Compound and method for adjusting SMN2
By modulating SMN2 RNA splicing with oligomeric compounds, the expression of full-length SMN protein is enhanced, addressing the molecular basis of SMA and improving symptoms such as muscle weakness and breathing difficulties.
Patent Information
- Application Number
- JP2025096506
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-02-28
- Filing Date
- 2025-06-10
- Publication Date
- 2025-09-17
AI Technical Summary
Current treatments for spinal muscular atrophy (SMA) do not effectively address the molecular basis of the disease, which is the loss of both copies of the motor neuron survival gene 1 (SMN1) and the inefficient expression of SMN2, leading to a predominance of unstable, non-functional SMNΔ7 protein.
Compounds and methods are developed to modulate SMN2 RNA splicing, specifically using oligomeric compounds, including modified oligonucleotides, to increase the expression of full-length SMN2 protein by enhancing the inclusion of exon 7 in SMN2 transcripts.
These compounds ameliorate symptoms of SMA by increasing full-length SMN protein expression, thereby improving muscle function, breathing, and overall survival rates in SMA patients.
Smart Images

Figure 2025134750000001 
Figure 2025134750000002 
Figure 2025134750000003
Abstract
Description
[Technical Field]
[0001] Sequence Listing This application has been filed in electronic format along with a Sequence Listing, which is provided as a file entitled BIOL0367WOSEQ_ST25.txt, 44 KB in size, created on February 26, 2021. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.
[0002] Compounds, methods, and pharmaceutical compositions are provided for modulating SMN2 RNA in cells or subjects. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom of a neurodegenerative disease. Such symptoms include muscle weakness; muscle weakness; inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased breathing; inability or decreased ability to eat, drink, and / or breathe unassisted; weight loss or decreased weight gain; and / or decreased survival rate. [Background technology]
[0003] Proximal spinal muscular atrophy (SMA) is a genetic neurodegenerative disorder characterized by the loss of spinal motor neurons. SMA is an early-onset, autosomal recessive disorder and a leading genetic cause of death in infants. Because the severity of SMA varies among patients, it is classified into four types. Type I SMA is the most severe form, occurring at birth or within six months of birth, and typically results in death within two years. Children with type I SMA are unable to sit or walk. Type II SMA is an intermediate form; patients can sit but cannot stand or walk. Patients with type III SMA, a chronic form of the disease, typically develop the disease by 18 months of age (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531–1536). Type IV SMA is a milder form, usually developing after age 18, sometimes after age 10. Patients with type IV SMA have limited, mild motor impairment, are able to walk in adulthood, and generally do not have respiratory or feeding problems (Farrar et al., Ann. Neurol, 2017, 81, 355-368; D'Amico et al., Orphanet J. of Rare Diseases, 2011, 6:71).
[0004] The molecular basis of SMA is the loss of both copies of the motor neuron survival gene 1 (SMN1), also known as the SMN telomeric form, which encodes a protein that is part of a multiprotein complex thought to be involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2, potentially also known as the SMN centromeric form, resides in a duplicated region on chromosome 5q13 and modulates disease severity. While SMN1 and SMN2 may encode the same protein, normal SMN1 gene expression results in the expression of only the full-length motor neuron survival (SMN) protein, while SMN2 gene expression results in two distinct protein forms: the full-length SMN2 protein and a truncated SMN2 protein, SMNΔ7. SMN2 contains a translationally silent mutation at position +6 of exon 7, resulting in inefficient inclusion of exon 7 in SMN2 transcripts. Thus, the predominant form of SMN2 is a truncated form lacking exon 7, which is unstable and inactive (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). Expression of the SMN2 gene results in approximately 10-20% full-length SMN protein and 80-90% unstable / non-functional SMNΔ7 protein. The SMN protein has an established role in spliceosome assembly and may also mediate mRNA transport in axons and nerve terminals.
[0005] It is an object of the present invention to provide compounds, methods and pharmaceutical compositions for treating SMA. Summary of the Invention
[0006] Compounds, methods, and pharmaceutical compositions are provided for modulating splicing of SMN2 RNA in a cell or subject. In certain embodiments, compounds useful for modulating splicing of SMN2 RNA are oligomeric compounds. In certain embodiments, oligomeric compounds increase the amount of SMN2 RNA containing exon 7. In certain embodiments, oligomeric compounds increase expression of full-length SMN2 protein. In certain embodiments, oligomeric compounds comprise modified oligonucleotides. In certain embodiments, the subject has a neurodegenerative disease. In certain embodiments, the subject has spinal muscular atrophy (SMA).
[0007] Also provided are methods useful for ameliorating at least one symptom of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SMA. In certain embodiments, the symptoms include muscle weakness; inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased breathing; inability or decreased ability to eat, drink, and / or breathe unassisted; weight loss or decreased weight gain; and / or decreased survival rate. In certain embodiments, provided herein are modified oligonucleotides for treating SMA. DETAILED DESCRIPTION OF THE INVENTION
[0008] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms, such as "includes" and "included," is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components comprising a single unit and elements and components comprising two or more subunits, unless expressly stated otherwise.
[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter of the invention described. All documents, or portions of documents, cited herein, including but not limited to patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety, as well as with respect to the portions of the documents discussed herein.
[0010] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0011] Unless otherwise indicated, the following terms have the following meanings:
[0012] As used herein, "2'-deoxyribonucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. Xyribonucleosides are 2'-β-D-deoxyribonucleosides and contain a 2'-β-D-deoxyribosyl sugar moiety having the β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxyribonucleosides may contain modified nucleobases or may contain RNA nucleobases (uracil).
[0013] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" refers to O-methoxyethyl.
[0014] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.
[0015] As used herein, "2'-NMA" refers to a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-NMA sugar moiety" refers to a 2'-O-CH2-C(=O)-NH-CH3 group with the sugar moiety in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" refers to ON-methylacetamide.
[0016] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.
[0017] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-OMe sugar moiety" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D configuration. "OMe" refers to O-methyl.
[0018] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.
[0019] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to a sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent group other than H or OH.
[0020] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.
[0021] As used herein, "administering" means giving a pharmaceutical agent to a subject.
[0022] As used herein, "amelioration" in the context of treatment means that at least one symptom is improved compared to the same symptom in the absence of the treatment. In certain embodiments, amelioration is a decrease in the severity or frequency of a symptom, or a delay in the onset or progression of the severity or frequency of a symptom. In certain embodiments, the symptom is muscle weakness; an inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased breathing; an inability or decreased ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival rate.
[0023] As used herein, "antisense activity" refers to the ability of an antisense compound to bind to its target. It refers to any detectable and / or measurable change that results from hybridization to a nucleic acid. As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of exerting at least one antisense activity.
[0024] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0025] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, where the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0026] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
[0027] As used herein, "cEt" means a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge having a formula of 4'-CH(CH3)-O-2', and the bridging methyl group is in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety with a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge is 4'-CH(CH3)-O-2', and the bridging methyl group is in the S configuration. "cEt" means constrained ethyl.
[0028] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.
[0029] As used herein, a "chirally enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or proportion of molecules in the population having a particular stereochemical configuration at a particular chiral center is greater than the number or proportion of molecules expected to have the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chirally enriched population of molecules having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
[0030] As used herein with respect to oligonucleotides, "complementary" means that at least 70% of the nucleobases of an oligonucleotide, or one or more portions thereof, and another nucleic acid, or one or more portions thereof, can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in reverse. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids need not have complementary nucleobases at each nucleoside. Rather, some mismatches are permitted. As used herein with respect to an oligonucleotide or portion thereof, "fully complementary" or "100% complementary" means that an oligonucleotide or portion thereof is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
[0031] As used herein in the context of oligonucleotides, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.
[0032] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.
[0033] As used herein, "internucleoside linkage" refers to the covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. "Phosphorothioate internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0034] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compounds are aligned.
[0035] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0036] As used herein, a "non-bicyclic modified sugar moiety" refers to a modified sugar moiety having a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, a "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" includes adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" refers to an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is one of the modified nucleobases. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.
[0037] As used herein, "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moieties are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. As used herein, "linked nucleosides" are nucleosides linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).
[0038] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. An oligomeric duplex Each oligomeric compound in the strand may be referred to as a "double-stranded oligomeric compound."
[0039] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide is composed of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.
[0040] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution.
[0041] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to a subject. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a pill, tablet, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0042] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects to the parent compound.
[0043] As used herein, "RNA" means RNA transcripts, and includes pre-mRNA and mature mRNA, unless otherwise specified.
[0044] As used herein in the context of a population of molecules of the same molecular formula, a "stereorandom chiral center" refers to a chiral center having a random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having stereorandom chiral centers in the (S) configuration may be, but is not necessarily, the same as the number of molecules having stereorandom chiral centers in the (R) configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0045] As used herein, "subject" means a human or non-human animal.
[0046] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0047] As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as, for example, an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. The oxides can be incorporated at one or more positions within an oligonucleotide, and such an oligonucleotide can hybridize to a complementary oligomeric compound or target nucleic acid.
[0048] As used herein, "standard in vivo assay" means the assay described in Example 2 and reasonable variations thereof.
[0049] As used herein, "symptom" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to the subject or a medical professional examining or testing the subject.
[0050] As used herein, "target nucleic acid" means the nucleic acid which an antisense compound is designed to affect.
[0051] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0052] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.
[0053] As used herein, a "therapeutically effective amount" refers to an amount of an agent that provides a therapeutic benefit to a subject, e.g., an amount that ameliorates a symptom of a disease.
[0054] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:
[0055] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 16, 17, 18, 19 or 20 linked nucleosides, and having a nucleobase sequence comprising at least 15 or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0056] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 17, 18, 19 or 20 linked nucleosides, and having a nucleobase sequence comprising at least 15, at least 16, or at least 17 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-27, 29-30, or 32-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0057] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 18, 19 or 20 linked nucleosides, and having a nucleobase sequence comprising at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-27, 30 or 33-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0058] Embodiment 4. A nucleic acid comprising 19 or 20 linked nucleosides and at least 15, at least 16, at least 17, at least 18, or at least 19 consecutive nucleosides of any of the nucleic acid base sequences of SEQ ID NOs: 20, 22, 24-27, 30, 33-50. 1. An oligomeric compound comprising a modified oligonucleotide having the nucleobase sequence comprising modified nucleobases, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0059] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 15, at least 16, or at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20, 22, 25, 27, 35, 39-46, or 49, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0060] Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 87.5%, 88.2%, 89%, 89.4%, 90%, 93.7%, 94%, 94.7%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 when measured across the entire nucleobase sequence of the modified oligonucleotide.
