α-1 ANTITRYPSIN (AAT) RNAi AGENTS, COMPOSITIONS INCLUDING AAT RNAi AGENTS, AND METHODS OF USE

Abstract

To provide RNAi agents for inhibiting expression of the α-1 antitrypsin (AAT) gene, compositions including the AAT RNAi agents, and methods of using the same.SOLUTION: Also there are disclosed pharmaceutical compositions including one or more AAT RNAi agents together with one or more excipients capable of delivering the RNAi agents to living cells in vivo. The delivery of the AAT RNAi agents to liver cells in vivo inhibits AAT gene expression and treats diseases associated with AAT deficiency such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure.SELECTED DRAWING: Figure 9

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Provisional Patent Application No. 62 / 444,452, filed January 10, 2017, U.S. Provisional Patent Application No. 62 / 486,720, filed April 18, 2017, and U.S. Provisional Patent Application No. 62 / 596,232, filed December 8, 2017, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Disclosed herein are RNA interference (RNAi) agents for the inhibition of alpha-1 antitrypsin gene expression, compositions comprising the alpha-1 antitrypsin RNAi agents, and methods of their use. [Background technology]

[0003] Alpha-1 antitrypsin (AAT, α1-antitrypsin, or A1AT) deficiency is an inherited autosomal codominant disorder that causes misfolding of the AAT protein and insufficient secretion of the misfolded protein, leading to lung and liver disease. AAT deficiency (AATD) occurs in approximately 1 in 1,500 to 3,500 individuals and most commonly affects individuals of European ancestry.

[0004] Alpha-1 antitrypsin is a protease inhibitor belonging to the serpin superfamily. Normal AAT protein is a circulating glycoprotein protease inhibitor that is primarily synthesized in the liver by stem cells and secreted into the blood. The known physiological function of AAT is to inhibit neutrophil proteases, which help protect host tissues from nonspecific damage during inflammation.

[0005] The most clinically significant form of AATD, a genetic disorder associated with liver disease in children and adults and lung disease in adults, is caused by Z mutations. The Z mutant allele (PiZ) predisposes mutant Z-form AAT protein ("Z-AAT protein") to misfolding, resulting in intracellular retention, via a single point mutation. Mutant Z-AAT protein monomers can form polymer chains that aggregate into aggregates sometimes referred to as "globules." Misfolded Z-AAT protein is ineffective at passing through the secretory pathway and instead polymerizes and accumulates in the endoplasmic reticulum (ER) of hepatocytes. The polymeric globules stress the ER and cause continuous hepatocellular injury, leading to an increased risk of fibrosis, cirrhosis, and hepatocellular carcinoma. Furthermore, the absence of circulating antiprotease activity predisposes the lungs to neutrophil elastase-mediated damage, ultimately leading to the development of respiratory complications such as emphysema.

[0006] Individuals with the homozygous PiZZ genotype have a severe deficiency of functional AAT, which leads to lung disease. Weekly use of AAT augmentation therapy using purified human AAT results in near-normal AAT plasma levels in subjects with AATD and helps prevent lung injury in affected individuals. However, although administration of purified AAT can improve or help prevent lung injury caused by the absence of endogenously secreted AAT, AATD patients remain vulnerable to endoplasmic reticulum liver storage disease caused by the deposition and accumulation of excessive, abnormally folded AAT protein. Accumulated Z-AAT protein in a globular conformation in hepatocytes is a well-known characteristic of AATD liver disease and is thought to lead to proteotoxic effects that are responsible for the induction of liver damage, including hepatocellular injury and death and chronic liver injury, in individuals with AATD (see, for example, D. Lindblad et al., Hepatology 2007, 46: 1228-1235). Patients with AATD often develop liver disease, which can be severe or fatal even in infants. Clinical manifestations of liver damage include chronic hepatitis, cirrhosis, hepatocellular carcinoma, tonsillitis, cholestasis, fibrosis, and even fulminant hepatic failure.

[0007] There is currently no clinically approved treatment for preventing the onset of liver disease caused by AATD or delaying its progression.In addition, although U.S. Patent Application Publication No. 2015 / 0361427 discloses a specific RNAi agent that can inhibit the expression of the AAT gene, there remains a need for novel and effective AAT RNAi agents with improved efficacy that can selectively, efficiently and safely inhibit the expression of the AAT gene, thereby preventing and potentially reversing Z-AAT accumulation-related liver damage and fibrosis. Similarly, U.S. Patent Application Publication No. 2015 / 0011607 by Brown et al. (Brown '607) discloses various sequences for inhibiting expression of the AAT gene, and Brown teaches the use of longer double-stranded constructs (referred to in Brown as DsiRNAs), which, according to Brown, have been found to provide "unexpectedly effective results in terms of potency and duration of action" compared to 19-23mer siRNA constructs (see, e.g., Brown '607, paragraph

[0376] ). Furthermore, many of the sequences disclosed in Brown '607 are intended to be used in DsiRNA constructs designed to target different locations on the AAT mRNA compared to the sequences disclosed in the present invention. Such differences result in different binding affinities for AAT mRNA and affect the inhibitory efficacy of the compound, while also generating different cleavage sites that potentially result in additional off-target problems (see, e.g., Piotr J. Kamola et al., PLoS Comput Biol, 2015, 11(12):e1004656 in Figure 1 (which illustrates the mechanism of siRNA-mediated gene silencing). For example, Brown '607 does not teach or suggest the design of an RNAi agent (of any length) in which the 5'-terminal nucleobase or nucleotide of the antisense strand would align with a position 19 nucleotides downstream (towards the 3' end) from position 1000 on the AAT gene (SEQ ID NO: 1).Stated another way, as an example including one such potential AAT RNAi agent sequence, Brown '607 does not teach or suggest the design of an RNAi agent in which the 5'-terminal nucleobase of the antisense strand of the RNAi agent corresponds to position 1018 on the AAT gene (SEQ ID NO: 1). Moreover, Brown '607 does not teach or suggest the modified AAT RNAi agent constructs disclosed herein. Summary of the Invention [Problem to be solved by the invention]

[0008] There is a need for novel AAT-specific RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) that can selectively and efficiently inhibit the expression of the AAT gene. Furthermore, there is a need for novel AAT-specific RNAi agent compositions for the treatment of diseases associated with AAT deficiency. [Means for solving the problem]

[0009] Because liver damage caused by AATD occurs through a gain-of-function mechanism, inhibiting AAT gene expression is useful for preventing the accumulation of Z-AAT protein in the liver.In addition, reducing or eliminating Z-AAT polymer aggregates reduces ER stress in hepatocytes, and provides additional benefits in reducing the likelihood of hepatocellular injury and supporting the treatment of hepatocellular injury and chronic liver damage, such as fibrosis, cirrhosis, hepatocellular carcinoma, and other conditions and diseases caused by AATD.Reducing inflammatory Z-AAT protein, which is clearly defined as the cause of progressive liver disease in AATD patients, is important because it slows or stops the progression of liver disease and allows for the repair of fibrotic tissue.

[0010] In general, the present disclosure features novel AAT RNAi agents, compositions comprising the AAT RNAi agents, and methods for inhibiting AAT gene expression in vivo and / or in vitro using the AAT RNAi agents and compositions comprising the AAT RNAi agents. Also described herein are methods for treating related disorders using the AAT RNAi agents and compositions comprising the AAT RNAi agents disclosed herein.

[0011] The AAT RNAi agent and method disclosed herein can provide the treatment of AATD, including the condition and disease caused by AATD, such as chronic hepatitis, liver cirrhosis, hepatocellular carcinoma and fulminant hepatic failure.When the AAT RNAi agent disclosed herein is administered to a subject, it can prevent and / or reverse the liver damage and fibrosis associated with Z-AAT accumulation.The AAT RNAi agent described herein can be administered to a subject, for example, a human or animal subject, by any suitable method known in the art, for example, by subcutaneous injection or intravenous administration.

[0012] In one aspect, the present disclosure features an RNAi agent for inhibiting expression of the alpha-1 antitrypsin (AAT) gene, the RNAi agent comprising a sense strand and an antisense strand. Also described herein is a composition comprising an RNAi agent capable of inhibiting expression of the alpha-1 antitrypsin gene (wherein the RNAi agent comprises a sense strand and an antisense strand) and at least one pharmaceutically acceptable excipient.

[0013] Each AAT RNAi agent described herein comprises a sense strand and an antisense strand. The sense strand and antisense strand can be partially, substantially, or fully complementary to one another. The sense strand and antisense strand of the RNAi agents described herein can each be 16-30 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 17-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 21-24 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. The RNAi agents described herein inhibit the expression of one or more AAT genes in vivo or in vitro upon delivery to cells that express AAT.

[0014] The AAT RNAi agent comprises a sense strand (also referred to as passenger strand) and an antisense strand (also referred to as guide strand). The sense strand of the AAT RNAi agent described herein comprises a nucleotide sequence having at least 85% identity to a sequence in AAT mRNA over a core stretch of at least 16 consecutive nucleotides. According to some embodiments, the sense strand core stretch having at least 85% identity to a sequence in AAT mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. The antisense strand of the AAT RNAi agent comprises a nucleotide sequence having at least 85% complementarity to a sequence in AAT mRNA and its corresponding sense strand over a core stretch of at least 16 consecutive nucleotides. According to some embodiments, the antisense strand core stretch having at least 85% complementarity to a sequence in AAT mRNA or its corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0015] According to some embodiments, the AAT RNAi agents disclosed herein target a portion of the AAT gene having the sequence of any of the sequences disclosed in Table 1.

[0016] Examples of AAT RNAi agent sense and antisense strands that can be used in AAT RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of duplexes that include AAT RNAi agents are provided in Table 6. Examples of 19-nucleotide core stretch sequences that can consist of or be included in the sense and antisense strands of certain AAT RNAi agents disclosed herein are provided in Table 2.

[0017] In another aspect, the present disclosure features a method for in vivo delivery of an AAT RNAi agent to lung cells in a subject, such as a mammal. According to some embodiments, one or more AAT RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein vectors, or Dynamic Polyconjugates (registered trademark) (DPC) (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185; each of which is incorporated herein by reference). According to some embodiments, delivery vehicles, such as polymers, amphipathic polymers, membrane active polymers, peptides, such as melittin or melittin-like peptides, reversibly modified polymers or peptides, or lipids, may be used with the AAT RNAi agents disclosed herein.

[0018] In some embodiments, the AAT RNAi agent is delivered to a target cell or tissue by covalently linking or conjugating the RNAi agent to a targeting group, such as an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of galactose or a galactose derivative cluster. In some embodiments, the AAT RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Exemplary targeting groups useful for delivering RNAi agents are disclosed, for example, in U.S. Patent Application No. 15 / 452,324 and International Publication No. WO 2017 / 1561012, which are incorporated herein by reference in their entireties.

[0019] The targeting group can be attached to the 3' or 5' end of the sense strand or antisense strand of the AAT RNAi agent. According to some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. According to some embodiments, the targeting group is attached to the 5' end of the sense strand. According to some embodiments, the targeting group is internally attached to a nucleotide on the sense strand and / or antisense strand of the RNAi agent. According to some embodiments, the targeting group is attached to the RNAi agent via a linker.

[0020] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5.

[0021] In another aspect, the disclosure features a composition that includes one or more AAT RNAi agents having a duplex structure disclosed in Table 6.

