Antisense oligonucleotides and their use for treatment of pain

Abstract

To provide a pharmaceutical composition for use in the treatment of pain.SOLUTION: The present invention provides an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets at least the region comprising or consisting of the nucleotides 219-229 of a specific sequence.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to the field of pain, and more particularly, the present invention relates to a method for treating peripheral pain. and pharmaceutical compositions. [Background technology]

[0002] Pain is an unpleasant sensation often caused by a severe or noxious stimulus. The definition widely used by the International Pain Society is that "pain is caused by acute or potential tissue damage. unpleasant sensory and emotional experiences associated with or described in terms of such damage " There are many different types of pain.

[0003] Acute pain is short-lived pain that occurs suddenly and has a specific cause, usually tissue injury. Yes, it generally lasts for less than six months and disappears once the underlying cause is treated.

[0004] Chronic pain is a medical condition that is difficult to treat due to its complex natural history, unclear etiology, and poor response to treatment. Chronic pain is a common problem that constitutes a major challenge for healthcare professionals. Many authors consider pain lasting longer than 6 months as the diagnosis, while others consider pain lasting longer than 6 months as the diagnosis. Three months is used as the low threshold. In chronic pain, the duration parameter is used arbitrarily. Various neuromuscular, reproductive, gastrointestinal, and urinary disorders can cause chronic pain. or contribute to chronic pain.

[0005] Nociceptive pain is the most common type of pain. It is the result of pain reception in response to tissue injury. It is caused by stimulation of the nociceptors in the body. Nociceptors are found throughout the body. especially in the skin and internal organs, which may be irritated by potentially harmful substances such as amputation or other injuries. When activated, they send electrical impulses to the brain, causing the subject to feel pain.

[0006] Visceral pain is caused by injury or damage to the internal organs. The areas affected are the chest, abdomen, and pelvis. Pain may be felt in the trunk area of ​​the body, including the pelvis. It is often difficult to pinpoint the exact location of visceral pain. Difficult. Visceral pain is often described as pressure, aching, squeezing or cramping.

[0007] Somatic pain is caused by stimulation of nociceptors in tissues rather than in the viscera. It involves the skin, muscles, joints, connective tissue, and bones. Somatic pain is often easier to localize than visceral pain. Somatic pain is usually felt as a constant aching or sharp sensation. It can be further classified as deep or superficial. Deep somatic pain is pain that affects the joints, tendons, bones and It is often described as pain. Superficial somatic pain is felt in the skin and mucous membranes. It is felt in the membrane. It can be felt sharply or pulsatingly.

[0008] Peripheral neuropathic pain is caused by damage to peripheral nerve endings in the skin (e.g., from nociceptors). These damaged nerve endings are caused by damage to nerve structures in the peripheral nervous system, such as the cerebral cortex. The edges can generate action potentials in the absence of stimulation and can be hypersensitive to normal stimulation; and and / or may be caused by residual local inflammatory irritation. Damaged and hypersensitive small nerve fibers may also contribute to peripheral neuropathic pain. Examples include diabetic neuropathy, postherpetic neuralgia, trigeminal neuralgia, and chronic idiopathic neuropathy. Peripheral neuropathy due to chronic axonal polyneuropathy and chemotherapy-induced polyneuropathy It is a harmful pain.

[0009] The two most commonly used compounds in the treatment of neuropathic pain are capsaicin and (agonist and counterirritant of steroid receptors), and lidocaine (membrane stabilizer) However, topical capsaicin 0.025% to 0.075% and capsaicin 8% packs Both of these drugs, when used excessively, often induce intolerable side effects such as increased burning sensation, Also, in many cases, the procedure must be combined with local anesthesia to counteract this side effect. (Jay GW & Barkin RL (2014)). U.S. Patent Application Publication No. 2014 No. 2013 / 0184351 and U.S. Patent Application No. 2013 / 0141056. The topical lidocaine 5% patch should be changed every 12 hours and should not be used on broken skin. It cannot be used on ulcerated, damaged or inflamed skin. The patch must be cut off, especially for patients with diabetic neuropathy. In particular, elderly people may have problems applying the cream to their toes. Other topical forms, such as tablets and gels, up to 8% are available commercially (Deny S et al. (2014)). Several studies show that topical lidocaine may be effective in relieving neuropathic pain. Although it is believed that topical lidocaine is effective in treating neuropathic pain (Derry S et al. (2014)), There is still no evidence from good quality randomized controlled trials available to support the use of However, the consensus between patients and their physicians is that topical lidocaine, more generally, is the preferred treatment for neuropathy. Response of patients suffering from neuropathic pain to both topical and oral medications for neuropathic pain. The rate remains totally inadequate.

[0010] It is increasingly felt that "neuropathic pain" is an inadequate container concept. "Neuropathic pain" is a collection of different pathologies characterized by different pathogenic processes. The hope is that a single therapeutic molecule will be effective in a range of different neuropathic pain syndromes. This is clearly too risky. Therefore, for patients suffering from certain neuropathic pain conditions, There is an urgent need for individualized treatment strategies. Chronic administration of several times a day, week, or month over the course of a year may reduce or eliminate side effects. There is a strong need for better treatment options that are free of side effects. Summary of the Invention

[0011] The present invention relates to inhibitors of FXYD2, which inhibitors are useful in treating a subject in need thereof. FXYD2 expression and / or activity is reduced, and nucleotides 219 to 229 of SEQ ID NO: 3 are The target region is at least the region containing nucleotides 219 to 229 of the present invention. The invention is defined by the claims. [Brief explanation of the drawings]

[0012] [Figure 1A-B] Figures 1A and 1B show the identification of antisense oligonucleotides targeting human FXYD2 mRNA. Also shown are quantification of FXYD2 protein levels by Western blot of HEK293 cell extracts after transfection with a series of antisense oligonucleotides targeting human FXYD2 mRNA (A) and ASO75 and ASO82 (B), each 15, 17, and 20 nucleotides in length. FXYD2 protein levels were normalized to actin protein levels. Data are shown as mean ± sem. * = p < 0.05; ** = p < 0.01; *** = p < 0.001; and **** = p < 0.0001 (n = 3). [Figure 2] Figure 2 shows in vivo inhibition of Fxyd2 expression in rat DRG neurons by intrathecal injection of Fxyd2-LASO, a lipid-modified Fxyd2 antisense oligonucleotide. Increasing amounts of Fxyd2-LASO were intrathecally injected daily for 14 days, and lumbar DRG (L4-L6) tissues were dissected and Fxyd2 protein levels were quantified. Fxyd2 protein levels were normalized to actin protein levels. Data are shown as mean ± sem. * = p < 0.05, ns indicates not significant. [Figure 3A-B] Figure 3A and B show that daily intrathecal injections of lipid-modified Fxyd2 antisense oligonucleotides are at least as effective as intrathecal administration of ω-conotoxin MVIIA in reducing pain sensitivity in the SNL model of neuropathic pain. Cohorts of rats underwent SNL surgery and were tested for their response to mechanical stimulation (A: von Frey test, B: Randall-Selitto paw pressure test). Daily intrathecal injections of 2 μg Fxyd2-LASO (n = 9) induced a gradual and complete reduction of mechanical hypersensitivity in two tests, but not in control-LASO (n = 9), and the reduction was reversible upon discontinuation of treatment. Resumption of Fxyd2-LASO treatment restored the analgesic effect. Treatment of a cohort of rats exhibiting neuropathic pain syndrome with a single intrathecal injection of ω-conotoxin MVIIA (n = 9) reduced mechanical hypersensitivity for 1–2 hours. Data are presented as mean ± sem. *=p<0.05; ***=p<0.001 and ****=p<0.0001. [Figure 4A-B]Figures 4A and 4B show that Fxyd2-LASO treatment attenuates mechanical hypersensitivity in an inflammatory pain model. Mechanical hypersensitivity was induced by intraplantar injection of CFA (complete Freund's adjuvant). Daily injections of Fxyd2-LASO (n = 6) attenuated the pain syndrome, whereas control-LASO (n = 6) did not (A: von Frey test; B: Randall-Selitto paw pressure test). The analgesic effect of Fxyd2-LASO was dependent on continuous treatment, as discontinuation of injections reversed pain hypersensitivity. Data are shown as mean ± sem. * = p < 0.05; ** = p < 0.01; and **** = p < 0.0001. [Figure 5A-B] Figures 5A and 5B show that lipid modification of Fxyd2-LASO is necessary for its analgesic effect in the SNL model of neuropathic pain. After induction of mechanical hypersensitivity by SNL, rats received daily intrathecal injections of either Fxyd2-LASO (n = 6) or Fxyd2-ASO (non-lipid-modified) (n = 6). Fxyd2-LASO effectively reversed pain behavior as evidenced by the mechanical hypersensitivity test (A: von Frey test, B: Randall-Selitto paw pressure test), whereas Fxyd2-ASO did not (Figures 5A and 5B). Data are shown as mean ± sem. * = p < 0.05; ** = p < 0.01; *** = p < 0.001; and *** * = p < 0.0001. [Figure 6A-B]Figures 6A and 6B show that Fxyd2 inhibition by intrathecal injection of Accell Fxyd2-siRNA reduces mechanical hypersensitivity in the SNL model. After induction of mechanical hypersensitivity by SNL, animals received daily intrathecal injections of Accell Fxyd2-siRNA (n = 9) or Accell control-siRNA (n = 9). Accell Fxyd2-siRNA, but not Accell control-siRNA, reduced mechanical hypersensitivity in the von Frey test (A) and the Randall-Selitto paw pressure test (B). Data are shown as mean ± sem. ** = p < 0.01; *** = p < 0.001; and **** = p < 0.0001. DETAILED DESCRIPTION OF THE INVENTION

[0013] The inventors have demonstrated that targeting regions of FXYD2 can inhibit the expression and / or activity of FXYD2. They have shown that they can be used to inhibit and / or reduce F Antisense oligonucleotides (ASOs; e.g., SEQ ID NO: 1) targeting the XYD2 gene 17) was designed and synthesized, which demonstrated efficacy in two rat models of pain (neuropathic and inflammatory). Intrathecal injection of FXYD2-optimized ASO was performed in patients with pain. We demonstrated that ASO effectively reduces its expression in the dorsal root ganglia (DRG) of rats. The results showed that FXYD2 ASO inhibits the proliferation of cerebrospinal fluid in a rat model of spinal nerve ligation (SNL). Significant reduction of neuropathic pain and analgesic effect of FXYD2 on neuropathic pain These results prove that the market share of ziconotide is larger than that of ziconotide, which has the largest market share in recent years. FXYD2 ASO inhibited the growth of leukemia-associated lymphoma cells in a complete Freund's adjuvant (CFA)-induced rat model. The results showed that the drug significantly reduced inflammatory pain in the sham group.

[0014] Therefore, the present inventors have obtained a therapeutic tool for pain, more specifically for neuropathic pain. Ta.

[0015] (Sequence of the invention) In a first aspect, the present invention relates to inhibitors of FXYD2, which inhibitors The present invention relates to a method for reducing the expression and / or activity of FXYD2 in a subject of need thereof, and ... A region including or consisting of nucleotides 219 to 229 is are also targeted.

[0016] As used herein, the term "FXYD2" includes ion transport regulator 2. It has the general meaning in the art and refers to the FXYD2 domain containing N The term refers to the gamma subunit of a,K-ATPase. The mRNA sequence of FXYD2 is available from NCBI Gene I It can be found at D number: 486.

[0017] Naturally occurring human FXYD2 gene, variant b, is Genbank accession no. Human FXYD2, having the nucleotide sequence as set forth in No. NM021603.4. The nucleotide sequence of transcript variant b cDNA is defined by the sequence of SEQ ID NO: 1 ( 593bp): ACTCTCCATCCAGGCCCCAGGCAAGCAGCACCTCCCTGCT CTCCTGCACTCCTGGACACAACCAGCAGCTCCTGCCATGG ACAGGTGGTACCTGGGCGGCAGCCCCAAGGGGGACGTGGA CCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGC CTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCA TCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAA GCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCT CGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCC AAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGG GCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCT GAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATC GCCAACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAG CCGGCGTCAGAGACCGCTGCTTCCCTCACCTGCCTGCCTG TCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGT ACAAATACAGCCGGGTCTCATTTGTTTTTTCAA.

[0018] Naturally occurring human FXYD2 gene, variant a, is Genbank accession no. Human FXYD2, having the nucleotide sequence as set forth in No. NM001680.5. The nucleotide sequence of transcript variant a cDNA is defined by the sequence of SEQ ID NO: 2 ( 589bp): AGACACTCTCCAAAAAGCAGAGACAGCAGGAAGAGGGGAG TGGAGGCAGCCCATTCACCTGGGGAAATGACTGGGTTGTC GATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCG TTCTACTATGACTATGAGACCGTTCGCAATGGGGGGCCTGA TCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCT CCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGC AGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGC GGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGC ATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTT TAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAG GAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCA ACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGG CGTCAGAGACCGCTGCTTCCCTCACCTGCCTGCCTGTCTC CCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTACAA ATACAGCCGGGTCTCATTTGTTTTTTCAA.

[0019] The naturally occurring human FXYD2 gene has a common coding sequence for both variants (a and b). has the following nucleotide sequence as defined in sequence SEQ ID NO:3, which is the sequence of: 5'-91 GGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCT ACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTT CGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTC AGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGC AAATCAATGAAGATGAGCCGTAA 267-3'.

[0020] You can see that FXYD2 is available on Facebook. Among the 4 pictures are: UGA GAG GUA GGU CCG GGG UCC GO CGU CGU GGA GGG ACG AGA GGA CGU GAG GAC CUG UGU UGG UCG UCG AGG ACG GUA CCU GUC CAC CAU GGA CCC GCC GUC GGG GO CCC CCU GCA CCU GGG CAA ACU ACU ACU ACU CUG GCA AGC GO ACC CCC GGA CUA GAA GCG ACC UGA CCG GAA WA GCA CCC CGA GGA WA GGA GGA GUC GUC UUC UAA GGC GAC ACC CCC GO AUU CUU CGC GUC CGU UUA GUU ACU UCU ACU CGG CAU UGU CGU CGG AGC CGC CAC GGU GGG UGA CGU GAC CCC GGU CGA CCC UUC GGU UCG UAC CGG GAC GGA GAC CGC GGA GGG GAA GAA GGG ACC CGA AAU CUG GAA ACA GGG GCA GUG ACG GUC GCG AAC CCG ACU UCC UUC GAG GUC UGA GO ACA CUG GGG GUC CAC CGU AGC GGU UGA GGA CGG AGC ACG GUG GAG UAC GAA UAU UAU UUC GGC CGC AGU CUC UGG CGA CGA AGG GAG UGG ACG GAC GGA CAG AGG GAG GAG ACA GUG GUG GUC GGA GAG GUU CGA WOW CAU WOW UAU GUC GGC CCA GAG UAA ACA AAA AAG UU。

[0021] You can see more FXYD2 updated to their Facebook page. Among the 5 pictures that are available are: UCU GUG AGA GGU UUU UCG UCU CUG UCG UCC UUC UCC CCU CAC CUC CGU CGG GUA AGU GGA CCC CUU UAC UGA CCC AAC AGC UAC CUG CCA CCG CCG UCG GGG UUC CCC CUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGG CAA GCG UUA CCC CCG GAC UAG AAG CGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAG GAG GAG UCG UCU UCU AAG GCG ACA CCC CCG UUA UUC UUC GCG UCC GO UAG UUA CUA CUA CUC GGC AUU GUC GUC GGA GCC GCC ACG GUG GGU GAC GUG ACC CCG GUC GAC CCU UCG GUU CGU ACC GGG ACG GAG ACC GCG GAG GGG AAG AAG GGA CCC GAA AUC UGG AAA CAG GGG CAG UGA CGG UCG CGA ACC CGA CUU CCU UCG AGG UCU GAG UUA CAC UGG GGG UCC ACC GUA GCG GUU GAG GAC GGA GCA CGG UGG AGU ACG AAU AUU AUU UCG GCC GCA GUC UCU GGC GAC GAA GGG AGU GGA CGG ACG GAC AGA GGG AGG AGA CAG UGG UGG UCG GAG AGG UUC GAG UUC AUG UUU AUG UCG GCC CAG AGU AAA CAA AAA AGU U.

