Enzyme and pathway modulation with sulfhydryl compounds and their derivatives

Abstract

To provide anti-α-synuclein antibodies with monogalactosylated (G1) and digalactosylated (G2) glycans, and to provide methods for producing the antibodies.SOLUTION: The present invention relates to proteins, particularly antibodies such as anti-CD20 / anti-CD3 bispecific antibodies and anti α-synuclein antibodies, having monogalactosylated (G1) and digalactosylated (G2) glycans. More particular, the present invention relates to galactosylation engineering to generate proteins with improved therapeutic properties, including proteins with increased titer. Further, the invention relates to a cell culture medium and a mammalian cell as well as methods using the cell culture medium and the mammalian cell for producing the proteins. Moreover, the present invention relates to the use of the antibodies as a medicament such as for the treatment of cancer, particularly cancer associated with B-cells, or Parkinson's disease.SELECTED DRAWING: None

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention relates to proteins bearing monogalactosylated (G1) and digalactosylated (G2) glycans, particularly antibodies such as anti-CD20 / anti-CD3 bispecific antibodies and anti-α-synuclein antibodies. More particularly, the present invention relates to galactosylation engineering to generate proteins with improved therapeutic properties, including proteins with increased titer. Furthermore, the present invention relates to cell culture media and mammalian cells, as well as methods of using the cell culture media and mammalian cells to produce the proteins. Furthermore, the present invention relates to the use of the antibodies as pharmaceuticals, such as for the treatment of cancer, particularly B-cell-related cancers, or Parkinson's disease. [Background technology]

[0002] background Many glycoproteins are major products of the biotechnology industry and have been utilized for therapeutic purposes. Examples include erythropoietin (EPO), therapeutic monoclonal antibodies (therapeutic mAbs), tissue plasminogen activator (tPA), interferon-α, granulocyte-macrophage colony-stimulating factor (GM-CSF), and human chorionic gonadotropin (hCG) (Cumming et al., Glycobiology 1:115-130 (1991)). Therefore, the oligosaccharide components of glycoproteins can affect their properties related to the efficacy of therapeutic glycoproteins, including, but not limited to, physical stability, resistance to protease attack, interaction with the immune system, pharmacokinetics, and specific biological activity. Such properties may depend not only on the presence or absence of oligosaccharides but also on their specific structures.

[0003] Generally, native immunoglobulins or antibodies are tetrameric glycoproteins, usually composed of two light chains and two heavy chains. Such immunoglobulins generally contain oligosaccharides at conserved positions in the heavy chain constant region, which can affect protein assembly, secretion, or functional activity in various ways (Boyd et al., (1995) Mol. Immunol. 32:1311-1318; Wittwer A., ​​and Howard, SC (1990) Biochem. 29:4175-4180; Wright, A., and Morrison, SL, Trends Biotech. 15:26-32 (1997)).

[0004] For example, increased antibody galactosylation may be functionally more anti-inflammatory, as described, for example, by Karsten et al. (Nature Medicine 18.9 (2012) 1401-1406), who showed that high galactosylation of IgG immune complexes in mice promotes the association of FcγRIIB with Dectin-1 and blocks the pro-inflammatory effector functions of C5aR and CXCR226. Other reported effects of galactosylation on IgG molecules include alterations in physicochemical properties such as conformation and surface accessibility (Krapp et al., J. Mol. Biol. 325 (2003) 979-89; Mimura et al., Mol. Immunol. 37 (2000) 697-706). Fortunato and Colina (J. Phys. Chem. 118 (2014) 9844-9851) used explicit water atom molecular dynamics simulations to study the effect of galactosylation in the Fc domain of immunoglobulin G1. They suggested that glycosylation could be used as a pathway to improve the aggregation resistance of monoclonal antibodies for therapeutic treatment.

[0005] Considering the impact of the glycosylation level and / or glycosylation pattern of various glycoproteins on their properties, particularly those related to therapeutic efficacy, it is important to ensure that the glycosylation pattern of glycoproteins, particularly those produced for clinical use, is uniform, so that the favorable properties of the antibody are at least retained.

