Autophagy promoter
S-lactoyl glutathione and its salts are utilized as active ingredients to address the lack of effective autophagy promoters and waste product inhibitors, achieving autophagy promotion and waste product suppression in various formulations and culture media.
Patent Information
- Application Number
- JP2024022617
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-19
- Publication Date
- 2025-08-29
AI Technical Summary
There are no known autophagy promoters or waste product production inhibitors containing S-lactoylglutathione and/or its salts, despite its known benefits such as whitening, anti-inflammatory, and antithrombotic effects.
S-lactoyl glutathione and/or its salts are used as active ingredients in formulations for promoting autophagy and inhibiting waste product production, with specific formulations for cosmetics, quasi-drugs, pharmaceuticals, and foods, and can be applied in culture media for in vitro cell culture.
S-lactoyl glutathione and/or its salts effectively promote autophagy and inhibit waste product production, demonstrating significant autophagy-promoting activity and waste product suppression.
Smart Images

Figure 2025126434000001 
Figure 2025126434000002 
Figure 2025126434000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to an autophagy promoter and a waste product production inhibitor characterized by containing S-lactoylglutathione and / or a salt thereof. [Background technology]
[0002] Autophagy is a mechanism in which an isolation membrane that appears in the cytoplasm surrounds cytoplasmic components to form an autophagosome, which then fuses with lysosomes to degrade the cytoplasmic components. Autophagy is an adaptive response to starvation; it is transiently induced in conditions with low amino acid or insulin levels, where it provides nutrients by breaking down cytoplasmic components. It also plays a role in removing unnecessary intracellular materials, such as damaged organelles that accumulate under stress, thereby contributing to maintaining intracellular homeostasis (Patent Document 1). Furthermore, autophagosomes directly eliminate pathogens, such as bacteria, that have invaded cells (Non-Patent Document 1).
[0003] Autophagy deficiency results in the intracellular accumulation of abnormal proteins. The intracellular accumulation of abnormal proteins is thought to be one of the causes of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease (Non-Patent Document 2). Autophagy abnormalities are also known to cause impaired innate immunity, abnormal mitochondrial accumulation, and activation of the transcription factor Nrf2 (NF-E2-related factor 2), which are involved in the development of pathologies such as infectious diseases and cancer (Non-Patent Document 3). Furthermore, autophagy is known to decline with aging, and its decline is associated with aging phenomena (Non-Patent Document 4). Promoting autophagy is crucial for preventing and improving these diseases and aging.
[0004] Waste products are a general term for unnecessary substances produced by cellular metabolism, etc. Waste products are known to cause proliferating cells to age and to cause tissue dysfunction (Non-Patent Documents 5 and 6). One hypothesis of aging is the waste product accumulation theory, which states that the aging phenomenon occurs when waste products gradually accumulate in the body because the production rate of metabolic products is faster than the excretion rate (Non-Patent Document 7). Therefore, inhibiting the production of waste products is extremely important for preventing and improving aging and tissue dysfunction.
[0005] S-lactoyl glutathione and / or a salt thereof is known to exhibit whitening effects (Patent Document 2), anti-inflammatory effects (Patent Document 3), antithrombotic effects (Patent Document 4), and effects of improving decreased VEGFR3 expression (Patent Document 5).
[0006] However, no autophagy promoters or waste product production inhibitors containing S-lactoylglutathione and / or its salts are known. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Patent Publication No. 2021-70670 [Patent Document 2] Patent No. 2876224 [Patent Document 3] Patent No. 2522940 [Patent Document 4] Patent No. 5356174 [Patent Document 5] Patent No. 5384285 [Non-patent literature]
[0008] [Non-Patent Document 1] Chemistry and Biology Vol.53 No.7 468-472(2015) [Non-patent document 2] Nature Vol.441 No.15 885-889(2006) [Non-patent document 3] Interdisciplinary Review Vol.e006 No.3 1-11(2014) [Non-patent document 4] Gifu Dental Society Journal Vol.45 No.1 1-7(2018) [Non-Patent Document 5] Yokohama City University Journal of Natural Sciences Vol.63 No.1·2·3 29-42(2013) [Non-patent document 6] Audiology Japan Vol.62 No.5 365(2019) [Non-Patent Document 7] Polymer Vol.24 No.1 44-49(1975) Summary of the Invention [Problem to be solved by the invention]
[0009] In view of the above-mentioned circumstances, an object of the present invention is to provide an excellent autophagy promoter and an excellent agent for suppressing the production of waste products. [Means for solving the problem]
[0010] As a result of intensive research aimed at solving the above-mentioned problems, the present inventors discovered that S-lactoyl glutathione and / or its salts have excellent autophagy-promoting effects and waste product production-inhibiting effects, leading to the completion of the present invention.
