Oligonucleotides for tissue specific apoe modulation

Abstract

To provide oligonucleotides for treating neurodegenerative and amyloid-related diseases.SOLUTION: An RNA molecule 15 to 35 bases in length comprising a region of complementarity which is substantially complementary to 5'GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA3' or 5'UGGACCCUAGUUUAAUAAAGAUUCACCAAG3' is provided.SELECTED DRAWING: None

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Patent Application No. 62 / 819,189, filed March 15, 2019, U.S. Provisional Patent Application No. 62 / 864,797, filed June 21, 2019, and U.S. Provisional Patent Application No. 62 / 951,441, filed December 20, 2019, the entire contents of each of which are incorporated herein by reference.

[0002] (Statement Regarding Federally Sponsored Research or Development) This invention was made with government support under Grant No. NS104022 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] FIELD OF THE INVENTION The present disclosure relates to novel apolipoprotein E (ApoE) targeting sequences, novel branched oligonucleotides, and novel methods for treating and preventing neurodegeneration. [Background technology]

[0004] Patients with neurodegenerative diseases, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), have limited treatment options. Abnormal cholesterol transport has been consistently linked to neurodegeneration and clinical deterioration in AD and ALS, making this a particularly attractive pathway to target for gene therapy.

[0005] Apolipoprotein E (ApoE) facilitates cholesterol transport in the systemic circulation and central nervous system (CNS). In human plasma and the CNS, total ApoE levels and specific ApoE isoforms (i.e., E2, E3, and E4) are associated with the onset and progression of AD and ALS. Furthermore, total ApoE levels in the CNS have been found to be predictive of neurodegenerative progression.

[0006] In mice, the overall reduction of ApoE reduces the pathological characteristics of neurodegeneration, indicating that non-selective regulation of ApoE may be a treatment approach for neurodegenerative diseases.The notable feature of the proposed compound is that in order to achieve measurable effects on neurodegeneration, it may be necessary to regulate ApoE almost completely, if not completely.Therefore, there is an urgent need in the art for a substance that can CNS-regulate ApoE expression. Summary of the Invention

[0007] The present disclosure provides oligonucleotide compounds that exhibit potent and effective silencing activity against ApoE expression. In certain embodiments, the oligonucleotides of the present disclosure can inhibit ApoE expression in tissues of the central nervous system (CNS).

[0008] In one aspect, the disclosure provides RNA molecules, e.g., RNA molecules 15 to 50 bases in length (e.g., 15 to 40 bases in length, e.g., 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases in length), that include a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0009] In some embodiments, the RNA molecule comprises a region of complementarity that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0010] In some embodiments, the RNA molecule comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0011] In some embodiments, the RNA molecule comprises a dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0012] In some embodiments, the RNA molecule comprises a length of 15 to 25 base pairs.

[0013] In some embodiments, the region of complementarity is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. For example, the region of complementarity can be complementary to a segment from 10 to 30 contiguous nucleotides of GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA or UGGACCCUAGUUUAAUAAAGAUUCACCAAG (e.g., a segment of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides of GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA or UGGACCCUAGUUUAAUAAAGAUUCACCAAG).

[0014] In some embodiments, the region of complementarity contains no more than three mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0015] In some embodiments, the region of complementarity is perfectly complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0016] In some embodiments, the dsRNA is blunt ended.

[0017] In some embodiments, the dsRNA comprises at least one single-stranded nucleotide overhang.

[0018] In some embodiments, the dsRNA comprises naturally occurring nucleotides.

[0019] In some embodiments, the dsRNA comprises at least one modified nucleotide.

[0020] In some embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0021] In some embodiments, the modified nucleotide comprises a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing a non-natural base.

[0022] In some embodiments, the dsRNA comprises at least one 2'-O-methyl modified nucleotide and at least one nucleotide comprising a 5' phosphorothioate group.

[0023] In some embodiments, the dsRNA is at least 75% chemically modified. In some embodiments, the dsRNA is at least 80% chemically modified. In some embodiments, the dsRNA is completely chemically modified.

[0024] In some embodiments, the dsRNA comprises a cholesterol moiety.

[0025] In some embodiments, the RNA molecule comprises a 5' end, a 3' end, and is complementary to a target, wherein (1) the RNA molecule comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) the nucleotides at positions 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate linkages.

[0026] In some embodiments, the dsRNA has a 5' end and a 3' end, is complementary to a target, and comprises a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.

[0027] In some embodiments, the RNA molecule comprises a 5' end and a 3' end and is complementary to a target, wherein (1) the RNA molecule comprises a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) the nucleotides at positions 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate linkages; and (5) the nucleotides at positions 1-2 from the 5' end are linked to each other via phosphorothioate linkages.

[0028] In some embodiments, the dsRNA has a 5' end and a 3' end, is complementary to a target, and comprises a first oligonucleotide and a second oligonucleotide, wherein: (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.

[0029] In some embodiments, the second oligonucleotide has a hydrophobic molecule attached to its 3' end.

[0030] In some embodiments, the linkage between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol.

[0031] In some embodiments, the nucleotides 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate linkages.

[0032] In some embodiments, the nucleotides 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent ribonucleotides via phosphorothioate linkages.

[0033] In one aspect, the present disclosure provides a pharmaceutical composition for inhibiting expression of the apolipoprotein E (ApoE) gene in an organism, the pharmaceutical composition comprising the above-described dsRNA and a pharmaceutically acceptable carrier.

[0034] In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 50%. In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 90%.

[0035] In one aspect, the present disclosure provides a method of inhibiting expression of an ApoE gene in a cell, the method comprising: The present invention provides a method for inhibiting expression of the ApoE gene in a cell, the method comprising: (a) introducing the above-described double-stranded ribonucleic acid (dsRNA) into a cell; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ApoE gene.

[0036] In one aspect, the present disclosure provides a method of treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0037] In some embodiments, dsRNA is administered to patient's brain.In some embodiments, dsRNA is administered locally to brain or cerebrospinal fluid, for example, by intracerebroventricular (ICV) injection.In other embodiments, dsRNA can be administered intravenously and can be delivered to brain through blood-brain barrier (BBB).

[0038] In some embodiments, administration of dsRNA causes a reduction in ApoE gene mRNA in the hippocampus. In some embodiments, administration of dsRNA causes a reduction in ApoE gene mRNA in the spinal cord.

[0039] In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 50%.

[0040] In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 90%.

[0041] In one aspect, the present disclosure provides a vector for inhibiting expression of an ApoE gene in a cell, the vector comprising a regulatory sequence operably linked to a nucleotide sequence encoding an RNA molecule substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', wherein the RNA molecule comprises 10 to 35 bases in length, and wherein the RNA molecule inhibits expression of the ApoE gene by at least 50% upon contact with a cell expressing the ApoE gene.

[0042] In some embodiments, the RNA molecule inhibits expression of the ApoE gene by at least 90%.

[0043] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0044] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0045] In one aspect, the present disclosure provides a cell comprising the above-described vector.

[0046] In one aspect, the present disclosure provides an RNA molecule having a length of 15 to 35 bases and including a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', wherein the RNA molecule targets the open reading frame (ORF) or 3' untranslated region of an ApoE gene mRNA.

[0047] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0048] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0049] In one aspect, the disclosure provides branched (e.g., di-branched) RNA compounds comprising two or more RNA molecules, each 15-35 bases in length, which further comprise a region of complementarity substantially complementary to ApoE mRNA, wherein the two RNA molecules are covalently linked to one another (e.g., by one or more moieties independently selected from a linker, a spacer, and a branch point).

[0050] In some embodiments, the RNA molecule comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0051] In some embodiments, the RNA molecule comprises a region of complementarity that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0052] In some embodiments, the RNA molecule comprises ssRNA or dsRNA.

[0053] In some embodiments, the RNA molecule comprises an antisense molecule or a GAPMER molecule.

[0054] In some embodiments, the antisense molecule comprises an antisense oligonucleotide.

[0055] In some embodiments, the antisense molecule enhances resolution of the complementary region.

[0056] In some embodiments, the degradation comprises nuclease degradation.

[0057] In some embodiments, the nuclease degradation is mediated by RNase H.

[0058] In one aspect, a branched oligonucleotide compound is provided that includes two or more nucleic acids, eg, two or more nucleic acids each 15 to 40 bases in length.

[0059] each nucleic acid independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; and

[0060] The two or more nucleic acids are linked to one another by one or more moieties, including linkers, spacers, or branch points.

[0061] In some embodiments, each nucleic acid independently comprises a region of complementarity that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0062] In some embodiments, each nucleic acid comprises 15 to 25 base pairs in length.

[0063] In some embodiments, each nucleic acid comprises single-stranded (ss) RNA or double-stranded (ds) RNA. In some embodiments, each nucleic acid comprises a dsRNA comprising a sense strand and an antisense strand, wherein each antisense strand independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In some embodiments, each region of complementarity is independently complementary to at least 10, 11, 12, or 13 contiguous nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0064] In some embodiments, each region of complementarity independently contains no more than three mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0065] In some embodiments, each region of complementarity is perfectly complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0066] In some embodiments, each dsRNA independently comprises at least one modified nucleotide.

[0067] In some embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0068] In some embodiments, the modified nucleotide comprises a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing a non-natural base.

[0069] In some embodiments, the two or more nucleic acids are each an RNA molecule having complementarity to a target, including a 5' end, a 3' end, wherein: (1) The RNA molecule contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) Nucleotides at positions 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

[0070] In some embodiments, each nucleic acid has a 5' end and a 3' end, has complementarity to a target, and is a dsRNA comprising a first oligonucleotide and a second oligonucleotide, wherein: (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages.

[0071] In some embodiments, the two or more nucleic acids each comprise an RNA molecule, wherein the RNA molecule comprises a 5' end and a 3' end and has complementarity to a target, wherein: (1) The RNA molecule contains a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) nucleotides 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (5) The first and second nucleotides from the 5' end are linked to each other via a phosphorothioate bond.

[0072] In one aspect, the present disclosure provides a compound of formula (I): [ka] [In formula (I), L comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, wherein: Formula (I) may further comprise one or more branching points B, and one or more spacers, wherein: B is, independently at each occurrence, a polyvalent organic species or derivative thereof; S, at each occurrence, independently comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; N comprises a double-stranded nucleic acid, e.g., a double-stranded nucleic acid 15 to 35 bases in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases in length), wherein the double-stranded nucleic acid comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and wherein the sense strand and the antisense strand each independently comprise one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8] The present invention provides a compound represented by the formula: In some embodiments, the compound has the formula (I-1) to (I-9): [Table 1] The compound has a structure selected from:

[0073] In one embodiment, the antisense strand is [ka] and a 5' terminal group R selected from the group consisting of:

[0074] In some embodiments, the compound has the formula (II): [ka] [In the formula, X is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - indicates a phosphodiester internucleoside linkage; = indicates a phosphorothioate internucleoside linkage; and --- indicates a base-pairing interaction or mismatch, each occurrence alone.] It has the following structure.

[0075] In some embodiments, the compound has Formula (III): [ka] [In the formula, X is, independently at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X, independently at each occurrence, is a nucleotide containing a 2'-O-methyl modification; Y is independently for each occurrence a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently at each occurrence, a nucleotide containing a 2'-O-methyl modification. It has the following structure.

[0076] In some embodiments, the compound has the formula (IV): [ka] [In the formula, X is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - indicates a phosphodiester internucleoside linkage; = indicates a phosphorothioate internucleoside linkage; and --- indicates a base-pairing interaction or mismatch, each occurrence alone.] It has the following structure.

[0077] In some embodiments, the compound has the formula (V): [ka] [In the formula, X is, independently at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X, independently at each occurrence, is a nucleotide containing a 2'-O-methyl modification; Y is independently for each occurrence a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently at each occurrence, a nucleotide containing a 2'-O-methyl modification. It has the following structure.

[0078] In some embodiments, the moiety L has the structure L1: [ka] is.

[0079] In some embodiments, when L is structure L1, R is R3 and n is 2.

[0080] In some embodiments, L has the structure L2: [ka] is.

[0081] In some embodiments, when L is structure L2, R is R3 and n is 2.

[0082] In one aspect, the present disclosure provides a compound of formula (VI): [ka] [In formula (VI), L comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, wherein formula (VI) may further comprise one or more branch points B, and one or more spacers, wherein B is, independently at each occurrence, a polyvalent organic species or derivative thereof; S, at each occurrence, independently comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; each cNA is independently a carrier nucleic acid that includes one or more chemical modifications; each cNA independently comprises at least 15 contiguous nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; and n is 2, 3, 4, 5, 6, 7, or 8] The present invention provides a delivery system for therapeutic nucleic acids having the structure:

[0083] In some embodiments, each cNA independently comprises 15 to 25 contiguous nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides) of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0084] In some embodiments, each cNA independently comprises 15 to 21 contiguous nucleotides (e.g., 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0085] In some embodiments, each cNA comprises 15 contiguous nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In some embodiments, each comprises 16 contiguous nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0086] In some embodiments, the delivery system has formula (VI-1) to (VI-9): [Table 2] The compound has a structure selected from:

[0087] In some embodiments, each cNA independently comprises a chemically modified nucleotide.

[0088] In some embodiments, the delivery system further comprises n therapeutic nucleic acids (NAs), wherein each NA is hybridized to at least one cNA.

[0089] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides. In some embodiments, each NA independently comprises 16 to 30 consecutive nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides). In some embodiments, each NA independently comprises 18 to 24 consecutive nucleotides (e.g., 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides).

[0090] In some embodiments, each NA independently comprises 16 to 21 contiguous nucleotides.

[0091] In some embodiments, each NA comprises 20 contiguous nucleotides. In some embodiments, each NA comprises 21 contiguous nucleotides.

[0092] In some embodiments, each cNA comprises 15 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and each NA comprises 20 consecutive nucleotides.

[0093] In some embodiments, each cNA comprises 16 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and each NA comprises 21 consecutive nucleotides.

[0094] In some embodiments, each NA comprises an unpaired overhang of at least two nucleotides. The nucleotides of the overhang can be linked via phosphorothioate bonds.

[0095] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagomiR, miRNA, gapmer, mixmer, and guide RNA.

[0096] In one aspect, the present disclosure provides a pharmaceutical composition for inhibiting expression of the apolipoprotein E (ApoE) gene in an organism, the pharmaceutical composition comprising one of the above-described compounds or systems and a pharmaceutically acceptable carrier.

[0097] In some embodiments, the compound or system inhibits expression of the ApoE gene by at least 50%.

[0098] In some embodiments, the compound or system inhibits expression of the ApoE gene by at least 90%.

[0099] In one aspect, the present disclosure provides a method of inhibiting expression of an ApoE gene in a cell, the method comprising: (a) introducing one of the compounds or systems described above into a cell; and (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts of the ApoE gene, thereby inhibiting expression of the ApoE gene in the cells.

[0100] In one aspect, the present disclosure provides a method of treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of one of the compounds or systems described above.

[0101] In some embodiments, the compound or system is administered to the brain of the patient.

[0102] In some embodiments, dsRNA is administered to patient's brain.In some embodiments, dsRNA is administered locally to brain or cerebrospinal fluid, for example, by intracerebroventricular (ICV) injection.In other embodiments, dsRNA is administered intravenously and can be delivered to brain through blood-brain barrier (BBB).

[0103] In some embodiments, administration of the compound or system causes a reduction in ApoE gene mRNA in the hippocampus.

[0104] In some embodiments, administration of the compound or system causes a reduction in ApoE gene mRNA in the spinal cord.

[0105] In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 50%.

[0106] In some embodiments, the dsRNA inhibits expression of the ApoE gene by at least 90%.

[0107] In one aspect, branched oligonucleotide compounds are provided that include two or more nucleic acids, e.g., two or more nucleic acids each comprising 15 to 40 bases in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases in length), wherein each nucleic acid comprises a region of complementarity substantially complementary to ApoE mRNA, and wherein the two nucleic acids are covalently linked to one another (e.g., by one or more moieties including a linker, spacer, or branch point).

[0108] In some embodiments, each nucleic acid independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

[0109] In some embodiments, each nucleic acid independently comprises a region of complementarity that is substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0110] In some embodiments, each nucleic acid independently comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0111] In some embodiments, each nucleic acid independently comprises an antisense molecule or a gapmer molecule.

[0112] In one aspect, a method of treating or managing an amyloid-related disease is provided, comprising administering to a patient diagnosed as having or at risk of developing the disease a therapeutically effective amount of one of the compounds or systems described above.

[0113] In some embodiments, the disease is selected from the group consisting of Alzheimer's disease, cerebral amyloid angiopathy, mild cognitive impairment, moderate cognitive impairment, and combinations thereof.

[0114] In some embodiments, the compound or system is administered to the patient's brain, for example, by intraventricular injection.

[0115] In non-limiting embodiments, administration of the compound or system inhibits, delays, prevents, or reduces cognitive decline. In further non-limiting embodiments, administration of the compound or system inhibits, delays, prevents, or reduces beta-amyloid plaque formation. In exemplary embodiments, administration of the compound or system inhibits, delays, prevents, or reduces neurodegeneration.

[0116] In a further aspect, methods are provided for treating or managing Alzheimer's disease, comprising administering to a patient diagnosed with or at risk of developing the disease a therapeutically effective amount of a branched oligonucleotide compound comprising two or more nucleic acids, e.g., two or more nucleic acids each comprising 15 to 40 bases in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases in length), wherein each nucleic acid comprises a region of complementarity substantially complementary to ApoE mRNA, and wherein the two nucleic acids are covalently linked to one another (e.g., by one or more moieties including a linker, spacer, or branch point).

[0117] In some embodiments, each nucleic acid of the branched oligonucleotide compound independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, each nucleic acid of the branched oligonucleotide independently comprises a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0118] In some embodiments, each nucleic acid comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

[0119] In further embodiments, each nucleic acid comprises an antisense molecule or a gapmer molecule.

[0120] In some embodiments, the branched oligonucleotide is administered to the patient's brain, for example, by intraventricular injection.

[0121] In non-limiting embodiments, administration of the branched oligonucleotide inhibits, delays, prevents, or reduces cognitive decline. In further non-limiting embodiments, administration of the compound or system inhibits, delays, prevents, or reduces beta-amyloid plaque formation. In exemplary embodiments, administration of the branched oligonucleotide inhibits, delays, prevents, or reduces neurodegeneration. [Brief explanation of the drawings]

[0122] The above and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one color drawing. Copies of this patent or patent application publication with color drawing(s) will be provided nationwide upon request and payment of the necessary fee.

[0123] Figures 1A-1C show the identification of novel target sequences that exhibit silencing in both mRNA- and protein-based mouse cell models.

[0124] [Figure 1A] FIG. 1A shows a screen to identify hit sequences targeting ApoE in mouse primary astrocytes.

[0125] [Figure 1B] FIG. 1B shows dose-response curves of hit sequences from the primary screen in mouse primary astrocytes.

[0126] [Figure 1C] FIG. 1C shows the dose response demonstrating protein silencing in mouse primary astrocytes.

[0127] 2A-2B show the identification of novel target sequences that exhibit mRNA silencing in an mRNA-based human cell model.

[0128] [Figure 2A] FIG. 2A shows a screen to identify hit sequences targeting ApoE in HepG2 cells.

[0129] [Figure 2B] FIG. 2B shows the dose-response curves of hit sequences from the primary screen in HepG2 cells.

[0130] 3A-3B show oligonucleotides targeting ApoE.

[0131] [Figure 3A] FIG. 3A shows target sequences in the mouse and human ApoE genes and oligonucleotides that target such sequences.

[0132] [Figure 3B] FIG. 3B shows examples of chemical modifications to oligonucleotides.

[0133] Figures 4A to 4C show CNS-siRNA. ApoE Silencing of mRNA and protein expression in the whole mouse brain 1 month after injection is shown.

[0134] [Figure 4A] FIG. 4A shows mRNA silencing in all brain regions one month after injection.

[0135] [Figure 4B] FIG. 4B shows protein silencing in all brain regions one month after injection.

[0136] [Figure 4C] FIG. 4C is a Western blot showing protein silencing throughout the brain.

[0137] Figures 5A-5B show CNS-siRNA ApoE silencing ApoE protein in the hippocampus at low doses.

[0138] [Figure 5A] FIG. 5A shows quantification of protein silencing in the hippocampus one month after injection.

[0139] [Figure 5B] FIG. 5B is a Western blot showing target protein silencing.

[0140] Figures 6A-6B show CNS-siRNA ApoE demonstrates that low doses silence the entire spinal cord.

[0141] [Figure 6A] FIG. 6A is a quantification of protein silencing in the spinal cord one month after injection.

[0142] [Figure 6B] FIG. 6B is a Western blot showing target ApoE (37 kDa) protein silencing compared to the control vinculin (116 kDa).

[0143] 7A-7B show CNS-siRNA ApoE We demonstrate that brain-specific (non-liver) silencing of ApoE is possible at low doses in vivo.

[0144] [Figure 7A] FIG. 7A is a quantification of protein silencing in the liver one month after injection.

[0145] [Figure 7B] FIG. 7B is a Western blot (ProteinSimple) showing target ApoE (37 kDa) protein silencing compared to the control vinculin (116 kDa).

[0146] 8A to 8C show GalNAc-siRNA. ApoE We show that silences protein expression in the liver but does not affect the protein in the brain.

[0147] [Figure 8A] FIG. 8A is a Western blot showing ApoE protein silencing in the liver compared to the control vinculin.

[0148] [Figure 8B] FIG. 8B is a Western blot showing no effect on protein levels in the brain.

[0149] [Figure 8C] FIG. 8C is a quantification of protein silencing in the liver and brain.

[0150] 9A-9B show that reducing hepatic ApoE increases serum cholesterol, whereas silencing CNS-ApoE alone does not.

[0151] [Figure 9A] FIG. 9A shows quantification of serum total cholesterol after silencing CNS ApoE.

[0152] [Figure 9B] FIG. 9B shows quantification of serum total cholesterol after silencing systemic ApoE, and quantification of cholesterol in the LDL and HDL fractions after silencing systemic ApoE.

[0153] 10A-10B show that CNS and systemic ApoE represent two distinct protein pools.

[0154] [Figure 10A]FIG. 10A shows protein silencing in the brain and liver after CNS-siRNAApoE injection.

[0155] [Figure 10B] FIG. 10B shows silencing in the brain (none) and liver after GalNAc-siRNAApoE injection.

[0156] [Figure 11] Figure 11 shows the structure of a di-hsiRNA. Black—2'-O-methyl, gray—2'-fluoro, red dash—phosphorothioate linkage, linker—tetraethylene glycol. Di-hsiRNAs are two asymmetric siRNAs linked via a linker to the 3' end of the sense strand. Hybridization to the longer antisense strand results in the formation of a protruding single-stranded, fully phosphorothioate region, which is essential for tissue distribution, cellular uptake, and efficacy. The structure presented here utilizes a four-monomer Teg Linger. The chemical identity of the linker can be varied without affecting efficacy. It can be adjusted by length, chemical composition (all carbon), saturation, or the addition of chemical targeting ligands.

[0157] [Figure 12] FIG. 12 shows the chemical synthesis, purification and quality control of dibranched siRNA.

[0158] [Figure 13] Figure 13 shows the HPLC and quality control of compounds produced by the method shown in the figure. Mass spectrometry identified three major products as the sense strand with a TEG (tetraethylene glycol) linker, dibranched oligos, and Vit-D (calciferol) conjugate. All products were independently purified by HPLC and tested in vivo. The dibranched oligos alone were characterized by unprecedented tissue distribution and efficacy, indicating that the branched structure is essential for tissue retention and distribution.

[0159] [Figure 14] Figure 14 shows mass spectrometry to confirm the mass of the bi-branched oligonucleotide. The observed mass of 11683 corresponds to the two sense strands joined by their 3' ends via a TEG linker.

[0160] 15A-15B show the synthesis of branched oligonucleotides using alternative chemical routes. [Figure 15A] FIG. 15A shows the mono-phosphoramidate linker approach. [Figure 15B] FIG. 15B shows the di-phosphate linker approach.

[0161] [Figure 16] FIG. 16 shows exemplary amidite linkers, spacers, and branching moieties.

[0162] [Figure 17] Figure 17 shows branched motifs of oligonucleotides. The double helix represents the oligonucleotide. The combination of various linkers, spacers, and branch points allows for a wide variety of branched hsiRNA structures to be generated.

[0163] [Figure 18] FIG. 18 shows structurally diverse branched oligonucleotides.

[0164] [Figure 19] FIG. 19 shows an asymmetric compound of the invention having four single-stranded phosphorothioate regions.

[0165] [Figure 20A]Figures 20A-20C show branched oligonucleotides of the present invention formed by annealing three oligonucleotides (Figure 20A). Longer linked oligonucleotides can include cleavable regions in the form of unmodified RNA, DNA, or UNA; (Figure 20B) asymmetric branched oligonucleotides with 3' and 5' linkages in spaced apart linkers as described above. This can be applied to the 3' and 5' ends of the sense or antisense strand, or a combination thereof; (Figure 20C) branched oligonucleotides consisting of three separate strands. Long double-sense strands can be synthesized with 3' and 5' phosphoramidites, allowing for 3'-3' adjacent or 5'-5' adjacent ends. [Figure 20B] Figures 20A-20C show branched oligonucleotides of the present invention formed by annealing three oligonucleotides (Figure 20A). Longer linked oligonucleotides can include cleavable regions in the form of unmodified RNA, DNA, or UNA; (Figure 20B) asymmetric branched oligonucleotides with 3' and 5' linkages in spaced apart linkers as described above. This can be applied to the 3' and 5' ends of the sense or antisense strand, or a combination thereof; (Figure 20C) branched oligonucleotides consisting of three separate strands. Long double-sense strands can be synthesized with 3' and 5' phosphoramidites, allowing for 3'-3' adjacent or 5'-5' adjacent ends. [Figure 20C]Figures 20A-20C show branched oligonucleotides of the present invention formed by annealing three oligonucleotides (Figure 20A). Longer linked oligonucleotides can include cleavable regions in the form of unmodified RNA, DNA, or UNA; (Figure 20B) asymmetric branched oligonucleotides with 3' and 5' linkages in spaced apart linkers as described above. This can be applied to the 3' and 5' ends of the sense or antisense strand, or a combination thereof; (Figure 20C) branched oligonucleotides consisting of three separate strands. Long double-sense strands can be synthesized with 3' and 5' phosphoramidites, allowing for 3'-3' adjacent or 5'-5' adjacent ends.

[0166] [Figure 21] FIG. 21 shows a branched oligonucleotide of the invention having a conjugated biologically active moiety.

[0167] [Figure 22] FIG. 22 shows the relationship between phosphorothioate content and stereoselectivity.

[0168] [Figure 23] FIG. 23 shows exemplary hydrophobic moieties.

[0169] [Figure 24] FIG. 24 shows exemplary internucleotide linkages.

[0170] [Figure 25] FIG. 25 shows exemplary internucleotide backbone linkages.

[0171] [Figure 26] FIG. 26 shows exemplary sugar modifications.

[0172] [Figure 27] FIG. 27 shows the structures of hsiRNA and fully metabolized (FM) hsiRNA.

[0173] [Figure 28] Figure 28 shows the chemical diversity of single-stranded fully modified oligonucleotides. The single-stranded oligonucleotides can consist of gapmers, mixmers, miRNA inhibitors, SSOs, PMOs, or PNAs.

[0174] [Figure 29] FIG. 29 shows a first strategy for incorporating hydrophobic moieties into branched oligonucleotide structures.