[0061] Example 7. なななななななななななななながが、sososssssssssssss、ssossssssssssss、ssossssossssoss、ssosssossssoss、soosssssssssooss、sooosssssssss ooss、sooosssssssoooss、ssssssss、ssosssssssssss、s ...、sssssssssssssss、ssssssssssssss ssssss、sssssssssssosss、ssssssssssssss、sos ...、sosssssssssssssss、sossssssssssssss、sossssssssss ssssssss、s ...、ssssssssssssssss、soosssssssssssssss、ssssssssssssss、sssssssssssss sssssssss、s ...、ssssssssssssssss、sssssssssssssss、sssssssssssssss、ssssssssssssss、sssssssssssss ossssssssss、 ...、sssssssssssss、ssssssssssss、ssssssssssss、ss oossssssoooss、s ...s、ssssssssssssssss、ss sssssssssosss、s ...sssssssoosssssssss、sssssssssssss、ssssssssssssss、sssssssssssssss、sosssssssssssssssss、sossssssssssssssssss、sosssssssssssssssss、soossssssssssssssss、ossssssssssssssssssso、ssssssssssssssssssss soo、ssssssssssssssssoss、s ... , selected from sossssssssssssssoss, sosssssssosssssssss, sososssssssssssssss, soossssssssssssssss, sssssssssssssssss, sssssssssssssssssso, ossssssssssssssssss, sssssssssososso, ssssssssssssoss, ssssssssssososs, ssssssosssssssss, ssssssossssssoss, sossssssssssssssss, sosssssssssssssoss, sossssssosssssssss, sosossssssssssssss, ssssssssssooooss, ssssssssoooossss, sssssssooossssss, ssssssoooossssss, ssssssooooosssss, ssssssoooooosssss, ssssssooooooossss, sssssoooossssssss, ssossssssssssoss, ssosssssossssoss, ssosssosssossoss, ssossossossososs, ssososososososss, ssoooossssssssss, soosssssssssooss, sooossssssssooss, sooosssssssoooss, soooossssssoooss, ssssssssssooooss, ssssssssoooosss, ssssssooossssss, ssssssoooosssss, ssssssooooosssss, ssssssoooooossss, sssssoooosssssss, sssssooooooossss, sssosssosssosss, ssosssssssssoss, ssossossossosss, ssossossosososs, ssososososososs, ssoooosssssssss, soossssssssooss, sooosssssssooss, sooossssssoooss, and soooosssssoooss, having an internucleoside linkage motif (5' to 3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkageThe oligomeric compound according to any one of embodiments 1 to 6.
[0062] Embodiment 8. The oligomeric compound of any one of embodiments 1-6, wherein the modified oligonucleotide has an internucleoside linkage motif selected from ssssssssssssssssxs and ssssssssssssssssx, where "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "x" represents a methoxypropylphosphonate internucleoside linkage.
[0063] Embodiment 9. The oligomeric compound of any of embodiments 1-6, wherein said modified oligonucleotide has an internucleoside linkage motif selected from zzzzzzzzzzzzzzzzzz, ssssssssssszzzzzz, ssssszzzzzzzzsssssss, zzooooooooooooozz, zzzzooooooooooozz, zzzzzzzooooooooozz, zzzzzzzooooooooozz, zzzzzzzzzooooooozz and ssoooooooooooooss, wherein "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "z" represents a mesylphosphoramidate internucleoside linkage.
[0064] Embodiment 10. The modified oligonucleotide is selected from the group consisting of eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, nnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnn, nennnneennnnnnn, nnnnnnnnnnnnenneen, nennnnneneenenneen, nnnnnnnnnnnnnnnnnne, nnnnnnnnnnnnnnnnnnd, nnnnnnnnnn nnnnnnny、nnnnnnnnnnnnnnnnndd、nnnnnnnnnnnnnnned、nnnnnnnnnnnnnnnde、nnnnnnnnnnnnnnnnee、eeeeeeeeeeeeeeeeedd、eeeeeeeeeeeeeeeeeeed、eeeeeeeeeeeeeeeeeeeeed、nnnnnnnnnnnnnd、nnnnnnnnnnnnnne、eeeeeeeeeeeeeeeeed、keekeekeekeeekeeek、keeeeekeeeeeek、keeeeekeeeeeek、keeeeeeeeeeeek、keeeeeeeeeek、eeeeeeekkeeeeeeeeeeeeeeek, eekeekeekeekeekek, eekeekeekeekeekee, eeeeekeekeekeekee, eeeeeekeekeekeeee, eeeeeekeeeeeeeeee, keekeekeekeeeeee, eeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeeekeekeek , keekeeeeeeeeeeeeee, eeeeeeeeeeeeeekeek, keekeekeekeekeekeek, keekeeekeeekeek, keeeekeeeekeeeek, keeeeeekeeeeeek, keeeeeeeeeeeeeek, kekeekeekeekeeke, eekeekeekeekeeke, eeeeekeekeekeeke, eeeeek 10. The oligomeric compound of any of embodiments 1-9, having a sugar moiety motif (5' to 3') selected from eekeekeeee, eeeeekeeeeeekeeee, keekeekeekeeeeee, eeeeeekeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeekeekeekeek, keekeekeeeeeeeeeeee, eeeeeeeeeeeeeee, eeeeeeeeeeeeeekeekeek, eeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeeey, ennnnnnnnnnnnnnnnnnnn, and ennnnnnnnnnnnnnnnnne, wherein "e" represents a 2'-MOE sugar moiety, "n" represents a 2'-NMA sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety.
[0065] Embodiment 11. The oligomeric compound of any of embodiments 1-9, wherein said modified oligonucleotide has a sugar motif (5' to 3') selected from nnnnnnnnnnnnnnnenn and nnnnnnnnnnnnnnnnen, where "e" represents a 2'-MOE sugar moiety and "n" represents a 2'-NMA sugar moiety.
[0066] Embodiment 12. The oligomeric compound of any of embodiments 1-9, wherein the modified oligonucleotide has a sugar motif (5' to 3') of qqnqqqqqnqnnqnqqnn, wherein each "n" represents a 2'-NMA sugar moiety, and each "q" is independently selected from a 2'-O-(N,N-dimethyl)acetamide sugar moiety, a 2'-O-(N-ethyl)acetamide sugar moiety, a 2'-O-(N-propyl)acetamide sugar moiety, a 2'-O-(N-cyclopropyl)acetamide sugar moiety, and a 2'-O-(N-cyclopropylmethyl)acetamide sugar moiety.
[0067] Embodiment 13 The oligomeric compound of any of embodiments 1-9, wherein said modified oligonucleotide comprises at least one modified sugar moiety.
[0068] Embodiment 14 The oligomeric compound of embodiment 13, wherein said modified oligonucleotide comprises at least one bicyclic sugar moiety.
[0069] Embodiment 15. The oligomeric compound of embodiment 14, wherein said bicyclic modified sugar moiety has a 4'-2' bridge, and said 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.
[0070] Embodiment 16 The oligomeric compound of embodiment 13, wherein said modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.
[0071] Embodiment 17 The oligomeric compound of embodiment 16, wherein said non-bicyclic modified sugar moiety is any of a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.
[0072] Embodiment 18 The oligomeric compound of embodiment 13, wherein said modified oligonucleotide comprises at least one sugar surrogate.
[0073] Embodiment 19 The oligomeric compound of embodiment 18, wherein the sugar surrogate is any of a morpholino, a modified morpholino, a PNA, a THP, and an F-HNA.
[0074] Embodiment 20. The oligomeric compound of any of embodiments 1-6 and 10-19, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.
[0075] Embodiment 21 The oligomeric compound of embodiment 20, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.
[0076] Embodiment 22 The oligomeric compound of embodiment 20 or embodiment 21, wherein said modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0077] Embodiment 23 The oligomeric compound of any of embodiments 1-20 or 22, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0078] Embodiment 24. The oligomeric compound of any of embodiments 20, 22, or 23, wherein each said internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
[0079] Embodiment 25. The oligomeric compound of any of embodiments 13-19, wherein the modified oligonucleotide has an internucleoside linkage motif (5' to 3') selected from: sosossssssssssss, sooossssssssssssss, sosssosssssssssss, sosssssosssssssss, sossssssosssssss, sssoossssssssss, sssssssoosssssss, sssssssssoosssssss, and ssssssssssssoossss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.
[0080] Embodiment 26 The oligomeric compound of any of embodiments 1-25, wherein said modified oligonucleotide comprises a modified nucleobase.
[0081] Embodiment 27 The oligomeric compound of embodiment 26, wherein said modified nucleobase is 5-methylcytosine.
[0082] Embodiment 28. The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
[0083] Embodiment 29. The oligomeric compound of any of embodiments 1 to 28, wherein said modified oligonucleotide comprises one or two non-complementary nucleobases.
[0084] Embodiment 30. The oligomeric compound of any of embodiments 1-29, wherein said modified oligonucleotide comprises one or two cleavable moieties.
[0085] Embodiment 31 The oligomeric compound of embodiment 30, wherein said cleavable moiety is a phosphodiester internucleoside linkage.
[0086] Embodiment 32. The oligomeric compound of any one of embodiments 1 to 31, consisting of the modified oligonucleotide.
[0087] Embodiment 33. The oligomeric compound of any of embodiments 1-32, wherein said oligomeric compound is a single-stranded oligomeric compound.
[0088] Embodiment 34. The following chemical notation: m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es Ges m C e A modified oligonucleotide (SEQ ID NO: 21) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage.
[0089] Embodiment 35. A compound having the following chemical notation: T eo T es m C es A es m C es T es T es T es m C es A es T es A es A es T es G es m C es T es G es G eo m C e A modified oligonucleotide (SEQ ID NO: 22) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage.
[0090] Embodiment 36. A compound having the following chemical notation: T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e A modified oligonucleotide (SEQ ID NO: 22) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage.
[0091] Embodiment 37. The following chemical notation: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns Ans T ns G ns m C ns T ns G ns G ns m C n A modified oligonucleotide (SEQ ID NO: 21) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage.
[0092] Embodiment 38. The following chemical structure: [ka] A modified oligonucleotide (SEQ ID NO: 21) or a salt thereof, based on
[0093] Embodiment 39. The modified oligonucleotide of embodiment 38, which is a sodium salt or a potassium salt.
[0094] Embodiment 40. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 21).
[0095] Embodiment 41. The following chemical structure: [ka] A modified oligonucleotide (SEQ ID NO: 22) or a salt thereof, based on
[0096] Embodiment 42 The modified oligonucleotide of embodiment 41, which is a sodium salt or a potassium salt.
[0097] Embodiment 43. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 22).
[0098] Embodiment 44. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 22), or a salt thereof.
[0099] Embodiment 45. The modified oligonucleotide of embodiment 44, which is a sodium salt or a potassium salt.
[0100] Embodiment 46. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 22).
[0101] Embodiment 47. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 21), or a salt thereof.
[0102] Embodiment 48. The modified oligonucleotide of embodiment 47, which is a sodium salt or a potassium salt.
[0103] Embodiment 49. The following chemical structure: [ka] A modified oligonucleotide based on (SEQ ID NO: 21).
[0104] Embodiment 50. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1 to 36 or the modified oligonucleotide of any of embodiments 38 to 49, and a pharmaceutically acceptable carrier or diluent.
[0105] Embodiment 51. The pharmaceutical composition of embodiment 50, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or PBS.
[0106] Embodiment 52. The pharmaceutical composition of embodiment 51, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and artificial CSF (aCSF).
[0107] Embodiment 53 The pharmaceutical composition of embodiment 51, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and PBS.
[0108] Embodiment 54. A chirally enriched population of modified oligonucleotides of any of embodiments 38 to 49, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
[0109] Embodiment 55. The chirally enriched population of embodiment 54, wherein said population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.
[0110] Embodiment 56. The chirally enriched population of embodiment 54, wherein said population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.