[0022] The naturally occurring human FXYD2 gene has a common coding sequence for both variants (a and b). 6, which has the following nucleotide sequence RNA as defined in SEQ ID NO: 6: CCG CCG UCG GGG UUC CCC CUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGG CAA GCG UUA CCC CCG GAC UAG AAG CGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAG GAG GAG UCG UCU UCU AAG GCG ACA CCC CCG UUA UUC UUC GCG UCC GUU UAG UUA CUU CUA CUC GGC AUU.

[0023] In a further embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: reducing the expression and / or activity of FXYD2 in a subject in need thereof, At least 15 nucleotides of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 Targeted leotide.

[0024] In certain embodiments, the antisense oligonucleotides of the present invention target: Target: - comprising or including nucleotides 210 to 238 of SEQ ID NO: 3 and / or - comprising nucleotides 210 to 267 of SEQ ID NO: 3 or nucleotides 210 to 238 of SEQ ID NO: 3 A region consisting of.

[0025] In a particular embodiment, the inhibitor of the present invention comprises the nucleotide sequence of SEQ ID NO: 3. Or, at least the region consisting of said nucleotides is targeted.

[0026] In a particular embodiment, the present invention relates to inhibitors of FXYD2, and reducing the expression and / or activity of FXYD2 in a subject in need thereof, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 targets at least the region consisting of said nucleotides.

[0027] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, Nucleic acid 21 as defined in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 The target region includes or consists of nucleic acids 219 to 229.

[0028] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, Nucleic acid 21 as defined in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 The region including nucleic acids 0 to 238 or consisting of nucleic acids 210 to 238 is targeted.

[0029] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, Nucleic acid 21 as defined in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 The region including nucleic acids 0 to 267 or consisting of nucleic acids 210 to 267 is targeted.

[0030] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, Nucleic acids 91 to 267 of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 are included. Target the area affected.

[0031] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, Nucleic acids 91 to 267 defined in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 Target different areas.

[0032] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, From the nucleic acid set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 Target different areas.

[0033] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, the inhibitor comprising: and reducing the expression and / or activity of FXYD2 in a subject in need thereof, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. Target the area affected.

[0034] In a particular embodiment, the antisense oligonucleotide of the present invention is 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and / or SEQ ID NO: 6 The target region is a nucleotide sequence that is

[0035] In some embodiments, the oligonucleotides of the invention are at least 15 nucleotides long. It has a length of 0.

[0036] In some embodiments, the oligonucleotides of the present invention are 15 to 25 nucleotides. It has a length of 1 / 2.

[0037] In particular, the oligonucleotides of the present invention are 15, 16, 17, 18, 19, 20, 21, It has a length of 22, 23, 24 or 25 nucleotides.

[0038] As used herein, the term "inhibitor" refers to a substance that inhibits the expression and / or activity of FXD2. By "anti-inflammatory" is meant a natural or synthetic compound that has a biological effect that inhibits or reduces.

[0039] In certain embodiments, the inhibitor of gene expression reduces and inhibits the expression of the FXYD2 gene. means a natural or synthetic compound that has a biological effect such as inhibiting or preventing the release of certain compounds. Inhibiting the expression of genes such as the XYD2 gene is usually achieved at various levels. However, the gene product (protein, e.g., FXYD2 protein) in the target cell or tissue may be expressed. It will be understood by those skilled in the art that the inhibition of expression or the reduction or even elimination of the protein may occur. The reduction is usually referred to as knockdown.

[0040] In certain embodiments, an inhibitor of the activity of FXYD2 reduces and inhibits the activity of FXYD2. "A compound" refers to a natural or synthetic compound that has a biological effect such as to inhibit or prevent the progression of a disease.

[0041] In a specific embodiment, the inhibitor of gene expression of FXYD2 is an siRNA, shR NA, antisense oligonucleotide, miRNA or ribozyme.

[0042] In one embodiment, the inhibitor of FXYD2 according to the present invention is an siRNA.

[0043] Small inhibitory RNAs, also known as small interfering RNAs (siRNAs), are used in the present invention. FXYD2 gene expression can also act as an inhibitor of FXYD2 expression. 2 expression is specifically inhibited by mRNA degradation in a sequence-specific manner (i.e., R Small double-stranded RNA (dsRNA) or small double-stranded RNA (SRNA) molecules, such as RNA interference or RNAi, are used to Treating a subject or cells with a vector or construct that causes the production of NA. The gene expression level can be reduced by selecting an appropriate dsRNA or a vector encoding the dsRNA. Methods for selecting the gene are well known in the art, and the sequences of the genes for this purpose are well known ( For example, Tuschl, T. et al. (1999); Elbashir, SM et al. (2001); Hannon, G.J. 02); McManus, MT. et al. (2002); Brummelkamp, ​​TR. et al. (2002); US Patent No. 657 3099 and U.S. Pat. No. 6,506,559, and WO 01 / 36 See Nos. 646, 99 / 32619 and 01 / 68836, which are incorporated herein by reference in their entirety. (Incorporated herein by reference).

[0044] In a particular embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor is It is RNA.

[0045] In a specific embodiment, the siRNA of the present invention is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 The target region is

[0046] In a particular embodiment, the siRNA of the present invention comprises the nucleic acid sequence set forth in SEQ ID NO:3. The target region comprises or consists of the nucleic acid.

[0047] In a particular embodiment, the siRNA of the present invention consists of the sequence of SEQ ID NO:31. The nucleic acid set forth in SEQ ID NO: 31 is defined as the following nucleic acid: 5'AAGAUUCCGCUGUGGGGGC(UU)3'.

[0048] In one embodiment, the inhibitor of FXYD2 according to the present invention is an shRNA.

[0049] Also, small hairpin RNAs (shRNAs) may be used in the present invention. Short hairpin RNA (shRNA) can act as an inhibitor of D2 expression. R forms an abrupt hairpin turn that can be used to suppress gene expression via interference Generally, shRNA is expressed using a vector introduced into cells. The vector uses a U6 promoter to ensure that the shRNA is always expressed. Typically, this vector is passed on to daughter cells so that the gene silencing can be inherited. The sh hairpin structure is cleaved by the cellular machinery into siRNA, which then binds to the RNA-guided silencing receptor. This complex binds to the siRNA. It binds to and cleaves the matching mRNA.

[0050] In one embodiment, the inhibitor of FXYD2 according to the present invention is an miRNA.

[0051] miRNA (miR) is an inhibitor of FXYD2 expression for use in the present invention. miRNA has its general meaning in the art and can function as a It has been reported to have a length of 23 nucleotides, but is usually 21-22 nucleotides. miRNA refers to a microRNA molecule that is 1000 kJ in length and inhibits the translation of target mRNA. Each is processed from a longer precursor RNA molecule (precursor miRNA). iRNAs are transcribed from non-protein-coding genes. Precursor miRNAs are It has two regions of complementarity that can form a stem loop or fold-like structure, is cleaved in animals by an RNase III-like nuclease enzyme called Dicer Usually, the processed miRNA is the stem portion. Mature miRNAs (also called "mature miRNAs") inhibit the translation of specific target genes, for example. These proteins are part of larger complexes that downregulate proteins such as:

[0052] Multiple miRNAs can be used to knock down FXYD2. The RNAs are complementary to different target transcripts or different binding sites on the target transcript. Polycistronic transcripts may also enhance the efficiency of target gene knockdown. In some embodiments, the same miRNA or different miRNAs can be used to Multiple genes encoding NAs can be co-located on a single transcript or on a single vector cassette. In one embodiment, the vector is limited to However, recombinant adeno-associated virus (rAAV) vectors and lentivirus vectors , including retroviral vectors and retrotransposon-based vector systems. It is an illus vector.

[0053] In one embodiment, the inhibitor of FXYD2 is an antisense nucleic acid.

[0054] The inhibitors of FXYD2 expression of the present invention are antisense oligonucleotide constructs. Antisense molecules, including antisense RNA molecules and antisense DNA molecules. Oligonucleotides bind to mRNA and prevent protein translation, or Acts directly to block translation of FXYD2 mRNA by increasing RNA degradation and thus may reduce the level and activity of FXYD2 protein in cells. For example, a sequence of at least 15 bases complementary to a specific region of the mRNA transcript sequence encoding FXYD2. Suitable antisense oligonucleotides can be synthesized, for example, by conventional phosphodiester technology. The gene can be synthesized and administered, for example, by intravenous injection or infusion. Methods using antisense technology to specifically reduce the expression of It is well known (e.g., U.S. Pat. No. 6,566,135, U.S. Pat. No. 6,566,131, U.S. Pat. No. 6,566,132 ... No. 6365354, U.S. Patent No. 6410323, U.S. Patent No. 6107091, U.S. See US Patent No. 6,046,321 and US Patent No. 5,981,732, and their each of which is incorporated herein by reference in its entirety).

[0055] Antisense RNA, which is complementary to the sense target sequence, is used to inhibit the activity of the inhibitor (e.g., DNA sequences for the production of either siRNA, shRNA, or miRNA The DNA encoding the desired double-stranded RNA is generated by, for example, transcription of the DNA. It is incorporated into a gene cassette, such as an expression cassette controlled by a promoter.

[0056] In certain embodiments, the inhibitor of FXYD2 gene expression is an antisense oligonucleotide. It is a nucleotide.

[0057] In certain embodiments, the inhibitor of FXYD2 gene expression is an inhibitor of FXYD2 mRNA. Isolated, synthetic, or recombinant antisense oligonucleotides targeting transcripts The oligonucleotides of the invention may be of any suitable type.

[0058] In some embodiments, the oligonucleotide is an RNA oligonucleotide. In some embodiments, the oligonucleotide is a DNA oligonucleotide. .

[0059] In certain embodiments, the antisense oligonucleotides include, but are not limited to, , SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, Sequence number 16, sequence number 17, sequence number 18, sequence number 19, sequence number 20, sequence number 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: No. 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, Selected from the group consisting of SEQ ID NO:41.

[0060] [Table 1]

[0061] As used herein, the term "nucleotide" refers to any modified or naturally occurring nucleotide. Nucleotides are usually defined as oxyribonucleotides or ribonucleotides. , thymidine (T), cytidine (C), guanosine (G), adenosine (A) and uridine Contains purines and pyrimidines containing (U).

[0062] As used herein, "oligonucleotide" refers to an oligomer of the above nucleotides. The term "oligonucleotide" refers to a nucleic acid in a 3'-5' or 5'-3' orientation. The oligonucleotide used in the present invention refers to a sequence, which may be single-stranded or double-stranded. The oligonucleotide may in particular be DNA or RNA. The term also includes (i) examples For example, linkages other than the standard phosphodiester bonds found in naturally occurring oligo- and polynucleotides. and (ii) optionally, a modified backbone structure, such as ribose or deoxyribose. and oligonucleotides having modified sugar moieties, such as morpholino moieties, rather than Oligonucleotide analogs include "oligonucleotide analogs" that are similar to standard Supporting bases capable of hydrogen bonding through Watson-Crick base pairs to polynucleotide bases The backbone of the analog is the same as that of the oligonucleotide analog molecule and the standard polynucleotide. in a sequence-specific manner between bases in a molecule (e.g., single-stranded RNA or single-stranded DNA) The bases are provided in a manner that allows for such hydrogen bonding. In particular, the analogs are substantially charge-free. The oligonucleotide analogue has a substantially uncharged phosphorus-containing backbone. The containing backbone may be a group consisting of a number of subunit bonds contained therein, for example, 50% to 100% of the bonds. %, typically at least 60% to 100%, or 75%, or 80%, are uncharged and single It contains a phosphorus atom.

[0063] The term "oligonucleotide" also refers to a sequence that is reversed relative to the normal orientation for transcription, Therefore, RNA or DNA complementary to the target gene mRNA molecule expressed in the host cell is corresponding to the NA sequence (e.g., via Watson-Crick base pairing) of the target gene mRNA molecule "A" refers to an oligonucleotide sequence that is capable of hybridizing to a target nucleic acid.

[0064] The antisense strand can be constructed in many other ways, provided that it can interfere with the expression of the target gene. For example, the antisense strand may be used to reverse transcription of the complement (e.g., antisense and sense). The target gene is then inserted into the target cell so that the RNA encoded by the target gene can be complementary to the target gene. reverse-complementing the coding region (or part of it) of the offspring with respect to its normal orientation for transcription In some embodiments, the oligonucleotides may be constructed by reverse-complementing. The oligonucleotide does not need to have the same introns or exons as the target gene; The non-coding regions of target genes can be used to target coding regions such as antisense oligonucleotides (ASOs). can be effective in achieving antisense inhibition of target gene expression similar to that achieved by the binding region. In some embodiments, the oligonucleotides include siRNA and antisense oligonucleotides. It has the same exon pattern as the target gene, such as an oligonucleotide (ASO).

[0065] As used herein, the term "target" or "targeted" refers to a gene encoding the FXYD2 gene. An oligonucleotide capable of specifically binding to the FXYD2 gene or FXYD2 mRNA encoding the product In particular, methods well known to those skilled in the art (e.g., antisense, RNA interference) ) refers to an oligonucleotide capable of inhibiting said gene or RNA.

[0066] According to the present invention, the antisense oligonucleotide of the present invention is an antisense oligonucleotide that binds to the FXYD2 gene product. and targeting mRNA and / or DNA encoding FXYD2, thereby inhibiting FXYD2 expression and / or Or the amount of activity can be reduced.

[0067] That is, the antisense oligonucleotide has a small affinity for the region of the mRNA sequence. It includes sequences that are at least partially complementary, especially completely complementary, and the complementarity is such that it can be expressed under intracellular conditions. As will be readily apparent to one of skill in the art, the A sequence that is "perfectly complementary" to two sequences can be in the form of a DNA molecule or in the form of an RNA molecule. A sequence refers to the reverse complementary counterpart of a second sequence in any of its forms. If there is a match, then it is "partially complementary" to the second sequence.

[0068] FXYD2 gene (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: Targeting cDNA or mRNA encoding the FXYD2 gene (including SEQ ID NO: 5 or SEQ ID NO: 6) The antisense oligonucleotide of the present invention can be used, for example, in bioinformatics tools. The mRNA sequence can be designed using the mRNA sequence as a reference.

[0069] In particular, the antisense oligonucleotides of the present invention inhibit the expression of FXYD2 in the DRG. The expression and / or activity of FXYD2 can be reduced by the oligonucleotide. Methods for determining whether a compound can reduce expression and / or activity are well known to those skilled in the art.

[0070] This can be achieved by, for example, RT-qPCR, in situ hybridization, etc. Analyze the RNA expression of D2 or FXYD by immunohistochemistry, Western blot, etc. By analyzing the protein expression of the 2 genes, as well as the tested antisense oligonucleotides, FXYD2 protein expression or FXYD2 functional activity in the presence and absence of oxalates This can be done by comparing.

[0071] In another embodiment, the oligonucleotide is located at the translation start point of the mRNA (AUG codon ), coding region (e.g., one or more exons), 5'-untranslated region or 3'-untranslated region The purpose is to target the RNA to the site for protein translation. translocation, the actual translation of RNA into protein, splicing or maturation of RNA, and All viral functions, including even independent catalytic activities, may be dependent on RNA. The goal is to interfere with the function of messenger RNA, including the RNA itself. The overall effect of the interference is to cause interference with protein expression.

[0072] In some embodiments, the oligonucleotides of the invention are stable in vivo. Further modifications, especially chemical modifications, may be made to enhance the activity and / or therapeutic efficacy of the compound. The manufacturer provides several modifications that may improve the efficacy of oligonucleotides, such as stabilizing modifications. (C. Frank Bennett and Eric E. Swayze, RNA Targeting Therapeutics: Molecular Mechanisms of Antisense Oligonucleotides as a Therapeutic PlatformAnn u. Rev. Pharmacol. Toxicol. 2010.50:259-293; Juliano RL. The delivery of therapy utic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48). As used herein, oligonucleotides may contain modified nucleotides. Chemical modifications can be made to (i) the phosphate group, (ii) the sugar moiety, and / or (i ii) Chemical modifications can occur at three different sites on the overall backbone structure. These include modifications, heterocycle modifications, sugar modifications and conjugation strategies.