[0006] However, expression of recombinant glycoproteins in host cells typically results in variations in the oligosaccharide structures attached to specific glycosylation sites, such that the produced glycoprotein exists as multiple glycoforms. Thus, it has been technically very challenging to precisely regulate and control the glycosylation level and / or glycosylation pattern in vivo in producing cells for a given therapeutic protein production process.

[0007] Over the past few decades, various methods have been proposed, including the introduction or overexpression of specific enzymes involved in oligosaccharide production into host cells (U.S. Pat. No. 5,047,355; U.S. Pat. No. 5,510,261), changes in oxygenation levels, pH, purification schemes, etc. (Werner, R. and Noe, W. (1993), Drug Res. 43:1134-1139; Werner, R. and Noe, W. (1993), Drug Res. 43:1242-1249; Hayter et al. (1992) Biotech and Bioeng. 39:327-335; Borys et al. (1994), Biotech and Bioeng. 43:505-514; Borys et al. (1993), Bio / technology 11:720-724; Hearing et al. (1989) J. Cell Several process parameters that can alter the glycosylation pattern of glycoproteins in host cells have been investigated, including those described in U.S. Patent No. 5,096,816; Chotigeat, W. (1994), Cytotech. 15:217-221; Goochee et al., in Frontiers in Bioprocessing II, Todd et al., eds. (1992) American Chemical Society pp. 199-240; U.S. Patent No. 5,096,816; Chotigeat, W. (1994), Cytotech. 15:217-221).

[0008] As outlined above, production of glycoproteins with desired glycosylation levels and / or glycosylation patterns is important to at least retain, and optionally optimize, the favorable properties of said antibodies, particularly those related to their therapeutic efficacy.

[0009] The technical problem is solved by providing the embodiments provided below and characterized in the appended claims. Summary of the Invention

[0010] Summary of the Invention Over the past few years, considerable efforts have been made to fundamentally understand and technically control the protein galactosylation process in mammalian cells, such as CHO cells. To date, several general strategies have been developed to influence the degree of protein glycosylation, the effects of which are often cell-type and product-specific: 1) improving the activity of glycosyltransferases, 2) improving the availability and activity of nucleotide sugar transporters for nucleotide sugar transfer, 3) increasing the availability of nucleotide sugar substrates, and 4) reducing glycosidase activity for extracellular glycan degradation (Hossler et al., Glycobiology 19(9)(2009)936-949; Hossler, Genomics and Systems Biology of Mammalian Cell Culture 127(2012)187-219). Crowell et al. (Biotechnol Bioeng 96(3)(2007)538-549) showed that supplementation of CHO cell cultures with manganese, a preferred cofactor for both the oligosaccharyltransferase complex and β1,4-galactosyltransferase, increased rhEPO N-glycan site occupancy and β1,4-galactosylation in late cultures. Gramer et al. (Biotechnol Bioeng. 108(7)(2011)1591-602) reported that the synergistic combination of uridine, MnCl2, and galactose quantitatively significantly increased mAb galactosylation relative to the total UMG concentration supplied. Several approaches have also been reported, using overexpression and / or knockdown of glycosyltransferases and nucleotide sugar transporters (Jeong et al., J Microbiol Biotechnol 18(12)(2008)1945-1952; Weikert et al., Nat Biotechnol 17(11)(1999)1116-1121). Supplying nucleotide sugar precursors has been reported as a possible strategy for controlling glycosylation of recombinant proteins (Wong et al., Biotechnology and Bioengineering 107.2(2010)321-336).Specifically, the addition of galactose, glucosamine, and N-acetylmannosamine to cell culture media has been shown to increase intracellular nucleotide sugar levels. However, the effect of increasing intracellular nucleotide sugar levels on glycosylation gene expression has not been fully characterized. Furthermore, increasing intracellular nucleotide sugar levels has not necessarily resulted in improved glycosylation of recombinant proteins. Some studies have employed the strategy of knocking down cellular glycosidases to improve protein glycosylation (Ngantung et al., Biotechnol Bioeng. 95(1)(2006)106-19). However, this approach has not always worked. In summary, basic research is still needed to investigate how various external factors affect the intracellular galactosylation process.