[0111] Embodiment 57. The chirally enriched population of embodiment 54, wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
[0112] Embodiment 58. The chirally enriched population of embodiment 57, wherein said population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.
[0113] Embodiment 59. The chirally enriched population of embodiment 57, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each remaining phosphorothioate internucleoside linkage.
[0114] Embodiment 60. The chirally enriched population of embodiment 57, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction.
[0115] Embodiment 61. The population of modified oligonucleotides of any of embodiments 38-49, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.
[0116] Embodiment 62. A method for treating a disease associated with SMN1 or SMN2, comprising administering to a subject having or at risk of developing a disease associated with SMN1 or SMN2 a therapeutically effective amount of the pharmaceutical composition of any of embodiments 50 to 53, thereby treating the disease associated with SMN1 or SMN2.
[0117] Embodiment 63 The method of embodiment 62, wherein the disease associated with SMN1 or SMN2 is a neurodegenerative disease.
[0118] Embodiment 64. The method of embodiment 63, wherein the neurodegenerative disease is spinal muscular atrophy (SMA).
[0119] Embodiment 65. The method of embodiment 64, wherein the SMA is any of SMA Type I, SMA Type II, SMA Type III, or SMA Type IV.
[0120] Embodiment 66. The method of embodiment 64 or embodiment 65, wherein at least one symptom of SMA is ameliorated.
[0121] Embodiment 67. The symptom is one or more of: muscle weakness; inability or decreased ability to sit, stand and / or walk upright; decreased neuromuscular activity; 67. The method of embodiment 66, wherein the patient exhibits any of the following symptoms: decreased electrical activity of muscles; decreased breathing; inability or decreased ability to eat, drink and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival rate.
[0122] Embodiment 68. The method of any of embodiments 62-67, wherein the pharmaceutical composition is administered to the central nervous system or systemically.
[0123] Embodiment 69. The method of embodiment 68, wherein the pharmaceutical composition is administered to the central nervous system and systemically.
[0124] Embodiment 70. The method of any of embodiments 62-67, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly.
[0125] Embodiment 71. A method for increasing SMN2 RNA containing exon 7, comprising contacting a cell, tissue, or organ with the oligomeric compound of any of embodiments 1-37, the modified oligonucleotide of any of embodiments 38-49, or the pharmaceutical composition of any of embodiments 50-53.
[0126] Specific oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0127] Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.
[0128] Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substituents that correspond to the substituents of other types of modified sugar moieties.
[0129] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents on the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"), and 2'-ON-alkylacetamides, such as 2'-ON-methylacetamide ("NMA"), 2'-ON-dimethylacetamide, 2'-ON-ethylacetamide, or 2'-ON-propylacetamide. See, for example, U.S. Patent No. 6,147,200; Prakash et al., 2003, Org. Lett., 5,403-6. "2'-ON-methylacetamide nucleoside" or "2'-NMA nucleoside" is shown below. [ka]
[0130] In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF, OCF, O-Ci-Ci. 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n), or OCH2C(=O)-N(R m )(R n ), where each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 and alkyl, where the 2'-substituents are described in U.S. Patent Nos. 6,531,584 to Cook et al., 5,859,221 to Cook et al., and 6,005,087 to Cook et al. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in International Patent Publication WO 2015 / 106128 to Manoharan et al. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include multiple non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in International Patent Publication No. WO 2008 / 101157 to Migawa et al. and U.S. Patent Publication No. 2013 / 0203836 to Rajeev.
[0131] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2), ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R m )(R n)) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 Alkyl, for example, OCH2C(=O)-N(H)CH3 ("NMA").
[0132] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0133] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.
[0134] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring to form a second ring, thereby providing a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Such 4' to 2' bridging sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., U.S. Patent No. 7,399,845 to Seth et al., U.S. Patent No. 7,569,849 to Bhat et al., U.S. Patent No. 7,569,849 to Seth et al., U.S. Patent No. 7,569,849 to Bhat et al., and the like). No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,283 to Seth et al.), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,425 to Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al. and U.S. Pat. No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al. and U.S. Pat. No. 8,124,745 to Allerson et al.), et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,426 to Seth et al.), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a and R b are independently H, a protecting group, or C1-C 12alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).
[0135] In certain embodiments, such a 4' to 2' bridge is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O--Si(R a )2-, -S(=O) x - and -N(R a )-, where: x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.
[0136] Additional bicyclic sugar moieties are known in the art, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al. al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et al., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al., U.S. Pat.No. 6,770,748 to Imanishi et al.; U.S. Patent No. RE44,779 to Wengel et al.; U.S. Patent No. 6,794,499 to Wengel et al.; U.S. Patent No. 6,670,461 to Wengel et al.; U.S. Patent No. 7,034,133 to Wengel et al.; U.S. Patent No. 8,080,644 to Wengel et al.; U.S. Patent No. 8,034,909 to Wengel et al.; U.S. Patent No. 8,153,365 to Wengel et al.; U.S. Patent No. 7,572,582 to Wengel et al.; and U.S. Patent No. 6,525,191 to Ramasamy et al.; International Patent No. WO2004 / 106356 to Torsten et al.; International Patent No. WO1999 / 014226 to Wengel et al.; International Patent No. WO2007 / 014226 to Seth et al. See U.S. Patent No. 134181 to Seth et al.; U.S. Patent No. 7,547,684 to Seth et al.; U.S. Patent No. 7,666,854 to Seth et al.; U.S. Patent No. 8,088,746 to Seth et al.; U.S. Patent No. 7,750,131 to Seth et al.; U.S. Patent No. 8,030,467 to Seth et al.; U.S. Patent No. 8,268,980 to Seth et al.; U.S. Patent No. 8,546,556 to Seth et al.; U.S. Patent No. 8,530,640 to Seth et al.; U.S. Patent No. 9,012,421 to Migawa et al.; U.S. Patent No. 8,501,805 to Seth et al.; and U.S. Patent Publications U.S. Patent No. 2008 / 0039618 to Allerson et al. and U.S. Patent No. US2015 / 0191727 to Migawa et al.
[0137] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.
[0138] [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).In this specification, the general description of bicyclic nucleosides includes both isomeric configurations.In the embodiments exemplified herein, when the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified, unless otherwise specified, they are in β-D configuration.
[0139] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substitutions and one or more bridging sugar substitutions (eg, 5'-substituted and 4'-2' bridging sugars).
[0140] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, an oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'-position (see, e.g., U.S. Patent No. 7,875,733 to Bhat et al. and U.S. Patent No. 7,939,677 to Bhat et al.) and / or the 5'-position.
[0141] In certain embodiments, the sugar surrogate comprises a ring with more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA"; see, e.g., U.S. Pat. No. 8,088,904 to Swayze et al., U.S. Pat. No. 8,440,803 to Swayze et al., U.S. Pat. No. 8,796,437 to Swayze et al., and U.S. Pat. No. 9,005,906 to Swayze et al.; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides containing additional modified THP compounds having the formula: [ka] wherein, independently, in each of said modified THP nucleosides: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group connecting the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group connecting the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linkage conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J 2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.
[0142] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0143] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510, and U.S. Patent Nos. 5,698,685 to Summerton et al.; 5,166,315 to Summerton et al.; 5,185,444 to Summerton et al.; and 5,034,506 to Summerton et al.). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]
[0144] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."
[0145] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., International Patent Publication No. WO 2011 / 133876.
[0146] Many other bicyclic and tricyclic sugars and sugar surrogate ring structures that can be used in modified nucleosides are known in the art.
[0147] Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobases, which are called abasic nucleosides.
[0148] In certain embodiments, modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted nucleobases. Selected from purine, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in U.S. Patent No. 3,687,808 to Merigan et al., The Concise Encyclopedia of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0149] Publications that teach the preparation of certain of the above and other modified nucleobases include, but are not limited to, U.S. Patent No. 2003 / 0158403 to Manoharan et al.; U.S. Patent No. 2003 / 0175906 to Manoharan et al.; U.S. Patent No. 4,845,205 to Dinh et al.; U.S. Patent No. 5,130,302 to Spielvogel et al.; U.S. Patent No. 5,134,066 to Rogers et al.; U.S. Patent No. 5,175,273 to Bischofberger et al.; U.S. Patent No. 5,367,066 to Urdea et al.; U.S. Patent No. 5,432,272 to Benner et al.; U.S. Patent No. 5,434,257 to Matteucci et al.; U.S. Patent No. 5,457,187 to Gmeiner et al.; U.S. Patent No. 5,459,255 to Cook et al.; Froehler et al. U.S. Patent No. 5,484,908 to Matteucci et al.; U.S. Patent No. 5,502,177 to Hawkins et al.; U.S. Patent No. 5,525,711 to Hawkins et al.; U.S. Patent No. 5,552,540 to Haralambidis et al.; U.S. Patent No. 5,587,469 to Cook et al.; U.S. Patent No. 5,594,121 to Froehler et al.; U.S. Patent No. 5,596,091 to Switzer et al.; U.S. Patent No. 5,596,091 to Cook et al. No. 5,614,617 to Froehler et al.; U.S. Pat. No. 5,645,985 to Froehler et al.; U.S. Pat. No. 5,681,941 to Cook et al.; U.S. Pat. No. 5,811,534 to Cook et al.; U.S. Pat. No. 5,750,692 to Cook et al.; U.S. Pat. No. 5,948,903 to Cook et al.; U.S. Pat. No. 5,587,470 to Cook et al.; U.S. Pat. No. 5,457,191 to Cook et al.; Matteuc No. 5,830,653 to Froehler et al.; U.S. Pat. No. 5,808,027 to Cook et al.; U.S. Pat. No. 6,166,199 to Cook et al.; and U.S. Pat. No. 6,005,096 to Matteucci et al.
[0150] Certain modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked to each other using any internucleoside bond.Two major types of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.Representative phosphorus-containing internucleoside bond includes, but is not limited to, phosphodiester, phosphotriester, methylphosphonate, methoxypropylphosphonate (MOP), phosphoramidate, mesylphosphoramidate, and phosphorothioate (P(O)=S) and phosphorodithioate (HS-P=S), containing phosphodiester bond ("P(O)=O") (also called unmodified or natural bond). Representative non-phosphorus-containing internucleoside linkages include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages, as compared to naturally occurring phosphate linkages, can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.
[0151] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate internucleoside linkages of a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, in which all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods in which the stereochemical configuration of each phosphorothioate internucleoside linkage is randomly selected. Nevertheless, as will be appreciated by those skilled in the art, each individual oligonucleotide molecule of each individual phosphorothioate has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in independently selected specific stereochemical configurations. In certain embodiments, the specific phosphorothioate internucleoside linkages in the specific configuration are present in at least 65% of the molecules in the population. In certain embodiments, the specific phosphorothioate internucleoside linkages in the specific configuration are present in at least 70% of the molecules in the population. In certain embodiments, the specific phosphorothioate internucleoside linkages in the specific configuration are present in at least 80% of the molecules in the population. In certain embodiments, the specific phosphorothioate internucleoside linkages in the specific configuration are present in at least 90% of the molecules in the population. In certain embodiments, the specific phosphorothioate internucleoside linkages in the specific configuration are present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 2003, 125, 8307; Wan et al. Nuc. Acid. Res., 2014, 42, 13456; and International Patent Publication No. WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides has at least one designated oligonucleotide in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioate each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be sterically random or can be in a specific stereochemical configuration.
