Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mrna

Abstract

To solve a current major challenge in exon skipping therapy that efficacy observed in patients is very low.SOLUTION: The present invention relates to a therapeutic antisense oligonucleotide which binds to exon 51 of the human dystrophin pre-mRNA to induce exon skipping, and conjugates and compositions thereof for the treatment of DMD.SELECTED DRAWING: Figure 4

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to UK Patent Application No. 1711809.2 filed on 21 July 2017, the contents of which are incorporated herein by reference. The present invention relates to therapeutic antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA and induce exon skipping, as well as conjugates and compositions thereof. The present invention further relates to methods and uses of antisense oligonucleotides for the treatment of muscle disorders, particularly Duchenne muscular dystrophy. [Background technology]

[0002] Disruption of alternative splicing underlies many diseases, and modulation of splicing using antisense oligonucleotides may have therapeutic implications. Splice-switching antisense oligonucleotides (SSOs) are an emerging treatment for neuromuscular diseases in which antisense-mediated exon skipping can restore the open reading frame and allow the synthesis of a partially or fully functional protein instead of a nonfunctional protein. Several SSOs are currently in clinical trials for conditions such as spinal muscular atrophy (SMA) and Duchenne muscular dystrophy (DMD).

[0003] Duchenne muscular dystrophy (DMD) is one of the most common fatal genetic disorders in boys worldwide, with an incidence of approximately 1 in 3,600–9,337 male births. DMD is caused by the absence of dystrophin protein due to mutations in the dystrophin (DMD) gene. The gene encoding the protein contains 79 exons spanning more than 2 million nucleotides of DNA. Any exon mutation that alters the reading frame of an exon, introduces a stop codon, or is characterized by the out-of-frame removal of one or more exons or duplications of one or more exons altogether, can disrupt the production of functional dystrophin and result in DMD. Becker muscular dystrophy (BMD), a milder form of muscular dystrophy, is typically found to occur when mutations, such as deletions of one or more exons, result in the correct reading frame throughout the dystrophin transcript and prevent premature termination of mRNA translation into protein. If the combination of upstream and downstream exons in the processing of a mutant dystrophin pre-mRNA maintains the correct reading frame of the gene, the result is an mRNA encoding a protein with short internal deletions that retain some activity, resulting in the Becker phenotype. Deletions of one or more exons that do not alter the reading frame of the dystrophin protein will result in a BMD phenotype, whereas deletions of exons that result in a frameshift will result in DMD (Monaco, Bertelson et al. 1988). In general, dystrophin mutations, including point mutations or exon deletions that alter the reading frame and prevent proper protein translation, result in DMD.

[0004] Currently, one of the most promising therapeutic approaches is exon skipping using antisense oligonucleotides (AOs). Exon skipping restores the reading frame by removing the mutated exon and / or its adjacent exons from the DMD pre-mRNA, allowing the production of a truncated but partially functional dystrophin protein. The majority of DMD patients harbor deletion mutations, and 20% of these are suitable for exon 51 skipping. In September 2016, the U.S. Food and Drug Administration (FDA) conditionally approved eteplirsen (Exondis51), the first DMD antisense drug developed to eliminate exon 51 from mutant DMD. Eteplirsen is an antisense oligonucleotide modified with phosphorodiamidate morpholino oligomers (morpholinos or PMOs), a well-established antisense chemistry for its safety and efficacy. However, eteplirsen remains controversial due to weak evidence supporting its efficacy in both restoring dystrophin protein to therapeutically beneficial levels and improving clinical outcomes. The FDA previously rejected another candidate drug for DMD exon 51 skipping, 2'-O-methyl-phosphorothioate-based antisense oligonucleotide drisapersen. While therapeutic drugs must ensure maximum benefit with minimal risk, treatment with drisapersen failed to demonstrate significant improvement in muscle function, raising safety concerns. Thus, despite the fact that significant therapeutic effects have been demonstrated in many animal studies, exon-skipping therapy currently faces a major challenge in that the efficacy observed in patients is very low.

[0005] The efficiency of exon skipping is highly dependent on the AO target sequence. However, there has been little discussion or consideration that the sequences targeted by eteplirsen and drisapersen may not be optimal options for exon skipping therapy. Several groups have conducted large-scale AO screening efforts to computationally and empirically determine effective AO sequences. However, the exon skipping efficacy of designed AOs has not been evaluated both quantitatively and statistically. Restoring dystrophin protein expression is necessary to improve dystrophic muscle function, but previous AO screening studies have not reported the ability of AOs to rescue dystrophin protein expression using adequate quantitative methods. Other studies have relied heavily on RT-PCR from primary DMD muscle cells. It is noteworthy that the AO sequences for eteplirsen and drisapersen have only been determined in this setting. Therefore, the efficacy of exon 51 skipping therapy may be improved by selecting more optimal AO sequences and by conducting more rigorous AO screening using more reliable and direct biological measurements, such as rescued dystrophin protein in DMD, to validate the best antisense oligonucleotides to be advanced in clinical trials.

[0006] It is an aim of one or more aspects of the present invention to address one or more such problems in the art. Summary of the Invention

[0007] According to a first aspect of the present invention, there is provided an antisense oligonucleotide capable of binding to exon 51 of human dystrophin pre-mRNA, wherein binding of the antisense oligonucleotide occurs entirely within the region between 0 and +89 of the pre-mRNA sequence, and the antisense oligonucleotide comprises at least 27 bases. According to a second aspect of the present invention there is provided a conjugate comprising an antisense oligonucleotide according to the first aspect and a carrier, wherein the carrier is conjugated to the antisense oligonucleotide. According to a third aspect of the present invention there is provided a cell loaded with a conjugate of the second aspect. According to a fourth aspect of the present invention there is provided a pharmaceutical composition comprising an antisense oligonucleotide according to the first aspect and / or a conjugate according to the second aspect and a pharmaceutically acceptable excipient.

[0008] According to a fifth aspect of the present invention, there is provided a method of treating a muscle disorder in a subject, comprising administering to the subject an effective amount of an antisense oligonucleotide capable of binding to exon 51 of human dystrophin pre-mRNA, wherein binding of the antisense oligonucleotide occurs entirely within a region between 0 and +89 of the pre-mRNA sequence, and wherein the antisense oligonucleotide comprises at least 27 bases. According to a sixth aspect of the present invention there is provided an antisense oligonucleotide capable of binding to exon 51 of human dystrophin pre-mRNA for use in treating a muscle disorder in a subject, wherein binding of the antisense oligonucleotide occurs entirely within the region between 0 and +89 of the pre-mRNA sequence and the antisense oligonucleotide comprises at least 27 bases. According to a seventh aspect of the present invention, there is provided a method for increasing human dystrophin protein expression in a cell, comprising contacting the cell with an effective amount of an antisense oligonucleotide capable of binding to exon 51 of human dystrophin pre-mRNA, wherein binding of the antisense oligonucleotide occurs entirely within a region between 0 and +89 of the pre-mRNA sequence, and wherein the antisense oligonucleotide comprises at least 27 bases. Specific embodiments of the present invention will now be described with reference to the following figures and tables: [Brief explanation of the drawings]