[0073] For example, oligonucleotides include oligodeoxyribonucleotides, oligoribonucleotides, otide, small regulatory RNA (sRNA), U7- or U1-mediated ASO, or peptide conjugate conjugates or their conjugated products such as nanoparticle-conjugated ASOs, morpholinosulfonic acid Phosphorodiamidate morpholino oligomers (phosphorodiamidate morpholino , PMO), peptide nucleic acid (PNA), phosphorothioate (PS) oligonucleotides , stereochemically pure phosphorothioate (PS) oligonucleotides, phosphoramides amide-modified oligonucleotides, thiophosphoramidate-modified oligonucleotides, and methionine-modified oligonucleotides. Chemically modified oligonucleotides by backbone modification, such as diethylphosphonate modified oligonucleotides. Otides; Bicyclic modified oligonucleotides, Bicyclic nucleic acids (BNA), Tricyclic modified oligonucleotides tide, tricyclic DNA antisense oligonucleotide (ASO), 5 in pyrimidine Nucleobase modifications such as -methyl substituted nucleobases, 5-substituted pyrimidine analogs, 2-thio-thymidine Heterocycle-modified oligonucleotides, such as amine-modified oligonucleotides and purine-modified oligonucleotides, Chemically modified oligonucleotides; Locked Nucleic Acid (LNA) oligonucleotides, 2',4'- Methyleneoxy-bridged nucleic acid (BNA), ethylene-bridged nucleic acid (ENA), constrained ethyl (cEt ) Oligonucleotides, 2'-O-MeRNA (2'-OMe), 2'-O-Me Modified RNA (MOE), 2'-fluoroRNA (FRNA), and 4'-thio-modified DNA sugar-modified oligonucleotides such as 2'-modified RNAs, 2'- and 4'-modified oligonucleotides, and 2'-modified RNAs such as 2'- and 4'-modified oligonucleotides; Chemically modified oligonucleotides by modification: 5'-GalNAc and 3'-GalNAcA N-acetylgalactosamine (GalNAc) oligonucleotides such as SO conjugates Lipid-oligonucleotide conjugates (LASOs), membrane-penetrating peptides (CPPs) Oligonucleotide conjugates, targeted oligonucleotide conjugates, antibodies Polymers with oligonucleotide conjugates, PEGylation and targeting ligands, etc. Chemically modified oligonucleotides by conjugation strategies such as oligonucleotide conjugates and, e.g., Bennett and Swayze, 2010 (RNA targeting the rapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic p latform. Annu Rev Pharmacol Toxicol. 2010;50:259-93), Wan and Seth, 201 6(The Medicinal Chemistry of Therapeutic Oligonucleotides. J Med Chem. 2016 Nov 10;59(21):9645-9667), Juliano, 2016(The delivery of therapeutic olig onucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48), Lundin et al., 2 015(Oligonucleotide Therapies: The Past and the Present. Hum Gene Ther. 2015 Aug;26(8):475-85) and Prakash, 2011(An overview of sugar-modified ol igonucleotides for antisense therapeutics. Chem Biodivers. 2011 Sep;8(9):1616-41 ) and the chemical modification and conjugation strategies described in Additionally, for in vivo use, the oligonucleotides may be stabilized. The oligonucleotide may be cleaved (e.g., by exonuclease or endonuclease) ) refers to an oligonucleotide that is relatively resistant to degradation in vivo. The stabilization of oligonucleotides can be a function of length or secondary structure. In particular, the stabilization of oligonucleotides can be a function of the phosphate Backbone modifications, phosphodiester modifications, phosphorothioate (PS) backbone modifications, phosphodiester Combination of ester and phosphorothioate modifications, thiophosphoroadate modifications, 2' modifications Modified (2'-O-Me, 2'-O-(2-methoxyethyl) (MOE) modified and 2'-fulv (Oro-modification), methylphosphonate, methylphosphorothioate, histodithioate, p-ethoxy, and combinations thereof.

[0074] In certain embodiments, the antisense oligonucleotide is a LASO. In some embodiments, the anti- Sense oligonucleotides may be used as described in WO 2014 / 195432. 2-30 carbon atoms, specifically 5-20 carbon atoms, more specifically 10-18 carbon atoms saturated or unsaturated, especially saturated, linear or branched chain, containing at least three carbon atoms; By substitution at the 3' or 5' end with a moiety containing a branched, especially linear, hydrocarbon chain. It will be modified.

[0075] In some embodiments, the antisense oligonucleotides of the present invention comprise at least modified by substitution at the 3' or 5' end with a moiety containing at least one ketal functional group. The ketal carbon of the ketal functional group is modified to be the same as that described in WO 2014 / 195430. As described above, 1 to 22 carbon atoms, specifically 6 to 20 carbon atoms, and especially 10 Two saturated or unsaturated alkyl groups containing up to 19 carbon atoms, more specifically 12 to 18 carbon atoms The hydrocarbon chains are provided as saturated, especially saturated, straight or branched, especially straight chain.

[0076] For example, oligonucleotides may be prepared using phosphorothioate derivatives (non-bridging phosphoryl oxygen groups). The nucleotide may be used as a nucleotide (substituting a sulfur atom) which is resistant to cleavage by nucleases. 2'-Methoxyethyl (MOE) modification (IONIS Pharmaceutical Additionally or alternatively, modified scaffolds such as those sold by Pharmacia Inc. are also effective. Oligonucleotides may be derivatives having substitutions at the 2' position of the sugar, in particular by the following chemical modifications: The nucleotides may contain modified nucleotides that are fully, partially or in combination: O-methyl 2'-O-Me substituted, 2-methoxyethyl (2'-O-MOE) substituted, fluoro 2'-fluoro-substituted, 2'-Cl-substituted, 2'-Br-substituted Substituted, cyanide group (2'-CN) substituted, trifluoromethyl group (2'-CF3) substituted, OC F3 group (2'-OCF3) substitution, OCN group (2'-OCN) substitution, O-alkyl group (2' -O-alkyl) substitution, S-alkyl group (2'-S-alkyl) substitution, N-alkyl group ( 2'-N-alkyl) substituted, O-alkenyl group (2'-O-alkenyl) substituted, S-alkenyl Alkenyl group (2'-S-alkenyl) substituted, N-alkenyl group (2'-N-alkenyl) Substitution, SOCH3 group (2'-SOCH3) substitution, SO2CH3 group (2'-SO2CH3) Substitution, ONO2 group (2'-ONO2) substitution, NO2 group (2'-NO2) substitution, N3 group (2 Additionally or alternatively, the present invention provides a compound having a substituted NH group (2'-NH) and / or a substituted NH group (2'-NH). The oligonucleotides may contain fully or partially modified nucleotides, Ribose moieties are used to generate locked nucleic acids (LNA), in which covalent bonds is formed between the 2' oxygen and 4' carbon of ribose, and in the 3'-terminal structure These molecules are terminated with LNA (gapmers) and complementary RNA and biological enzymes that can activate RNase H, such as when they form strong hybrids with DNA. It is very stable in culture medium.

[0077] In some embodiments, the oligonucleotides used in the present invention are A, 2'-OMe analog, 2'-O-Met, 2'-O-(2-methoxyethyl) (M OE) Oligomer, 2'-phosphorothioate analog, 2'-fluoro analog, 2' -Cl analog, 2'-Br analog, 2'-CN analog, 2'-CF3 analog, 2 '-OCF3 analog, 2'-OCN analog, 2'-O-alkyl analog, 2'-S -Alkyl analogs, 2'-N-alkyl analogs, 2'-O-alkenyl analogs, 2 '-S-alkenyl analogue, 2'-N-alkenyl analogue, 2'-SOCH3 analogue 2'-SO2CH3 analog, 2'-ONO2 analog, 2'-NO2 analog, 2 '-N3 analog, 2'-NH2 analog, tricyclo(tc)-DNA, U7 short-chain nucleic acid (sn)RNA, tricyclo-DNA-oligoantisense molecules, and combinations thereof The modified nucleotides are selected from the group consisting of: -DNA ANTISENSE OLIGONUCLEOTIDES, COMPOSITIONS AND METHODS FOR TREATING DIFFERENT DISEASES - Patent application See U.S. Provisional Application No. 61 / 212,384, filed on Dec. 1, 2003, and the complete contents of which are incorporated herein by reference. (Incorporated by reference herein).

[0078] In a particular embodiment, the oligonucleotide according to the invention is an LNA oligonucleotide. As used herein, "LNA" (locked nucleic acid) (or "LNA oligonucleotide") is a LNA nucleotides and LNA analog nucleotides are also known as LNA nucleotides. The term "oligonucleotides" refers to oligonucleotides containing the above bicyclic, tricyclic, or polycyclic nucleoside analogs. Generally, LNA oligonucleotides, LNA nucleotides and LNA analogue nucleotides are used. Reotide is disclosed in WO 99 / 14226 and its subsequent application WO 00 / 56746, International Publication No. 00 / 56748, International Publication No. 00 / 66604, International Publication No. 01 / 25248, International Publication No. 02 / 28875, International Publication No. 02 / 0942 50, WO 03 / 006475, U.S. Pat. No. 6,043,060, U.S. Pat. 268490, U.S. Patent No. 6,770,748, U.S. Patent No. 6,639,051, and U.S. Patent No. Publication No. 2002 / 0125241, Publication No. 2003 / 0105 309, U.S. Patent Application Publication No. 2003 / 0125241, U.S. Patent Application Publication No. 200 2 / 0147332, U.S. Patent Application Publication No. 2004 / 0244840 and U.S. Patent No. and published application No. 2005 / 0203042, all of which are incorporated herein by reference. LNA oligonucleotides and LNA analogue oligonucleotides is commercially available from, for example, Proligo LLC, 6200 Lookout Road, Boulder, CO 80301 USA. It is possible.

[0079] Other forms of the oligonucleotides of the present invention include, but are not limited to, lentiviral or In combination with adeno-associated virus-based viral transduction methods, small molecule receptors such as U1 or U7 It is an oligonucleotide sequence attached to the NA molecule (Denti, MA, et al, 2008; Goyenva lle, A, et al, 2004).

[0080] Another form of oligonucleotide of the present invention is a peptide nucleic acid (PNA). In nucleic acids, the deoxyribose backbone of oligonucleotides resembles a peptide more than a sugar. Each subunit or monomer is substituted with a naturally occurring carboxyl group attached to this backbone. or non-naturally occurring bases. One such backbone is an N-(2 It is constructed from repeating units of (-aminoethyl)glycine. Due to the radical deviation, these compounds were named peptide nucleic acids (PNAs) (Dueho (Im et al., New J. Chem., 1997, 21, 19-31). PNA binds to both DNA and RNA. PNA / DNA or PNA / RNA duplexes are formed. The formation of an A / RNA duplex is more common than DNA / DNA, DNA / RNA, or RNA / RNA The high thermal stability of PNAs is due to their affinity determined by their large Tm. The neutral backbone of PNAs can contribute to the absence of charge repulsion. This results in a Tm of the PNA / DNA (RNA) duplex that is virtually independent of salt concentration. The interaction of PNA / DNA (RNA) duplexes is strongly dependent on ionic strength. A, which offers additional advantages over DNA / RNA or RNA / RNA duplex interactions. Homopyrimidine PNA forms a highly thermostable (PNA)2 / DNA(RNA) triplex. have been shown to bind complementary DNA or RNA in an antiparallel orientation (e.g., Egholm, et al., Science, 1991, 254, 1497; Egholm, et al., J. Am. Chem. Soc., 1992, 114, 1895; see Egholm, et al., J. Am. Chem. Soc., 1992, 114, 9677). In addition to their specificity, PNAs have also been shown to bind to DNA or RNA with increased specificity. When a PNA / DNA duplex mismatch is melted compared to a DNA / DNA duplex, 8 The magnitude of this decrease in Tm is thought to be about 20°C. The PNA strand binds to the DNA or RNA strand in one of two ways. The orientation is such that the carboxyl end of the PNA is aligned with the 5' end of the DNA or RNA. The amino terminus of the PNA is directed toward the 3' end of the DNA or RNA. When a DNA or RNA strand binds to a PNA strand in a complementary manner from the 3' direction, it is said to be antiparallel. In the antiparallel orientation, the carboxyl and amino termini of the PNA are aligned with the DNA or R The 5'-3' orientation of PNAs is reversed compared to oligonucleotides. The advantage of these is that they (with suitable nucleobases or other side groups attached to them) can be easily The mido backbone is not recognized or cleaved by either nucleases or proteases. As a result, PNAs, unlike nucleic acids and peptides, are resistant to enzymatic degradation. WO 92 / 20702 describes a method for cleaving DNA that is more strongly complementary than the corresponding DNA. This paper describes peptide nucleic acid (PNA) compounds that bind to complementary D and RNA. It showed strong binding affinity and specificity for NA (Egholm, M., et al., Chem. Soc., Che m. Commun., 1993, 800; Egholm, M., et.al., Nature, 1993, 365, 566; and Nielsen, P., et.al. Nucl. Acids Res., 1993, 21, 197). Furthermore, PNAs have been shown to be effective in the detection of ATP in cell extracts. It exhibits nuclease resistance and stability (Demidov, VV, et al., Biochem. Pharmacol., 1994, 48, 1309-1313). Modifications of PNAs include the use of extended backbones (Hyrup, B., et.al. Chem. Soc. ., Chem. Commun., 1993, 518), an extended linker between the backbone and the nucleobase, an amide bond Reversal of the bond (Lagriffoul, PH, et.al., Biomed. Chem. Lett., 1994, 4, 1081) and Use of chiral scaffolds based on cinnamic acid (Dueholm, K. L, et.al., BioMed. Chem. Lett., 1994, 4 Peptide nucleic acids include those described in U.S. Pat. No. 5,539,082 and U.S. Pat. No. 5,539,082. Peptide nucleic acids are further described in U.S. Patent Application Serial No. 08 / 686,113. It is listed in the number.

[0081] Generally, the oligonucleotides of the invention are obtained by conventional methods well known to those skilled in the art. For example, the oligonucleotides of the invention can be synthesized using a number of techniques well known in the art. They can be synthesized de novo, for example, by the b-cyanoethyl phosphoramidite method (Beaucage et al. , 1981), nucleoside H-phosphonate method (Garegg et al., 1986; Froehler et al., 19 86, Garegg et al., 1986, Gaffney et al., 1988). These chemicals are commercially available. These nucleic acids may be referred to as synthetic nucleic acids. Alternatively, oligonucleotides can be produced in large quantities in plasmids (Sambrook, et al. (See, e.g., et al., 1989). Oligonucleotides can be prepared by cleaving or cleaving fragments with restriction enzymes, exonucleases, or endonucleases. These can be prepared from existing nucleic acid sequences using well-known techniques, such as using cleavage. An oligonucleotide prepared with can refer to an isolated nucleic acid.

[0082] Those skilled in the art will appreciate the chemical modification of oligonucleotides, lipid and polymer-based nanoparticles or Nanocarriers, oligonucleotides, carbohydrates, peptides, antibodies, aptamers, lipids or Ligand-oligonucleotide conjugates by binding to target factors such as small molecules Late, J., and Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48. Several approaches have been developed to enhance the delivery and efficacy of oligonucleotides, including small molecules that improve the delivery of ribosomal proteins. Lipophilic and lipid conjugates can be easily provided. Fatty acid-oligonucleotide conjugates, sterol-oligonucleotide conjugates It includes a gate and a vitamin-oligonucleotide conjugate.

[0083] In certain embodiments, the oligonucleotides of the invention are conjugated to a second molecule. Typically, the second molecule is selected from the group consisting of an aptamer, an antibody, or a polypeptide. For example, the oligonucleotide of the present invention may be conjugated to a membrane-permeable peptide. Membrane-permeable peptides are well known in the art, and examples thereof include the TAT peptide. (Bechara C, Sagan S. Cell-penetrating peptides: 20 years later, where do w e stand? FEBS Lett. 2013 Jun 19;587(12):1693-702).

