ3-20 gene segment fused to a human Jκ1 gene segment.

[0227] In some embodiments, the immunoglobulin variable regions are light and / or heavy chain immunoglobulin variable regions that include histidine codon insertions and / or substitutions designed to introduce pH-dependent binding properties into antibodies produced in such non-human organisms. In some such embodiments, the histidine codons are inserted into and / or substituted into the nucleic acid sequences encoding CDR3. Various such light and / or heavy chain immunoglobulin loci are provided in U.S. Patent Nos. 9,301,510, 9,334,334, and 9,801,362, and U.S. Patent Application Publication No. 20140013456, which are incorporated herein by reference in their entireties. In some embodiments, the histidine-modified rearranged human (humanized) light chain variable region operably linked to the endogenous light chain constant region comprises a single rearranged human immunoglobulin light chain variable region gene sequence comprising human Vκ and Jκ segment sequences, optionally wherein the Vκ segment sequence is derived from a human Vκ1-39 or Vκ3-20 gene segment, and wherein the single rearranged human immunoglobulin light chain variable region gene sequence comprises a substitution of at least one non-histidine codon in the Vκ segment sequence for a histidine codon expressed at a position selected from the group consisting of 105, 106, 107, 108, 109, 111, and combinations thereof (according to IMGT numbering). In some embodiments, the histidine-modified unrearranged human (humanized) heavy chain variable region operably linked to the endogenous heavy chain constant region comprises a complementarity-determining region 3 (CDR3) coding sequence (e.g., a modified (human) Vκ segment sequence described herein). H In some embodiments, the unrearranged human (humanized) immunoglobulin heavy chain variable gene sequence comprises an unrearranged human V gene segment (VV gene segment) that includes a substitution of at least one non-histidine codon with a histidine codon or an insertion of at least one histidine codon. In some embodiments, the unrearranged human (humanized) immunoglobulin heavy chain variable gene sequence comprises an unrearranged human V V gene segment (VV gene segment). H (e.g., the modified (human) V H segment), unrearranged human D HH , or composite D H , and unrecombined human J Hand optionally in which case the unrearranged human V H segment (e.g., a modified (human) V H In some embodiments, a histidine-engineered unrearranged human (humanized) light chain variable region operably linked to an endogenous heavy chain constant region comprises an unrearranged V L and non-reconstructed J L In some embodiments, the histidine-engineered unrearranged human (humanized) light chain variable region comprises no more than two unrearranged human V gene segments. L (e.g., two or fewer Vκ gene segments) and one or more unrearranged human J L (e.g., Jκ) gene segments, and up to two human V L Each of the gene segments comprises a substitution of at least one non-histidine codon for a histidine codon or an insertion of at least one histidine codon in the CDR3-encoding sequence. In some embodiments, the two or less unrearranged human Vκ gene segments are human Vκ1-39 and human Vκ3-20 gene segments, each comprising one or more substitutions of a non-histidine codon for a histidine codon, and wherein the human Vκ and Jκ gene segments are capable of rearrangement, and the human Vκ and human Jκ gene segments encode human light chain variable domains comprising one or more histidines at positions selected from the group consisting of 105, 106, 107, 108, 109, 111 (according to IGMT numbering), and combinations thereof, wherein the one or more histidines result from one or more substitutions.

[0228] In some embodiments, the immunoglobulin constant region comprises a heavy chain constant region gene. In some embodiments, the heavy chain constant region is a human heavy chain constant region gene. In some embodiments, the heavy chain constant region gene is a heavy chain constant region gene of endogenous species origin. In some embodiments, the heavy chain constant region gene is a mouse constant region gene or a rat constant region gene. In some embodiments, the constant region gene is a mixture of human and non-human sequences. For example, in some embodiments, the constant region gene encodes a human CH1 region and a non-human (e.g., endogenous species origin, mouse, rat) CH2 and / or CH3 region. In some embodiments, the heavy chain constant region gene is a Cμ, Cδ, Cγ (Cγ1, Cγ2, Cγ3, Cγ4), Cα, or Cε constant region gene. In some embodiments, the constant region gene is an endogenous constant region gene. In some embodiments, the constant region genes encode mutated CH1 regions so that the non-human animal expresses heavy chain-only antibodies (see, e.g., U.S. Patent No. 8,754,287; U.S. Patent Application Publication No. 2015 / 0289489, the entire contents of which are incorporated herein by reference). For example, in some embodiments where the goal is to generate heavy chains to create bispecific antibodies (in general or dual-light chain organisms), the Fc domain of the heavy chain contains modifications to promote heavy chain heterodimerization and / or inhibit heavy chain homodimerization. Such modifications are provided, for example, in U.S. Patent Nos. 5,731,168, 5,807,706, 5,821,333, 7,642,228, and 8,679,785, and U.S. Patent Application Publication No. 2013 / 0195849, the entire contents of which are incorporated herein by reference.

[0229] In some embodiments, the immunoglobulin constant region comprises a light chain constant region gene. In some embodiments, the light chain constant region gene is a kappa constant region gene. In some embodiments, the light chain constant region gene is a lambda constant region gene. In some embodiments, the light chain constant region gene is a light chain constant region gene of endogenous species origin. In some embodiments, the light chain constant region gene is a mouse constant region gene or a rat constant region gene. In some embodiments, the light chain constant region gene is a mixture of human and non-human sequences.

[0230] In some embodiments, the immunoglobulin variable region comprising the human variable region gene segment and the immunoglobulin constant region gene to which the variable region gene segment is operably linked are located at an endogenous immunoglobulin locus. In some embodiments, the endogenous immunoglobulin locus is an endogenous heavy chain locus. In some embodiments, the endogenous immunoglobulin locus is an endogenous κ locus. In some embodiments, the endogenous immunoglobulin locus is an endogenous λ locus. In some embodiments, the constant region gene to which the human variable region gene segment is operably linked is an endogenous constant region gene.

[0231] In some embodiments, one or more endogenous immunoglobulin loci, or portions of one or more endogenous loci (e.g., variable and / or constant regions) in the genome of a non-human animal provided herein, are inactivated. Endogenous immunoglobulin variable region gene agents and portions thereof can be inactivated using any method known in the art, including, but not limited to, deleting the locus or portion thereof from the genome of the organism, replacing the locus or portion thereof with a different nucleic acid sequence, inverting the portion of the locus, and / or moving the portion of the locus to another location in the genome of the non-human organism. In some embodiments, the inactivation of the locus is only partial. In some embodiments, the variable region of the locus is inactivated, but the constant region remains functional (e.g., because it is operably linked to a non-endogenous variable region gene segment).

[0232] In some embodiments, the genetically modified non-human animal comprises an inactivated endogenous immunoglobulin heavy chain locus. In some embodiments, the endogenous immunoglobulin heavy chain locus, or a portion thereof, is inactivated by deleting, substituting, transferring, and / or inverting at least a portion of an endogenous variable region of the endogenous heavy chain locus. In some embodiments, at least a portion of the variable region of the endogenous heavy chain locus that is deleted, substituted, transferred, and / or inverted comprises a variable region J segment. In some embodiments, the endogenous immunoglobulin heavy chain locus, or a portion thereof, is inactivated by deleting, substituting, transferring, and / or inverting at least a portion of an endogenous constant region of the endogenous heavy chain locus. In some embodiments, at least a portion of the constant region of the endogenous heavy chain locus that is deleted, substituted, transferred, and / or inverted comprises the Oμ gene of the endogenous constant region.

[0233] In some embodiments, the genetically modified non-human animal comprises an inactivated endogenous immunoglobulin κ chain locus. In some embodiments, the endogenous immunoglobulin κ chain locus, or portion thereof, is inactivated by deleting, replacing, moving, and / or inverting at least a portion of an endogenous variable region of the endogenous κ chain locus. In some embodiments, at least a portion of the variable region of the endogenous κ chain locus that is deleted, replaced, moved, and / or inverted comprises a variable region J segment. In some embodiments, the endogenous immunoglobulin κ chain locus, or portion thereof, is inactivated by deleting, replacing, moving, and / or inverting at least a portion of an endogenous constant region of the endogenous κ chain locus. In some embodiments, at least a portion of the constant region of the endogenous κ chain locus that is deleted, replaced, moved, and / or inverted comprises an endogenous constant region CK gene.

[0234] In some embodiments, the genetically modified non-human animal comprises an inactivated endogenous immunoglobulin λ chain locus. In some embodiments, the endogenous immunoglobulin λ chain locus, or a portion thereof, is inactivated by deletion, substitution, relocation, and / or inversion of at least a portion of an endogenous variable region of the endogenous λ chain locus. In some embodiments, at least a portion of at least one VJC gene cluster in the endogenous λ chain locus is deleted, substituted, relocated, and / or inverted. In some embodiments, the endogenous immunoglobulin λ chain locus, or a portion thereof, is inactivated by deletion, substitution, relocation, and / or inversion of at least a portion of an endogenous constant region of the endogenous λ chain locus. In some embodiments, at least a portion of the constant region of the endogenous λ chain locus that is deleted, substituted, relocated, and / or inverted comprises a C gene of an endogenous constant region.