[0009] [Figure 1] Figure 1 shows in vitro screening of 10 μM antisense oligonucleotides (AOs) and the analogue AOs eteplirsen (aEte) and drisapersen (aDri) in an exon 52-deleted DMD skeletal muscle cell immortalized clone (KM571). Differentiated myotubes were harvested 5 days posttransfection. (A) Efficiency of exon 51 skipping measured by one-step RT-PCR. Representative images are shown. M, 100-bp marker; blank, no RNA template. (B) Efficiency of truncated dystrophin protein induction measured by quantitative Western blotting using an anti-dystrophin C-terminal antibody. Rescued dystrophin protein levels were calculated using a standard curve from healthy 8220 cells. Data represent the mean ± SD of three to four independent experiments. **p<0.01 for aEte, †p<0.05 for aDri, and ††p<0.01 for all AOs in (A) and Ac0 in (B). §§p<0.01 for all AOs in (A) and Ac0 in (B). [Figure 2] Figure 1 shows a time course analysis of dystrophin exon 51 skipping and protein in the exon 52-deleted DMD-KM571 cell line transfected with 5 μM Ac0, Ac48, and the eteplirsen and drisapersen analogs AO. Samples were collected at days 2 and 11 posttransfection. (A) RT-PCR analysis of exon 51 skipping. M, 100 bp marker; R, replicate number; blank, no RNA template. (B) Quantification of induced dystrophin protein by Western blotting using an anti-dystrophin C-terminal antibody. A representative replicate of three independent experiments is shown. [Figure 3]This figure shows the dose-dependent effects of Ac0, Ac48, and the eteplirsen and drisapersen analogs AO in immortalized DMD skeletal muscle cells, as measured by one-step RT-PCR and quantitative Western blotting. DMD skeletal muscle cells were transfected with 1, 3, and 10 μM AO and harvested 5 days posttransfection. (A) and (B) show the exon 51 skipping efficiency and rescued dystrophin protein expression levels in DMD muscle cells (ID KM571) harboring an exon 52 deletion mutation. (C) and (D) show the efficiency of exon 51 skipping and rescue of dystrophin protein expression in DMD muscle cells (ID 6594) harboring an exon 48-50 deletion mutation. Data represent the mean ± SD of 3–7 independent experiments in the KM571 cell line and 3–4 independent experiments in the 6594 cell line. *p<0.05, **p<0.01 vs. aEte; †p<0.05 and ††p<0.01 vs. Ac48; §p<0.05 vs. aDri at the same concentration; §§p<0.01; NS, not significant vs. Ac0 at the next dose; ns, not significant vs. Ac0 at 10 μM. (E) Dose-response to AO analyzed by regression model. The statistical validity of the regression equations for exon skipping and dystrophin protein production was p<0.008 and p<0.014, respectively. Plots show the values ​​of exon skipping or dystrophin protein levels predicted by regression analysis. Regression slopes and 95% confidence intervals (CIs) are shown for each AO. [Figure 4]Immunocytochemistry of immortalized DMD patient-derived skeletal muscle cells containing exon 52 (ID KM571) and exon 48-50 deletion mutations (ID 6594). Cells were stained with an anti-dystrophin C-terminal antibody 5 days after transfection with 10 μM Ac0, Ac48, and the analog eteplirsen (aEte). Gray lines indicate dystrophin-positive myotubes. White dots indicate nuclei counterstained with DAPI. * indicates a representative false-positive myotube due to contraction or detachment from the culture plate. Representative images shown are from three independent experiments. Scale bar: 100 μm. [Figure 5] Figure 1 shows the optimization of Ac0 morpholino antisense oligonucleotide length. Immortalized DMD myocytes were transfected with Ac0 morpholinos consisting of 25-, 26-, 27-, 28-, 29-, and 30-mer lengths. Representative images and quantification of exon 51 skipping induced by 1 μM (A and B) and 3 μM (C and D) Ac0 morpholinos in exon 52-deleted DMD myocytes (KM571) as revealed by RT-PCR are shown. (E-H) show the results for immortalized DMD cells with exons 48-50 deleted. Data are based on three independent experiments. [Figure 6]Figure 1 shows the exon 51 skipping efficiency induced by the analogs AcO, Ac48, eteplirsen (aEte), and drisapersen (aDri) in primary DMD skeletal muscle cells and healthy skeletal muscle cells. Differentiated myotubes were transfected with 10 μM AcO, Ac48, and the analogs eteplirsen and drisapersen and harvested 3 days later. The exon 51 skipping efficiency, as determined by one-step RT-PCR, was shown in primary DMD cells harboring deletion mutations in exons 45-50 (ID 4546) (A and B) or exons 49-50 (ID 4555) (C and D), and in healthy primary muscle cells (E and F). Data represent the mean ± SD from at least triplicate wells for each condition. M, 100-bp marker. *p<0.05 and **p<0.01 versus Ac48, ††p<0.01 versus aEte, §§<0.01 versus aDri. [Figure 7] Figure 1 shows the in vivo efficacy of the 30-mer Ac0 antisense morpholino oligonucleotide in the hDMD / Dmd-null mouse model. Exon skipping efficiency was analyzed by RT-PCR in the tibialis anterior muscle 2 weeks after intramuscular injection of Ac0 morpholino or the analog eteplirsen, aEte (50 μg in 30 μL saline). (A) Densitometry analysis of exon 51 skipping as visualized by a microchip-based capillary electrophoresis system. (B) Average percentage of exon 51 skipping efficiency (mean ± SE). N = 7 in each group. M, marker; NT, untreated muscle; UM, upper marker dye; LM, lower marker dye. [Figure 8]Figure 1 shows the in vivo efficacy of the 30-mer Ac48 antisense morpholino oligonucleotide in the hDMD / Dmd-null mouse model. The efficiency of exon skipping was analyzed by RT-PCR in the tibialis anterior muscle 2 weeks after intramuscular injection of Ac48 morpholino or the analog drisapersen aDri (50 μg in 30 μL saline). Densitometry analysis of exon 51 skipping represented by a microchip-based capillary electrophoresis system. M, marker; NT, untreated muscle; UM, upper marker dye; LM, lower marker dye. DETAILED DESCRIPTION OF THE INVENTION

[0010] The present inventors have developed a series of antisense oligonucleotides that bind within the early region from 0 to +89 of exon 51 of the dystrophin pre-mRNA sequence and are longer than the usual length of at least 27 bases, each with remarkable efficiency and potency. To generate antisense oligonucleotides, we conducted a study to quantitatively evaluate the efficacy of morpholino-based antisense oligonucleotides against exon 51 skipping using a systematic screening method including in silico, in vitro, and in vivo tests. We conducted a combined screening study using computational analysis to predict the exon skipping efficiency of designed antisense oligonucleotide sequences, followed by in vitro testing of morpholino antisense oligonucleotides in immortalized DMD patient-derived muscle cell lines. This study revealed that the beginning of the human dystrophin exon 51 sequence, particularly the region from 0 to +89 of the sequence, is a highly promising target region for inducing exon skipping, which is significantly different from the internal regions targeted by the known eteplirsen and drisapersen antisense therapies.

[0011] Antisense oligonucleotides identified from this region were optimized for the most effective restoration of dystrophin production in muscle cells. Various factors, including the length of the antisense oligonucleotide, were investigated. Surprisingly, the inventors discovered that antisense oligonucleotides binding to this early region were more effective when they were longer than many of the known antisense oligonucleotide sequences for exon 51. Specifically, the inventors identified an upward trend correlating the length of antisense oligonucleotides of 27 bases or more with efficacy. The inventors showed that a difference of just a few bases means that antisense oligonucleotides have significantly different efficiencies. As demonstrated herein, 30-mer antisense oligonucleotides perform up to 1.5 times better than the same 25-mer sequence (42% vs. 65% skipping efficiency). Without wishing to be bound by theory, this may be because longer sequences are more specific to the target sequence and less likely to cause off-target effects.

[0012] It is demonstrated herein that the inventors' optimization of these identified antisense oligonucleotide sequences enabled an increase in the efficiency of exon 51 skipping and dystrophin protein rescue by up to 12-fold and more than 7-fold, respectively, compared to the industry-standard "eteplirsen" sequence. Furthermore, statistically significant in vivo exon 51 skipping by the most effective antisense oligonucleotides identified through these in vitro screens was confirmed using transgenic mice carrying the human DMD gene, a result not previously demonstrated by eteplirsen or drisapersen antisense oligonucleotides. Thus, the antisense oligonucleotides described herein are shown to provide effective therapies and treatments for muscle disorders, particularly DMD. These antisense oligonucleotides not only offer an alternative therapy in a field of medicine where only one such drug has been approved on the market, but also offer an improved option for treatment that is several-fold more effective in increasing dystrophin protein expression. This, along with strong evidence supporting the efficacy of the therapy, is expected to provide a viable treatment option for people suffering from DMD and other muscle disorders. For the avoidance of doubt and to clarify the manner in which the present disclosure is to be interpreted, certain terms used in accordance with the present invention will now be further defined. The present invention includes any combination of the described aspects and features except where such combination is expressly not permitted or explicitly avoided.

[0013] It should be noted that when an embodiment of the present invention refers to a method or use comprising an antisense oligonucleotide, this may also include a conjugate or pharmaceutical composition comprising an antisense oligonucleotide as defined herein. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0014] antisense oligonucleotides The present invention relates to antisense oligonucleotides having a length of at least 27 bases that bind to exon 51 of human dystrophin pre-mRNA within the region 0 to +89, which can be used to treat muscle disorders. Where appropriate, "antisense oligonucleotides" may be referred to herein as "AOs" or "oligos" or "oligomers." Suitably, the antisense oligonucleotide induces skipping of exon 51 of the human dystrophin gene. Suitably, the antisense oligonucleotide increases the skipping of exon 51 of the human dystrophin gene. Suitably, the antisense oligonucleotide allows expression of a functional human dystrophin protein. Suitably, the antisense oligonucleotide increases the expression of functional human dystrophin protein. Suitably, the antisense oligonucleotide comprises at least 28 bases, suitably at least 29 bases, suitably at least 30 bases. Suitably, the antisense oligonucleotide comprises 27 to 30 bases.