[0084] In some embodiments, the oligonucleotides of the present invention are those recognized by those of skill in the art. Other carriers may be used to obtain the desired results, such as liposomes or micelles. Liposomes are lipid bilayer membranes with a structure similar to biological membranes. Such carriers are useful for cellular uptake of oligonucleotides. to enhance targeting or to improve the pharmacokinetic or therapeutic properties of oligonucleotides. For example, the oligonucleotides of the present invention can be encapsulated in liposomes, pharmaceutical compositions, etc. The active ingredient may be administered by injecting it into a small membrane consisting of aqueous concentric layers attached to a lipid membrane. The oligonucleotides contained in the body are dispersed or present in various forms. The liposomes may be present in both the aqueous phase and the lipid membrane, or what is commonly called a liposomal suspension. Generally, but not exclusively, the hydrophobic layer is composed of lecithin and sphingomyelin, cholesterol, and steroids such as terol, diacetyl phosphate, stearylamine or phosphatidine This includes stronger or weaker ionic surfactants such as acids, or other hydrophobic materials. Generally, the diameter of a liposome is in the range of about 15 nm to about 5 μm. The use of liposomes as a vehicle offers several advantages. Liposomes have the potential to increase stability, increase uptake efficiency, and improve biological activity. hollow spheroids composed of lipids prepared in a manner similar to those that form membranes They range in size from 0.05 to several microns in diameter and capture water-soluble compounds. Some studies have shown that liposomes can deliver nucleic acids into cells, and It has been shown that nucleic acids and nucleic acids maintain their biological activity. Liposome delivery vehicles, originally designed as delivery vehicles, are capable of delivering intact nucleic acid molecules into cells. Specific advantages of using liposomes include the following: they can be used in compositions they are non-toxic and biodegradable; they exhibit long circulating half-lives; and the recognition molecule They can be easily attached to surfaces for targeting to tissues. Finally, liquid suspensions or cost-effective manufacturing of liposome-based pharmaceuticals in lyophilized products is acceptable. This demonstrates the viability of this technology as a drug delivery system.

[0085] In some embodiments, the oligonucleotide of the present invention is an oligonucleotide It is combined with a complexing agent to enhance cellular uptake. Examples of complexing agents are cationic lipids. Cationic lipids can be used to deliver oligonucleotides into cells. The term "cationic lipid" refers to lipids and synthetic lipids that have both polar and non-polar domains. which may have a positive charge at or near physiological pH, They can bind to polyanions such as acids, facilitating the transport of nucleic acids into cells. The hydrophobic lipids include saturated and unsaturated alkyl and alicyclic ethers, as well as amines, amides or derivatives thereof. Cationic lipids include esters of derivatives thereof. The groups may contain, for example, from 1 to about 25 carbon atoms. In particular, straight or branched chain alkyl or alkoxy groups are The cycloaliphatic group has six or more carbon atoms. The cycloaliphatic group is a compound that is compatible with cholesterol and other steroids. Cationic lipids include, for example, Cl-, Br-, I-, F-, acetate, triflate, etc. Prepared with a variety of counterions (anions) including acetate, sulfate, nitrite, and nitrate Examples of cationic lipids include polyethyleneimine, polyimideamine (PAMA), M) Star-shaped dendrimer, Lipofectin (combination of DOTMA and DOPE), Lipo Infectase, Lipofectamine, DOPE, Cytofectin (Gilead Sciences, Foster City, CA) Cationic surfactants include Eufectin (JBL, San Luis Obispo, Calif.) and Eufectin (JBL, San Luis Obispo, Calif.). Liposomes contain: N-[1-(2,3-dioleoloxy)-propyl]- N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3- Dioleoloxy)-propyl]-N,N,N-trimethylammonium methylsulfate DOTAP, 3p-[N-(N',N'-dimethylaminoethane)carbamoyl] Cholesterol (DC-Chol), 2,3-dioleyloxy-N-[2(sperm N,N-dimethyl-1-propanaminium trifluoromethyl Acetate (DOSPA), 1,2-Dimyristyloxypropyl-3-dimethyl-1- Hydroxyethylammonium bromide; and dimethyldioctadecylammonium bromide amide (DDAB). Cationic lipids such as N-(1-(2,3-dioleyloxy)propionate (DOTMA)-N,N,N-trimethylammonium chloride (DOTMA) is a phosphoro A 1000-fold enhancement of the antisense effect of thioate oligonucleotides was observed (Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108). Also, oligo The nucleotides can be conjugated with, for example, poly(L-lysine) or avidin, and this mixture Cationic surfactants may or may not be included in the product (e.g., steryl-poly(L-lysine)). Lipids have been used in the art to deliver oligonucleotides into cells. (See, for example, U.S. Patent No. 5,855,910, U.S. Patent No. 5,851,548 ...5,910, U.S. Patent No. 5,855 30430, U.S. Patent No. 5780053, U.S. Patent No. 5767099, Lewis et al. l. 1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al. 1998. Molecular Membran (See eBiology 15:1). Other lipid compositions that may be used in connection with the claimed methods may be used. In addition to those described above, other lipid compositions are known in the art, e.g., U.S. Pat. No. 4,629,999. 235871, U.S. Patent No. 4501728, U.S. Patent No. 4837028, U.S. Patent This is taught in US Pat. No. 4,737,323.

[0086] In a particular embodiment of the inhibitor of the present invention, the inhibitor comprises the nucleotide sequence of SEQ ID NO:3. It targets the region consisting of octides.

[0087] In certain embodiments of the antisense oligonucleotides of the present invention, the antisense The oligonucleotides are SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: No. 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, Sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or sequence number 4 1.

[0088] In certain embodiments of the antisense oligonucleotides of the present invention, the antisense The oligonucleotides are SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: No. 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, Sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or sequence number 4 It consists of an array of 1s.

[0089] In certain embodiments of the antisense oligonucleotides of the present invention, the antisense The oligonucleotides are SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: No. 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, Sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or sequence number 4 1.

[0090] In certain embodiments of the antisense oligonucleotides of the present invention, the antisense The oligonucleotides are SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 , SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.

[0091] In particular embodiments of the inhibitors and / or antisense oligonucleotides of the present invention, In the present invention, the inhibitor and / or antisense oligonucleotide is administered to the dorsal root ganglion (D The amount of FXYD2 in RG can be reduced.

[0092] According to the present invention, a first nucleic acid sequence having at least 70% identity to a second nucleic acid sequence is 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 9 92, 93, 94, 95, 96, 97, 98, or 99% identity Nucleic acid sequence identity can be determined using a suitable sequence alignment algorithm such as BLAST N and Specifically determined using default parameters (Karlin and Altschul, Proc. Natl Acad. Sci. USA 2012;10:1111-1112, 2012). d. Sci. USA 87(6):2264-2268 (1990)).

[0093] (Vector of the present invention) In a second aspect, the present invention relates to a vector for the transfer of a heterologous nucleic acid, said nucleic acid comprising: Inhibitory R specifically binds to FXYD2 mRNA and inhibits FXYD2 expression in cells Encodes NA.

[0094] In a particular embodiment, the present invention relates to a vector for the delivery of heterologous nucleic acid, said nucleic acid This invention specifically binds to FXYD2 mRNA and inhibits the expression of FXYD2 in cells. The inhibitor encodes the corresponding gene.

[0095] In a particular embodiment of the vector of the invention, the inhibitor is an siRNP as described above. A or an antisense oligonucleotide.

[0096] In a further embodiment, the nucleic acids of the invention (e.g., antisense nucleic acids) are They can be delivered alone (naked ASO / LASO) or in combination with vectors.

[0097] In its broadest sense, a "vector" refers to a vector that is capable of delivering an oligonucleotide of the invention to a cell. In particular, the vector is a vehicle capable of facilitating the transfer of a protein. Generally, the nucleic acid transporter useful in the present invention is Vectors may include, but are not limited to, naked plasmids, non-viral delivery systems (e.g., cationic transfection agents, liposomes, lipid nanoparticles, etc.), phagemids, viruses, other viruses or viruses engineered by the insertion or incorporation of oligonucleotide sequences Viral vectors include, but are not limited to, the following viruses: These include nucleic acid sequences from viruses: retroviruses (e.g., Moloney murine leukemia virus and Lentivirus-derived vectors), Harvey murine sarcoma virus, mouse mammary tumor virus, and RNA viruses such as Rous sarcoma virus; adenoviruses and adeno-associated viruses (AAVs); );SV40 virus;Polyoma virus;Epstein-Barr virus;Papillomavirus herpesvirus; vaccinia virus; poliovirus. Those skilled in the art will recognize the Although not shown, other vectors well known in the art can readily be used.

[0098] Therefore, an object of the present invention is to provide a method for producing a recombinant human FXYD2 comprising administering to the human anthraquinone derivative a part or fragment of FXYD2 or a variant thereof. The present invention relates to a vector containing an oligonucleotide sequence that encodes the vector.

[0099] In another embodiment, the vector of the present invention encodes a portion or fragment of FXYD2. Includes variants of the oligonucleotide sequence.

[0100] In another embodiment, the vector of the present invention comprises an oncogene encoding a variant of FXYD2. It includes variants of the oligonucleotide sequence.

[0101] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. The present invention relates to a vector comprising an antisense oligonucleotide sequence encoding a target gene.

[0102] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. The present invention relates to a vector containing an shRNA sequence encoding an inhibitor.

[0103] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. The present invention relates to a vector containing a miRNA sequence encoding a target gene.

[0104] In another embodiment of the vector of the present invention, the antisense oligonucleotide comprises: Nucleotide sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5 or sequence number 6 The target region is one that contains or consists of the nucleotide.

[0105] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 1 7, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, Sequence number 29, sequence number 30, sequence number 33, sequence number 34, sequence number 35, sequence number 36 , SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41 The present invention relates to a vector comprising the same.

[0106] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 1 7, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, Sequence number 29, sequence number 30, sequence number 33, sequence number 34, sequence number 35, sequence number 36 , SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41 The present invention relates to a vector comprising:

[0107] In another embodiment, the vector of the present invention comprises a portion or fragment of FXYD2 or a fragment thereof. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO No. 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 26 or SEQ ID NO: 27.

[0108] In another embodiment, the vector of the present invention comprises a portion or fragment of FXYD2 or a fragment thereof. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO No. 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, Sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or sequence number 4 It consists of a variant of the sequence of 1.

[0109] In a specific embodiment, the vector of the invention comprises SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, Sequence number 25 consists of a variant of the sequence of sequence number 26.

[0110] In other embodiments, the present invention provides a nucleic acid sequence similar to, but not limited to, SEQ ID NO: 1, SEQ ID a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6; and a vector comprising the promoter.

[0111] In other embodiments, the present invention provides a nucleic acid sequence similar to, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO: No. 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 3 9, a sequence selected from the group consisting of SEQ ID NO: 40 or SEQ ID NO: 41, and a promoter The present invention relates to a vector comprising or consisting of:

[0112] In other embodiments, the sequences include, but are not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and a promoter. relates to vectors comprising them.

[0113] In another embodiment of the vector of the present invention, the antisense oligonucleotide comprises: Nucleotide sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5 or sequence number 6 nucleotides, and U6 promoter or Pol II promoter or The target region comprises:

[0114] In some embodiments, the vector may comprise, but is not limited to, SEQ ID NO: 7, SEQ ID NO: No. 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: No. 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 2 5, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, a sequence selected from the group consisting of SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41, and U6 It contains a sequence containing a promoter or a Pol II promoter.

[0115] In some embodiments, the vector may comprise, but is not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO Sequence number 18, sequence number 19, sequence number 20, sequence number 21, sequence number 22, sequence number 23 , SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and U 6 promoter or a sequence containing a Pol II promoter.

[0116] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. The oligonucleotide sequence encoding the target gene and the vector containing the CAG promoter are described. do.

[0117] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. miRNA sequence encoding the target gene, and a CAG promoter or Pol II promoter The present invention relates to a vector comprising:

[0118] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. The present invention relates to a vector comprising an shRNA sequence encoding the inhibitor, and a U6 promoter.

[0119] In another embodiment of the vector of the present invention, the antisense oligonucleotide comprises: Nucleotide sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5 or sequence number 6 It targets the region containing or consisting of the nucleotide and the CAG promoter.

[0120] In other embodiments, the present invention provides a nucleic acid sequence similar to, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO: No. 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 3 9, a sequence selected from the group consisting of SEQ ID NO: 40 or SEQ ID NO: 41, and a CAG promoter. The present invention relates to a vector containing the vector.

[0121] In other embodiments, the present invention provides a method for the preparation of a nucleic acid sequence similar to, but not limited to, SEQ ID NO: 17, SEQ ID NO: 1 8, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and a CAG promoter. Concerning a vector containing a motor.

[0122] Variants include, for example, alleles, such as alternative splice forms, between individuals (e.g., polymorphisms). This includes naturally occurring variants due to mutations. The term variant also refers to variants derived from other sources or organisms. Variants preferably include the gene sequences of the present invention, Substantially homologous, i.e., typically at least about 75%, to the sequences of the present invention, are preferred. More preferably, at least about 85%, more preferably at least about 90%, more preferably at least The variants of the genes of the present invention also show approximately 95% nucleotide sequence identity. hybridize to the above sequence (or its complementary strand) under suitable hybridization conditions. Typical stringent hybridization conditions include about 30°C, preferably about At temperatures above 35°C, more preferably above 42°C, and / or below about 500 mM, preferably Hybridization conditions include temperature, salt concentration and / or can be adjusted by those skilled in the art by modifying the concentrations of other reagents such as SDS, SSC, etc. do.

[0123] In a particular embodiment, the use of the vectors of the present invention is achieved by using non-viral vectors or viral vectors. It is an illus vector.

[0124] In certain embodiments, the non-viral vector comprises a nucleic acid sequence encoding FXYD2. It is a plasmid containing

[0125] In other specific embodiments, the vector may be a viral vector.

[0126] Gene delivery viral vectors useful in the practice of the present invention can be synthesized using techniques in molecular biology. They can be constructed using methodologies well known in the art. Typically, they are constructed using a viral vector carrying the transgene. The target contains the transgene, appropriate regulatory elements, and a virus that mediates cell transduction. It is constructed from polynucleotides that encode elements necessary for the production of a protein.

[0127] As used herein, a "transgene" refers to an antisense oligonucleotide of the present invention. It means Chido.

[0128] The terms "gene transfer" or "gene delivery" refer to the transfer of exogenous DNA into a host cell. A method or system for easily inserting A. Such a method is a non-integrative transposition method. Transient expression of DNA, extrachromosomal replication and expression of transfer replicons (e.g., episomes), or allows for integration of the transferred genetic material into the genomic DNA of the host cell.

[0129] Such recombinant viruses can be produced by transfection of packaging cells or by the transfection of herpes simplex viruses. In the art, methods such as transient transfection using per-plasmid or virus are used. A typical example of a viral packaging cell is PA These include 317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc. Detailed protocols for generating replication-defective recombinant viruses are described, for example, in WO 95 / 04944. / 14785, International Publication No. 96 / 22378, U.S. Patent No. 5,882,877, U.S. Patent No. Patent No. 6013516, U.S. Patent No. 4861719, U.S. Patent No. 5278056 and This can be seen in WO 94 / 19478.

[0130] In certain embodiments, the viral vector is an adenovirus, a retrovirus, or a recombinant virus. Antiviral, herpesvirus, or adeno-associated virus (AAV) vectors good.

[0131] In certain embodiments, adeno-associated virus (AAV) vectors are employed.

[0132] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. Adeno-associated virus (AAV) vector containing an oligonucleotide sequence encoding the Regarding.

[0133] In another embodiment, the adeno-associated virus (AAV) vector of the present invention is FXYD Variants of the oligonucleotide sequences encoding portions or fragments of 2 are included.

[0134] In another embodiment, the present invention provides a method for producing a portion or fragment of FXYD2 or a barrier thereof. Adeno-associated virus (AAV) vectors containing antisense sequences encoding do.

[0135] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) containing an shRNA sequence encoding an ant.

[0136] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) vectors containing miRNA sequences encoding ant do.

[0137] In another embodiment of the adeno-associated virus (AAV) of the present invention, an antisense oligonucleotide is The oligonucleotide may be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or targets a region comprising or consisting of the nucleotides of SEQ ID NO:6.

[0138] In certain embodiments, the present invention relates to, but is not limited to, a portion or portions of FXYD2. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: No. 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 2 1, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, Sequence number 35, sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or an adeno-associated virus (AAV) comprising a sequence selected from the group consisting of SEQ ID NO: 41 Regarding vectors.