[0235] In various embodiments, the modification of the immunoglobulin locus does not affect the reproductive capacity of the non-human animal. In some embodiments, the heavy chain locus comprises a functional, for example, endogenous ADAM6a gene, ADAM6b gene, or both, and the genetic modification does not affect the expression and / or function of the endogenous ADAM6a gene, ADAM6b gene, or both. In some embodiments, the genome of the genetically modified non-human animal further comprises an ectopic functional, for example, endogenous ADAM6a gene, ADAM6b gene, or both. Exemplary non-human animals that express exogenous ADAM6a and / or ADAM6b are described in U.S. Patent Nos. 8,642,835 and 8,697,940, each of which is incorporated herein by reference in its entirety.

[0236] In some embodiments, the genetically modified non-human animal further contains and expresses an exogenous terminal deoxynucleotidyl transferase (TdT) gene for increased antigen receptor diversity. Exemplary non-human animals expressing exogenous TdT are described in PCT Patent Application Publication No. 2017210586, which is incorporated herein by reference in its entirety.

[0237] In some embodiments, the transcriptional regulator comprises a RAG1 transcriptional regulator, a RAG2 transcriptional regulator, an immunoglobulin heavy chain transcriptional regulator, an immunoglobulin kappa light chain transcriptional regulator, an immunoglobulin lambda light chain transcriptional regulator, or any combination thereof.

[0238] In some embodiments, the genome of the provided non-human animal further comprises one or more human immunoglobulin heavy and / or light chain genes (see, e.g., U.S. Patent Nos. 8,502,018, 8,642,835, 8,697,940, 8,791,323, and U.S. Patent Application Publication Nos. 2013 / 0096287A1 and 2018 / 0125043A1, and PCT Application Publication No. 2019 / 113065, each of which is incorporated by reference in its entirety). Alternatively, recombinant nucleic acid molecules comprising modified Ig V segments described herein may be introduced into embryonic stem cells of different modified strains, such as the VELOCIMMUNE® strain (see, e.g., U.S. Patent No. 8,502,018 or U.S. Patent No. 8,642,835, each of which is incorporated by reference in its entirety). In some embodiments, the non-human animals described herein can be produced by introducing the targeting vectors described herein into cells from a modified lineage. For example, the targeting vectors described herein can be introduced into the non-human animals described in U.S. Patent Nos. 8,642,835 and 8,697,940, the entire contents of which are incorporated herein by reference, such that the non-human animals express antibodies with fully human variable regions and mouse constant regions. In some embodiments, the non-human animals described herein are produced to further comprise human immunoglobulin genes (variable region genes and / or constant region genes). In some embodiments, the non-human animals described herein comprising the modified Ig V segments described herein comprise an engineered D H region as described herein and genetic material from a heterologous species (e.g., human), where the genetic material encodes, in whole or in part, one or more human heavy chain variable regions and / or light chain variable regions.

[0239] The non-human animals described herein can often be prepared, as described above or using methods known in the art, to contain additional human or humanized genes, depending on the intended use of the non-human animal. Such additional human or humanized genetic material can be introduced through further modification of the genome of cells (e.g., embryonic stem cells) carrying the genetic modification, as described above, or through breeding techniques known in the art, with other genetically modified lines as desired.

[0240] For example, as described herein, non-human animals comprising the modified Ig V segments described herein can be prepared using methods such as those described in U.S. Patent Application Publication Nos. 2011-0195454 A1, 2012-0021409 A1, 2012-0192300 A1, 2013-0045492 A1, 2013-0185821 A1, 2013-0198880 A1, and 2013-0302836 A1, which are incorporated by reference in their entireties. A1, 2015-0059009 A1; International Patent Application Publication Nos. 2011 / 097603, 2012 / 148873, 2013 / 134263, 2013 / 184761, 2014 / 160179, 2014 / 160202.

[0241] A transgenic founder non-human animal can be identified based on the presence of a modified Ig V segment in its genome and / or based on the expression of an anchor-modified antibody that includes amino acids corresponding to the receptor-binding portion of a non-immunoglobulin polypeptide that binds to its cognate receptor. The transgenic founder non-human animal can then be used to breed with another non-human animal carrying the modified Ig V segment, thereby generating a series of non-human animals each carrying one or more copies of the modified Ig V segment. Furthermore, transgenic non-human animals carrying the modified Ig V segment can be further bred to other transgenic non-human animals carrying other desired transgenes (e.g., human immunoglobulin genes).

[0242] Transgenic non-human animals may also be generated that contain a selection system that allows for the control or direction of transgene expression. Exemplary systems include the Cre / loxP recombinase system of bacteriophage P1 (see, e.g., Lakso, M. et al., 1992, Proc. Natl. Acad. Sci. USA 89:6232-6236, incorporated herein by reference in its entirety) and the FLP / Frt recombinase system of Saccharomyces cerevisiae (O'Gorman, S. et al., 1991, Science 251:1351-1355, which are incorporated herein by reference in their entirety. Such animals can be provided by constructing a "double" transgenic animal, for example, by mating two transgenic animals, one containing a transgene with a selected modification (e.g., a modified Ig V segment) and the other containing a transgene encoding a recombinase (e.g., Cre recombinase).

[0243] Mouse (i.e., modified human V H Segment, D H , and J. HWhile embodiments utilizing modified Ig V segments in mice (e.g., mice comprising gene segments, all of which are operably linked to one or more mouse heavy chain constant region genes) are discussed extensively herein, other non-human animals comprising modified Ig V segments are also provided. Such non-human animals include any of the non-human animals that can be genetically modified to express the anchor-modified immunoglobulins described herein, e.g., mammals such as mice, rats, rabbits, pigs, cattle (e.g., cows, bulls, buffalo), deer, sheep, goats, chickens, cats, dogs, ferrets, primates (e.g., marmosets, rhesus monkeys), and the like. For example, for non-human animals for which suitable genetically modifiable ES cells are not readily available, other methods are used to generate the non-human animals comprising the genetic modification. Such methods include, for example, modifying the genome of a non-ES cell (e.g., a fibroblast or an induced pluripotent cell) and using somatic cell nuclear transfer (SCNT) to introduce the genetically modified genome into a suitable cell, e.g., an enucleated oocyte, and gestation of the modified cell (e.g., the modified oocyte) into a non-human animal under conditions suitable for the formation of an embryo.

[0244] Methods for modifying the genome of non-human animals (e.g., pigs, cows, rodents, chickens, etc.) include modifying the genome to include a modified Ig V segment described herein, for example, using zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or Cas proteins (i.e., CRISPR / Cas systems). Guidance on methods for modifying the germline genome of non-human animals can be found, for example, in U.S. Patent Application Publication Nos. 2015-0376628 A1, 2016-0145646 A1, and 2016-0177339 A1, which are incorporated herein by reference in their entireties.

[0245] In some embodiments, the non-human animals described herein are mammals. In some embodiments, the non-human animals described herein are small mammals, such as small mammals of the Jerboidea or Murine superfamily. In some embodiments, the genetically modified animals described herein are rodents. In some embodiments, the rodents described herein are selected from mice, rats, and hamsters. In some embodiments, the rodents described herein are selected from the Murine superfamily. In some embodiments, the genetically modified animals described herein are from a family selected from the family Odontoidea (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muridae (pure-breed mice and rats, gerbils, spiny mice, maned mice), Tetragnathidae (tree mice, rock mice, white-tailed rats, Madagascar rats and mice), Dormiceidae (e.g., spiny dormice), and Moleratidae (e.g., mole rats, bamboo rats, and plateau mole rats). In some embodiments, the genetically modified rodent described herein is selected from a pure breed of mouse or rat (Muridae), a gerbil, a spiny mouse, and a maned mouse. In some embodiments, the genetically modified mouse described herein is from a member of the Muridae family. In some embodiments, the non-human animal described herein is a rodent. In some embodiments, the rodent described herein is selected from a mouse and a rat. In some embodiments, the non-human animal described herein is a mouse.

[0246] In some embodiments, the non-human animals described herein are rodents that are mice of the C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse of the present invention is a 129 strain selected from the group consisting of strains that are 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129 / SvJae, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing et al., 1999, Mammalian Genome 10:836; Auerbach, W. et al., 2000, Biotechniques 29(5):1024-1028, 1030, 1032; the entire contents of which are incorporated herein by reference). In some embodiments, the genetically modified mice described herein are a mix of the aforementioned 129 strain and the aforementioned C57BL / 6 strain. In some embodiments, the mice described herein are a mix of the aforementioned 129 strains, or a mix of the aforementioned BL / 6 strains. In some embodiments, the 129 strain in the mix described herein is a 129S6 (129 / SvEvTac) strain. In some embodiments, the mice described herein are a BALB strain, e.g., a BALB / c strain. In some embodiments, the mice described herein are a mix of a BALB strain and another aforementioned strain.

[0247] In some embodiments, the non-human animal described herein is a rat. In some embodiments, the rat described herein is selected from Wistar rats, LEA strains, Sprague Dawley strains, Fischer strains, F344, F6, and Dark Agouti. In some embodiments, the rat strain described herein is a mixture of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0248] Method for producing anchor-modified immunoglobulins and anchor-modified immunoglobulins Several in vitro and in vivo techniques have been developed to generate antibody-based therapeutics. In particular, in vivo techniques have been characterized by the generation of transgenic animals (i.e., rodents) with human immunoglobulin genes, where the genes have been randomly integrated into the animal's genome (see, e.g., U.S. Pat. No. 5,569,825, incorporated herein by reference in its entirety) or precisely placed into endogenous immunoglobulin loci operably linked to the animal's endogenous immunoglobulin constant regions (see, e.g., U.S. Pat. Nos. 8,502,018, 8,642,835, 8,697,940, and 8,791,323, incorporated herein by reference in their entireties). Both approaches have been successful in generating promising antibody therapeutic candidates for human use. Furthermore, both of these approaches have an advantage over in vitro approaches in that antibody candidates are selected from an antibody repertoire generated in vivo, which involves selection for affinity and specificity for the antigen within the internal environment of the host immune system. In this way, antibodies bind to naturally presented antigens (within the relevant biological epitopes and surfaces) rather than to artificial environments or in silico predictions that can accompany in vitro techniques. Despite the robust antibody repertoires available from in vivo techniques, antibodies against complex (e.g., viruses, channel polypeptides) or cytoplasmic antigens remain challenging. Furthermore, due to immune tolerance, generating antibodies against polypeptides that share a high degree of sequence identity between species (e.g., humans and mice) remains a challenge.