[0175] [Figure 30] Figure 30 shows a second strategy for incorporating hydrophobic moieties into branched oligonucleotide structures.

[0176] [Figure 31] FIG. 31 shows a third strategy for incorporating hydrophobic moieties into branched oligonucleotide structures.

[0177] [Figure 32] Figure 32 shows a schematic di-siRNA molecule. Black - 2'-O-methyl, gray - 2'-fluoro, red dash - phosphorothioate linkage, linker attached to the terminal nucleotide at the 3' end of each passenger strand. The alternating nucleotide modification motifs differ at positions 1, 11, and 15 from the 5' end of the sense target strand and positions 5, 16, and 18 from the 5' end of the complementary binding strand.

[0178] [Figure 33] FIG. 33 shows the experimental design of a study to evaluate the effect of ApoE silencing on neurodegenerative diseases.

[0179] [Figure 34] FIG. 34 shows the mRNA silencing effect two months after injection of siRNA targeting ApoE in an Alzheimer's disease (APP / PSEN1) animal model.

[0180] [Figure 35] Figure 35 contains graphs showing the effects of tissue-specific siRNA targeting ApoE two months after injection in an Alzheimer's disease (APP / PSEN1) animal model. Figure 35A: mRNA silencing two months after injection of di-siRNA ApoE. Figure 35B: mRNA silencing two months after injection of GalNAc-siRNA ApoE.

[0181] [Figure 36] Figure 36 contains diagrams showing tissue-specific protein silencing two months after injection in an animal model of Alzheimer's disease. Figure 36A: Protein silencing two months after injection of di-siRNAApoE. Figure 36B: Protein silencing two months after injection of GalNAc-siRNAApoE.

[0182] [Figure 37] Figure 37 contains raw Western blots showing ApoE protein expression in the hippocampus, cortex, and liver after ICV or SC injection of di-siRNANTC, di-siRNAApoE, GalNAcNTC, or GalNAcAPOE.

[0183] [Figure 38] FIG. 38 contains immunofluorescence microscopy images of cerebral cortex sections from mice treated with either di-siRNANTC or di-siRNAApoE.

[0184] [Figure 39] Figure 39 includes charts reporting the average number of cortical plaques measured in animals treated with di-siRNAApoE and GalNAc-siRNAApoE. Figure 39A: Average number of cortical plaques per animal in mice treated with di-siRNAAPOE compared to mice treated with di-siRNANTC. Figure 39B: Average number of cortical plaques per animal in mice treated with GalNAc-siRNAApoE compared to mice treated with GalNAc-siRNANTC.

[0185] [Figure 40] Figures 40A-C contain charts reporting the results of sex-specific analysis between mice treated with di-siRNANTC and di-siRNAApoE. Figure 40A: Sex-specific analysis of mice treated with di-siRNANTC and di-siRNAApoE. Figure 40B: Number of plaques in each slice of individual mice. Figure 40C: Number of plaques in each slice of individual mice.

[0186] [Figure 41] FIG. 41 is a chart reporting the effect of gender on silencing efficacy by di-siRNA ApoE.

[0187] [Figure 42] Figures 42A-B show the novel di-siRNA ApoE 1156 silencing ApoE4 in the brain and spinal cord. Figure 42A: Quantification of protein silencing in the hippocampus and liver one month after injection. Figure 42B: Quantification of protein silencing in the spinal cord.

[0188] [Figure 43] Figure 43 shows siRNAs with methyl-rich substitution patterns.

[0189] Figures 44A-C show the identification of novel target sequences that exhibit mRNA silencing in an mRNA-based human cell model. [Figure 44A] Figure 44A shows a primary screen identifying hit sequences targeting ApoE in HepG2 cells. [Figure 44B] Figure 44B shows the efficacy and potency of hit sequences from the primary screen in HepG2 cells. [Figure 44C] Figure 44C shows the dose-response curves of hit sequences from the primary screen in HepG2 cells.

[0190] [Figure 45]Figure 45 shows the measurement of pathological amyloid beta-42 in picograms per milligram of cortical tissue. Results were measured separately in female and male mice. For each gender, the left data point corresponds to the non-targeting control di-siRNA, and the right data point corresponds to the APOE-targeting di-siRNA.

[0191] [Figure 46-1] Figures 46A-C show mouse cortical staining (Figure 46A) and relative quantification of X-34- and APP6E10 / LAMP1-positive plaques (Figure 46B). For Figures 46A and 46B, results were measured separately in female and male mice. For each gender, the left data point corresponds to a non-targeting control di-siRNA, and the right data point corresponds to an APOE-targeting di-siRNA. For Figure 46C, results were compared to GalNAc-conjugated APOE siRNA. [Figure 46-2] Figures 46A-C show mouse cortical staining (Figure 46A) and relative quantification of X-34- and APP6E10 / LAMP1-positive plaques (Figure 46B). For Figures 46A and 46B, results were measured separately in female and male mice. For each gender, the left data point corresponds to a non-targeting control di-siRNA, and the right data point corresponds to an APOE-targeting di-siRNA. For Figure 46C, results were compared to GalNAc-conjugated APOE siRNA.

[0192] [Figure 47] FIG. 47 shows the measurement of serum cholesterol (HDL and LDL levels) with di-siRNA targeting APOE and GalNAc-conjugated siRNA targeting APOE.

[0193] [Figure 48A] Figures 48A-B show measurements of APOE protein levels in the hippocampus and cortex of a 3x-Tg-AD mouse model 4 months after injection of di-siRNA ApoE 1156. [Figure 48B]Figures 48A-B show measurements of APOE protein levels in the hippocampus and cortex of a 3x-Tg-AD mouse model 4 months after injection of di-siRNA ApoE 1156.

[0194] [Figure 49A] Figures 49A-B show measurements of APOE protein levels in the hippocampus and cortex of a 3x-Tg-AD mouse model one month after injection of di-siRNA ApoE 1133. [Figure 49B] Figures 49A-B show measurements of APOE protein levels in the hippocampus and cortex of a 3x-Tg-AD mouse model one month after injection of di-siRNA ApoE 1133.

[0195] [Figure 50] Figure 50 shows siRNA accumulation in several regions of the posterior cortex of non-human primates (NHPs). NHPs were injected with 25 mg of di-siRNA ApoE 1133 into the cisterna magna, and siRNA accumulation was assessed 2 months after injection.

[0196] DETAILED DESCRIPTION OF CERTAIN EXEMPLARY EMBODIMENTS Novel ApoE target sequences are provided. Also provided are novel interfering RNA molecules, such as siRNAs, that target the novel ApoE target sequences of the present invention.

[0197] Unless otherwise specified, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein is well known and commonly used in the art. Unless otherwise specified, the methods and techniques provided herein are performed according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout the specification unless otherwise specified. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications as commonly accomplished in the art or as described herein. The nomenclature used in connection with analytical chemistry, organic synthetic chemistry, and medicinal chemistry described herein, and the laboratory methods and techniques thereof, are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparations, formulations, delivery, and patient treatment.

[0198] Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise stated. The use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0199] In order that the present invention may be more readily understood, certain terms are first defined.

[0200] The term "nucleoside" refers to a molecule in which a purine or pyrimidine base is covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Further exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine (also referred to as "rare" nucleosides). The term "nucleotide" refers to a nucleoside having one or more phosphate groups joined to the sugar moiety by ester linkages. Exemplary nucleotides include nucleoside monophosphates, diphosphates, and triphosphates. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides joined entirely by phosphodiester or phosphorothioate linkages between the 5' and 3' carbon atoms.

[0201] The terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" refer to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides). DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA may be modified post-transcriptionally. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is a single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated when ribosomes bind to the mRNA during protein synthesis.

[0202] As used herein, the term "small interfering RNA" ("siRNA") (also referred to in the art as "short interfering RNA") refers to an RNA (or RNA analog) containing about 10-50 nucleotides (or nucleotide analogs) capable of directing or mediating RNA interference. Preferably, the siRNA contains about 15-30 nucleotides or nucleotide analogs, more preferably about 16-25 nucleotides (or nucleotide analogs), even more preferably about 18-23 nucleotides (or nucleotide analogs), and even more preferably about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs). The term "short" siRNA refers to an siRNA containing about 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term "long" siRNA refers to an siRNA containing about 24-25 nucleotides, e.g., 23, 24, 25, or 26 nucleotides. Short siRNAs may optionally contain fewer than 19 nucleotides, for example, 16, 17, or 18 nucleotides, provided that the shorter siRNA retains the ability to mediate RNAi. Similarly, long siRNAs may optionally contain more than 26 nucleotides, provided that the long siRNA retains the ability to mediate RNAi without further processing (e.g., enzymatic processing) of the short siRNA.

[0203] The term "nucleotide analog" or "altered nucleotide" or "modified nucleotide" refers to a non-standard nucleotide, including non-natural ribonucleotides or deoxyribonucleotides. Exemplary nucleotide analogs retain the ability of the nucleotide analog to perform its intended function despite modifications at any position to alter the specific chemical properties of the nucleotide. Examples of nucleotide positions that can be derivatized include the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine, etc.; the 6-position, such as 6-(2-amino)propyluridine; and the 8-position of adenosine and / or guanosine, such as 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deazanucleotides, such as 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyladenosine, or otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs as described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0204] Nucleotide analogs can also include modifications to the sugar moiety of nucleotide.For example, the 2'OH-group can be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, or COOR, where R is substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc.Other possible modifications include those described in US Patents 5,858,988 and 6,291,438.

[0205] The phosphate group of nucleotide can also be modified, for example, by replacing one or more oxygen atoms of the phosphate group with sulfur (for example, phosphorothioate), or by making other substitutions that allow the nucleotide to perform its intended function, as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5):317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and US Patent 5,684,143. The above-mentioned specific modification (for example, phosphate group modification) preferably reduces the hydrolysis rate of the polynucleotide containing the analog, for example, in vivo or in vitro.

[0206] The term "oligonucleotide" refers to a short polymer of nucleotides and / or nucleotide analogs. "RNA analog" refers to a polynucleotide (e.g., a chemically synthesized polynucleotide) that contains at least one modified or altered nucleotide compared to the corresponding unmodified or unmodified RNA, but retains the same or similar properties or functions as the corresponding unmodified or unmodified RNA. As described above, oligonucleotides may be linked by linkages that reduce the rate of hydrolysis of the RNA analog compared to RNA molecules with phosphodiester linkages. For example, analog nucleotides may contain methylenediol, ethylenediol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoroamidate, and / or phosphorothioate linkages. Preferred RNA analogs include sugar- and / or backbone-modified ribonucleotides and / or deoxyribonucleotides. Such modifications may further include, for example, the addition of non-nucleotide material (one or more nucleotides of the RNA) to the end or internally of the RNA. The RNA analog need only be sufficiently similar to natural RNA to have the ability to mediate RNA interference.

[0207] As used herein, the term " RNA interference " (" RNAi ") refers to the selective intracellular degradation of RNA.RNAi occurs naturally in cells to remove foreign RNA (such as viral RNA).Natural RNAi proceeds through the fragments that are cut from free dsRNA, which directs the degradative mechanism to other similar RNA sequences.Alternatively, RNAi can be initiated by human hands, for example, to silence the expression of target genes.

[0208] An RNAi agent, e.g., an RNA silencing agent, has a strand that is "sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi)," meaning that the strand has sufficient sequence to induce destruction of the target mRNA by the RNAi machinery or process.

[0209] As used herein, the term "isolated RNA" (e.g., "isolated siRNA" or "isolated siRNA precursor") means an RNA molecule that, when produced by recombinant techniques, is substantially free of other cellular material or culture medium, and, when chemically synthesized, is substantially free of chemical precursors or other chemicals.

[0210] As used herein, the term "RNA silencing" refers to a group of sequence-specific regulatory mechanisms (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression) mediated by RNA molecules that result in the inhibition or "silencing" of the expression of corresponding protein-encoding genes. RNA silencing has been observed in many organisms, including plants, animals, and fungi.

[0211] As used herein, the term "differential RNA silencing" refers to the ability of an RNA molecule to substantially inhibit the expression of a "first" or "target" polynucleotide sequence, but not substantially inhibit the expression of a "second" or "non-target" polynucleotide sequence, for example, when both polynucleotide sequences are present in the same cell.In certain embodiments, the target polynucleotide sequence corresponds to a target gene, while the non-target polynucleotide sequence corresponds to a non-target gene.In other embodiments, the target polynucleotide sequence corresponds to a target allele, while the non-target polynucleotide sequence corresponds to a non-target allele.In certain embodiments, the target polynucleotide sequence is a DNA sequence that encodes the regulatory region (for example, promoter or enhancer element) of a target gene.In another embodiment, the target polynucleotide sequence is the target mRNA encoded by a target gene.

[0212] The term "in vitro" has its art-recognized meaning, e.g., with respect to purified reagents or extracts, e.g., cellular extracts, and the term "in vivo" has its art-recognized meaning with respect to living cells, e.g., immortalized cells, primary cells, cell lines, and / or cells of an organism.

[0213] As used herein, the term "transgene" refers to any nucleic acid molecule that is inserted into a cell by strategy and becomes part of the genome of the organism that develops from that cell. Such transgenes can include genes that are heterologous (i.e., foreign) in part or in whole to the transgenic organism, or can represent genes that are homologous to endogenous genes of the organism. The term "transgene" also refers to a nucleic acid molecule containing one or more nucleic acid sequences, e.g., DNA, selected from one or more sequences encoding one or more engineered RNA precursors for expression in a transgenic organism, e.g., an animal, that are heterologous (i.e., foreign) in part or in whole to the transgenic animal, or homologous to an endogenous gene of the transgenic animal, but that are designed to be inserted into the animal's genome at a location different from the native gene. A transgene includes one or more promoters and other DNA, such as introns, necessary for expression of a selected nucleic acid sequence, all operably linked to the selected sequence, and may include enhancer sequences.

[0214] A gene "involved in" a disease or disorder includes a gene whose normal or abnormal expression or function results in or causes the disease or disorder or at least one symptom of the disease or disorder.

[0215] As used herein, the term "gain-of-function mutation" refers to any mutation in a gene in which the protein encoded by the gene (i.e., mutant protein) acquires a function not normally associated with that protein (i.e., wild-type protein) that causes or contributes to a disease or disorder. A gain-of-function mutation can be a deletion, addition, or substitution of nucleotides in a gene that alters the function of the encoded protein. In one embodiment, a gain-of-function mutation alters the function of the mutant protein or causes it to interact with other proteins. In another embodiment, a gain-of-function mutation causes, for example, the reduction or elimination of normal wild-type protein through the interaction of the modified mutant protein with the normal wild-type protein.

[0216] As used herein, the term "target gene" refers to a gene whose expression is substantially inhibited or "silenced." This silencing can be achieved by RNA silencing, for example, by cleaving the mRNA of the target gene, or by translational repression of the target gene. A "non-target gene" refers to a gene whose expression is not substantially silenced. In one embodiment, the polynucleotide sequences of the target gene and the non-target gene (e.g., the mRNAs encoded by the target and non-target genes) can differ by one or more nucleotides. In another embodiment, the target gene and the non-target gene can differ by one or more polymorphisms (e.g., single nucleotide polymorphisms or SNPs). In another embodiment, the target gene and the non-target gene can share less than 100% sequence identity. In another embodiment, the non-target gene can be a homolog (e.g., ortholog or paralog) of the target gene.

[0217] A "target allele" is an allele (e.g., an SNP allele) whose expression is selectively inhibited or "silenced." This silencing can be achieved by RNA silencing, for example, by cleaving the mRNA of the target gene or target allele with siRNA. A "non-target allele" is an allele whose expression is not substantially silenced. In certain embodiments, the target allele and the non-target allele can correspond to the same target gene. In other embodiments, the target allele corresponds to or is related to the target gene, and the non-target allele corresponds to or is related to the non-target gene. In one embodiment, the polynucleotide sequences of the target allele and the non-target allele can differ by one or more nucleotides. In another embodiment, the target allele and the non-target allele can differ by one or more allelic polymorphisms (e.g., one or more SNPs). In another embodiment, the target allele and the non-target allele can share less than 100% sequence identity.

[0218] As used herein, the term "polymorphism" refers to the variation in gene sequence (for example, one or more deletions, insertions, or substitutions) that can be identified or detected when comparing the same gene sequence from different sources or subjects (but from the same organism).For example, polymorphism can be identified when comparing the same gene sequence from different subjects.The identification of such polymorphism is routine in the art, and the method is similar to the method used to detect point mutations in breast cancer, for example.Identification can be carried out, for example, by using DNA extracted from control lymphocytes, and then amplifying the polymorphic region with primers specific to the polymorphic region.Alternatively, polymorphism can be identified when comparing two alleles of the same gene.In certain embodiments, polymorphism is single nucleotide polymorphism (SNP).

[0219] As used herein, variation in sequence between two alleles of the same gene within an organism is referred to as an "allelic polymorphism." In certain embodiments, an allelic polymorphism corresponds to a SNP allele. For example, an allelic polymorphism can include a single nucleotide variation between two alleles of a SNP. A polymorphism can be at a nucleotide within a coding region, but due to the degeneracy of the genetic code, no change in amino acid sequence is encoded. Alternatively, a polymorphic sequence can encode a different amino acid at a specific position, but this change in amino acid does not affect the function of the protein. Polymorphic regions can also be found in non-coding regions of genes. In exemplary embodiments, a polymorphism is found in the coding region of a gene or in the untranslated region of a gene (e.g., the 5'UTR or 3'UTR).

[0220] As used herein, the term " allele frequency " refers to the relative frequency measure (for example, proportion or percentage) of an allele (for example, SNP allele) at a single locus in a population.For example, if a population has n loci of a specific chromosomal locus (and the gene that occupies that locus) in each of their somatic cells, the allele frequency of an allele is the proportion or percentage of the loci that this allele occupies in that group.In certain embodiments, the allele frequency of an allele (for example, SNP allele) is at least 10% (for example, at least 15%, 20%, 25%, 30%, 35%, 40% or more) in sample group.

[0221] As used herein, the term "sample population" refers to a population that includes a statistically significant number of individuals.For example, a sample population can include 50, 75, 100, 200, 500, 1000 or more individuals.In certain embodiments, a sample population can include individuals that share at least a common disease phenotype (e.g., a gain-of-function disorder) or mutation (e.g., a gain-of-function mutation).

[0222] As used herein, the term "heterozygosity" refers to the proportion of individuals in a group who are heterozygous (e.g., contain two or more different alleles) at a particular genetic locus (e.g., SNP). Heterozygosity can be calculated for a sample group using methods well known to those skilled in the art.

[0223] As used herein, the term "polyglutamine domain" refers to a protein segment or domain consisting of consecutive glutamine residues linked by peptide bonds. In one embodiment, the consecutive region contains at least 5 glutamine residues.

[0224] As used herein, the term "expanded polyglutamine domain" or "expanded polyglutamine segment" refers to a segment or domain of a protein that contains at least 35 consecutive glutamine residues linked by peptide bonds. Such an expanded segment is found in subjects afflicted with a polyglutamine disorder described herein, regardless of whether the subject exhibits overt symptoms.

[0225] As used herein, the term "trinucleotide repeat" or "trinucleotide repeat region" refers to a segment of a nucleic acid sequence that consists of consecutive repeats of a specific trinucleotide sequence. In one embodiment, the trinucleotide repeat comprises at least 5 consecutive trinucleotide sequences. Exemplary trinucleotide sequences include, but are not limited to, CAG, CGG, GCC, GAA, CTG, and / or CGG.

[0226] As used herein, the term "trinucleotide repeat disease" refers to any disease or disorder characterized by an extended trinucleotide repeat region located within a gene, where the extended trinucleotide repeat region is the cause of the disease or disorder. Examples of trinucleotide repeat diseases include, but are not limited to, spinocerebellar ataxia type 12, spinocerebellar ataxia type 8, fragile X syndrome, fragile XE mental retardation, Friedreich's ataxia, and myotonic dystrophy. Exemplary trinucleotide repeat diseases for treatment by the present invention are characterized by or caused by an extended trinucleotide repeat at the 5' end of the coding region of a gene, where the gene encodes a mutant protein that causes or contributes to the disease or disorder. Certain trinucleotide diseases in which the mutation is not associated with the coding region, such as fragile X syndrome, may not be suitable for treatment by the methodology of the present invention due to the absence of an appropriate mRNA that can be targeted by RNAi. In contrast, diseases such as Friedreich's ataxia are believed to be amenable to treatment by the methodology of the present invention because the causative mutations are not within the coding region (i.e., within an intron), but the mutations may be, for example, within a pre-mRNA (e.g., a pre-spliced ​​pre-mRNA).

[0227] The phrase "considering the function of a gene in a cell or organism" means considering or studying the expression, activity, function or phenotype resulting therefrom.

[0228] As used herein, the term "RNA silencing agent" refers to an RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, an RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include small (<50 b.p.), non-coding RNA molecules, such as RNA duplexes containing paired strands, and precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include siRNA, miRNA, siRNA-like duplexes, antisense oligonucleotides, gapmer molecules, and dual-function oligonucleotides and their precursors. In one embodiment, an RNA silencing agent can induce RNA interference. In another embodiment, an RNA silencing agent can mediate translational repression.

[0229] As used herein, the term "rare nucleotide" refers to a naturally occurring nucleotide that occurs rarely, including naturally occurring deoxyribonucleotides or ribonucleotides that occur rarely, such as guanosine, adenosine, cytosine, or naturally occurring ribonucleotides that are not uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine.

[0230] The term "engineered" in the context of engineered RNA precursors or engineered nucleic acid molecules indicates that the precursor or molecule does not exist in nature and means that all or part of the nucleic acid sequence of the precursor or molecule has been created or selected by humans. Once created or selected, the sequence can be replicated, translated, transcribed, or otherwise manipulated by mechanisms within the cell. Thus, an RNA precursor produced within a cell from a transgene containing an engineered nucleic acid molecule is an engineered RNA precursor.

[0231] As used herein, the term "microRNA" ("miRNA"), also referred to in the art as "small RNA" ("stRNA"), refers to small (10-50 nucleotide) RNAs that are genetically encoded (e.g., by viral, mammalian, or plant genomes) and can direct or mediate RNA silencing. "miRNA disorder" is intended to mean a disease or disorder characterized by aberrant expression or activity of miRNA.

[0232] As used herein, the term "bifunctional oligonucleotide" refers to an RNA silencing agent of the formula TL-μ, where T is the mRNA targeting moiety, L is the linking moiety, and μ is the miRNA recruiting moiety. As used herein, the term "mRNA targeting moiety," "targeting moiety," "mRNA targeting portion," or "mRNA targeting portion" refers to a domain, portion, or region of a bifunctional oligonucleotide that has sufficient size and sufficient complementarity to the portion or region of the mRNA selected or targeted for silencing (i.e., this portion has sufficient sequence to capture the target mRNA). As used herein, the term "linking moiety" or "linking portion" refers to the domain, portion, or region of an RNA silencing agent that covalently binds or binds to the mRNA.

[0233] As used herein, the term "antisense strand" of an RNA silencing agent, e.g., an siRNA or RNA silencing agent, refers to a strand that is substantially complementary to a section of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides, of the mRNA of a gene targeted for silencing. The antisense strand, or first strand, has a sequence sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., a sequence having sufficient complementarity to induce destruction of the desired target mRNA by RNAi machinery or manipulation (RNAi interference) or a sequence having sufficient complementarity to induce translational repression of the desired target mRNA.

[0234] The term "sense strand" or "second strand" of an RNA silencing agent, such as an siRNA or RNA silencing agent, refers to the strand complementary to the antisense strand or first strand. The antisense strand and the sense strand are also referred to as the first strand or second strand, where the first strand or second strand is complementary to the target sequence, and the second strand or first strand is complementary to the first strand or second strand, respectively. The miRNA duplex intermediate or siRNA-like duplex contains an miRNA strand that is sufficiently complementary to a section of about 10 to 50 nucleotides of the mRNA of the gene targeted for silencing, and an miRNA* strand that is sufficiently complementary to form a duplex with the miRNA strand.

[0235] As used herein, the term "guide strand" refers to the strand of an RNA silencing agent, e.g., the antisense strand of an siRNA duplex or siRNA sequence, that enters the RISC complex and directs cleavage of a target mRNA.

[0236] As used herein, the term " asymmetry " in the asymmetry of the duplex region of RNA silencing agent (such as the stem of shRNA) refers to the unequal strength of binding or base pairing between the ends of RNA silencing agent (for example, between the terminal nucleotide of the first strand or stem portion and the terminal nucleotide of the opposite second strand or stem portion), so that the 5' end of one strand of duplex is more frequently in a temporary unpaired state, for example, single-stranded state, than the 5' end of complementary strand.This structural difference determines that one strand of duplex is preferentially incorporated into RISC complex.The strand whose 5' end is not tightly paired with complementary strand is preferentially incorporated into RISC and mediates RNAi.

[0237] As used herein, the term "binding strength" or "base pair strength" refers to the strength of the interaction between a pair of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., an siRNA duplex), which is primarily due to H-bonding, van der Waals interactions, etc. between the nucleotides (or nucleotide analogs).

[0238] As used herein, the "5' end" at the 5' end of the antisense strand refers to the 5'-terminal nucleotide, for example, the region between 1 and about 5 nucleotides from the 5' end of the antisense strand. As used herein, the "3' end" at the 3' end of the sense strand refers to the region complementary to the 5'-terminal nucleotide of the complementary antisense strand, for example, the region between 1 and about 5 nucleotides.

[0239] As used herein, the term "destabilizing nucleotide" refers to a first nucleotide or nucleotide analog that can form a base pair with a second nucleotide or nucleotide analog, and the base pair forms a base pair with a lower binding strength than conventional base pairing (i.e., Watson-Crick base pairing).In certain embodiments, the destabilizing nucleotide can form a mismatched base pair with the second nucleotide.In other embodiments, the destabilizing nucleotide can form a wobble base pair with the second nucleotide.In still other embodiments, the destabilizing nucleotide can form an ambiguous base pair with the second nucleotide.

[0240] As used herein, the term "base pair" refers to an interaction between a pair of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., a duplex formed by a strand of an RNA silencing agent and a target mRNA sequence), primarily due to H-bonding, van der Waals interactions, etc. between the nucleotides (or nucleotide analogs). As used herein, the term "binding strength" or "base pair strength" refers to the strength of a base pair.

[0241] As used herein, the term "mismatch base pair" refers to a non-complementary or non-Watson-Crick base pair, e.g., a base pair that is not a normal complementary G:C, A:T, or A:U base pair. As used herein, the term "ambiguous base pair" (also known as a non-discriminatory base pair) refers to a base pair formed by common nucleotides.

[0242] As used herein, the term "universal nucleotide" (also known as "neutral nucleotide") includes nucleotides (e.g., certain destabilizing nucleotides) that have bases ("universal bases" or "neutral bases") that do not significantly discriminate between bases on complementary polynucleotides when base-pairing. Universal nucleotides are primarily hydrophobic molecules that can efficiently pack into antiparallel duplex nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base portion of a universal nucleotide typically contains a nitrogen-containing aromatic heterocyclic moiety.

[0243] As used herein, the term "sufficient complementarity" or "sufficient degree of complementarity" means that the RNA silencing agent has sufficient sequence (e.g., antisense strand, mRNA targeting portion, or miRNA recruitment portion) to bind to the desired target RNA and induce RNA silencing of the target mRNA, respectively.