[0015] In one embodiment, the antisense oligonucleotide comprises 30 bases. In one embodiment, the antisense oligonucleotide consists of 30 bases. Suitably, binding of the antisense oligonucleotide occurs entirely within the regions between 0 to +88, 0 to +87, 0 to +86, 0 ​​to +85, 0 to +84, 0 to +83, 0 to +82, 0 to +81, 0 to +80, 0 to +79, 0 to +78 of the pre-mRNA sequence. In one embodiment, binding of the antisense oligonucleotide occurs entirely within the region between 0 and +78 of the pre-mRNA sequence.

[0016] Suitably, the antisense oligonucleotide comprises at least 27 bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises at least 28 bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises at least 29 bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises at least 27 consecutive bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises at least 28 consecutive bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises at least 29 consecutive bases of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48).

[0017] Suitably, the antisense oligonucleotide has at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide has between 90% and 100% identity to one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide has at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide has between 90% and 100% homology to one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48).

[0018] Suitably, the antisense oligonucleotide may comprise a variant antisense oligonucleotide that differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases from one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide may comprise a variant antisense oligonucleotide that differs by up to three bases from one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide may comprise a variant antisense oligonucleotide that differs by up to two bases from one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48).

[0019] Suitably, the antisense oligonucleotide may comprise a variant antisense oligonucleotide that differs by one base from one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48).

[0020] Suitably, the antisense oligonucleotide comprises one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide consists of one of the following sequences: SEQ ID NO:1 (Ac0), SEQ ID NO:2 (Ac5), SEQ ID NO:3 (Ac26), SEQ ID NO:4 (Ac30), or SEQ ID NO:5 (Ac48). Suitably, the antisense oligonucleotide comprises SEQ ID NO: 1 (Ac0) or SEQ ID NO: 5 (Ac48). In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 1 (Ac0). Suitably, the antisense oligonucleotide consists of SEQ ID NO: 1 (Ac0) or SEQ ID NO: 5 (Ac48). In one embodiment, the antisense oligonucleotide consists of SEQ ID NO: 1 (Ac0).

[0021] It will be understood that the present invention may further include embodiments directed to each individual antisense oligonucleotide sequence listed in Table 3, i.e., each antisense oligonucleotide comprising or consisting of any of the sequences listed in Table 3. Furthermore, according to a second aspect of the present invention, a conjugate comprising an antisense oligonucleotide listed in Table 3 is contemplated. Furthermore, a pharmaceutical composition according to a fourth aspect of the present invention is contemplated, comprising an antisense oligonucleotide listed in Table 3 or a conjugate thereof. Furthermore, a medical use according to a fifth aspect of the present invention is contemplated, comprising an antisense oligonucleotide listed in Table 3 for the treatment of a muscular disorder. Furthermore, a method of treatment according to a sixth aspect is contemplated, comprising an antisense oligonucleotide listed in Table 3. Furthermore, a method of increasing human dystrophin protein expression in a cell according to a seventh aspect is contemplated, comprising an antisense oligonucleotide listed in Table 3.

[0022] Suitably, the antisense oligonucleotides are synthetic and non-naturally occurring. Suitable, antisense oligonucleotides can be routinely produced by the well-known technique of solid phase synthesis.The equipment for such synthesis is sold by several manufacturers, including, for example, Applied Biosystems (Foster City, California).One method for synthesizing oligonucleotides on modified solid support is described in U.S. Patent No. 4,458,066.Any other means for such synthesis known in the art can additionally or alternatively be used. Suitably, the antisense oligonucleotide is an antisense oligonucleotide analogue. Suitably, the terms "oligonucleotide analogue" and "nucleotide analogue" refer to any modified synthetic analogue of an oligonucleotide or nucleotide, respectively, known in the art. Suitable examples of oligonucleotide analogs include peptide nucleic acids (PNAs), morpholino oligonucleotides, phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, alkylphosphonate oligonucleotides, acylphosphonate oligonucleotides and phosphoramidite oligonucleotides.

[0023] Suitably, the antisense oligonucleotide comprises a morpholino subunit and therefore suitably the antisense oligonucleotide is a morpholino antisense oligonucleotide. Suitably, the antisense oligonucleotide comprises morpholino subunits linked together by phosphorus-containing linkages, and thus suitably is a phosphoramidate or phosphorodiamidate morpholino antisense oligonucleotide.

[0024] The term "morpholino antisense oligonucleotide" or "PMO" (phosphoramidate or phosphorodiamidate morpholino oligonucleotide) refers to an antisense oligonucleotide analog composed of morpholino subunit structures, where (i) the structures are suitably 1 to 3 atoms in length, suitably 2 atoms in length, and suitably uncharged or cationic, and are linked together by phosphorus-containing linkages connecting the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit, and (ii) each morpholino ring contains a purine or pyrimidine base-pairing moiety effective to bind to a base in a polynucleotide by base-specific hydrogen bonding. Suitably, the antisense oligonucleotides contain a phosphorus-containing intersubunit linkage connecting the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit. Suitably, the antisense oligonucleotide comprises a phosphorus-containing intersubunit linkage according to the following structure (I):

[0025] [ka] During the ceremony: Y1 is -O-, -S-, -NH-, or -CH2-; Z is O or S; Pj is a purine or pyrimidine base-pairing moiety effective to bind to a base in a polynucleotide by base-specific hydrogen bonding; and X is fluoro, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted thioalkoxy, amino, optionally substituted alkylamino, or optionally substituted heterocyclyl.

[0026] Variations in the intersubunit linkages may be made as long as they do not interfere with binding or activity. For example, the oxygen attached to the phosphorus may be substituted with sulfur (thiophosphorodiamidate). The 5' oxygen may be substituted with amino or lower alkyl-substituted amino. The pendant nitrogen attached to the phosphorus may be unsubstituted or mono- or di-substituted with (optionally substituted) lower alkyl. Suitably, the synthesis, structure, and binding properties of morpholino oligonucleotides are detailed in U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063, and 5,506,337, and PCT Application No. PCT / US07 / 11435.

[0027] Antisense oligonucleotide binding The present invention relates to an antisense oligonucleotide capable of binding within the region of 0 to +89 of exon 51 of human dystrophin pre-mRNA. By "capable of binding" is meant that the antisense oligonucleotide comprises a sequence that is capable of binding to human dystrophin pre-mRNA at the specified region. Suitably, the antisense oligonucleotide is complementary to a sequence of the human dystrophin pre-mRNA in the designated region. Suitably, the antisense oligonucleotide comprises a sequence complementary to a sequence of the human dystrophin pre-mRNA in the designated region.

[0028] An antisense oligonucleotide and a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other, thereby causing exon skipping, suitably exon skipping of exon 51. Accordingly, "hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity or pairing such that stable and specific binding occurs between the antisense oligonucleotide and a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA. Suitably, the antisense oligonucleotide is hybridizable and / or complementary to a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA sufficiently to induce exon skipping, suitably exon skipping of exon 51.

[0029] Suitably, the antisense oligonucleotide may not be 100% complementary to a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA, however, suitably the antisense oligonucleotide is sufficiently complementary to avoid non-specific binding. Suitably, the antisense oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a sequence within region 0 to +89 of exon 51 of human dystrophin pre-mRNA.

[0030] It is understood that the entire length of an antisense oligonucleotide need not bind to human dystrophin pre-mRNA in order for the antisense oligonucleotide to be able to bind. It is understood that a portion of the antisense oligonucleotide, such as the 5' or 3' end of the antisense oligonucleotide, may not bind to human dystrophin pre-mRNA. However, according to the first aspect, the portion of the antisense oligonucleotide that binds to human dystrophin pre-mRNA must be within the region of exon 51 from 0 to +89. Thus, suitably, the antisense oligonucleotide is capable of hybridising to a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA. Suitably, the antisense oligonucleotide is capable of hybridising to a sequence within the region 0 to +89 of exon 51 of human dystrophin pre-mRNA sufficiently to cause exon skipping of exon 51.

[0031] human dystrophin The present invention relates to therapeutic antisense oligonucleotides for use in the treatment of muscle disorders, particularly dystrophin disorders such as DMD. Dystrophin is a rod-shaped cytoplasmic protein that is an essential part of a protein complex that connects the cytoskeleton of muscle fibers through the cell membrane to the surrounding extracellular matrix. The dystrophin protein contains multiple functional domains. The DMD gene encoding dystrophin is one of the longest known human genes, covering 2.3 megabases (0.08% of the human genome) at locus Xp21. The primary transcript in muscle is approximately 2,100 kilobases long and requires 16 hours to transcribe; the mature mRNA is 14.0 kilobases long. The 79-exon muscle transcript encodes a protein of 3,685 amino acid residues. The dystrophin protein contains an actin-binding domain and a central rod domain. This large central domain is formed by 24 spectrin-like triple-helical elements of approximately 109 amino acids that share homology with alpha-actinin and spectrin. The repeats are typically interrupted by four proline-rich non-repeat segments, also known as hinge regions. Each repeat is encoded by two exons and is typically interrupted by an intron between amino acids 47 and 48 of the first part of alpha helix 2. Another intron is found at various positions within the repeats, usually interspersed on helix 3. Dystrophin also contains a cysteine-rich domain that includes a cysteine-rich segment (i.e., 15 cysteines in 280 amino acids).