[0249] The present invention is therefore particularly based on the recognition that an in vivo system is constructed that features the generation of antibodies with increased affinity for antigens by having anchors that help the immunoglobulin to tether to the antigen of interest (e.g., the anchor's cognate receptor) and by contributing to the avidity of the molecule through affinity for the cognate receptor and / or by performing somatic hypermutation of a large repertoire of immunoglobulins capable of recognizing their cognate receptor.

[0250] The provided non-human animals can be used to generate human antibodies, which comprise variable domains derived from one or more variable region nucleic acid sequences encoded by the genetic material of the cells of the non-human animals described herein. For example, the provided non-human animals are immunized with an antigen of interest (e.g., a receptor cognate to the anchor) under conditions and for a time sufficient to cause the non-human animal to generate an immune response against the antigen of interest. Antibodies are isolated from the non-human animals (or one or more cells, e.g., one or more B cells) and characterized using various assays that measure, for example, affinity, specificity, epitope mapping, ability to inhibit ligand-receptor interaction, inhibitory receptor activity, etc. In some embodiments, the antibodies produced by the provided non-human animals comprise one or more human variable domains derived from one or more human variable region nucleotide sequences isolated from the non-human animals.

[0251] The non-human animals described herein provide improved in vivo systems and sources of biological material (e.g., cells) for producing human antibodies useful in various assays. In some embodiments, the provided non-human animals are used to develop therapeutic agents that target one or more receptors in the ligand-receptor pairs described herein. In some embodiments, the provided non-human animals are used to identify, screen, and / or develop candidate therapeutic agents (e.g., antibodies, etc.) that bind to one or more G protein-coupled receptor (GPCR) polypeptides. In some embodiments, the provided non-human animals are used to screen and develop candidate therapeutic agents (e.g., antibodies, etc.) that interfere with the activity of one or more receptor tyrosine kinases, one or more human GPCR polypeptides, one or more Notch receptors, one or more of CD28, CTLA4, and PD1, plexin receptors, LDLRs, LILRs, KIRs, and integrins, or NPRs, such as NPR3. In some embodiments, the provided non-human animals are used to determine the binding profile of antagonists and / or agonists of one or more human GPCR polypeptides, one or more Notch receptors, one or more of CD28, CTLA4, and PD1, plexin receptors, LDLR, LILR, KIR, and integrins, or NPRs, such as NPR3. In some embodiments, the provided non-human animals are used to determine the epitope of one or more candidate therapeutic antibodies that bind to one or more human GPCR polypeptides, one or more Notch receptors, one or more of CD28, CTLA4, and PD1, plexin receptors, LDLR, LILR, KIR, and integrins, or NPRs, such as NPR3.

[0252] In some embodiments, the provided non-human animals are used to determine the pharmacokinetic profile of the antibody. In some embodiments, one or more provided non-human animals and one or more control or reference non-human animals are each exposed to one or more candidate therapeutic antibodies at various doses (e.g., 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, or 50 mg / kg or more). The candidate therapeutic antibodies can be administered via any desired route of administration, including parenteral and oral routes. Parenteral routes include, for example, intravenous, intraarterial, intraportal, intramuscular, subcutaneous, intraperitoneal, intrathecal, intracerebroventricular, intracranial, intrathoracic, or other routes of injection. Oral routes include, for example, oral, nasal, transdermal, pulmonary, rectal, buccal, vaginal, and ocular. Administration may be by continuous infusion, topical administration, sustained release from an implant (gel, membrane, etc.), and / or intravenous injection, e.g., using an intravenous fluid bag. Blood may be isolated from the non-human animals (humanized and control) at various time points (e.g., 0 hours, 6 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or up to 30 days or more). Various assays may be used to determine the pharmacokinetic properties of the administered candidate therapeutic antibody using feed obtained from the non-human animals described herein, including, but not limited to, total IgG, anti-therapeutic antibody response, agglutination, etc.

[0253] In some embodiments, the provided non-human animals express antibodies, and thus cells, cell lines, and cell cultures can be generated to serve as a source of antibodies for use in binding and functional assays, e.g., to assay for antagonist or agonist binding or function, where the antagonist or agonist is specific for a human polypeptide sequence or epitope, or is specific for a human polypeptide sequence or epitope that functions in ligand-receptor interaction (binding). In some embodiments, the epitope bound by a candidate therapeutic antibody or siRNA can be determined using cells isolated from the provided non-human animals.

[0254] In some embodiments, the cells derived from the provided non-human animals can be isolated and used ad hoc or maintained in culture for many generations, hi some embodiments, the cells derived from the provided non-human animals are immortalized (e.g., through the use of a virus) and maintained in culture (e.g., in continuous culture) indefinitely.

[0255] In some embodiments, the non-human animals described herein provide an in vivo system for the generation of antibody variants that bind to human target antigens. Such variants include antibodies with desired functionality, specificity, and low cross-reactivity against a common epitope shared by two or more human target antigens. In some embodiments, the provided non-human animals are utilized to generate panels of antibodies to generate a series of antibody variants that are screened for desired or improved functionality.

[0256] In some embodiments, the non-human animals described herein provide an in vivo system for generating antibody libraries. Such libraries provide a source of heavy and light chain variable region sequences that can be grafted with different Fc regions based on desired effector functions and / or used as a source for affinity maturation of variable region sequences using techniques known in the art (e.g., site-directed mutagenesis, error-prone PCR, etc.).

[0257] kit The present invention further provides packs or kits comprising one or more containers filled with at least one non-human animal, non-human cell, DNA fragment, and / or targeting vector described herein. The kits may be used in any applicable method (e.g., research methods). Optionally, associated with such containers may be a notice in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical and biological products, reflecting (a) regulatory approval for manufacture, use, or sale for human administration, (b) instructions for use, or both, or a contract governing the transfer of materials and / or biological products (e.g., non-human animals or non-human cells described herein) between two or more entities.