[0244] As used herein, the term " translational repression " refers to the selective inhibition of mRNA translation.Natural translational repression is carried out through the miRNA that is cut from shRNA precursor.Both RNAi and translational repression are mediated by RISC.Both RNAi and translational repression are naturally occurring, but can also be initiated by human hands, for example, to silence the expression of target gene.

[0245] Various methodologies of the present invention include comparing a value, level, characteristic, property, etc. to a "suitable control," interchangeably referred to herein as a "suitable control." A "suitable control" or "suitable control" is a control or standard familiar to those of skill in the art that is useful for comparison purposes. In one embodiment, a "suitable control" or "suitable control" is a value, level, characteristic, property, etc. determined prior to performing an RNAi methodology, as described herein. For example, transcription rates, mRNA levels, translation rates, protein levels, biological activity, cellular characteristics or properties, genotype, phenotype, etc., can be determined prior to introducing an RNA silencing agent of the present invention into a cell or organism. In another embodiment, a "suitable control" or "suitable control" is a value, level, characteristic, property, etc. determined in a cell or organism, e.g., a control exhibiting normal traits or a normal cell or organism. In yet another embodiment, a "suitable control" or "suitable control" is a predefined value, level, characteristic, property, etc.

[0246] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0247] Various aspects of the invention are described in further detail in the following subsections. I. Novel Target Sequences

[0248] In certain exemplary embodiments, the RNA silencing agent of the present invention can target the APOE mRNA target listed in Table 1, 2, or 7. In certain exemplary embodiments, the RNA silencing agent of the present invention can target 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3'. In certain exemplary embodiments, the RNA silencing agent of the present invention can target one or more target sequences of 5' GAUUCACCAAGUUUA 3' and 5' CAAGUUUCACGCAA. In certain exemplary embodiments, the RNA silencing agent of the present invention can target 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In certain exemplary embodiments, the RNA silencing agent of the present invention can target the target sequence 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0249] The genomic sequence of each target sequence can be found in the public database maintained, for example, by NCBI. II. siRNA Design

[0250] In some embodiments, siRNAs are designed as follows: First, a portion of a target gene (e.g., the ApoE gene) is selected, e.g., one or more of the target sequences listed in Table 1, Table 2, or Table 7. Cleavage of the mRNA at these positions eliminates translation of the corresponding protein. A sense strand is designed based on the target sequence (see Figure 3A). Preferably, the portion (and the corresponding sense strand) contains approximately 19 to 25 nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides. More preferably, the portion (and the corresponding sense strand) contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs less than 19 nucleotides or more than 25 nucleotides in length can also function to mediate RNAi. Therefore, siRNAs of such lengths are within the scope of the present invention, provided they retain the ability to mediate RNAi. Longer RNAi agents have been demonstrated to induce interferon and PKR responses in certain mammalian cells, which may be undesirable. However, longer RNAi agents may be useful in situations where, for example, cell types are unable to mount a PKR response, or where the PKR response is downregulated or attenuated by alternative means.

[0251] The sequence of sense strand is designed so that target sequence is basically in the center of strand.If target sequence is moved to a position that is not center, in some cases, the efficiency of cleavage by siRNA may decrease.This composition, that is, the composition with low efficiency, may be desirable to use when detecting the off-silencing of wild-type mRNA.

[0252] The antisense strand is usually the same length as the sense strand and contains complementary nucleotides. In one embodiment, the strands are completely complementary, i.e., the strands are blunt-ended when aligned or annealed. In another embodiment, the strands are aligned or annealed such that an overhang of 1, 2, 3, 4, 5, 6, or 7 nucleotides is generated, for example, the 3'-end of the sense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5'-end of the antisense strand, and / or the 3'-end of the antisense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5'-end of the sense strand. The overhang can comprise or consist of nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhang can comprise or consist of deoxyribonucleotides, such as dTs, or nucleotide analogs, or other suitable non-nucleotide materials.

[0253] To facilitate entry of the antisense strand into RISC (and thereby increase or improve the efficiency of target cleavage and silencing), the strength of base pairing between the 5' end of the sense strand and the 3' end of the antisense strand can be altered and moderated or reduced, for example, as described in detail in U.S. Patents 7,459,547, 7,772,203, and 7,732,593 entitled "Methods and Compositions for Controlling Efficacy of RNA Silencing" (filed June 2, 2003), and 8,309,704, 7,750,144, 8,304,530, 8,329,892, and 8,309,705 entitled "Methods and Compositions for Enhancing the Efficacy and Specificity of RNAi" (filed June 2, 2003), the contents of which are incorporated herein by reference. In one embodiment of these aspects of the present invention, the base pair strength is reduced because there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the second or sense strand than there are G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the second or sense strand. In another embodiment, the base pair strength is reduced because there is at least one mismatch base pair between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In certain exemplary embodiments, the mismatch base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the base pair strength is reduced because there is at least one wobble base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In another embodiment, the base pair strength is reduced because at least one base pair contains a rare nucleotide, e.g., inosine (I). In certain exemplary embodiments, the base pairs are selected from the group consisting of I:A, I:U, and I:C. In yet other embodiments, at least one base pair comprises a modified nucleotide, thereby reducing base pair strength.In certain exemplary embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.

[0254] The design of siRNA suitable for targeting the ApoE target sequence shown in Figure 3 is described in detail below. siRNA can be designed according to the above exemplary teachings for any other target sequence found in the ApoE gene. Furthermore, this technology can also be applied to target any other target sequence, for example, non-disease-causing target sequence.

[0255] To verify the efficacy of siRNA in disrupting mRNA (e.g., ApoE mRNA), siRNA can be incubated with cDNA (e.g., ApoE cDNA) in a Drosophila-based in vitro mRNA expression system. 32P-radiolabeled newly synthesized mRNA (e.g., ApoE mRNA) is detected by autoradiography on an agarose gel. The presence of cleaved mRNA indicates mRNA nuclease activity. Suitable controls include omission of the siRNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but lacks significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA, and a homology search can be performed to confirm that the negative control lacks homology to any other genes in the appropriate genome. Furthermore, negative control siRNAs can be designed by introducing one or more base mismatches into the sequence. The siRNA-mRNA complementarity site is selected to provide optimal mRNA specificity and maximal mRNA cleavage. III. RNAi substances

[0256] The present invention includes, for example, the siRNA molecule designed as described above.The siRNA molecule of the present invention can also be chemically synthesized, can be transcribed from DNA template in vitro or from shRNA in vivo, or can be transcribed in vitro by using recombinant human DICER enzyme to cut the dsRNA template into the pool of 20-, 21- or 23-bp double-stranded RNA that mediates RNAi.

[0257] In one aspect, instead of RNAi substance being interfering ribonucleic acid, for example, the above-mentioned siRNA or shRNA, RNAi substance can be as described above, encoding interfering ribonucleic acid, for example, the above-mentioned shRNA.In other words, RNAi substance can be the transcription template of interfering ribonucleic acid.Therefore, the RNAi substance of the present invention can also comprise small hairpin RNA (shRNA) and the expression construct that is manipulated to express shRNA.It is believed that the transcription of shRNA starts from polymerase III (pol III) promoter and terminates at the 2nd position of 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into stem-loop structures with 3'UU-overhangs, and then the ends of these shRNAs are processed to convert them into siRNA-like molecules of approximately 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002, supra; Miyagishi et al., 2002; Paddison et al., 2002, supra; Paul et al., 2002, supra; Sui et al., 2002 supra; Yu et al., 2002, supra. Details regarding the design and use of shRNAs can be found on the Internet at the following addresses: katandin.cshl.org:9331 / RNAi / docs / BseRI-BamHI_Strategy.pdf and katandin.cshl.org:9331 / RNAi / docs / Web_version_of_PCR_Strategy1.pdf).

[0258] Expression constructs of the present invention include any construct suitable for use in an appropriate expression system, including, but not limited to, retroviral vectors, linear expression cassettes, plasmids, and viral or virus-derived vectors known in the art. Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems, such as the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. Constructs can contain one or both strands of an siRNA. Expression constructs expressing both strands can also include a loop structure connecting the strands, or each strand can be transcribed separately from a separate promoter within the same construct. Alternatively, each strand can be transcribed from a separate expression construct (Tuschl, T., 2002, Supra).

[0259] Synthetic siRNAs can be delivered into cells using methods known in the art, including cationic liposome transfection and electroporation. To achieve longer-term suppression of a target gene (e.g., the ApoE gene) or to facilitate delivery under certain circumstances, one or more siRNAs can be expressed intracellularly from a recombinant DNA construct. Methods for expressing siRNA duplexes intracellularly from recombinant DNA constructs, enabling longer-term suppression of a target gene in cells, include mammalian Pol III promoter systems capable of expressing functional double-stranded siRNAs (e.g., the H1 or U6 / snRNA promoter systems (Tuschl, T. 2002, supra); (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra). RNA Pol III promoter systems are known in the art, including the H1 or U6 / snRNA promoter systems (Tuschl, T. 2002, supra). Transcription termination by III occurs at a run of four consecutive T residues in the DNA template, providing a mechanism for terminating siRNA transcripts at specific sequences. siRNAs are complementary to the target gene sequence in a 5'-3' or 3'-5' orientation, and the two strands of the siRNA can be expressed in the same or separate constructs. Hairpin siRNAs expressed intracellularly and driven by the H1 or U6 snRNA promoter can inhibit target gene expression ((Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra).Additionally, constructs containing siRNA sequences under the control of a T7 promoter can produce functional siRNAs when cotransfected into cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra). A single construct can contain multiple sequences encoding siRNAs targeting the same gene or multiple genes, e.g., multiple regions of the gene encoding ApoE, and can be driven by separate Pol III promoter sites.

[0260] Animal cells express a series of approximately 22-nucleotide non-coding RNAs called microRNAs (miRNAs), which can regulate gene expression at the post-transcriptional or post-translational level during animal development. A common feature of miRNAs is that they are all excised from the stem-loop of a ~70-nucleotide precursor RNA, presumably by the RNase III enzyme Dicer or its homologs. By replacing the stem sequence of the miRNA precursor with a sequence complementary to the target mRNA, vector constructs expressing the engineered precursor can be used to produce siRNAs that initiate RNAi against specific mRNA targets in mammalian cells (Zeng et al., 2002, supra). When expressed in a DNA vector containing a polymerase III promoter, microRNA-designed hairpins can silence gene expression (McManus et al., 2002, supra). MicroRNAs targeting polymorphisms are also useful for blocking translation of mutant proteins in the absence of siRNA-mediated gene silencing. Such applications are useful, for example, in situations where the designed siRNA causes off-target silencing of a wild-type protein.

[0261] Viral delivery mechanisms can also be used to induce specific silencing of target genes through siRNA expression, for example, by generating recombinant adenoviruses carrying siRNA under the transcriptional control of an RNA Pol II promoter (Xia et al., 2002, supra). Infecting HeLa cells with these recombinant adenoviruses can reduce endogenous target gene expression. Injecting recombinant adenoviral vectors into transgenic mice expressing the siRNA target gene results in in vivo reduction of target gene expression. In animal models, whole embryo electroporation can efficiently deliver synthetic siRNA to postimplantation mouse embryos (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by rapid injection (within 5 seconds) of a large volume of siRNA-containing solution into the animal via the tail vein, a "high-pressure" delivery technique (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Nanoparticles and liposomes can also be used to deliver siRNA to animals. In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and related vectors can be used to deliver one or more siRNA to cells, such as neuronal cells (e.g., brain cells) (U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766).

[0262] The nucleic acid compositions of the present invention include both unmodified siRNAs and modified siRNAs as known in the art, such as crosslinked siRNA derivatives or derivatives having a non-nucleotide moiety attached to their 3' or 5' ends, etc. Modifying the siRNA derivatives in this manner can improve the cellular uptake of the resulting siRNA derivative compared to the corresponding siRNA, improve the cellular targeting activity of the resulting siRNA derivative, make it useful for tracking the siRNA derivative within cells, or improve the stability of the siRNA derivative compared to the corresponding siRNA.

[0263] As described herein, engineered RNA precursors introduced into cells or whole organisms lead to the production of desired siRNA molecules. Such siRNA molecules bind to endogenous protein components of the RNAi pathway to bind to and target specific mRNA sequences for cleavage and destruction. This results in the depletion of mRNA targeted by the siRNA generated from the engineered RNA precursor from the cell or organism, thereby reducing the concentration of the protein encoded by that mRNA in the cell or organism. The RNA precursor is typically a nucleic acid molecule that encodes either strand of a dsRNA alone or the entire nucleotide sequence of an RNA hairpin loop structure.

[0264] The nucleic acid compositions of the invention can be unconjugated or conjugated to another moiety, such as a nanoparticle, to improve the properties of the composition, e.g., pharmacokinetic parameters such as absorption, efficacy, bioavailability and / or half-life. This conjugation can be achieved by methods known in the art, for example, using methods from Lambert et al., Drug Deliv. Rev. 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkylcyanoacrylate (PACA) nanoparticles); Liptal et al., J. Control Release 53(1-3):137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids bound to intercalating agents, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids bound to nanoparticles).

[0265] The nucleic acid molecules of the present invention can also be labeled using any method known in the art. For example, the nucleic acid compositions can be labeled with a fluorophore, such as Cy3, fluorescein, or rhodamine. Labeling can be accomplished using kits such as SILENCER TM This can be done using an siRNA labeling kit (Ambion). Furthermore, siRNA can be labeled using, for example, 3 H, 32 It can be radiolabeled with P or other suitable isotopes.

[0266] Furthermore, because RNAi is believed to proceed through at least one single-stranded RNA intermediate, those skilled in the art will understand that ss-siRNAs (e.g., the antisense strand of ds-siRNAs) can also be designed (e.g., for chemical synthesis), produced (e.g., enzymatically produced), or expressed (e.g., from a vector or plasmid) as described herein and utilized in accordance with the claimed methodologies. Furthermore, in invertebrates, RNAi can be effectively induced by long dsRNAs (e.g., dsRNAs of about 100-1000 nucleotides in length, preferably about 200-500 nucleotides in length, e.g., about 250, 300, 350, 400, or 450 nucleotides in length) that act as effectors of RNAi (Brondani et al., Proc Natl Acad Sci USA. 2001 Dec. 4; 98(25):14428-33. Epub 2001 Nov. 27.). IV. Anti-ApoE RNA Silencing Agents

[0267] In one embodiment, the present invention provides novel anti-ApoE RNA silencing agents (e.g., siRNA and shRNA), methods for producing the RNA silencing agents, and methods (e.g., research and / or therapeutic methods) for using the improved RNA silencing agents (or portions thereof) for RNA silencing of ApoE protein. The RNA silencing agents include antisense strands (or portions thereof) that are sufficiently complementary to heterozygous single nucleotide polymorphisms to mediate RNA-mediated silencing mechanisms (e.g., RNAi).

[0268] In certain embodiments, siRNA compounds are provided that have one or any combination of the following characteristics: (1) are fully chemically stabilized (i.e., have no unmodified 2'-OH residues); (2) are asymmetric; (3) have a duplex of 11-16 base pairs; (4) have an alternating pattern of chemically modified nucleotides (e.g., 2'-fluoro and 2'-methoxy modifications), although consecutive 2'-fluoro and consecutive 2'-methoxy modifications are also contemplated; and (5) have a single-stranded, fully phosphorothioated tail of 5-8 bases. The number of phosphorothioate modifications varies from 6 to 17 in total in different embodiments.

[0269] In certain embodiments, the siRNA compounds described herein can be conjugated to a variety of targeting substances, including, but not limited to, cholesterol, DHA, phenyltropane, cortisol, vitamin A, vitamin D, GalNac, and gangliosides. The cholesterol-modified versions have demonstrated 5-10-fold improved in vitro efficacy in a wide variety of cell types (e.g., HeLa, neurons, hepatocytes, and trophoblasts) compared to previously used chemical stabilization patterns (e.g., all purines modified but not pyrimidines).

[0270] Certain compounds of the present invention having the structural properties described above and herein are sometimes referred to as "hsiRNA-ASP" (characterized by hydrophobic modifications, small interfering RNA, and highly stabilized patterns). Furthermore, this hsiRNA-ASP pattern exhibits significantly improved distribution, such as delivery through the brain and spinal cord to the liver, placenta, kidney, spleen, and several other tissues, making it available for therapeutic intervention.

[0271] In the liver, hsiRNA-ASP is delivered to endothelial cells and Kupffer cells but not hepatocytes, making this chemical modification pattern complementary rather than competing techniques to GalNac conjugates.

[0272] The compounds of the present invention can be illustrated by the following aspects and embodiments.

[0273] In a first aspect, provided herein is an oligonucleotide of at least 16 consecutive nucleotides having a 5' end, a 3' end, and complementarity to a target, wherein: (1) the oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) nucleotides at positions 1-6 from the 3' end, or 1-7 from the 3' end, are linked to adjacent nucleotides via phosphorothioate linkages.

[0274] In a second aspect, provided herein is a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is an oligonucleotide described herein (e.g., comprising one of the target sequences of Figure 3A); (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate linkages.

[0275] In a third aspect, provided herein is a compound having the structure: XA(-LBLA)j(-SBSA)r(-SB)t-OR wherein X is a 5' phosphate group; A is, independently for each occurrence, a 2'-methoxy-ribonucleotide; B is, independently for each occurrence, a 2'-fluoro-ribonucleotide; L is, independently for each occurrence, a phosphodiester or phosphorothioate linker; S is a phosphorothioate linker; and R is selected from hydrogen and a capping group (e.g., acyl such as acetyl); j is 4, 5, 6, or 7; r is 2 or 3; and t is 0 or 1.

[0276] In a fourth aspect, provided herein is a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is selected from the oligonucleotides of the third aspect; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) the second oligonucleotide has the structure: CLB(-SASB)m'(-PAPB)n'(-PASB)q'(-SA)r'(-SB)t'-OR wherein C is a hydrophobic molecule; A is, independently at each occurrence, a 2'-methoxy-ribonucleotide; B is, independently at each occurrence, a 2'-fluoro-ribonucleotide; L is a linker comprising one or more moieties selected from the group consisting of 0 to 4 repeating units of ethylene glycol, phosphodiester, and phosphorothioate; S is a phosphorothioate linker; P is a phosphodiester linker; R is selected from hydrogen and a capping group (e.g., acyl such as acetyl); m' is 0 or 1; n' is 4, 5, or 6; q' is 0 or 1; r' is 0 or 1; and t' is 0 or 1. a) Design of anti-ApoE siRNA molecules

[0277] The siRNA molecules of the present invention are duplexes comprising a sense strand and a complementary antisense strand, where the antisense strand is sufficiently complementary to ApoE mRNA to mediate RNAi. Preferably, the siRNA molecules are about 10-50 or more nucleotides long, i.e., each strand contains 10-50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecules are about 15-30, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long in each strand, where one of the strands is sufficiently complementary to the target region. Preferably, the strands are aligned such that there are at least 1, 2, or 3 bases at the end of the strand that is not aligned (i.e., no complementary bases are present in the opposing strand), resulting in an overhang of 1, 2, or 3 residues at one or both ends of the duplex when the strands are annealed. Preferably, the siRNA molecule has a length of about 10 to 50 or more nucleotides, i.e., each strand contains 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecule has a length of about 15 to 30, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, nucleotides in each strand, wherein one strand is substantially complementary to the target sequence and the other strand is identical or substantially identical to the first strand.

[0278] Generally, siRNAs can be designed using any method known in the art, for example, using the following protocol.

[0279] 1. The siRNA should be specific for a target sequence, such as the target sequence shown in Figure 3A. In one embodiment, the target sequence is found in a wild-type ApoE allele. In another embodiment, the target sequence is found in both a mutant ApoE allele and a wild-type ApoE allele. In another embodiment, the target sequence is found in a wild-type ApoE allele. The first strand should be complementary to the target sequence, and the other strand should be substantially complementary to the first strand. (See Figure 3 for exemplary sense and antisense strands.) Exemplary target sequences are selected from the 5'-untranslated region (5'-UTR) of the target gene. Cleavage of the mRNA at these sites should eliminate translation of the corresponding ApoE protein. Target sequences from other regions of the ApoE gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with a low G / C content (35-55%) may be more active than those with a G / C content higher than 55%. Thus, in one embodiment, the present invention includes nucleic acid molecules having a G / C content of 35-55%.

[0280] 2. The sense strand of the siRNA is designed based on the sequence of the selected target site. Preferably, the sense strand contains approximately 19 to 25 nucleotides, for example, 19, 20, 21, 22, 23, 24, or 25 nucleotides. More preferably, the sense strand contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs less than 19 nucleotides or more than 25 nucleotides in length can also function to mediate RNAi. Therefore, siRNAs of such lengths are within the scope of the present invention, provided they retain the ability to mediate RNAi. Longer RNA silencing agents have been shown to induce interferon or protein kinase R (PKR) responses in certain mammalian cells, which may be undesirable. Preferably, the RNA silencing agents of the present invention do not induce a PKR response (i.e., are sufficiently short in length). However, longer RNA silencing agents may be useful, for example, in cell types that cannot generate a PKR response or in situations where the PKR response is downregulated or attenuated by alternative means.

[0281] The siRNA molecule of the present invention has sufficient complementarity with the target sequence so that the siRNA can mediate RNAi. Generally, it is preferred that the siRNA comprises a nucleotide sequence that is sufficiently identical to the target sequence portion of the target gene, so as to cause RISC-mediated cleavage of the target gene. Therefore, in a preferred embodiment, the sense strand of the siRNA is designed to have a sequence that is sufficiently identical to a portion of the target. For example, the sense strand may be 100% identical to the target site. However, 100% identity is not essential. It is preferred that the sense strand and the target RNA sequence have more than 80% identity, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% identity. The present invention has the advantage that it can tolerate certain sequence variations to improve the efficiency and specificity of RNAi. In one embodiment, sense strand has 4, 3, 2, 1 or 0 mismatched nucleotides with target region, such as target region that has at least one base pair difference between wild-type allele and mutant allele, for example, target region that contains gain-of-function mutation, and the other strand is identical or substantially identical with first strand.In addition, the siRNA sequence that has small insertion or deletion of 1 or 2 nucleotides can also be effective for mediating RNAi.Alternatively, the siRNA sequence that has substitution or insertion of nucleotide analogue can also be effective for inhibition.Alternatively, the siRNA sequence that has substitution or insertion of nucleotide analogue can also be effective for inhibition.

[0282] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison (e.g., gaps can be introduced into the first or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions x 100), optionally penalizing the score for the number of gaps introduced and / or the length of the gaps introduced.

[0283] Sequence comparison and determination of percent identity between two sequences can be performed using a mathematical algorithm. In one embodiment, alignments are generated over specific portions of the aligned sequences that have sufficient identity, but not over portions with a lower degree of identity (i.e., local alignments). A preferred, non-limiting example of a local alignment algorithm utilized for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0284] In another embodiment, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the length of the aligned sequences (i.e., gapped alignment). To obtain a gapped alignment for comparison purposes, Gapped BLAST can be used, as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the entire length of the aligned sequences (i.e., global alignment). A preferred, non-limiting example of a numerical algorithm used for global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0285] 3. The antisense or guide strand of an siRNA is always the same length as the sense strand and contains complementary nucleotides. In one embodiment, the guide strand and the sense strand are completely complementary, i.e., the strands are blunt-ended when aligned or annealed. In another embodiment, the strands of an siRNA can be paired in such a way as to have a 3' overhang of 1 to 7 (e.g., 2, 3, 4, 5, 6, or 7) or 1 to 4, e.g., 2, 3, or 4, nucleotides. The overhang can comprise (or consist of) nucleotides corresponding to the target gene sequence (or its complement). The overhang can comprise (or consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhang can comprise (or consist of) deoxyribonucleotides, such as dT, or nucleotide analogs, or other suitable non-nucleotide materials. Thus, in another embodiment, the nucleic acid molecule can have a 2-nucleotide 3' overhang, such as TT. The overhanging nucleotides can be either RNA or DNA. As noted above, it is preferred to select a target region in which the mutant:wild-type mismatch is a purine:purine mismatch.

[0286] 4. Compare potential targets to the appropriate genome database (human, mouse, rat, etc.) using any method known in the art, and eliminate from consideration target sequences with significant homology to other coding sequences. One such method for sequence homology searching is known as BLAST, and is available on the website of the National Center for Biotechnology Information.

[0287] 5. Selection of one or more sequences that meet the evaluation criteria

[0288] Further general information regarding the design and use of siRNAs can be found in "The siRNA User Guide," available on the website of The Max-Plank-Institut für Biophysikalische Chemie.

[0289] Alternatively, siRNA may be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing to a target sequence (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, hybridization at 50°C or 70°C for 12-16 hours; followed by washing). Further preferred hybridization conditions include hybridization at 70°C in 1xSSC or 50°C in 1xSSC, 50% formamide, followed by washing at 70°C in 0.3xSSC, or hybridization at 70°C in 4xSSC or 50°C in 4xSSC, 50% formamide, followed by washing at 67°C in 1xSSC. The hybridization temperature for hybrids expected to be less than 50 base pairs in length should be 5-10°C lower than the melting temperature (Tm) of the hybrid, where T m is determined according to the following formula: For hybrids of less than 18 base pairs, T m ( o C) = 2(# of A+T bases) + 4(# of G+C bases). For hybrids 18-49 base pairs long, T m ( o[C] = 81.5 + 16.6(log 10[Na+]) + 0.41(% G+C) - (600 / N), where N is the number of bases in the hybrid, and [Na+] is the sodium ion concentration in the hybridization buffer ([Na+] for 1x SSC is 0.165M). Additional examples of stringency conditions for polynucleotide hybridization are described in Chapters 9 and 11 of Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Sections 2.10 and 6.3-6.4 of Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., which are incorporated herein by reference.

[0290] Negative control siRNA should have the same nucleotide composition as selected siRNA, but does not have significant sequence complementarity with appropriate genome.Such negative control can be designed by randomly scrambling the nucleotide sequence of selected siRNA.Homology search can be carried out to confirm that negative control lacks homology with any other gene of appropriate genome.Also, negative control siRNA can be designed by introducing 11 or more base mismatches into sequence.

[0291] 6. To verify the effectiveness of siRNA in disrupting target mRNA (e.g., wild-type or mutant ApoE mRNA), siRNA may be incubated with target cDNA (e.g., ApoE cDNA) in a Drosophila-based in vitro mRNA expression system. 32P-radiolabeled newly synthesized mRNA (e.g., ApoE mRNA) is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Suitable controls include omitting the siRNA and using a non-targeting cDNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but lacks significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. Homology searches can be performed to confirm that the negative control lacks homology to any other genes in the appropriate genome. Additionally, negative control siRNAs can be designed by introducing one or more base mismatches into the sequence.

[0292] Anti-ApoE siRNA can be designed to target any of the above-mentioned target sequences.The siRNA comprises the antisense strand that is sufficiently complementary to the target sequence and mediates the silencing of the target sequence.In certain embodiments, the RNA silencing agent is siRNA.

[0293] In certain embodiments, the siRNA comprises a sense strand comprising the sequence shown in Figure 3A, and an antisense strand comprising the sequence shown in Figure 3A.