[0139] In another embodiment, the adeno-associated virus (AAV) vector of the present invention comprises: and a gene encoding a portion or fragment of FXYD2 or a variant thereof, but not limited to the above. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, Sequence number 13, sequence number 14, sequence number 15, sequence number 16, sequence number 17, sequence number 18 , SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: No. 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, Selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41 Contains variants of one sequence.

[0140] In a specific embodiment, the adeno-associated virus (AAV) vector of the present invention comprises: Examples include, but are not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: No. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26 The present invention also includes variants of a sequence selected from the group consisting of:

[0141] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) vector containing an oligonucleotide sequence encoding the ant Regarding.

[0142] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) vectors containing antisense sequences encoding antagonism do.

[0143] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) vectors containing miRNA sequences encoding ant do.

[0144] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus (AAV) vectors containing shRNA sequences encoding antagonism do.

[0145] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated oligonucleotides containing an oligonucleotide sequence encoding the ant and a CAG promoter Regarding viral (AAV) vectors.

[0146] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. an adeno-associated virus containing an antisense sequence encoding the ant and a CAG promoter; Regarding AAV vectors.

[0147] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus containing an miRNA sequence encoding an ant and a CAG promoter (AAV) vectors.

[0148] In a specific embodiment, the present invention provides a portion or fragment of FXYD2 or variants thereof. Adeno-associated virus containing an shRNA sequence encoding the ant and a CAG promoter (AAV) vectors.

[0149] In certain embodiments, the present invention provides SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. A region comprising or consisting of the nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 A vector containing a target antisense oligonucleotide and a CAG promoter Regarding.

[0150] In certain embodiments, the present invention provides SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: No. 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 2 7, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or An adeno-associated virus (AAV) vector containing the sequence of SEQ ID NO: 41 and a CAG promoter Regarding Tar.

[0151] In certain embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising, but not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and a CAG fragment thereof. The present invention relates to an adeno-associated virus (AAV) vector containing a promoter.

[0152] In one embodiment, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AA5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, or are other serotypes of AAV capable of infecting humans, rodents, monkeys or other species.

[0153] "AAV vector" includes, but is not limited to, AAV1, AAV2, AAV3, AA V4, AA5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.1 0, etc. An AAV vector is a vector derived from an adeno-associated virus serotype, e.g., For example, all or part of the rep and / or cap genes have been deleted, but functional flanking ITR sequences remain. The AAV vector may have one or more wild-type AAV genes that maintain the sequence. It is necessary for the rescue, replication and packaging of AAV vectors. These sequences are required in cis for viral replication and packaging. It is defined herein that an ITR comprises at least one ITR (e.g., a functional ITR). As long as the sequence provides functional rescue, replication, and packaging, wild-type polynucleotides are The sequence need not be the same as the original sequence and may be altered, for example, by the insertion, deletion or substitution of nucleotides. The AAV expression vector contains a transcription initiation region, a desired DNA (i.e., a component linked to a regulatory element containing a transcription termination region (i.e., a nucleic acid sequence of the present invention) The device is constructed using well-known techniques to at least serve as a support.

[0154] In certain embodiments, the viral vectors used in the compositions and methods of the invention are Recombinant adeno-associated virus (rAAV). rAAV is a vector known in the art. Any serotype, variant, or derivative, or combination thereof (e.g., rAAV2, rAAV containing two or more serotypes, such as two or more of rAAV8 and rAAV9 In some embodiments, the rAAV can be rAAV1, rAAV V, or 2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rA AV9, rAAV10, rAAV-11, rAAV-12, rAAV-13, rAAV- 14, rAAV-15, rAAV-16, rAAV.rh8, rAAV.rh10, rA AV.rh20, rAAV.rh39, rAAV.Rh74, rAAV.RHM4-1, AAV.hu37, rAAV.Anc80, rAAV.Anc80L65, rAAV.7 m8, rAAV.PHP.B, rAAV2.5, rAAV2tYF, rAAV3B, rA AV.LK03, rAAV.HSC1, rAAV.HSC2, rAAV.HSC3, rA AV.HSC4, rAAV.HSC5, rAAV.HSC6, rAAV.HSC7, rA AV.HSC8, rAAV.HSC9, rAAV.HSC10, rAAV.HSC11, rAAV.HSC12, rAAV.HSC13, rAAV.HSC14, rAAV.HS C15 or rAAV, HSC16 or other rAAV, or a combination of two or more thereof It is a combination.

[0155] In some embodiments, the rAAV used in the compositions and methods of the invention is AA V1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AA V9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV -15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh20, AAV .rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.A nc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2 .5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.H SC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV .HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV .HSC15 or AAV.HSC16, or derivatives, variants or pseudotypes thereof Some embodiments comprise capsid proteins from an AAV capsid serotype selected from the following: In embodiments, the rAAV is, for example, AAV1, AAV2, AAV3, AAV4, AAV 5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-1 2, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AA V.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RH M4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV .7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV. LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4 , AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV .HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV. From HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 For the vp1, vp2 and / or vp3 sequences of the selected AAV capsid serotype, At least 80% identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5 % identity, i.e., capsid proteins of 100% or less identity.

[0156] In certain embodiments, the AAV used in the methods described herein is Anc80 or Anc80L65 as described in et al., 2015: 1056-1068. and which is incorporated herein by reference in its entirety. The AAVs used in the methods described herein are described in U.S. Pat. No. 9,193,956, U.S. Pat. Patent No. 9458517 and U.S. Patent No. 9587282 and U.S. Patent Application Publication No. 201 As described in US Pat. No. 6 / 0376323, LGETTRP (SEQ ID NO: 14) or L ALGETTRP (SEQ ID NO: 15) containing one of the amino acid insertions, each of which is incorporated herein by reference in its entirety. In certain embodiments, The AAV used in the methods described herein is described in U.S. Pat. No. 9,193,956, U.S. Pat. US Patent No. 9458517 and US Patent No. 9587282 and US Patent Application Publication No. 20 As described in the above document, the AAV.7m8 is each of which is incorporated herein by reference in its entirety. The AAV used in the methods described herein may be any of the AAVs disclosed in U.S. Pat. No. 6,623,669, such as AAV-PHP.B. In certain embodiments, the AAV is any of the AAVs disclosed in U.S. Pat. No. 9,585,971. The AAVs used in the methods described herein are AAV.Rh74 and RHM4- 1 and U.S. Patent No. 9,840,719 and International Publication No. WO 2015 / 013313. and each of the above documents is incorporated herein by reference in its entirety. In certain embodiments, the methods described herein are The AAV may be any of the AAVs disclosed in WO 2014 / 172669, such as AAV.Rh74. In certain embodiments, the present invention provides an AAV comprising: In the present invention, the AAV used in the methods described herein is the same as that described in Georgiadis et al., 201 6, Gene Therapy 23: 857-862 and Georgiadis et al., 2018, Gene Therapy 25: 450 and AAV2 / 5 as described in the literature, which are incorporated herein by reference in their entireties. In certain embodiments, the AA used in the methods described herein V may be any of the vectors disclosed in WO 2017 / 070491, such as AAV2tYF. AAV, which is incorporated herein by reference in its entirety. The AAV used in the methods described herein is the same as that described in Puzzo et al., 2017, AAVLK03 or AAV3B as described in Sci. Transl. Med. 29(9): 418 and the entirety of which is incorporated herein by reference. The AAV used in the methods described herein is capable of expressing HSC1, HSC2, HSC3, , HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC 11, HSC12, HSC13, HSC14, HSC15 or HSC16 etc. No. 8,628,966, U.S. Pat. No. 8,927,514, U.S. Pat. No. 9,923,120 and International Any of the AAVs disclosed in Patent Publication No. 2016 / 049230, which are incorporated herein by reference in their entirety. The same is incorporated herein by reference.

[0157] In certain embodiments, the AAV used in the methods described herein is No. 6,239,693, as disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: U.S. Patent No. 7,282,199, U.S. Patent No. 7,906,111, U.S. Patent No. Patent No. 8524446, U.S. Patent No. 8999678, U.S. Patent No. 8628966, U.S. Patent No. 8,927,514, U.S. Patent No. 8,734,809, U.S. Patent No. 9,284,357 , U.S. Patent No. 9,409,953, U.S. Patent No. 9,169,299, U.S. Patent No. 9,193,95 6, U.S. Patent No. 9,458,517 and U.S. Patent No. 9,587,282, U.S. Patent Application Publication No. 2015 / 0374803, U.S. Patent Application Publication No. 2015 / 0126588, U.S. Patent Application Publication No. 2017 / 0067908, U.S. Patent Application Publication No. 2013 / 02248 36, U.S. Patent Application Publication No. 2016 / 0215024, U.S. Patent Application Publication No. 2017 / 0051257, and International Application No. PCT / US2015 / 034799, Application No. PCT / EP2015 / 053335. In some embodiments, rAA V is a member of any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: For the vp1, vp2 and / or vp3 sequences of the AAV capsid serotypes disclosed above, At least 80% identity, e.g., 85%, 85%, 87%, 88%, 89%, 90% %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99 0.5%, i.e., capsid proteins of 100% or less identity: U.S. Pat. No. 7 282199, U.S. Patent No. 7906111, U.S. Patent No. 8524446, U.S. Patent No. 8,999,678, U.S. Patent No. 8,628,966, U.S. Patent No. 8,927,514, U.S. Patent No. 8734809, U.S. Patent No. 9284357, U.S. Patent No. 9409953, U.S. Patent No. 9,169,299, U.S. Patent No. 9,193,956, U.S. Patent No. 9,458,517 No. 9,587,282, and U.S. Patent Application Publication No. 2015 / 0374803. , U.S. Patent Application Publication No. 2015 / 0126588, U.S. Patent Application Publication No. 2017 / 00 67908, U.S. Patent Application Publication No. 2013 / 0224836, U.S. Patent Application Publication No. 2 016 / 0215024, U.S. Patent Application Publication No. 2017 / 0051257, and International Patent Application Publication No. Application No. PCT / US2015 / 034799, International Application No. PCT / EP2015 / 053335 issue.

[0158] In some embodiments, the rAAV is a rAAV, the contents of each of which are incorporated herein by reference in their entirety. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2), which is incorporated herein by reference. International Publication No. 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), International Publication No. No. 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85 and 97), WO 2003 / 042397 2006 / 068888 (see, for example, SEQ ID NOs: 1 and 3-6), WO 2006 / 110689 (see, for example, SEQ ID NOs: 5-38), WO 2009 / 10496 No. 4 (see, e.g., SEQ ID NOS: 1-5, 7, 9, 20, 22, 24, and 31), International Publication No. 2010 / 127097 (see, e.g., SEQ ID NOS: 5-38), and WO 2015 / 191508 (see, e.g., SEQ ID NOS: 80-294), and U.S. Patent Application Publication No. 2002 / 0029994. 015 / 0023924 (see e.g., SEQ ID NOS: 1, 5-10) In some embodiments, the rAAV comprises a protein as described in WO 2003 / 013994. 052051 (see e.g., SEQ ID NO: 2), WO 2005 / 033321 (see e.g., See, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: Nos. 2, 81, 85 and 97), WO 2006 / 068888 (see e.g., sequences Nos. 1 and 3-6), WO 2006 / 110689 (e.g., SEQ ID NOs. 5- 38), WO 2009 / 104964 (e.g., SEQ ID NOS: 1-5, 7, 9, 20, 22, 24 and 31), WO 2010 / 127097 (see e.g., sequences Nos. 5-38), and WO 2015 / 191508 (e.g., SEQ ID NO: 80 294), and U.S. Patent Application Publication No. 2015 / 0023924 (see, e.g., sequences 1, 5-10) of the capsid serotypes vp1, vp2 and / or vp At least 80% identity to the three sequences, e.g., 85%, 85%, 87%, 88% %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99%, 99.5%, etc., i.e., capsid proteins with 100% or less identity do.

[0159] AAV nucleic acid sequence-based viral vectors and recombinant AAV and AAV capsids Methods for producing such compounds are described, for example, in U.S. Pat. No. 7,282,199, U.S. Pat. No. 7,906,111, U.S. Pat. National Patent No. 8524446, U.S. Patent No. 8999678, U.S. Patent No. 8628966 , U.S. Patent No. 8,927,514, U.S. Patent No. 8,734,809, U.S. Patent No. 928,435 No. 7, U.S. Patent No. 9,409,953, U.S. Patent No. 9,169,299, U.S. Patent No. 9,193 956, U.S. Patent No. 9,458,517, and U.S. Patent No. 9,587,282, U.S. Patent No. Publication No. 2015 / 0374803, U.S. Patent Application Publication No. 2015 / 0126588 , U.S. Patent Application Publication No. 2017 / 0067908, U.S. Patent Application Publication No. 2013 / 02 24836, U.S. Patent Application Publication No. 2016 / 0215024, U.S. Patent Application Publication No. 2 No. 017 / 0051257, and International Application No. PCT / US2015 / 034799, International Application No. PCT / EP2015 / 053335, International Publication No. 2003 / 0520 51, International Publication No. 2005 / 033321, International Publication No. 03 / 042397, International Publication No. 2006 / 068888, International Publication No. 2006 / 110689, International Publication No. 009 / 104964, WO 2010 / 127097, and WO 201 No. 5 / 191508, and U.S. Patent Application Publication No. 2015 / 0023924. are.

[0160] In additional embodiments, the rAAV comprises a pseudotyped rAAV. In this case, the pseudotyped AAV is a pseudotyped rAAV of rAAV2 / 8 or rAAV2 / 9. Methods for producing and using AAV are well known in the art (e.g., Duan et al. , J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000) ; Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001).

[0161] In additional embodiments, the rAAV comprises capsids of two or more AAV capsid serotypes. In some embodiments, the capsid comprises a capsid protein chimera. The quality is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AA V8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-1 4, AAV-15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh2 0, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B , AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV. HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC1 0, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC1 4, two from AAV serotypes selected from AAV.HSC15 or AAV.HSC16 It is a chimera of the above AAV capsid proteins.

[0162] In certain embodiments, single-stranded AAV (ssAAV) may be used. In some embodiments, self-complementary vectors such as scAAV can be used (see, e.g., Wu, 2007, Human Gene Therapy, 18(2):171-82, McCarty et al, 2001, Gene Therapy, Vol. 8, Nu mber 16, Pages 1248-1254; and U.S. Patent No. 6,596,535, U.S. Patent No. 712,571 No. 7,456,683, which are incorporated by reference in their respective entireties. (incorporated herein as filed).

[0163] In certain embodiments, the recombinant AAV vector used to deliver the transgene Such vectors are non-replicating "rAAV" vectors that have tropism for cells in the DRG. ", and it is particularly preferred to produce AAV8 or AAVrh10. In embodiments, the viral vectors provided herein are AAV9 or AA In certain embodiments, the viral vectors described herein are Vrh10-based viral vectors. The AAV8 or AAVrh10-based viral vectors provided by the present inventors are targeted to the DRG. AAV variant capsids may be used, including but not limited to: No. 7,906,111 to Wilson, which is incorporated herein by reference in its entirety. AAV / hu.31 and AAV / hu.32 are particularly preferred, and AAV variant capsids are described in Chatterjee et al., each of which is incorporated by reference in its entirety. rjee, U.S. Patent No. 8,628,966, U.S. Patent No. 8,927,514, and Smith et al., 2014, Mol Ther 22: 1625-1634.

[0164] In some embodiments, the present invention provides a method for detecting a target gene that is (i) under the control of a regulatory element and an ITR and (ii) an AAV capsid. Regarding adeno-associated virus (rAAV), the transgene is specific for FXYD2 mRNA. The gene encodes an inhibitory RNA that specifically binds to and inhibits the expression of FXYD2 in cells.

[0165] In certain embodiments, (i) a transgene under the control of regulatory elements and flanked by ITRs (ii) an expression cassette containing the transgene; and (iii) an expression cassette containing the amino acid sequence of an AAV capsid protein. or maintain the biological function of the AAV capsid. At least 95%, 96%, 97%, 98%, 99% or 99.9% of the sequence and an AAV vector comprising an artificial genome comprising a viral capsid having an identity of do.