[0022] According to some embodiments, compositions comprising a combination or cocktail of at least two AAT RNAi agents having different nucleotides are described herein. According to some embodiments, two or more different AAT RNAi agents are each separately and independently bound to a targeting group. According to some embodiments, two or more different AAT RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more moieties that target the asialoglycoprotein receptor. According to some embodiments, two or more different AAT RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more galactose derivatives. According to some embodiments, two or more different AAT RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more N-acetyl-galactosamine. According to some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently bound to the same targeting group. According to some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently bound to the same targeting group. According to some embodiments, when more than one RNAi agent is included in the composition, each RNAi agent is independently bound to a different targeting group, eg, a targeting group having a different chemical structure.

[0023] According to some embodiments, targeting group is connected to AAT RNAi agent without using additional linker. According to some embodiments, targeting group is designed to have existing linker to easily facilitate connection to AAT RNAi agent. According to some embodiments, when two or more RNAi agents are contained in the composition, two or more RNAi agents can be connected to their respective targeting groups using the same linker. According to some embodiments, when two or more RNAi agents are contained in the composition, two or more RNAi agents can be connected to their respective targeting groups using different linkers.

[0024] In another aspect, the disclosure features a method for inhibiting alpha-1 antitrypsin gene expression in a subject, the method including administering to the subject an AAT RNAi agent in an amount capable of inhibiting expression of the AAT gene, wherein the AAT RNAi agent includes a sense strand and an antisense strand.

[0025] Also described herein is a method for treating the condition or disease caused by AATD, comprising administering to a subject a therapeutically effective amount of the RNAi agent described herein.Further described is a method for inhibiting the expression of AAT gene, comprising administering to a cell the AAT RNAi agent described herein.

[0026] According to some embodiments, disclosed herein are methods for treating AATD (including treating a condition or disease caused by AATD) comprising administering to a subject a therapeutically effective amount of an RNAi agent having an antisense strand comprising any of the sequences in Tables 2, 3, or 4.

[0027] According to some embodiments, disclosed herein are methods for inhibiting expression of the AAT gene, comprising administering to a cell an AAT RNAi agent comprising an antisense strand comprising any of the sequences in Tables 2, 3, or 4.

[0028] According to some embodiments, disclosed herein are methods for treating AATD (including treating a condition or disease caused by AATD) comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Tables 2, 3, or 4.

[0029] According to some embodiments, disclosed herein are methods for inhibiting expression of the AAT gene, comprising administering to a cell an AAT RNAi agent comprising a sense strand comprising any of the sequences in Tables 2, 3, or 4.

[0030] According to some embodiments, disclosed herein are methods for treating AATD (including treating a condition or disease caused by AATD) comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 5 and an antisense strand comprising any of the sequences in Table 4.

[0031] Disclosed herein is a method for inhibiting expression of the AAT gene, comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 5 and an antisense strand comprising any of the sequences in Table 4.

[0032] According to some embodiments, disclosed herein are methods for inhibiting expression of the AAT gene, comprising administering to a subject an AAT RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 5, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 4. According to some embodiments, disclosed herein are methods for inhibiting expression of the AAT gene, comprising administering to a subject an AAT RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the modified sequences in Table 5, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 4.

[0033] According to some embodiments, disclosed herein are methods for inhibiting expression of the AAT gene in a cell, comprising administering one or more AAT RNAi agents having the duplex structures shown in Table 6.

[0034] According to some embodiments, the AAT RNAi agents disclosed herein have a structure that comprises, consists of, or consists essentially of the structure shown in any one of FIGS.

[0035] The AAT RNAi agent disclosed herein is designed to target a specific position on AAT gene (SEQ ID NO: 1).As defined herein, when the 5'-end nucleobase of antisense strand is aligned with the position that is 19 nucleotides downstream (towards the 3'-end) from the position on gene when base-pairing with gene, the antisense strand sequence is designed to target the AAT gene at a specific position on gene.For example, as shown in Tables 1, 2 and 3 herein, the antisense strand sequence designed to target the AAT gene at position 1000 requires the 5'-end nucleobase of antisense strand to be aligned with the 1018th position of AAT gene when base-pairing with gene. As provided herein, an AAT RNAi agent does not require the nucleobase at position 1 (5'→3') of the antisense strand to be complementary to the gene, provided that the gene is present across at least 85% complementarity (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and a core stretch sequence of at least 16 contiguous nucleotides. For example, for an AAT RNAi disclosed herein that is designed to target position 1000 of the AAT gene, the 5'-terminal nucleobase of the antisense strand of the AAT RNAi agent should be aligned with position 1018 of the gene; however, the 5'-terminal nucleobase of the antisense strand can, but need not, be complementary to position 1018 of the AAT gene if there is at least 85% complementarity (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and a core stretch sequence of at least 16 consecutive nucleotides of the gene. As shown, inter alia, by the various examples disclosed herein, the specific site of binding of the antisense strand of the AAT RNAi agent to the gene (e.g., whether the AAT RNAi agent is designed to target the AAT gene at position 1000, 1142, or elsewhere) is highly important to the level of inhibition achieved by the AAT RNAi agent.

[0036] According to some embodiments, the antisense strand is designed to have the sequence target position 1000 of the AAT gene (SEQ ID NO: 1).

[0037] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein all or substantially all nucleotides are modified nucleotides.

[0038] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein all or substantially all nucleotides are modified nucleotides.

[0039] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein all or substantially all nucleotides are modified nucleotides.

[0040] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein all or substantially all nucleotides are modified nucleotides.

[0041] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein all or substantially all nucleotides are modified nucleotides.

[0042] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides are modified nucleotides. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein all or substantially all nucleotides are modified nucleotides.

[0043] According to some embodiments, the asense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides are modified nucleotides. According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein all or substantially all nucleotides are modified nucleotides.

[0044] According to some embodiments, the asense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides are modified nucleotides. According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein all or substantially all nucleotides are modified nucleotides.

[0045] According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides are modified nucleotides.

[0046] According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides are modified nucleotides.

[0047] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857).

[0048] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885).

[0049] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864).

[0050] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866).

[0051] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), which differs by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857), which differs by 0, 1, 2, or 3 nucleotides.

[0052] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), which differs by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885), which differs by 0, 1, 2, or 3 nucleotides.

[0053] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), which differs by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864), which differs by 0, 1, 2, or 3 nucleotides.

[0054] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), which differs by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866), which differs by 0, 1, 2, or 3 nucleotides.

[0055] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04824.

[0056] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04825.

[0057] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04826.

[0058] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04827.

[0059] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04828.

[0060] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04829.

[0061] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04830.

[0062] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04831.

[0063] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04832.

[0064] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04833.

[0065] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04834.

[0066] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04835.

[0067] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04836.

[0068] According to some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04837.

[0069] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides are modified nucleotides, and SEQ ID NO: 80 is located at positions 1-19 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 80 is located at positions 1-19 (5'→3') of the antisense strand.

[0070] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides are modified nucleotides, and SEQ ID NO: 81 is located at positions 1-19 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 81 is located at positions 1-19 (5'→3') of the antisense strand.

[0071] According to some embodiments, the sense strand of the AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides are modified nucleotides, and position 19 of SEQ ID NO: 429 base pairs with the nucleotide located at the 5'-end of the antisense strand. According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein all or substantially all nucleotides are modified nucleotides, and position 19 of SEQ ID NO: 429 base pairs with the nucleotide located at the 5'-end of the antisense strand.

[0072] According to some embodiments, the sense strand of the AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides are modified nucleotides, and position 19 of SEQ ID NO: 430 base pairs with the nucleotide located at the 5'-end of the antisense strand. According to some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein all or substantially all nucleotides are modified nucleotides, and position 19 of SEQ ID NO: 430 base pairs with the nucleotide located at the 5'-end of the antisense strand.

[0073] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO:794 is located at positions 1-21 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794), wherein all or substantially all nucleotides are modified nucleotides and SEQ ID NO:794 is located at positions 1-21 (5'→3') of the antisense strand.

[0074] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 839 is located at positions 1-22 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein all or substantially all nucleotides are modified nucleotides and SEQ ID NO: 839 is located at positions 1-22 (5'→3') of the antisense strand.

[0075] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 800 is located at positions 1-21 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein all or substantially all nucleotides are modified nucleotides and SEQ ID NO: 800 is located at positions 1-21 (5'→3') of the antisense strand.

[0076] According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 801 is located at positions 1-21 (5'→3') of the antisense strand. According to some embodiments, the antisense strand of an AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein all or substantially all nucleotides are modified nucleotides and SEQ ID NO: 801 is located at positions 1-21 (5'→3') of the antisense strand.

[0077] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 794 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857).

[0078] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 839 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885).

[0079] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 800 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864).

[0080] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides are modified nucleotides and SEQ ID NO: 801 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866).

[0081] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), which differs by 0, 1, 2 or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide and SEQ ID NO: 794 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857), which differs by 0, 1, 2 or 3 nucleotides.

[0082] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), differing by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides are modified nucleotides and SEQ ID NO: 839 is located at the 5'-end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885), differing by 0, 1, 2, or 3 nucleotides.

[0083] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), differing by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide and SEQ ID NO: 800 is located at the 5'-end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864), differing by 0, 1, 2, or 3 nucleotides.

[0084] According to some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), differing by 0, 1, 2, or 3 nucleotides, where at least one or more nucleotides is a modified nucleotide and SEQ ID NO: 801 is located at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866), differing by 0, 1, 2, or 3 nucleotides.

[0085] The AAT RNAi agents described herein can also include one or more phosphorothioate internucleoside linkages.

[0086] The AAT RNAi agents described herein can also include one or more targeting or binding groups. According to some embodiments, the AAT RNAi agents disclosed herein include one or more targeting groups. According to some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. According to some embodiments, the asialoglycoprotein receptor ligand comprises a galactose or galactose derivative cluster. According to some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamine. According to some embodiments, the targeting ligand comprises an N-acetyl-galactosamine trimer. According to some embodiments, the targeting group is conjugated to the sense strand of the AAT RNAi agent disclosed herein.

[0087] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0088] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0089] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0090] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0091] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5'->3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO:913), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5'->3') cguuuaGfGfCfauguuuaacausu (SEQ ID NO:1276), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; optionally present on the sense strand is one, two, or more inverted basic deoxyribose residues (invAb); and optionally attached to the 5' end of the sense strand is a targeting ligand comprising N-acetyl-galactosamine.

[0092] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; optionally present on the sense strand is one, two, or more inverted basic deoxyribose residues (invAb); and optionally attached to the 5' end of the sense strand is a targeting ligand comprising N-acetyl-galactosamine.

[0093] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5'->3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO:959), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5'->3') cgcguuuaGfGfCfauguuuaaca (SEQ ID NO:1278), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; optionally present on the sense strand is one, two, or more inverted basic deoxyribose residues (invAb); and optionally attached to the 5' end of the sense strand is a targeting ligand comprising N-acetyl-galactosamine.

[0094] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; optionally present on the sense strand is one, two, or more inverted basic deoxyribose residues (invAb); and optionally attached to the 5' end of the sense strand is a targeting ligand comprising N-acetyl-galactosamine.