[0032] Normally, the amino terminus of dystrophin binds to F-actin, and the carboxy terminus binds to the dystrophin-associated protein complex (DAPC) in the muscle cell membrane. The DAPC contains dystroglycan, sarcoglycan, integrins, and caveolin, and mutations in any of these components cause autosomal inherited muscular dystrophies. Normal skeletal muscle tissue contains only trace amounts of dystrophin (approximately 0.002% of total muscle protein), but its absence (or abnormal expression) leads to the development of severe and currently incurable symptoms, most easily characterized by several abnormal intracellular signaling pathways, ultimately resulting in significant muscle fiber necrosis and progressive muscle weakness and fatigue. In the absence of dystrophin, the DAPC is destabilized, resulting in reduced amounts of its component proteins, which in turn leads to progressive fiber damage and membrane leakage. In various forms of muscular dystrophies, such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), muscle cells produce altered, functionally defective forms of dystrophin or no dystrophin at all, primarily due to mutations in the gene sequence that lead to incorrect splicing. The predominant expression of defective dystrophin protein, or the complete absence of dystrophin or dystrophin-like proteins, leads to the rapid progression of muscle degeneration.

[0033] The mRNA encoding dystrophin in patients with muscular dystrophies usually contains out-of-frame mutations (e.g., deletions, insertions, or splice site mutations) that result in frameshifts or premature termination of the translation process, resulting in the failure of functional dystrophin to be produced in most muscle fibers. Suitably, the antisense oligonucleotide induces exon skipping to restore the reading frame of the dystrophin mRNA. Suitably, the antisense oligonucleotide induces exon skipping of exon 51 to restore the reading frame of the dystrophin mRNA. Suitably, restoration of the reading frame restores the production of a partially functional dystrophin protein. Suitably, the partially functional dystrophin is a truncated dystrophin protein. Suitably, the truncated dystrophin protein is the same dystrophin protein that is produced in patients suffering from a less severe form of muscle disorder; BMD.

[0034] Muscle disorders The present invention relates to the use of therapeutic antisense oligonucleotides in the treatment of muscle disorders. Suitably, the muscle disorder is selected from any muscle disorder resulting from a genetic mutation. Suitably, the muscle disorder is selected from any muscle disorder resulting from a genetic mutation in a gene associated with muscle function. Suitably, the muscle disorder is selected from any muscle disorder resulting from a genetic mutation in the human dystrophin gene. Suitably, the muscle disorder is selected from any muscular dystrophic disorder. Suitably, the muscle disorder is selected from Duchenne muscular dystrophy, Becker muscular dystrophy, congenital muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic muscular dystrophy, and oculopharyngeal muscular dystrophy. Suitably, the muscle disorder is Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD). In one embodiment, the myopathy is DMD.

[0035] Carriers and Conjugates The present invention also relates to a conjugate of an antisense oligonucleotide and a carrier. Suitably, the carrier may comprise any molecule operable to transport the antisense oligonucleotide to a target cell, suitably a muscle cell. Suitable carriers may include peptides, small molecule chemicals, polymers, nanoparticles, lipids, liposomes, exosomes, and the like. Suitably, the carrier is a peptide, which may be selected from, for example, a viral protein such as VP22 (derived from herpesvirus tegument protein), a snake venom protein such as CyLOP-1 (derived from crotamine), a cell adhesion glycoprotein such as pVEC (derived from mouse vascular endothelial cadherin protein), penetratin (antennapedia homeodomain), Tat (transactivating regulatory protein of human immunodeficiency virus) or reverse Tat. Suitably the peptide is a cell penetrating peptide. Suitably the peptide is an arginine-rich cell-penetrating peptide.

[0036] The use of arginine-rich peptide carriers is particularly useful. Certain arginine-based peptide carriers have been shown to be highly effective in delivering antisense compounds to primary cells, including muscle cells (Marshall, Oda et al. 2007; Jearawiriyapaisarn, Moulton et al. 2008; Wu, Moulton et al. 2008). Furthermore, arginine peptide carriers, when conjugated to antisense oligonucleotides, exhibit enhanced ability to alter the splicing of some gene transcripts compared to other peptides (Marshall, Oda et al. 2007). Suitably, the arginine-rich cell-penetrating peptide may be selected from the carrier peptides described in, for example, WO2015075747, WO2013030569, WO2009147368, US20120289457, or US20160237426. In one embodiment, the arginine-rich cell-penetrating peptide is selected from those described in WO2013030569 or WO2009147368. Suitably, the carrier is capable of inducing cellular penetration of the antisense oligonucleotide within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the cells in a given cell culture population. Suitably, the carrier is capable of inducing cellular penetration of the antisense oligonucleotide within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the muscle cells in a muscle cell culture.

[0037] Suitably, the conjugation of carrier with antisense oligonucleotide can be at any suitable position for forming covalent bond between carrier and antisense oligonucleotide or between linker moiety and antisense oligonucleotide.For example, the conjugation of carrier can be at the 3' end of antisense oligonucleotide.Alternatively, the conjugation of carrier to antisense oligonucleotide can be at the 5' end of oligonucleotide.Alternatively, carrier can be conjugated to antisense oligonucleotide via any intersubunit bond.

[0038] Suitably, the carrier is covalently attached to the 3' or 5' end of the antisense oligonucleotide at its N-terminal or C-terminal residue. Suitably, the carrier is attached at its C-terminal residue to the 5' end of the antisense oligonucleotide. When the antisense oligonucleotide contains a phosphorus-containing intersubunit linkage and the carrier is a peptide, the peptide may optionally be conjugated to the antisense oligonucleotide via a covalent bond to the phosphorus of the terminal linking group. Alternatively, when the carrier is a peptide and the antisense oligonucleotide is a morpholino, the peptide may be conjugated to the nitrogen atom of the 3' terminal morpholino group of the oligomer.

[0039] The carrier may optionally be conjugated to the antisense oligonucleotide via a linker moiety, which may optionally include one or more of an optionally substituted piperazinyl moiety, beta-alanine, glycine, proline, and / or 6-aminohexanoic acid residues, in any combination. Alternatively, the carrier may be directly conjugated to the antisense oligonucleotide without a linker moiety. Suitably, the conjugate may further comprise a homing moiety. Suitably, the homing moiety is selective for a selected mammalian tissue, i.e., the same tissue targeted by the antisense oligonucleotide. Suitably, the homing moiety is selective for muscle tissue. Suitably, the homing moiety is a homing peptide.

[0040] Suitable homing peptides are disclosed, for example, in "Effective Dystrophin Restoration by a Novel Muscle-Homing Peptide-Morpholino Conjugate in Dystrophin-Deficient mdx Mice," Gao et al. Mol Ther. 2014 Jul; 22(7): 1333-1341. Suitably, the carrier peptide and the homing peptide may be formed as a chimeric fusion protein. Suitably, the conjugate may comprise a chimeric peptide formed from a cell-penetrating peptide and a muscle-specific homing peptide. The conjugate may optionally be in the form of carrier peptide-homing peptide-antisense oligonucleotide, or homing peptide-carrier peptide-antisense oligonucleotide. Suitably, the antisense oligonucleotide may be conjugated to a carrier that enhances the solubility of the antisense oligonucleotide. Suitably, it is soluble in aqueous media. Suitably, in addition to the carrier that can transport the antisense oligonucleotide, a carrier that enhances solubility may be conjugated to the antisense oligonucleotide. Suitably, the carrier that enhances solubility and the carrier that transports the antisense oligonucleotide may be formed as a chimeric fusion protein. Suitable carriers which increase the solubility of antisense oligonucleotides are polymers such as polyethylene glycol or triethylene glycol.

[0041] pharmaceutically acceptable excipients The present invention further relates to pharmaceutical compositions comprising the antisense oligonucleotides of the present invention or conjugates thereof, and further comprising one or more pharmaceutically acceptable excipients. Suitably, pharmaceutical compositions are prepared using pharmaceutically inert inorganic and / or organic excipients by methods known in the art (such as those described in Remingtons Pharmaceutical Sciences, Mack Publ. Co., Easton, PA (1985)). The term "pharmaceutically acceptable" refers to molecules and compositions that are physiologically tolerated and that typically do not produce allergic or similar adverse reactions when administered to a patient. Suitably, the pharmaceutical compositions may be formulated as pills, tablets, coated tablets, hard gelatin capsules, soft gelatin capsules and / or suppositories, liquids and / or syrups, injectable solutions, microcapsules, implants and / or rods, etc. In one embodiment, the pharmaceutical composition may be formulated as an injectable solution. Suitably, pharmaceutically acceptable excipients for preparing pills, tablets, coated tablets, and hard gelatin capsules may be selected from any of lactose, corn starch and / or its derivatives, talc, stearic acid and / or its salts, etc.