[0166] In certain embodiments, (i) a transgene under the control of regulatory elements and flanked by ITRs (ii) an expression cassette containing the transgene and the amino acid sequence of the AAVrh10 capsid protein. AAVrh10 capsid having the sequence or maintaining the biological function of the AAVrh10 capsid At least 95%, 96%, 97%, 98% of the amino acid sequence of the psyllid protein and an artificial genome containing a viral capsid with 99% or 99.9% identity. AAVrhlO vectors are provided. In certain embodiments, AAVrhlO is encoded by The capsid encoding the ribosomal protein is described in U.S. Pat. No. 9,790,427, which is incorporated herein by reference in its entirety. No. 81, which is a sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid substitutions, Maintains the biological function of h10.

[0167] The regulatory elements are selected to be functional in mammalian cells. The resulting construct containing the combined components (5' and 3') constitutes a functional AAV It is flanked by ITR sequences. "Adeno-associated virus inverted terminal repeats" or "AAV The ITRs act as the origin of DNA replication and packaging signals for the virus. art-recognized fragments found at each end of the AAV genome that function in conjunction with is The AAV ITRs, together with the AAVrep coding region, form the 2 Excision, rescue, and mammalian reproduction of a polynucleotide sequence inserted between two adjacent ITRs The polynucleotide sequences of the AAV ITR regions provide for integration into the animal cell genome. As used herein, "AAV ITR" refers to a wild-type polynucleotide The sequence does not necessarily include, but may be altered, for example, by the insertion, deletion or substitution of nucleotides. Additionally, AAV ITRs may be used in a variety of AAV vectors, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV-17, AAV-18, AAV V-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV1 The AAV may be derived from any of several AAV serotypes, including AAVrh.0, AAVrh.10, etc. 5' and 3' ITRs flanking a selected polynucleotide sequence in an AAV vector are able to function as intended, i.e., extract the desired gene from the host cell genome or vector. The sequence can be excised and rescued, and the AAVRep gene product is present in the cell. The heterologous sequence may be any sequence that is not necessarily identical or identical to the sequence of the host cell, as long as it allows for the integration of the heterologous sequence into the recipient cell genome. It is not necessary that the AAV ITRs be derived from or isolated from a single AAV serotype. includes, but is not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV -5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10 etc. The vector may be derived from any of several AAV serotypes, including: The 5' and 3' ITRs flanking the selected polynucleotide sequence are function, i.e., to excise and rescue desired sequences from a host cell genome or vector. and the AAVRep gene product can be expressed in the recipient cell genome when present in the cell. As long as it allows integration of the NA molecule, it is not necessarily the same or derived from the same AAV serotype. It is not necessary for the components to be identical or separate.

[0168] Certain embodiments have specificity for mammalian DRG cells and high transduction efficiency. A review and comparison of the transduction efficiencies of different AAV serotypes. are provided in this patent application. In particular examples, AAV2, AAV5, AAV8, AA V9- and rh.10-based vectors direct long-term transgene expression in DRG do.

[0169] The selected polynucleotide sequence directs its transcription or expression in vivo in the subject. operably linked to a regulatory element. Such regulatory elements are It may include regulatory sequences normally associated with the gene.

[0170] Typically, the vector of the present invention comprises an expression cassette. Generally, a nucleic acid construct refers to a nucleic acid construct that contains sufficient nucleic acid elements for the expression of a nucleic acid molecule of the present invention. The nucleic acid molecule may encode a heterologous gene and may also include appropriate regulatory elements. Gene refers to a transgene encoding a desired RNA.

[0171] One or more expression cassettes can be used. Each expression cassette encodes a desired RNA. Each expression cassette may comprise at least a promoter sequence operably linked to a sequence encoding the expression cassette. contains additional regulatory elements, spacers, introns, UTRs and polyadenylation sites etc. In some embodiments, the expression cassette may comprise, for example, two or more mi In another embodiment, the transgene is polycistronic relative to the RNA encoding the transgene. An expression cassette comprises a promoter, a nucleic acid encoding one or more desired RNA molecules, and a polynucleotide. In a further embodiment, the expression cassette comprises a 5'-promoter sequence, a desired a sequence encoding the first RNA, a sequence encoding the desired second RNA, and a polyadenylation Contains a 3' ylation sequence.

[0172] In some embodiments, the expression cassette may contain, for example, introns, enhancers, promoters, re-enylation site, woodchuck post-transcriptional response element (WPRE), and / or Additional elements, such as other elements known to affect the expression level of the code sequence, may be added. Typically, the expression cassette comprises a sequence of the present invention operably linked to a promoter sequence. The nucleic acid molecule includes:

[0173] The term "operably linked" refers to the association of two or more nucleic acid fragments with a single nucleic acid fragment. This means that the function of one affects the other.

[0174] For example, a promoter can affect the expression of a coding region (e.g., A promoter can act on a coding sequence if the sequence is under the transcriptional control of the promoter. The coding sequence is operably linked to a regulatory sequence in either sense or antisense. It can be coupled to the function.

[0175] As used herein, the term "promoter" refers to a polynucleotide that contains DNA regulatory sequences. The regulatory sequence refers to a nucleotide region derived from a gene that allows binding of RNA polymerase. and initiates transcription of downstream (3'-direction) coding sequences. is an "inducible promoter" (a polynucleotide operably linked to the promoter) Expression of the sequence is induced by an analyte, cofactor, regulatory protein, etc.), (expression of a polynucleotide sequence operably linked to said promoter is (Induced by precipitates, cofactors, regulatory proteins, etc.) and "constitutive promoters" It may include "-".

[0176] In some embodiments, the promoter is a heterologous promoter. The term "motor" refers to a gene that, in nature, is operably linked to a given coding sequence. This refers to a promoter sequence that is not found in the

[0177] Useful heterologous regulatory sequences are generally derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the phosphoglycerate kinase (PKG) protein. promoter, CAG ((CMV) cytomegalovirus enhancer, Tribeta activator a complex of the CBA promoter and rabbit beta globin intron, U6 promoter promoter, neural promoter (human synapsin 1 (hSyn) promoter, NeuN promoter) Motor, CamKII promoter, dopamine 1 receptor and dopamine 2 receptor promoter promoter), SV40 early promoter, mouse mammary tumor virus LTR promoter, Adenovirus major late promoter (Ad MLP), herpes simplex virus ( CMV promoters such as the HSV promoter and the CMV immediate early promoter region (CMV-IE) motor, Rous sarcoma virus (RSV) promoter, synthetic promoters, and hybrid In addition, non-viral genes such as mouse metallothionein genes are also included. Sequences derived from genes may also find use herein. Such promoter sequences may be derived from, for example, It is commercially available from, for example, Stratagene (San Diego, CA).

[0178] For the purposes of the present invention, heterologous promoters, as well as DRG-specific and inducible promoters Both promoters and other regulatory elements, such as enhancers, may be beneficial for particular uses.

[0179] "Enhancers" can stimulate promoter activity and enhance the innate elements of promoters. or heterologous elements inserted to enhance the level or tissue specificity of the promoter. In some embodiments, the promoter is a polynucleotide sequence that can be a promoter. The promoter is derived in its entirety from the native gene. The promoter is composed of different elements derived from promoters of different natural origins. In some embodiments, the promoter comprises a synthetic polynucleotide sequence. The promoters may be expressed in different tissues or cell types, or at different stages of development, or in different environments. Expression of genes in response to conditions or the presence or absence of drugs or cofactors It will be understood by those skilled in the art that the following may be induced: ubiquitous, cell type-specific, tissue-specific , developmental stage-specific, and drug-responsive promoters (e.g., tetracycline-responsive promoters) Conditional promoters, such as promoters for the expression of ribosomal proteins, are well known to those skilled in the art.

[0180] In mammalian systems, three types of promoters exist and are candidates for the construction of expression vectors. Is: Pol I promoter controls transcription of large ribosomal RNA; Pol II Promoters are mRNAs (which are translated into proteins) and small nuclear RNAs (snRNAs). regulates transcription; uniquely transcribes Pol III small non-coding RNAs. When designing constructs for expression of RNA in vivo, each has advantages and limitations to consider. For example, Pol III promoters are designed to cleave small molecules from DNA templates in vivo. It is useful for synthesizing interfering RNA (shRNA) for better tissue-specific expression. For regulation, Pol II promoters are preferred, but are only used for miRNA transcription. However, when a Pol II promoter is used, the RNA may be an siRNA, sh It functions as an RNA or miRNA and is detranslated so that it is not translated into peptides in vivo. It is preferred to omit the start signal.

[0181] AAV expression vectors containing the desired DNA molecule flanked by AAV ITRs are AAV had the major AAV open reading frame ("ORF") excised from It can be constructed by inserting a selected sequence directly into the AV genome. As long as it maintains a sufficient portion of the ITRs to allow the binding function, it can be used in other AAV genomes. Such constructs can be prepared using techniques well known in the art. The invention can be designed using techniques such as those described in U.S. Pat. No. 5,173,414 and U.S. Pat. No. 5,139,629. 941, and International Publication No. 92 / 01070 (published January 23, 1992) and International See Publication No. 93 / 03769 (published March 4, 1993). Alternatively, AAV The ITRs are excised from the viral genome or from the AAV vector containing them, and are then transfected into standard Ligation techniques can be used to ligate selected nucleic acid constructs present in other vectors. AAV vectors containing ITRs can be fused to the 5' and 3' ends. In particular, some AAV vectors are described therein. , from the American Type Cellular Collection (ATCC), accession no. 532 22, 53223, 53224, 53225 and 53226. The chimeric gene comprises an AAV I gene located 5' and 3' of one or more selected nucleic acid sequences. The chimeric gene in mammalian DRG cells can be synthetically produced to contain the TR sequence. Preferred codons for expression of the sequence may be used, and in certain embodiments, Codon optimization of the gene is performed by well-known methods. The complete chimeric sequence is generated by standard methods. For the generation of AAV vectors, the vectors are constructed from overlapping oligonucleotides prepared by The AAV expression vector is then transfected into a suitable host using well-known techniques such as transfection. Many transfection techniques are known in the art. Particularly suitable transfection methods are calcium phosphate precipitation, direct transfection of cultured cells, and Microinjection, electroporation, and liposome-mediated gene transfer These include methods such as lipid-mediated transduction, and high-velocity microprojectile-based nucleic acid delivery. .

[0182] For example, certain viral vectors may contain, in addition to the nucleic acid sequences of the present invention, sequences derived from AAV-2. The backbone of the AAV vector plasmid contains the ITRs, mouse PKG (phosphoglycerate kinase). promoters of genes such as ribosomal kinase, or enhancers and promoters from CMV immediate early genes β-actin gene, splice donor and intron from chicken β-actin gene, rabbit β-globin Cytomegalovirus / β-actin hybrids consisting of splice acceptors from BIN lid promoter (CAG), or dopamine 1 receptor or dopamine 2 receptor a neural promoter such as the promoter, or a woodchuck hepatitis virus post-transcriptional regulatory element Synapsin promoter with or without wild-type or mutant forms of the promoter (WPRE) The viral vector further comprises an amplicon containing a rabbit beta globin polyA sequence. Cylindryl (AmpR), Kanamycin, Hygromycin B, Geneticin, Blastocyst It contains a sequence encoding an antibiotic resistance gene such as the erythropoietin S or puromycin resistance gene. It can be seen.

[0183] In one embodiment, a retroviral vector is used.

[0184] Retroviruses, by virtue of their ability to integrate their genes into host cells, are able to transmit large amounts of exogenous Transfer genetic material, infect a wide range of species and cells, and be packaged in specific cell lines The retroviral vector can be selected as a gene delivery vector for To achieve this, nucleic acids encoding desired genes are specifically designed to produce replication-deficient viruses. A specific piece of viral sequence is inserted into the viral genome to produce virions. , the packaging cell line contains the gag, pol and / or env genes but not the LTR and and / or constructed without packaging components. The recombinant plasmid containing the cDNA together with the packaging sequence is then transferred to a saccharified matrix (e.g., calcium phosphate precipitate). When introduced into this cell line (by the cloning method), the packaging sequence is Allows RNA transcription and is packaged into viral particles that are secreted into the culture medium The medium containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad range of cell types.

[0185] In other embodiments, lentiviruses are used.

[0186] In a specific embodiment, the present invention provides a portion or fragment of FXYD2, or a variant thereof. The present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a ribozyme inhibitor.

[0187] In another embodiment, the lentiviral vector of the present invention comprises a portion or fragment of FXYD2. Variants of the oligonucleotide sequences encoding the fragments are included.

[0188] In another embodiment, the lentiviral vector of the present invention comprises a variant of FXYD2. This includes variants of the oligonucleotide sequences encoding the

[0189] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. The present invention relates to a lentiviral vector comprising an antisense sequence encoding an ant.

[0190] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. The present invention relates to a lentiviral vector comprising an shRNA sequence encoding an ant.

[0191] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. The present invention relates to a lentiviral vector comprising a miRNA sequence encoding an ant.

[0192] In other embodiments, the present invention provides SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 , comprising the nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 or variants thereof, or a lentivirus containing an antisense oligonucleotide targeting a region consisting of any one of Regarding Lusvector.

[0193] In other embodiments, the present invention relates to, but is not limited to, a portion or portion of FXYD2. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO No. 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 2 1, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, Sequence number 35, sequence number 36, sequence number 37, sequence number 38, sequence number 39, sequence number 40 or SEQ ID NO: 41. do.

[0194] In other embodiments, the lentiviral vector of the present invention comprises, but is not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: No. 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 2 7, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or It includes variants of a sequence selected from the group consisting of SEQ ID NO:41.

[0195] In other embodiments, the lentiviral vector of the present invention comprises, but is not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 This includes variants of the same sequence.

[0196] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. The present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding an ant.

[0197] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. A lentiviral vector containing an shRNA sequence encoding the ant and a U6 promoter. Regarding.

[0198] In other embodiments, the present invention provides SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 , targeting a region containing or consisting of the nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 antisense oligonucleotides targeting the IL-11 receptor and a lentivirus containing the U6 promoter Regarding vectors.

[0199] In other embodiments, the present invention provides SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 1 0, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, Sequence number 22, sequence number 23, sequence number 24, sequence number 25, sequence number 26, sequence number 27 , SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: This relates to a lentiviral vector comprising the sequence of sequence number 41 and a U6 promoter.

[0200] In other embodiments, the lentiviral vector of the present invention comprises, but is not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 It contains a variant of the sequence, and a U6 promoter.

[0201] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. A lentivirus containing an oligonucleotide sequence encoding the ant, and a CAG promoter Regarding Lusvector.

[0202] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. Lentivirus containing an antisense sequence encoding Ant and a CAG promoter Regarding vectors.

[0203] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. A lentiviral vector containing a miRNA sequence encoding the ant and a CAG promoter About Kuta.

[0204] In another embodiment, the present invention relates to a portion or fragment of FXYD2, or variants thereof. A lentiviral vector containing an shRNA sequence encoding the ant and a CAG promoter About Kuta.

[0205] In certain embodiments, the present invention provides SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. A region comprising or consisting of the nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 Antisense oligonucleotides targeting CAG promoter-containing lentiviruses Regarding Lusvector.

[0206] In certain embodiments, the present invention provides SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: No. 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 2 7, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or This invention relates to a lentiviral vector comprising the sequence of SEQ ID NO: 41 and a CAG promoter.