[0011] As described herein, antibody galactosylation depends on the concentration of UDP-galactose present in cells, as these sugar molecules act as substrates for galactosylation. Consequently, increased UDP-galactose content was found to be associated with higher galactosylation and sialylation of antibodies expressed in CHO cells. Changes in intracellular UDP-galactose levels can have a significant impact on glycan heterogeneity.

[0012] In this context, the UDP-glucose and UDP-galactose conversion pathway, which includes two identified enzymes, uridine diphosphate α-D-glucose epimerase (UDP-Glc-E) and UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase (UDP-Gal-T), has been found to play an important role in the UDP-glucose and UDP-galactose conversion pathway in mammalian cells, such as CHO cells.

[0013] In this regard, UDP-Gal-T (EC 2.7.7.12) is a very special class of enzyme that can be regulated by several simple sulfhydryl molecules, such as L-cysteine, glutathione, 2-mercaptoethanol, and DTT. As early as 1966, Mayes and Hansen (Methods Enzymol. 9 (1966) 708-713) found that L-cysteine ​​could be used to activate and stimulate the enzymatic activity of partially purified UDP-Gal-T from bovine liver. Subsequently, Mayes (Arch. Biochem. Biophys. 172 (1976) 715-720) conducted extensive studies using fully purified UDP-Gal-T from bovine liver, further confirming this activating function of L-cysteine. Similar studies have been conducted on UDP-Gal-T from other organisms. Saito et al. (J. Biol. Chem. 242 (1967) 2362-2368) demonstrated that L-cysteine ​​stimulates purified E. coli UDP-Gal-T to reach its maximum activity. Chowdhury (Indian J. Biochem. Biophys. 16 (1979) 273-277) also confirmed this observation using UDP-Gal-T purified from E. coli.

[0014] Thus, the present invention has discovered that it is possible to regulate and control the intracellular UDP-galactose content and galactosylation of recombinant proteins such as antibodies during the manufacturing process using sulfhydryl compounds or their derivatives. For example, the present invention has discovered that it is possible to regulate and control the N-glycan processing of recombinant monoclonal antibodies during the manufacturing process using sulfhydryl compounds or their derivatives, thereby successfully and specifically manipulating the cell culture process for fine-tuning antibody galactosylation.

[0015] One unique feature of the present invention is the use of simple sulfhydryl molecules or compounds such as L-cysteine ​​to modulate the in vivo activity of UDP-Gal-T in mammalian cell lines, such as CHO K1 and its derivative cell lines, to produce recombinant proteins with monogalactosylated (G1) or digalactosylated (G2) glycans. In other words, the present invention provides a new approach for modulating sugar and galactose-constituting UDP sugars in vivo by modulating a newly identified and characterized conversion pathway, specifically using two enzymes, UDP-Gal-T and UDP-Glc-E, in mammalian cells, such as CHO K1 and its derivative cell lines, to produce recombinant proteins with monogalactosylated (G1) or digalactosylated (G2) glycans. As shown in the examples herein, it has been demonstrated that by adjusting the relative medium concentrations of specific sulfhydryl compounds or their derivatives, the galactosylation of different antibodies can be precisely controlled in high-yield, batch, or fed-batch production processes with minimal impact on other glycoforms, other product quality attributes, or cell culture performance. Furthermore, these data demonstrate that precise regulation and control of complex and dynamic cellular processes at production scale is possible to define the molecular heterogeneity and biological activity of recombinant antibody products. This enables understanding of key effector interactions that form the basis for knowledge-based design of cell culture media or feed compositions to achieve specific levels of antibody galactosylation while maximizing cell growth and productivity.