[0011] That is, the present invention includes the following inventions. (1) An autophagy promoter characterized by containing S-lactoyl glutathione represented by chemical formula (1) and / or a salt thereof. [ka] (2) A waste product production inhibitor characterized by containing S-lactoyl glutathione and / or a salt thereof. [Effects of the Invention]
[0012] According to the present invention, there are provided autophagy promoters and waste product production inhibitors containing S-lactoylglutathione and / or a salt thereof as an active ingredient. DETAILED DESCRIPTION OF THE INVENTION
[0013] The chemical formula (1) of S-lactoylglutathione of the present invention is shown below. [ka]
[0014] S-Lactoylglutathione is produced in the cell proliferation control process by the non-enzymatic reaction of methylglyoxal with glutathione to give the intermediate hemimercaptal, which is then metabolized by glyoxalase I.
[0015] S-lactoylglutathione may be a commercially available product, but as mentioned above, it can also be produced enzymatically from methylglyoxal and glutathione using glyoxalase I (Japanese Patent Laid-Open Publication No. 1-98487).
[0016] Salts of S-lactoylglutathione include alkali metal salts such as sodium, potassium, and lithium; alkaline earth metal salts such as calcium and magnesium; salts with ammonium and amines such as monoethanolamine, diethanolamine, triethanolamine, triethylamine, piperazine, and arginine; and hydrochloride salts, and these can be produced from S-lactoylglutathione by conventional methods.
[0017] In the present invention, S-lactoyl glutathione and / or a salt thereof may be used as is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, and acidulants, which are used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., within a range that does not impair the effects.
[0018] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of dosage forms thereof include lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath additives, foundations, dusting powders, lipsticks, ointments, poultices, candy tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and solutions for injection.
[0019] In the present invention, the content of S-lactoylglutathione and / or a salt thereof is preferably in the range of 0.0001 to 5% by weight, more preferably 0.001 to 0.5% by weight, for external use.
[0020] For internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Generally, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 1 g.
[0021] In the following, formulation examples and experimental examples of the present invention will be given as examples to explain the present invention in detail, but the present invention is not limited thereto. Unless otherwise specified, % in the examples indicates % by weight. [Example]
[0022] (Formulation example 1) Lotion Prescription Content (%) 1.S-Lactoyl Glutathione 0.1 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly, and components 7 to 10 are dissolved uniformly. The mixture is then mixed and filtered to obtain the product.
[0023] (Formulation example 2) Cream Prescription Content (%) 1. S-Lactoyl Glutathione 0.02 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-butylene glycol 8.5 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-9, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 11-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 10 at 45°C, further cool to 30°C, add ingredient 1, and dissolve uniformly to form the final product.
[0024] (Formulation Example 3) Emulsion Prescription Content (%) 1. S-Lactoyl Glutathione Sodium Salt 0.008 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, further cool to 30°C, add ingredient 1, and dissolve uniformly to form the final product.
[0025] (Formulation Example 4) Gel Prescription Content (%) 1. S-Lactoyl Glutathione Potassium Salt 0.4 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make the total volume 100 [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.
[0026] (Formulation Example 5) Bath additive Prescription Content (%) 1.S-Lactoyl Glutathione 0.005 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total volume 100 [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.
[0027] (Prescription Example 6) Ointment Prescription Content (%) 1.S-Lactoyl Glutathione 0.5 2. Polyoxyethylene cetyl ether (30E.O.) 2.0 3. Glyceryl monostearate 10.0 4. Liquid Paraffin 5.0 5. Cetyl alcohol 6.0 6. Methyl parahydroxybenzoate 0.1 7. Propylene Glycol 10.0 8. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-5, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 6-8, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify. Cool to 30°C while stirring, then add ingredient 1 and dissolve uniformly to form the product.
[0028] (Prescription Example 7) Powder Prescription Content (%) 1.S-Lactoyl Glutathione 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to form a powder.
[0029] (Prescription Example 8) Tablets Prescription Content (%) 1.S-Lactoyl Glutathione Sodium Salt 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Component 6 is added to the formed granules and compressed into tablets. Each tablet weighs 0.52 g.