[0095] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') (NAG37)s(invAb)scguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO: 1028), where a, c, g, and u are 2′-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; (invAb) is reverse abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0096] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') (NAG37)s(invAb)sgcguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO: 1030), where a, c, g, and u are 2′-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; (invAb) is reverse abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0097] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacas (invAb) (SEQ ID NO: 1024), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; (invAb) is reverse abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0098] According to some embodiments, the antisense strand of the RNAi agent comprises or consists of the sequence (5' → 3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), and the sense strand of the AAT RNAi agent comprises or consists of the sequence (5' → 3') (NAG37)s(invAb)sagcguuuaGfGfCfauguuuaacas (invAb) (SEQ ID NO: 1033), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; (invAb) is reverse abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0099] According to some embodiments, the AAT RNAi agents described herein are selected from the group consisting of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG 32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0100] According to some embodiments, the AAT RNAi agents described herein are selected from the group consisting of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG68), (NAG69), (NAG70), (NAG71), (NAG72), (NAG73), (NAG74), (NAG75), (NAG76), (NAG77), (NAG78), (NAG79), (NAG80), (NAG81), (NAG82), (NAG83), (NAG84), (NAG85), (NAG86), (NAG87), (NAG88), (NAG89), (NAG90), (NAG91), (NAG92), (NAG93), (NAG94) One targeting group can be included at the 5' end of the sense strand having the structure (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0101] The AAT RNAi agent disclosed herein can be incorporated into the composition comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient.According to some embodiments, the composition disclosed herein comprises one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient is a pharmaceutical composition.

[0102] The pharmaceutical composition comprising one or more AAT RNAi agents can be administered by many means, depending on whether local or systemic treatment is desired.Administration can be, but is not limited to, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, subcutaneous administration (for example, via implantable device), and intraparenchymal administration.In some embodiments, the compositions described herein are administered by subcutaneous injection.

[0103] According to some embodiments, compositions comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient can further comprise one or more additional therapeutic agents or therapeutic agents.

[0104] According to some embodiments, the compositions described herein, comprising one or more AAT RNAi agents, are packaged in a kit, a container, a pack, a dispenser, a pre-filled syringe, or a vial. According to some embodiments, the compositions described herein are administered parenterally.

[0105] The AAT RNAi agent disclosed herein and the composition comprising it can be administered to a subject to inhibit the expression of alpha-1 antitrypsin gene in the subject.In some embodiments, the subject is a human.In some embodiments, the subject is a human who has been diagnosed with AATD.

[0106] According to some embodiments, disclosed herein is a method for inhibiting expression of an AAT gene in a cell, the method comprising administering an AAT RNAi agent having an antisense strand that is at least partially complementary to a portion of an AAT mRNA having any one of the sequences listed in Table 1.

[0107] The AAT RNAi agents disclosed herein and compositions comprising the same can be administered to a subject for the treatment of conditions or diseases caused by AATD (alpha-1 antitrypsin) deficiency. Conditions or diseases that can be treated, prevented, and / or managed by administering the AAT RNAi agents disclosed herein and compositions comprising the same include chronic hepatitis, cirrhosis, hepatocellular carcinoma, hepatic tonsillitis, cholestasis, fibrosis, or fulminant hepatic failure.

[0108] As used herein, "oligonucleotide" or "polynucleotide" means a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[0109] As used herein, "RNAi agent" or "RNAi trigger" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can reduce or inhibit translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, RNAi can act through an RNA interference mechanism (i.e., triggering RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or any other mechanism or pathway. Although RNAi agents, as the term is used herein, are believed to act primarily through RNA interference, the disclosed RNAi agents are not constrained or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to a targeted mRNA (e.g., AAT mRNA). The RNAi agent can contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0110] As used herein, the terms "silence," "reduce," "inhibit," "down-regulate," ("knockdown"), when referring to expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is decreased when a cell, group of cells, tissue, organ, or subject is treated with an RNAi agent compared to a second cell, group of cells, tissue, organ, or subject that is untreated or has not been treated.

[0111] As used herein, the terms "sequence" and "nucleotide sequence" mean a series or contiguous series of nucleic acid bases or nucleotides described by a series of letters, using standard nomenclature.

[0112] As used herein, a "base," "nucleotide base," or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a standard building block of all nucleic acids and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. As used herein, the term "nucleotide" can include modified nucleotides (e.g., nucleotide mimetics, abasic residues (Abs), or surrogate replacement moieties).

[0113] As used herein, and unless otherwise specified, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a target mRNA) with respect to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vivo)) and form a triple or double helix structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under specific standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af as defined herein are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0114] As used herein, "perfectly complementary" or "fully complementary" means that all (100%) of the nucleobases or nucleotides in a contiguous sequence of a first polynucleotide will hybridize with the same number of nucleobases or nucleotides in a contiguous sequence of a second polynucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0115] As used herein, "partially complementary" means that in a pair of hybridized nucleic acid base sequences, at least 70%, but not all, of the bases in the contiguous sequence of the first polynucleotide will hybridize with the same number of bases in the contiguous sequence of the second polynucleotide.

[0116] As used herein, "substantially complementary" means that in a pair of hybridized nucleobase sequences, at least 85%, but not all, of the bases in the contiguous sequence of the first polynucleotide will hybridize with the same number of bases in the contiguous sequence of the second polynucleotide. The terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used herein in reference to nucleobase or nucleotide correspondence between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of AAT mRNA.

[0117] As used herein, the terms "substantially identical" or "substantially identity" as applied to nucleic acid sequences means that the nucleic acid sequence comprises a sequence having at least about 85% sequence identity, or even, for example, at least 90%, at least 95%, or at least 99% identity, relative to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where identical nucleobases occur in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those nucleotide sequences disclosed herein.

[0118] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief from or a reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic treatment, and / or inhibition of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0119] As used herein, the phrase "introducing into a cell," when referring to an RNAi agent, means functionally delivering the RNAi agent into the cell. The phrase "functional delivery" means delivering the RNAi agent into the cell in a manner that allows the RNAi agent to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0120] Unless otherwise specified, symbols used herein The use of TIFF2025134688000002.tif99 means that any group or group of groups may be attached thereto in accordance with the scope of the invention described herein.

[0121] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0122] As used herein, for each structure that has asymmetric centers and thus gives rise to enantiomers, diastereomers, or other stereoisomeric configurations, unless a particular structure is identified as having a particular configuration, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0123] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to certain materials or steps, and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0124] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition exists. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their state of protonation based on the environment (e.g., pH), as will be readily understood by those skilled in the art.

[0125] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0126] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0127] [Figure 1A] 1A-1E show the chemical duplex structure of AD04828 shown as the sodium salt.

[0128] [Figure 1B] 1A-1E show the chemical duplex structure of AD04828 shown as the sodium salt.

[0129] [Figure 1C] 1A-1E show the chemical duplex structure of AD04828 shown as the sodium salt.

[0130] [Figure 1D] 1A-1E show the chemical duplex structure of AD04828 shown as the sodium salt.

[0131] [Figure 1E] 1A-1E show the chemical duplex structure of AD04828 shown as the sodium salt.

[0132] [Figure 2A]2A-2E show the chemical duplex structure of AD04828 shown as the free acid.

[0133] [Figure 2B] 2A-2E show the chemical duplex structure of AD04828 shown as the free acid.

[0134] [Figure 2C] 2A-2E show the chemical duplex structure of AD04828 shown as the free acid.

[0135] [Figure 2D] 2A-2E show the chemical duplex structure of AD04828 shown as the free acid.

[0136] [Figure 2E] 2A-2E show the chemical duplex structure of AD04828 shown as the free acid.

[0137] [Figure 3A] 3A-3E show the chemical duplex structure of AD04831 shown as the sodium salt.

[0138] [Figure 3B] 3A-3E show the chemical duplex structure of AD04831 shown as the sodium salt.

[0139] [Figure 3C] 3A-3E show the chemical duplex structure of AD04831 shown as the sodium salt.

[0140] [Figure 3D] 3A-3E show the chemical duplex structure of AD04831 shown as the sodium salt.

[0141] [Figure 3E] 3A-3E show the chemical duplex structure of AD04831 shown as the sodium salt.

[0142] [Figure 4A] 4A-4E show the chemical duplex structure of AD04831 shown as the free acid.

[0143] [Figure 4B] 4A-4E show the chemical duplex structure of AD04831 shown as the free acid.

[0144] [Figure 4C] 4A-4E show the chemical duplex structure of AD04831 shown as the free acid.

[0145] [Figure 4D] 4A-4E show the chemical duplex structure of AD04831 shown as the free acid.

[0146] [Figure 4E] 4A-4E show the chemical duplex structure of AD04831 shown as the free acid.

[0147] [Figure 5A] 5A-5E show the chemical duplex structure of AD04836 shown as the sodium salt.

[0148] [Figure 5B] 5A-5E show the chemical duplex structure of AD04836 shown as the sodium salt.

[0149] [Figure 5C] 5A-5E show the chemical duplex structure of AD04836 shown as the sodium salt.

[0150] [Figure 5D] 5A-5E show the chemical duplex structure of AD04836 shown as the sodium salt.

[0151] [Figure 5E]5A-5E show the chemical duplex structure of AD04836 shown as the sodium salt.

[0152] [Figure 6A] 6A-6E show the chemical duplex structure of AD04836 shown as the free acid.

[0153] [Figure 6B] 6A-6E show the chemical duplex structure of AD04836 shown as the free acid.

[0154] [Figure 6C] 6A-6E show the chemical duplex structure of AD04836 shown as the free acid.

[0155] [Figure 6D] 6A-6E show the chemical duplex structure of AD04836 shown as the free acid.

[0156] [Figure 6E] 6A-6E show the chemical duplex structure of AD04836 shown as the free acid.

[0157] [Figure 7A] 7A-7E show the chemical duplex structure of AD04837 shown as the sodium salt.

[0158] [Figure 7B] 7A-7E show the chemical duplex structure of AD04837 shown as the sodium salt.

[0159] [Figure 7C] 7A-7E show the chemical duplex structure of AD04837 shown as the sodium salt.

[0160] [Figure 7D] 7A-7E show the chemical duplex structure of AD04837 shown as the sodium salt.

[0161] [Figure 7E] 7A-7E show the chemical duplex structure of AD04837 shown as the sodium salt.

[0162] [Figure 8A] Figures 8A-8E show the chemical duplex structure of AD04837 shown as the free acid.

[0163] [Figure 8B] Figures 8A-8E show the chemical duplex structure of AD04837 shown as the free acid.

[0164] [Figure 8C] Figures 8A-8E show the chemical duplex structure of AD04837 shown as the free acid.

[0165] [Figure 8D] Figures 8A-8E show the chemical duplex structure of AD04837 shown as the free acid.

[0166] [Figure 8E] Figures 8A-8E show the chemical duplex structure of AD04837 shown as the free acid.

[0167] [Figure 9] 9 is a bar graph showing the mean normalized cynomolgus monkey AAT (cAAT) serum levels in cynomolgus monkeys (n=3) after a single subcutaneous administration of 3 mg / kg of AD04828, AD04836, AD04831, or AD04837 according to Example 4. AAT serum levels were normalized to the mean pre-treatment value. Experimental error is shown as the standard deviation.

[0168] [Figure 10]10 is a bar graph showing the mean normalized cynomolgus monkey cAAT serum levels in cynomolgus monkeys (n=2 or n=3) after a single subcutaneous administration of 3 mg / kg of AD04828, AD04836, AD04831, or AD04837 according to Example 5. AAT serum levels were normalized to the mean pre-treatment value. Experimental error is shown as the standard deviation.