[0258] Non-limiting embodiments are described below. Embodiment 1. 1. A recombinant nucleic acid molecule comprising a modified immunoglobulin (Ig) variable (V) segment encoding an anchor-modified Ig polypeptide, the modified Ig V segment comprises a nucleic acid sequence encoding an anchor between a nucleic acid sequence encoding an Ig signal peptide and nucleic acid sequences encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3 of a germline Ig V segment or a variant thereof; The anchor-modified Ig polypeptide comprises, in operable linkage: (i) Ig signal peptide, (ii) anchors, and (iii) comprising FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a germline Ig V segment or a variant thereof; the anchor comprises a receptor-binding portion of a subject non-immunoglobulin polypeptide that binds to a cognate receptor; and Optionally, the nucleic acid molecule lacks all other V segments. A recombinant nucleic acid molecule. Embodiment 2. 2. The recombinant nucleic acid molecule of embodiment 1, wherein the Ig signal peptide is the Ig signal peptide of a germline Ig V segment or a variant thereof. Embodiment 3. Germline Ig V segments or variants thereof are referred to as germline Ig heavy chain variable (V H ) segment or a variant thereof, whereby The modified Ig V segment comprises a nucleic acid sequence encoding an Ig signal peptide and a germline Ig V H A modified Ig V segment or a variant thereof, comprising a nucleic acid sequence encoding an anchor between the nucleic acid sequences encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3. H is a segment, and The anchor-modified Ig polypeptide comprises, in operable linkage: (i) Ig signal peptide, (ii) anchors, and (iii) germline Ig V H 3. The recombinant nucleic acid molecule of embodiment 1 or embodiment 2, comprising FR1, CDR1, FR2, CDR2, FR3, and CDR3 of the segment or a variant thereof. Embodiment 4. The germline Ig V segment or its variant is a germline human (h)V H 1-2 segments, germline hV H 1-3 segments, germline hV H 1-8 segments, germline hV H 1-18 segments, germline hV H 1-24 segments, germline hV H 1-45 segments, germline hV H 1-46 segments, germline hV H 1-58 segments, germline hV H 1-69 segment, germline hV H 2-5 segments, germline hV H 2-26 segments, germline hV H 2-70 segments, germline hV H3-7 segments, germline hV H 3-9 segments, germline hV H 3-11 segments, germline hV H 3-13 segments, germline hV H 3-15 segments, germline hV H 3-16 segments, germline hV H 3-20 segments, germline hV H 3-21 segments, germline hV H 3-23 segments, germline hV H 3-30 segments, germline hV H 3-30-3 segment, germline hV H 3-30-5 segment, germline hV H 3-33 segments, germline hV H 3-35 segments, germline hV H 3-38 segments, germline hV H 3-43 segments, germline hV H 3-48 segments, germline hV H 3-49 segments, germline hV H 3-53 segment, germline hV H 3-64 segments, germline hV H 3-66 segments, germline hV H 3-72 segment, germline hV H 3-73 segment, germline hV H 3-74 segment, germline hV H 4-4 segment, germline hV H 4-28 segments, germline hV H 4-30-1 segment, germline hV H 4-30-2 segment, germline hV H 4-30-4 segment, germline hV H 4-31 segments, germline hV H 4-34 segments, germline hV H 4-39 segments, germline hV H 4-59 segment, germline hV H 4-61 segment, germline hV H5-51 segment, germline hV H 6-1 segment, germline hV H 7-4-1 segment, germline hV H 4. The recombinant nucleic acid molecule of any one of embodiments 1 to 3, which is the 7-81 segment, or a variant thereof. Embodiment 5. Germline Ig V segments or their variants are referred to as germline hV H 5. The recombinant nucleic acid molecule of any one of embodiments 1 to 4, wherein the 1-69 segment or a variant thereof, and optionally the Ig signal peptide comprises the sequence MDWTWRFLFVVAAATGVQS (SEQ ID NO: 7). Embodiment 6. In an operable linkage, from 5' to 3', (I) Modified Ig V H segment, (II) one or more Ig heavy chain diversities (D H ) segment, and (III) one or more Ig heavy chain binding (J H 6. A recombinant nucleic acid molecule according to any one of embodiments 3 to 5, comprising a nucleotide sequence corresponding to a nucleotide sequence of ... Embodiment 7. (II) one or more Ig D H One, several, or all human Ig D segments H Contains segments, and / or (III) one or more Ig J H One, several, or all human Ig J segments H 7. The recombinant nucleic acid molecule of embodiment 6, comprising a segment. Embodiment 8. (II) one or more Ig D H (III) one or more Ig J segments; H The gene segments are recombined to form rearranged IgD H / J H forming a sequence such that the recombinant nucleic acid molecule is operably linked, 5' to 3', Modified Ig V Hgene segments, and Reconstituted IgD H / J H 8. A recombinant nucleic acid molecule according to embodiment 6 or embodiment 7, comprising the sequence Embodiment 9. Modified Ig V H Gene segments and rearrangements of Ig D H / J H The sequences are recombined to form a reconstructed Ig V encoding an anchor-modified Ig heavy chain variable domain. H / D H / J H Form an array, an anchor-modified Ig heavy chain variable domain in operable linkage, (i) Ig signal peptide, (ii) anchors, and (iii) Reconstituted Ig V H / D H / J H 9. The recombinant nucleic acid molecule of embodiment 8, comprising FR1, complementarity determining region (CDR) 1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequences: Embodiment 10. Modified Ig V H The segment is a non-rearranged engineered Ig V H 9. The recombinant nucleic acid molecule of any one of embodiments 3 to 8, which is a gene segment. Embodiment 11. Ig heavy chain constant region (C H ), Ig C H a nucleic acid sequence encoding (I) Modified Ig V H segment, (II) one or more Ig D H Segments, and (III) one or more Ig J H 11. A recombinant nucleic acid molecule according to any one of embodiments 6 to 10, which is downstream of and operably linked to a segment. Embodiment 12. IgC H12. The recombinant nucleic acid molecule of embodiment 11, wherein the nucleic acid sequence encoding comprises an Igμ gene encoding an IgM isotype, an Igδ gene encoding an IgD isotype, an Igγ gene encoding an IgG isotype, an Igα gene encoding an IgA isotype, and / or an Igε gene encoding an IgE isotype. Embodiment 13. a nucleic acid sequence encoding an anchor-modified Ig heavy chain, the anchor-modified Ig heavy chain being operably linked to (i) Ig signal peptide, (ii) anchors; (iii) Reconstituted Ig V H / D H / J H an Ig heavy chain variable domain comprising FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence (iv) Ig C H 13. A recombinant nucleic acid molecule according to any one of embodiments 3 to 12, comprising: Embodiment 14. IgC H is a non-human Ig C H 14. The recombinant nucleic acid molecule according to any one of embodiments 11 to 13, Embodiment 15. Non-human Ig C H is a rodent Ig C H 15. The recombinant nucleic acid molecule of embodiment 14, wherein Embodiment 16. Non-human Ig C H is rat Ig C H 16. The recombinant nucleic acid molecule of embodiment 15, wherein Embodiment 17. Non-human Ig C H is mouse Ig C H 16. The recombinant nucleic acid molecule of embodiment 15, wherein Embodiment 18. The germline Ig V gene segment or its variants are referred to as the germline Ig light chain variable (V L ) segment or a variant thereof, whereby The modified Ig V segment comprises a nucleic acid sequence encoding an Ig signal peptide and a germline Ig V L A modified Ig V segment or a variant thereof, comprising a nucleic acid sequence encoding an anchor between the nucleic acid sequences encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3. L is a segment, and The anchor-modified Ig polypeptide comprises, in operable linkage: (i) Ig signal peptide, (ii) anchors, and (iii) germline Ig V L 3. The recombinant nucleic acid molecule of embodiment 1 or embodiment 2, comprising FR1, CDR1, FR2, CDR2, FR3, and CDR3 of the segment or a variant thereof. Embodiment 19. In an operable linkage, from 5' to 3', (I) Modified Ig V L Segments, and (II) one or more Ig light chain binding (J L 20. The recombinant nucleic acid molecule of embodiment 18, comprising a .DELTA.AGA.) segment. Embodiment 20. Modified Ig V L A gene segment and one or more Ig J L The segments are recombined to form a rearranged Ig V that encodes an anchor-modified Ig light chain variable domain. L / J L Form an array, an anchor-modified Ig light chain variable domain in operable linkage, (i) Ig signal peptide, (ii) anchors, and (iii) Reconstituted Ig V L / J L 20. The recombinant nucleic acid molecule of embodiment 19, comprising FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequences: Embodiment 21. Ig light chain constant region (C L), IgC L a nucleic acid sequence encoding (I) Modified Ig V L Segments, and (II) one or more Ig light chain binding (J L 21. The recombinant nucleic acid molecule of embodiment 19 or embodiment 20, wherein the recombinant nucleic acid molecule is downstream of and operably linked to the .) segment. Embodiment 22. a nucleic acid sequence encoding an anchor modified Ig light chain, the anchor modified Ig light chain being operably linked to (i) Ig signal peptide, (ii) anchors; (iii) Reconstituted Ig V L / J L an Ig light chain variable domain comprising FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 encoded by the sequence (iv) Ig C L 22. A recombinant nucleic acid molecule according to any one of embodiments 18 to 21, comprising: Embodiment 23. IgC L is a non-human Ig C L 23. The recombinant nucleic acid molecule of embodiment 21 or embodiment 22, wherein Embodiment 24. Non-human Ig C L is a rodent Ig C L 24. The recombinant nucleic acid molecule of embodiment 23, wherein Embodiment 25. Non-human Ig C L is rat Ig C L 24. The recombinant nucleic acid molecule of embodiment 23, wherein Embodiment 26. Non-human Ig C L is mouse Ig C L 24. The recombinant nucleic acid molecule of embodiment 23, wherein Embodiment 27. Germline Ig V LThe segment or variant thereof is a germline Ig light chain variable kappa (Vκ) segment or variant thereof, whereby the modified Ig V-segment comprises a nucleic acid sequence encoding an anchor between a nucleic acid sequence encoding an Ig signal peptide and nucleic acid sequences encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3 of a germline Ig V-segment or a variant thereof; and The anchor-modified Ig polypeptide comprises, in operable linkage: (i) Ig signal peptide, (ii) anchors, and (iii) A recombinant nucleic acid molecule described in any one of embodiments 18 to 26, comprising FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a germline Ig Vκ segment or a variant thereof. Embodiment 28. In an operable linkage, from 5' to 3', (I) a modified Ig Vκ segment, and (II) A recombinant nucleic acid molecule of embodiment 27, comprising one or more Ig light chain binding kappa (Jκ) segments. Embodiment 29. further comprising a nucleic acid sequence encoding an Ig light chain constant kappa region (CK), a nucleic acid sequence encoding Ig Cκ (I) a modified Ig Vκ segment, and (II) The recombinant nucleic acid molecule of embodiment 28, which is downstream of and operably linked to one or more Ig Jκ segments. Embodiment 30. Germline Ig V L The segment or variant thereof is a germline Ig light chain variable lambda (Vλ) segment or variant thereof, whereby the modified Ig V-segment comprises a nucleic acid sequence encoding an anchor between a nucleic acid sequence encoding an Ig signal peptide and nucleic acid sequences encoding framework region (FR) 1, complementarity-determining region (CDR) 1, FR2, CDR2, FR3, and CDR3 of a germline Ig V-segment or a variant thereof; and The anchor-modified Ig polypeptide comprises, in operable linkage: (i) Ig signal peptide, (ii) anchors, and (iii) A recombinant nucleic acid molecule described in any one of embodiments 18 to 26, comprising FR1, CDR1, FR2, CDR2, FR3, and CDR3 of a germline Ig Vλ segment or a variant thereof. Embodiment 31. In an operable linkage, from 5' to 3', (I) a modified Ig Vλ segment, and (II) A recombinant nucleic acid molecule according to embodiment 30, comprising one or more Ig light chain joining lambda (Jλ) segments. Embodiment 32. further comprising a nucleic acid sequence encoding an Ig light chain constant lambda region (Cλ), a nucleic acid sequence encoding an Ig Cλ (I) a modified Ig Vλ segment, and (II) The recombinant nucleic acid molecule of embodiment 31, which is downstream of and operably linked to one or more Ig Jλ segments. Embodiment 33. 33. The recombinant nucleic acid molecule of any one of embodiments 1 to 32, wherein the anchor comprises a linker that links the receptor-binding portion of the non-immunoglobulin polypeptide of interest to FR1, CDR1, FR2, CDR2, FR3 and CDR3 of a germline Ig V segment or variant thereof. Embodiment 34. 34. The recombinant nucleic acid molecule of embodiment 33, wherein the linker comprises the sequence GGGGS (SEQ ID NO: 5). Embodiment 35. 35. The recombinant nucleic acid molecule of any one of embodiments 1 to 34, wherein the anchor comprises a natriuretic peptide receptor (NPR) binding portion of a natriuretic peptide (NP). Embodiment 36. 36. The recombinant nucleic acid molecule of embodiment 35, wherein the NPR-binding portion of NP comprises the C-terminal tail of NP. Embodiment 37. The recombinant nucleic acid molecule of embodiment 35 or embodiment 36, wherein NP is atrial natriuretic peptide (ANP). Embodiment 38. 38. The recombinant nucleic acid molecule of any one of embodiments 1 to 37, wherein the anchor comprises the sequence NSFRY (SEQ ID NO: 3). Embodiment 39. 39. A recombinant nucleic acid molecule according to any one of embodiments 1 to 38, comprising a sequence selected from the group consisting of the sequence set forth as SEQ ID NO: 8 or a degenerate variant thereof, the sequence set forth as SEQ ID NO: 10 or a degenerate variant thereof, SEQ ID NO: 11 or a degenerate variant thereof, and SEQ ID NO: 12 or a degenerate variant thereof. Embodiment 40. The targeting vector further comprises 5' and 3' homology arms that target the non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus transfers the recombinant nucleic acid molecule to the non-human Ig C locus of the non-human Ig heavy chain locus. H and optionally the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus, and / or the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and is operably linked to an endogenous Ig V H , D H and / or J H A targeting vector comprising a recombinant nucleic acid molecule of any one of embodiments 1 to 10 and 33 to 39, comprising deletions of gene segments, or a combination thereof. Embodiment 41. Upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule ligates a non-human V at the non-human Ig heavy chain locus. HThe targeting vector of embodiment 40, which replaces a segment. Embodiment 42. Upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule cleaves one or more non-human VHV sequences at the non-human Ig heavy chain locus. H Segment, all non-human D H segments, and all non-human J H 42. The targeting vector of embodiment 40 or embodiment 41, which replaces a segment. Embodiment 43. Upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule assembles into one non-human V at the non-human Ig heavy chain locus. H All or all non-human V except for segment H Segment, all non-human D H segments, and all non-human J H 43. A targeting vector according to any one of embodiments 40 to 42, which replaces a segment. Embodiment 44. 