[0042] Suitably, pharmaceutically acceptable excipients for preparing soft gelatin capsules and / or suppositories may be selected from fats, waxes, semi-solid and liquid polyols, natural and / or hardened oils, and the like. Suitably, pharmaceutically acceptable excipients for preparing solutions and / or syrups may be selected from water, sucrose, invert sugar, glucose, polyols, and the like. Suitably, pharmaceutically acceptable excipients for preparing injections may be selected from water, physiological saline, alcohol, glycerol, polyols, vegetable oils, and the like. Suitably, the pharmaceutically acceptable excipients for preparing the microcapsules, implants and / or rods may be selected from mixed polymers such as glycolic acid and lactic acid. Additionally, the pharmaceutical composition may contain liposome formulations as described by N. Weiner (Drug Develop Ind Pharm 15 (1989) 1523), "Liposome Dermatics" (Springer Verlag 1992), and Hayashi (Gene Therapy 3 (1996) 878).

[0043] The pharmaceutical composition may optionally contain two or more different antisense oligonucleotides or conjugates thereof. The pharmaceutical composition may optionally further contain one or more antisense oligonucleotides or conjugates thereof that target different exons, suitably different exons of human dystrophin pre-mRNA. One or more additional antisense oligonucleotides or conjugates thereof may optionally target an exon adjacent to exon 51, for example, exon 50 or exon 52 of human dystrophin pre-mRNA. Suitably, one or more antisense oligonucleotides or conjugates thereof that target different exons of human dystrophin pre-mRNA, together with the antisense oligonucleotide of the present invention, can act to restore the reading frame of dystrophin mRNA.

[0044] Optionally, pharmaceutical composition can further comprise one or more antisense oligonucleotides or their conjugates that target different genes.For example, one or more additional antisense oligonucleotides or their conjugates can target myostatin.This type of dual targeting is described in "Dual exon skipping in myostatin and dystrophin for Duchenne muscular dystrophy" Kemaladewi et al. BMC Med Genomics.2011 Apr 20;4:36. One or more further antisense oligonucleotides may optionally be linked together and / or attached to the antisense oligonucleotide of the first aspect.

[0045] The antisense oligonucleotide and / or conjugate may optionally be present in the pharmaceutical composition as a physiologically acceptable salt. Suitably, the physiologically acceptable salt retains the desired biological activity of the antisense oligonucleotide and / or its conjugate and does not impart undesired toxicological effects. In the case of antisense oligonucleotides, suitable examples of pharmaceutically acceptable salts include: (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, and the like, and polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with organic acids, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0046] The pharmaceutical compositions may optionally contain, in addition to at least one antisense oligonucleotide and / or conjugate, one or more different therapeutically active ingredients, which may be selected from, for example, corticosteroids, utrophin upregulators, TGF-beta inhibitors, and myostatin inhibitors. In addition to the active ingredient and excipient, the pharmaceutical composition may suitably contain additives such as fillers, extenders, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, preservatives, sweeteners, dyes, flavors or fragrances, thickeners, diluents or buffer substances, etc., as well as solvents and / or solubilizers and / or agents for achieving a sustained-release effect, and salts for changing osmotic pressure, coating agents and / or antioxidants. Suitable additives may include Tris-HCl, acetate salts, phosphate salts, Tween 80, polysorbate 80, ascorbic acid, sodium metabisulfite, thimersol, benzyl alcohol, lactose, mannitol, etc.

[0047] Administration The present invention relates to therapeutic antisense oligonucleotides and pharmaceutical compositions comprising therapeutic antisense oligonucleotides for administration to a subject. Suitably, the antisense oligonucleotides and / or pharmaceutical compositions may be for topical, enteral or parenteral administration. Suitably, the antisense oligonucleotides and / or pharmaceutical compositions may be for administration orally, transdermally, intravenously, intrathecally, intramuscularly, subcutaneously, intranasally, transmucosally, and the like. In one embodiment, the antisense oligonucleotide and / or pharmaceutical composition is for intramuscular administration. In one embodiment, the antisense oligonucleotide and / or pharmaceutical composition is for intramuscular administration by injection.

[0048] An "effective amount" or "therapeutically effective amount" refers to the amount of an antisense oligonucleotide administered to a subject, either in a single dose or as part of a series, effective to produce a desired physiological response or therapeutic effect in the subject. Suitably, the desired physiological response comprises increased expression of a relatively functional or biologically active form of dystrophin protein in muscle tissue or muscle cells that suitably contain defective or non-dystrophin-containing dystrophin protein. Suitably, the desired therapeutic effect includes amelioration of myopathic symptoms or conditions, attenuation of the progression of myopathic symptoms or conditions, and delay in the onset of myopathic symptoms or conditions. Examples of such symptoms include fatigue, mental retardation, muscle weakness, impaired motor skills (e.g., running, hopping, jumping), frequent falls, and difficulty walking. Suitably, the antisense oligonucleotide or conjugate thereof is administered at a dose ranging from about 0.0001 to about 100 mg per kilogram of body weight per day.

[0049] Suitably, the antisense oligonucleotide or conjugate thereof is administered daily, once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months. Suitably, the dosage and frequency of administration can be determined by a physician as necessary to maintain the desired expression of functional dystrophin protein. Suitably, the antisense oligonucleotide or conjugate thereof may be administered as two, three, four, five, six or more sub-doses separately at appropriate intervals throughout the day, optionally in unit dosage forms.

[0050] subject The present invention also relates to the treatment of muscle disorders by administering a therapeutically effective amount of an antisense oligonucleotide or a conjugate thereof to a subject in need thereof. Suitably, the subject has a myopathic disorder as defined above. Suitably, the subject is a mammal. Suitably, the subject is a human. Suitably, the subject may be male or female, however, suitably, the subject is male. Suitably, the subject is of any age, however, suitably, the subject is between 1 month and 50 years old, suitably between 1 and 30 years old, suitably between 2 and 27 years old, suitably between 4 and 25 years old.

[0051] Exon skipping and increased dystrophin expression The present invention relates to therapeutic antisense oligonucleotides for use in the treatment of muscle disorders by inducing exon skipping in human dystrophin pre-mRNA to restore functional dystrophin protein expression. Suitably, a "functional" dystrophin protein refers to a dystrophin protein that has sufficient biological activity to reduce the progressive degradation of muscle tissue otherwise characteristic of muscular dystrophy, when compared to a defective form of dystrophin protein present in a subject with a muscle disorder such as DMD. Suitably, a functional dystrophin protein may have about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the in vitro or in vivo biological activity of wild-type dystrophin. Suitably, a functional dystrophin protein has at least 10% to 20% of the in vitro or in vivo biological activity of wild-type dystrophin. Suitably, dystrophin activity in in vitro muscle cultures can be measured according to myotube size, myofibril organization, contractile activity, and spontaneous clustering of acetylcholine receptors (see, e.g., Brown et al., Journal of Cell Science. 112:209-216, 1999).

[0052] Animal models are also valuable resources for studying disease pathogenesis and provide a means to test dystrophin-related activities. The two most widely used animal models for DMD research are the mdx mouse and the Golden Retriever Muscular Dystrophy (GRMD) dog, both of which are dystrophin-negative (see, e.g., Collins & Morgan, Int J Exp Pathol 84: 165-172, 2003). Using these and other animal models, the functional activities of various dystrophin proteins can be measured. Suitably, "exon skipping" refers to the process by which an entire exon, or part of an exon, is removed from a given unprocessed RNA (pre-mRNA) and thereby excluded from the mature RNA that is translated into protein. Suitably, the part of the protein that would otherwise be encoded by the skipped exon is not present in the expressed form of the protein.

[0053] Suitably, exon skipping therefore creates a truncated but still functional protein as defined above. Suitably, the exon to be skipped is an exon of the human dystrophin gene that may contain a mutation or other change in its sequence that would cause aberrant splicing in other circumstances. Suitably, the exon skipped is exon 51 of the dystrophin gene. Suitably, the antisense oligonucleotide is operable to induce exon skipping of the dystrophin pre-mRNA. Suitably, the antisense oligonucleotide is operable to induce exon skipping of exon 51 in the dystrophin pre-mRNA. Suitably, the antisense oligonucleotide is operable to increase the expression of a functional form of dystrophin protein in muscle tissue and is operable to increase muscle function in muscle tissue.