[0030] Next, experimental examples will be given to explain the effects of the present invention in detail. [Example]
[0031] (Experimental Example 1) Evaluation of autophagy-promoting effects using gene expression related to autophagy induction as an indicator Human dermal fibroblasts were seeded and cultured in DMEM medium containing 10% FBS at 37°C under 5% CO2 conditions. When the cells reached confluence, they were cultured in DMEM medium containing 10% FBS supplemented with S-lactoyl glutathione (Sigma-Aldrich) to a final concentration of 0.1 mM for 24 hours, followed by total RNA extraction. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and total RNA content was determined by absorbance at 260 nm using a Nanodrop spectrophotometer. mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. For real-time RT-PCR, a High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. 500 ng of total RNA was reverse transcribed and then subjected to PCR (95°C for 15 seconds, 60°C for 60 seconds, 40 cycles). Other procedures were performed according to established methods. The expression levels of ATG7 (autophagy-related 7) and BECN1 (beclin 1), which are factors that induce autophagy, were determined as a ratio to the expression level of 18S rRNA, which served as an internal standard. The expression levels of ATG7 and BECN1 were calculated as the ratio of the expression levels of ATG7 and BECN1 mRNA in the sample-treated group to the expression levels of ATG7 and BECN1 mRNA in the sample-untreated group. The primers used to measure the expression levels of each gene are as follows:
[0032] Primer set for ATG7 CTGTAACTTAGCCCAGTACCCTGGA (SEQ ID NO: 1) TACGGTCACGGAAGCAAACAAC (SEQ ID NO: 2) Primer set for BECN1 CCAGATGCGTTATGCCCAGAC (SEQ ID NO: 3) CATTCCATTCCACGGGAACAC (SEQ ID NO: 4) Primer set for 18S rRNA CCGAGCCGCCTGGATAC (SEQ ID NO: 5) CAGTTCCGAAAACCAACAAAATAGA (SEQ ID NO: 6)
[0033] The experimental results are shown in Table 1. As a result, it was confirmed that the S-lactoyl glutathione of the present invention has excellent ATG7 expression-promoting activity and BECN1 expression-promoting activity. Therefore, it was confirmed that S-lactoyl glutathione has an autophagy-promoting activity.
[0034] [Table 1]
[0035] (Experimental Example 2) Evaluation of autophagy promotion using autophagosomes as an indicator Human dermal fibroblasts were seeded and cultured in DMEM medium containing 10% FBS at 37°C under 5% CO2 conditions. When the cells reached subconfluence, they were stained with the autophagosome staining reagent DAPRed (Dojindo) according to the protocol. They were then cultured for 24 hours in DMEM medium containing 10% FBS supplemented with S-lactoyl glutathione (Sigma-Aldrich) to a final concentration of 1 mM. Nuclei were stained with Hoechst 3342 (Dojindo). The fluorescence intensity of autophagosomes per nucleus was calculated using a fluorescence microscope and image analysis software (ImageJ) and calculated as a percentage of the fluorescence intensity in the control group.
[0036] The test results are shown in Table 2. As a result, it was confirmed that the S-lactoyl glutathione of the present invention has an excellent effect of increasing autophagosomes. Therefore, it was confirmed that S-lactoyl glutathione has an autophagy-promoting effect.
[0037] [Table 2] [Industrial Applicability]
[0038] The present invention can be used as an autophagy promoter or a waste product production inhibitor containing S-lactoyl glutathione and / or a salt thereof. It can also be used in cosmetics, foods, quasi-drugs, and pharmaceuticals containing these. Furthermore, it can be used as a method for promoting autophagy or as an autophagy-promoting additive to a culture medium, or as a method for inhibiting waste product production or as an additive to a culture medium for inhibiting waste product production in in vitro cell culture.
Claims
1. An autophagy promoter characterized by containing S-lactoyl glutathione represented by chemical formula (1) and / or a salt thereof. 【Chemical 1】
2. A waste product production inhibitor characterized by containing S-lactoyl glutathione and / or a salt thereof.
Citation Information
Patent Citations
Calcium hydrogen phosphateecalcium carbonate compound structure and the manufacture
JP1978056174A
Cutter holder for turning machine tool
JP1978084285A
Il-37 production enhancers
JP2021070670A
A drug containing s-lactoyl glutathione and / or its salt as an active ingredient
JP2522940B2
New whitening agent
JP2876224B2