44. The targeting vector of any one of embodiments 40 to 43, wherein upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig heavy chain regulatory sequence at the non-human Ig heavy chain locus. Embodiment 45. A targeting vector described in any one of embodiments 40 to 44, wherein the 5' homology arm comprises the sequence set forth as SEQ ID NO: 11 and / or the 3' homology arm comprises the sequence set forth as SEQ ID NO: 12. Embodiment 46. The targeting vector further comprises 5' and 3' homology arms that target a non-human Ig heavy chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the targeted non-human Ig heavy chain locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig heavy chain regulatory sequence of the non-human Ig heavy chain locus, optionally wherein the non-human Ig heavy chain locus is an endogenous rodent Ig heavy chain locus, and / or wherein the non-human Ig heavy chain locus comprises a human or humanized immunoglobulin heavy chain variable region and is operably linked to an endogenous Ig VH , D H and / or J H A targeting vector comprising a recombinant nucleic acid molecule according to any one of embodiments 1 to 17 and 33 to 39, comprising deletions of gene segments, or a combination thereof. Upon homologous recombination between the targeting vector and the non-human Ig heavy chain locus, the recombinant nucleic acid molecule cleaves one or more non-human VHV sequences at the non-human Ig heavy chain locus. H Segment, all non-human D H gene segments, and all non-human J H gene segment, and one or more non-human C H The targeting vector of embodiment 46, which replaces a gene. Embodiment 48. The targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus transfers the recombinant nucleic acid molecule to the non-human Ig C locus of the non-human Ig light chain locus. L and optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V L and / or J L A targeting vector comprising a recombinant nucleic acid molecule of any one of embodiments 1-2, 18-20, 27-28, 30-31, and 33-38, comprising deletions of gene segments, or a combination thereof. Embodiment 49. Upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule ligates a non-human V at the non-human Ig light chain locus. L The targeting vector of embodiment 48, which replaces a segment. Embodiment 50. Upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule ligates one or more non-human VL1 and VL2 loci at the non-human Ig light chain locus. LSegment and all non-human J L 50. The targeting vector of embodiment 48 or embodiment 49, which replaces a segment. Embodiment 51. Upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule integrates all non-human V and V sequences at the non-human Ig light chain locus. L Segment and all non-human J H A targeting vector described in any one of embodiments 48 to 50, which replaces a segment. Embodiment 52. 52. The targeting vector of any one of embodiments 48 to 51, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig heavy chain locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain regulatory sequence at the Ig light chain locus. Embodiment 53. The targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain locus, whereby upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the targeted non-human Ig light chain locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig light chain regulatory sequence of the non-human Ig light chain locus, optionally wherein the non-human Ig light chain locus is an endogenous rodent Ig light chain locus, and / or wherein the non-human Ig light chain locus comprises a human or humanized immunoglobulin light chain variable region and is operably linked to an endogenous Ig V L and / or J L A targeting vector comprising a recombinant nucleic acid molecule of any one of embodiments 1-2, 18-38, comprising deletions of gene segments, or a combination thereof. Embodiment 54. Upon homologous recombination between the targeting vector and the non-human Ig light chain locus, the recombinant nucleic acid molecule is integrated into the non-human V region of the non-human Ig light chain locus. L Segment, all non-human J L segments, and non-human C L The targeting vector of embodiment 53, which replaces a gene. Embodiment 55. 39. The targeting vector comprising the recombinant nucleic acid molecule of any one of embodiments 1-2, 18-20, 27-28, and 33-38, wherein the targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises the recombinant nucleic acid molecule upstream of and operably linked to a non-human Ig Cκ of the non-human Ig light chain κ locus, optionally wherein the non-human Ig light chain κ locus is an endogenous rodent Ig light chain κ locus, and / or wherein the non-human Ig light chain κ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vκ and / or Jκ gene segment, or comprises a combination thereof. Embodiment 56. 56. The targeting vector of embodiment 55, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces the non-human Vκ segment at the non-human Ig light chain κ locus. Embodiment 57. The targeting vector of embodiment 55 or embodiment 56, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces one or more non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. Embodiment 58. 58. The targeting vector of any one of embodiments 55 to 57, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces all non-human Vκ segments and all non-human Jκ segments at the non-human Ig light chain κ locus. Embodiment 59. 59. The targeting vector of any one of embodiments 55 to 58, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain κ regulatory sequence at the Ig light chain κ locus. Embodiment 60. 30. A targeting vector comprising a recombinant nucleic acid molecule of any one of embodiments 1-2 and 18-29, wherein the targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain κ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the targeted non-human Ig light chain κ locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig light chain κ regulatory sequence of the Ig light chain κ locus. Embodiment 61. 61. The targeting vector of embodiment 60, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain κ locus, the recombinant nucleic acid molecule replaces the non-human Vκ segments, all of the non-human Jκ gene segments, and the non-human CK gene of the non-human Ig light chain κ locus. Embodiment 62. 39. The targeting vector comprising the recombinant nucleic acid molecule of any one of embodiments 1-2, 18-20, 30-31, and 33-38, wherein the targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises the recombinant nucleic acid molecule upstream of and operably linked to the non-human Ig Cλ of the non-human Ig light chain locus, optionally wherein the non-human Ig light chain λ locus is an endogenous rodent Ig light chain λ locus, and / or wherein the non-human Ig light chain λ locus comprises a human or humanized immunoglobulin light chain variable region, comprises a deletion of an endogenous Ig Vλ and / or Jλ gene segment, or comprises a combination thereof. Embodiment 63. 63. The targeting vector of embodiment 62, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces the non-human Vλ segment at the non-human Ig light chain λ locus. Embodiment 64. The targeting vector of embodiment 62 or embodiment 63, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces one or more non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain locus. Embodiment 65. 65. The targeting vector of any one of embodiments 62-64, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces all non-human Vλ segments and all non-human Jλ segments at the non-human Ig light chain λ locus. Embodiment 66. 66. The targeting vector of any one of embodiments 62 to 65, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises a recombinant nucleic acid molecule operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus. Embodiment 67. 39. A targeting vector comprising a recombinant nucleic acid molecule of any one of embodiments 1-2, 18-26, and 30-38, wherein the targeting vector further comprises 5' and 3' homology arms that target the non-human Ig light chain λ locus, such that upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the targeted non-human Ig light chain λ locus comprises the recombinant nucleic acid molecule operably linked to a non-human Ig light chain λ regulatory sequence at the Ig light chain λ locus. Embodiment 68. 68. The targeting vector of embodiment 67, wherein upon homologous recombination between the targeting vector and the non-human Ig light chain λ locus, the recombinant nucleic acid molecule replaces the non-human Vλ segment, all non-human Jλ gene segments, and the non-human Cλ gene at the non-human Ig light chain λ locus. Embodiment 69. A non-human animal genome comprising the recombinant nucleic acid molecule of any one of embodiments 1 to 39, or the targeting vector of any one of embodiments 40 to 68, optionally wherein the non-human animal is a rodent, and optionally wherein the rodent is a rat or a mouse. Embodiment 70. 70. The non-human animal genome of embodiment 69, wherein the recombinant nucleic acid is located in an endogenous Ig locus of the non-human animal genome. Embodiment 71. A non-human animal or a non-human animal cell comprising a recombinant nucleic acid molecule described in any one of embodiments 1 to 39, a targeting vector described in any one of embodiments 40 to 68, or a non-human animal genome described in embodiment 69 or embodiment 70. Embodiment 72. The non-human animal or non-human animal cell of embodiment 71, wherein the recombinant nucleic acid molecule, targeting vector, or non-human animal genome is in the germline of the non-human animal or non-human animal cell. Embodiment 73. A method for modifying an isolated cell in vitro, comprising introducing into the isolated cell a recombinant nucleic acid molecule according to any one of embodiments 1 to 39. Embodiment 74. The in vitro method of embodiment 73, wherein the introducing comprises contacting the cell with a targeting vector of any one of embodiments 40 to 68. Embodiment 75. 75. The in vitro method of embodiment 73 or embodiment 74, wherein the cell is a host cell. Embodiment 76. The in vitro method of embodiment 73 or embodiment 74, wherein the cell is an embryonic stem (ES) cell. Embodiment 77. 77. The in vitro method of any one of embodiments 73 to 76, wherein the cell is a rodent cell, optionally wherein the rodent cell is a rat cell or a mouse cell. Embodiment 78. A non-human animal embryo produced from the embryonic stem cells of embodiment 76. Embodiment 79. A non-human animal produced from the embryonic stem cells of embodiment 76. Embodiment 80. A method for producing a non-human animal, comprising implanting the ES cells or embryos comprising the ES cells of embodiment 76 into a suitable host, and maintaining the host under appropriate conditions during the development of the ES cells or embryos into viable offspring. Embodiment 81. The non-human animals, compared to control non-human animals, (a) Equivalent numbers of mature B cells in the spleen; (b) Equivalent numbers of kappa-positive B cells in the spleen; (c) equivalent numbers of lambda-positive B cells in the spleen; (d) comparable levels of serum IgG, and / or (e) a comparable level of serum IgM. A non-human animal according to any one of embodiments 71-72 and 79, or a non-human animal produced according to the method of embodiment 80. Embodiment 82. A non-human animal according to any one of embodiments 71 to 72, 79 and 81, or a non-human animal produced according to the method described in embodiment 80, wherein the non-human animal is capable of eliciting an immune response equivalent to that of a control non-human animal. Embodiment 83. a plurality of antigen binding proteins, each of said antigen binding proteins comprising an anchor-modified Ig polypeptide, and optionally The mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide; The mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry; or 80. The non-human animal of any one of embodiments 71-72, 79, and 81-82, or a non-human animal produced according to the method of embodiment 80, wherein the mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide, and wherein the mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry. Embodiment 84. The non-human animal of any one of embodiments 71-72, 79, and 81-83, or a non-human animal produced according to the method of embodiment 80, wherein the non-human animal further comprises a cognate receptor for the non-immunoglobulin polypeptide of interest. Embodiment 85. a plurality of antigen binding proteins, each of which comprises an anchor-modified Ig polypeptide and which specifically binds to a cognate receptor of a non-immunoglobulin polypeptide of interest; and optionally The mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide; The mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry; or 80. The non-human animal of any one of embodiments 71-72, 79, and 81-84, or a non-human animal produced according to the method of embodiment 80, wherein the mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide, and the mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry. 86. 86. The non-human animal of any one of embodiments 84-85, wherein the cognate receptor is a natriuretic peptide receptor (NPR). Embodiment 87. Each of the multiple antigen-binding proteins is 1X10 9 KD less than 30 minutes, and / or t 1 / 2 Embodiment 88. A non-human animal according to any one of embodiments 84 to 86, comprising: 88. The non-human animal of any one of embodiments 84-87, wherein at least 15% of the plurality of antigen-binding proteins block binding of the cognate receptor to the non-immunoglobulin polypeptide of interest. Embodiment 89. 89. The non-human animal of any one of embodiments 84-88, wherein more than 50% of the antigen-binding proteins of the plurality bind to a cognate receptor expressed on the cell surface. Embodiment 90. A non-human animal according to any one of embodiments 71-72, 79, and 81-89, or a non-human animal produced according to the method of embodiment 80, wherein the non-human animal is a rodent, optionally wherein the rodent is a rat or a mouse. Embodiment 91. 1. A method of producing an antigen-binding protein or obtaining a nucleic acid encoding said antigen-binding protein, comprising: Immunizing a non-human animal according to any one of embodiments 71-72, 79, and 81-90, or a non-human animal produced according to the method according to embodiment 80, with an antigen; causing a non-human animal to produce an antigen binding protein comprising an anchor-modified Ig polypeptide that binds to the antigen, or to produce a nucleic acid encoding said protein; and optionally the mass of the antigen-binding protein confirms the presence of the anchor-modified Ig polypeptide; The mass of the antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry, or The mass of the antigen binding protein confirms the presence of the anchor-modified Ig polypeptide, and the mass of the antigen binding protein is determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry. Embodiment 92. 92. The method of embodiment 91, further comprising recovering the antigen binding protein, or the nucleic acid encoding the antigen binding protein, from the non-human animal or non-human animal cell. Embodiment 93. The method of embodiment 92, wherein the non-human animal cell is a B cell or a hybridoma. 92. A non-human animal cell recovered according to the method of embodiment 91. 95. The non-human animal of embodiment 94, wherein the non-human animal cell is a B cell. 96. 96. The non-human animal cell of embodiment 94 or 95, wherein the B cell is a mouse B cell. Embodiment 97. A hybridoma cell comprising a non-human animal cell according to any one of embodiments 94 to 95 fused with a myeloma cell. Embodiment 98. 1. An anchor-modified Ig polypeptide encoded by a recombinant nucleic acid molecule according to any one of embodiments 1 to 39, by a targeting vector according to any one of embodiments 40 to 68, by a non-human animal genome according to any one of embodiments 69 to 70, expressed by a non-human animal or a non-human animal cell according to any one of embodiments 71 to 72 and 81 to 90, produced according to the method according to any one of embodiments 73 to 76 and 80 or expressed by a non-human animal or a non-human animal cell produced according to the method according to any one of embodiments 91 to 93, wherein the anchor-modified Ig polypeptide optionally comprises: The mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide; The mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time of flight mass spectrometry; or The mass of each antigen-binding protein confirms the presence of an anchor-modified Ig polypeptide, and the mass of each antigen-binding protein is determined by matrix-assisted laser desorption / ionization-time-of-flight mass spectrometry, anchor-modified Ig polypeptide. Embodiment 99. 99. The anchor-modified Ig polypeptide of embodiment 98, comprising the amino acid sequence set forth as SEQ ID NO: 3 at its N-terminus.