[0054] Suitably, the antisense oligonucleotide is operable to increase muscle function by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to muscle function in a subject with a muscle disorder such as DMD who is not administered the antisense oligonucleotide. Suitably, the antisense oligonucleotide is operable to result in at least about a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% increase in the proportion of muscle fibers expressing functional dystrophin protein compared to a subject with a muscle disorder such as DMD who is not administered the antisense oligonucleotide.

[0055] Suitably, the antisense oligonucleotide is operable to induce expression of a functional form of dystrophin protein to a level that is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 25, 40, 45, or 50% of the expression of dystrophin protein in a wild-type cell and / or subject. Suitably, the antisense oligonucleotide is operable to induce expression of a functional form of dystrophin protein to a level that is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20% of the expression of dystrophin protein in a wild-type cell and / or subject. Suitably, the antisense oligonucleotide is operable to induce expression of a functional form of dystrophin protein to a level that is at least 10, 15, or 20% of the expression of dystrophin protein in a wild-type cell and / or subject. Suitably, the antisense oligonucleotide is operable to induce skipping of exon 51 in dystrophin pre-mRNA to a level of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

[0056] Suitably, the antisense oligonucleotide is operable to induce skipping of exon 51 in the dystrophin pre-mRNA to a level of at least 60%, 70%, 80%, 90%, or 100%. Suitably, the antisense oligonucleotide is operable to induce exon 51 skipping of dystrophin pre-mRNA to a level of 60% to 80%. An "increased" or "enhanced" amount can include a 1.1, 1.2, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50-fold or greater increase over the amount produced when no antisense oligonucleotide compound (absence of drug) or a control compound is administered under the same circumstances. Suitably, the amount of "increase" or "enhancement" is a statistically significant amount.

[0057] Throughout this description and the claims, the words "comprise" and "contain" and variations thereof mean "including, but not limited to," and are not intended to exclude (and do not exclude) other moieties, additives, ingredients, integers, or steps. Throughout this description and the claims, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, the specification should be understood to contemplate both the plural and the singular unless the context requires otherwise.

[0058] It should be understood that any feature, integer, property, compound, chemical moiety, or chemical group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless inconsistent therewith. All features disclosed herein (including the accompanying claims, abstract, and drawings), and / or all steps of any method or process so disclosed, may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive. The invention is not limited to the details of the foregoing embodiments. The invention extends to any novel or any novel combination of features disclosed in this specification (including the accompanying claims, abstract and drawings), or any novel or any novel combination of method or process steps so disclosed. The reader's attention is directed to all articles and documents related to this application that are filed contemporaneously or previously hereto and that are open to public inspection herewith, and the contents of all such articles and documents are incorporated herein by reference. [Example]

[0059] 1. Materials and Methods 1.1 AO design and in silico screening. Using a recently developed AO prediction algorithm, we designed and analyzed 413 30-mer and 25-mer AOs targeting exon 51 (see Table 3). Table 3 lists, from left to right, the exon number, distance from the acceptor splice site, AO sequence (5' to 3'), predicted skipping percentage, and ranking within the screen. The AOs on the left are 30-mers, and the AOs on the right are 25-mers. Based on their predicted exon skipping efficiency, eight AOs separated by at least four bases were selected for in vitro screening (Table 2). The target sequence specificity of the selected AOs, eteplirsen and drisapersen, was analyzed using the University of California, Santa Cruz genome browser (http: / / genome.ucsc.edu / index.html), confirming that the AO sequences theoretically do not bind to non-target RNA sequences with 100% identity.

[0060] 1.2 Antisense morpholinos. All antisense sequences, including eteplirsen and the drisapersen analog AO, were synthesized by Gene Tools (Philomas, OR) using morpholino chemistry.

[0061] 1.3 Cells. Immortalized human skeletal muscle cells derived from three healthy subjects (ID 8220, CHQ, and KM155) and two DMD patients with deletion mutations in exon 52 (ID KM571) and exons 48–50 (ID 6594) of the DMD gene, respectively, were generated by transduction with human telomerase expression vectors and cyclin-dependent kinase 4 expression vectors from the Institute of Myology Human Cell Immortalization Platform, as previously described. Three immortalized healthy muscle cell lines were characterized, and clonal line 8220, which showed the highest dystrophin expression, was selected as a positive control to prevent overestimation of rescued dystrophin expression in the immortalized DMD cells. Primary skeletal muscle cells derived from DMD patients with deletion mutations in exons 45–50 (ID 4546) and exons 49–50 (ID 4555) and healthy subjects were prepared by biobanks of skeletal muscle, neural tissue, DNA, and cell lines.

[0062] 1.4 Transfection of AO. To mimic the in vivo effects of AO-mediated exon skipping therapy as closely as possible, mature differentiated myotubes expressing sufficient levels of DMD mRNA were used for in vitro screening. Cells were cultured under growth conditions in growth medium (GM): DMEM / F12 containing skeletal muscle supplement mix (Promocell, Heidelberg, Germany), 20% fetal bovine serum (Life Technologies, Waltham, MA), and antibiotics (50 units penicillin and 50 μg / ml streptomycin, Life Technologies, Waltham, MA). Immortalized and primary DMD skeletal muscle cells were plated at 1.7 x 10 cells per well onto 12- or 24-well culture plates coated with type I collagen. 4 / cm 2 and 2.2x10 4 / cm 2Two days after seeding, at approximately 80-90% confluence, GM was replaced with differentiation medium (DM): DMEM / F12 containing 2% horse serum (GE Healthcare, Chicago, IL), 1x ITS solution (Sigma, St. Louis, MO), and antibiotics. After 3 days in DM, cells were transfected with 1, 3, 5, or 10 μM AO containing 6 μM Endo-porter transfection reagent (Gene Tools, Philomath, OR) (1 mM concentrated AO was incubated at 65°C for 10 min immediately before dilution in DM). Two days after AO transfection, AO-containing DM was replaced with regular DM. Cells were harvested on days 2, 5, or 11 after AO transfection (days 5, 8, or 14 after differentiation).

[0063] 1.5 Mouse. Animal studies were approved by the Animal Care and Use Committees of the University of Alberta, Children's National Medical Center, and the National Center for Neuropsychiatry (NCNP). Male and female Dmd exon 52 deletion mdx5242 and wild-type mice (Jackson Laboratory, Bar Harbor, Maine) on a C57BL / 6J background were prepared at 4–8 weeks of age. The Dmd mutation in affected mice was confirmed by PCR genotyping. A transgenic mouse model containing the human DMD gene but not the mouse Dmd gene (hDMD / Dmd-null mice) was generated by crossing male hDMD mice (Jackson Laboratory, Bar Harbor, Maine) with female Dmd-null mice.

[0064] 1.6 Intramuscular injection. Five or 20 μg of the mouse morpholinos Ac0, Ac48, eteplirsen, or drisapersen in 40 μL of saline were injected intramuscularly into the tibialis anterior (TA) muscle under isoflurane inhalation anesthesia as previously described. 50 μg of Ac0 morpholino and the analog eteplirsen in 30 μL of saline were injected into the TA muscle of hDMD / Dmd-null mice. All muscle samples were collected 2 weeks after intramuscular injection.

[0065] 1.7 Analysis of exon skipping by RT-PCR. Total RNA was extracted using Trizol (Invitrogen, Waltham, MA) as previously described. RT-PCR to detect dystrophin mRNA was performed on 200 ng and 320 ng of total RNA in immortalized and primary skeletal muscle cells, respectively, using the SuperScript III One-Step RT-PCR System (Invitrogen, Waltham, MA) and 0.2 μM forward and reverse primers (see Table 1). Primers were designed using Primer3Plus software, and their specificity was confirmed in healthy human skeletal muscle cells (strain 8220). RT-PCR conditions were as follows: 50°C for 5 min; 94°C for 2 min; 35 cycles of 94°C for 15 s, 60°C for 30 s, and 68°C for 35 s; and 68°C for 5 min. PCR products were separated on a 1.5% agarose gel and visualized with SYBR Safe DNA Gel Stain (Invitrogen, Waltham, MA). The efficiency of exon 51 skipping was calculated using ImageJ software (NIH) or the MCE-202 MultiNA system (Shimadzu, Kyoto, Japan) using the following formula: [Formula 1] An unknown top band above the native band, possibly due to an unexpected splicing event, was excluded from the quantification of skipping efficiency. The sequence of the PCR product was confirmed with Big Dye Terminator v3.1 (Applied Biosystems, Waltham, MA). GAPDH or 18S ribosomal RNA was used as an internal control.