[0152] In certain embodiments, modified oligonucleotides comprise a (5' to 3') soooossssssssssssssssss. In certain embodiments, the particular stereochemical configuration of the modified oligonucleotide is (5' to 3') Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, where each "Sp" represents a phosphorothioate internucleoside linkage in the S configuration, Rp represents a phosphorothioate internucleoside linkage in the R configuration, and "o" represents a phosphodiester internucleoside linkage.
[0153] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH moieties.
[0154] In certain embodiments, the modified internucleoside linkages are any of those described in International Patent Publication No. WO2021 / 030778, which is incorporated herein by reference.
[0155] Specific motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. The modified, unmodified, and otherwise modified sugar moieties, nucleobases, and / or internucleoside linkages of a oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif describes modifications to a nucleobase that are independent of the sequence of the nucleobase).
[0156] Specific glycomotifs In certain embodiments, oligonucleotides contain one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or portions thereof in a defined pattern or sugar modification motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.
[0157] In certain embodiments, modified oligonucleotides have a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside in the wing being different from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moiety of at least the nucleoside closest to the gap in each wing (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).
[0158] In certain embodiments, each wing of a gapmer comprises 1 to 6 bicyclic nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleosides of each wing of a gapmer comprise a modified sugar moiety.
[0159] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety, and each remaining nucleoside comprises a 2'-deoxyribosyl sugar moiety.
[0160] Here, the lengths (number of nucleosides) of the three regions of a gapmer can be designated using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When this nomenclature is followed by a specific modification, the modification is a modification of each sugar moiety in each wing, and the gap nucleoside contains a 2'-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-deoxyribonucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing.
[0161] In certain embodiments, each nucleoside of a modified oligonucleotide or portion thereof comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2'-deoxyribosyl sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, a PNA, a THP, and an F-HNA.
[0162] In certain embodiments, a modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety. In certain embodiments, the modified sugar moieties are independently selected from a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, a 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, a bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, a sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA.
[0163] In certain embodiments, each nucleoside of a modified oligonucleotide comprises a modified sugar moiety (a "fully modified oligonucleotide"). In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same modified sugar moiety (a "uniformly modified oligonucleotide"). In certain embodiments, the uniformly modified sugar motif is 7 to 20 nucleosides in length. In certain embodiments, each nucleoside of a uniformly modified sugar motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, a modified oligonucleotide having at least one fully modified sugar motif may also have at least one, at least two, at least three, or at least four 2'-deoxyribonucleosides.
[0164] Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0165] In certain embodiments, modified oligonucleotides comprise blocks of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.
[0166] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0167] Specific internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioates, (Sp) phosphorothioates, and (Rp) phosphorothioates. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, where the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate internucleoside linkages within the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, one or more internucleoside linkages is a mesyl phosphoramidate internucleoside linkage.In certain embodiments, each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, one or more internucleoside linkages are methoxypropyl phosphonate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a methoxypropyl phosphonate internucleoside linkage. In certain embodiments, each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a methoxypropyl phosphonate internucleoside linkage.
[0168] In certain embodiments, the modified oligonucleotides contain phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, or at least 5 phosphodiester internucleoside linkages, with the remaining internucleoside linkages being phosphorothioate internucleoside linkages.
[0169] Specific length The length of the oligonucleotide can be increased or decreased without loss of activity. For example, Woolf et al., Proc. Natl. Acad. Sci. USA, 1992, 89:7305-7309, 1992, tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases long containing 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target nucleic acid, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was obtained using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
[0170] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, an oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13 ...21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 3~16 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces , 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~3 0 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~2 9 pieces, 17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces , 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 1 9~27 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~ 27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, 24 It may consist of up to 28, 24-29, 24-20, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.
[0171] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.
[0172] Certain modified oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif can be modified or unmodified, and the sugar modification may or may not follow the gapmer modification pattern. For example, the internucleoside linkages within the wing regions of a sugar gapmer can be the same or different from each other and the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides can contain one or more modified nucleobases regardless of the gapmer pattern of sugar modification. Unless otherwise indicated, any modifications are independent of the nucleobase sequence.
[0173] Specific populations of modified oligonucleotides A population of modified oligonucleotides, in which all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for both β-D ribosyl sugar moieties of a specific stereochemical configuration and at least one specific phosphorothioate internucleoside linkage.
[0174] Nucleic acid base sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. The oligonucleotide has a nucleobase sequence complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or target nucleic acid.
[0175] Certain oligomeric compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to either or both ends of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both ends of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3'-end and / or 5'-end of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5'-end of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.
[0176] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.
[0177] Specific conjugate groups In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties, and clearance properties. In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows the oligonucleotide to be detected. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al. al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., di- Hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al. al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., International Patent No. WO2014 / 179620).
[0178] Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, fluorescein, rhodamine, coumarin, fluorophores, and dyes.
[0179] In certain embodiments, the conjugate moiety comprises an active ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic drug, antibacterial drug, or antibiotic.
[0180] Conjugated Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is linked to the oligonucleotide via a more complex conjugate linker, which comprises one or more conjugate linker moieties, which are the subunits that make up the conjugate linker. In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside or amino acid units.
[0181] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least It also contains one neutral linking group.
[0182] In certain embodiments, conjugate linkers, including those described above, are bifunctional linking moieties known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. Generally, bifunctional linking moieties contain at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups and nucleophilic groups for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0183] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Including, but not limited to, alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0184] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are generally linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.
[0185] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group containing 1 to 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound may be greater than 30. Alternatively, the oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and containing no conjugate group. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, the conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, the conjugate linker comprises 1 linker nucleoside.
[0186] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, and after the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Therefore, certain conjugate linkers can contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.
[0187] In certain embodiments, the cleavable bond is selected from among an amide bond, an ester bond, an ether bond, one or both ester bonds of a phosphodiester bond, a phosphate ester bond, a carbamate bond, or a disulfide bond. In certain embodiments, the cleavable bond is one or both ester bonds of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0188] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxyribonucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and covalently linked to the remainder of the conjugated linker or conjugated moiety by a phosphate or phosphorothioate internucleoside linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0189] Specific end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.
[0190] oligomeric duplex In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.
[0191] Antisense activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid to confer at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces, modulates, or increases the amount or activity of the target nucleic acid by 25% or more in a standard cellular assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to confer one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.
[0192] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, provided herein are antisense compounds that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides within the gap of a gapmer are tolerated.
[0193] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), and finally target nucleic acid is cleaved.For example, certain antisense compound can cause target nucleic acid to be cleaved by Argonaute.The antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).
[0194] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or another nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in exon inclusion. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an increase in the amount or activity of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in altered splicing, resulting in RNA inclusion.
[0195] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity includes observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.
[0196] Specific target nucleic acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA (including introns, exons, and untranslated regions). In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.
[0197] Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleobase oligonucleotides, as well as 28- and 42-nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, to terminate the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lesser extent than the 28 or 42 nucleobase oligonucleotides.
[0198] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a portion that is 100% or completely complementary to the target nucleic acid. In certain embodiments, the completely complementary portion has a length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acid bases.
[0199] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases relative to the target nucleic acid, hi certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 from the 5' end of the oligonucleotide.
[0200] SMN2 In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide, or a portion thereof, complementary to a target nucleic acid encoding SMN2. In certain embodiments, SMN2 has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14 truncated from nucleotide 19939708 to 19967777).
[0201] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 modulates splicing of SMN2 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 modulates splicing of SMN2 RNA containing exon 7. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 increases the expression of full-length SMN2 protein. In certain embodiments, the oligomeric compound consists of modified oligonucleotides.
[0202] In certain embodiments, contacting cells of a subject with an oligomeric compound complementary to SEQ ID NO: 1 ameliorates one or more symptoms of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SMA, including SMA Type I, SMA Type II, SMA Type III, and SMA Type IV. In certain embodiments, the symptom is any of: muscle weakness; inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased breathing; inability or decreased ability to eat, drink, and / or breathe unassisted; weight loss or decreased weight gain; and / or decreased survival rate.
[0203] In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 are capable of increasing SMN2 RNA containing exon 7 in vivo by at least 1-fold, 2-fold, or 3-fold when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 are capable of increasing full-length SMN2 protein in vivo by at least 1-fold, 2-fold, or 3-fold when administered according to a standard in vivo assay.
[0204] Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS). Such tissues include brain tissue, such as spinal cord, cortex, and coronary brain tissue.
[0205] Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.
[0206] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0207] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain such embodiments, the excipient is selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0208] In certain embodiments, the oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition will depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.
[0209] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is directed to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body. In certain embodiments, prodrugs comprise one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.
[0210] Lipid moieties are used in various ways in nucleic acid therapy. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceuticals to muscle tissue.
[0211] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0212] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compositions provided herein, to a particular tissue or cell type. For example, in certain embodiments, pharmaceutical compositions comprise liposomes coated with a tissue-specific antibody.
[0213] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Particular such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which contains 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v of the non-polar surfactant Polysorbate 80™. % polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied widely without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be varied; for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of the polyethylene glycol can be varied, other biocompatible polymers can replace polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.
[0214] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid in solubility or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0215] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and cation-associated (salt) form, and aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Moreover, a particular oligonucleotide may have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of each form in multiple positions, all of which are in equilibrium. The term "oligonucleotide" is intended to include all such forms. A depicted structure necessarily represents a single form. Nevertheless, unless otherwise indicated, such a drawing is intended to include the corresponding form as well. Herein, when a structure showing the free acid of a compound is followed by the term "or a salt thereof," all such forms, whether fully or partially protonated, deprotonated, or associated with a cation, are expressly included. In certain instances, one or more specific cations are identified.
[0216] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to obtain the desired pH.
[0217] Certain specific dosages will now be described. The dosages may be in the form of dosage units. For clarity, a dosage (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As noted above, in aqueous solution, the free acid may be in anionic and salt form. The amount of the modified oligonucleotide or oligomeric compound is in equilibrium. However, for the purpose of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still counted in the dose weight, and the mass of the Na+ ions is not counted in the dose weight. Thus, for example, a dose or administration unit of 10 mg of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 is equal to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1263789, 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1287717, 10.52 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1287745, and 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1358996. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is assumed to be fully protonated for the purposes of calculating the dosage.
[0218] Specific Composition Compound number: 1263789 In certain embodiments, compound number 1263789 is characterized as a modified oligonucleotide having a sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside is a 2'-MOE sugar moiety, the internucleoside linkages between nucleosides 2-3 and 4-5 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0219] In certain embodiments, compound number 1263789 has the following chemical designation (5' to 3'): m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (SEQ ID NO: 21), where: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.
[0220] In certain embodiments, compound 1263789 is represented by the following chemical structure: [ka]
[0221] Structure 1. Compound number 1263789 In certain embodiments, the sodium salt of compound 1263789 is represented by the following chemical structure: [ka]
[0222] Structure 2. Sodium salt of compound number 1263789 Compound number: 1287717 In certain embodiments, compound number 1287717 is characterized as a modified oligonucleotide having the sequence (5' to 3') of TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each nucleoside contains a 2'-MOE sugar moiety; the internucleoside linkages between nucleosides 1-2 and 19-20 are phosphodiester internucleoside linkages; the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, and 18-19 are phosphorothioate internucleoside linkages; and each cytosine is a 5-methylcytosine.