[0294] The complementary sites of the siRNA-mRNA are selected to provide optimal mRNA specificity and maximal mRNA cleavage. b) siRNA-like molecules

[0295] The siRNA-like molecules of the present invention have a sequence that is "sufficiently complementary" to the target sequence of ApoE mRNA (i.e., have a strand with a sequence), and direct gene silencing by either RNAi or translational repression. siRNA-like molecules are designed in the same way as siRNA molecules, but the degree of sequence identity between the sense strand and the target RNA is similar to that observed between miRNA and its target. Generally, as the degree of sequence identity between miRNA sequence and the corresponding target gene sequence decreases, the tendency to mediate post-transcriptional gene silencing by translational repression rather than RNAi increases. Therefore, in an alternative embodiment where post-transcriptional gene silencing by translational repression of target gene is desired, the miRNA sequence has partial complementarity with the sequence of target gene. In certain embodiments, the miRNA sequence has partial complementarity with one or more short sequences (complementary sites) dispersed within the target mRNA (e.g., within the 3'-UTR of the target mRNA) (Hutvagner and Zamore, Science, 2002; Zeng et al., Mol. Cell, 2002; Zeng et al., RNA, 2003; Doench et al., Genes & Dev., 2003). Because the mechanism of translational repression is cooperative, in certain embodiments, multiple complementary sites (e.g., 2, 3, 4, 5, or 6) can be targeted.

[0296] The ability of an siRNA-like duplex to mediate RNAi or translational repression can be predicted by the distribution of non-identical nucleotides between the target gene sequence and the silencing agent nucleotide sequence at the complementary site. In one embodiment where gene silencing by translational repression is desired, at least one non-identical nucleotide is present in the central portion of the complementary site, thereby causing the duplex formed by the miRNA guide strand and the target mRNA to contain a central "bulge" (Doench JG et al., Genes & Dev., 2003). In another embodiment, 2, 3, 4, 5, or 6 consecutive or non-consecutive non-identical nucleotides are introduced. The non-identical nucleotides can be selected to form wobble base pairs (e.g., G:U) or mismatch base pairs (G:A, C:A, C:U, G:G, A:A, C:C, U:U). In a further preferred embodiment, the "bulge" is centered at nucleotides 12 and 13 from the 5' end of the miRNA molecule. c) short hairpin RNA (shRNA) molecules

[0297] In a particular characteristic embodiment, the present invention provides shRNA that can mediate the RNA silencing of ApoE target sequence with improved selectivity.Compared to siRNA, shRNA mimics the natural precursor of microRNA (miRNA) and enters the top of gene silencing pathway.Therefore, shRNA is believed to mediate gene silencing more efficiently by being delivered through the entire natural gene silencing pathway.

[0298] miRNAs are approximately 22-nucleotide non-coding RNAs that can regulate gene expression at the post-transcriptional or translational level during plant and animal development. One common feature of miRNAs is that they are all excised from a precursor RNA stem-loop of approximately 70 nucleotides, called pre-miRNA, presumably by the RNase III enzyme Dicer or its homologs. Naturally occurring miRNA precursors (pre-miRNAs) generally have a single strand that forms a double-stranded stem containing two complementary portions, and a loop connecting the two portions of the stem. In a typical pre-miRNA, the stem contains one or more bulges, e.g., extra nucleotides that create a single-nucleotide "loop" in one portion of the stem, and / or one or more unpaired nucleotides that create a gap in the hybridization of the two portions of the stem to each other. The short hairpin RNAs or engineered RNA precursors of the present invention are artificial constructs based on these naturally occurring pre-miRNAs, but are engineered to deliver a desired RNA silencing agent (e.g., an siRNA of the present invention). By replacing the stem sequence of the pre-miRNA with a sequence complementary to the target mRNA, shRNAs are formed, which are processed throughout the cellular gene-silencing pathway and thus efficiently mediate RNAi.

[0299] The necessary elements of an shRNA molecule include a first and a second portion, which are sufficiently complementary to anneal or hybridize to form a duplex or double-stranded stem portion. The two portions do not need to be completely or perfectly complementary. The first and second "stem" portions are connected by a portion whose sequence does not share sufficient sequence complementarity to anneal or hybridize to other portions of the shRNA. This latter portion is referred to as the "loop" portion of the shRNA molecule. The shRNA molecule is then processed to produce siRNA. The shRNA may also contain one or more bulges, i.e., extra nucleotides, e.g., one, two, or three nucleotide loops, that create a small nucleotide "loop" in a portion of the stem. The stem portions may be the same length, or one portion may contain an overhang of, e.g., one to five nucleotides. The overhanging nucleotides may include, for example, uracil (U), e.g., all Us. Such Us are particularly encoded by thymidine (T) in the DNA encoding the shRNA, which indicates the termination of transcription.

[0300] In the shRNA (or engineered precursor RNA) of the present invention, a portion of the double-stranded stem is a nucleic acid sequence complementary (or antisense) to the ApoE target sequence. Preferably, one strand of the stem portion of the shRNA is sufficiently complementary (e.g., antisense) to the sequence of the target RNA (e.g., mRNA) to mediate degradation or cleavage of the target RNA via RNA interference (RNAi). Thus, the engineered RNA precursor comprises a double-stranded stem having two portions and a loop connecting the two stem portions. The antisense portion may be located at the 5' or 3' end of the stem. The stem portion of the shRNA is preferably about 15 to about 50 nucleotides in length. Preferably, the two stem portions are about 18 or 19 to about 21, 22, 23, 24, 25, 30, 35, 37, 38, 39, or 40 or more nucleotides in length. In a preferred embodiment, the length of the stem portion should be 21 nucleotides or longer. When used in mammalian cells, the length of the stem portion should be less than about 30 nucleotides to avoid eliciting nonspecific responses such as the interferon pathway. In fact, the stem can include a much larger section complementary to the target mRNA (up to and including the entire mRNA). In fact, the stem can include a much larger section complementary to the target mRNA (up to and including the entire mRNA).

[0301] The two parts of the double-stranded stem should be sufficiently complementary to hybridize and form a double-stranded stem. Thus, the two parts can be, but are not necessarily, completely or perfectly complementary. Furthermore, the two stem parts can have the same length, and one part can include an overhang of 1, 2, 3, or 4 nucleotides. The overhanging nucleotides can include, for example, uracil (U), for example, all U. The loop of shRNA or engineered RNA precursor differs from the natural pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Thus, the loop in shRNA or engineered RNA precursor can be 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotides, for example, 15, 20, or more nucleotides in length.

[0302] The loop of shRNA or engineered RNA precursor differs from the natural pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence.Therefore, the loop in shRNA or engineered RNA precursor can be 2, 3, 4, 5, 6, 7, 8, 9 or more nucleotides in length, for example, 15 or 20 or more nucleotides in length.Preferred loops consist of or include a "tetraloop" sequence.Exemplary tetraloop sequences include, but are not limited to, the sequence GNRA [where N is any nucleotide and R is a purine nucleotide], GGGG, and UUU.

[0303] In certain embodiments, the shRNAs of the present invention comprise the sequence of the desired siRNA molecule described above. In other embodiments, the sequence of the antisense portion of the shRNA can be designed essentially as described above, or generally by selecting a sequence of 18, 19, 20, 21, or more nucleotides from within the target RNA (e.g., ApoE mRNA), for example, from a region of 100 to 200 or 300 nucleotides upstream or downstream of the translation initiation. Generally, the sequence can be selected from any portion of the target RNA (e.g., mRNA), including the 5' UTR (untranslated region), coding sequence, or 3' UTR. This sequence can optionally immediately follow a region of the target gene containing two adjacent AA nucleotides. The last two nucleotides of the nucleotide sequence can be selected to be UU. This 21 or so nucleotide sequence is used to construct a portion of the double-stranded stem of the shRNA. This sequence can, for example, enzymatically replace the stem portion of the wild-type pre-miRNA sequence, or it can be included in the complete sequence to be synthesized. For example, DNA oligonucleotides encoding the entire stem-loop engineered RNA precursor, or only the portion to be inserted into the double stem of the precursor, can be synthesized and restriction enzymes used to assemble the engineered RNA precursor construct, e.g., from the wild-type pre-miRNA.

[0304] The engineered RNA precursor contains, in its duplex stem, approximately 21-22 nucleotides of the desired siRNA or siRNA-like duplex to be generated in vivo. Thus, the stem portion of the engineered RNA precursor contains at least 18 or 19 nucleotide pairs corresponding to the sequence of an exon of the gene whose expression is to be reduced or inhibited. The two 3' nucleotides flanking this region of the stem are selected to maximize siRNA production from the engineered RNA precursor and maximize the efficacy of the resulting siRNA in targeting the corresponding mRNA for translational repression or disruption by RNAi in vivo and in vitro.

[0305] In certain embodiments, the shRNA of the present invention comprises miRNA sequence, or optionally end-modified miRNA sequence, to enhance entry into RISC.MiRNA sequence can be similar or identical to any naturally occurring miRNA (see, for example, The miRNA Registry; Griffiths-Jones S, Nuc. Acids Res., 2004).To date, more than 1,000 kinds of naturally occurring miRNA have been identified, and it is believed that they together comprise about 1% of all predicted genes in the genome. Many natural miRNAs are clustered in the introns of pre-mRNAs and can be identified in silico using homology-based searches (Pasquinelli et al., 2000; Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001) or computer algorithms (e.g., MiRScan, MiRSeeker) that predict the ability of candidate miRNA genes to form stem-loop structures in pre-mRNAs (Grad et al., Mol. Cell., 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003; Lai EC et al., Genome Bio., 2003). Online registries provide searchable databases of all publicly available miRNA sequences (The miRNA Registry at the Sanger Institute website; Griffiths-Jones S, Nuc. Acids Res., 2004).Exemplary naturally occurring miRNAs include lin-4, let-7, miR-10, miR-15, miR-16, miR-168, miR-175, miR-196 and their homologs, as well as other naturally occurring miRNAs from humans and certain model organisms, including Drosophila melanogaster, Caenorhabditis elegans, zebrafish, Arabidopsis thalania, Mus musculus, and Rattus norvegicus, as described in International PCT Publication No. WO 03 / 029459.

[0306] Naturally occurring miRNAs are expressed by endogenous genes in vivo and processed by Dicer or other RNAses from hairpin or stem-loop precursors (pre-miRNA or pri-miRNA) (Lagos-Quintana et al., Science, 2001; Lau et al., Science, 2001; Lee and Ambros, Science, 2001; Lagos-Quintana et al., Curr. Biol., 2002; Mourelatos et al., Genes Dev., 2002; Reinhart et al., Science, 2002; Ambros et al., Curr. Biol., 2003; Brennecke et al., 2003; Lagos-Quintana et al., RNA, 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003). In vivo, miRNAs exist temporarily as double-stranded duplexes, but only one strand is incorporated into the RISC complex, directing gene silencing. Certain miRNAs, for example, plant miRNAs, have perfect or near-perfect complementarity with their target mRNAs, and therefore directly cleave the target mRNAs. Other miRNAs are not perfectly complementary to the target mRNAs, and therefore directly suppress the translation of the target mRNAs. The degree of complementarity between a miRNA and its target mRNA is thought to determine its mechanism of action. For example, perfect or near-perfect complementarity between a miRNA and its target mRNA predicts a cleavage mechanism (Yekta et al., Science, 2004), while less than perfect complementarity predicts a translation repression mechanism. In certain embodiments, the miRNA sequence is a naturally occurring miRNA sequence, and its abnormal expression or activity is correlated with a miRNA disorder. d) Dual-functional oligonucleotide tethers

[0307] In other embodiments, the RNA silencing agents of the present invention comprise bifunctional oligonucleotide tethers useful for the intracellular mobilization of miRNAs. Animal cells express a series of miRNAs, non-coding RNAs of approximately 22 nucleotides that can regulate gene expression at the post-transcriptional or translational level. By binding miRNAs bound to RISC and recruiting them to target mRNAs, bifunctional oligonucleotide tethers can suppress the expression of genes involved in the atherosclerotic process, for example. The use of oligonucleotide tethers offers several advantages over existing techniques for suppressing the expression of specific genes. First, the methods described herein enable endogenous (often abundant) miRNAs to mediate RNA silencing. Thus, the methods described herein eliminate the need to introduce exogenous molecules (e.g., siRNA) to mediate RNA silencing. Second, the RNA silencing agents, and in particular the binding moieties (e.g., oligonucleotides such as 2'-O-methyl oligonucleotides), can be made stable and resistant to nuclease activity. As a result, the tethers of the present invention can be designed for direct delivery, eliminating the need to indirectly deliver precursor molecules or plasmids designed to produce the desired agent within cells. Third, the tether and its respective segments can be designed to fit specific mRNA sites and specific miRNAs. This allows for cell-specific and gene-product-specific targeting. Fourth, the methods disclosed herein leave the mRNA intact, allowing practitioners to block protein synthesis with short pulses using the cell's own machinery. As a result, these RNA silencing methods are highly tunable.

[0308] The bifunctional oligonucleotide tethers ("tethers") of the invention are designed to recruit miRNAs (e.g., endogenous cellular miRNAs) to target mRNAs to induce regulation of a gene of interest. In preferred embodiments, the tether has the formula TL-μ, where T is an mRNA targeting moiety, L is a binding moiety, and μ is an miRNA recruitment moiety. Any one or more moieties may be double-stranded. Preferably, however, each moiety is single-stranded.

[0309] The moieties within the tether can be arranged or joined (5' to 3' direction) as shown in the formula TL-μ (i.e., the 3' end of the targeting moiety is joined to the 5' end of the binding moiety, which is joined to the 5' end of the miRNA recruitment moiety). Alternatively, the moieties can be arranged or joined within the tether as follows: μ-TL (i.e., the 3' end of the miRNA recruitment moiety is joined to the 5' end of the binding moiety, which is joined to the 5' end of the targeting moiety).

[0310] The above-described mRNA targeting moiety is capable of capturing a specific target mRNA. According to the present invention, expression of the target mRNA is undesired, thereby inhibiting translation of the mRNA. The mRNA targeting moiety should be large enough to effectively bind to the target mRNA. The length of the targeting moiety will vary widely, depending in part on the length of the target mRNA and the degree of complementarity between the target mRNA and the targeting moiety. In various embodiments, the targeting moiety is less than about 200, 100, 50, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides in length. In certain embodiments, the targeting moiety is about 15 to about 25 nucleotides in length.

[0311] The above-mentioned miRNA recruitment site can associate with miRNA. According to the present invention, the miRNA can be any miRNA that can suppress target mRNA. It has been reported that there are more than 250 endogenous miRNAs in mammals (Lagos-Quintana et al. (2002) Current Biol. 12:735-739; Lagos-Quintana et al. (2001) Science 294:858-862; and Lim et al. (2003) Science 299:1540). In various embodiments, the miRNA can be any miRNA recognized in the art.

[0312] The binding moiety is any agent capable of binding to a targeting moiety such that the activity of the targeting moiety is maintained. The binding moiety is preferably an oligonucleotide moiety consisting of a sufficient number of nucleotides to allow the targeting agent to fully interact with its respective target. The binding moiety is preferably an oligonucleotide moiety containing a sufficient number of nucleotides to allow the targeting agent to fully interact with its respective target. The binding moiety has little or no sequence homology with mRNA or miRNA sequences in cells. Exemplary binding moieties include one or more 2'-O-methyl nucleotides, such as 2'-β-methyl adenosine, 2'-O-methyl thymidine, 2'-O-methyl guanosine, or 2'-O-methyl uridine. e) Gene Silencing Oligonucleotides

[0313] In certain exemplary embodiments, gene expression (i.e., ApoE gene expression) can be regulated using an oligonucleotide-based compound comprising two or more single-stranded antisense oligonucleotides linked via their 5' ends, allowing for the presence of two or more accessible 3' ends, effectively inhibiting or reducing the expression of the ApoE gene. Such linked oligonucleotides are also known as gene silencing oligonucleotides (GSO). (See, for example, U.S. Patent No. 8,431,544, assigned to Idera Pharmaceuticals, Inc., which is incorporated herein by reference in its entirety for all purposes.)

[0314] The attachment of the GSO at the 5' end is independent of other oligonucleotide attachments and can be accomplished via either the 2' or 3' hydroxyl position of the nucleotide, either directly through the 5', 3', or 2' hydroxyl group, or indirectly through a non-nucleotidic linker or nucleoside. Attachment can also be via a functionalized sugar or nucleobase of the 5'-terminal nucleotide.

[0315] GSOs can contain two identical or different sequences conjugated at their 5'-5' ends via phosphodiester, phosphorothioate, or non-nucleoside linkers. Such compounds can contain 15-27 nucleotides complementary to a specific portion of an mRNA target of interest for antisense downregulation of the gene product. GSOs containing identical sequences can inhibit the expression of proteins bound to specific mRNAs through Watson-Crick hydrogen bonding interactions. GSOs containing different sequences can inhibit the expression of proteins bound to two or more distinct regions of one or more mRNA targets. Such compounds consist of heteronucleotide sequences complementary to the target mRNA and form a stable duplex structure through Watson-Crick hydrogen bonding. Under certain conditions, GSOs containing two free 3' ends (5'-5' linked antisense) can be more potent inhibitors of gene expression than those containing a single free 3' end or no free 3' ends.

[0316] In some embodiments, the non-nucleotidic linker is glycerol or a glycerol homolog of the formula HO--(CH2)o--CH(OH)--(CH2)p--OH, where o and p are independently integers from 1 to about 6, 1 to about 4, or 1 to about 3. In some other embodiments, the non-nucleotidic linker is a derivative of 1,3-diamino-2-hydroxypropane. Some such derivatives have the formula: HO--(CH2)m--C(O)NH--CH2--CH(OH)--CH2--NHC(O)--(CH2) m --OH, wherein m is an integer of 0 to about 10, 0 to about 6, 2 to about 6, or 2 to about 4.

[0317] Some non-nucleotide linkers allow the binding of more than two GSO components. For example, the non-nucleotide linker glycerol has three hydroxyl groups to which GSO components can be covalently bound. Thus, some oligonucleotide-based compounds of the present invention comprise two or more oligonucleotides linked to a nucleotide or non-nucleotide linker. Such oligonucleotides according to the present invention are referred to as "branched".

[0318] In certain embodiments, the GSO is at least 14 nucleotides in length. In certain exemplary embodiments, the GSO is 15-40 nucleotides in length or 20-30 nucleotides in length. Thus, the component oligonucleotides of the GSO can independently be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0319] These oligonucleotides can be prepared by art-recognized methods, such as phosphoramidate or H-phosphonate chemistry, which can be performed manually or by automated synthesizer. These oligonucleotides can also be modified in several ways without impairing their ability to hybridize to mRNA. Such modifications can include at least one internucleotide bond of the oligonucleotide that is alkyl phosphonate, phosphorothioate, phosphorodithioate, methyl phosphonate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate hydroxyl, acetamidate, or carboxymethyl ester, or a combination thereof, and other internucleotide bonds between the 5' end of one nucleotide and the 3' end of another nucleotide, where the 5' nucleotide phosphodiester bond is replaced with various chemical groups. V. Modified Anti-ApoE RNA Silencing Agents

[0320] In certain embodiments of the present invention, the above-described RNA silencing agents of the present invention (or any portion thereof) may be modified to further improve the activity of the agent. The RNA silencing agents described in Section II above may be modified with any of the modifications described below. These modifications may, in part, serve to further improve target discrimination, improve the stability of the agent (e.g., prevent degradation), promote cellular uptake, improve targeting efficiency, improve the efficacy of binding (e.g., to the target), improve patient tolerance to the agent, and / or reduce toxicity. 1) Modifications for improved target discrimination

[0321] In certain embodiments, the RNA silencing agent of the present invention may be substituted with destabilizing nucleotides to improve single-nucleotide target discrimination (see U.S. Ser. No. 11 / 698,689, filed January 25, 2007, and U.S. Provisional Application No. 60 / 762,225, filed January 25, 2006, both of which are incorporated herein by reference). Such modifications are sufficient to destroy the specificity of the RNA silencing agent for non-target mRNAs (e.g., wild-type mRNAs) without appreciably affecting the specificity of the RNA silencing agent for target mRNAs (e.g., gain-of-function mutant mRNAs).

[0322] In a preferred embodiment, the RNA silencing agent of the present invention is modified by introducing at least one common nucleotide into its antisense strand. A common nucleotide comprises a base moiety that can indiscriminately base pair with any of the four bases of conventional nucleotides (e.g., A, G, C, U). Common nucleotides are preferred because they have relatively little effect on the stability of the RNA duplex or the duplex formed by the guide strand of the RNA silencing agent and the target mRNA. Exemplary common nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxynosine (e.g., 2'-deoxynosine), 7-deaza 2'-deoxynosine, 2'-aza-2'-deoxynosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In a particularly preferred embodiment, the common nucleotide is an inosine residue or its naturally occurring analog.

[0323] In certain embodiments, the RNA silencing agent of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides from specificity-determining nucleotide (i.e., the nucleotide that recognizes disease-related polymorphism).For example, destabilizing nucleotide can be introduced within 5, 4, 3, 2, or 1 nucleotide from specificity-determining nucleotide.In exemplary embodiments, destabilizing nucleotide is introduced at 3 nucleotides from specificity-determining nucleotide (i.e., there are two stabilizing nucleotides between destabilizing nucleotide and specificity-determining nucleotide).In RNA silencing agents (such as siRNA and shRNA) with double strands or strand portions, destabilizing nucleotide can be introduced into the strand or strand portion that does not contain specificity-determining nucleotide.In preferred embodiments, destabilizing nucleotide is introduced into the same strand or strand portion that contains specificity-determining nucleotide. 2) Modifications to improve efficacy and specificity

[0324] In certain embodiments, the RNA silencing agent of the present invention can be modified to facilitate the improvement of efficacy and specificity in mediating RNAi by asymmetric design rules (see US Patent 8,309,704,7,750,144,8,304,530,8,329,892 and 8,309,705).This modification facilitates the antisense strand of siRNA (for example, the siRNA that is produced by the siRNA or shRNA that is designed using the method of the present invention) to enter RISC in place of sense strand, so that antisense strand preferentially guides the cleavage or translational suppression of target mRNA, thereby increasing or improving the efficiency of target cleavage and silencing. Preferably, the asymmetry of the RNA silencing agent is improved by reducing the base pair strength between the 5' end of the antisense strand (AS 5') and the 3' end of the sense strand (S 3') of the RNA silencing agent compared to the binding strength or base pair strength between the 3' end of the antisense strand (AS 3') and the 5' end of the sense strand (S '5) of the RNA silencing agent.

[0325] In one embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved so that there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion than between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved so that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. Preferably, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved so that there is at least one wobble base pair, such as G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved so that there is at least one base pair containing a rare nucleotide, such as inosine (I). Preferably, the base pair is selected from the group consisting of I:A, I:U and I:C. In yet another embodiment, the asymmetry of the RNA silencing agent of the present invention may be improved such that at least one base pair comprises a modified nucleotide. In a preferred embodiment, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G and 2,6-diamino-A. 3) RNA silencing agents with improved stability

[0326] The RNA silencing agent of the present invention can be modified to improve its stability in serum or cell culture medium.To improve stability, the 3'-residue can be stabilized against degradation, for example, selected to consist of purine nucleotides, particularly adenosine or guanosine nucleotides.Alternatively, pyrimidine nucleotides can be replaced with modified analogs, for example, uridine can be replaced with 2'-deoxythymidine, and this does not affect the efficiency of RNA interference.

[0327] In one aspect, the present invention features an RNA silencing agent, wherein the first and second strands are modified by replacing internal nucleotides with modified nucleotides, so that the in vivo stability is improved compared with the corresponding unmodified RNA silencing agent.As defined herein, an "internal" nucleotide is a nucleotide that occurs at any position other than the 5'-end or 3'-end of a nucleic acid molecule, polynucleotide, or oligonucleotide.Internal nucleotides can be within a single-stranded molecule, or within a double-stranded or double-stranded molecule.In one embodiment, the sense strand and / or antisense strand are modified by replacing at least one internal nucleotide.In another embodiment, the sense strand and / or antisense strand are modified by replacing at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more internal nucleotides. In another embodiment, the sense and / or antisense strands are modified by substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of their internal nucleotides. In yet another embodiment, the sense and / or antisense strands are modified by substitution of all their internal nucleotides.

[0328] In one aspect, the present invention features an RNA silencing agent that is at least 80% chemically modified. In a preferred embodiment of the present invention, the RNA silencing agent is fully chemically modified, i.e., 100% of the nucleotides are chemically modified.

[0329] In a preferred embodiment of the present invention, RNA silencing agent can contain at least one modified nucleotide analogue.Nucleotide analogue can be located at the position where target specific silencing activity, for example, RNAi-mediated activity or translation suppression activity, is not substantially affected, for example, at the 5'-end and / or 3'-end region of siRNA molecule.In particular, end can be stabilized by incorporating modified nucleotide analogue.

[0330] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., containing modifications to the phosphate-sugar backbone). For example, the phosphodiester bond of natural RNA may be modified to include at least one nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, the phosphoester group attached to adjacent ribonucleotides is replaced with a modified group, such as a phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2'OH-group is replaced with a group selected from the group consisting of H, OR, R, halo, SH, SR, NH, NHR, NR, or ON, where R is C-C alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I.

[0331] In certain embodiments, the modification is 2'-fluoro, 2'-amino and / or 2'-thio modification.Specific preferred modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino-allyl-uridine.In certain embodiments, the 2'-fluoro ribonucleotide is any uridine and cytidine.Additional exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribothymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine and 5-fluoro-uridine. 2'-deoxynucleotides and 2'-ome nucleotides can also be used in the modified RNA silencing agent moiety of the present invention. Additional modified residues include deoxyabasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside and ribavirin. In a particularly preferred embodiment, the 2' moiety is a methyl group, so that the binding moiety is a 2'-O-methyl oligonucleotide.

[0332] In an exemplary embodiment, the RNA silencing agent of the present invention comprises a locked nucleic acid (LNA). LNA is resistant to nuclease activity (highly stable) and contains sugar-modified nucleotides with single-nucleotide discrimination against mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules have 2'-O,4'-C-ethylene-bridged nucleic acids and can be modified with 2'-deoxy-2''-fluorouridine. Furthermore, LNA increases the specificity of oligonucleotides by constraining the sugar moiety to the 3'-terminal structure, thereby pre-organizing the nucleotide for base pairing and increasing the melting temperature of the oligonucleotide by as much as 10°C per base.

[0333] In another exemplary embodiment, the RNA silencing agent of the present invention comprises peptide nucleic acid (PNA). PNA comprises modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced with a neutral 2-aminoethylglycine moiety, which can form a polyamide backbone that is highly resistant to nuclease digestion and confers improved binding specificity to the molecule (Nielsen, et al., Science, (2001), 254: 1497-1500).

[0334] Also preferred are nucleobase-modified ribonucleotides, i.e., ribonucleotides containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. The base can be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at the 8-position, such as 8-bromoguanosine; deazanucleotides, such as 7-deazadenosine, and O- and N-alkylated nucleotides, such as N6-methyladenosine. The above modifications may also be combined.

[0335] In other embodiments, crosslinking can be used to modify the pharmacokinetics of RNA silencing agents, for example, to increase their half-life in the body.Therefore, the present invention includes RNA silencing agents having two complementary strands of nucleic acid, wherein the two strands are crosslinked.The present invention also includes RNA silencing agents that are conjugated to another moiety (e.g., a non-nucleic acid moiety such as a peptide, an organic compound (e.g., a dye), etc.) or are not conjugated (e.g., at their 3' ends).By modifying siRNA derivatives in this way, the cellular uptake of the resulting siRNA derivatives can be improved, or the intracellular targeting of the resulting siRNA derivatives can be improved, compared with the corresponding siRNAs, which is useful for tracking the siRNA derivatives in cells, or the stability of the siRNA derivatives can be improved, compared with the corresponding siRNAs.