[0066] [Table 1]

[0067] 1.8 Western blotting Cells were harvested using RIPA buffer (Thermo Scientific, Waltham, MA) containing cOmplete, Mini, EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland) and then homogenized by passing the cells through a 21-gauge needle 10 times. The supernatant was prepared as a loading sample by centrifugation at 14,000 g for 15 min at 4°C. Protein from muscle tissue was prepared as previously described. Protein concentration was adjusted using the Bradford assay by diluting the supernatant 100-fold with distilled water. Proteins were heated at 70°C for 10 min in sample buffer containing 10% SDS, 70 mM Tris-HCl, pH 6.8, 5 mM EDTA, 20% glycerol, 0.004% bromophenol blue, and 5% 2-mercaptoethanol. Western blotting was then performed as previously described. Twelve and 30 μg of cells and tissue samples, respectively, were used for sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Blots were incubated with a rabbit polyclonal antibody against the dystrophin C-terminus (1:2500, ab15278, Abcam, Cambridge, UK) or a DYS1 antibody against the dystrophin rod domain (1:400, Leica Biosystems, Buffalo Grove, IL) in blocking solution for 1 hour at room temperature. Primary antibodies were reacted with HRP-conjugated anti-rabbit or mouse IgG H+L antibody (1:10,000, Bio-Rad, Hercules, CA). AO-induced dystrophin protein expression levels were quantified using ImageJ (NIH) using a standard curve (R2 = 0.93–0.99) of dystrophin protein from untreated DMD cells or healthy 8220 skeletal muscle cells diluted with wild-type mouse protein. α-Tubulin was detected on the same membrane as a loading control. As a loading control / differentiation marker, myosin heavy chain (MyHC) on the post-transfer gel was stained with Coomassie brilliant blue (Bio-Rad, Hercules, CA).

[0068] 1.9 Immunocytochemistry. Cells were fixed with 4% paraformaldehyde for 5 minutes at room temperature. After washing with 0.01% Triton X-100 in PBS, cells were blocked with 10% goat serum (Life Technologies, Waltham, MA) in 0.05% Triton X-100 in PBS for 20 minutes and then incubated overnight at 4°C with anti-dystrophin C-terminus (ab15278) or rod domain (DYS1) antibodies diluted 1:50 in blocking solution. Dystrophin signals were detected with Alexa 488- or 594-conjugated secondary antibodies (1:500). Desmin (1:80, Abcam, Cambridge, UK) and fast-twitch MyHC (1:30, Leica Biosystems, Buffalo Grove, IL) were detected to confirm myogenic differentiation of the cells. Cells were stored in SlowFade Gold Antifade Mountant with DAPI (Invitrogen, Waltham, MA) at 4°C until analysis.

[0069] 1.10 Immunohistochemistry. Dystrophin-positive myofibers were detected in frozen sections of TA muscle from untreated and treated mdx52 mice using the ab15278 antibody as previously described. The dystrophin signal intensity in treated mice was compared with that in wild-type mice using a neutral density filter (Eclipse TE 2000-U, Nikon, Tokyo, Japan).

[0070] 1.11 Statistical Analysis. To determine the efficiency of exon skipping and the significance of dystrophin protein rescue, data sets were prepared from at least three independent experiments in immortalized cells, triplicate wells in primary cells, and three to seven mice. Statistical analysis between AO treatment groups was performed by one-way ANOVA followed by a post hoc Tukey-Kramer multiple comparison test. Simple regression analysis was performed to determine the dose-response to AO. Statistical significance was set at p<0.05 for all analyses.

[0071] 2. Results 2.1 In silico screening of AO for exon 51 skipping. We designed 204 and 209 AOs, 30-mer and 25-mer in length, respectively, covering all possible target sites in DMD exon 51, for a total of 413 AOs (see Table 3). Our exon skipping efficiency algorithm ("In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy," Echigoya et al., PLOS ONE, March 2015) predicted that the highest efficiency of exon 51 skipping at the first 5' site of exon 51 was 80.5% for 30-mer AOs and 41.2% for 25-mer AOs. In silico screening showed that the exon skipping efficiency of the 30-base region targeted by eteplirsen was very low (23.7%), ranking 92nd among all 413 AO candidates tested. It is noted that the target site of drisapersen is completely encompassed by that of the 30-mer eteplirsen.

[0072] 2.2 Characterization of immortalized clones of healthy and DMD skeletal muscle cell lines. Key challenges in preclinical studies using primary DMD muscle cells include low muscle cell purity and insufficient amounts of mutant dystrophin mRNA, which pose problems when attempting to test the efficacy of AO. To overcome these hurdles, we generated immortalized clones of skeletal muscle cells from three healthy subjects and two DMD patients with exon 52 (ex52) and ex48-50 deletion (del) mutations (IDs KM571 and 6594, respectively). All immortalized skeletal muscle cell lines tested expressed readily detectable dystrophin mRNA from day 3 after differentiation induction. To avoid overestimating the dystrophin protein levels induced by AO in DMD cells, we selected the cell line (ID 8220) containing the highest level of dystrophin protein among three immortalized healthy skeletal muscle cell lines determined by Western blotting to serve as a positive control. Dystrophin protein expression in the 8220 cell line was also confirmed by immunocytochemistry.

[0073] 2.3 In vitro screening of exon 51 skipping AO. Based on the results of the in silico screening, we selected eight 30-mer AOs containing both high- and low-ranked sequences separated by at least four bases for in vitro screening (Table 2). In this study, all tested AOs, including those of eteplirsen and drisapersen, were synthesized using morpholino chemistry, which has been demonstrated to be well tolerated in patients enrolled in clinical trials. Here, we named control morpholino oligonucleotides (generated by Gene Tools) with the same sequences as eteplirsen and drisapersen "analog eteplirsen" and "analog drisapersen." In RT-PCR, five of our morpholino AOs (Ac0, Ac5, Ac26, Ac30, and Ac48) at 10 μM showed significantly higher skipping efficiency than analog eteplirsen and drisapersen in immortalized DMD skeletal muscle cells carrying ex52del (Figure 1A). Among the AOs tested, Ac0 in particular had the highest skipping efficiency, reaching 72%, which was 4-fold and 25-fold higher than the eteplirsen and drisapersen analogs, respectively. Western blotting revealed that Ac0 also induced the highest levels of dystrophin protein, reaching 16% of the level of healthy control cell lines, followed by Ac48 at 13% (Figure 1B). Interestingly, the two AOs with the highest skipping efficiency during testing, Ac0 and Ac48, were not the ones predicted to be the best by the algorithm.

[0074] [Table 2]

[0075] 2.4 Time course analysis using Ac0, Ac48, and the eteplirsen and drisapersen analogues AO. The sustained effects of 5 μM Ac0, Ac48, and the eteplirsen and drisapersen analogs were examined in ex52del.KM571 cells. The superiority of the oligonucleotides Ac0 and Ac48 of the present invention in terms of exon skipping efficiency and dystrophin protein rescue was observed at days 2 and 11 posttransfection compared to the eteplirsen and drisapersen analog AO (Figure 2).

[0076] 2.5 Dose-dependent effects of Ac0, Ac48, and analogs eteplirsen and drisapersen. RT-PCR showed that at the highest concentration of 10 μM, Ac0 induced exon 51 skipping in DMD KM571 (ex52del) and 6594 cells (ex48-50del), up to 74% and 64%, respectively, significantly higher than the analogs eteplirsen and drisapersen (Figure 3). At the lowest concentration (1 μM), Ac0 demonstrated 12-fold and 10-fold higher exon skipping efficiency in KM571 and 6594 cells compared with the analog eteplirsen, respectively. Interestingly, even at a concentration of 1 μM, Ac0 induced higher levels of exon 51 skipping than the analog eteplirsen at 10 μM (24% and 15% efficiency in KM571 and 24% and 21% efficiency in 6594, respectively). Quantitative Western blotting revealed that 10 μM Ac0 rescued dystrophin protein expression in DMD cell lines to 21% of the normal cell line level (Figure 3A-D). Even at 1 μM, the relative ratio of Ac0 to the analog eteplirsen demonstrated 7.1-fold and 3.3-fold higher dystrophin protein production efficiency in KM571 and 6594 cell lines, respectively. 1 μM Ac0 enabled rescued dystrophin protein production at levels higher or equivalent to 10 μM analog eteplirsen (10% and 6% in KM571, and 11% and 10% in 6594, respectively), confirming that Ac0 is more than 10-fold more effective in dystrophin protein production than the analog eteplirsen in terms of concentration. The analog drisapersen did not effectively inhibit either exon skipping or dystrophin production in DMD muscle cell lines. The exon skipping responses to Ac0 and Ac48 were greater than those of the analogs eteplirsen and drisapersen and occurred in a dose-dependent manner (Fig. 3A and C). Furthermore, the dose-response of Ac0 on dystrophin protein production was higher than that of the control analogs in both DMD cell lines (Fig. 3E).