[0223] In certain embodiments, compound 1287717 has the following chemical designation (5' to 3'): T eo T es m C es A es m C es T es T es T es m C es A es T es Aes A es T es G es m C es T es G es G eo m C e (SEQ ID NO: 22), where: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.
[0224] In certain embodiments, compound 1287717 is represented by the following chemical structure: [ka]
[0225] Structure 3. Compound number 1287717 In certain embodiments, the sodium salt of compound 1287717 is represented by the following chemical structure: [ka]
[0226] Structure 4. Sodium salt of compound number 1287717 Compound number: 1287745 In certain embodiments, compound number 1287745 is a modified oligonucleotide having the sequence (5' to 3') of TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein nucleosides 1 and 20 each contain a 2'-MOE, nucleosides 2-19 each contain a 2'-NMA, and the internucleoside linkages between nucleosides 1-2 and 19-20 are phosphodiesters. and wherein the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, and 18-19 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0227] In certain embodiments, compound number 1287745 has the following chemical designation (5' to 3'): T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e (SEQ ID NO: 22), where: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.
[0228] In certain embodiments, compound 1287745 is represented by the following chemical structure: [ka]
[0229] Structure 5. Compound number 1287745 In certain embodiments, the sodium salt of compound 1287745 is represented by the following chemical structure: [ka]
[0230] Structure 6. Sodium salt of compound number 1287745 Compound number: 1358996 In certain embodiments, compound number 1358996 is characterized as a modified oligonucleotide having the sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside is a 2'-NMA sugar moiety, the internucleoside linkages between nucleosides 2-3 and 4-5 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0231] In certain embodiments, compound number 1358996 has the following chemical representation (5' to 3'): m C ns A no m C ns T no T ns T ns m Cns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ ID NO: 21), where: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase 、 G is a guanine nucleobase, T is a thymine nucleobase, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.
[0232] In certain embodiments, compound 1358996 is represented by the following chemical structure: [ka]
[0233] Structure 7. Compound number 1358996 In certain embodiments, the sodium salt of compound 1358996 is represented by the following chemical structure: [ka]
[0234] Structure 8. Sodium salt of compound number 1358996 Specific Comparative Compositions In certain embodiments, Spinraza® (generic name nusinersen; compound number 396443), approved for the treatment of SMA, is a comparator compound (e.g., Chiroboga, et al., Neurology, 86(10):890-897, 2016; Finkel, et al., Lancet, 338(10063):3017-3026, 2016; Finkel, et al., N. Engl. J. Med., 377(18):1723-1732, 2017; Mercuri, et al., N. Engl. J. Med., 378(7):625-635, 2018; Montes, et al. (See, e.g., Darras, et al., Muscle Nerve. 60(4):409-414, 2019; Darras, et al., Neurology, 92(21):e2492-e2506, 2019.) Spinraza® was previously described in International Patent Publication No. WO2010120820, which is incorporated herein by reference, and has the sequence (5' to 3') TCACTTTCATAATGCTGG (SEQ ID NO: 23), in which each nucleoside contains a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.
[0235] In certain embodiments, although not approved for human treatment, compound number 387954, Other previously described compounds, including 396442, 443305, and 819735, are comparative compounds.
[0236] Compound No. 387954 was previously described in International Patent Publication No. WO2014 / 179620, which is incorporated herein by reference. Compound No. 387954 has the sequence (5' to 3') of ATTCACTTTCATAATGCTGG (SEQ ID NO: 20), in which each nucleoside is a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.
[0237] Compound No. 396442 was previously described in International Patent Publication No. WO2010 / 120820, which is incorporated herein by reference. Compound No. 396442 has the sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO:21), in which each nucleoside is a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.
[0238] Compound No. 443305 was previously described in International Patent Publication No. WO2018 / 014041, which is incorporated herein by reference. Compound No. 443305 has the sequence (5' to 3') of TCACTTTCATAATGCTGG (SEQ ID NO:23), in which each nucleoside is a 2'-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.
[0239] Compound No. 819735 was previously described in International Patent Publication No. WO2018 / 014041, which is incorporated herein by reference. Compound No. 819735 has the sequence (5' to 3') of CACTTTCATAATGCTGGC (SEQ ID NO: 21), in which each nucleoside is a 2'-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine. [Table 1]
[0240] In certain embodiments, the compounds described herein are superior to the compounds described in International Patent Nos. WO2007 / 002390, WO2010 / 120820, WO2015 / 161170, and WO2018 / 014041 because they exhibit one or more improved properties (e.g., potency, efficacy, and tolerability).
[0241] For example, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 each demonstrated improved efficacy in vivo compared to Compound No. 396443. As shown in Example 5, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 had spinal cord EDTA values of 13.3, 8.8, and 7.4, respectively. 50 In comparison, compound 396443 achieved an ED of 22.0 in the spinal cord. 50 Thus, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 are each more potent than Compound No. 396443 in this assay.
[0242] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each exhibited improved 3-hour FOB scores compared to Compound No. 396443, Compound No. 387954, and Compound No. 443305. As shown in Example 6, at 700 μg, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 achieved 3-hour FOB scores of 0, 3.25, 1, and 0, respectively. In comparison, at half the dose (350 μg), Compound No. 396443 achieved a 3-hour FOB score of 4.0, and at the same dose (700 μg), Compound No. 387954 and Compound No. 443305 achieved 3-hour FOB scores of 4.0 and 4.75, respectively. Thus, in this assay, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 are each better tolerated than Compound No. 396443, Compound No. 387954, and Compound No. 443305.
[0243] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each demonstrated improved long-term tolerability compared to Compound No. 396442 and Compound No. 819735. As shown in Example 7, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 exhibited no adverse events, no Purkinje cell loss, and cortical GFAP mRNA levels less than two-fold above control levels. In comparison, Compounds 396442 and 819735 each exhibited adverse events, Purkinje cell loss, and cortical GFAP mRNA levels more than two-fold above control levels in certain treated animals. Thus, in this assay, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 are each better tolerated than Compound No. 396442 and Compound No. 819735.
[0244] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is incorporated herein by reference in its entirety. While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. cited in this application is incorporated herein by reference in its entirety.
[0245] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice, the sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily recognize that designations such as "RNA" or "DNA" to describe modified oligonucleotides are arbitrary in certain instances. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar moiety (a 2'-OH in place of a single 2'-H in DNA) or as an RNA with a modified base (thymine (methylated uracil) in place of the uracil in RNA). Thus, including those in the sequence listing, this Nucleic acid sequences provided herein, without limitation, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. By way of further example and not limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" is intended to encompass such compounds containing RNA bases, such as those having the sequence "AUCGAUCG," whether modified or unmodified, and those having some DNA bases and some RNA bases, such as "AUCGATCG," and those having some DNA bases and some RNA bases, such as "ATCGATCG." m CGAUUCG" (however, m The present invention encompasses any oligomeric compound having such a nucleobase sequence, including, but not limited to, oligomeric compounds having other modified nucleobases such as cytosine bases having a methyl group at the 5-position, ...
[0246] Certain compounds (e.g., oligonucleotides) described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined with respect to absolute stereochemistry as (R) or (S), as α or β in the case of, for example, sugar anomers, or as (D) or (L), for example, amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers, including stereorandom and optically pure forms thereof, unless otherwise specified. Similarly, all cis and trans isomers and tautomers of the compounds herein are included unless otherwise specified. Oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate internucleoside linkages include compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random. Unless otherwise specified, the compounds described herein are also intended to include the corresponding salts.
[0247] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S,34 S, 35 S, or 36 In certain embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging. [Example]
[0248] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Moreover, when specific embodiments are provided, the inventors intend the general application of those specific embodiments.
[0249] Example 1: Design of modified oligonucleotides complementary to human SMN2 nucleic acid Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as shown in the table below.
[0250] The modified oligonucleotides in the table below are 16, 17, 18, 19, or 20 nucleosides in length, as indicated. The modified oligonucleotides contain 2'-MOE, 2'-NMA, cEt, 2'-OMe, and / or 2'-β-D-deoxyribosyl sugar moieties, as indicated. Each internucleoside linkage of the modified oligonucleotides is either a phosphorothioate or a phosphodiester internucleoside linkage, as shown. Cytosine is either unmethylated or 5-methylcytosine, as shown.
[0251] Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise noted. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. Each modified oligonucleotide listed in the table below targets the active site of the SMN2 transcript for exon 7 inclusion. "Start Site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop Site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
[0252] Table 2 The modified oligonucleotides in Table 2 below are 16, 17, 18, 19, or 20 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is listed in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine. Each modified oligonucleotide listed in Table 2 below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise noted. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]
[0253] Table 3 The modified oligonucleotides in Table 3 below are 16, 17, 18, 19, or 20 nucleosides in length. Each nucleoside contains a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is listed in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0254] Each modified oligonucleotide listed in Table 3 below is identical to SEQ ID NO: 1 (nucleotide 19 The modified oligonucleotide is 100% complementary to the target nucleic acid sequence (GENBANK Accession No. NT_006713.14, truncated from 939708 to 19967777). "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 3-1] [Table 3-2]
[0255] Table 4 The modified oligonucleotides in Table 4 below are 18 or 19 nucleosides in length. Each nucleoside contains either a 2'-MOE or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is listed in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0256] Each modified oligonucleotide listed in Table 4 below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise noted. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 4]
[0257] Table 5 The modified oligonucleotides in Table 5 below are 16, 17, or 18 nucleosides in length. Each nucleoside contains either a 2'-MOE sugar moiety or a cEt sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "k" represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is listed in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0258] Each modified oligonucleotide listed in Table 5 below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14 truncated to nucleotides 19939708-19967777). "Start Site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop Site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 5-1] [Table 5-2] [Table 5-3]
[0259] Table 6 The modified oligonucleotides in Table 6 below are 19 or 20 nucleosides in length. Each nucleoside contains a 2'-MOE, 2'-NMA, 2'-OMe, or 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, each "y" represents a 2'-OMe sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide, as provided in the internucleoside linkage motif string, is (5' to 3'): sssssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Cytosine is either unmethylated cytosine or 5-methylcytosine, and each lowercase "c" in the nucleobase sequence string represents an unmethylated cytosine and each capital "C" in the nucleobase sequence string represents a 5-methylcytosine.