[0336] Other exemplary modifications include: (a) 2' modifications, e.g., providing a 2'OMe moiety on a U in the sense strand or antisense strand, particularly the sense strand, or providing a 2'OMe moiety on a 3' overhang, e.g., the 3' end (3' end means the 3' atom of the molecule, or the extreme 3' end, e.g., the extreme 3'P or 2' position, as indicated by the context); (b) backbone modifications, e.g., replacing O with S in the phosphate backbone, e.g., providing a phosphorothioate modification on U or A or both; e.g., a backbone modification replacing O with S; (c) replacing U with a C5 amino linker; (d) replacing A with G (preferably, the sequence variation is located in the sense strand, not the antisense strand); and (d) modifications at the 2', 6', 7', or 8 positions. Exemplary embodiments are those in which one or more of these modifications are present in the sense strand but not in the antisense strand, or in which the antisense strand has fewer such modifications. Still other exemplary modifications include the use of a 3' overhang, e.g., a methylated P at the 3' end; a combination of 2' modifications, e.g., providing a 2'OMe moiety and modifying the backbone (e.g., replacing O with S), e.g., providing a phosphorothioate modification, or the use of a 3' overhang, e.g., a methylated P at the 3' end; modifications with a 3' alkyl, modifications with an abasic pyrrolidone at the 3' end; modifications with naproxen, ibuprofen, or other moieties that inhibit degradation at the 3' end. 4) Modifications to improve cellular uptake

[0337] In other embodiments, the RNA silencing agent may be modified with a chemical moiety, for example, to enhance cellular uptake by target cells (e.g., neuronal cells). Thus, the present invention includes RNA silencing agents that are conjugated or unconjugated (e.g., at their 3' ends) to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), or the like. Conjugation can be achieved by methods known in the art, for example, using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkylcyanoacrylate (PACA) nanoparticles); Lipotal et al., J. Control Release 53(1-3):137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids bound to intercalating agents, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids bound to nanoparticles).

[0338] In certain embodiments, the RNA silencing agent of the present invention is conjugated to a lipophilic moiety.In one embodiment, the lipophilic moiety is a ligand comprising a cationic group.In another embodiment, the lipophilic moiety is bound to one or both of the siRNAs.In an exemplary embodiment, the lipophilic moiety is bound to one end of the sense strand of the siRNA.In another exemplary embodiment, the lipophilic moiety is bound to the 3' end of the sense strand.In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or cationic dye (e.g., Cy3).In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine. 5) Tethered Ligand

[0339] Other entities can be tethered to the RNA silencing agents of the present invention. For example, ligands tethered to RNA silencing agents can improve stability, hybridization thermodynamics with the target nucleic acid, targeting of specific tissues or cell types, or cell permeability, for example, via endocytosis-dependent or -independent mechanisms. Ligands and associated modifications can also increase sequence specificity, thereby reducing off-site targeting. The tethered ligand can contain one or more modified bases or sugars that can function as intercalators. These are preferably located in internal regions, such as bulges, of the RNA silencing agent / target duplex. Intercalators can be aromatic, for example, polycyclic aromatic or heterocyclic aromatic compounds. Polycyclic intercalators can have stacking capabilities and can include systems with two, three, or four fused rings. The general bases described herein can be included on the ligand. In one embodiment, the ligand can contain a cleavage group that contributes to target gene inhibition by cleaving the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, and can promote selective cleavage of target RNA at the bulge site by free metal ions such as Lu(III). In some embodiments, a peptide ligand can be tethered to an RNA silencing agent to, for example, promote cleavage of target RNA at the bulge region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (eg, via an amino acid derivative) to promote cleavage of a target RNA.The tethered ligand can be an aminoglycoside ligand, which can provide the RNA silencing agent with improved hybridization properties or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as neo-N-acridine, neo-S-acridine, neo-C-acridine, tobra-N-acridine, and KanaA-N-acridine. The use of an acridine analog can increase sequence specificity. For example, neomycin B has a higher affinity for RNA compared to DNA, but lower sequence specificity. The acridine analog, neo-5-acridine, has increased affinity for the HIV Rev-response element (RRE). In some embodiments, a guanidine analog (guanidinoglycoside) of the aminoglycoside ligand is tethered to the RNA silencing agent. In guanidinoglycosides, the amine group of an amino acid is replaced with a guanidine group. The attachment of a guanidine analog can improve the cell permeability of RNA silencing agents. The tethered ligand can be a poly-arginine peptide, peptoid, or peptidomimetic, which can improve the cellular uptake of oligonucleotide agents.

[0340] Exemplary ligand is preferably covalently bound to the carrier, directly or indirectly through an intervening tether.In exemplary embodiments, ligand is bound to the carrier through an intervening tether.In exemplary embodiments, ligand changes the distribution, target or life span of the RNA silencing agent that it is incorporated into.In exemplary embodiments, ligand improves the affinity of selected target, for example, molecule, cell or cell type, compartment, for example, compartment, tissue, organ or region of body cell or organ, for example, compared with the species that do not have such ligand.

[0341] Exemplary ligands can improve transport, hybridization, and specificity properties, and may also improve nuclease resistance of the resulting natural or modified RNA silencing agent or polymer molecule containing any combination of monomers and / or natural or modified ribonucleotides described herein. Ligands can include, for example, therapeutic modifiers to promote uptake; diagnostic compounds or reporter groups to monitor distribution; cross-linking agents; nuclease resistance-conferring moieties; and natural or unusual nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanol-derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein-binding agents, integrin-targeting molecules, polycations, peptides, polyamines, and peptidomimetics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); amino acids, or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidyl.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0342] The ligand can also include a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody, that binds to a specific cell type, such as a kidney cell. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptidomimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridine and substituted acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidinium aminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules, e.g., cholesterol (and its thioanalogs), cholic acid, cholic acid, lithocholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono-, bis-, or tris-fatty acid esters, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19, or C 20 fatty acids) and their ethers, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , or C 20 alkyl; e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennape dia-peptides, Tat peptides), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraazamacrocycles, Eu 3+ conjugate), dinitrophenyl, HRP or AP.

[0343] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., co-ligands, or antibodies, e.g., molecules with specific affinity for antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, e.g., lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, e.g., lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-kB.

[0344] The ligand can be, for example, a substance, such as a drug, that can increase the uptake of the RNA silencing agent into cells, for example, by disrupting the cytoskeleton, for example, by disrupting cellular microtubules, microfilaments, and / or intermediate filaments.The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.The ligand can increase the uptake of the RNA silencing agent into cells, for example, by activating an inflammatory response.Exemplary ligands that can have such an effect include tumor necrosis factor alpha (TNFα), interleukin-1β, or gamma interferon.In one aspect, the ligand is a lipid or lipid-based molecule.Such lipid or lipid-based molecule preferably binds to serum proteins, for example, human serum albumin (HSA).HSA-binding ligands allow the conjugate to be distributed to target tissues in the body, for example, non-renal target tissues. For example, the target tissue may be the liver, including the parenchymal cells of the liver. Molecules that can bind to HSA may also be used as ligands. For example, neproxin or aspirin may be used. Lipid or lipid-based ligands may be used. The lipid-based ligand can (a) increase the conjugate's resistance to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) be used to modulate binding to serum proteins, such as HSA. The lipid-based ligand can be used to regulate, e.g., control, the binding of the conjugate to target tissues. For example, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds more weakly to HSA can be used to target the conjugate to the kidney. In a preferred embodiment, the lipid-based ligand binds to HSA. The lipid-based ligand can bind to HSA with sufficient affinity so that the conjugate is preferably distributed to non-renal tissues. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed. In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA so that the conjugate is preferably distributed to the kidney. Other moieties that target kidney cells can also be used instead of or in addition to the lipid-based ligand.

[0345] In another embodiment, the ligand is a moiety, such as a vitamin, that is taken up by target cells, for example, proliferating cells.These are particularly useful for treating disorders characterized by, for example, malignant or non-malignant unwanted cell proliferation, for example, cancer cells.Exemplary vitamins include vitamins A, E, and K.Other exemplary vitamins include vitamin B, for example, folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients that are taken up by cancer cells.Also included are HSA and low-density lipoprotein (LDL).

[0346] In another embodiment, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, it can be modified, including peptidylmimetic, invertomers, non-peptide or pseudo-peptide bonds, and the use of D-amino acids. The helical agent is preferably an alpha-helical agent, preferably having a lipophilic and lipophobic phase.

[0347] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into a defined three-dimensional structure similar to natural peptides. Attachment of peptides and peptidomimetics to oligonucleotides can affect the pharmacokinetic distribution of RNA silencing agents, for example, by improving cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). The peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature 354:82-84, 1991). In an exemplary embodiment, the peptide or peptidomimetic tethered to the RNA silencing agent via an incorporated monomer unit is a cell-targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or an RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can have structural modifications, such as to enhance stability or direct conformational properties. Any of the structural modifications described below can be used.

[0348] VI. Branched Oligonucleotides

[0349] Two or more of the above-described RNA silencing agents, such as oligonucleotide constructs such as anti-ApoE siRNAs, can be linked together by one or more moieties independently selected from linkers, spacers, and branch points to form a branched oligonucleotide RNA silencing agent. Figure 11 shows an example of a di-branched di-siRNA scaffold for delivering two siRNAs. In a typical embodiment, each nucleic acid of the branched oligonucleotide comprises an antisense strand (or a portion thereof) having sufficient complementarity to a telozygous single nucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi). In another embodiment, a second type of branched oligonucleotide is provided, characterized by a nucleic acid comprising a sense strand (or a portion thereof) for silencing an ApoE antisense transcript, wherein the sense strand has sufficient complementarity to the antisense transcript to mediate an RNA-mediated silencing mechanism. In a further embodiment, a third type of branched oligonucleotide is provided, comprising both types of nucleic acids, i.e., a first oligonucleotide comprising an antisense strand (or a portion thereof) and a second oligonucleotide comprising a sense strand (or a portion thereof).

[0350] In exemplary embodiments, a branched oligonucleotide can have 2 to 8 RNA silencing agents attached via a linker. The linker can be hydrophobic. In some embodiments, the branched oligonucleotide of the present application comprises 2 to 3 oligonucleotides. In some embodiments, the oligonucleotides independently have substantial chemical stabilization (e.g., at least 40% of the constituent bases are chemically modified). In exemplary embodiments, the oligonucleotides independently have complete chemical stabilization (i.e., all of the constituent bases are chemically modified). In some embodiments, the branched oligonucleotide has one or more single-stranded phosphorothioated tails, each independently having 2 to 20 nucleotides. In non-limiting embodiments, each single-stranded tail has 8 to 10 nucleotides.

[0351] In certain embodiments, branched oligonucleotides are characterized by three properties: (1) a branched structure, (2) complete metabolic stabilization, and (3) the presence of a single-stranded tail containing a phosphorothioate linker. In certain embodiments, branched oligonucleotides have two or three branches. It is believed that increasing the overall size of the branched structure promotes increased uptake. Also, without being bound by a particular theory of action, it is believed that multiple adjacent branches (e.g., two or three) allow each branch to work in concert, thus dramatically improving the rate of internalization, trafficking, and release.

[0352] Branched oligonucleotides are provided in a variety of structurally diverse embodiments. For example, as shown in Figure 17, in some embodiments, the nucleic acid attached at the branch point can be single-stranded or double-stranded and consist of an miRNA inhibitor, gapmer, mixmer, SSO, PMO, or PNA. These single strands can be attached at their 3' or 5' ends. Combinations of siRNA and single-stranded oligonucleotides can also be used for dual functions. In another embodiment, short nucleic acids complementary to gapmers, mixmers, miRNA inhibitors, SSO, PMO, and PNA can be used to deliver active single-stranded nucleic acids and improve distribution and cellular internalization. The short double-stranded region has a low melting temperature (Tm ~ 37°C) and rapidly degrades once the branched structure is internalized in cells.

[0353] As shown in Figure 21, di-siRNA branched oligonucleotides can contain chemically diverse conjugates. Conjugated biologically active ligands can be used to improve cell specificity and promote membrane binding, internalization, and serum protein binding. Examples of biologically active moieties used for conjugation include DHAg2, DHA, GalNAc, and cholesterol. These moieties can be attached to di-siRNA via a linker or spacer, or can be added via an additional linker or spacer attached to another free siRNA end.

[0354] The presence of branched structures enhances tissue retention levels in the brain by over 100-fold compared to unbranched compounds of the same chemical composition, suggesting a novel mechanism for cellular retention and distribution. Branched oligonucleotides distribute unexpectedly uniformly throughout the spinal cord and brain. Furthermore, branched oligonucleotides exhibit unexpectedly efficient systemic delivery to a variety of tissues and exceptionally high levels of tissue accumulation.

[0355] Branched oligonucleotides include a variety of therapeutic nucleic acids, including ASOs, miRNAs, miRNA inhibitors, splice switching, PMOs, and PNAs. In some embodiments, the branched oligonucleotides further comprise a conjugated hydrophobic moiety and exhibit unprecedented silencing and efficacy in vitro and in vivo.

[0356] Non-limiting embodiments of branched oligonucleotide configurations are disclosed in Figures 11, 17-19, 25-27, and 50-52. Non-limiting examples of linkers, spacers, and branch points are disclosed in Figure 13.

[0357] Linker

[0358] In an embodiment of the branched oligonucleotide, each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and a combination thereof; wherein any carbon or oxygen atom of the linker may optionally be replaced by a nitrogen atom, and has a hydroxyl substituent or an oxo substituent. In one embodiment, each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment, each linker is a peptide. In another embodiment, each linker is RNA. In another embodiment, each linker is DNA. In another embodiment, each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment, each linker is a phosphoramidate. In another embodiment, each linker is an ester. In another embodiment, each linker is an amide. In another embodiment, each linker is a triazole. In another embodiment, each linker is a structure selected from the formula of Figure 17. VII. Compounds of formula (I)

[0359] In another aspect, provided herein is a compound of formula (I): [ka]

[0013] In the formula (I), L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and a combination thereof, and the formula (I) may optionally further comprise one or more branch points B, and one or more spacers S (wherein B is, independently at each occurrence, a polyvalent organic species or a derivative thereof; and S is, independently at each occurrence, selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and a combination thereof).

[0360] The moiety N is an RNA duplex comprising a sense strand and an antisense strand; and n is 2, 3, 4, 5, 6, 7, or 8. In some embodiments, the antisense strand of N comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, N comprises a strand capable of targeting one or more target sequences of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'. The sense strand and the antisense strand each independently comprise one or more chemical modifications.

[0361] In some embodiments, the compound of Formula (I) has a structure selected from Formulas (I-1) through (I-9) in Table 3. [Table 3]

[0362] In one embodiment, the compound of Formula (I) is Formula (I-1). In another embodiment, the compound of Formula (I) is Formula (I-2). In another embodiment, the compound of Formula (I) is Formula (I-3). In another embodiment, the compound of Formula (I) is Formula (I-4). In another embodiment, the compound of Formula (I) is Formula (I-5). In another embodiment, the compound of Formula (I) is Formula (I-6). In another embodiment, the compound of Formula (I) is Formula (I-7). In another embodiment, the compound of Formula (I) is Formula (I-8). In another embodiment, the compound of Formula (I) is Formula (I-9).

[0363] In an embodiment of the compound of Formula (I), each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and a combination thereof; wherein any carbon or oxygen atom of the linker may be replaced by a nitrogen atom, and has a hydroxyl substituent or an oxo substituent. In one embodiment of the compound of Formula (I), each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment of the compound of Formula (I), each linker is a peptide. In another embodiment of the compound of Formula (I), each linker is RNA. In another embodiment of the compound of Formula (I), each linker is DNA. In another embodiment of the compound of Formula (I), each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment of the compound of Formula (I), each linker is a phosphoramidate. In another embodiment of a compound of Formula (I), each linker is an ester. In another embodiment of a compound of Formula (I), each linker is an amide. In another embodiment of a compound of Formula (I), each linker is a triazole. In another embodiment of a compound of Formula (I), each linker is a structure selected from the formulas of Figure 17.

[0364] In one embodiment of the compound of Formula (I), B is a polyvalent organic species. In another embodiment of the compound of Formula (I), B is a derivative of a polyvalent organic species. In one embodiment of the compound of Formula (I), B is a triol or tetrol derivative. In another embodiment, B is a tri- or tetra-carboxylic acid derivative. In another embodiment, B is an amine derivative. In another embodiment, B is a tri- or tetra-amine derivative. In another embodiment, B is an amino acid derivative. In another embodiment of the compound of Formula (I), B is selected from the formulae of Figure 16.

[0365] Polyvalent organic species are moieties that contain carbon and three or more valencies (i.e., points of attachment to a moiety such as S, L, or N, as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, etc.), tetrols (e.g., ribose, pentaerythritol, 1,2,3,5-tetrahydroxybenzene, etc.), tri-carboxylic acids (e.g., citric acid, 1,3,5-cyclohexanetricarboxylic acid, trimesic acid, etc.), tetra-carboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, etc.), tertiary amines (e.g., tripropargylamine, triethanolamine, etc.), triamines (e.g., diethylenetriamine, etc.), tetramines, and species that contain combinations of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, cysteine, etc.).

[0366] In an embodiment of the compound of Formula (I), each nucleic acid comprises one or more chemically modified nucleotides. In an embodiment of the compound of Formula (I), each nucleic acid consists of chemically modified nucleotides. In certain embodiments of the compound of Formula (I), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of each nucleic acid comprises chemically modified nucleotides.

[0367] In some embodiments, each antisense strand independently comprises a 5'-terminal group R selected from the group in Table 4. [Table 4]

[0368] In one embodiment, R is R1. In another embodiment, R is R2. In another embodiment, R is R3. In another embodiment, R is R4. In another embodiment, R is R5. In another embodiment, R is R6. In another embodiment, R is R7. In another embodiment, R is R8. Structure of Formula (II)

[0369] In some embodiments, the compound of Formula (I) has the formula (II): [ka] wherein X, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, at each occurrence alone, represents a base pairing interaction or mismatch.

[0370] In certain embodiments, the structure of Formula (II) does not contain any mismatch. In one embodiment, the structure of Formula (II) contains one mismatch. In another embodiment, the compound of Formula (II) contains two mismatches. In another embodiment, the compound of Formula (II) contains three mismatches. In another embodiment, the compound of Formula (II) contains four mismatches. In some embodiments, each nucleic acid is composed of chemically modified nucleotides.

[0371] In certain embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of Formula (II) are chemically modified nucleotides. In other embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of Formula (II) are chemically modified nucleotides. Structure of formula (III)

[0372] In some embodiments, the compound of Formula (I) has the formula (III): [ka]

[0373] wherein X, independently for each occurrence, is a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X, independently for each occurrence, is a nucleotide that includes a 2'-O-methyl modification; Y, independently for each occurrence, is a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y, independently for each occurrence, is a nucleotide that includes a 2'-O-methyl modification.

[0374] In some embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0375] In certain embodiments, the structure of Formula (III) does not contain any mismatches. In one embodiment, the structure of Formula (III) contains one mismatch. In another embodiment, the compound of Formula (III) contains two mismatches. In another embodiment, the compound of Formula (III) contains three mismatches. In another embodiment, the compound of Formula (III) contains four mismatches. Structure of formula (IV)

[0376] In some embodiments, the compound of Formula (I) has the formula (IV): [ka] wherein X, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, at each occurrence alone, represents a base pairing interaction or mismatch.

[0377] In certain embodiments, the structure of formula (IV) does not contain any mismatch. In one embodiment, the structure of formula (IV) contains one mismatch. In another embodiment, the compound of formula (IV) contains two mismatches. In another embodiment, the compound of formula (IV) contains three mismatches. In another embodiment, the compound of formula (IV) contains four mismatches. In some embodiments, each nucleic acid is composed of chemically modified nucleotides.

[0378] In certain embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of formula (IV) are chemically modified nucleotides. In other embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of formula (IV) are chemically modified nucleotides. Structure of formula (V)

[0379] In some embodiments, the compound of Formula (I) has the formula (V): [ka] wherein X, independently for each occurrence, is a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X, independently for each occurrence, is a nucleotide that includes a 2'-O-methyl modification; Y, independently for each occurrence, is a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y, independently for each occurrence, is a nucleotide that includes a 2'-O-methyl modification.

[0380] In certain embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0381] In certain embodiments, the structure of Formula (V) does not contain any mismatches. In one embodiment, the structure of Formula (V) contains one mismatch. In another embodiment, the compound of Formula (V) contains two mismatches. In another embodiment, the compound of Formula (V) contains three mismatches. In another embodiment, the compound of Formula (V) contains four mismatches. Flexible Linker

[0382] In an embodiment of the compound of Formula (I), L is L1: [ka] It has the following structure. In an L1 embodiment, R is R 3 and n is 2.

[0383] In an embodiment of the structure of formula (II), L has the structure L1. In an embodiment of the structure of formula (III), L has the structure L1. In an embodiment of the structure of formula (IV), L has the structure L1. In an embodiment of the structure of formula (V), L has the structure L1. In an embodiment of the structure of formula (VI), L has the structure L1. In an embodiment of the structure of formula (VI), L has the structure L1.

[0384] In an embodiment of the compound of Formula (I), L is L2: [ka] It has the following structure.

[0385] In an embodiment of L2, R is R3 and n is 2. In an embodiment of the structure of Formula (II), L has the structure of L2. In an embodiment of the structure of Formula (III), L has the structure of L2. In an embodiment of the structure of Formula (IV), L has the structure of L2. In an embodiment of the structure of Formula (V), L has the structure of L2. In an embodiment of the structure of Formula (VI), L has the structure of L2. In an embodiment of the structure of Formula (VI), L has the structure of L2. Delivery System

[0386] In a third aspect, provided herein is a compound of formula (VI): [ka]

[0387]

[0013] A delivery system for therapeutic nucleic acids is provided having the structure: [in Formula (VI), L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof, and wherein Formula (VI) may optionally further comprise one or more branch points B, and one or more spacers S (wherein B is, independently at each occurrence, a polyvalent organic species or a derivative thereof; and S is, independently at each occurrence, selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof); each cNA is independently a carrier nucleic acid comprising one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8.

[0388] In one embodiment of the delivery system, L is an ethylene glycol chain. In another embodiment of the delivery system, L is an alkyl chain. In another embodiment of the delivery system, L is a peptide. In another embodiment of the delivery system, L is RNA. In another embodiment of the delivery system, L is DNA. In another embodiment of the delivery system, L is a phosphate. In another embodiment of the delivery system, L is a phosphonate. In another embodiment of the delivery system, L is a phosphoramidate. In another embodiment of the delivery system, L is an ester. In another embodiment of the delivery system, L is an amide. In another embodiment of the delivery system, L is a triazole.

[0389] In one embodiment of the delivery system, S is an ethylene glycol chain. In another embodiment, S is an alkyl chain. In another embodiment of the delivery system, S is a peptide. In another embodiment, S is RNA. In another embodiment of the delivery system, S is DNA. In another embodiment of the delivery system, S is a phosphate. In another embodiment of the delivery system, S is a phosphonate. In another embodiment of the delivery system, S is a phosphoramidate. In another embodiment of the delivery system, S is an ester. In another embodiment, S is an amide. In another embodiment, S is a triazole.

[0390] In one embodiment of the delivery system, n is 2. In another embodiment of the delivery system, n is 3. In another embodiment of the delivery system, n is 4. In another embodiment of the delivery system, n is 5. In another embodiment of the delivery system, n is 6. In another embodiment of the delivery system, n is 7. In another embodiment of the delivery system, n is

[0391] In certain embodiments, each cNA comprises >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% chemically modified nucleotides.

[0392] In some embodiments, the compound of Formula (VI) is selected from the group consisting of: [Table 5] having a structure selected from the formulas (VI-1) to (VI-9)

[0393] In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-1). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-2). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-3). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-4). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-5). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-6). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-7). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-8). In some embodiments, the compound of Formula (VI) has the structure of Formula (VI-9).

[0394] In some embodiments, the compound represented by formula (VI) (e.g., formulas (VI-1) to (VI-9)) has each cNA independently comprising at least 15 consecutive nucleotides. In some embodiments, each cNA independently comprises chemically modified nucleotides.

[0395] In some embodiments, the delivery system further comprises a therapeutic nucleic acid (NA) comprising a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'. In further embodiments, the NA comprises a strand capable of targeting one or more of the following target sequences: 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

[0396] Also, each NA is hybridized to at least one cNA. In one embodiment, the delivery system consists of two NAs. In another embodiment, the delivery system consists of three NAs. In another embodiment, the delivery system consists of four NAs. In another embodiment, the delivery system consists of five NAs. In another embodiment, the delivery system consists of six NAs. In another embodiment, the delivery system consists of seven NAs. In another embodiment, the delivery system consists of eight NAs.

[0397] In some embodiments, each NA independently comprises at least 16 contiguous nucleotides. In some embodiments, each NA independently comprises 16 to 20 contiguous nucleotides. In some embodiments, each NA independently comprises 16 contiguous nucleotides. In another embodiment, each NA independently comprises 17 contiguous nucleotides. In another embodiment, each NA independently comprises 18 contiguous nucleotides. In another embodiment, each NA independently comprises 19 contiguous nucleotides. In another embodiment, each NA independently comprises 20 contiguous nucleotides.

[0398] In some embodiments, each NA comprises an unpaired overhang of at least 2 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 3 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 4 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 5 nucleotides. In another embodiment, each NA comprises an unpaired overhang of at least 6 nucleotides. In some embodiments, the nucleotides of the overhang are linked via phosphorothioate bonds.

[0399] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagomir, miRNA, gapmer, mixmer, or guide RNA. In one embodiment, each NA is independently DNA. In another embodiment, each NA is independently siRNA. In another embodiment, each NA is independently antagomir. In another embodiment, each NA is independently miRNA. In another embodiment, each NA is independently gapmer. In another embodiment, each NA is independently mixmer. In another embodiment, each NA is independently guide RNA. In some embodiments, each NA is the same. In some embodiments, each NA is different.

[0400] In some embodiments, the delivery system further comprising n therapeutic nucleic acids (NAs) has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises two therapeutic nucleic acids (NAs), and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In another embodiment, the delivery system further comprises three therapeutic nucleic acids (NAs), and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system further comprises four therapeutic nucleic acids (NAs), and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising five therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising six therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising seven therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising eight therapeutic nucleic acids (NAs).

[0401] In one embodiment, the delivery system comprises the structure L1 or L2, where R is R 3 and n is 2. In another embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (VI), further comprising a linker of the structure L1, where R is R 3and n is 2. In another embodiment, the delivery system has a structure selected from formula (I), (II), (III), (IV), (V), (VI), further comprising a linker of the structure L2, where R is R 3 and n is 2.

[0402] In some embodiments of the delivery system, the target of delivery is selected from the group consisting of brain, liver, skin, kidney, spleen, pancreas, colon, fat, lung, muscle, and thymus. In one embodiment, the target of delivery is the brain. In another embodiment, the target of delivery is the striatum of the brain. In another embodiment, the target of delivery is the cortex of the brain. In another embodiment, the target of delivery is the striatum of the brain. In one embodiment, the target of delivery is the liver. In one embodiment, the target of delivery is the skin. In one embodiment, the target of delivery is the kidney. In one embodiment, the target of delivery is the spleen. In one embodiment, the target of delivery is the pancreas. In one embodiment, the target of delivery is the colon. In one embodiment, the target of delivery is fat. In one embodiment, the target of delivery is the lung. In one embodiment, the target of delivery is muscle. In one embodiment, the target of delivery is the thymus. In one embodiment, the target of delivery is the spinal cord.