[0077] 2.6 Immunocytochemical evaluation of dystrophin protein rescue. Immunocytochemistry revealed that 10 μM Ac0 and Ac48 produced more dystrophin-positive myotubes and showed stronger signal intensity compared to the analog eteplirsen in DMD skeletal muscle cell lines harboring the ex52 and ex48-50del mutations (Figure 4).

[0078] 2.7 Optimization of Ac0 morpholino length. In silico and in vitro screening revealed that the first 5' region of exon 51, located between 0 and +89, is a critical region affecting exon 51 skipping. To optimize the length of Ac0 targeting this region, we systematically removed nucleotides one by one at the 5' site and compared the skipping efficiency of Ac0 morpholinos of different lengths (25- to 30-mer) (see Table 2). In vitro testing in immortalized DMD myocytes treated with 1 μM of these AOs showed that 25- to 30-mer Ac0 morpholinos resulted in efficient exon skipping (>20%) (Figure 5), an effect not observed with the analogs eteplirsen and drisapersen at the same dose (Figure 3). However, increasing the length of the AO improved the efficiency of exon skipping. Statistically significant efficacy of the 30-mer Ac0 was confirmed at doses of 1 and 3 μM in both cell lines compared to the shorter Ac0 morpholino, even against AOs that were only one or two bases shorter.

[0079] 2.8 Effects of Ac0, Ac48, and the analogs eteplirsen and drisapersen on primary DMD patient-derived skeletal muscle cells. We also tested AO in primary DMD skeletal muscle cells harboring exon 45-50 (ID 4546) or exon 49-50 del mutations (ID 4555) to verify whether the superior efficacy of the 30-mer Ac0 was consistent across other muscle cell types and deletion mutation patterns. RT-PCR demonstrated that Ac0 achieved significantly higher exon skipping efficiency compared with the analogs eteplirsen and drisapersen in both primary DMD muscle cells (Figure 6A-D): up to 5-fold and 7-fold higher efficiencies were observed compared with the analogs eteplirsen and drisapersen, respectively. The remarkable efficiency of Ac0-mediated exon 51 skipping was also confirmed in primary healthy skeletal muscle cells (Figure 6E and F). Interestingly, concomitant with increased exon 51 skipping efficiency, spontaneous skipping of exon 52 without perturbing the reading frame was observed in primary healthy and DMD myocytes, as well as in the immortalized ex48-50del (6594) DMD myocyte cell line.

[0080] 2.10 In vivo efficacy of Ac0 morpholino and analog eteplirsen in hDMD / Dmd-null mice. A major hurdle in the development of exon-skipping therapies is the inability to always test human-specific AOs in appropriate animal models. This limits the evaluation of the in vivo efficacy of AOs designed for patients. Here, we developed a new mouse model (hDMD / Dmd-null) that contains the full-length human DMD gene but lacks the entire mouse Dmd gene to test the in vivo efficacy of human AOs. This mouse model was adopted to avoid cross-reactivity between human and mouse sequences (note that conventional mdx mice still contain mouse dystrophin mRNA, which may cross-react with human-targeted AOs). It was obtained by crossbreeding hDMD mice34 with Dmd-null mice35. Ac0, Ac48, the analog eteplirsen, or the analog drisapersen were injected into the TA muscle of these mice, and the efficacy of exon 51 skipping in vivo was analyzed 2 weeks after injection. The results showed that the exon skipping efficiency was significantly higher in mice treated with Ac0 compared to the analog eteplirsen (Figure 7). A visible exon 51 skipping band was observed in mice treated with Ac48, with a mean exon skipping efficiency of 1.11% (±0.46%, SE). On the other hand, no quantifiable exon 51 skipping band was observed in mice treated with the analog drisapersen (Figure 8).

[0081] array GTGTCACCAGAGTAACAGTCTGAGTAGGAG Ac0 (SEQ ID NO: 1) AGGTTGTGTCACCAGAGTAACAGTCTGAGT Ac5 (SEQ ID NO: 2) GGCAGTTTCCTTAGTAACCACAGGTTGTGT Ac26 (SEQ ID NO: 3) AGATGGCAGTTTCCTTAGTAACCACAGGTT Ac30 (SEQ ID NO: 4) ATGGCATTTCTAGTTTGGAGATGGCAGTTT Ac48 (SEQ ID NO: 5) CTCCAACATCAAGGAAGATGGCATTTCTAG Eteplirsen (SEQ ID NO: 6) TCAAGGAAGATGGCATTTCT drisapersen (SEQ ID NO: 7) TGTCACCAGAGTAACAGTCTGAGTAGGAG hEx51_Ac0-29mer (SEQ ID NO: 8) GTCACCAGAGTAACAGTCTGAGTAGGAG hEx51_Ac0-28mer (SEQ ID NO: 9) TCACCAGAGTAACAGTCTGAGTAGGAG hEx51_Ac0-27mer (SEQ ID NO: 10) CACCAGAGTAACAGTCTGAGTAGGAG hEx51_Ac0-26mer (SEQ ID NO: 11) ACCAGAGTAACAGTCTGAGTAGGAG hEx51_Ac0-25mer (SEQ ID NO: 12) CCACAGGTTGTGTCACCAGAGTAACAGTCT Ac9 (SEQ ID NO: 13) TTATAACTTGATCAAGCAGAGAAAGCCAGT Ac141 (SEQ ID NO: 14) atacCTTCTGCTTGATGATCATCTCGTTGA Ac207 (SEQ ID NO: 15) CAGCCAGTGAAGAGGAAGTTAG Ex49 / 50_94-10_hDMD_Fwd (SEQ ID NO: 16) CCAGCCATTGTGTTGAATCC Ex53_80-99_hDMD_Rv (SEQ ID NO: 17) AGGACCCGTGCTTGTAAGTG Ex47_60-79_hDMD_Fwd (SEQ ID NO: 18) GATTGTTCTAGCCTCTTGATTGC Ex52_83-105_hDMD_Rv (SEQ ID NO: 19) GACAAGGGCGATTTGACAG Ex43 / 44_167-12_hDMD_Fwd (SEQ ID NO: 20) CAAGCACTCAGCCAGTGAAG mDmd_ex49_83-102_Fwd (SEQ ID NO: 21) TCCAGCCATTGTGTTGAATC deletion mDmd_ex53_81-100_Rv (SEQ ID NO: 22) TCCCTGAGCTGAACGGGAAG hGAPDH_662-81_Fwd (SEQ ID NO: 23) TCCAGCCATTGTGTTGAATC Control hGAPDH_860-79_Rv (SEQ ID NO: 24) TCGATGCTCTTAGCTGAGTGTCC h18S_760-82_Fwd (SEQ ID NO: 25) TGATCGTCTTCGAACCTCCG Control h18S_1039-58_Rv (SEQ ID NO: 26)

[0082] [Table 3-1] [Table 3-2] [Table 3-3]

Claims

1. An antisense oligonucleotide analog capable of binding to exon 51 of human dystrophin pre-mRNA, the antisense oligonucleotide consisting of one of SEQ ID NOs: 8-11.

2. The antisense oligonucleotide analogue of claim 1, wherein the antisense oligonucleotide analogue is selected from peptide nucleic acid (PNA), morpholino oligonucleotide, phosphorothioate oligonucleotide, phosphorodithioate oligonucleotide, alkylphosphonate oligonucleotide, acylphosphonate oligonucleotide and phosphoramidite oligonucleotide.

3. A conjugate comprising the antisense oligonucleotide analogue of claim 1 and a carrier, wherein the carrier is conjugated to the antisense oligonucleotide analogue.

4. The conjugate described in claim 3, wherein the carrier transports the antisense oligonucleotide analog to a target cell.

5. A conjugate described in claim 3 or 4, wherein the carrier is selected from a peptide, a polymer, a nanoparticle, a lipid, a liposome, a cell-penetrating peptide or an exosome.

6. A pharmaceutical composition comprising an antisense oligonucleotide analogue described in claim 1 or 2, and / or a conjugate described in any one of claims 3 to 5, and a pharmaceutically acceptable excipient.

7. Use of an antisense oligonucleotide analogue capable of binding to exon 51 of human dystrophin pre-mRNA for the manufacture of a medicament for treating a muscle disorder in a subject, comprising: the muscle disorder is Duchenne muscular dystrophy or Becker muscular dystrophy; The use wherein the antisense oligonucleotide analogue consists of one of SEQ ID NOs: 8-11.

8. The use described in claim 7, wherein the muscle disorder is Duchenne muscular dystrophy.

9. An antisense oligonucleotide analog described in claim 1 or 2, which is a morpholino oligonucleotide.

Images