[0016] In particular, the present invention provides an anti-CD20 / anti-CD3 bispecific antibody having monogalactosylated (G1) and digalactosylated (G2) glycans, comprising a first antigen-binding domain and a second antigen-binding domain, wherein the first antigen-binding domain comprises: (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 25; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 26, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 27; a light chain variable domain (VL) comprising the second antigen-binding domain comprises: (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 34; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 35, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 36 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 37; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 38, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 39 a light chain variable domain (VL) comprising The present invention relates to an anti-CD20 / anti-CD3 bispecific antibody having 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan; preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan; more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

[0017] Preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody (a) the first antigen-binding domain comprises the VH sequence of SEQ ID NO: 28 and the second antigen-binding domain comprises the VH sequence of SEQ ID NO: 40; (b) the first antigen-binding domain comprises the VL sequence of SEQ ID NO: 29 and the second antigen-binding domain comprises the VL sequence of SEQ ID NO: 41; (c) The first and second antigen-binding domains comprise the VH sequence described in (a) and the VL sequence described in (b).

[0018] Preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody (a) the VH sequence of the first antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 28, and the VH sequence of the second antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 40; (b) the VL sequence of the first antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 29 and the VL sequence of the second antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 41; or (c) An anti-CD20 / anti-CD3 bispecific antibody comprises the VH sequences of the first and second antigen-binding domains described in (a) and the VL sequences of the first and second antigen-binding domains described in (b).

[0019] Even more preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, the anti-CD20 / anti-CD3 bispecific antibody being (a) a first heavy chain of SEQ ID NO: 46 and a second heavy chain of SEQ ID NO: 45 (b) a first light chain of SEQ ID NO: 33 and a second light chain of SEQ ID NO: 44; or (c) The first heavy chain and the second heavy chain described in (a) and the first light chain and the second light chain described in (b).

[0020] Most preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, and the anti-CD20 / anti-CD3 bispecific antibody is (a) a first heavy chain of SEQ ID NO: 47 and a second heavy chain of SEQ ID NO: 45 (b) a first light chain of SEQ ID NO: 33, a second light chain of SEQ ID NO: 44, and a third light chain; or (c) The first heavy chain and the second heavy chain described in (a) and the first light chain, the second light chain and the third light chain described in (b).

[0021] Similarly, the present invention provides an anti-α-synuclein antibody having monogalactosylated (G1) and digalactosylated (G2) glycans, (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 10; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 11, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 12 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 13; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 14, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 15 a light chain variable domain (VL) comprising 17.2 to 48.0% (w / w) G1 and 3.1 to 15.0% (w / w) G2 per total glycan; preferably 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan; preferably 27.2 to 47.0% G1 and 4.4 to 15.0% G2 per total glycan; preferably 40.0 to 4 More preferably, the anti-α-synuclein antibody has 41.0 to 45.0% (w / w) G1 and 9.5 to 14.0% (w / w) G2 per total glycan, and most preferably 42.1 to 43.9% (w / w) G1 and 10.6 to 13.3% (w / w) G2 per total glycan.

[0022] Preferably, the anti-alpha-synuclein antibody is (a) the VH sequence of SEQ ID NO: 16; (b) the VL sequence of SEQ ID NO: 17; or (c) the VH sequence described in (a) and the VL sequence described in (b) Includes:

[0023] More preferably, the anti-alpha-synuclein antibody is (a) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 16; (b) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 17; or (c) the VH sequence described in (a) and the VL sequence described in (b) Includes:

[0024] Even more preferably, the anti-alpha-synuclein antibody comprises a heavy chain of SEQ ID NO:20 and a light chain of SEQ ID NO:21.

[0025] Preferably, the monogalactosylated (G1) and digalactosylated (G2) glycans of the anti-CD20 / anti-CD3 bispecific antibody or anti-α-synuclein antibody as disclosed in the context of the present invention are associated with N-acetylglucosamine.

[0026] Similarly, the present invention relates to a cell culture medium for producing the antibodies disclosed in the context of the present invention having monogalactosylated (G1) and digalactosylated (G2) glycans in mammalian cells, wherein the cell culture medium comprises sulfhydryl groups from one or more sulfhydryl compounds at a concentration greater than 4.0 mM and less than 10.0 mM and glucose at a concentration greater than at least 3.0 g / L.