[0403] In certain embodiments, the compounds of the invention are characterized by the following properties: (1) two or more branched oligonucleotides, e.g., having an unequal number of 3' and 5' ends; (2) being substantially chemically stabilized, e.g., greater than 40%, optimally 100% of the oligonucleotide being chemically modified (e.g., RNA-free and optionally DNA-free); and (3) a phosphorothioated single oligonucleotide containing at least three, optimally 5-20 phosphorothioated linkages.

[0404] It is to be understood that the methods described herein are not limited to the particular methods and experimental conditions disclosed herein, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0405] Furthermore, unless otherwise indicated, the experiments described herein employ conventional molecular and cell biological and immunological techniques within the skill of those in the art. Such techniques are well known to those skilled in the art and are fully described in the literature. See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by M.R. Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition). Nucleic acids, vectors, and methods for introducing host cells

[0406] The RNA silencing agent of the present invention may be introduced directly (i.e., intracellularly) into cells (e.g., nerve cells), extracellularly into cavities, interstitial spaces, or the circulation of an organism, or may be introduced orally, or by immersing cells or organisms in a solution containing nucleic acid. Vascular or extravascular circulation, blood or lymphatic system, and cerebrospinal fluid are sites where nucleic acids can be introduced.

[0407] The RNA silencing agent of the present invention can be introduced by using nucleic acid delivery methods known in the art, including injection of a solution containing nucleic acid, bombardment by particles covered with nucleic acid, immersion of cells or organisms in a solution of nucleic acid, or electroporation of cell membrane in the presence of nucleic acid.Other methods known in the art for introducing nucleic acid into cells can be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate.Nucleic acid can be introduced with other components that perform one or more of the following activities: enhance nucleic acid uptake by cells, or otherwise increase the inhibition of target gene.

[0408] Physical methods for introducing nucleic acids include injecting a solution containing RNA, bombarding cells or organisms with particles coated with RNA, immersing cells or organisms in a solution of RNA, or electroporating cell membranes in the presence of RNA. Viral constructs packaged in viral particles can achieve both efficient introduction of an expression construct into cells and transcription of the RNA encoded by the expression construct. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated carrier transport and chemically mediated transport using calcium phosphate, can also be used. Thus, RNA can be introduced with components that perform one or more of the following activities: improving RNA uptake by cells, inhibiting single-strand annealing, stabilizing single strands, or otherwise increasing target gene inhibition.

[0409] RNA can be introduced directly into cells (i.e., intracellularly), extracellularly into cavities, interstitial spaces, or the circulation of an organism, orally, or by bathing a cell or organism in a solution containing RNA. Vascular or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites where RNA can be introduced.

[0410] Cells bearing the target gene may be derived from germline or somatic cells, totipotent or pluripotent cells, dividing or non-dividing cells, parenchymal or epithelial cells, immortalized or transformed cells, etc. The cells may be stem cells or differentiated cells. Differentiated cell types include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelial cells, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of endocrine or exocrine glands.

[0411] Depending on the specific target gene and the dose of double-stranded RNA material delivered, this process can result in partial or complete loss of target gene function. Reductions or losses of at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more of the targeted cells are exemplary. Inhibition of gene expression refers to the absence (or observable reduction) of protein and / or mRNA product levels from the target gene. Specificity refers to the ability to inhibit the target gene without eliciting effects on other genes in the cell. Inhibition results can be confirmed by examining the external properties of the cell or organism (as demonstrated in the examples below) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring on microarrays, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence-activated cell sorting (FACS).

[0412] For RNA-mediated inhibition in cell lines or whole organisms, gene expression can be conveniently assayed using reporter or drug resistance genes whose protein products can be easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and their derivatives. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracycline. Depending on the assay, quantifying gene expression can determine the degree of inhibition, such as 10%, 33%, 50%, 90%, 95%, or even 99% or more, compared to cells not treated with the present invention. Lower injection doses and longer times after administration of the RNAi agent can result in inhibition in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of target cells). Quantifying gene expression in cells can indicate similar amounts of inhibition at the level of target mRNA accumulation or target protein translation. For example, the efficiency of inhibition can be determined by assessing the amount of gene product in cells; mRNA may be detected with a hybridization probe containing a nucleotide sequence outside the region used for the inhibitory double-stranded RNA, and the translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.

[0413] The RNA can be introduced in an amount that allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500, or 1000 copies per cell) of the material can result in more effective inhibition, although lower doses may also be useful for certain applications.

[0414] In an exemplary embodiment, the effectiveness of the RNAi agent of the present invention (e.g., siRNA targeting ApoE target sequence) is tested for its ability to specifically degrade mutant mRNA (e.g., ApoE mRNA and / or ApoE protein production) in cells, particularly in neuronal cells (e.g., clonal lines of striatal or cortical neurons and / or primary neurons). Other easily transfectable cells, such as HeLa cells or COS cells, are also suitable for cell-based validation assays. Cells are transfected with human wild-type or mutant cDNA (e.g., human wild-type or mutant ApoE cDNA). Standard siRNA, modified siRNA, or a vector capable of generating siRNA from U-loop mRNA is co-transfected. Selective reduction in target mRNA (e.g., ApoE mRNA) and / or target protein (e.g., ApoE protein) is measured. The reduction of target mRNA or protein can be compared with the level of target mRNA or protein in the absence of RNAi agent or in the presence of RNAi agent that does not target ApoE mRNA.Exogenously introduced mRNA or protein (or endogenous mRNA or protein) can be assayed for comparison.When utilizing neural cells, which are known to be somewhat resistant to standard transfection techniques, it may be desirable to introduce RNAi agent (for example, siRNA) by passive uptake. Recombinant adeno-associated viruses and vectors

[0415] In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and their related vectors can be used to deliver one or more siRNAs to cells, such as neural cells (e.g., brain cells). AAVs can infect a variety of cell types, but infection efficiency varies depending on the serotype, which is determined by the sequence of the capsid protein. Several native AAV serotypes have been identified, with serotypes 1-9 being the most commonly used recombinant AAVs. AAV-2 is the most commonly studied and published serotype. The AAV-DJ system includes serotypes AAV-DJ and AAV-DJ / 8. These serotypes were created by DNA shuffling of multiple AAV serotypes to generate AAVs with hybrid capsids that have improved transduction efficiency in vitro (AAV-DJ) and in vivo (AAV-DJ / 8) in various cells and tissues.

[0416] In certain embodiments, widespread central nervous system (CNS) delivery can be achieved by intravascular delivery of recombinant adeno-associated virus 7 (RAAV7), RAAV9, and rAAV10, or other suitable RAAV (Zhang et al. (2011) Mol. Ther. 19(8):1440-8. doi: 10.1038 / mt.2011.98. Epub 2011 May 24). rAAV and related vectors are well known in the art and are described in U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766, each of which is incorporated herein by reference in its entirety for all purposes.

[0417] rAAV can be delivered to the subject in the composition by any suitable method known in the art.rAAV can be suspended in a physiologically compatible carrier (i.e., in the composition) and can be administered to the subject, that is, the host animal such as human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, non-human primate (e.g., macaque).In certain embodiments, the host animal is a non-human host animal.

[0418] Delivery of one or more rAAVs to a mammalian subject can be achieved, for example, by intramuscular injection or administration into the mammalian subject's bloodstream. Administration into the bloodstream can be by injection into a vein, artery, or other vascular conduit. In certain embodiments, one or more rAAVs are administered into the bloodstream by isolated limb perfusion, a technique well known in the surgical field. This method essentially allows one skilled in the art to isolate a limb from the general circulation before administering rAAV virions. Variants of the isolated limb perfusion technique described in U.S. Patent 6,177,403 can also be utilized by those skilled in the art to administer virions to the vasculature of an isolated limb, potentially improving transduction of muscle cells or tissues. Furthermore, in certain instances, it may be desirable to deliver virions to the subject's central nervous system (CNS). "CNS" refers to all cells and tissues of the vertebrate brain and spinal cord. Thus, this term includes, but is not limited to, neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, etc. Recombinant AAV can be delivered directly to the CNS or brain by injection using neurosurgical techniques known in the art, such as stereotactic injection, using a needle, catheter, or related device, for example, into the ventricular region, as well as the striatum (e.g., the caudate nucleus or putamen of the striatum), the spinal cord and neuromuscular junction, or the cerebellar lobules (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).

[0419] Compositions of the invention can include rAAV alone or in combination with one or more other viruses (e.g., a second rAAV encoded with one or more different transgenes). In certain embodiments, the composition includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs, each with one or more different transgenes.

[0420] The effective amount of rAAV is the amount sufficient to target infection of animals and target desired tissues.In some embodiments, the effective amount of rAAV is the amount sufficient to generate a stable somatic cell line transgenic animal model.This effective amount mainly depends on factors such as the species, age, weight, health condition, and targeted tissue of the subject, and therefore may vary from animal to animal and tissue.For example, the effective amount of one or more rAAVs is generally about 10 9 ~10 16 The volume of the solution containing the genome copies ranges from about 1 ml to about 100 ml. In some cases, about 10 11 ~10 12 A dose of 10 rAAV genome copies is appropriate. 12 rAAV genome copies are effective in targeting heart, liver, and pancreatic tissues. In some cases, stable transgenic animals are generated by multiple doses of rAAV.

[0421] In some embodiments, the rAAV composition contains a particularly high rAAV concentration (e.g., about 10 13 The composition is formulated to reduce aggregation of AAV particles in the composition when rAAV is present in the presence of 1000 genome copies / mL or more. Methods for reducing rAAV aggregation include, for example, adding surfactants, adjusting pH, and adjusting salt concentration. (See, e.g., Wright et al. (2005) Molecular Therapy 12:171-178, the contents of which are incorporated herein by reference.)

[0422] A "recombinant AAV (rAAV) vector" comprises at least a transgene and its regulatory sequences, as well as 5' and 3' AAV inverted terminal repeats (ITRs). The recombinant AAV vector is packaged into capsid proteins and delivered to selected target cells. In some embodiments, the transgene is a nucleic acid sequence heterologous to the vector sequence that encodes a polypeptide, protein, functional RNA molecule (e.g., siRNA), or other gene product of interest. The nucleic acid coding sequence is operably linked to regulatory elements in a manner that allows for transcription, translation, and / or expression of the transgene in cells of the target tissue.

[0423] The AAV sequence of the vector typically includes cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequences are usually about 145 base pairs in length. In certain embodiments, substantially the entire ITR-encoding sequence is used in the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the skill of one in the art (see, e.g., the text in Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such a molecule for use in the present invention is a "cis-acting" plasmid containing a transgene, where the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences, which can be obtained from any known AAV, including the mammalian AAV types described further herein. VIII. Treatment Methods

[0424] In one aspect, the present invention provides preventive and therapeutic methods for treating subjects at risk of (or susceptible to) diseases or disorders that are caused in whole or in part by abnormal cholesterol transport.In one embodiment, the disease or disorder is one in which ApoE levels in the central nervous system (CNS) are found to predict the progression of neurodegeneration.In another embodiment, the disease or disorder is a polyglutamine disorder.In a preferred embodiment, the disease or disorder is one in which reducing ApoE in the CNS reduces the clinical symptoms seen in neurodegenerative diseases such as AD and ALS.

[0425] As used herein, "treatment" or "treating" is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or a vector or transgene encoding same) to a patient, or to a tissue or cell line isolated from a patient having a disease or disorder, or having symptoms of a disease or disorder, or predisposed to a disease or disorder, with the intent to cure, cure, alleviate, palliate, alter, treat, ameliorate, improve, or affect the disease or disorder, symptoms of the disease or disorder, or predisposition to the disease.

[0426] In one aspect, the present invention provides a method for preventing the above-mentioned disease or disorder in a subject by administering a therapeutic agent (for example, an RNAi agent or a vector or transgene encoding the same) to the patient.Subjects at risk of disease can be identified, for example, by any one or a combination of the diagnostic or predictive assays described herein.The administration of the prophylactic agent can be carried out before the symptoms characteristic of the disease or disorder appear, thereby preventing the disease or disorder or delaying its progression.

[0427] Another aspect of the invention relates to methods for therapeutically treating a patient, i.e., altering the development of a disease or disorder. In exemplary embodiments, the modifying methods of the invention involve contacting ApoE-expressing CNS cells with a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding the same) specific for a target sequence in the gene (e.g., SEQ ID NO: 1, 2, or 3), such that sequence-specific interference of the gene is achieved. These methods can be performed in vitro (e.g., by culturing cells with the agent), or alternatively, in vivo (e.g., by administering the agent to a subject).

[0428] With regard to both preventative and therapeutic methods of treatment, such treatments may be specifically tailored or varied based on knowledge gained from the field of pharmacogenomics. As used herein, "pharmacogenomics" refers to the application of genomics technologies, such as gene sequencing, statistical genetics, and gene expression analysis, to drugs in clinical development and on the market. More specifically, the term refers to the study of how a patient's genes determine their response to a drug (e.g., the patient's "drug response phenotype" or "drug response genotype"). Accordingly, another aspect of the present invention provides methods for tailoring preventative or therapeutic treatments for individuals using either the target gene molecules of the present invention or target gene modifiers depending on that individual's drug response genotype. Pharmacogenomics allows clinicians or physicians to target preventative or therapeutic treatments to patients who will most benefit from the treatment and to avoid treating patients who will experience drug-related toxic side effects.

[0429] Therapeutic agents can be tested in suitable animal models.For example, the RNAi agent described herein (or the expression vector or transgene encoding it) can be used in animal models to determine the efficacy, toxicity or side effects of treatment with this agent.Alternatively, a therapeutic agent can be used in animal models to determine the mechanism of action of such agent.For example, a drug can be used in animal models to determine the efficacy, toxicity or side effects of treatment with this drug.Alternatively, a drug can be used in animal models to determine the mechanism of action of this drug.

[0430] The pharmaceutical composition comprising the RNA silencing agent of the present invention can be administered to patients diagnosed with neurodegenerative disease or at risk of developing it.In one embodiment, the patient has been diagnosed with a neurological disease and is generally healthy otherwise.For example, the patient is not in the terminal stage of the disease and can live at least 2, 3, 5 or more years after diagnosis.The patient can be treated immediately after diagnosis, or treatment can be delayed until the patient experiences more debilitating symptoms, such as motor fluctuations and abnormal movements in Parkinson's disease patients.In another embodiment, the patient has not yet reached the advanced stage of the disease.

[0431] In an embodiment of this aspect, the prophylactic and therapeutic methods are directed to treating or managing neurodegenerative diseases or disorders by reducing ApoE in the CNS to reduce abnormal amyloid accumulation. In a non-limiting example, the RNA silencing agent is a branched oligonucleotide described in Sections VI and VII of this specification, administered to a patient diagnosed with or at risk of developing an amyloid-related neurodegenerative disease or disorder, such as Alzheimer's disease, cerebral amyloid angiopathy, or mild to moderate cognitive impairment. Patients may be treated after diagnosis, at various stages of the disease, or as a preventative measure if they are at risk for a neurodegenerative disease or disorder due to genetic traits, family history, or other factors. Effective dosages and administration schedules can be established and monitored by metrics indicative of effective treatment, such as the degree of inhibition, delay, prevention, or reduction of cognitive decline, brain beta-amyloid plaque formation, and neurodegenerative symptoms detected after initiation of treatment.

[0432] In one embodiment, the patient has been diagnosed with or is at risk of developing Alzheimer's disease and is otherwise healthy. ApoE This is accomplished by administering a branched oligonucleotide containing two nucleic acids, each 15 to 35 bases in length. Each nucleic acid is characterized by a region substantially complementary to a portion of ApoE mRNA, e.g., one or more of the target sequences listed in Table 1, Table 2, or Table 7. The two nucleic acids are linked to each other, e.g., by a linker, spacer, or branch point. Each nucleic acid can independently be single-stranded (ss) RNA or double-stranded (ds) RNA. For example, each nucleic acid can independently be an antisense molecule or a gapmer.

[0433] RNA silencing agents modified for improved neuronal uptake can be administered at a unit dose of less than about 1.4 mg per kg of body weight, or less than 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of body weight, and less than 200 nmoles of RNA agent per kg of body weight (e.g., about 4.4 x 10 copies), or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmoles of RNA silencing agent per kg of body weight. The unit dose can be administered, for example, by injection (e.g., intravenously or intramuscularly, intrathecally, or directly into the brain), by inhalation, or by topical application. Particularly preferred dosages are less than 2, 1, or 0.1 mg / kg body weight.

[0434] Direct delivery of an RNA silencing agent to an organ (e.g., directly to the brain) can be at a dosage on the order of about 0.00001 mg to about 3 mg per organ, or preferably about 0.0001 to 0.001 mg per organ, about 0.03 to 3.0 mg per organ, about 0.1 to 3.0 mg per eye, or about 0.3 to 3.0 mg per organ. In another embodiment, the dosage can be on the order of about 10 mg to about 50 mg per organ, or preferably about 20 mg to about 30 mg per organ. The dosage can be an amount effective to treat or prevent a neurodegenerative disease or disorder, such as AD or ALS. In one embodiment, the unit dose is administered less frequently than once daily, for example, less frequently than every 2, 4, 8, or 30 days. In another embodiment, the unit dose is not administered regularly (e.g., not periodically). For example, the unit dose may be administered only once. In one embodiment, the effective amount is administered with other traditional treatment modalities.

[0435] In one embodiment, a subject is administered an initial dose of an RNA silencing agent and 11 or more maintenance doses. The maintenance dose is generally lower than the initial dose, for example, half the initial dose. The maintenance regimen can include treating the subject with a dose ranging from 0.01 g to 10 mg per kg of body weight per day, for example, 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg per kg of body weight per day. The maintenance dose is preferably administered no more frequently than once every 5, 10, or 30 days. Furthermore, the treatment regimen can be continued for a period that varies depending on the nature of the particular disease, its severity, and the patient's overall condition. In a preferred embodiment, the dose may be administered no more frequently than once per day, for example, no more frequently than once per 24, 36, 48, or more hours, for example, no more frequently than once every 5 or 8 days. After treatment, the patient's condition can be monitored for changes and alleviation of symptoms. The dosage of the compound can be increased if the patient does not respond significantly to the current dosage level, or decreased if a reduction in symptoms of the disease state is observed, if the disease state is eliminated, or if undesirable side effects are observed.

[0436] An effective amount can be administered in a single dose or in two or more doses, as desired or considered appropriate under specific circumstances.If it is desired to facilitate repeated or frequent infusion, implantation of a delivery device, such as a pump, a semi-permanent stent (e.g., intravenous, intraperitoneal, intracapsular, or intraarticular), or a reservoir is desirable.In one embodiment, the pharmaceutical composition comprises multiple RNA silencing agent species.In another embodiment, the RNA silencing agent species has non-overlapping, non-adjacent sequences with another species with respect to a naturally occurring target sequence.In another embodiment, the multiple RNA silencing agent species are specific for different naturally occurring target genes.In another embodiment, the RNA silencing agent is allele-specific.In another embodiment, the multiple RNA silencing agent species target two or more target sequences (e.g., 2, 3, 4, 5, 6, or more target sequences).

[0437] After successful treatment, it may be desirable to administer maintenance therapy to the patient to prevent recurrence of the disease, in which case the compounds of the invention are administered at a maintenance dose ranging from 0.01 g to 100 g per kg of body weight (see U.S. Patent No. 6,107,094).

[0438] The concentration of the RNA silencing agent composition is sufficient to be effective in treating or preventing a disorder or regulating a physiological condition in humans. The concentration or amount of the RNA silencing agent administered depends on the parameters determined for the agent and the method of administration, e.g., nasal, buccal, or pulmonary. For example, nasal formulations tend to use lower concentrations of some components to avoid irritation or burning of the nasal passages. It may be desirable to dilute oral formulations 10-100 times to provide a suitable nasal formulation.

[0439] Certain factors may affect the dosage required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatment, the subject's general health and / or age, and other existing diseases.Furthermore, treatment of a subject with a therapeutically effective amount of an RNA silencing agent can include a single treatment, or preferably, a series of treatments.It will also be understood that the effective dosage of an RNA silencing agent for treatment may increase or decrease over the course of a particular treatment.Changes in dosage may be consequently revealed by the results of the diagnostic assays described herein.For example, after administering an RNA silencing agent composition, the subject may be monitored.Based on the information from monitoring, an additional amount of the RNA silencing agent composition can be administered.

[0440] Administration depends on the severity and responsiveness of the disease being treated, with the course of treatment lasting from several days to several months, or until a cure or reduction in disease symptoms is achieved. Optimal administration schedules can be calculated from measurements of drug accumulation in the patient's body. Those skilled in the art can easily determine the optimal dosage, administration method, and repetition rate. The optimal dosage may depend on the relative potency of individual compounds, but can generally be estimated based on the EC50 values ​​found to be effective in in vitro and in vivo animal models. In some embodiments, the animal model includes a transgenic animal expressing a human gene, e.g., a gene that produces a target RNA, e.g., an RNA expressed in neurons. The transgenic animal may lack the corresponding endogenous RNA. In another embodiment, the composition for testing includes an RNA silencing agent that is complementary, at least in its internal region, to a sequence conserved between the target RNA in the animal model and the target RNA in humans. IX. Pharmaceutical Compositions and Methods of Administration

[0441] The present invention relates to the use of the aforementioned agents for the preventive and / or therapeutic treatments described below. Therefore, the modulating agents of the present invention (e.g., RNAi agents) can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically contain a nucleic acid molecule, protein, antibody, or modified compound and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any solvents, dispersion media, coating agents, antibacterial agents, antifungal agents, isotonic agents, absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents with pharmaceutically active substances is well known in the art. Except insofar as a conventional media or agent is incompatible with the active compound, its use in the present compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0442] The pharmaceutical composition of the present invention is formulated to be compatible with its intended administration route.Examples of administration routes include parenteral administration, such as intravenous administration, intradermal administration, subcutaneous administration, intraperitoneal administration, intramuscular administration, oral (e.g., inhalation) administration, transdermal (topical) administration, and transmucosal administration.In certain exemplary embodiments, the pharmaceutical composition of the present invention is delivered to cerebrospinal fluid (CSF) by administration routes including but not limited to intrasternal (IS) administration, intracerebroventricular (ICV) administration, and intrathecal (IT) administration (e.g., via pump, infusion, etc.). Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration may contain the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent, such as benzyl alcohol or methyl paraben; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating agent, such as ethylenediaminetetraacetic acid; a buffer, such as acetate, citrate, or phosphate, and agents for the adjustment of tonicity, such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in glass or plastic ampoules, disposable syringes, or multiple-dose vials.

[0443] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous, IS, ICV, and IT administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), and phosphate-buffered saline (PBS). In all cases, the composition should be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, such as sugars, polyalcohols, such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin in the composition.

[0444] Sterile injectable solution can be prepared by incorporating the required amount of active compound into a suitable solvent containing one or a combination of the ingredients listed above, as needed, followed by filtration sterilization.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle containing a basic dispersion medium and the other ingredients listed above that are required.For the preparation of sterile injectable solution, the preferred method of preparing sterile powder is vacuum drying and freeze-drying, which allows the powder of active ingredient plus any additional desired ingredient to be obtained from the previously sterile-filtered solution of s.

[0445] Oral compositions generally contain an inert diluent or an edible carrier. These can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with an excipient and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, where the compound in the fluid carrier is applied orally and expectorated, expectorated, or swallowed. Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or sterote; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0446] For administration by inhalation, the compounds are delivered in the form of a spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

[0447] Systemic administration can also be via transmucosal or transdermal means. For transmucosal or transdermal administration, a penetrant appropriate to the barrier to be permeated is used in the formulation. Such penetrants are generally known in the art, and include, for example, detergents, bile salts, fusidic acid derivatives, etc. for transmucosal administration. Transmucosal administration can be achieved using nasal sprays or suppositories. For transdermal administration, the active compound is generally formulated into ointments, salves, gels, or creams.

[0448] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter or other glycerides) or retention enemas for rectal administration.

[0449] RNA silencing agents can also be administered by transfection or infection using methods known in the art, including, but not limited to, those described in McCaffrey et al. (2002), Nature, 418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20(10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm. 53(2), 151-160, erratum at Am. J. Health Syst. Pharm. 53(3), 325 (1996).

[0450] RNA silencing agents can also be administered by any method suitable for administering nucleic acid agents, such as DNA vaccines. These methods include gene guns, biological syringes, skin patches, and needle-free methods, such as the microparticle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389, and transdermal needle-free vaccination of mammals using powder vaccines, as disclosed in U.S. Patent No. 6,168,587. Intranasal administration is also possible, as described, inter alia, in Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2), 205-10. Liposomes (e.g., as described in U.S. Patent No. 6,472,375) and microencapsulation can also be used. Biodegradable, targetable microparticle delivery systems can also be used (e.g., as described in U.S. Patent No. 6,471,996).

[0451] In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used. Methods for preparing such formulations will be apparent to those skilled in the art. These materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells using monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, for example, as described in U.S. Patent 4,522,811.

[0452] The formulation of oral or parenteral compositions in the form of dosage unit is particularly advantageous because of the ease of administration and uniformity of dosage.Dosage unit form used herein refers to a physically separate unit suitable as a single dose of the subject to be treated, and each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.The specification of the dosage unit form of the present invention is determined and directly depends on the inherent properties of active compound and the specific therapeutic effect to be achieved, and the inherent limitation of the technology of compounding this active compound for individual treatment.

[0453] The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals to determine, for example, the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred. Compounds that exhibit toxic side effects may be used, but care should be taken to design a delivery system that targets such compounds to the site of affected tissues so as to minimize potential damage to uninfected cells, thereby reducing side effects.

[0454] Data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The dosage of such compounds preferably lies within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage range will vary depending on the dosage form and route of administration used. For any compound used in the methods of the invention, a therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test compound that achieves a half-life response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

[0455] The pharmaceutical compositions can be included in a container, pack, or dispenser together with any instructions for use.

[0456] As defined herein, a therapeutically effective amount of an RNA silencing agent (i.e., an effective dosage) depends on the RNA silencing agent selected. For example, if a plasmid encoding an shRNA is selected, it may be administered in a single dosage ranging from approximately 1 μg to 1000 mg, and in some embodiments, 10 μg, 30 μg, 100 μg, or 1000 μg. In some embodiments, 1 to 5 g of the composition can be administered. The composition can be administered once or more times daily to once or more times weekly, including once every other day. Those skilled in the art will appreciate that certain factors, including the severity of the disease or disorder, previous treatments, the subject's general health and / or age, and other diseases present, will influence the dosage and timing required to effectively treat a subject. Furthermore, treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or, preferably, a series of treatments.

[0457] The nucleic acid molecules of the present invention can be inserted into expression constructs, such as viral vectors, retroviral vectors, expression cassettes, or plasmid viral vectors, using methods known in the art, including, but not limited to, those described in Xia et al. (2002) supra. Expression constructs can be administered to a subject, for example, by inhalation, oral administration, intravenous injection, topical administration (see U.S. Patent No. 5,328,470), or stereotactic injection (see, for example, Chen et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 3054-3057). Pharmaceutical formulations of delivery vectors can include the vector in an acceptable diluent or a slow-release matrix in which the delivery vehicle is embedded. Alternatively, if the complete delivery vector can be produced directly from recombinant cells, e.g., retroviral vectors, the pharmaceutical formulation can include one or more cells that produce the gene delivery system.