[0169] [Figure 11] 11 is a bar graph showing the results of Western blot analysis of the soluble fraction (Z-AAT monomer) from the livers of PiZ mice administered either saline or a NAG-binding AAT RNAi agent having a duplex structure, AD04837, every two weeks for 8 weeks, normalized to baseline controls, according to Example 7. Individual mouse measurements are grouped by treatment group, and experimental error is shown as the standard deviation.

[0170] [Figure 12] 12 is a bar graph showing the results of Western blot analysis of the insoluble fraction (Z-AAT monomer) from the livers of PiZ mice administered either saline or the NAG-binding AAT RNAi agent having the double-stranded structure AD04837 according to Example 7. Individual mouse measurements are grouped by treatment group, and experimental error is shown as the standard deviation. DETAILED DESCRIPTION OF THE INVENTION

[0171] RNAi agents: Described herein are RNAi agents (also referred to herein as AAT RNAi agents or AAT RNAi triggers) for inhibiting expression of the AAT gene. Each AAT RNAi agent includes a sense strand and an antisense strand. The sense strand and antisense strand can each be 16-30 nucleotides in length. In some embodiments, the sense strand and antisense strand can each be 17-26 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 17-21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is about 23 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length, and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 19 nucleotides in length, and the antisense strand is 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0172] According to some embodiments, the region of perfect or substantial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect or substantially complementary).

[0173] The sense and antisense strands are each 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to as a target sequence) that is 16-23 nucleobases in length. The sense core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is completely identical or at least 85% identical to the nucleotide sequence (target sequence) present in the AAt mRNA target. The sense strand core stretch sequence can be the same length as the corresponding antisense core sequence, or can be of a different length. According to some embodiments, the antisense core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. According to some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0174] Examples of nucleotide sequences used to form AAT RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of AAT RNAi agent duplexes, including the sense and antisense strand sequences in Tables 2, 3, 4, and 5, are shown in Table 6.

[0175] The sense and antisense strands of the AAT RNAi agent anneal to form a duplex. The sense and antisense strands of the AAT RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. According to some embodiments, the sense strand core stretch sequence comprises a sequence of at least at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides relative to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense strand core stretch sequences of the AAT RNAi agent have a region of at least at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired, or 100% base-paired).

[0176] According to some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Tables 2, 3, or 4. According to some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Tables 2, 3, or 4.

[0177] The sense strand and / or antisense strand can optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3'-end, 5'-end, or both ends of the core stretch sequence. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the AAT mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the AAT mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand additional nucleotides.

[0178] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to the nucleotides (core stretch sequence nucleotides or extended nucleotides) in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the nucleotides (core stretch sequence nucleotides or extended nucleotides) in the corresponding sense strand. According to some embodiments, both the sense and antisense strands of an RNAi agent comprise 3' and 5' extensions. According to some embodiments, one or more 3' extended nucleotides of one strand base-pair with one or more 5' extended nucleotides of the other strand. According to other embodiments, one or more 3' extended nucleotides of one strand do not base-pair with one or more 5' extended nucleotides of the other strand. According to some embodiments, an AAT RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension.

[0179] According to some embodiments, the AAT RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. According to other embodiments, the AAT RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. According to some embodiments, one or more of the antisense strand extension nucleotides comprises a uracil or thymidine nucleotide, or a nucleotide complementary to the corresponding AAt mRNA sequence. According to some embodiments, the 3' antisense strand extension comprises or consists of one of the following sequences, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5'→3').

[0180] According to some embodiments, the 3'-end of the antisense strand can contain an additional abasic residue (Ab). An "abasic residue" or "abasic site" is a nucleotide or nucleoside lacking a nucleobase at the 1'-position of the sugar. According to some embodiments, Ab or AbAb can be added to the 3'-end of the antisense strand (see Table 7). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).

[0181] In some embodiments, the AAT RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, or a nucleotide corresponding to a nucleotide in the AAT mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).

[0182] According to some embodiments, the 3'-end of the sense strand can include an additional abasic residue. According to some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. According to some embodiments, one or more abasic residues added to the 3'-end of the sense strand are inverted (invAb). According to some embodiments, one or more inverted abasic residues or abasic sites can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. According to some embodiments, the inclusion of one or more inverted abasic residues or abasic sites at or near the end of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.

[0183] According to some embodiments, the AAT RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5 or 6 nucleotides in length. According to some embodiments, one or more sense strand extension nucleotides comprise uracil or a uracil nucleotide, or a nucleotide corresponding to a nucleotide in the AAT mRNA sequence. According to some embodiments, the 5' sense strand extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed from 5' to 3'). The sense strand can have a 3' extension and / or a 5' extension.

[0184] According to some embodiments, the 5'-end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). According to some embodiments, one or more abasic residues added to the 5'-end of the sense strand are inverted (invAb). According to some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of an RNAi agent. According to some embodiments, inclusion of one or more inverted abasic residues at or near the end of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of the RNAi agent. According to some embodiments, abasic (deoxyribose) residues can be replaced with ribitol (abasic ribose) residues.

[0185] According to some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence can comprise an inverted abasic residue (invAb) (see Table 7).

[0186] Examples of sequences used to form AAT RNAi agents are provided in Tables 2, 3, 4, and 5. According to some embodiments, the AAT RNAi agent antisense strand comprises any of the sequences in Tables 2, 3, or 4. According to some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Tables 2, 3, or 4. According to certain embodiments, the AAT RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4. According to some embodiments, the AAT RNAi agent sense strand comprises any of the sequences in Tables 2, 3, or 5. According to some embodiments, the AAT RNAi agent sense strand comprises the nucleotide sequence (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, 5-24, 6-23, 6-24, 7-24 of any of the sequences in Table 2, 3, or 5. According to particular embodiments, the AAT RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 5.

[0187] According to some embodiments, the sense strands of the RNAi agents described herein contain the same number of nucleotides. According to some embodiments, the sense strands of the RNAi agents described herein contain different numbers of nucleotides. According to some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent are less than blunt. According to some embodiments, both ends of the RNAi agent are blunt-ended. According to some embodiments, neither end of the RNAi agent is blunt-ended. As used herein, blunt end refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0188] According to some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form frayed ends. According to some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form frayed ends. According to some embodiments, both ends of the RNAi agent form frayed ends. According to some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double-stranded RNAi agent where the terminal nucleotides of two annealed strands from a pair (i.e., do not form an overhang) are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides can be on the sense strand or the antisense strand and form either a 3' or 5' overhang. According to some embodiments, the RNAi agent comprises: a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends.

[0189] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve the activity of compounds in cells while also creating serum stability for those compounds and minimizing the potential for activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

[0190] In some embodiments, the AAT RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the AAT RNAi agent is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein.

[0191] Modified nucleotides: In some embodiments, the AAT RNAi agent comprises one or more modified nucleotides. As used herein, "modified nucleotide" refers to a nucleotide other than ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'→3' linked (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3' cellonucleotide mimics (unlocked nucleobase analogs represented herein as NUNA or NUNA), locked nucleotides (represented herein as NLNA or NLNA), 3'-O-methoxy (2' internucleoside linkage) nucleotides (represented herein as 3'-OMen), 2'-F-arabinonucleotides (represented herein as NfANA or NfANA), 5'-Me, 2'-fluoronucleotides (represented herein as 5Me- Nf), morpholino nucleotides, phosphonate vinyl deoxyribonucleotides (referred to herein as vpdN), phosphonate vinyl-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides (cPrpN).2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as a lowercase "n" in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotides), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, multiple modifications can be incorporated into a single AAT RNAi agent or even into a single nucleotide thereof. AAT RNAi agent sense and antisense strands can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0192] Modified nucleotides include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) derivatives of adenine and guanine, 2-methyl- ... n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0193] According to some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand that are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are ribonucleotides. According to some embodiments, one or more nucleotides of an RNAi agent are ribonucleotides.

[0194] Modified internucleoside linkages: According to some embodiments, one or more nucleotides of an AAT RNAi agent are linked by a non-standard bond or backbone (i.e., a modified internucleoside bond or backbone). Modified internucleoside bond or backbone include, but are not limited to, 5'-phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino bonds, and the usual 3'-5 ... Boranophosphates having a 3'-5' linkage, an analog of a 2'-5' linked boranophosphate, or a boranophosphate with reverse polarity, where pairs of adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. According to some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to: short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short chain heteroatom or heterocyclic intersugar linkages. According to some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 moieties.

[0195] According to some embodiments, the sense strand of the AAT RNAi agent comprises 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the AAT RNAi agent comprises 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently comprise 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. According to some embodiments, the sense strand of the AAT RNAi agent comprises 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the AAT RNAi agent comprises 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently comprise 1, 2, 3, or 4 phosphorothioate linkages.

[0196] According to some embodiments, the AAT RNAi agent sense strand comprises at least two phosphorothioate internucleoside linkages. According to some embodiments, the at least two phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3' end of the sense strand. According to some embodiments, the at least two phosphorothioate internucleoside linkages are between nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. According to some embodiments, the AAT RNAi agent antisense strand comprises four phosphorothioate internucleoside linkages. According to some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 5' end of the antisense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. According to some embodiments, the AAT RNAi agent comprises at least two phosphorothioate internucleoside linkages and three or four phosphorothioate internucleoside linkages in the antisense strand.

[0197] In some embodiments, the AAT RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0198] AAT RNAi Agent: According to some embodiments, the AAT RNAi agents disclosed herein target the AAT gene at or near a location in the AAT genome set forth in Table 1. According to some embodiments, the antisense strand of an AAT RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target AAT 19-mer sequence disclosed in Table 1.

[0199] [Table 1-1] [Table 1-2] [Table 1-3]

[0200] According to some embodiments, the AAT RNAi agent comprises an antisense strand, wherein position 19 (5'→3') of the antisense strand can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. According to some embodiments, the AAT RNAi agent comprises an antisense strand, wherein position 1 (5'→3') of the antisense strand can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0201] According to some embodiments, the AAT RNAi agent comprises an antisense strand, wherein position 2 (5'→3') of the antisense strand can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. According to some embodiments, the AAT RNAi agent comprises an antisense strand, wherein positions 2-18 (5'→3') of the antisense strand can base pair with each of the complementary bases located at positions 18-2 of a 19-mer target sequence disclosed in Table 1.

[0202] For the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3'-end) of the antisense strand can be perfectly complementary to the AAT gene, or can be non-complementary to the AAT gene. According to some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand is U, A, or dT. According to some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0203] According to some embodiments, the AAT RNAi agent antisense strand comprises nucleotide sequence (5' to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, 3, or 4. According to some embodiments, the AAT RNAi agent sense strand comprises nucleotide sequence (5' to 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, 3, or 5.

[0204] According to some embodiments, the AAT RNAi agent comprises (i) an antisense strand comprising nucleotide sequence (5'->3'-end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, 3, or 4, and (ii) a sense strand comprising nucleotide sequence (5'->3'-end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, 3, or 5.

[0205] According to some embodiments, the AAT RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below.

[0206] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9]

[0207] [Table 3-1] [Table 3-2]

[0208] AAT RNAi agents and antisense strands comprising or consisting of nucleotide sequences in Tables 2 or 3 can be modified or unmodified nucleotides. According to some embodiments, AAT RNAi agents having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences in Tables 2 or 3 are all or substantially all modified nucleotides.

[0209] According to some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or 3. According to some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or 3.

[0210] As used herein, each N nucleotide listed in the sequences disclosed in Table 2 can be independently selected. According to some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. According to some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. According to some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobase as the N nucleotide at the corresponding position on the other strand. According to some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase from the N nucleotide at the corresponding position on the other strand.