[0259] Other features of the described embodiments will become apparent in the course of the following description of exemplary embodiments, which are given by way of illustration and are not intended to be limiting thereof. [Example]

[0260] The following examples are provided to illustrate to one of ordinary skill in the art how to make and use the methods and compositions disclosed herein, and are not intended to limit the scope of what the inventors regard as their invention. Unless otherwise indicated, temperatures are given in degrees Celsius and pressures are at or near atmospheric.

[0261] Example 1. Construction of immunoglobulin variable regions containing ANP-modified immunoglobulin variable region gene segments This non-limiting example describes the construction of a targeting vector for integrating an anchor-modified immunoglobulin (Ig) variable region (V) gene segment into the immunoglobulin variable region of an immunoglobulin locus. As described below, a coding sequence for the C-terminal tail of ANP is placed in operable linkage with an Ig V gene segment. The modified Ig V segment may be placed in operable linkage with an Ig joining (J) gene segment and, if necessary, an Ig diversity (D) gene segment, such that, upon V(D)J recombination, an antibody is expressed that comprises the C-terminal tail of ANP at the N-terminus of the immunoglobulin polypeptide chain.

[0262] ANP modified V for insertion into immunoglobulin heavy chain variable regions H Targeting vectors containing gene segments were generated using VELOCIGENE® technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al., 2003, Nature Biotech. 21(6):652-659, which are incorporated herein by reference) and molecular biology techniques known in the art. Non-limiting exemplary strategies for constructing targeting vectors using sequences encoding the C-terminal tail of ANP are described in Figures 1-2.

[0263] Germline V via a sequence encoding a peptide linker H A donor DNA fragment containing the C-terminal tail of ANP inserted within the 1-69 gene segment was generated by de novo DNA synthesis (Blue Heron Biotech, Bothell, WA). Figure 1 shows the "p466090" ANP-V H The "1-69 Cas9" donor fragment is shown. The spectinomycin resistance cassette "SPEC" was ligated into the EcoRI and AvrII sites of donor plasmid p46609 to generate plasmid p46685 (Figure 1). Figure 2 shows a detailed diagram of the resulting donor plasmid p46609.