[0260] Each nucleobase of the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise indicated. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 6-1] [Table 6-2]
[0261] Table 7 The modified oligonucleotides in Table 7 below are 19 or 20 nucleosides in length. Each nucleoside contains a 2'-MOE, 2'-NMA, or 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide, as provided in the internucleoside linkage motif column, is (5' to 3'): ssssssssssssssssssoo, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0262] Each nucleobase of the modified oligonucleotides listed in Table 7 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise indicated. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 7-1] [Table 7-2] [Table 7-3]
[0263] Table 8 The modified oligonucleotides in Table 8 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE, 2'-NMA, or 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide, as provided in the internucleoside linkage motif column, is (5' to 3'): sssssssssssssosso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0264] Each nucleobase of the modified oligonucleotides listed in Table 8 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise indicated. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 8]
[0265] Table 9 The modified oligonucleotides in Table 9 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety, each "n" represents a 2'-NMA sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. Each modified oligonucleotide, as provided in the internucleoside linkage motif column, The internucleoside linkage motif of the nucleotide is (5' to 3'): sssssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0266] Each nucleobase of the modified oligonucleotides listed in Table 9 below is complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14, truncated to nucleotides 19939708-19967777), unless otherwise indicated. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italicized font. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 9]
[0267] Table 10 The modified oligonucleotides in Table 10 below are each 19 nucleosides in length. Each nucleoside contains a 2'-MOE or 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide, as listed in the internucleoside linkage motif column, is (5' to 3'): osssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0268] Each nucleobase of the modified oligonucleotides listed in Table 10 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14 truncated from nucleotides 19939708 to 19967777), unless otherwise indicated. Non-complementary nucleobases are indicated in the nucleic acid sequence column in underlined, bold, italic font. The "start site" is the base of the modified oligonucleotide. "Stop site" indicates the 5'-most nucleoside to which a modified oligonucleotide is complementary in a target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which a modified oligonucleotide is complementary in a target nucleic acid sequence. [Table 10]
[0269] Table 11 The modified oligonucleotides in Table 11 below are each 20 nucleosides in length. Each nucleoside contains a 2'-MOE or 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is either a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide, as listed in the internucleoside linkage motif column, is (5' to 3'):ossssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine is a 5-methylcytosine.
[0270] Each modified oligonucleotide listed in Table 11 below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14 truncated to nucleotides 19939708-19967777). "Start Site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop Site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. [Table 11]
[0271] Example 2: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg) The activity of selected modified oligonucleotides was tested in human SMN2 transgenic mice. The Taiwanese strain of SMN type III mice was obtained from the Jackson Laboratory (Bar Harbor, Maine). These mice lack mouse SMN and are either homozygous for human SMN2 (mSMN- / -; hSMN2+ / +; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J, stock number 005058; Bar Harbor, Maine) or heterozygous for mouse SMN and human SMN2 (mSMN+ / -; hSMN2+ / -; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J), which were obtained by breeding HOM / HOM (stock number 00005058) with FVB / NJ (stock number 001800).
[0272] treatment Homozygous or heterozygous transgenic mice were divided into groups of four mice each. Each mouse received a single bolus injection of 35 μg of the modified oligonucleotide via ICV. Comparative compounds Nos. 387954, 396442, and 396443 were also tested in this assay. One group of four mice received PBS as a negative control.
[0273] RNA analysis After two weeks of treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord to detect SMN2. Real-time qPCR analysis of RNA was performed using primer probe set hSMN2vd#4_LTS00216_MGB (forward sequence: GCTGATGCTTTGGGAAGTATGTTA (SEQ ID NO: 11); reverse sequence: CACCTTCCTTCTTTTTGATTTTGTC, designated herein as SEQ ID NO: 12; probe sequence TACATGAGTGGCTATCATACT (SEQ ID NO: 13)) to identify exon 7 (exon 7 +The amount of SMN2 RNA containing exon 7 (exon 7) was determined using primer probe set hSMN2_Sumner68_PPS50481 (forward sequence: CATGGTACATGAGTGGCTATCATACTG (SEQ ID NO: 14); reverse sequence: TGGTGTCATTTAGTGCTGCTCTATG (SEQ ID NO: 15); probe sequence CCAGCATTTCCATATAATAGC (SEQ ID NO: 16)). - The amount of SMN2 RNA excluding the nucleotides was determined. Total SMN2 RNA levels were measured using primer probe set hSMN2_LTS00935 (forward sequence: CAGGAGGATTCCGTGCTGTT (SEQ ID NO: 17); reverse sequence: CAGTGCTGTATCATCCCAAATGTC (SEQ ID NO: 18); probe sequence: ACAGGCCAGGCGAT (SEQ ID NO: 19)).
[0274] Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. Tables 12-18 each represent a different experiment. [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17] [Table 18]
[0275] Example 3: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg) The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above. 443 and 819735 were also tested in this assay. Transgenic mice were divided into groups of four. Each mouse received a single 15 μg ICV bolus injection of the modified oligonucleotide. One group of four mice received PBS as a negative control. After two weeks of treatment, the mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold changes in RNA levels compared to the PBS control, normalized to total SMN2 levels. Tables 19-23 each represent a different experiment. [Table 19] [Table 20] [Table 21] [Table 22] [Table 23]
[0276] Example 4: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (70 μg) The activity of the modified oligonucleotides was tested in human SMN2 transgenic mice essentially as described in Example 2 above. The transgenic mice were divided into groups of four mice each. Each mouse received a single 70 μg ICV bolus injection of the modified oligonucleotide. One group of four mice received PBS as a negative control. After two weeks of treatment, the mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to the PBS control, normalized to total SMN2 levels. [Table 24]
[0277] Example 5: Transgenic mice, multiple doses of modified oocytes complementary to human SMN2 Oligonucleotide activity The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above. Comparative compound no. 396443 was also tested in this assay. Transgenic mice were divided into groups of four mice each. Each mouse received a single ICV injection of the modified oligonucleotide at multiple doses as shown in the table below. One group of four mice received PBS as a negative control. After two weeks of treatment, mice were sacrificed, and RNA was extracted from coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS control, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ending theme 50 was calculated in GraphPad Prism7 using nonlinear regression, four-parameter dose-response curves [Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope)]. [Table 25]
[0278] Example 6: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice, 3-hour study The modified oligonucleotides described above were tested in wild-type female C57 / B16 mice to assess tolerability. Each wild-type female C57 / B16 mouse received a single ICV injection of 700 μg of the modified oligonucleotides listed in the table below. Comparative compound No. 396443 was also tested in this assay at a dose of 350 μg. Comparative compound No. 387954, 3 96442, 443305, and 819735 were also tested in this assay at a dose of 700 μg. Each treatment group consisted of four mice. One group of four mice received PBS as a negative control for each experiment (identified in separate tables below). Three hours after injection, mice were evaluated according to seven different criteria. The criteria were: (1) the mouse was active, alert, and responsive; (2) the mouse reared or hunched without stimulation; (3) the mouse showed any movement without stimulation; (4) the mouse showed forward movement when lifted; (5) the mouse showed any movement when lifted; (6) the mouse responded to a pinch by the tail; and (7) rhythmic breathing. For each of the seven criteria, a subscore of 0 was assigned if the criterion was met, and a subscore of 1 was assigned if the criterion was not met (Functional Observation Bound Score or FOB). After evaluating all seven criteria, the scores were summed and averaged within each treatment group. The results are shown in the tables below: Tables 26 to 49 each represent a different experiment. [Table 26] [Table 27] [Table 28] [Table 29] [Table 30] Table 31 Table 32
Table 33
[0279] Example 7: Tolerability of modified oligonucleotides complementary to human SMN2 in rats, long-term evaluation In a separate study conducted under the same conditions, the above selected modified oligonucleotides were tested in Sprague-Dawley rats to evaluate the long-term tolerability of the oligonucleotides. Comparative compounds 396442 and 819735 were also tested in this assay. Each Sprague-Dawley rat received a single intrathecally (IT) delivered dose of 3 mg of oligonucleotide or PBS. Starting one week after treatment, each animal was weighed and assessed weekly by a trained observer for adverse events. Adverse events were defined as neurological dysfunction not typical of PBS-treated control animals and included, but were not limited to, abnormal limb extension, abnormal gait, tremors, respiratory abnormalities, paralysis, and spasticity. The onset of adverse events was defined as the week after dosing when dysfunction was first noted. If no adverse events were observed, the onset was marked as "None." The onset of adverse events usually correlated with growth failure, defined by a lack of weight gain / retention similar to that observed in PBS-treated animals. Similar tolerability assessments are described in Oestergaard et al., Nucleic Acids Res., 2013 Nov, 41(21), 9634-9650 and Southwell et al., Mol Ther., 2014 Dec, 22(12), 2093-2106.
[0280] At the end of the experiment, rats were sacrificed and tissues were collected. Histopathology was performed using calbindin staining. The study was performed on cerebellar sections using RT-PCR. Purkinje cell loss was observed in calbindin-stained cerebellar sections, as shown in the table below. The cerebellum and spinal cord were also evaluated using antibodies specific for the modified oligonucleotides. Animals demonstrating no oligonucleotide uptake were excluded from histopathological analysis. Histology was not completed for animals sacrificed early due to adverse events. Additionally, cortical GFAP, a marker of astrogliosis (Abdelhak, et al., Scientific Reports, 2018, 8, 14798), was measured using RT-PCR, with a mean increase of more than two-fold, as shown below. [Table 50]
[0281] Example 8: Tolerability and Pharmacokinetics of Modified Oligonucleotides in Non-Human Primates, Single and Repeated Dose Cynomolgus monkeys were treated with modified oligonucleotides to investigate their local and systemic tolerability and pharmacokinetics. Each group received either artificial CSF or modified oligonucleotides as a single lumbar intrathecal bolus injection (IT), or, for the repeated-dose groups, as an IT bolus on day 1 of the experiment and at subsequent time points. Tissues were collected one week after the final injection.
[0282] In single-dose studies, monkeys are given a single dose of modified oligonucleotides to assess tolerability. Typical doses for single-dose studies in adult cynomolgus monkeys include 1 mg, 3 mg, 7 mg, and 35 mg.
[0283] In multiple-dose studies, monkeys receive an IT bolus dose on day 1 of the study, followed by weekly (e.g., days 8, 15, and 22 in a 4-week study) or monthly (e.g., days 29, 57, and 84 in a 13-week study) IT bolus doses. Typical doses tested include 1 mg, 3 mg, 7 mg, and 35 mg.
[0284] Assessment of tolerability is based on clinical observations, body weight, food consumption, physical and neurological examinations including sensorimotor, cerebral and spinal reflexes, evaluation of coagulation, hematology, clinical chemistry (blood and cerebrospinal fluid (CSF)), cell counts, and anatomic pathology. A complete necropsy is performed with gross abnormalities recorded. Organ weights are measured and microscopic examinations are performed. Blood is collected for complement analysis. Additionally, blood, CSF, and tissues (at necropsy) are collected for toxicokinetic evaluation.
[0285] Modified oligonucleotide tolerability will be analyzed in brain and spinal cord tissue by measuring Aif1 and Gfap levels in cynomolgus monkeys treated with modified oligonucleotides or controls. Brain and spinal cord samples will be collected, flash-frozen in liquid nitrogen, and cryopreserved (-60°C to -90°C). At the time of sampling, 2 mm biopsy punches will be used to extract samples from the frozen tissue for RNA analysis. Punches will be obtained from multiple brain and spinal cord regions.
[0286] Example 9: Phase Ia Human Clinical Trial with Compound Nos. 1263789, 1287717, 1287745, or 1358996 The safety, tolerability, pharmacokinetics, pharmacodynamics, and efficacy of modified oligonucleotides complementary to human SMN2 are evaluated in a clinical trial setting. Single and / or multiple doses of the modified oligonucleotides are evaluated in patients with confirmed SMA, such as SMA Type I, SMA Type II, SMA Type III, or SMA Type IV.