[0211] Particular modified AAT RNAi agent sense and antisense strands are provided in Tables 4 and 5. Modified AAT RNAi agent antisense strands, and their underlying terminally modified nucleobase sequences, are provided in Table 4. Modified AAT RNAi agent sense strands, and their underlying terminally modified nucleobase sequences, are provided in Table 5. In forming an AAT RNAi agent, each nucleotide in each terminally modified sequence listed in Tables 4 and 5, and Tables 2 and 3, above, can be a modified nucleotide.

[0212] The AAT RNAi agent described herein is formed by annealing sense strand and antisense strand.The sense strand that comprises the sequence listed in Table 2, 3 or 5 can be hybridized with any antisense strand that comprises the sequence listed in Table 2, 3 or 4, provided that these two sequences have at least 85% complementary region over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0213] According to some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Tables 2, 3, or 4.

[0214] According to some embodiments, the AAT RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Tables 2 or 3.

[0215] Examples of antisense strands containing modified nucleotides are provided in Table 4. Examples of sense strands containing modified nucleotides are provided in Table 5.

[0216] As used in Tables 4 and 5, the following notations are used to denote modified nucleotides, targeting groups, and linking groups. Those skilled in the art will readily understand that unless otherwise specified, when present in an oligonucleotide, the monomers are linked to each other by 5'-3'-phosphodiester bonds: A = adenosine-3'-phosphate. C = cytidine-3'-phosphate. G = guanosine-3'-phosphate. U = uridine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N UNA = 2',3'-seconucleotide mimic (unlocked nucleobase analogue)-3'-phosphate N UNAS = 2',3'-seconucleotide mimic (unlocked nucleobase analogue)-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNAS = 2',3'-seco-uridine-3'-phosphorothioate a_2N = see Table 7 a_2Ns = see Table 7 pu_2N = See Table 7 pu_2Ns = See Table 7 Npu = See Table 7 Nus = see Table 7 N LNA = locked nucleotide N fANA = 2'-F-arabinonucleotide NM = 2'-methoxyethyl nucleotide AM = 2'-methoxyethyl adenosine-3'-phosphate AMs = 2'-methoxyethyl adenosine-3'-phosphorothioate TM = 2'-methoxyethylthymidine-3'-phosphate TMs = 2'-methoxyethylthymidine-3'-phosphorothioate R = Ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 7. (invAb)s = inverse (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 7 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate bond vpdN = vinylphosphonate deoxyribonucleotide (5Me - Nf) = 5'-Me, 2'-fluoronucleotide cPrp = cyclopropylphosphonate, see Table 7. epTcPr = see Table 7 epTM = see Table 7 (Chol-TEG)=See Table 7 (TEG-biotin) = See Table 7. (PEG - C3 - SS)=See Table 7 (Alk-SS-C6)=See Table 7 (C6 - SS - Alk)=See Table 7 (C6 - SS - Alk - Me)=See Table 7

[0217] Those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each given monomer ex vivo, instead of a phosphate group. Unless otherwise specified herein, this understanding of those skilled in the art will be used when describing the AAT RNAi agents and compositions of AAT RNAi agents disclosed herein.

[0218] Targeting groups and binding groups include the following, the chemical structures of which are provided in Table 7 below: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG 29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand can have any of the targeting groups or binding groups listed above, as well as other targeting groups or binding groups, covalently attached to the 5' and / or 3' ends of the sequence.

[0219] [Table 4-1] [Table 4-2] [Table 4-3]

[0220] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0221] The AAT RNAi agent described herein is formed by annealing sense strand and antisense strand.The sense strand that comprises the sequence listed in Table 2, 3 or 5 can be hybridized with any antisense strand that comprises the sequence listed in Table 2, 3 or 4, provided that these two sequences have at least 85% complementary region over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0222] According to some embodiments, the antisense strand of an AAT RNAi agent disclosed herein differs from any of the antisense strands in Table 4 by 0, 1, 2, or 3 nucleotides. According to some embodiments, the sense strand of an AAT RNAi agent disclosed herein differs from any of the sense strands in Table 5 by 0, 1, 2, or 3 nucleotides.

[0223] According to some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2, 3, or 4. According to some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, 3, or 4. According to certain embodiments, the AAT RNAi agent antisense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 4.

[0224] According to some embodiments, the AAT RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, 3, or 5. According to some embodiments, the AAT RNAi agent sense strand comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2, 3, or 5. According to certain embodiments, the AAT RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 4.

[0225] With respect to the AAT RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the AAT gene or can be non-complementary to the AAT gene. According to some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT (or modified versions of U, A, or dT). According to some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0226] According to some embodiments, the AAT RNAi agent antisense strand comprises nucleotide sequence (5' to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Tables 2, 3, or 4. According to some embodiments, the AAT RNAi agent sense strand comprises nucleotide sequence (5' to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Tables 2, 3, or 5.

[0227] According to some embodiments, the AAT RNAi agent comprises (i) an antisense strand comprising nucleotide sequence (5'->3'-end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, 3, or 4, and (ii) a sense strand comprising nucleotide sequence (5'->3'-end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, 3, or 5.

[0228] A sense strand comprising a sequence listed in Table 2, 3, or 5 can hybridize to any antisense strand comprising a sequence listed in Table 2, 3, or 5, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. According to some embodiments, an AAT RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 5, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 4. Representative sequence pairings are illustrated by the duplex identification numbers shown in Table 6.

[0229] According to some embodiments, the AAT RNAi agent comprises any of the duplexes represented by any of the duplex identification numbers provided herein. According to some embodiments, the AAT RNAi agent consists of any of the duplexes represented by any of the duplex identification numbers provided herein. According to some embodiments, the AAT RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex identification numbers provided herein. According to some embodiments, the AAT RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex identification numbers provided herein, and a targeting group and / or binding group covalently attached to the sense or antisense strand. According to some embodiments, the AAT RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the duplex identification numbers provided herein. According to some embodiments, the AAT RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the duplex identification numbers provided herein, and a targeting group and / or binding group covalently attached to the sense or antisense strand.

[0230] According to some embodiments, the AAT RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Tables 2, 3, or 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0231] According to some embodiments, the AAT RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 2 or 5, and further comprises a targeting group selected from the group consisting of: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NA (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. According to some embodiments, the targeting group is (NAG25) or (NAG25)s, as defined in Table 7. According to other embodiments, the targeting group is (NAG37) or (NAG37)s, as defined in Table 7.

[0232] According to some embodiments, the AAT RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense and / or sense strand nucleotide sequences of any of the duplexes in Table 6.

[0233] According to some embodiments, the AAT RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense and / or sense strand nucleotide sequences of any of the duplexes in Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0234] According to some embodiments, the AAT RNAi agent comprises the duplex structure of any of the duplexes in Table 6.

[0235] According to some embodiments, the AAT RNAi agent consists of the duplex structure of any of the duplexes in Table 6.

[0236] [Table 6-1] [Table 6-2] [Table 6-3]

[0237] In some embodiments, the AAT RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agent described herein inhibits or knocks down the expression of one or more AAT genes in vivo upon delivery to cells that express the AAT gene.

[0238] Targeting Groups, Binding Groups and Delivery Vehicles: According to some embodiments, the AAT RNAi agent is covalently linked to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. According to some embodiments, the AAT RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. According to some embodiments, the non-nucleotide group is linked to the 5' end of the AAT RNAi agent sense strand. The non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. According to some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0239] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0240] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific distribution and / or cell-specific uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have higher valency with respect to the target to which they are directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibodies with affinity for cell surface molecules. According to some embodiments, the targeting group is attached to the RNAi agent using a linker, such as a PEG linker, or in some cases, one, two, or three abasic and / or ribitol (abasic ribose) residues, which can act as linkers. According to some embodiments, the targeting group comprises a galactose derivative cluster.

[0241] The AAT RNAi agents described herein can be synthesized with a reactive group, such as an amine group, at the 5' end, which can then be used to attach a targeting group using methods typical in the art.

[0242] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose that have affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-(n)-butanoylgalactosamine, and N-iso-butanoylgalactosamine (see, e.g., ST Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0243] Galactose derivatives have been used to target molecules to hepatocytes in vivo via their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of an asialoglycoprotein receptor ligand to the asialoglycoprotein receptor promotes cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. The asialoglycoprotein receptor ligand can be a monomer (e.g., having a single galactose derivative) or a polymer (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. Preparation of targeting groups, such as galactose derivative clusters, is described, for example, in U.S. Patent Application No. 15 / 452,324 and U.S. Patent Publication No. US2017 / 0253875, the contents of both of which are incorporated herein by reference in their entireties.

[0244] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule via its C-1 carbon. According to some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a three-arm galactose derivative or a trivalent galactose derivative). According to some embodiments, the galactose derivative cluster includes an N-acetyl-galactosamine. According to some embodiments, the galactose derivative cluster includes three N-acetyl-galactosamines. According to some embodiments, the galactose derivative is a galactose derivative tetramer (also referred to as a four-arm galactose derivative or a tetravalent galactose derivative). According to some embodiments, the galactose derivative cluster includes four N-acetyl-galactosamines.

[0245] As used herein, a galactose derivative trimer contains three galactose derivatives, each attached to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each attached to a central branch point. The galactose derivatives are attached to the central branch point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are attached to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group. (See, e.g., U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branch point to an RNAi agent. Examples of branch point groups are di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur via a linker or spacer. According to some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. According to some embodiments, the linker comprises a rigid linker, such as a cyclic group. According to some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. According to some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0246] Embodiments of the present disclosure include pharmaceutical compositions for delivering AAT RNAi agents to living cells in vivo. Such pharmaceutical compositions can include, for example, AAT RNAi agents conjugated to galactose derivative clusters. According to some embodiments, the galactose derivative clusters are composed of galactose derivative trimers, which can be, for example, N-acetyl-galactosamine trimers, or galactose derivative tetramers, which can be, for example, N-acetyl-galactosamine tetramers.

[0247] Targeting groups include, but are not limited to, the following as defined in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NA G29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0248] According to some embodiments, a linking group is covalently attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group or a delivery polymer or delivery vehicle. The linking group can be linked to the 3' or 5' end of the RNAi agent sense strand or antisense strand. According to some embodiments, the linking group is linked to the RNAi agent sense strand. According to some embodiments, the linking group is covalently attached to the 5' or 3' end of the RNAi agent sense strand. According to some embodiments, the linking group is covalently attached to the 5' or 3' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0249] A linker or linking group is a bond between two atoms that connects one chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage includes a labile bond. A linkage can optionally include a spacer that increases the distance between the two linked atoms. A spacer can further add flexibility and / or length to the linkage. Spacers can include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, alkyl groups, and alkenyl groups; each of which can include one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the above list is not intended to limit the scope of the description.

[0250] Any of the AAT RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5 can include a 3' or 5' targeting group or linking group, whether modified or not. Any of the AAT RNAi agent sequences listed in Tables 4 or 5 that include a 3' or 5' targeting group or linking group, or cannot include a 3' or 5' targeting group or linking group, or can include a different 3' or 5' targeting group or linking group, including, but not limited to, those shown in Table 7. Any of the AAT RNAi agent duplexes listed in Tables 2, 3, or 6, whether modified or not, can further include a targeting group or linking group, including, but not limited to, those shown in Table 7, and the targeting group or linking group can be attached to the 3' or 5' end of either the sense or antisense strand of the AAT RNAi agent duplex.