[0264] The donor fragment was used to modify BAC clone VI504 (MAID6211). See Figure 2. BAC clone VI504 contains, from 5' to 3', an approximately 20 kb 5' homology arm, the mouse Adam6a gene "a," an Frt-Ub-Hyg-Frt cassette, and an approximately 15 kb I-CeuI-AscI fragment containing the mouse Adam6a gene "b," the germline human V H Approximately 9 kb AscI-AsiSI fragment containing the 1-69 gene, human D H and Human J H It contains an approximately 60 kb fragment containing the gene and an approximately 8 kb 3' mouse homology arm containing the mouse IgH intronic enhancer (black oval), the IgM switch region, and part of the mouse IgM gene (Figure 3).

[0265] In step 1, VI504 was digested in vitro using Cas9 complexed with a mixture of two gRNAs to generate human germline V H The 5' and 3' ends of the 1-69 gene were truncated. The resulting 3' and 5' ends overlapped by 60 bp with those of p46685. The XhoI fragment of p46685 was then assembled with VI504 (MAID6211) by Gibson Assembly to generate VI738. In step 2, VI738 was digested with MreI to remove the spectinomycin resistance cassette. The BAC was then repaired by joiner oligo-mediated Gibson Assembly, leaving a seamless junction (ΔMreI) to generate the final LTVEC VI748 (MAID6833). The LTVEC was identical to VI504 except for the insertion of the ANP-G4S codon in VI748.

[0266] Correct assembly of the donor fragments described and the germline (GL) V of BAC clone VI504 described herein H 1-69 gene segment and NP-modified V HTargeted replacement of the 1-69 gene segment was confirmed throughout the construction of the targeting vector by sequence analysis and polymerase chain reaction using the primers listed in Table 1 . [Table 3-1] [Table 3-2]

[0267] Example 2. NP modified V H Generation of rodents containing the gene segment In this example, the genome is NP-modified V H A gene segment, e.g., V containing the C-terminal tail of ANP H 1 shows the generation of non-human animals (e.g., rodents) containing immunoglobulin heavy chain variable regions containing gene segments.

[0268] Linearize the VI748 targeting vector and remove the majority of the 5' V H All endogenous V except for the 1-86 segment H , D H , and J. H Mouse embryonic stem cells with a genome homozygous for a segment-deleted endogenous Ig heavy chain variable region locus (1115KO) and homozygous for an endogenous Ig light chain variable region locus with a complete repertoire of human Vκ and Jκ segments and replacement of all endogenous Vκ and Jκ segments were electroporated. The Ig heavy chain locus of the ES cells (with a background of 50% Balb, 25% C57BL / 6, and 25% 129) used for electroporation of each targeting vector is shown in Figure 4. After electroporation, electroporated cells were cultured in selective medium. Drug-resistant colonies were picked 10 days after electroporation and screened by TAQMAN™ to identify anchor-modified Vκ. HUsing primers / probes that detect proper integration of the 1-69 gene segment, chromosome analysis was performed for targeting accuracy as previously reported (Valenzuela et al., supra; Frendewey, D. et al., 2010, Methods Enzymol. 476:295-307, which is incorporated herein by reference in its entirety). Forward primer: TGTGTCCCTGTCCACAGGTG (SEQ ID NO: 34) Probe: CCAGTCCAACAGTTCCGGTACG (SEQ ID NO: 35) Reverse primer: CAGCTGGACCTGGCTACC (SEQ ID NO: 36)

[0269] The VELOCIMOUSE® method (DeChiara, TM et al., 2010, Methods Enzymol. 476:285-294; DeChiara, TM, 2009, Methods Mol. Biol., 530:311-324; Poueymirou et al., 2007, Nat. Biotechnol., 25:91-99, incorporated herein by reference in their entirety) was used. In this method, targeted ES cells were injected into uncompacted 8-cell stage Swiss Webster embryos, and healthy, fully ES cell-derived F0 generation mice were generated. The mice were transfected with anchor (ANP)-modified V H The modified mice are heterozygous for the segment and express ANP-V modified antibodies. H These are called 1-69 modified mice.

[0270] For example, to remove any lox-added selection cassette introduced by the unremoved targeting construct at the ES cell stage or in the embryo, the drug selection cassette may optionally be removed by subsequent addition of recombinase (e.g., by Cre treatment) by breeding with a Cre-deficient mouse strain (see, e.g., International Patent Application Publication No. WO 2009 / 114400, incorporated herein by reference in its entirety), optionally retaining the selection cassette in the mouse.

[0271] Example 3. Analysis of rodent immunophenotypes by flow cytometry analysis ANP-V H To determine the immune phenotype of the 1-69 modified mice, bone marrow and splenic B cells were analyzed by flow cytometry. This study included two VELOCIMMUNE® control mice (see, e.g., U.S. Patent Nos. 8,502,018, 8,642,835, and 8,697,940, each of which is incorporated by reference in its entirety) and three ANP-V mice, as described in Example 2. H 1-69 mice were euthanized and their spleens and bone marrow were harvested. Bone marrow was harvested from the femur by centrifugation at 8,000 rpm for 2 minutes. Spleens were dissociated into single-cell suspensions. Erythrocytes from spleen and bone marrow preparations were lysed with ACK lysis buffer, followed by washing with DPBS containing 2% FBS. Isolated cells (a total of 1 × 10 6 The cells were incubated with anti-mouse CD16 / CD32 (clone 2.4G2, BD) for 10 minutes on ice, followed by labeling with the antibody panel listed in Table 2 for 30 minutes on ice. [Table 4]

[0272] After staining, cells were washed and fixed with 2% formaldehyde. Data acquisition was performed on a BD LSRFortessa flow cytometer and analyzed using FlowJo. Cell subsets were identified using the following strategies: Myeloid mature: immature B cells (B220int IgM+), mature B cells (B220high IgM+), pro-B cells (IgM- B220int, c-Kitint CD43high), pre-B cells (IgM- B220int, c-Kit-CD43int). Spleen and bone marrow kappa / lambda: B cells (CD19+ CD3-), T cells (CD3+ CD19-), IgK+ B cells (CD19+ IgK+ IgL-), IgL+ B cells (CD19+ IgK- IgL+). Splenic maturation: mature B cells (CD19+, B220+ CD93-), follicular B cells (CD19+, B220+ CD93-, CD21 / 35int IgMint / +), marginal zone B cells (CD19+, B220+ CD93-, CD21 / 35+ IgM+), transitional B cells (CD19+, B220+ CD93+), T1 B cells (CD19+, B220+ CD93+, IgM+ CD23-), T2 B cells (CD19+, B220+ CD93+, IgM+ CD23+), and T3 B cells (CD19+, B220+ CD93+, IgMint CD23+).

[0273] As shown in Figures 5A to 5F, in the spleen, ANP-V H There were similar levels of B cells in the 1-69 modified mice compared to the VELOCIMMUNE® control mice. H The frequency of mature B cells in 1-69 modified mice appeared similar to that observed in VELOCIMMUNE® control mice, whereas ANP-V H Immature cells in 1-69 modified mice were slightly reduced compared to VELOCIMMUNE® control mice. In the spleen, the frequency of lambda and kappa positive B cells was significantly higher than that of ANP-V. H Similar in 1-69 modified and VELOCIMMUNE® control mice.

[0274] As shown in Figures 6A-6F, in bone marrow, ANP-V H There were similar levels of B cells in the 1-69 modified mice compared to VELOCIMMUNE® control mice. In the bone marrow, ANP-V was significantly higher than in VELOCIMMUNE® control mice. H There were more pro-B cells and fewer pre-B cells in the 1-69 modified mice. Compared to VELOCIMMUNE® control mice, ANP-V H The bone marrow of 1-69-modified mice had fewer mature B cells and more immature B cells.

[0275] ANP-V H To further analyze the immunophenotype of the 1-69 modified mice, mouse IgG levels were analyzed by Western blot. H Blood was collected from a subset of 1-69 engineered mice and VELOCIMMUNE® control mice. Serum was collected in serum separator tubes (BD), incubated for 30 minutes, and separated from the blood by centrifugation at 9000 rcf for 5 minutes at 4°C. Mouse serum was diluted 1:25 in PBS and then run on a 4-20% Novex Tris-Glycine gel under non-reducing conditions. BioRad Trans-Blot™ was used. The gel was transferred to a polyvinylidene difluoride (PVDF) membrane according to the manufacturer's instructions. The blot was then blocked overnight with 10% nonfat milk in Tris-buffered saline (TBST, Sigma) containing 0.05% Tween®-20. The PVDF membrane was then incubated with anti-mouse IgG-HRP (Thermo / Pierce, Cat #31432) diluted 1:20,000 in 4% nonfat dry milk in TBST at room temperature for 1 hour. The blot was then washed five times for 5 minutes per wash, followed by development for 1 minute using Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences) according to the manufacturer's instructions. The blot was then imaged using a GE Healthcare ImageQuant LAS-4000 Cooled CCD Camera Gel Documentation System. Images were acquired at 15-second intervals until 20 images were acquired or the image was fully exposed, whichever occurred first.

[0276] As shown in Figure 7, serum IgG levels were significantly higher than ANP-V as measured by Western blot. H The results were comparable between the 1-69 modified mice and the VELOCIMMUNE® control mice, suggesting that the ANP Designer V mice have normal Ab levels compared to the VELOCIMMUNE® control mice.