[0287] Patient safety will be closely monitored throughout the study. Safety and tolerability assessments will include physical examination and standard neurological assessment (including fundus), vital signs (HR, BP, orthostatic change, weight), ECG, AEs and concomitant medications, Columbia-Suicide Severity Rating Scale (C-SSRS), CSF safety labs (cell count, protein, glucose), plasma laboratory tests (clinical chemistry, hematology), and urinalysis.
[0288] Age- and type-appropriate validity assessments were selected, including, for example, the Hammersmith Functional Motor Scale (HFMSE), a reliable and validated tool used to assess motor function in children with SMA; the Pediatric Quality of Life (PedsQL™) Measure 4.0 General Scale, the Pediatric Quality of Life 3.0 Neuromuscular Module; the Compound Muscle Action Potential (CMAP); the Motor Unit Number Estimation (MUNE); the Upper Limb Module (ULM); and the 6-Minute Walk Test (6MWT) (Darras, et al., Neurology, 2019, 92:e2492-e2506).
[0289] Example 10: Design of modified oligonucleotides complementary to human SMN2 nucleic acid Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as shown in the table below.
[0290] Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NT_006713.14 truncated to nucleotides 19939708-19967777). "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
[0291] The modified oligonucleotides in the table below are 18 nucleosides in length. Each nucleoside contains either a 2'-MOE or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage can be a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, a methoxypropyl phosphate linkage, or a methyl phosphate linkage. The internucleoside linkages of each modified oligonucleotide are either phosphorothioate internucleoside linkages or mesylphosphoramidate (MsP) internucleoside linkages. The internucleoside linkage motifs of each modified oligonucleotide are provided in the internucleoside linkage motif string, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, each "x" represents a methoxypropylphosphonate internucleoside linkage, and each "z" represents a mesylphosphoramidate (MsP) internucleoside linkage. Each cytosine is a 5-methylcytosine. Modified oligonucleotide 449320 was previously described in International Patent Publication WO 2015 / 161170 A2. [Table 51]
[0292] All modified oligonucleotides in the table below consist of the sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23). Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described above). "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
[0293] The modified oligonucleotides in the table below are 18 nucleosides in length. Each nucleoside contains either a 2'-MOE or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is listed in the sugar motif column, where each "e" represents a 2'-MOE sugar moiety and each "n" represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate. The internucleoside linkage is either a thioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate (MsP) internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif column, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate (MsP) internucleoside linkage. Each cytosine is a 5-methylcytosine. The modified oligonucleotides in the table below are conjugated to a 6-palmitamidohexylphosphate conjugate group attached to the 5'-OH of the oligonucleotide. The structure of the conjugate group is as follows: [ka] [Table 52]
[0294] All modified oligonucleotides in the table below consist of the sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23), with a start site 27062 and a stop site 27079 in SEQ ID NO: 1 (described above), where "start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence and "stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
[0295] The modified oligonucleotides in the table below are 18 nucleosides in length. The sugar and internucleoside linkage motifs of each modified oligonucleotide are shown in the Sequence and Chemical Notation column, where each subscript "n" represents a 2'-NMA sugar moiety, each subscript "[DMA]" represents a 2'-O-(N,N-dimethyl)acetamide moiety, each subscript "[NEA]" represents a 2'-O-(N-ethyl)acetamide moiety, each subscript "[NPA]" represents a 2'-O-(N-propyl)acetamide moiety, each subscript "[NcPA]" represents a 2'O-(N-cyclopropyl)acetamide moiety, each subscript "[McPA]" represents a 2'-O-(N-cyclopropylmethyl)acetamide moiety, and each subscript "s" represents a phosphorothioate internucleoside linkage. Each cytosine is a 5-methylcytosine, and cytosine residues ( m The superscript "m" before C) represents 5-methylcytosine. The structure of each sugar shown in the table below is as follows: [ka] [Table 53]
[0296] Example 11: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg) The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0297] treatment Transgenic mice were divided into groups of four mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses shown in the table below. One group of four mice received PBS as a negative control. After two weeks of treatment, mice were sacrificed, and RNA was extracted from coronal brains and spinal cords for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS controls, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ending theme 50 was calculated in GraphPad Prism7 using nonlinear regression, four-parameter dose-response curves [Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope)].
[0298] RNA analysis After two weeks of treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord to detect SMN2. Real-time qPCR analysis of RNA was performed. The primer probe set hSMN2vd#4_LTS00216_MGB was used to target exon 7 (exon 7 + ) containing The amount of SMN2 RNA was measured. The primer probe set hSMN2_Sumner68_PPS50481 was used to detect exon 7 (exon 7 - The amount of SMN2 RNA excluding the marker (p < 0.05) was measured. Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are expressed as the fold change in RNA levels compared to the PBS control, normalized to total SMN2 levels. [Table 54] [Table 55]
[0299] Example 12: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg) The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0300] treatment Transgenic mice were divided into groups of four mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses shown in the table below. One group of four mice received PBS as a negative control. After two weeks of treatment, mice were sacrificed, and RNA was extracted from coronal brains and spinal cords for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS controls, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ending theme 50 is a nonlinear regression, 4-parameter dose-response curve [Y=Bottom+(Top-Bottom) / (1+(10^lo gEC50 / X)^HillSlope)] was calculated using GraphPad Prism7.
[0301] RNA analysis After two weeks of treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord to detect SMN2. Real-time qPCR analysis of RNA was performed. The primer probe set hSMN2vd#4_LTS00216_MGB was used to target exon 7 (exon 7 + The amount of SMN2 RNA containing exon 7 (exon 7) was measured using the primer probe set hSMN2_Sumner68_PPS50481. - The amount of SMN2 RNA excluding the marker (p < 0.05) was measured. Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are expressed as the fold change in RNA levels compared to the PBS control, normalized to total SMN2 levels. [Table 56]
[0302] Example 13: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, multiple doses The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described in Example 2 above.
[0303] treatment Transgenic mice were divided into groups of four mice each. Each mouse received a single ICV injection of the modified oligonucleotide in multiple doses as shown in the table below. One group of four mice received PBS as a negative control. Two weeks after treatment, mice were sacrificed, and RNA was extracted from coronal brains and spinal cords for real-time qPCR analysis of SMN2 RNA. Results are expressed as fold change in RNA levels compared to PBS controls, normalized to total SMN2 levels. Exon inclusion (exon 7) + )'s ending theme 50 was calculated in GraphPad Prism7 using nonlinear regression, four-parameter dose-response curves [Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope)].
[0304] RNA analysis After two weeks of treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord to detect SMN2. Real-time qPCR analysis of RNA was performed. The primer probe set hSMN2vd#4_LTS00216_MGB was used to target exon 7 (exon 7 + The amount of SMN2 RNA containing exon 7 (exon 7) was measured using the primer probe set hSMN2_Sumner68_PPS50481. - The amount of SMN2 RNA excluding the marker (p < 0.05) was measured. Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are expressed as the fold change in RNA levels compared to the PBS control, normalized to total SMN2 levels. [Table 57] [Table 58-1] [Table 58-2] [Table 59]
[0305] Example 15: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice The modified oligonucleotides described above were tested in wild-type female C57 / B16 mice to assess oligonucleotide tolerability. Each wild-type female C57 / B16 mouse received a single ICV injection of 700 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of four mice. One group of four mice received PBS as a negative control for each experiment (identified in separate tables below). Three hours after injection, mice were evaluated according to seven different criteria. The criteria were: (1) Mice were active, alert, and responsive; (2) Mice reared or hunched without stimulation; (3) Mice showed any movement without stimulation; (4) Mice showed forward movement when lifted; (5) Mice showed any movement when lifted; (6) Mice responded to tail pinch; and (7) Rhythmic breathing. For each of the seven criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 if the criterion was not met (Functional Observational Batch Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the table below. [Table 60] In one aspect, the present invention may be as follows. [Aspect 1] An oligomeric compound comprising a modified oligonucleotide consisting of 16, 17, 18, 19, or 20 linked nucleosides and having a nucleic acid base sequence comprising at least 15 or at least 16 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 20 to 50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 2] An oligomeric compound comprising a modified oligonucleotide consisting of 17, 18, 19, or 20 linked nucleosides and having a nucleic acid base sequence comprising at least 15, at least 16, or at least 17 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 20-27, 29-30, or 32-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 3] An oligomeric compound comprising a modified oligonucleotide consisting of 18, 19, or 20 linked nucleosides and having a nucleic acid base sequence comprising at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 20 to 27, 30, or 33 to 50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 4] An oligomeric compound comprising a modified oligonucleotide consisting of 19 or 20 linked nucleosides and having a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, or at least 19 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20, 22, 24-27, 30, and 33-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 5] An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20, 22, 25, 27, 35, 39-46, or 49, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 6] An oligomeric compound described in any one of Aspects 1 to 5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 87.5%, 88.2%, 89%, 89.4%, 90%, 93.7%, 94%, 94.7%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 when measured across the entire nucleobase sequence of the modified oligonucleotide. [Aspect7] がなななななななななななきながが、sososssssssssssss、ssossssssssssss、ssossssossssoss、ssosssossssoss、soosssssssssooss、sooossssssssss ooss、sooosssssssoooss、ssssssss、ssosssssssssss、s ...、sssssssssssssss、ssssssssssssss ssssss、sssssssssssosss、ssssssssssssss、sos ...、sosssssssssssssss、sossssssssssssss、sossssssssss ssssssss、s ...、ssssssssssssssss、soosssssssssssssss、ssssssssssssss、sssssssssssss sssssssss、s ...、ssssssssssssssss、sssssssssssssss、sssssssssssssss、ssssssssssssss、sssssssssssss osssssssssss、 ...、ssssssssssssssss、sssssssssssssss、ssssssssssssss、sssssssssssss、ssssssssssss、ssssssss oossssssoooss、s ...s、ssssssssssssssss、ss sssssssssosss、s ...sssssssoossssssss、sssssssssssss、ssssssssssssss、sssossssssssssssss、sossssssssssssssss、sossssssssssssssssss、sosssssssssssssssss、soossssssssssssssss、ossssssssssssssssss so、ssssssssssssssssssoo、ssssssssssssssssssoss、s ... ssssssoosssssssss、sossssssssssssssss、sossssssssssssssssss、sosssssssssssssssssss、sosssssssssssssssssssssss、sossssssssssssssssssss、sossssssssssssssssss、soosssssssssssssssssss、 ...s、ssssssssssssssssss sssssssssssss、ssssssssssssssssso、ossssssssssssssssssssss、s ... ss、ssssssssosssssssss、soss ... oossss、ssssssooossssss、s ...