[0458] The nucleic acid molecule of the present invention can also include small hairpin RNA (shRNA) and expression constructs engineered to express shRNA.The transcription of shRNA is thought to start from polymerase III (pol III) promoter and terminate at position 2 of the transcription termination site of 4-5-thymine.The expressed shRNA is thought to fold into a stem-loop structure with a 3'UU-overhang, and then the end of these shRNAs is processed to convert shRNA into siRNA-like molecules of about 21 nucleotides. Brummelkamp et al. (2002), Science, 296, 550-553; Lee et al, (2002). supra; Miyagishi and Taira (2002), Nature Biotechnol., 20, 497-500; Paddison et al. (2002), supra; Paul (2002), supra; Yu et al. (2002), supra.

[0459] The expression construct may be any construct suitable for use in an appropriate expression system, including, but not limited to, retroviral vectors, linear expression cassettes, plasmids, and viral or virus-derived vectors known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems, such as the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. The construct may contain one or both strands of the siRNA. Expression constructs expressing both strands may also include a loop structure connecting the two strands, or each strand may be transcribed separately from a separate promoter within the same construct. Each strand may also be transcribed from a separate expression construct. Tuschl (2002), Supra.

[0460] In certain exemplary embodiments, the composition comprising the RNA silencing agent of the present invention can be delivered to the nervous system of a subject by various routes.Exemplary routes include intrathecal delivery, parenchymal (for example, intracerebral) delivery, nasal delivery, and intraocular delivery.The composition can also be delivered systemically, for example, by intravenous, subcutaneous, or intramuscular injection, which is particularly useful for delivering RNA silencing agent to peripheral nerve cells.Preferred delivery route is to deliver directly to the brain, for example, to the ventricle or hypothalamus of the brain, or to the lateral or dorsal region of the brain.The RNA silencing agent of the present invention for nerve cell delivery can be incorporated into pharmaceutical compositions suitable for administration.

[0461] For example, the composition can include one or more RNA silencing agents and a pharmaceutically acceptable carrier. The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (including intraocular, nasal, or transdermal), oral, or parenteral. Parenteral administration includes intravenous infusion, subcutaneous injection, intraperitoneal or intramuscular injection, intrathecal administration, or intraventricular (e.g., intracerebroventricular) administration. In certain exemplary embodiments, the RNA silencing agents of the present invention are delivered across the blood-brain barrier (BBB) ​​using various suitable compositions and methods described herein.

[0462] The route of delivery can depend on the patient's disorder. For example, to a subject diagnosed with a neurodegenerative disease, the anti-ApoE RNA silencing agents of the present invention can be administered directly into the brain (e.g., to the globus pallidus or the striatum of the basal ganglia, and near the medium spiny neurons of the striatum). In addition to the RNA silencing agents of the present invention, the patient can be administered a secondary therapy, e.g., a palliative therapy and / or a disease-specific treatment. Secondary therapies include symptomatic therapy (e.g., to reduce symptoms), neuroprotective therapy (e.g., to slow or halt disease progression), and restorative therapy (e.g., to reverse disease progression). Other therapies include psychotherapy, physical therapy, speech therapy, communication and memory aids, social support services, and educational support.

[0463] The RNA silencing agent can be delivered to neurons in the brain. A delivery method that does not require the composition to pass through the blood-brain barrier can be utilized. For example, a pharmaceutical composition containing an RNA silencing agent can be delivered to a patient by direct injection into the area containing disease-affected cells. For example, the pharmaceutical composition can be delivered by direct injection into the brain. The injection can be performed by stereotactic injection into a specific area of ​​the brain (e.g., the substantia nigra, cortex, hippocampus, striatum, or globus pallidus). The RNA silencing agent can be delivered into multiple areas of the central nervous system (e.g., multiple areas of the brain and / or into the spinal cord). The RNA silencing agent can be delivered into a generalized area of ​​the brain (e.g., diffuse delivery to the cortex of the brain).

[0464] In one embodiment, RNA silencing agents can be delivered by a cannula or other delivery device, with one end being implanted into tissue, for example, the brain, for example, the substantia nigra, cortex, hippocampus, striatum or globus pallidus of the brain.The cannula can be connected to a reservoir of RNA silencing agents.Flow or delivery can be mediated by a pump, for example, an osmotic pump or a minipump, for example, an Alzet pump (Durect, Cupertino, CA).In one embodiment, the pump and reservoir are implanted in a region away from tissue, for example, the abdomen, and delivery is effectively carried out by a conduit that connects the pump or reservoir to the release site.Devices for delivery to the brain are described, for example, in US Patents 6,093,180 and 5,814,014.

[0465] The RNA silencing agent of the present invention can be further modified so that it can cross the blood-brain barrier.For example, the RNA silencing agent can be conjugated with the molecule that allows the agent to cross the barrier.This modified RNA silencing agent can be administered by any desired method, for example, by intracerebroventricular or intramuscular injection, or by pulmonary delivery, etc.

[0466] In certain embodiments, exosomes are used to deliver the RNA silencing agents of the present invention. Exosomes can cross the BBB and specifically deliver siRNA, antisense oligonucleotides, chemotherapeutic agents and proteins to neural cells after systemic injection. (Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr;29(4):341-5. doi: 10.1038 / nbt.1807; El-Andaloussi S, Lee Y, Lakhal-Littleton S, Li J, Seow Y, Gardiner C, Alvarez-Erviti L, Sargent IL, Wood MJ. (2011). Exosome-mediated delivery of siRNA in vitro and in vivo. Nat Protoc. 2012 Dec;7(12):2112-26. doi: 10.1038 / nprot.2012.131; EL Andaloussi S, Mager I, Breakefield XO, Wood MJ. (2013). Extracellular vesicles: biology and emerging therapeutic opportunities. Nat Rev Drug Discov. 2013 May;12(5):347-57. doi: 10.1038 / nrd3978; El Andaloussi S, Lakhal S, Mager I, Wood MJ. (2013). Exosomes for targeted siRNA delivery across biological barriers. Adv Drug Deliv Rev. 2013 Mar;65(3):391-7. doi: 10.1016 / j.addr.2012.08.008).

[0467] In certain embodiments, one or more lipophilic molecules are used to enable the RNA silencing agent of the present invention to be delivered across the BBB (Alvarez-Ervit (2011)). The RNA silencing agent will then be activated, for example, by enzymatic degradation of the lipophilic camouflage, releasing the agent into its active form.

[0468] In certain embodiments, one or more receptor-mediated permeabilizing compounds can be used to increase the permeability of the BBB, allowing delivery of the RNA silencing agents of the present invention. These drugs temporarily increase the permeability of the BBB by increasing the osmotic pressure in the blood and loosening the tight junctions between endothelial cells (El-Andaloussi (2012)). Loosening the tight junctions allows for successful intravenous injection of the RNA silencing agent.

[0469] In certain embodiments, nanoparticle-based delivery systems are used to deliver the RNA silencing agents of the present invention across the BBB. As used herein, "nanoparticle" refers to polymeric nanoparticles, typically solid, biodegradable colloidal systems that have been widely studied as drug or gene carriers. (SP Egusquiaguirre, M. Igartua, RM Hernandez, and JL Pedraz, "Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research," Clinical and Translational Oncology, vol. 14, no. 2, pp. 83-93, 2012). Polymeric nanoparticles are broadly divided into two types: natural polymers and synthetic polymers. Natural polymers for siRNA delivery include, but are not limited to, cyclodextrin, chitosan, and atelocollagen. (Y. Wang, Z. Li, Y. Han, L.H. Liang, and A. Ji, “Nanoparticle-based delivery system for application of siRNA in vivo,” Current Drug Metabolism, vol. 11, no. 2, pp. 182-196, 2010). Synthetic polymers that have been intensively studied include, but are not limited to, polyethyleneimine (PEI), poly(dl-lactide-co-glycolide) (PLGA), and dendrimers.(X. Yuan, S. Naguib, and Z. Wu, "Recent advances of siRNA delivery by nanoparticles," Expert Opinion on Drug Delivery, vol. 8, no. 4, pp. 521-536, 2011). For a review of nanoparticles and other suitable delivery systems, see Jong-Min Lee, Tae-Jong Yoon, and Young-Seok Cho, "Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy," BioMed Research International, vol. 2013, Article ID 782041, 10 pages, 2013. doi:10.1155 / 2013 / 782041 (incorporated by reference in its entirety).

[0470] The RNA silencing agent of the present invention can be administered to the eye, for example, to treat retinal disorders such as retinopathy. For example, the pharmaceutical composition can be applied to the surface of the eye or tissues nearby, such as the inside of the eyelid. They can be applied topically, for example, as a spray, drop, eyewash, or ointment. Ointments or droppable liquids can be delivered by ocular delivery systems known in the art, such as applicators or eyedroppers. Such compositions can also contain mucomimetic agents such as hyaluronic acid, chondroitin sulfate, hydroxypropylmethylcellulose, or poly(vinyl alcohol), preservatives such as sorbic acid, EDTA, or benzylcuronium chloride, and a standard amount of diluent and / or carrier. The pharmaceutical composition can be administered inside the eye and can be introduced by a needle or other delivery device that can introduce it into a selected area or structure. A composition containing an RNA silencing agent can also be applied via an eye patch.

[0471] Generally, the RNA silencing agent of the present invention can be administered by any suitable method.As used herein, local delivery can refer to directly applying the RNA silencing agent to any surface of the body, including the eye, mucous membrane, the surface of a body cavity, or any surface inside the body.Preparations for local administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids.Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc. may be required or desirable.Topical administration can also be used as a means to selectively deliver the RNA silencing agent to the epidermis or dermis of a subject, specific layers thereof, or underlying tissues.

[0472] The composition for intrathecal or intraventricular (e.g., intracerebroventricular) administration can comprise a sterile aqueous solution, which can also contain buffer, diluent and other suitable additives.The composition for intrathecal or intraventricular administration preferably does not contain a transfection reagent or any additional lipophilic moiety other than, for example, the lipophilic moiety bound to the RNA silencing agent.

[0473] Preparations for parenteral administration may include sterile aqueous solutions, which may contain buffers, diluents, and other suitable additives. Intraventricular injection may be facilitated, for example, by an intraventricular catheter connected to a reservoir. For intravenous use, the total concentration of solutes should be controlled to make the preparation isotonic.

[0474] The RNA silencing agent of the present invention can be administered to subject by pulmonary delivery.Pulmonary delivery composition can be delivered by inhalation of dispersion, so that the composition in dispersion can be easily absorbed directly into blood circulation through alveolar area and reach lung.Pulmonary delivery is effective for both systemic delivery and local delivery for treating lung disease.In one embodiment, the RNA silencing agent administered by pulmonary delivery is modified so that it can cross the blood-brain barrier.

[0475] Pulmonary delivery can be achieved by a variety of approaches, including nebulization, aerosolization, micellar, and dry powder-based formulations. Delivery can be achieved using liquid nebulizers, aerosol-based inhalers, and dry powder dispersers. Metered-dose devices are preferred. One advantage of using an atomizer or inhaler is that the device is self-contained, minimizing the potential for contamination. For example, dry powder dispersers deliver drugs that can be easily formulated as dry powders. RNA silencing agent compositions, either by themselves or in combination with a suitable powder carrier, can be stably stored as lyophilized or spray-dried powders. Delivery of the composition for inhalation is mediated by a dose-timing element, including a timer, dose counter, time measurement device, or time indicator, which, when incorporated into the device, allows for dose tracking, compliance monitoring, and / or dose triggering for patients during administration of the aerosolized pharmaceutical.

[0476] Types of pharmaceutical excipients useful as carriers include stabilizers, e.g., human serum albumin (HSA), bulking agents, e.g., carbohydrates, amino acids, and polypeptides; pH adjusters or buffers; salts, e.g., sodium chloride, etc. These carriers may be in crystalline or amorphous form, or a mixture of both.

[0477] Particularly useful bulking agents include compatible carbohydrates, polypeptides, amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, etc.; disaccharides such as lactose, trehalose, etc.; cyclodextrins such as 2-hydroxypropyl-β-cyclodextrin; and polysaccharides such as raffinose, maltodextrin, dextran, etc.; alditols such as mannitol, xylitol, etc. Preferred groups of carbohydrates include lactose, trehalose, raffinose maltodextrin, and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.

[0478] Suitable pH adjusters or buffers include organic salts prepared from organic acids or organic bases, such as sodium citrate and sodium ascorbate, with sodium citrate being preferred.

[0479] The RNA silencing agents of the present invention can be administered by oral and nasal delivery. For example, the drug administered through these membranes has a rapid onset of action, provides therapeutic plasma levels, avoids the first-pass effect of hepatic metabolism, and avoids drug exposure to the hostile gastrointestinal (GI) environment.Another advantage is that the membrane site is easily accessible, so that drug can be easily applied, localized, and removed.In one embodiment, the RNA silencing agent administered by oral or nasal delivery is modified so that it can cross the blood-brain barrier.

[0480] In one embodiment, the composition comprising RNA silencing agent is dispensed by implanted device in unit dose or measured dose.This device can comprise the sensor for monitoring the parameters in the body of subject.For example, device can comprise pump such as osmotic pump and optionally related electronic equipment.

[0481] The RNA silencing agent can be packaged into the natural capsid of the virus, or into an artificial capsid or structure derived therefrom produced chemically or enzymatically. X. Kit

[0482] In certain other embodiments, the present invention provides kits comprising a suitable container containing a pharmaceutical formulation of an RNA silencing agent, e.g., a double-stranded RNA silencing agent, or sRNA agent (e.g., a precursor, e.g., a larger RNA silencing agent that can be processed into an sRNA agent, or DNA encoding the RNA silencing agent, e.g., a double-stranded RNA silencing agent, or sRNA agent, or precursor thereof). In certain embodiments, the individual components of the pharmaceutical formulation can be provided in a single container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container containing a formulation of the RNA silencing agent and at least one other container containing a carrier compound. Kits can be packaged in various configurations, such as one or more containers in a single box. The various components can be combined, e.g., according to instructions provided with the kit. The components can be combined, e.g., according to the methods described herein, for preparing and administering a pharmaceutical composition. The kit can include a delivery device.

[0483] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made, using appropriate equivalents, without departing from the scope of the embodiments disclosed herein. While certain embodiments have been described in detail above, the same will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting. [Example]

[0484] Example 1. In vitro identification of hyper-functional ApoE target sequences 1.1 Identification of siRNAs targeting mouse ApoE that cause a dose-dependent reduction in mRNA and protein The mouse ApoE gene was used as a target for mRNA knockdown. A panel of cholesterol-conjugated siRNAs targeting the mouse ApoE gene was developed and screened in vitro in primary mouse astrocytes compared with untreated control cells. Each siRNA was tested at a concentration of 1.5 μM, and mRNA was assessed at 72 hours using the QuantiGene gene expression assay (ThermoFisher, Waltham, MA). Figure 1A reports the results of the screen.

[0485] As shown in Figure 1B, dose-response curves and IC50 values ​​were obtained for the hit compounds identified in the screen. 1134 and 1203 were selected for further study based on their high efficacy and potency. Figure 1C shows the dose-response of 1134 demonstrating protein silencing in mouse primary astrocytes, assessed after 1 week using a protein quantification assay from ProteinSimple (San Jose, CA). Table 1 below describes the two targets, 1134 and 1203. [Table 6] 1.2 Identification of siRNAs targeting human ApoE that cause a dose-dependent reduction in mRNA and protein

[0486] The human ApoE gene was used as a target for mRNA knockdown. A panel of siRNAs targeting the human ApoE gene was developed and screened in vitro in human HepG2 cells compared with untreated control cells. Each siRNA was tested at a concentration of 1.5 μM, and mRNA was assessed at 72 hours using the QuantiGene gene expression assay (ThermoFisher, Waltham, MA). Figure 2A reports the results of the screen; 1156 and 1163 were selected for further study based on their high efficacy and potency. Dose-response curves and IC50 values ​​were then obtained for the hit compounds obtained from the screen, as shown in Figure 2B. Table 2 below describes the two targets, 1156 and 1163. [Table 7]

[0487] A second round of screening of the human ApoE gene was performed, this time using siRNAs with the methyl-rich chemical pattern of Figure 43, testing multiple target regions of the gene. Figure 44A reports the results of the screen, and as shown in Figure 44B, 64, 1125, 1129, 1133, 1139, and 1143 were selected for further study based on their high efficacy and potency. Dose-response curves and IC50 values ​​were then obtained for hit compounds from the screen, as shown in Figure 44C (Column 1, left to right: 64, 1129, 1139; Column 2, left to right: 1125, 1133, 1143). The target sequences are listed in Table 7 below. [Table 8] 1.3 ApoE target sequences (mouse and human)

[0488] Figure 3A is a table showing the target sequences identified in the mouse and human ApoE genes, as well as the antisense and sense sequences of oligonucleotides targeting these sequences. As shown in Figure 3B, the oligonucleotide sequences can be used in the context of numerous chemical modifications (P2, P3, P2G, P3G) and with different chemical conjugates (e.g., GalNAc, CNS-siRNA, cholesterol). These oligonucleotides can also be used in the context of antisense oligonucleotide gene silencing. Example 2. In vivo efficacy of tissue-specific ApoE-targeted siRNA in mice 2.1 CNS-siRNA ApoE silences mRNA and protein expression throughout the mouse brain one month after injection.

[0489] The first group of wild-type mice received 475 μg of di-siRNA ApoE via ICV injection, the second control group received phosphate-buffered saline (PBS), and the third control group received di-siRNA. NTC (non-targeting control). Each group contained six mice. One month after injection, mRNA silencing was assessed in all brain regions using QuantiGene (Figure 4A), protein silencing was assessed using ProteinSimple (Figure 4B), and protein silencing throughout the brain was assessed by Western blot (Figure 4C).

[0490] We found that novel siRNA sequences targeting ApoE exhibited potent mRNA and protein silencing in vivo. Previous reports using ApoE-silencing oligonucleotides used sequences that demonstrated approximately 50% target mRNA and protein silencing after ICV injection. Without being bound by any particular theory, the low degree of silencing may invalidate many of the conclusions reached using previous sequences. On the other hand, novel sequences offer a significant advantage for studying the role of ApoE in neurodegeneration. 2.2 CNS-siRNAApoE silences ApoE protein in the hippocampus at low doses

[0491] Groups of wild-type mice received 475 μg, 237.5 μg, and 118.75 μg of di-siRNA, respectively. ApoE Each group contained three mice. One month after injection, protein silencing in the hippocampus was quantified and compared with control mice injected with PBS or NTC. As seen in the diagram in Figure 5A and the Western blot in Figure 5B, the novel siRNA targeting ApoE demonstrates in vivo protein silencing at low doses. Previous reports using ApoE-silencing oligonucleotides using sequences demonstrated approximately 50% silencing of target mRNA and protein after ICV injection of approximately 400 μg of the oligonucleotide. 2.3 CNS-siRNA ApoE silences ApoE throughout the spinal cord at low doses

[0492] Figure 6A shows quantification of protein silencing in the spinal cord one month after injection. Di-siRNA ApoE doses: 237.5 μg and 118.75 μg. Figure 6B shows a Western blot (ProteinSimple) demonstrating target ApoE (37 kDa) protein silencing compared to control vinculin (116 kDa). After ICV injection, ApoE 1134 silenced protein expression in all regions of the spinal cord (cervical, thoracic, and lumbar). ApoE silencing in the spinal cord has not previously been demonstrated. The ability to silence spinal ApoE has numerous implications for the treatment of spinal cord-related neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). 2.4 CNS-siRNA ApoE Brain-specific (non-liver) ApoE silencing is possible at low doses in mice

[0493] Figure 7A shows quantification of protein silencing in the liver one month after injection. Di-siRNA ApoE doses: 475 μg, 237.5 μg, and 118.75 μg. Figure 7B shows a Western blot (ProteinSimple) demonstrating target ApoE (37 kDa) protein silencing compared to control vinculin (116 kDa). The dose response to ICV injection of CNS-ApoE showed reduced hepatic protein expression after injection of 475 μg, but not after injection of 237.5 μg and 118.75 μg. Combined with the silencing data in the brain and spinal cord after injection of 237.5 μg and 118.75 μg, this data further suggests that CNS-specific silencing of ApoE is achieved by siRNA. Furthermore, this data also suggests that the two pools of ApoE (CNS and systemic) do not affect each other. Residual hepatic expression did not appear to replenish silenced CNS (brain or spinal cord) ApoE. 2.5 GalNAc-siRNA ApoE silences protein expression in the liver but does not affect the brain protein

[0494] GalNAc conjugates that target siRNA to hepatocytes were synthesized and administered subcutaneously to WT mice at a dose of 10 mg / kg. ApoE Protein silencing was quantified in the liver and hippocampus one month after injection of GalNAc-siRNA. Figure 8A is a Western blot (ProteinSimple) comparing ApoE protein silencing in the liver with control vinculin. Figure 8B is a Western blot (ProteinSimple) showing no effect on protein levels in the brain. Figure 8C is a quantification of protein silencing in the liver and brain. GalNAc-siRNA ApoEThe conjugate potently silences ApoE expression in the liver but does not affect ApoE expression in the brain. Without being bound by theory, it appears that ApoE produced in the brain does not cross the blood-brain barrier to replenish the systemic ApoE pool, even after systemic silencing. 2.6 Reducing hepatic ApoE increases serum cholesterol, but silencing CNS-ApoE alone does not

[0495] A major concern with silencing ApoE as a treatment for Alzheimer's disease is its potential impact on systemic cholesterol metabolism. Mice in which ApoE is genetically ablated develop high systemic cholesterol and aortic atherosclerosis. We show that tissue-specific modulation of ApoE in the CNS does not result in an increase in serum cholesterol, whereas systemic modulation causes a significant increase in cholesterol, particularly LDL. This level of differentiation of the effects of ApoE silencing on cholesterol has not been demonstrated previously. Figure 9A shows quantification of serum total cholesterol after silencing CNS ApoE. Figure 9B shows quantification of serum total cholesterol after silencing systemic ApoE, as well as quantification of cholesterol in the LDL and HDL fractions after silencing systemic ApoE. 2.7 CNS and systemic ApoE represent two distinct protein pools

[0496] By using the present ApoE sequences in combination with tissue-specific chemical conjugates, we provide evidence that two distinct pools of ApoE exist: CNS ApoE and systemic ApoE. Without being bound by any particular theory, the data suggest that the two pools of ApoE do not interact, do not affect each other's expression, and do not cross the blood-brain barrier. This leads us to hypothesize that one pool of ApoE (CNS or systemic) may influence the progression of neuropathology, while the other pool may have little or no effect. Figure 10A shows the CNS-siRNA. ApoE Figure 10B shows protein silencing in the brain and liver after injection of GalNAc-siRNA. ApoE 1 shows silencing in the brain (none) and liver after injection of Example 3 Chemical Synthesis of Di-siRNAs and Vitamin D-Conjugated hsiRNA

[0497] The di-siRNA used for in vitro and in vivo efficacy evaluation was synthesized as follows. As shown in Figure 12, triethylene glycol was reacted with acrylonitrile to introduce a protected amine functionality. Next, a branch point was added as a tosylated solketal, followed by reduction of the nitrile to yield a primary amine, which was then conjugated to vitamin D (calciferol) via a carbamate linker. The ketal was then hydrolyzed to release a cis-diol, which was selectively protected at the primary hydroxyl with a dimethoxytrityl (DMTr) protecting group and subsequently succinylated with succinic anhydride. The resulting moiety was attached to a solid support, followed by solid-phase oligonucleotide synthesis and deprotection to yield three products: VitD, the capped linker, and the di-siRNA. The products of the synthesis were then analyzed as described in Example 6. Example 4 Alternative Synthetic Route 1

[0498] As shown in Figure 15A, the monophosphoamidate linker approach involves the following steps: monoazide tetraethylene glycol is attached as a tosylated solketal with a branch point. The ketal is then removed to release a cis-diol, which is selectively protected at the primary hydroxyl with a dimethoxytrityl (DMTr) protecting group. The azide is then reduced with triphenylphosphine to a primary amine, which is immediately protected with a monomethoxytrityl (MMTr) protecting group. The remaining hydroxyl is succinylated with succinic anhydride and attached to a solid support (LCAA CPG). Synthesis and deprotection of the oligonucleotide yielded one major product: a di-siRNA with phosphate and phosphoamidate linkages. This example demonstrates an alternative, straightforward synthetic route that generates only phosphate and phosphoamidate linkers. Example 5 Alternative synthetic route 2

[0499] A second alternative synthetic approach was developed to generate diphosphate-containing moieties. As shown in Figure 15B, the diphosphonate linker approach involves the following steps: starting with solketal-modified teraethylene glycol, removing the ketal, and selectively protecting the two primary hydroxyls with dimethoxytrityl (DMTr). The remaining hydroxyl is extended in length with silyl-protected 1-bromoethanol. The TBDMS is removed, succinylated, and attached to a solid support. This is followed by solid-phase oligonucleotide synthesis and deprotection to generate di-siRNAs with diphosphate-containing linkers. Example 6 Quality Control of Chemical Synthesis of Di-siRNA and Vitamin D-Conjugated hsiRNA HPLC

[0500] To evaluate the quality of the chemical synthesis of Di-siRNA and vitamin D-conjugated hsiRNA, analytical HPLC was used to identify and quantify the synthesized products. Three major products were identified: the siRNA sense strand capped with a triethylene glycol (TEG) linker, Di-siRNA, and the vitamin D-conjugated siRNA sense strand (Figure 13). Each product was isolated by HPLC and used in subsequent experiments. The chemical structures of the three major synthesized products are shown in Figure 13. The HPLC conditions included: 5-80% B over 15 min, Buffer A (0.1 M TEAA + 5% ACN), and Buffer B (100% ACN). Mass spectrometry

[0501] Further quality control was performed by mass spectrometry to confirm the identity of the Di-siRNA complex. The product was observed to have a mass of 11,683 m / z, corresponding to the two sense strands of the siRNA linked at the 3' end via a TEG linker (Figure 14). In this particular example, the sense strand of the siRNA was designed to target the huntingtin gene (Htt). The chemical synthesis method summarized in Example 5 successfully produced the desired product, a di-branched siRNA complex targeting the huntingtin gene. LC-MS conditions included: 0-100% B over 7 min, 0.6 mL / min. Buffer A (25 mM HFIP, 15 mM DBA in 20% MeOH), Buffer B (20% Buffer A in MeOH). Example 7 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 1

[0502] In one example, a short hydrophobic alkylene or alkane (Hy) bearing an unprotected hydroxyl group (or amine) that can be phosphated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phosphitylation reagent) is used to generate the corresponding lipophilic phosphoramidite. These lipophilic phosphoramidites can be added to the terminal positions of branched oligonucleotides using conventional oligonucleotide synthesis conditions. This strategy is illustrated in Figure 29. Example 8 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 2

[0503] In another example, short / small aromatic planar molecules (Hy) bearing unprotected hydroxyl groups (or amines) with or without a positive charge that can be phosphitylated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phosphitylation reagent) are used to generate the corresponding aromatic hydrophobic phosphoramidites. The aromatic moiety can bear a positive charge. These lipophilic phosphoramidites can be added to the terminal positions of branched oligonucleotides using conventional oligonucleotide synthesis conditions. This strategy is illustrated in Figure 30. Example 9 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 3

[0504] To introduce biologically important hydrophobic moieties, short lipophilic peptides are generated by sequential peptide synthesis on a solid support or in solution (the latter is described herein). Short (1-10) amino acid chains can contain positively charged or polar amino acid moieties, as positive charges reduce the overall net charge of the oligonucleotide and therefore increase its hydrophobicity. Once a peptide of appropriate length is generated, it should be capped with acetic anhydride or another short fatty acid to increase hydrophobicity and mask the free amine. The carbonyl protecting group is then removed, and 3-aminopropan-1-ol is attached, phosphitylating the free hydroxyl group (or amine). This amino acid phosphoramidite can then be added to the 5' terminal position of a branched oligonucleotide using conventional oligonucleotide synthesis conditions. This strategy is illustrated in Figure 31. Example 10: Silencing ApoE in Neurodegeneration

[0505] Transgenic mouse models that mimic a range of pathologies associated with Alzheimer's disease are summarized in Table 6. While none of the models fully recapitulate the human disease, the models provide significant insight into the pathophysiology of beta-amyloid toxicity: [Table 9]

[0506] To evaluate the effect of ApoE silencing on neurodegenerative diseases, APP / PSEN1 mice were injected with di-siRNA by ICV at 8 weeks of age. ApoE or di-siRNA NTC The second group (n = 7 per group) was injected with GalNAc ApoE and GalNAc NTC The animals were euthanized at 4 months of age, 2 months after injection. NTC In the female group, 4 cases were di-siRNA. ApoE One female patient had di-siRNA. NTCOne case in the male group, di-siRNA ApoE One death was observed in the male group. NTC 3 cases in the GalNAc group ApoE One death was observed in the group. All deaths were due to natural causes of pathology in the animal model and occurred at least one month after injection.