[0251] Examples of targeting groups and linking groups are provided in Table 7. Table 5 provides several embodiments of AAT RNAi agent sense strands with targeting groups or linking groups attached to the 5' or 3' end.

[0252] [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6] [Table 7-7] [Table 7-8] [Table 7-9] [Table 7-10] [Table 7-11] [Table 7-12] [Table 7-13] [Table 7-14] [Table 7-15] [Table 7-16] [Table 7-17]

[0253] In each of the above structures in Table 7, NAG comprises N-acetyl-galactosamine or another asialoglycoprotein receptor ligand, as will be understood by one of skill in the art in view of the above structures and descriptions provided herein. For example, according to some embodiments, NAG in the structures provided in Table 7 is represented by the following structure: [ka]

[0254] Each (NAGx) can be attached to the AAT RNAi agent via a phosphate group (such as (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group ((NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or other linking group: [ka]

[0255] Other linking groups known to those skilled in the art may be used.

[0256] According to some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. The delivery vehicle is a compound that improves delivery of RNAi to a cell or tissue. The delivery vehicle can include, but is not limited to, a polymer, such as an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine. According to some embodiments, the RNAi agent can be combined with a lipid, a nanoparticle, a polymer, a liposome, a micelle, a DPC, or other delivery system available in the art. RNAi agents may also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

[0257] Pharmaceutical Compositions and Formulations: The AAT RNAi agent disclosed herein can be prepared as a pharmaceutical composition or formulation. According to some embodiments, the pharmaceutical composition comprises at least one AAT RNAi agent. The pharmaceutical composition is particularly useful for inhibiting the expression of target mRNA in a target cell, cell group, tissue, or organism. The pharmaceutical composition can be used to treat a subject with a disease or disorder that would benefit from a reduction in the level of target mRNA or an inhibition of the expression of a target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in the level of target mRNA or an inhibition of the expression of a target gene. According to some embodiments, a method is provided for administering an AAT RNA agent bound to a targeting ligand as described herein to a subject to be treated. According to some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition containing the AAT RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human.

[0258] Pharmaceutical compositions comprising AAT RNAi agents and methods comprising administering to a subject a therapeutically effective amount of the AAT RNAi agents described herein reduce the level of target mRNA in a cell, group of cells, tissue or subject, thereby inhibiting expression of AAT mRNA in the subject.

[0259] According to some embodiments, the described pharmaceutical compositions comprising AAT RNAi agents are used to treat or manage clinical symptoms in subjects with AATD, such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, tonsillitis, cholestasis, fibrosis, and even fulminant hepatic failure. According to some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. According to some embodiments, administration of the disclosed AAT RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0260] The pharmaceutical compositions described, comprising AAT RNAi agents, can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting the expression of AAT mRNA. According to some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising AAT RNAi agents, thereby treating the symptom. According to other embodiments, the subject is administered a therapeutically effective amount of one or more AAT RNAi agents, thereby preventing at least one symptom.

[0261] The administration route is the route by which the AAT RNAi agent comes into contact with the body. Generally, methods for administering drugs and nucleic acids for the treatment of mammals are well known to those skilled in the art and can be applied to the administration of the compositions described herein. The AAT RNAi agent disclosed herein can be administered via any suitable route in a preparation appropriately tailored to a specific route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally. According to some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0262] Pharmaceutical compositions comprising the AAT RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Any suitable method generally recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. According to certain embodiments, the compositions are administered subcutaneously or intravenously by infusion or injection.

[0263] Thus, according to some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0264] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one described AAT RNAi agent and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., AAT RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can a) aid in processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) act to enhance the overall stability, efficacy, or any other attribute of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0265] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, bulking agents, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0266] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0267] Sterile injectable solution can be prepared by incorporating the required amount of active compound into suitable solvent with one or combination of the ingredients listed above as needed, and then sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle that contains basic dispersion medium and other ingredients that are required from those listed above.For the preparation of sterile powder for sterile injectable solution, preparation method includes vacuum drying and freeze-drying, which obtains powder of active ingredient and any additional desired ingredients from its sterile filtered solution.

[0268] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ocular administration.

[0269] Therapeutic compounds can be prepared with carriers that will protect the compound against rapid excretion from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. They can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0270] AAT RNAi agent can be formulated in the composition in dosage unit form for ease of administration and uniformity of dosage.Dosage unit form refers to a physically separate unit that is adapted as a unit dose for the subject to be treated; each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect together with required pharmaceutical carrier.The dosage unit system of the present disclosure is determined and directly depends on the unique characteristics of active compound and the therapeutic effect to be achieved, and the inherent limitations of the technical field of preparing such active compound for individual treatment.

[0271] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory drugs (e.g., antihistamines, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs expressing or containing the RNAi agent defined herein can be used as a "pharmaceutical composition." As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent to produce pharmacological, therapeutic, or preventive results.

[0272] Generally, an effective amount of active compound will be in the range of about 0.1 to about 100 mg / kg body weight / day, e.g., about 1.0 to about 50 mg / kg body weight / day. According to some embodiments, an effective amount of active compound will be in the range of about 0.25 to about 5 mg / kg body weight per administration. According to some embodiments, an effective amount of active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per administration. The amount administered will also depend on variables such as the patient's overall health, the relative biological availability of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Also, in some cases, the initial dose administered may be increased beyond the upper levels noted above to rapidly achieve desired blood or tissue levels, or in some cases, the initial dose may be less than optimal.

[0273] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein, including an AAT RNAi agent, are combined with an excipient or a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0274] When the described AAT RNAi agents are added to a pharmaceutically acceptable excipient or adjuvant, they can be packaged in a kit, container, pack or dispenser. The pharmaceutical compositions described herein can be packaged in pre-filled syringes or vials.

[0275] Treatment methods and inhibition of expression: The AAT RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from the administration of the compounds. According to some embodiments, the RNAi agents disclosed herein can be used to treat subjects with symptoms, diseases, or disorders that would benefit from reducing or inhibiting the expression of AATD or AAT mRNA, such as AATD liver disease. The subject is administered a therapeutically effective amount of any one or more of the AAT RNAi agents described herein. The subject can be a human or a patient. The subject can be an adult, adolescent, child, or infant. The described pharmaceutical compositions containing the AAT RNAi agents can be used to provide methods for therapeutic treatment of diseases, such as AATD. Such methods include administering the pharmaceutical compositions described herein to humans or animals.

[0276] According to some embodiments, the AAT RNAi agent described herein is used to treat subjects with AATD, including symptoms, diseases or disorders related to AATD. AATD liver diseases or disorders include, but are not limited to, chronic hepatitis, cirrhosis, hepatocellular carcinoma, tonsillitis, cholestasis, fibrosis and fulminant hepatic failure. According to some embodiments, the AAT RNAi agent described is used to treat at least one symptom in subjects with AATD. The subject is administered a therapeutically effective amount of one or more of the RNAi agents described.

[0277] According to certain embodiments, the present invention provides a method for treating AATD in a patient in need thereof, comprising administering to the patient any of the AAT RNAi agents described herein.

[0278] According to some embodiments, AAT RNAi agents are used to treat or manage the clinical symptoms of subjects with AATD liver disease or disorders.The subjects are administered a therapeutically effective amount of one or more AAT RNAi agents or compositions containing AAT RNAi agents as described herein.According to some embodiments, the method comprises administering a composition comprising the AAT RNAi agent as described herein to the subject to be treated.

[0279] According to some embodiments, the gene expression level and / or mRNA level of the AAT gene in a subject administered with a described AAT RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or 99% or more compared to the subject before administration of the AAT RNAi agent or to a subject that has not received the AAT RNAi agent. The gene expression level and / or mRNA level in a subject is reduced in cells, cell groups, and / or tissues of the subject.

[0280] According to some embodiments, the protein level of AAT in a subject administered with a described AAT RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the AAT RNAi agent or to a subject not receiving the AAT RNAi agent. The protein level in the subject is reduced in the subject's cells, cell populations, tissues, blood, and / or other bodily fluids.

[0281] According to some embodiments, Z-AAT polymer protein levels in a subject with AATD to which a described AAT RNAi agent is administered are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% relative to the subject prior to administration of the AAT RNAi agent or relative to a subject not receiving the AAT RNAi agent. According to some embodiments, Z-AAT polymer protein levels in a subject administered a described AAT RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% relative to the subject prior to administration of the AAT RNAi agent or relative to a subject not receiving the AAT RNAi agent.

[0282] The reduction of AAT gene expression, AAT mRNA or AAT protein level can be assessed and quantified by common methods known in the art. The examples disclosed herein demonstrate commonly known methods for assessing the inhibition of AAT gene expression and the reduction of AAT protein level. The reduction or decrease of AAT mRNA level and / or protein level (including Z-AAT polymer and / or monomer) is collectively referred to herein as the reduction or decrease of AAT or the inhibition or reduction of AAT expression.

[0283] Cells and tissues, and non-human organisms: Cells, tissues, and non-human organisms are contemplated that contain at least one of the AAT RNAi agents described herein. The cells, tissues, or non-human organisms are produced by delivering the RNAi agent to the cells, tissues, or non-human organisms.

[0284] The embodiments and items provided above are illustrated by the following non-limiting examples. [Example]

[0285] Example 1. Identification of RNAi Agent Sequences and Synthesis of RNAi Agents: The selection process to identify lead sequences for inhibiting AAT gene expression began with an in silico approach to identify conserved sequences across variants of the AAT gene (SEQ ID NO: 1). AAT sequences were first screened using bioinformatics for 19-nucleotide sequences with complementary sequences in known variants of human AAT. Sequences known to have manufacturing problems and those predicted to have low RNAi activity based on known parameters were eliminated. Next, the sequences were subjected to cross-species reactivity analysis to select candidates that would cross-react with cynomolgus monkey AAT. The sequences were also evaluated for specificity to avoid off-target effects on the human and cynomolgus monkey genomes. A family of 115 19-mer sequences was selected as candidates.

[0286] The duplexes in Table 6 herein were synthesized according to the following procedure.

[0287] Synthesis: The sense and antisense strands of the AAT RNAi agent were synthesized on a solid phase used for oligonucleotide synthesis using the phosphoramidite technique. Depending on the scale, either MerMade96E® (Bioautomation) or MerMade12® (Bioautomation) was used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). In particular, the following 2'-O-methyl phosphoramidites were used: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, 5'-O-dimethoxy-trityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, 5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxy-trityl-2'-O-methyluridine-3'- O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. 2'-Deoxy-2'-fluoro-phosphoramidite carried the same protecting groups as 2'-O-methyl RNAamidite.The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. Trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0288] The target ligand-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM). All other amidites were dissolved in anhydrous acetonitrile (50 mM), and molecular bonds (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 15 min (target ligand), 90 s (2'OMe), and 60 s (2'F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0289] Cleavage and deprotection of support-bound oligomers: After completion of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt % methylamine and 28% ammonium hydroxide solution (Aldrich) in water for 2 hours at 30° C. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0290] purification; The crude oligomer was purified by anion-exchange HPLC using a TKSgel SuperQ-5PW 13µ column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, and contained 20% acetonitrile, and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. The UV trace at 260 nm was recorded. Appropriate fractions were pooled and then run on a size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 media containing a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0291] Annealing: Complementary strands were mixed to form RNAi agents by combining equimolar RNA solutions (sense and antisense) in 0.2x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). This solution was placed in a 70°C thermomixer, heated to 95°C, held at 95°C for 5 minutes, and then slowly cooled to room temperature. Some RNAi agents were lyophilized and stored at 15 to -25°C. Duplex concentrations were determined by measuring the solution absorbance in 0.2x PBS on a UV-Vis spectrometer. The solution absorbance at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. Unless otherwise noted, all conversion factors were 0.037 mg / (ml·cm). For some experiments, the conversion factor was calculated from the experimentally determined extinction coefficient.