、ssssssssssssss、sssssssooooosssss、ssssssssssssss、ssssssssssssss、ssssssssssssss、ssssssssssssssss、sssssssssssssssss 、sssssssssssss、ssosssssssssss、ssossssssssssss、ssosssssssosssos、ssossossossossosss、ssososososososssss、ssoooosssssssssssss、soossssssssssssss、sooos ...7. The oligomeric compound of any one of aspects 1-6, having an internucleoside linkage motif (5' to 3') selected from: ssssoooossssss, ssssooooooossss, sssosssssssss, ssosssssssss, ssossossossss, ssossossosss, ssossosososs, ssosososososs, ssoooossssssss, sooossssssssooss, sooosssssssooss, sooosssssssoooss, and soooossssssoooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. [Aspect 8] The oligomeric compound of any one of Aspects 1 to 6, wherein the modified oligonucleotide has an internucleoside linkage motif selected from ssssssssssssssssxs and ssssssssssssssssx, where "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "x" represents a methoxypropylphosphonate internucleoside linkage. [Aspect 9] The oligomeric compound of any one of Aspects 1 to 6, wherein the modified oligonucleotide has an internucleoside linkage motif selected from zzzzzzzzzzzzzzzzz, ssssssssssszzzzzz, ssssszzzzzzzzsssssss, zzooooooooooooozz, zzzzooooooooooozz, zzzzzzzooooooooozz, zzzzzzzooooooooozz, zzzzzzzzooooooozz and ssoooooooooooooooss, wherein "s" represents a phosphorothioate internucleoside linkage, "o" represents a phosphodiester internucleoside linkage, and "z" represents a mesylphosphoramidate internucleoside linkage. [Aspect 10] The modified oligonucleotide may ee, nnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnn, nnnnnneennnnn nn, nnnnnnnnnnnnenneen, nnnnnneneenenneen, nnnnnnnnnnnnnnnnnnne, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnnnny, nnnnnnnnnnnnn nnnnndd, nnnnnnnnnnnnnnnnnnned, nnnnnnnnnnnnnnnnnnde, nnnnnnnnnnnnnnnnnee, eeeeeeeeeeeeeeeeeedd, eeeeeeeeeeeeeeeeeeed, e eeeeeeeeeeeeeeeeede, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnnnne, eeeeeeeeeeeeeeeeeeed, keekeekeekeekeeeek, keeekeekeeekeeeek, keeeeekeeeeeekeeeek, keeeeeeekeeeeeeeek, keeeeeeeeeeeeeeeeek, eeekeekeekeekeekeekek, eeekeekeekeekeekeekee, eeeeeekeekeekee kee, eeeeeekeekeekeeee, eeeeeekeeeeeeeeee, keekeekeekeeeeeeee, eeeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeeekeekeek, keekeeeeeeeeeeeeee, eeeeeeeeeeeeeekeek, keekeekeekeekeeek, keekeeekeeekeeek, keeeekeeeeeekeeeek, keeeeeeekeeeeeeeek,keeeeeeeeeeeeeeek, eekeekeekeekeekek, eekeekeekeekeekee, eeeeekeekeekeekee, eeeeeekeekeekeeee, eeeeeekeeeeeeeeee, keekeekeekeeeeee, eeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeeekeekeek , keekeeeeeeeeeeeeee, eeeeeeeeeeeeeekeek, keekeekeekeekeekeek, keekeeekeeekeek, keeeekeeeekeeeek, keeeeeekeeeeeek, keeeeeeeeeeeeeek, kekeekeekeekeeke, eekeekeekeekeeke, eeeeekeekeekeeke, eeeeeke The oligomeric compound of any one of embodiments 1-9, having a sugar moiety motif (5' to 3') selected from ekeekeeee, eeeeekeeeeeekeeee, keekeekeekeeeeee, eeeeeekeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeekeekeekeek, keekeekeeeeeeeeeeee, eeeeeeeeeeeeeee, eeeeeeeeeeeeeekeek, eeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeeey, ennnnnnnnnnnnnnnnnnnn, and ennnnnnnnnnnnnnnnnne, wherein "e" represents a 2'-MOE sugar moiety, "n" represents a 2'-NMA sugar moiety, "k" represents a cEt sugar moiety, "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and "y" represents a 2'-OMe sugar moiety. [Aspect 11] The oligomeric compound of any one of Aspects 1 to 9, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from nnnnnnnnnnnnnnnenn and nnnnnnnnnnnnnnnnen, where "e" represents a 2'-MOE sugar moiety and "n" represents a 2'-NMA sugar moiety. [Aspect 12] The oligomeric compound of any one of Aspects 1 to 9, wherein the modified oligonucleotide has a sugar motif (5' to 3') of qqnqqqqqnqnnqnqqnn, wherein each "n" represents a 2'-NMA sugar moiety, and each "q" is independently selected from a 2'-O-(N,N-dimethyl)acetamide sugar moiety, a 2'-O-(N-ethyl)acetamide sugar moiety, a 2'-O-(N-propyl)acetamide sugar moiety, a 2'-O-(N-cyclopropyl)acetamide sugar moiety, and a 2'-O-(N-cyclopropylmethyl)acetamide sugar moiety. [Aspect 13] The oligomeric compound of any one of Aspects 1 to 9, wherein the modified oligonucleotide comprises at least one modified sugar moiety. [Aspect 14] The oligomeric compound of Aspect 13, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety. [Aspect 15] The oligomeric compound of Aspect 14, wherein the bicyclic modified sugar moiety has a 4'-2' bridge, and the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-. [Aspect 16] The oligomeric compound of Aspect 13, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety. [Embodiment 17] The oligomeric compound of embodiment 16, wherein the non-bicyclic modified sugar moiety is any one of a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety. [Aspect 18] The oligomeric compound of Aspect 13, wherein the modified oligonucleotide comprises at least one sugar surrogate. [Aspect 19] The oligomeric compound of Aspect 18, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA. [Aspect 20] The oligomeric compound according to any one of Aspects 1 to 6 and 10 to 16, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [Aspect 21] The oligomeric compound of aspect 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [Aspect 22] The oligomeric compound of aspect 20 or aspect 21, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 23] The oligomeric compound of any one of Aspects 1 to 20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [Aspect 24] The oligomeric compound of any one of Aspects 20, 22, or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage. [Aspect 25] The oligomeric compound of any one of Aspects 10 to 16, wherein the modified oligonucleotide has an internucleoside linkage motif (5' to 3') selected from sosossssssssssss, sooossssssssssssss, sosssosssssssssss, sossssssossssssss, sosssssssosssssss, sssoossssssssss, sssssssssss, sssssssssss, sssssssssss, and sssssssssssssoosssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. [Aspect 26] The oligomeric compound according to any one of Aspects 1 to 25, wherein the modified oligonucleotide comprises a modified nucleobase. [Aspect 27] The oligomeric compound of Aspect 26, wherein the modified nucleobase is 5-methylcytosine. [Aspect 28] The oligomeric compound according to any one of Aspects 1 to 27, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides. [Aspect 29] The oligomeric compound of any one of Aspects 1 to 28, wherein the modified oligonucleotide comprises one or two non-complementary nucleobases. [Aspect 30] The oligomeric compound of any one of Aspects 1 to 29, wherein the modified oligonucleotide comprises one or two cleavable moieties. [Aspect 31] The oligomeric compound of aspect 30, wherein the cleavable moiety is a phosphodiester internucleoside linkage. [Aspect 32] The oligomeric compound according to any one of Aspects 1 to 31, which comprises the modified oligonucleotide. [Aspect 33] The oligomeric compound according to any one of Aspects 1 to 32, wherein the oligomeric compound is a single-stranded oligomeric compound. [Embodiment 34] Chemical notation: m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e A modified oligonucleotide (SEQ ID NO: 21) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage. [Aspect 35] The following chemical notation: T eo T es m C es A es m C es T es T es T es m Ces A es T es A es A es T es G es m C es T es G es G eo m C e A modified oligonucleotide (SEQ ID NO: 22) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage. [Aspect 36] The following chemical notation: T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e A modified oligonucleotide (SEQ ID NO: 22) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage. [Aspect 37] Chemical notation of: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n A modified oligonucleotide (SEQ ID NO: 21) according to A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, n is a 2'-NMA sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound comprising the modified oligonucleotide wherein o is a phosphodiester internucleoside linkage. [Aspect 38] The following chemical structure: [ka] A modified oligonucleotide or a salt thereof based on the formula: [Aspect 39] The modified oligonucleotide according to Aspect 38, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 40] The following chemical structure: [ka] Modified oligonucleotides based on [Aspect 41] The following chemical structure: [ka] A modified oligonucleotide or a salt thereof based on the formula: [Aspect 42] The modified oligonucleotide according to Aspect 41, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 43] The following chemical structure: [ka] Modified oligonucleotides based on [Aspect 44] The following chemical structure: [ka] A modified oligonucleotide or a salt thereof based on the formula: [Aspect 45] The modified oligonucleotide according to Aspect 44, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 46] The following chemical structure: [ka] Modified oligonucleotides based on [Aspect 47] The following chemical structure: [ka] A modified oligonucleotide or a salt thereof based on the formula: [Aspect 48] The modified oligonucleotide according to Aspect 47, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 49] The following chemical structure: [ka] Modified oligonucleotides based on [Aspect 50] A pharmaceutical composition comprising the oligomeric compound according to any one of Aspects 1 to 37 or the modified oligonucleotide according to any one of Aspects 38 to 49, and a pharmaceutically acceptable carrier or diluent. [Aspect 51] The pharmaceutical composition according to aspect 50, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or PBS. [Aspect 52] The pharmaceutical composition described in Aspect 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial CSF (aCSF). [Aspect 53] The pharmaceutical composition described in Aspect 52, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. [Aspect 54] A chirally enriched population of modified oligonucleotides described in any one of aspects 38 to 49, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. [Embodiment 55] A chirally enriched population according to embodiment 54, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration. [Embodiment 56] The chirally enriched population of embodiment 54, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration. [Embodiment 57] The chirally enriched population of embodiment 54, wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Embodiment 58] A chiral enriched population according to embodiment 57, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 59] A chirally enriched population according to embodiment 57, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [Embodiment 60] The chiral enriched population of embodiment 57, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction. [Aspect 61] A population of modified oligonucleotides described in any one of Aspects 38 to 49, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom. [Aspect 62] A method for treating a disease associated with SMN1 or SMN2, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any one of aspects 50 to 53 to a subject having or at risk of developing a disease associated with SMN1 or SMN2, thereby treating the disease associated with SMN1 or SMN2. [Aspect 63] The method described in Aspect 62, wherein the disease associated with SMN1 or SMN2 is a neurodegenerative disease. [Aspect 64] The method described in Aspect 63, wherein the neurodegenerative disease is spinal muscular atrophy (SMA). [Aspect 65] The method described in aspect 64, wherein the SMA is any of SMA type I, SMA type II, SMA type III, or SMA type IV. [Aspect 66] A method according to aspect 64 or aspect 65, wherein at least one symptom of SMA is alleviated. [Aspect 67] The method described in Aspect 66, wherein the symptoms are any of: muscle weakness; inability or decreased ability to sit upright, stand and / or walk; decreased neuromuscular activity; decreased electrical activity of one or more muscles; decreased breathing; inability or decreased ability to eat, drink and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival rate. [Aspect 68] A method according to any one of aspects 62 to 67, wherein the pharmaceutical composition is administered to the central nervous system or systemically. [Aspect 69] The method of aspect 68, wherein the pharmaceutical composition is administered to the central nervous system and systemically. [Aspect 70] A method described in any one of Aspects 62 to 67, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly. [Aspect 71] A method for increasing SMN2 RNA containing exon 7, comprising contacting a cell, tissue, or organ with an oligomeric compound described in any one of aspects 1 to 37, a modified oligonucleotide described in any one of aspects 38 to 49, or a pharmaceutical composition described in any one of aspects 50 to 53.
Claims
[Claim 1] The invention described in the specification.