[0277] ANP-V H To further analyze the immunophenotype of the 1-69-modified mice, serum IgM and total IgG levels were measured by ELISA. For ELISA, plates were coated overnight at 4°C with 1 μg / mL anti-mouse IgM+IgG+IgA (clone Ab102445, Abcam). Plates were then washed with DPBS containing 0.1% Tween-20 and blocked with 1% BSA in DPBS for 1 hour at room temperature. ANP-V HSerum from either 1-69-mutated or VELOCIMMUNE® control mice, along with mouse IgM standard (Biolegend, Cat. No. 401604) or mouse IgG standard (Sigma, Cat. No. I8765), was serially diluted in 1% BSA in DPBS and incubated for 1 hour at room temperature. After incubation, the plates were washed with DPBS containing 0.1% Tween-20, and IgM or IgG was detected using either anti-mouse IgM-HRP (Southern Biotech, Cat. No. 1021-05) or anti-mouse IgG-HRP (Southern Biotech, Cat. No. 1030-05). After further washing, TMB substrate (BD) was added. After color development, the reaction was stopped with 1N sulfuric acid, and absorbance was measured at 450 nm on a SpectraMax plate reader. Standard plots were generated in GraphPad Prism using nonlinear regression (curve fit, 4 parameters) of the IgM or IgG standards to quantify serum IgM and IgG levels.

[0278] As shown in Figures 8A-8B, serum IgG levels measured by ELISA were significantly higher than those of ANP-V. H Serum IgM levels measured by ELISA were comparable between the 1-69 engineered mice and the VELOCIMMUNE® control mice. H The results were comparable between the 1-69 modified mice and the VELOCIMMUNE® control mice. Both results suggest that the ANP mice had normal Ab levels compared to the VELOCIMMUNE® control mice.

[0279] The retention of the antibody anchor was verified by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS). Immunoglobulins isolated from mouse serum using Protein A magnetic beads (Thermo Scientific) were run on SDS-PAGE gels under reducing conditions to separate the immunoglobulin heavy and light chains. The immunoglobulin heavy chains were isolated and digested overnight with Lys-C enzyme (Promega). Salts were removed from the digest using C18 Ziptips (Millipore) according to the manufacturer's protocol. Peptides were eluted from each ziptip in 2.5 μl of 70% ACN / 0.1% TFA containing 10 mg / mL α-cyano-4-hydroxycinnamic acid (CHCA) and applied directly to a Bruker Anchorchip Target (Bruker Daltonics) mixed with α-cyano-4-hydroxycinnamic acid (Protea) dissolved in 70% acetonitrile + 0.1% trifluoroacetic acid (TFA). Upon drying, each target was analyzed by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) on a Bruker Ultraflextreme MALDI MS (Bruker Daltonics) in reflextron positive mode.

[0280] By MALDI-TOF MS, the ANP-modified immunoglobulin was identified as ANP-V. H‐ It was suggested that the protein remained intact in the serum of 1-69-modified mice (data not shown).

[0281] Example 4. Production of antibodies in rodents containing engineered immunoglobulin variable region gene segments This example demonstrates the production of antibodies in rodents whose genomes comprise immunoglobulin heavy chain variable regions that include engineered immunoglobulin variable region gene segments described herein. Using the methods described in this example and / or immunization methods known in the art, rodents containing engineered immunoglobulin variable region gene segments described herein can be immunized with a polypeptide or fragment thereof (e.g., a peptide derived from a desired epitope) described herein, or a combination of polypeptides or fragments thereof, if desired.

[0282] Briefly, cohorts of mice containing the engineered immunoglobulin variable region gene segments described herein are challenged with an antigen of interest, e.g., a receptor for a non-immunoglobulin polypeptide of interest that binds to its cognate receptor, using immunization methods known in the art. Antibody immune responses are monitored by ELISA immunoassay (i.e., serum titers).

[0283] immunization

[0284] VELOCIMMUNE® control (n=3) mice and ANP-V H 1-69 engineered (n=4) mice were immunized with a protein immunogen consisting of the extracellular domain of NPR3 fused to a C-terminal mFc tag (referred to as human NPR3 ecto-mFc) using a standard immunization protocol. Blood samples were collected from mice before the start of immunization and after each immunogen boost. After the final bleed, mice were euthanized and antibodies were isolated. Titer analysis was performed against the human NPR3 protein (composed of the extracellular domain of NPR3 fused to a myc-myc-hexahistidine tag; referred to as human NPR3 ecto-MMH) and engineered human NPR3-expressing cells (HEK293 cells engineered to overexpress full-length human NPR3; referred to as 293 / hNPR3).

[0285] Determination of antiserum titers

[0286] Antibody titers in serum against NPR3 were determined using ELISA. 96-well microtiter plates (Pierce) were coated overnight at 4°C with 2 μg / mL of human NPR3 ecto-MMH antigen in phosphate-buffered saline (PBS, Irvine Scientific). The plates were washed with PBS containing 0.05% Tween 20 (PBS-T, Sigma-Aldrich) and blocked with 250 μl of 0.5% bovine serum albumin (BSA, Sigma-Aldrich) in PBS for 1 hour at room temperature. After washing with PBS-T, preimmune and immune antisera were serially diluted threefold in 0.5% BSA-PBS and added to the plates for 1 hour at room temperature. The plate was washed, and a goat anti-mouse IgG-Fc-horseradish peroxidase (HRP)-conjugated secondary antibody (Jackson Immunoresearch) was added at a 1:5000 dilution and incubated at room temperature for 1 hour. The plate was then washed, and color was developed using TMB / H2O2 as substrate for 15-20 minutes. The reaction was stopped with acid, and the plate was read at 450 nm on a spectrophotometer (Victor, Perkin Elmer). Antibody titers were calculated using Graphpad PRISM software. Titers were defined as the interpolated serum dilution factor, where the binding signal is twice background.

[0287] Antibody titers against cells

[0288] Anti-NPR3 antibody titers against engineered cells were determined using the Meso Scale Discovery (MSD) MULTI-ARRAY® method. 96-well carbon electrode plates (MSD) were coated with either 293 / hNPR3 or HEK293 cells at 40,000 cells per well in PBS for 1 hour at 37°C. The cell coating solution was discarded, and the plates were blocked by incubating with 150 μL of 2% bovine serum albumin in PBS (BSA, Sigma-Aldrich) for 1 hour at room temperature (RT), followed by washing with PBS. Pre-immune and post-immune antisera were serially diluted threefold in 1% BSA-PBS and added to the plates for 1 hour at room temperature, followed by washing. A goat anti-mouse IgG-Fc ruthenium-conjugated secondary antibody (ruthenium-labeled in-house by Jackson ImmunoResearch) was then added to the plates at 1 μg / mL and incubated for 1 hour at room temperature. MSD's 4X Read Buffer, Detergent-Free, was diluted to 1X and 150 μL was added to each well for reading on an MSD SECTOR® Imager. Antibody titers were calculated using Graphpad PRISM software. Titers are defined as the interpolated serum dilution factor where the binding signal is 2x background.

[0289] result

[0290] After immunization with NPR3 ectoprotein immunogen, VELOCIMMUNE® control mice and ANP-V H The humoral immune response in 1-69 modified mice was determined using recombinant hNPR3 protein and engineered human NPR3-expressing cells (HEK293 / hNPR3). H Antisera from 1-69 engineered mice (n=4) showed a range of high antibody titers against the hNPR3.mmh protein, with a mean titer of 465,625, comparable to the mean titer of 394,032 in the VELOCIMMUNE® control strain (n=3) (Figure 9).H The mean antibody titers in the 1-69 engineered mice were 268,763 and 3,948, respectively, suggesting that the antisera were specific for NPR3. Similar results were obtained in VELOCIMMUNE® control mice, with mean antibody titers of 72,826 and 5,219 for HEK293 / hNPR3-expressing cells and parental HEK293 cells, respectively (Figure 10). These results suggest that ANP-V H This suggests that the 1-69 modified mice are capable of eliciting an immune response comparable to that of the VELOCIMMUNE® control mouse strain.

[0291] Example 4. Isolation of cells expressing, and / or nucleic acids encoding, antibodies produced in rodents containing engineered immunoglobulin variable region gene segments If a desired immune response is obtained, spleen cells (and / or other lymphoid tissues) are harvested and fused with mouse myeloma cells to preserve their viability and form immortalized hybridoma cell lines. The hybridoma cell lines are screened (e.g., by ELISA assay) and selected to identify hybridoma cell lines that produce antigen-specific antibodies. The hybridomas may be further characterized for the desired relative binding affinity and isotype. Using this technique, several antigen-specific chimeric antibodies (i.e., antibodies possessing human variable domains and rodent constant domains) are obtained.

[0292] DNA encoding the heavy and light chain variable regions may be isolated and combined with heavy and light chain constant regions of a desired isotype to prepare a fully human antibody. Such antibody proteins may be produced in cells such as CHO cells. The fully human antibodies are then characterized for relative binding affinity and / or neutralizing activity against the antigen of interest.

[0293] DNA encoding antigen-specific chimeric antibodies or the light and heavy chain variable domains can be isolated directly from antigen-specific lymphocytes. First, high-affinity chimeric antibodies with human variable regions and rodent constant regions are isolated, characterized, and selected for desirable properties such as affinity, selectivity, and epitope. The rodent constant regions are then replaced with the desired human constant regions to generate fully human antibodies. While the constant regions selected can vary depending on the specific application, the characteristics of high-affinity antigen binding and target specificity reside in the variable regions. Antigen...

Claims

[Claim 1] The invention described in the specification.