[0292] Example 2. In vitro testing of AAT RNAi agents Candidate sequence duplexes were tested in vitro. The antisense and sense strand sequences were annealed to form 21-mer duplexes (with 19 base pairs and dinucleotide UU overhangs on each 3' end) for in vitro testing, as shown in Table 8 below:

[0293] [Table 8-1] [Table 8-2] [Table 8-3]

[0294] AAT RNAi agents were evaluated by transfection of Hep3B cells, a human hepatocellular carcinoma line. Cells were plated at approximately 10,000 cells per well in a 96-well format, and each of the 115 AAT RNAi agent duplexes was transfected at three concentrations (10 nM, 1 nM, and 0.1 nM) using LipoFectamine RNAiMax (Thermo Fisher) transfection reagent. The relative expression of each of the 115 AAT RNAi agents was determined by qRT-PCR by comparing the expression level of AAT mRNA to an endogenous control and normalized to untreated Hep3B cells (ΔΔC ), as shown in Table 9. T analysis).

[0295] [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]

[0296] Example 3. In vivo testing of NAG-binding AAT RNAi agents in PiZ mice AAT RNAi agents were evaluated in vivo using the transgenic PiZ mouse model (PiZ mouse), which carries the human PiZ AAT mutant allele and models human AATD (Carlson et al., Journal of Clinical Investigation 1989).

[0297] NAG-conjugated AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate knockdown of AAT gene expression. On day 1, each mouse received a single subcutaneous (SQ) dose of 5.0 mg / kg (mpk) of either AD04446, AD04447, AD04448, AD04449, AD04450, AD04451, AD04454, AD04455, AD04456, AD04457, AD04458, or AD04459 into the loose skin on the back between the shoulders. (See Tables 4-7 for modified AAT RNAi agent and NAG ligand structures.) AAT RNAi agents AD04451 and AD04459 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1000; AAT RNAi agents AD04446 and AD04454 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1142; AAT RNAi agents AD04447 and AD04455 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1211; AAT RNAi agents AD04448 and AD04456 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1326; AAT RNAi agents AD04449 and AD04457 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1338; and AAT RNAi agents AD04450 and AD04458 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1427. (See also Tables 1 and 2.) Three mice were administered each AAT RNAi agent (n=3).

[0298] Plasma samples were collected and analyzed for AAT (Z-AAT) protein levels on days 1 (pre-dose), 8, 15, 22, 29, and 36. AAT levels were normalized to AAT plasma levels on day 1 (pre-dose). Protein levels were measured by quantifying circulating human Z-AAT levels in plasma using a commercially available ELISA kit according to the manufacturer's recommendations. The average normalized AAT (Z-AAT) levels for each RNAi agent are reported in Table 10 below.

[0299] [Table 10]

[0300] As shown by the data in Table 10 above, AAT RNAi agent D04447 showed essentially no reduction in AAT protein, while AAT RNAi agents AD04458 (containing a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1427) and AD04459 (containing a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000) showed substantial reduction in AAT protein across all time points. For example, AD04458 showed knockdown of about 69% (0.308) at day 8, about 83% (0.174) at day 15, and about 82% (0.177) at day 22. Furthermore, for example, AD04459 showed knockdown of about 74% (0.256) at day 8, about 87% (0.134) at day 15, and about 83% (0.174) at day 22.

[0301] Example 4. In vivo testing of NAG-binding AAT RNAi agents in cynomolgus monkeys NAG-conjugated AAT RNAi agents were prepared and combined in a pharmaceutically acceptable saline buffer, as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus monkey (Macaca fascicularis) primates ("cynomolgus monkeys" are referred to as "monkeys") were subcutaneously injected with 3 mg / kg of AD04824, AD04825, AD04826, or AD04827 (see Tables 4-7 for modified AAT RNAi agent and NAG ligand structures). Each of these AAT RNAi agents contained a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000 and cross-react with cynomolgus monkeys. Three monkeys in each group were tested (n=3).

[0302] Serum samples from treated cynomolgus monkeys were collected on days -7 and 1 (pre-dose), and days 8, 15, 22, and 29 to monitor knockdown. On day 36, AD04825 and AD04826-injected cynomolgus monkeys were measured. At the indicated time points, blood samples were collected and analyzed for cynomolgus AAT (cAAT). Blood was collected from the vena cava. cAAT levels were determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer's recommendations. The AAT level for each animal at each time point was divided by the pretreatment level of expression in that animal (the average of days -7 and 1 (pre-dose)) to determine a "normalized to pre-dose" expression ratio.

[0303] Normalized cynomolgus monkey AAT (cAAT) protein levels after treatment with each respective AAT RNAi agent are reported in Table 11 below.

[0304] [Table 11]

[0305] The mean normalized cAAT levels for each of the respective treatment groups are shown in the bar graphs in Figure 9. As shown in Table 11 above and Figure 9, each of the AAT RNAi agents tested showed substantial knockdown of cAAT in cynomolgus monkeys across all time points measured.

[0306] Example 5. In vivo testing of NAG-binding AAT RNAi agents in cynomolgus monkeys NAG-conjugated AAT RNAi agents were prepared and combined in a pharmaceutically acceptable saline buffer, as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus monkey (Macaca fascicularis) primates were subcutaneously injected with 3 mg / kg of AD04828, AD04831, AD04836, or AD04837 (see Tables 4-7 for modified AAT RNAi agent and NAG ligand structures). Each of these AAT RNAi agents contained a modified nucleotide sequence designed to target the AAT gene at position 1000 (SEQ ID NO: 1) and cross-react with cynomolgus monkeys. Three monkeys in each group were tested with AD04828 and AD04831 (n=3), and two monkeys in each group were tested with AD04836 and AD04837 (n=2).

[0307] Serum samples from treated cynomolgus monkeys were collected on days -35 and 1 (pre-dose), and on days 8, 15, 21, and 29 to monitor knockdown. At the indicated time points, blood samples were collected and analyzed for cAAT. Blood was collected from the vena cava. cAAT levels were determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer's recommendations. The cAAT level for each animal at each time point was divided by the pre-treatment level of expression in that animal (the average of days -35 and 1 (pre-dose)) to determine a "normalized to pre-dose" expression ratio.

[0308] Normalized cynomolgus monkey AAT (cAAT) protein levels after treatment with each respective AAT RNAi agent are reported in Table 12 below.

[0309] [Table 12]

[0310] The mean normalized cAAT levels for each of the respective treatment groups are shown in the bar graphs in Figure 10. As shown in Table 12 above and the bar graphs in Figure 10, each of the AAT RNAi agents tested showed substantial knockdown of cAAT in cynomolgus monkeys across all time points measured.

[0311] Example 6. In vivo testing of NAG-binding AAT RNAi agents in cynomolgus monkeys AAT RNAi agents were evaluated in vivo using the transgenic PiZ mouse model (PiZ mouse) as described in Example 3. NAG-linked AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate knockdown of AAT gene expression. On day 1, each mouse received a single subcutaneous (SQ) dose of 2.0 mg / kg (mpk) of either AD04824, AD04828, AD04829, AD04830, AD04831, AD04832, AD04833, AD04834, AD04836, AD04837, AD04838, AD04839, or AD04857 into the loose skin on the back between the shoulders. (See Tables 4-7 for modified AAT RNAi agent and NAG ligand structures.) Each of the AAT RNAi agents in this study contained a modified nucleotide antisense strand sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000. (See also Tables 1 and 2.) Three mice were administered each AAT RNAi agent (n=3).

[0312] Plasma samples were collected and analyzed for AAT (Z-AAT) protein levels on days -2, 1 (pre-dose), 8, 15, 22, 29, and 36. AAT levels were normalized to AAT plasma levels on day 1 (pre-dose). Protein levels were measured by quantifying circulating human Z-AAT levels in plasma using a commercially available ELISA kit according to the manufacturer's recommendations. The average normalized AAT (Z-AAT) levels for each RNAi agent are reported in Table 13 below.

[0313] [Table 13]

[0314] As shown by the data in Table 13 above, each of the AAT RNAi agents showed a substantial reduction in AAT protein by at least day 29. For example, at day 15, each AAT RNAi agent tested achieved at least 70% protein knockdown compared to pre-treatment levels, with multiple groups achieving greater than 90% knockdown.

[0315] Example 7. In vivo testing of NAG-binding AAT RNAi agents in cynomolgus monkeys The transgenic PiZ mouse model described in Example 3 was used. Each mouse was 5 weeks old at the start of the study. A NAG-binding AAT RNAi agent was prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate knockdown of AAT gene expression. Starting on day 1, each mouse received a subcutaneous (SQ) dose of 4.0 mg / kg (mpk) of the following into the loose skin on the back between the shoulders at a q2w (i.e., one injection every two weeks for a total of four injections): (1) saline vehicle; (2) AD04837 (see Tables 4-7 for modified AAT RNAi agent and NAG ligand structures), which contains a modified nucleotide antisense strand sequence designed to target the AAT gene at position 1000 (SEQ ID NO: 1), as previously described; or (3) a NAG-binding RNAi agent containing a nucleotide sequence targeting the HBV gene, used as a negative control. Single subcutaneous injections of the saline vehicle group, the AAT RNAi agent group, and the HBV RNAi agent group were administered on days 1, 15, 29, and 43. Seven mice received saline vehicle q2w (Group 1); nine mice received AAT RNAi agent q2w (Group 2); and six mice received HBV RNAi agent q2w (Group 3). Mice in the three treatment groups were sacrificed on day 57 (13 weeks of age). In addition to the treatment groups, seven mice were sacrificed during the first week of the study (i.e., 5-week-old mice) to serve as baseline controls.

[0316] Plasma samples were collected and analyzed for AAT (Z-AAT) protein levels in all groups on days 1 (pre-dose), 8, 15, 22, 29, and 36. Additional samples for the AAT RNAi agent group and saline vehicle group were collected on days 43, 50, and 57. AAT levels were normalized to AAT plasma levels on day 1 (pre-dose). Protein levels were measured by quantifying circulating human Z-AAT levels in plasma using a commercially available ELISA kit according to the manufacturer's recommendations. The mean normalized AAT (Z-AAT) levels for saline vehicle and each RNAi agent are reported in Table 14 below.

[0317] [Table 14]

[0318] As shown by the data in Table 14 above, the HBV RNAi agent served well as a negative control, exhibiting essentially no AAT inhibition. Furthermore, the NAG-binding AAT RNAi agent (AD09837) achieved significant knockdown of expression at all time points compared to the saline and HBV RNAi agent negative controls. When administered q2w, the AAT RNAi agent in Example 7 demonstrated approximately 96% AAT protein knockdown (0.040) at day 36 and maintained a similar level of knockdown through day 57.

[0319] In addition to monitoring serum AAT levels, we further analyzed homogenized liver tissue from PiZ mice treated with NAG-binding AAT RNAi agent (AD04837) to determine whether both soluble Z-AAT (presumably primarily a monomeric protein) and insoluble Z-AAT polymer (presumably a polymeric protein) were effectively reduced. A modified Western blot protocol was used to separate soluble and insoluble Z-AAT fractions under non-denaturing conditions, as previously described and known in the art (see, e.g., Mueller et al., Molecular Therapy, March 2012, 20(3): 590-600).