[0507] Figure 34 is a diagram reporting mRNA silencing in all brain regions in APP / PSEN1 AD mice (2-5 females and 5 males per group, 237 μg / injection) at 2 months post-injection. Furthermore, strong silencing was observed in all brain regions. These results demonstrate that the present nucleic acids offer significant advantages in studying the role of ApoE in neurodegeneration. As shown in the diagram in Figure 35, the brain (di-siRNA) ApoE ) or liver (GalNAc-siRNA ApoE Novel siRNAs targeting either di- or di-siRNAs show potent target-specific mRNA silencing in target tissues 2 months after ICV injection. Potent target-specific protein silencing was also observed (Figure 36). The raw Western blots in Figure 37 show that di- and di-siRNAs are potent target-specific mRNA silencing in target tissues 2 months after ICV injection. NTC , di-siRNA ApoE , GalNAc NTC , or GalNAc ApoE 1 shows ApoE protein expression in the hippocampus, cortex, and liver after ICV or SC injection of

[0508] Disappearance of the second band, representing ApoE protein, indicates strong silencing compared to the NTC control group. Collectively, the evidence indicates the presence of two distinct pools of ApoE in the APP / PSEN1 model of Alzheimer's disease: CNS ApoE and systemic ApoE. This data suggests that the two pools of ApoE do not interact, do not affect each other's expression, and do not cross the blood-brain barrier. This data supports the hypothesis that one pool of ApoE (CNS or systemic) may influence the progression of neuropathology, while the other pool has little or no effect.

[0509] Cerebral cortical tissue slices (4 slices per animal) of 40 μm thickness were stained using a standard immunofluorescence protocol with anti-APP 6E10 and anti-Lamp1 antibodies. Tiled images (10x magnification) were taken with a Leica microscope. As can be seen in Figure 38, di-siRNA was detected. ApoE In treated animals, di-siRNA NTC A visual reduction in β-amyloid and Lamp1-positive plaques was observed compared to treated animals, and this reduction was statistically significant, as can be seen graphically in FIG.

[0510] Because a worsening phenotype in female mice has been previously observed, di-siRNA NTC Treated mice and di-siRNA ApoE Gender-specific analysis was performed among treated mice. As reported in Figure 40, significant differences were observed between both female and male groups, but the differences in female mice appeared to be more dramatic. Furthermore, the data reported in Figure 41 indicate that gender did not affect the efficacy of silencing.

[0511] Previous reports using oligonucleotides to silence human ApoE have demonstrated approximately 50% silencing of target mRNA and protein after ICV injection of approximately 400 μg. Meanwhile, our novel di-siRNA targeting human ApoE (E3 and E4) ApoE One month after injection of 237 μg of 1156, approximately 80-90% protein silencing was found in the hippocampus (FIG. 42A) and spinal cord (FIG. 42B).

[0512] Additional cortical staining was performed to detect di-siRNA ApoE The results showed a reduction in neuropathology after administration of 1156. Pathological amyloid beta-42 was measured in both female and male mice, and a reduction in amyloid beta-42 content was observed (Figure 45). Furthermore, X-34 staining was used to image protein aggregates in the mouse cerebral cortex. di-siRNA ApoEA reduction in X-34-positive plaques was also observed in the APP6E10- and LAMP1-positive plaques compared to controls (Figures 46A and 46B). When comparing the number of APP6E10- and LAMP1-positive plaques in the mouse cortex, no effect was observed with GalNAc-conjugated APOE siRNA, which was consistent with the di-siRNA. ApoE This indicates that the format is important in reducing neuropathology (Figure 46C).

[0513] di-siRNA ApoE To demonstrate that di-siRNA does not affect serum cholesterol, we administered di-siRNA to an APP / PSEN1 mouse model. ApoE and compared with GalNAc-conjugated APOE siRNA. ApoE 237 μg of di-siRNA was injected bilaterally via ICV. Two months after injection, LDL and HDL levels were measured. These results were compared with those obtained when GalNAc-conjugated siRNA was injected subcutaneously at 10 mg / kg. As shown in Figure 47, di-siRNA ApoE had no effect on HDL or LDL levels, whereas silencing APOE in the liver (via GalNAc conjugates) resulted in elevated LDL levels.

[0514] di-siRNA ApoE The efficacy of 1156 was further tested in a transgenic mouse model of Alzheimer's disease (3xTg-AD) over a 4-month period to demonstrate long-term silencing of APOE in the central nervous system. ApoE 237 μg of di-siRNA was injected, and APOE protein levels were measured 4 months after injection. ApoE potently inhibited APOE in the hippocampus and cortex, even 4 months after injection.

[0515] Additional APOE targets were tested in a 2'-O-methyl enriched pattern, as shown in Figure 43. Mice were injected with di-siRNA as described above. ApoE1133 and APOE protein levels were measured one month after injection. ApoE 1133 potently inhibited APOE in the hippocampus and cortex.

[0516] To further demonstrate the efficacy of the ApoE siRNA of the present invention, non-human primates (NHPs) were administered 25 mg of di-siRNA. ApoE Two months after injection, di-siRNA was detected in several regions of the posterior cortex and cerebellum. ApoE The accumulation of 1133 guide strand was measured, and as shown in Figure 50, high levels of siRNA accumulated in the sample tissues, with an average accumulation of 20 μg siRNA / gram tissue. Inclusion by Citation

[0517] The contents of all references (including literature, patents, patent applications, and websites) that may be cited throughout this application, as well as the literature cited therein, are expressly incorporated herein by reference in their entirety for all purposes. This disclosure employs, unless otherwise indicated, conventional techniques of immunology, molecular biology, and cell biology that are well known in the art.

[0518] This disclosure also incorporates by reference throughout techniques well known in the fields of molecular biology and drug delivery, including, but not limited to, those described in the following publications: Atwell et al. J. Mol. Biol. 1997, 270: 26-35; Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley &Sons, NY (1993); Ausubel, F.M. et al. eds., Short Protocols In Molecular Biology (4th Ed. 1999) John Wiley & Sons, NY. (ISBN 0-471-32938-X); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Giege, R. and Ducruix, A. Barrett, Crystallization of Nucleic Acids and Proteins, a Practical Approach, 2nd ea., pp. 20 1-16, Oxford University Press, New York, New York, (1999); Goodson, in Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981; Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991); Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Kontermann and Dubel eds., Antibody Engineering (2001) Springer-Verlag. New York. 790 pp. (ISBN 3-540-41354-5). Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); Lu and Weiner eds., Cloning and Expression Vectors for Gene Function Analysis (2001) BioTechniques Press. Westborough, MA. 298 pp. (ISBN 1-881299-21-X). Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Old, R.W. & S.B. Primrose, Principles of Gene Manipulation: An Introduction To Genetic Engineering (3d Ed. 1985) Blackwell Scientific Publications, Boston. Studies in Microbiology; V.2:409 pp. (ISBN 0-632-01318-4). Sambrook, J. et al. eds., Molecular Cloning: A Laboratory Manual (2d Ed. 1989) Cold Spring Harbor Laboratory Press, NY. Vols. 1-3. (ISBN 0-87969-309-6). Sustained and Controlled Release Drug Delivery Systems, JR Robinson, ed., Marcel Dekker, Inc., New York, 1978 Winnacker, EL From Genes To Clones: Introduction To Gene Technology (1987) VCH Publishers, NY (translated by Horst Ibelgaufts). 634 pp. (ISBN 0-89573-614-4). equivalent

[0519] The present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. Accordingly, the foregoing embodiments are considered in all respects to be illustrative and not limiting of the present disclosure. The scope of the present disclosure is, therefore, indicated by the appended claims, rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Claims

1. An RNA molecule of 15 to 35 bases in length that contains a region of complementarity that is substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

2. 2. The RNA molecule of claim 1, comprising a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

3. 3. The RNA molecule of claim 1 or 2, comprising single-stranded (ss) RNA or double-stranded (ds) RNA.

4. 4. The dsRNA of claim 3, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

5. 5. The dsRNA molecule of claim 3, wherein the RNA molecule is 15 to 25 base pairs in length.

6. 6. The dsRNA of any one of claims 3 to 5, wherein the region of complementarity is complementary to at least 10, 11, 12 or 13 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

7. 7. The dsRNA of any one of claims 3 to 6, wherein the complementary region contains no more than three mismatches with 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

8. 8. The dsRNA of claim 3, wherein the complementary region is completely complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

9. The dsRNA of any one of claims 3 to 9, which is blunt-ended.

10. 10. The dsRNA of any one of claims 3 to 9, comprising at least one single-stranded nucleotide overhang.

11. The dsRNA of any one of claims 3 to 10, comprising naturally occurring nucleotides.

12. 12. The dsRNA of any one of claims 3 to 11, comprising at least one modified nucleotide.

13. 13. The dsRNA of claim 12, wherein the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

14. 13. The dsRNA of claim 12, wherein the modified nucleotide comprises a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing an unnatural base.

15. 15. The dsRNA of any one of claims 3 to 14, comprising at least one 2'-O-methyl modified nucleotide and at least one nucleotide comprising a 5' phosphorothioate group.

16. 16. The dsRNA of any one of claims 3 to 15, wherein at least 80% is chemically modified.

17. The dsRNA of any one of claims 3 to 10 and 12 to 16, which is completely chemically modified.

18. 18. The dsRNA of any one of claims 3 to 17, comprising a cholesterol moiety.

19. 19. The RNA molecule of any one of claims 1 to 18, comprising a 5' end and a 3' end and having complementarity to a target, (1) the RNA molecule contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) The RNA molecule, in which the nucleotides at positions 1-2 to 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

20. 19. The dsRNA of any one of claims 3 to 18, having a 5' end and a 3' end, having complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The dsRNA, wherein the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.

21. 19. The RNA molecule of any one of claims 1 to 18, comprising a 5' end and a 3' end and having complementarity to a target, (1) the RNA molecule contains a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) nucleotides 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (5) The RNA molecule, in which the 1st and 2nd nucleotides from the 5'-end are linked via phosphorothioate bonds.

22. 18. The dsRNA of any one of claims 3 to 17, having a 5' end and a 3' end, having complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The dsRNA, wherein the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.

23. 23. The RNA of claim 20 or 22, wherein the second oligonucleotide has a hydrophobic molecule attached to its 3' end.

24. 24. The RNA of any one of claims 20, 22, and 23, wherein the bond between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol.

25. 25. The RNA of any one of claims 20 and 22 to 24, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.

26. 26. The RNA of any one of claims 20 and 22 to 25, wherein the nucleotides 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent ribonucleotides via phosphorothioate bonds.

27. A pharmaceutical composition for inhibiting expression of the apolipoprotein E (ApoE) gene in an organism, comprising the RNA of any one of claims 1 to 26 and a pharmaceutically acceptable carrier.

28. 28. The pharmaceutical composition of claim 27, wherein the dsRNA inhibits expression of the ApoE gene by at least 50%.

29. 28. The pharmaceutical composition of claim 27, wherein the dsRNA inhibits expression of the ApoE gene by at least 90%.

30. 1. A method for inhibiting expression of an ApoE gene in a cell, comprising: (a) introducing into a cell the double-stranded ribonucleic acid (dsRNA) of any one of claims 3 to 18, 20 and 22; and (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts of the ApoE gene, thereby inhibiting expression of the ApoE gene in the cells.

31. 26. A method of treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the dsRNA of any one of claims 3 to 18, 20 and 22.

32. 32. The method of claim 31, wherein the dsRNA is administered to the brain of the patient.

33. 32. The method of claim 31, wherein the dsRNA is administered by intracerebroventricular (ICV) injection.

34. 34. The method of claim 32 or 33, wherein administration of dsRNA causes a reduction in ApoE gene mRNA in the hippocampus.

35. The method of any one of claims 31 to 34, wherein administration of dsRNA causes a reduction in ApoE gene mRNA in the spinal cord.

36. 36. The method of any one of claims 31 to 35, wherein the dsRNA inhibits expression of the ApoE gene by at least 50%.

37. 37. The method of any one of claims 31 to 36, wherein the dsRNA inhibits expression of the ApoE gene by at least 90%.

38. 1. A vector for inhibiting expression of an ApoE gene in a cell, the vector comprising a regulatory sequence operably linked to a nucleotide sequence encoding an RNA molecule substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', wherein the RNA molecule is 10 to 35 bases in length, and which, when contacted with a cell expressing the ApoE gene, inhibits expression of the ApoE gene by at least 50%.

39. 39. The vector of claim 38, wherein the RNA molecule inhibits expression of the ApoE gene by at least 90%.

40. 39. The vector of claim 38, wherein the RNA molecule comprises ssRNA or dsRNA.

41. 41. The vector of claim 40, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

42. 39. A cell comprising the vector of claim 38.

43. An RNA molecule having a length of 15 to 50 bases and including a complementary region substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3', and targeting the open reading frame (ORF) or 3' untranslated region (UTR) of ApoE gene mRNA.

44. 44. The RNA molecule of claim 43, comprising ssRNA or dsRNA.

45. 45. The dsRNA of claim 43 or 44, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

46. A bi-branched RNA compound comprising two RNA molecules, each 15 to 50 bases in length, each comprising a region of complementarity substantially complementary to ApoE mRNA, wherein the two RNA molecules are linked to each other by one or more moieties independently selected from a linker, a spacer, and a branch point.

47. 47. The di-branched RNA compound of claim 46, comprising a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

48. 48. The di-branched RNA compound of claim 46 or 47, comprising a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

49. 49. The bi-branched RNA compound of any one of claims 46 to 48, wherein the RNA molecule comprises ssRNA or dsRNA.

50. 50. The di-branched RNA compound of any one of claims 46 to 49, wherein the RNA molecule comprises an antisense molecule or a gapmer molecule.

51. 51. The di-branched RNA compound of claim 50, wherein the antisense molecule comprises an antisense oligonucleotide.

52. 52. The di-branched RNA compound of claim 50 or 51, wherein the antisense molecule enhances resolution of the complementary region.

53. 53. The di-branched RNA compound of claim 52, wherein the degradation comprises nuclease degradation.

54. 54. The di-branched RNA compound of claim 53, wherein the nuclease degradation is mediated by RNase H.

55. 1. A branched oligonucleotide compound comprising two or more nucleic acids, each nucleic acid is 15 to 50 bases in length; each nucleic acid independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; and The branched oligonucleotide compound, wherein the two or more nucleic acids are covalently linked to one another, and the linkage may be mediated by one or more moieties selected from a linker, a spacer, and a branch point.

56. 56. The branched oligonucleotide compound of claim 55, wherein each nucleic acid independently comprises a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

57. 57. The branched oligonucleotide compound of claim 55 or 56, wherein each nucleic acid is 15 to 25 base pairs in length.

58. 58. The branched oligonucleotide compound of any one of claims 55 to 57, wherein each nucleic acid comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

59. 59. The branched oligonucleotide compound of any one of claims 55-58, wherein each nucleic acid comprises a dsRNA comprising a sense strand and an antisense strand, and each antisense strand independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

60. 60. The branched oligonucleotide compound of any one of claims 55-59, wherein each region of complementarity is independently complementary to at least 10, 11, 12, or 13 contiguous nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

61. 61. The branched oligonucleotide compound of any one of claims 55-60, wherein each complementary region independently contains no more than 3 mismatches to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

62. 62. The branched oligonucleotide compound of any one of claims 55-61, wherein each region of complementarity is perfectly complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

63. 63. The branched oligonucleotide compound of any one of claims 55 to 62, wherein each nucleic acid independently comprises at least one modified nucleotide.

64. 64. The branched oligonucleotide compound of claim 63, wherein the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

65. 64. The branched oligonucleotide compound of claim 63, wherein the modified nucleotide comprises a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing a non-natural base.

66. 66. The branched oligonucleotide compound of any one of claims 55 to 65, wherein each of said two or more nucleic acids is an RNA molecule comprising a 5' end and a 3' end and has complementarity to a target, wherein: (1) the RNA molecule contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; and (4) The branched oligonucleotide compound, wherein the nucleotides at positions 1-2 to 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.

67. 66. The branched oligonucleotide of any one of claims 55 to 65, wherein each nucleic acid comprises a 5' end and a 3' end, has complementarity to a target, and comprises a dsRNA comprising a first oligonucleotide and a second oligonucleotide, wherein: (1) the first oligonucleotide comprises a sequence substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The branched oligonucleotide, wherein the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.

68. 66. The branched oligonucleotide compound of any one of claims 55 to 65, wherein said two or more nucleic acids each comprise an RNA molecule comprising a 5' end and a 3' end and having complementarity to a target, wherein: (1) the RNA molecule contains a region of three consecutive 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate linkages; (4) nucleotides 1-2 through 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (5) The branched oligonucleotide compound, wherein the nucleotides at positions 1 and 2 from the 5' end are linked to each other via phosphorothioate bonds.

69. Formula (I) 【Chemical 1】 [In formula (I), L comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, wherein formula (I) may further comprise one or more branch points B, and one or more spacers S, wherein B is, independently at each occurrence, a polyvalent organic species or derivative thereof; S, at each occurrence, independently comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; N is a double-stranded nucleic acid having a length of 15 to 35 bases, including a sense strand and an antisense strand, wherein: the antisense strand comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; the sense strand and the antisense strand each independently comprise one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8. A compound represented by the formula:

70. Formulas (I-1) to (I-9): 【Table 1】 70. The compound of claim 69, having a structure selected from:

71. The antisense strand is 【Chemistry 2】 【Chemistry 3】 71. The compound of claim 69 or 70, comprising a 5' terminal group R selected from the group consisting of:

72. Formula (II): 【Chemistry 4】 [In the formula, X is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - indicates a phosphodiester internucleoside linkage; = indicates a phosphorothioate internucleoside linkage; and Each occurrence alone indicates a base pairing interaction or mismatch.

70. The compound of claim 69 having the structure:

73. Formula (III): 【Chemistry 5】 [In the formula, X is, independently for each occurrence, a nucleotide containing a 2'-deoxy-2'-fluoro modification; X is, independently for each occurrence, a nucleotide containing a 2'-O-methyl modification; Y is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently at each occurrence, a nucleotide containing a 2'-O-methyl modification.

73. The compound of claim 72 having the structure:

74. Formula (IV): 【Chemistry 6】 [In the formula, X is independently selected at each occurrence from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; Y, at each occurrence, is independently selected from adenosine, guanosine, uridine, cytidine, and chemically modified derivatives thereof; - indicates a phosphodiester internucleoside linkage; = indicates a phosphorothioate internucleoside linkage; and Each occurrence alone indicates a base pairing interaction or mismatch.

70. The compound of claim 69 having the structure:

75. Formula (V): 【Chemistry 7】 [In the formula, X is, independently for each occurrence, a nucleotide containing a 2'-deoxy-2'-fluoro modification; X is, independently for each occurrence, a nucleotide containing a 2'-O-methyl modification; Y is, independently for each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently at each occurrence, a nucleotide containing a 2'-O-methyl modification.

75. The compound of claim 74 having the structure:

76. L is the structure L1: 【Chemistry 8】 76. The compound of any one of claims 69 to 75, wherein

77. R is R 3 and n is 2.

78. L is the structure L2: 【Chemistry 9】 76. The compound of any one of claims 69 to 75, wherein

79. R is R 3 and n is 2.

80. Formula (VI): 【Chemistry 10】 [In formula (VI), L comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, wherein formula (VI) may further comprise one or more branch points B, and one or more spacers S, B independently at each occurrence comprises a polyvalent organic species or derivative thereof; S, at each occurrence, independently comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; each cNA is independently a carrier nucleic acid that includes one or more chemical modifications; each cNA independently comprises at least 15 consecutive nucleotides of 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'; and n is 2, 3, 4, 5, 6, 7, or 8. A delivery system for therapeutic nucleic acids having the structure:

81. Formulas (VI-1) to (VI-9): 【Table 2】 81. The delivery system of claim 80, having a structure selected from:

82. 82. The delivery system of claim 80 or 81, wherein each cNA independently comprises at least one chemically modified nucleotide.

83. 83. The delivery system of any one of claims 80 to 82, further comprising n therapeutic nucleic acids (NAs), wherein each NA is hybridized to at least one cNA.

84. 84. The delivery system of claim 83, wherein each NA independently comprises at least 16 consecutive nucleotides.

85. 85. The delivery system of claim 84, wherein each NA independently comprises 16 to 20 consecutive nucleotides.

86. 86. The delivery system of any one of claims 83 to 85, wherein each NA comprises an unpaired overhang of at least two nucleotides.

87. 87. The delivery system of claim 86, wherein the nucleotides of the overhang are linked via phosphorothioate linkages.

88. 88. The delivery system of any one of claims 80 to 87, wherein each NA is independently selected from the group consisting of DNA, siRNA, antagomir, miRNA, gapmer, mixmer, and guide RNA.

89. A pharmaceutical composition for inhibiting expression of the apolipoprotein E (ApoE) gene in an organism, comprising a compound according to any one of claims 44 to 79 or a system according to any one of claims 80 to 88, and a pharmaceutically acceptable carrier.

90. 90. The pharmaceutical composition of claim 89, wherein the compound or system inhibits expression of the ApoE gene by at least 50%.

91. 91. The pharmaceutical composition of claim 90, wherein the compound or system inhibits expression of the ApoE gene by at least 90%.

92. 1. A method for inhibiting expression of an ApoE gene in a cell, comprising: (a) introducing a compound according to any one of claims 44 to 79 or a system according to any one of claims 80 to 88 into a cell; and (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts of the ApoE gene, thereby inhibiting expression of the ApoE gene in the cells.

93. 87. A method of treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of a compound of any one of claims 44-79 or a system of any one of claims 80-88.

94. 94. The method of claim 93, wherein the compound or system is administered to the brain of the patient.

95. 95. The method of claim 94, wherein the compound or system is administered by intracerebroventricular (ICV) injection.

96. 96. The method of any one of claims 93 to 95, wherein administration of the compound or system causes a reduction in ApoE gene mRNA in the hippocampus.

97. 97. The method of any one of claims 93 to 96, wherein administration of the compound or system causes a reduction in ApoE gene mRNA in the spinal cord.

98. 98. The method of any one of claims 93 to 97, wherein the compound or system inhibits expression of the ApoE gene by at least 50%.

99. 99. The method of claim 98, wherein the compound or system inhibits expression of the ApoE gene by at least 90%.

100. A branched oligonucleotide compound comprising two nucleic acids, each 15-35 bases in length, each nucleic acid comprising a region of complementarity substantially complementary to ApoE mRNA, wherein the two nucleic acids are covalently linked to one another, and the linkage may be mediated by one or more moieties, including a linker, spacer, or branch point.

101. 101. The branched oligonucleotide compound of claim 100, wherein each nucleic acid independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

102. 102. The branched oligonucleotide compound of claim 100 or 101, wherein each nucleic acid independently comprises a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

103. 103. The branched oligonucleotide compound of any one of claims 100-102, wherein each nucleic acid independently comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

104. 104. The branched oligonucleotide compound of any one of claims 100-103, wherein each nucleic acid independently comprises an antisense molecule or a gapmer molecule.

105. 100. A method of treating or managing an amyloid-related disease, comprising administering to a patient diagnosed as having or at risk of developing the disease a therapeutically effective amount of a compound of any one of claims 44-79 or a system of any one of claims 80-88.

106. 106. The method of claim 105, wherein the disease is selected from the group consisting of Alzheimer's disease, cerebral amyloid angiopathy, mild cognitive impairment, moderate cognitive impairment, and combinations thereof.

107. 107. The method of claim 105 or 106, wherein the compound or system is administered to the brain of the patient.

108. 108. The method of claim 107, wherein the compound or system is administered by intracerebroventricular injection.

109. 109. The method of any one of claims 105 to 108, wherein the administration of a compound or system inhibits, delays, prevents or reduces cognitive decline.

110. 110. The method of any one of claims 105 to 109, wherein administration of a compound or system inhibits, delays, prevents, or reduces beta-amyloid plaque formation.

111. 111. The method of any one of claims 105 to 110, wherein the administration of a compound or system inhibits, delays, prevents or reduces neurodegeneration.

112. A method for treating or managing Alzheimer's disease, comprising administering to a patient diagnosed with or at risk of developing the disease a therapeutically effective amount of a branched oligonucleotide compound comprising two nucleic acids 15 to 35 bases in length, each nucleic acid comprising a region of complementarity substantially complementary to ApoE mRNA, and the two nucleic acids being linked to each other by one or more moieties comprising a linker, spacer, or branch point.

113. 113. The method of claim 112, wherein each nucleic acid of the branched oligonucleotide compound independently comprises a region of complementarity substantially complementary to 5' GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3' or 5' UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3'.

114. 114. The method of claim 112 or 113, wherein each nucleic acid of the branched oligonucleotide independently comprises a region of complementarity substantially complementary to one or more of 5' GAUUCACCAAGUUUA 3', 5' CAAGUUUCACGCAAA 3', and 5' CCUAGUUUAAUAAAGAUUCA 3'.

115. 115. The method of any one of claims 112 to 114, wherein each nucleic acid of the branched oligonucleotide compound comprises single-stranded (ss) RNA or double-stranded (ds) RNA.

116. 116. The method of any one of claims 112 to 115, wherein each nucleic acid of the branched oligonucleotide compound comprises an antisense molecule or a gapmer molecule.

117. 117. The method of any one of claims 112 to 116, wherein the branched oligonucleotide compound is administered to the brain of the patient.

118. 118. The method of claim 117, wherein the branched oligonucleotide compound is administered by intracerebroventricular injection.

119. 119. The method of any one of claims 112 to 118, wherein the administration of a branched oligonucleotide compound inhibits, delays, prevents or reduces cognitive decline.

120. 120. The method of any one of claims 112-119, wherein administration of a branched oligonucleotide compound inhibits, slows, prevents or reduces beta-amyloid plaque formation.

121. 121. The method of any one of claims 112 to 120, wherein neurodegeneration is inhibited, delayed, prevented or reduced by administration of a branched oligonucleotide compound.

Images