[0207] Lentiviruses contain the common retroviral genes gag, pol, and env. In addition, they are complex retroviruses that contain other genes with regulatory or structural functions. The heterogeneity allows the virus to change its life cycle during the course of latent infection. Some examples of HIV include human immunodeficiency viruses (HIV1, HIV2) and simian immunodeficiency viruses (HIV-1, HIV-2). Lentiviral vectors contain HIV virulence genes. For example, the env, vif, vpr, and nef genes are attenuated The lentiviral vector is deleted to ensure the biological safety of the vector. are well known in the art, e.g., U.S. Pat. No. 6,013,516 and U.S. Pat. No. 5,994,133. See, e.g., U.S. Pat. No. 6, both of which are incorporated herein by reference. Generally, vectors The vectors can be plasmid-based or virus-based and are used to select and transfer nucleic acids into host cells. The desired vector is constructed to carry sequences necessary for the integration of foreign nucleic acid. The gag, pol and env genes of the present invention are also well known in the art. The clone is cloned into a selected vector and used to transform the desired target cells. Recombinant lentiviruses capable of infecting non-dividing cells can be used to infect suitable host cells. Carries packaging functions, namely gag, pol and env, and rev and tat Transfection with two or more vectors is described in U.S. Pat. No. 5,994,136. and is incorporated herein by reference. Nucleic acids encoding the viral gag and pol genes can be provided to generate vesicles. Describe the first vector and other vectors that can provide nucleic acid encoding the viral env. Introduction of a vector providing a heterologous gene into packaging cells allows the desired Generate producer cells that release infectious viral particles carrying the foreign gene. v is an amphoteric envelope protein that allows transduction of cells from humans and other species. Typically, the nucleic acid molecule or vector of the present invention comprises a "regulatory sequence" The promoter sequence, polyadenylation signal, transcription termination sequence, upstream regulatory domain, ribosome entry sites ("IRES") and enhancers, etc. It is assembled into recipient cells for replication, transcription and translation of coding sequences. The selected coding sequence is provided in a suitable host cell for replication, transcription and translation. Not all of these regulatory sequences need always be present, so long as they allow.

[0208] (Method of Treating Pain) In a third aspect, the present invention provides a method for treating pain in a subject in need thereof. The present invention relates to inhibitors and / or antisense oligonucleotides for the treatment of rheumatoid arthritis.

[0209] In certain embodiments, the present invention provides inhibitors and / or antisense oligonucleotides as described above. A method for treating a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a oligonucleotide. The present invention relates to a method for treating pain in elephants.

[0210] In certain embodiments, the antisense oligonucleotides in the methods of the present invention At least SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: The region containing or consisting of the nucleotide in sequence number 6 is targeted.

[0211] In a particular embodiment, the inhibitor in the method of the present invention is the nucleotide sequence of SEQ ID NO: 3. The target region is one that contains or consists of the nucleotide.

[0212] In certain embodiments, the antisense oligonucleotides in the methods of the present invention are SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: No. 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 3 7, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41, or The sequence comprises or consists of a sequence selected from the group consisting of:

[0213] In certain embodiments, the antisense oligonucleotides in the methods of the present invention are SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or The nucleic acid comprises or consists of a sequence selected from the group consisting of:

[0214] In certain embodiments, the antisense oligonucleotides in the methods of the present invention is administered alone (naked) or in a vector as described above.

[0215] As used herein, the term "treatment" or "treating" refers to the treatment of a person at risk of contracting a disease. Patients who are ill or at risk of having a disease, and those diagnosed as being ill or having a disease Both prophylactic or preventative treatment, including treatment of patients diagnosed with a medical condition, and It means therapeutic or disease-modifying treatment and also includes the suppression of clinical recurrence. Preventing, treating, delaying the onset of, reducing the severity of, or alleviating one or more symptoms of a recurrent disorder or to prolong the survival of a subject beyond the expected survival time in the absence of such treatment. To extend the lifespan, it may be administered to subjects who have a medical disorder or who may eventually become disabled. A "therapeutic regimen" is a pattern of treatment for a disease, such as the pattern of doses used during treatment. The therapeutic regimen may include an induction regimen and a maintenance regimen. The term "regimen" or "induction phase" refers to a therapeutic regimen (or The general purpose of an induction regimen is to initiate a treatment regimen. The goal of induction regimens is to provide patients with high levels of the drug during the maintenance phase. administering a larger dose of a drug than a physician would normally use during a maintenance regimen; "Loading regimens" which may involve administering the drug more frequently than the patient would otherwise administer it, or both. The term "maintenance regimen" or "maintenance phase" may also be used (in part or in whole). is the treatment of a disease, e.g., by keeping a patient in remission for an extended period of time (months or years). means a treatment regimen (or part of a treatment regimen) used to maintain a patient during Maintenance regimens involve continuous therapy (e.g., weekly, monthly, or yearly) drug) or intermittent therapy (e.g., discontinued treatment, intermittent treatment, relapse treatment, or Treatment upon achievement of certain criteria (eg, symptoms of a disease, etc.) may be employed.

[0216] As used herein, the term "pain" refers to pain that is often caused by a strong or noxious stimulus. The definition widely used by the International Society for Pain Research is that "pain is an acute, mild, discomfort associated with or described in terms of potential tissue damage Pain is a sensory and emotional experience. There are different types of pain: acute pain, chronic pain, In the present invention, the pain is peripheral pain. Generally, peripheral pain is classified into neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, and postoperative pain. pain and / or chronic postoperative pain.

[0217] As used herein, "subject" refers to mammals such as rodents, cats, dogs, and primates. In particular, the subject of the present invention is a human, a mouse, or a rat. The term "subject" as used herein includes "patient."

[0218] In certain embodiments, the subject suffers from or is susceptible to pain.

[0219] In certain embodiments, the subject suffers from or is susceptible to peripheral pain.

[0220] In certain embodiments, the subject suffers from or is susceptible to neuropathic pain.

[0221] In certain embodiments, the subject suffers from or is susceptible to inflammatory pain.

[0222] In certain embodiments, the subject suffers from or is susceptible to diabetic pain.

[0223] In certain embodiments, the subject suffers from or is susceptible to chemotherapy pain.

[0224] In certain embodiments, the subject suffers from or is susceptible to post-operative pain.

[0225] In certain embodiments, the subject suffers from or is susceptible to chronic post-surgical pain.

[0226] As used herein, the term "administer" or "administration" refers to administration by intravenous, intramuscular, enteral, or cutaneous administration. intravenously, parenterally, systemically, topically, spinally, nasally, locally, or epidermally (e.g., by injection or infusion) By using the above method, it is possible to detect a substance present outside the body (for example, an FXYD2 inhibitor such as the ASO of the present invention) It refers to the act of injecting or other physical delivery into an animal. When a disease or symptom thereof is treated, administration of the substance usually occurs after the onset of the disease or symptom thereof. When disease is prevented, administration of the substance usually occurs before the onset of the disease or its symptoms. In embodiments, administration is by means of a patch, paste, ointment, suspension, solution or cream, gel, or the like. In certain embodiments, administration is by cream. It can be done.

[0227] In certain embodiments, administration of inhibitors and / or antisense oligonucleotides is administered intrathecally, subcutaneously, topically, or intravenously.

[0228] In a further embodiment, i) an antisense oligonucleotide according to the invention, and ii) Classical treatments include the use of drugs in the treatment of pain, either simultaneously, separately or sequentially as a combined preparation. It is used for this purpose.

[0229] As used herein, the term "classical treatment" refers to natural or synthetic compounds. In certain embodiments, classical treatments include, but are not limited to, aspirin, paracetamol, steroids, nonsteroidal anti-inflammatory drugs (NSAIDs), codeine, cryotherapy, virtual therapy, Selected from the group consisting of hemp, morphine and its derivatives, and opium and its derivatives.

[0230] A "therapeutically effective amount" refers to the amount of an active ingredient (e.g., a compound according to the present invention) required to provide a therapeutic benefit to a subject. For example, a "therapeutically effective amount" for a subject refers to the minimum amount of an ASO (or ASO) that is effective to treat a disorder. improvement in the pathological symptoms, disease progression or physiological state associated with, or against, a disorder The total daily use of the compounds of the present invention is an amount that induces, improves or causes tolerance. It will be understood that certain conditions may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective amount level in a subject will depend on the disorder being treated and the severity of the disorder, the type of compound being used, and the dosage and administration of the compound. the activity of the particular compound being used, the particular composition used, the age, weight, and general health of the subject, Sex and diet, time of administration, route of administration, excretion rate of the specific compound used, duration of treatment, Drugs used in combination with or simultaneously with specific compounds known in the medical arts, The amount of serotonin produced will depend on a variety of factors, including the amount of serotonin produced, ... and the amount of serotonin produced, necessary to achieve the desired therapeutic effect. The dose of the compound is initiated at a level lower than the normal dose and gradually increased until the desired effect is achieved. It is well known to those skilled in the art to increase the dosage. However, the daily dosage of the product is The dosage may vary over a wide range, from 0.01 to 1000 mg for adults. For symptomatic adjustment of the dose to the subject, 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and TA drugs usually contain about 0.01 mg to 500 mg of active ingredient. The effective amount of the drug is usually 1 mg to about 100 mg. 0.0002 mg / kg (body weight) to about 20 mg / kg (body weight) per day, preferably 1 Supplied at dosage levels of 0.001 mg / kg body weight to 7 mg / kg body weight .

[0231] (Pharmaceutical composition) In a fourth aspect, the present invention provides an inhibitor and / or antisense oligonucleotide according to the present invention. The present invention relates to pharmaceutical compositions comprising nucleotides.

[0232] In certain embodiments, the antisense oligonucleotides in the pharmaceutical compositions of the present invention The octide may be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: At least a region comprising or consisting of 6 nucleotides is targeted.

[0233] In a particular embodiment, the inhibitor in the pharmaceutical composition of the present invention is the The region containing or consisting of the nucleotide is targeted.

[0234] In certain embodiments, the present invention provides SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: No. 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 2 7, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or An antisense oligonucleotide comprising and / or consisting of a sequence selected from the group consisting of SEQ ID NO: 41. The present invention relates to a pharmaceutical composition according to the present invention, which comprises at least a cis-nucleotide.

[0235] In certain embodiments, the antisense oligonucleotides in the pharmaceutical compositions of the present invention The octides are SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 The present invention comprises or consists of a sequence selected from the group consisting of:

[0236] In certain embodiments, the present invention provides a pharmaceutical composition according to the present invention for use in treating pain. Pertaining to things.

[0237] In certain embodiments, the present invention relates to a pharmaceutical composition for use according to the present invention, The pain is peripheral.

[0238] In certain embodiments, the present invention relates to a pharmaceutical composition for use according to the present invention, is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, post-operative pain and / or Chronic postoperative pain.

[0239] The inhibitors and / or antisense oligonucleotides described above can be administered in the form of pharmaceutical compositions. To achieve this, a pharmaceutically acceptable excipient and, optionally, a sustained release matrix such as a biodegradable polymer are added. "Pharmaceutical" or "pharmaceutically acceptable" means a drug that is suitable for oral administration, if desired. Produces adverse, allergic or other untoward reactions when administered to mammals, especially humans. Pharmaceutically acceptable carriers or excipients refer to non-toxic solids and molecules that are not solid, semi-solid or liquid fillers, diluents, encapsulating materials or formulation aids of any type It means that the active ingredient is administered orally, sublingually, subcutaneously, intramuscularly, intravenously, transdermally, topically or rectally. The pharmaceutical compositions of the present invention for administration alone or in combination with other active ingredients may be administered in unit dosage form. In this state, the compound can be administered to subjects such as animals and humans in admixture with conventional pharmaceutical carriers. The dosage forms include tablets, gel capsules, powders, granules, and oral suspensions or solutions. Oral dosage forms, sublingual and buccal dosage forms, aerosols, implants, subcutaneous, transdermal, topical, Intraperitoneal, intramuscular, intravenous, subdermal, subcutaneous, intraspinal and nasal dosage forms, and rectal dosage forms Includes attitude.

[0240] In certain embodiments, the pharmaceutical compositions of the present invention are administered intrathecally, subcutaneously, topically, or intravenously. It is administered by administration.

[0241] Typically, the pharmaceutical composition contains a pharmaceutically acceptable vehicle in an injectable formulation. These are especially suitable for isotonic, sterile saline (monosodium phosphate or disodium phosphate). , sodium chloride, potassium, calcium or magnesium, etc., or salts of such mixture), or dry, optionally with sterile water or saline to form an injection solution; In particular, it may be a lyophilized composition. Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions. ; preparations containing sesame oil, peanut oil or aqueous propylene glycol; and sterile injectable solutions or and sterile powders for the extemporaneous preparation of dispersions. In all cases the form must be sterile. It must be fluid enough to pass through a syringe easily. It must be stable under the conditions of storage and preservation and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The compounds of the present invention may be prepared as free bases or pharmaceutically acceptable salts. A solution containing the compound is prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and the like. Under normal conditions of storage and use, these preparations , contains a preservative to prevent the growth of microorganisms. The compounds (acids) are formulated in the compositions in neutral or salt form. Pharmaceutically acceptable salts include ( and acid addition salts (formed with the free amino groups of the protein), which include acid addition salts such as hydrochloric acid or It is formed with inorganic acids such as phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, and mandelic acid. Salts formed with free carboxyl groups are suitable, for example, with sodium, potassium, ammonium hydroxide. Inorganic bases such as ammonium, calcium, or iron, and isopropylamine, trimethylamine, histidine, The carrier may be, for example, water, ethanol, polyethylene glycol, or an organic base such as thiamine, procaine, etc. glycols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) The solvent or dispersion medium may be a solvent or dispersion medium containing, for example, a hydroxypropyl methylcellulose ... Fluidity can be achieved by, for example, the use of a coating such as lecithin, the required particle size in the case of dispersions, etc. The prevention of microbial action can be achieved by, for example, para Various antibacterial and antifungal agents such as benzophenone, chlorobutanol, phenol, sorbic acid, and thimerosal This can be achieved by using antifungal agents. In many cases, the antifungal agent contains an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of injectable compositions can be achieved by, for example, using monostearate. This can be achieved by the use in the compositions of agents which delay absorption, such as aluminum and gelatin. Sterile injectable solutions can be prepared by combining the required amount of niacin in an appropriate solvent with some of the other ingredients listed above, as required. The dispersion is prepared by incorporating the active polypeptide into a dispersion medium, followed by sterilization by filtration. Various sterile active ingredients are incorporated into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, Therefore, the preferred method of preparation is to sterilize the active ingredient and any additional desired ingredients from a previously sterile-filtered solution. Vacuum drying and freeze drying techniques may be used to produce powders of the ingredients. The formulations may be administered in a manner compatible with the dosage formulation, and in such amount as is therapeutically effective. They are easily administered in a variety of dosage forms, such as in the form of an injection solution, although drug release capsules and the like may also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary. The liquid diluent is first made isotonic with sufficient saline or glucose. Aqueous solutions of the compounds are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Sterile aqueous media that can be used will be known to those of skill in the art in light of the present disclosure. For example, one dose may contain 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected Some variations in dose may be made depending on the condition of the subject being treated. The person responsible for administration must, in any event, determine the appropriate dose for each individual subject. Determine.

[0242] In certain embodiments, the present invention provides topical formulations comprising antisense oligonucleotides. For example, but not limited to, the present invention provides antisense oligonucleotides The dosage form for topical or transdermal administration of the inhibitor of the present invention comprises: These may include, but are not limited to, powders, sprays, ointments, pastes, creams, lotions, gels, solutions, In certain non-limiting embodiments, topical formulations include micelles, Antisense oligonucleotides contained in liposomes or non-lipid microspheres In certain non-limiting embodiments, such topical formulations include, but are not limited to: Dimethyl sulfoxide, hydrocarbons (e.g., alkanes and alkenes), alcohols (e.g., glycols and glycerol), acids (e.g. fatty acids), amines, amides, esters (e.g. isopropyl myristate), surfactants (e.g., anionic, cationic or nonionic surfactants), Permeability enhancers such as surfactants, terpenes, and lipids (e.g., phospholipids) may be included.

[0243] In certain embodiments, the formulation is a patch, a paste, an ointment, a suspension, a solution, a cream , gel, or spray. In certain embodiments, the formulation is a cream.

[0244] The present invention is further illustrated by the following figures and examples. The drawings and figures should not be construed as limiting the scope of the invention. [Example]

[0245] Materials and Methods animal All studies were approved by the French Ministry of Research (approval #C34-172-36) and nationally The study was conducted in accordance with the International Association of Pain Research (IASP) guidelines. All animals had free access to water and food. They were housed on a 12 / 12 dark / light cycle with access to food. Five-week-old male Sprague-Dawley rats (Janvier, France) weighing 200–250 g were placed in the Used.