[0320] Western blots were prepared to examine specific livers from sacrificed mice. Specifically, the following livers were examined: (i) six baseline mice; (ii) five AAT RNA-treated mice; and (iii) four saline mice. (The gel used for Western blot analysis contained 15 wells.) Animal samples used for this Western blot were randomly selected from various groups. Figures 11 and 12 show bar graphs reflecting the quantified Z-AAT polymer and Z-AAT monomer levels from Western blot analysis.

[0321] As can be seen from the bar graphs in Figure 11, which reports monomer protein levels, mice administered the AAT RNAi agent showed a significant decrease in AAT monomer protein across all time points when compared to baseline, suggesting significant inhibition of the gene. Furthermore, as shown in Figure 12, which reports polymer protein levels, animals treated with saline vehicle continued to have elevated polymeric AAT loads after 8 weeks. Conversely, animals treated with the AAT RNAi agent showed a decrease in polymer content of approximately 50% over 8 weeks compared to baseline (5-week-old) mice, suggesting that administration of the NAG-binding AAT RNAi agent (AD09837) can prevent, and potentially reverse, the production of polymeric AAT protein.

[0322] Example 8. In vivo testing of NAG-binding AAT RNAi agents in cynomolgus monkeys The transgenic PiZ mouse model described in Example 3 was used to evaluate RNAi agents in vivo. On day 1, each mouse received a single subcutaneous (SQ) administration of either: (1) saline; (2) 1.0 mg / kg AD04837, a NAG-binding AAT RNAi agent (containing a modified nucleotide antisense strand sequence designed to target the AAT gene at position 1000 (SEQ ID NO: 1)); (3) 2.0 mg / kg AD04837; (4) 4.0 mg / kg AD04837; or (5) 8.0 mg / kg AD04837. Four animals received group 1 (saline), and all four were sacrificed on day 43. Fifteen animals were administered to each of groups 2, 3, 4 and 5, and three animals from each group were sacrificed on days 8, 15, 22, 29 and 43, respectively.

[0323] Plasma samples were collected and AAT (Z-AAT) protein levels were analyzed for all groups on days 1 (pre-dose), 8, 15, 22, 29, 36, and 43. For sacrificed mice, cardiac puncture was performed for serum isolation for Z-AAT protein level assessment (200 μl of plasma). AAT levels were normalized to AAT plasma levels on day 1 (pre-dose). Protein levels were measured by quantifying circulating human-AAT levels in plasma with a commercially available ELISA kit according to the manufacturer's recommendations. The mean normalized AAT (Z-AAT) levels for saline vehicle and each RNAi agent-treated group are reported in Table 15 below.

[0324] [Table 15]

[0325] As shown by the data in Table 15 above, the NAG-binding AAT RNAi agent achieved significant knockdown of expression compared to saline across all time points measured at all dose levels tested.

[0326] Furthermore, AAT mRNA levels were also assessed for mice sacrificed at each time point. As described above, for groups 2 to 5 (i.e., RNAi agent groups), three mice were sacrificed on days 8, 15, 22, 29, and 43, respectively; and for group 1, all four mice were sacrificed on day 43. Half of the left liver lobe was collected and flash-frozen in liquid nitrogen for RNA isolation.

[0327] [Table 16]

[0328] As shown in Table 16 above, relative AAT mRNA expression levels were significantly reduced across all measured time points compared to saline vehicle. For example, on day 15, Group 2 (1.0 mg / kg AAT RNAi agent) showed an approximately 58% reduction in AAT mRNA levels (0.419); Group 3 (2.0 mg / kg AAT RNAi agent) showed an approximately 67% reduction in AAT mRNA levels (0.327); Group 4 (4.0 mg / kg AAT RNAi agent) showed an approximately 84% reduction in AAT mRNA levels (0.161); and Group 5 (8.0 mg / kg AAT RNAi agent) showed an approximately 94% reduction in AAT mRNA levels (0.055).

[0329] Other embodiments While the present invention has been described in conjunction with a detailed description thereof, the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. An RNAi agent for inhibiting expression of the alpha-1 antitrypsin (AAT) gene, comprising: (a) Below (5' → 3'): (i) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913); (ii) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958); (iii) usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959); and (iv) usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960); an antisense strand having a nucleotide sequence selected from: wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; and s is a phosphorothioate linkage; and (b) a sense strand complementary to the antisense strand, wherein all nucleotides on the sense strand are modified nucleotides; wherein the sense strand is linked to a targeting group that comprises N-acetyl-galactosamine.

2. The RNAi agent of claim 1 , wherein the sense strand is 30 nucleotides or less in length and the antisense strand is 30 nucleotides or less in length.

3. 3. The RNAi agent of claim 1, wherein the sense strand is 24 nucleotides or less in length and the antisense strand is 24 nucleotides or less in length.

4. The RNAi agent according to any one of claims 1 to 3, wherein the sense strand and the antisense strand are each 21 to 24 nucleotides in length.

5. The RNAi agent of any one of claims 1 to 4, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

6. The RNAi agent of any one of claims 1 to 5, wherein the RNAi agent has two blunt ends.

7. The RNAi agent of any one of claims 1 to 6, wherein the targeting group comprises an N-acetyl-galactosamine trimer.

8. 8. The RNAi agent of any one of claims 1 to 7, wherein the targeting group has a structure selected from the group consisting of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

9. The RNAi agent of any one of claims 1 to 8, wherein the RNAi agent comprises a targeting group conjugated to the 5' end of the sense strand.

10. 10. The RNAi agent of any one of claims 1-9, wherein the sense strand comprises the sequence (5' → 3')agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s is a phosphorothioate linkage; and optionally present on the sense strand are one or two inverted basic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages.

11. the sense strand comprises the sequence (5'→3')(NAG37)s(invAb)sagcguuuaGfGfCfauguuuaacas(invAb) (SEQ ID NO:1033), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s is a phosphorothioate linkage; and (invAb) is an inverted basic deoxyribose residue, and (NAG37)s has the following chemical structure: 【Chemical 1】 The RNAi agent according to any one of claims 1 to 9, comprising:

12. The RNAi agent of claim 11 , wherein the RNAi agent has the duplex structure of SEQ ID NOs: 960 and 1033.

13. 10. The RNAi agent of any one of claims 1-9, wherein the sense strand comprises the sequence (5' → 3')cguuuaGfGfCfauguuuuaacausu (SEQ ID NO: 1276), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s is a phosphorothioate linkage; and optionally present on the sense strand are one or two inverted basic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages.

14. the sense strand of the RNAi agent comprises the sequence (5'→3')(NAG37)s(invAb)scguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO: 1028), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s is a phosphorothioate linkage; and (invAb) is an inverted basic deoxyribose residue, and (NAG37)s has the following chemical structure: 【Chemistry 2】 The RNAi agent of claim 13, having the formula:

15. The RNAi agent of claim 14, wherein the RNAi agent has a duplex structure of SEQ ID NOs: 913 and 1028.

16. 10. The RNAi agent of any one of claims 1-9, wherein the sense strand comprises the sequence (5' → 3') gcguuuaGfGfCfauguuuuaacausu (SEQ ID NO: 1277), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s is a phosphorothioate linkage; and optionally present on the sense strand are one or two inverted basic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages.

17. the sense strand comprises the sequence (5'→3') (NAG37)s(invAb)sgcguuuaGfGfCfauguuuaacausu(invAb) (SEQ ID NO:1030), where a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; s is a phosphorothioate linkage; and (invAb) is an inverted basic deoxyribose residue, and (NAG37)s has the following chemical structure: 【Chemistry 3】 The RNAi agent according to any one of claims 1 to 9, comprising:

18. 18. The RNAi agent of claim 17, wherein the RNAi agent has the duplex structure of SEQ ID NOs: 958 and 1030.

19. 10. The RNAi agent of any one of claims 1-9, wherein the sense strand comprises the sequence (5' → 3') cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s is a phosphorothioate linkage; and optionally present on the sense strand are one or two inverted basic deoxyribose residues (invAb) and / or one, two, three, or four phosphorothioate internucleoside linkages.

20. the sense strand comprises the sequence (5'→3') (NAG37)s(invAb)scgcguuuaGfGfCfauguuuaacas(invAb) (SEQ ID NO:1024), where a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted basic deoxyribose residue, and (NAG37)s has the following chemical structure: 【Chemistry 4】 20. The RNAi agent of claim 19, having the following structure:

21. The RNAi agent of claim 20, wherein the RNAi agent has a duplex structure of sequence pair numbers 959 and 1024.

22. A composition comprising the RNAi agent of any one of claims 1 to 21 and at least one pharmaceutically acceptable excipient.

23. 23. The composition of claim 22, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.

24. 23. The composition of claim 22, wherein the composition is formulated for administration by subcutaneous injection.

25. The composition of any one of claims 22 to 24 for use in a method for inhibiting expression of the AAT gene in a subject, comprising administering to the subject an effective amount of the composition of any one of claims 22 to 24.

26. 25. The composition of any one of claims 22 to 24 for use in a method for treating alpha-1 antitrypsin deficiency (AATD), comprising administering a therapeutically effective amount of the composition of any one of claims 22 to 24 to a subject in need thereof.

27. 25. The composition of any one of claims 22 to 24 for use in a method for treating a condition or disease caused by alpha-1 antitrypsin deficiency (AATD), comprising administering to a subject in need thereof a therapeutically effective amount of the composition of any one of claims 22 to 24.

28. 13. A composition comprising the RNAi agent of claim 12 and at least one pharmaceutically acceptable excipient.

29. 16. A composition comprising the RNAi agent of claim 15 and at least one pharmaceutically acceptable excipient.

30. 20. A composition comprising the RNAi agent of claim 18 and at least one pharmaceutically acceptable excipient.

31. 21. A composition comprising the RNAi agent of claim 20 and at least one pharmaceutically acceptable excipient.

32. The RNAi agent of claim 1, wherein the RNAi agent has a duplex structure of SEQ ID NOs: 960 and 1279.

33. The RNAi agent of claim 1, wherein the RNAi agent has a duplex structure of SEQ ID NOs: 913 and 1276.

34. The RNAi agent of claim 1, wherein the RNAi agent has a duplex structure of SEQ ID NOs: 958 and 1277.

35. The RNAi agent of claim 1, wherein the RNAi agent has a duplex structure of SEQ ID NOs: 959 and 1278.

36. 29. A pharmaceutical composition for treating alpha-1 antitrypsin deficiency (AATD), including symptoms or diseases caused by or resulting from AATD, comprising a therapeutically effective amount of the composition of claim 28.

37. 30. A pharmaceutical composition for treating alpha-1 antitrypsin deficiency (AATD), including symptoms or diseases caused by or resulting from AATD, comprising a therapeutically effective amount of the composition of claim 29.

38. 31. A pharmaceutical composition for treating alpha-1 antitrypsin deficiency (AATD), including symptoms or diseases caused by or resulting from AATD, comprising a therapeutically effective amount of the composition of claim 30.

39. 32. A pharmaceutical composition for treating alpha-1 antitrypsin deficiency (AATD), including symptoms or diseases caused by or resulting from AATD, comprising a therapeutically effective amount of the composition of claim 31.

Images