[0246] Chronic pain model The SNL (spinal nerve ligation) model of peripheral neuropathic pain and the CFA (complete femoral artery augmentation) model of chronic inflammatory pain The Freund's adjuvant (Freund's adjuvant) model was used. All surgical procedures were performed under deep isoflurane anesthesia. The SNL procedure was performed as previously described. 2 To put it simply: The L6 transverse process was removed to expose the L4 and L5 spinal nerves. The ligature was tightly ligated with 6.0 silk thread. Complete Freund's adjuvant (CFA)-induced pain The model was used to assess chronic inflammatory pain. Briefly, isoflurane anesthesia was administered. Under anesthesia, an intraplantar injection (50 μl) of a 1 mg / ml solution of Mycobacterium tuberculosis (Sigma-Aldrich) was administered to the rat. The test was performed on the left hind leg of the subject.

[0247] Intraspinal injection of ASO, LASO, siRNA, or ω-conotoxin MVIIA into rats Shooting ASO and LASO were manufactured by ChemBioPharm (Bordeaux, France). Non-targeting ASOs and LASOs were provided by ChemBioPharm (Centre). sequence; 5' CGTGTAGGTACGGCAGATC 3' (SEQ ID NO: 32), negative We designed 29 different Fxyd2-ASOs, the sequences of which are listed in Table 1. The "Accel" siRNA against rat-human Fxyd2 mRNA was expressed in Dhar The sense sequence was 5' AAGAUUCCGCUGUGGGGG C(UU) 3' and is set forth in SEQ ID NO: 31. "In vivo accelerator non-targeting" siRNA (Dharmacon, D-001910-01) was used as a negative control. IIA was purchased from Sigma Aldrich (Ref. C1182) and was prepared as described by de Souza et al. 1 The cells were injected intrathecally at a dose of 100 pmol as described by.

[0248] SNL-operated rats were tested to confirm mechanical hypersensitivity and then administered intrathecally. Under short isoflurane anesthesia 4 2 μg of control or Fxyd2-siR was administered intraspinally daily. 20 μl of 5% glucose solution containing NA, ASO, or LASO was injected. In rats, 4 μg of control or Fxyd2 was administered intraspinally daily from the third day after CFA injection. -LASO was injected in 20 μl of 5% glucose solution in water.

[0249] Behavioral testing in rats Male Sprague-Dawley rats were housed three per cage under standard light and temperature conditions. Commercially available solid food and tap water were available ad libitum. After arrival, the animals were kept in a group setting for 4 days. To avoid stress due to the experimental conditions, the analysis was carried out in a group room. The test was conducted by the same experimenter under calm conditions in a test room close to the Each day, animals were weighed, gently handled for 5 minutes, and placed in the testing room for 1 hour. They were allowed to habituate to the nociceptor apparatus. The subjects were assessed once a day after surgery, before surgery, and on the day of surgery (d0). To do this, six animals were tested for each test condition using the von F method as described above for mice. For mechanical hyperalgesia, six animals were previously tested in each test condition. Paw-pressure vocalization testing as described in 5 Using The nociceptive threshold was determined in hand-held rats. A steadily increasing pressure was applied to the injured hind limb with a Basile analgesiometer (Apele x; stylus tip diameter 1 mm) was used. A cut-off value was determined.

[0250] In vitro knockdown of FXYD2 protein using ASO A control-ASO, 29 Fxyd2-ASOs, each 20 nucleotides long, and ASO#75 and ASO#82, which are 15 and 17 nucleotides long, respectively (sequences shown in Table 1) (ChemBioPharm, Bordeaux, France), and in vitro using HEK293M cells. HEK293M cells were cultured in DMEM containing antibiotics (penicillin 50 U / ml, Glutamine supplemented with streptomycin (50 μg / ml) and 10% heat-inactivated fetal bovine serum Cells were seeded at a 50% density and maintained in amax (Invitrogen) medium. One day later, the cells were cultured in the indicated AS medium. The cells were treated with Lipofectamine 2000, a cationic lipid (Invitrogen) for 2 days. gen) was used to increase the intracellular uptake of ASO. Lipofectamin diluted 1 / 1000 in TI-MEM (Life Technologies) e 2000 for 20 min, followed by 100 nM AS After 4 hours, the medium was replaced with the standard culture medium described above.

[0251] In vivo knockdown of Fxyd2 protein using LASO 0, 0.5, 2, 4, or 8 μg of Fxyd2-LASO in 20 μl of 5% glucose The Fxyd2-LASO solution was injected intraspinally daily for 14 days. Rats received an intraperitoneal injection of pentobarbital and intracardially administered PBS. Lumber DRG (L4-L6) were dissected and stored at -80°C. Saved.

[0252] Western blot Cells or tissues were soaked in NP40 buffer (1% NP40, 150 mM NaCl, 50 mM Mechanically homogenize the cells in 100 mM Tris-HCl, pH 7.5, and protease inhibitors at 4°C. The lysate was clarified at 12,000 x g for 10 minutes at 4°C. After protein quantification using a ELISA kit (Ischer, France), the lysates were subjected to SDS-PAGE. The fragments were transferred to a cellulose membrane using rabbit anti-C-terminal Fxyd2 and mouse anti-actin antibodies. The cells were incubated with primary and fluorescent IRDye secondary antibodies (LI-COR Biosciences). Immunodetection was then performed using an Odyssey CLx Imager (LI-COR Biosciences). Image Studio Lite software (LI-COR Biosciences) was used. Quantitation was performed using

[0253] statistical analysis In Western blot studies, one-way analysis of variance (ANOVA) was performed followed by post-hoc analysis. Statistical analysis was performed using the Kudanett test. Group and time effects were assessed by multi-way ANOVA. If the ANOVA showed a significant effect, A Bonferroni post-hoc test was used to determine significance. P values ​​<0.05 ( * ) , P<0.01( ** ), P<0.001( *** ) and P<0.0001( **** ) are considered statistically significant. All data shown are means ± sem.

[0254] (result) We used the RNAfold program (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAfold.c gi) to identify oligonucleotide sequences with potential functional knockdown properties. The human FXYD2 mRNA (NCBI reference sequence NM_001680) was used to The secondary structure of human FXYD2 mRNA was depicted (data not shown). A series of overlapping oligonucleotide sequences covering 7 bases (Table 1) were used to identify human H EK293 cells were transfected with individual ASOs and analyzed by Western blot. The XYD2 protein was tested by quantifying the nucleotides 210 to 238 (ASO#7 The region containing the nucleotides #5 to #84 (targeted by nucleotides #5 to #84) is particularly preferred for antisense inhibition. was found (Fig. 1A).

[0255] ASO#75 and ASO#82, which are 15, 17, and 20 nucleotides in length, respectively, were tested. (SEQ ID NOs: 17, 24, 38 to 41). By using an ASO with a length of 20 nucleotides, also achieved good efficacy (Figure 1B).

[0256] The sequence of ASO#75 (SEQ ID NO: 17, complementary to bases 210-229) is identical to that of rat and human It is 100% preserved between the two, and its efficacy can be tested in rat model studies. ASO#75 was selected for further study because it significantly increased the activity of ASO#75 in the rat DRG after intraspinal injection. ASO#75 was tested in vivo for knockdown of Fxyd2 in mice (Figure 2). To avoid the well-known toxic effects of transfection agents and to facilitate ASO uptake into neurons, To increase the loading efficiency, we used a lipid-modified version of ASO#75, hereafter referred to as F This lipid modification is called xyd2-LASO. Described in Pokholenko et al. 2013.

[0257] First, we demonstrated that Fxyd2 protein levels in DRG neurons could be effectively reduced. A dose-response analysis was performed to find the minimum amount of Fxyd2-LASO that could induce Fxyd2 expression. -LASO (0, 0.5, 2, 4, and 8 μg) or control-LASO was administered in 20 μl of 5% The rats were then injected intraspinally into the lumbar DRG (L4, L5) every day for 14 days. The mice were then dissected (L6) and tissues were analyzed by Western blot. Downregulation was achieved by injection of 2 μg of Fxyd2-LASO, whereas injection of higher amounts of LASO Control-LASO showed no further reduction in Fxyd2 protein levels. There was no impact on the

[0258] We demonstrated that Fxyd is a potent anti-inflammatory drug in pain behavior in rats with the SNL model of neuropathic pain. The in vivo effects of intraspinal injection of 2-LASO were examined (Figure 3). Four days after surgery, rats were The study showed a decrease in withdrawal threshold to von Frey filaments and pressure on the ipsilateral paw ( Responsiveness to mechanical stimuli as evidenced by increased response to the Randall-Selitto test Daily injections of Fxyd2-LASO from the 14th day after surgery improved pain response. The pain response gradually recovered, and by the 21st day after surgery, the response had returned to baseline. The attenuation was maintained as long as Fxyd2-LASO injections were continued (6 days). Discontinuation of LASO injections caused recurrence of hypersensitivity to mechanical stimuli within 2 days. Matched injections of 2 μg of control-LASO in translesioned rats resulted in a decrease in pain behavior. There was no attenuation effect.

[0259] After that, we developed a representative intraspinal injection drug for human use under the name Prialt. The commercially available synthetic form, ω-conotoxin MVIIA, and Fxyd2-LASO The analgesic effects of ω-conotoxin MVIIA were compared. Fxyd2-LASO is a calcium channel inhibitor that is used to treat mechanistic In a cohort of rats in which the hypersensitivity recurred after cessation of injections, we performed a new series of injections. Again, Fxyd2-LASO completely eliminated pain behavior. A cohort of rats that developed neuropathic pain after receiving ω-conotoxin MVIIA ( 100 pmoles / intraspinal injection 1 ω-conotoxin MVIIA was administered As expected, pain behavior was partially attenuated (Figure 3), but the effect was short-lived (1-2 hours). This study demonstrates that intraspinal injection of Fxyd2-LASO has a beneficial effect on neuropathic pain in rodent models. It is an effective pain reliever in the Prove that it is at least as effective as the leading drug, Prialt.

[0260] Next, we investigated whether the underlying mechanisms are different from those of nerve injury-induced pain. In other pain models known to inhibit Fxyd2, Fxyd2-LASO inhibited Fxyd2 Therefore, we investigated whether inhibition of the sarcolemma could be effective in inducing long-term mechanical hypersensitivity. A commonly used method is to administer CFA (Complete Freund's Adjuvant) by plantar injection. We employed an inflammatory pain model using von Frey filaments and randoxorubicin (Fig. 4). Mechanical hypersensitivity was tested using the Dal-Selit test. CFA injection was performed within 2 days. Testing in control animals treated with control-LASO, which induces rapid mechanical hypersensitivity This was maintained over the time course. Painful pain can be a symptom of neuropathic pain, even if it is for a longer timeframe than that of nerve injury-induced neuropathic pain. The maximum analgesic effect was observed at day 7 of treatment compared with day 7 of injury-induced neuropathic pain. Second, pain behavior was measured in the von Frey filament test. Although fully attenuated, the results show partial efficacy in the Randall-Selitto test (Figure 4) As in the nerve injury model, discontinuation of Fxyd2-LASO injections significantly abolished pain behavior. The resumption of Fxyd2-LASO injections subsequently reversed the analgesic effect. To recover.

[0261] Next, we compared the expression of unmodified Fxyd2-ASO antisense oligonucleotides in the same study. Direct comparison of the response to intraspinal injection of leiotide and Fxyd2-LASO We investigated the importance of lipid modification of Fxyd2-LASO in its analgesic effect. After surgery and induction of neuropathic pain behavior, cohorts of rats were treated with 2 μg of Fxyd2-AS. The mice were treated with daily intraspinal injections of 0 or Fxyd2-LASO. found that Fxyd2-ASO was not effective in attenuating pain behavior, and lipid modification was associated with the This was necessary for the pain-suppressing effect of leutide.

[0262] Finally, we investigated the role of Fxyd2 mRNA expression in the IL-16 signaling pathway as an alternative to inhibiting its function. The effectiveness of using siRNA against the Accell technology (Dharm) was tested (Figure 6). acon) and recognized the same 100% conserved rat-human sequence as ASO#75. We purchased custom-made siRNAs that recognize the target gene. Accell Technology also purchased additional transfectants. We used 2 μg of Fxyd2-siRNA per injection. "Non-targeting" siRNA was used as a control. Although not as effective as Fxyd2-LASO, daily Fxyd2-siRNA has mechanistic benefits. reduced hypersensitivity, whereas control siRNA did not.

[0263] (Conclusion) Overall, these results suggest that several inhibitors of human FXYD2 expression can be inhibited in vitro. Identify antisense oligonucleotides for 100% conserved rat-human ASOs Intraspinal injection of lipid-modified (LASO#75) of peripheral neuropathic pain and C FA-induced inflammatory pain and pain behavior were observed in two rodent models of neuropathic pain. It was significantly attenuated.

[0264] Therefore, the inventors believe that the antisense oligonucleotides of the present invention inhibit FXYD2. They have demonstrated that it is possible to injure the nerves and thereby treat pain.

[0265] (References) Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are incorporated herein by reference. 1- De Souza, AH et al. An evaluation of the anticiceptive effects of Phα1β , a neurotoxin from the spider Phoneutria nigriventer, and ω-conotoxin MVIIA, a cone snail Conus magus toxin, in rat model of inflammatory and neuropathic pain . Cell Mol Neurobiol. 33, 59-67 (2013) 2- Kim, SH & Chung, JM An experimental model for peripheral neuropathy p roduced by segmental spinal nerve ligation in the rat. Pain 50, 355-363 (1992). 3- Ferreira, J. et al. Evidence for the participation of kinins in Freund’s a djuvantinduced inflammatory and nociceptive responses in kinin B1 and B2 recepto r knockout mice. Neuropharmacology 41, 1006-1012 (2001). 4- Pieraut, S. et al. NKCC1 phosphorylation stimulates neurite growth of injur ed adult sensory neurons. J. Neurosci. 25, 6751-6759 (2007). 5- Rivat, C. et al. Non-nociceptive environmental stress induces hyperalgesia, not analgesia, in pain and opioid-experienced rats. Neuropsychopharmacology 32, 2217-2228 (2007).

Claims

1. An inhibitor of FXYD2, reducing the expression and / or activity of FXYD2 in a subject in need thereof, A region comprising or consisting of nucleotides 219 to 229 of SEQ ID NO: 3 An inhibitor that targets

2. A nucleic acid sequence comprising or consisting of nucleotides 210 to 238 of SEQ ID NO: 3 and / or a region comprising or including nucleotides 210 to 267 of SEQ ID NO:

3. The inhibitor of claim 1 , which targets a region consisting of nucleotides.

3. Targeting a region containing or consisting of at least the nucleotides of SEQ ID NO: 3 The inhibitor according to claim 1 or 2.

4. An inhibitor of FXYD2, reducing the expression and / or activity of FXYD2 in a subject in need thereof, , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 Nucleotide-targeting inhibitors.

5. siRNA, shRNA, antisense oligonucleotide, miRNA or ribozyme The inhibitor according to any one of claims 1 to 4, which is a steroid hormone.

6. The inhibitor according to any one of claims 1 to 5, which is an antisense oligonucleotide. quality.

7. The antisense oligonucleotide is a lipid-conjugated antisense oligonucleotide. The inhibitor according to any one of claims 1 to 6, which is a nucleotide (LASO).

8. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 1 8, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, Sequence number 30, sequence number 33, sequence number 34, sequence number 35, sequence number 36, sequence number 37 , SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41, or The inhibitor according to any one of claims 1 to 7, which consists of said sequence.

9. Any of claims 1 to 8, which can reduce the amount of FXYD2 in the dorsal root ganglion (DRG). The inhibitor and / or antisense oligonucleotide according to any one of claims 1 to 4.

10. Any one of claims 1 to 9 for use in treating pain in a subject in need thereof Item 1. An inhibitor and / or antisense oligonucleotide according to item 1.

11. The pain may be neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, or postoperative pain. and / or chronic postoperative pain. oligonucleotides.

12. The administration of the antisense oligonucleotide may be by intrathecal administration, subcutaneous administration, local administration, or 12. The inhibitor and / or antisense compound according to claim 10 or 11, administered intravenously. Oligonucleotide.

13. The inhibitor and / or antisense oligonucleotide according to any one of claims 1 to 9 A pharmaceutical composition comprising methicone.

14. 14. A pharmaceutical composition according to claim 13 for use in the treatment of pain.

15. The pain may be neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, or postoperative pain. and / or chronic postoperative pain.

Images