[0027] Preferably, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free and / or oligopeptide-free cell culture medium, more preferably a chemically defined medium, more preferably a serum-free, protein-free and oligopeptide-free cell culture medium.

[0028] Similarly, the present invention provides a mammalian cell producing an anti-CD20 / anti-CD3 bispecific antibody disclosed in the context of the present invention having monogalactosylated (G1) and digalactosylated (G2) glycans, comprising a polynucleotide comprising a sequence that has 80% identity to a polynucleotide encoding a first antigen-binding domain comprising a first and second heavy chain variable domain (VH) disclosed in the context of the present invention, or a polynucleotide comprising a sequence that has 80% identity to a polynucleotide comprising a sequence encoding a second antigen-binding domain comprising a first and second light chain variable domain (VL) disclosed in the context of the present invention, or one or more vectors containing such polynucleotides Including, It relates to mammalian cells, wherein said cells are cultured in a cell culture medium as disclosed in the context of the present invention.

[0029] Preferably, the mammalian cell is a mammalian cell that encodes a sequence having 80% identity to a polynucleotide encoding the first and second heavy chains as disclosed in the context of the present invention, or a sequence having 80% identity to a polynucleotide comprising a sequence encoding the first and second light chains as disclosed in the context of the present invention, or one or more vectors containing such polynucleotides further comprising The cells are cultured in a cell culture medium as disclosed in the context of the present invention.

[0030] Similarly, the present invention relates to an anti-α-synuclein antibody having monogalactosylated (G1) glycans and digalactosylated (G2) glycans, comprising a polynucleotide comprising a sequence having 80% identity to a polynucleotide encoding a heavy chain variable domain (VH) disclosed in the context of the present invention, or a polynucleotide comprising a sequence having 80% identity to a polynucleotide encoding a light chain variable domain (VL) disclosed in the context of the present invention; Such polynucleotides and one or more vectors comprising The cells are cultured in a cell culture medium as disclosed in the context of the present invention.

[0031] Similarly, the present invention provides a method for producing an anti-CD20 / anti-CD3 bispecific antibody as disclosed in the context of the present invention, which has monogalactosylated (G1) and digalactosylated (G2) glycans, comprising the steps of: (a) culturing mammalian cells as disclosed in the context of the present invention in a cell culture medium as disclosed in the context of the present invention, wherein at least greater than 4.0 mM and less than 10.0 mM sulfhydryl groups from one or more sulfhydryl compounds and a glucose concentration of at least greater than 3.0 g / L mp in the cell culture medium are maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating said antibody; The present invention relates to a method, comprising:

[0032] Preferably, maintaining concentrations effective for the production of anti-CD20 / anti-CD3 bispecific antibodies having 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan; preferably, 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan; more preferably, 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably, 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

[0033] Preferably, culturing the mammalian cells results in an increase in titer of the antibody of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and most preferably at least 80%, compared to the titer in a corresponding culture of the mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium between at least 4.0 mM and less than 10.0 mM. As another example, culturing the mammalian cells results in an increase in titer of the antibody of 30-75%, compared to the titer in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium between at least 4.0 mM and less than 10.0 mM.

[0034] Similarly, the present invention provides a method for producing an alpha-synuclein antibody as disclosed in the context of the present invention, having monogalactosylated (G1) and digalactosylated (G2) glycans, comprising: (a) culturing mammalian cells as disclosed in the context of the present invention in a cell culture medium as disclosed in the context of the present invention, wherein a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 4.0 mM and less than 10.0 mM and a glucose concentration of at least 3.0 g / L mp in the cell culture medium is maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating said antibody; The present invention relates to a method, comprising:

[0035] Preferably, the concentrations are 17.2 to 48.0% (w / w) G1 and 3.1 to 15.0% (w / w) G2 per total glycan, 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan; preferably 27.2 to 47.0% G1 and 4.4 to 15.0% G2 per total glycan; preferably 40.0 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan. It is effective for producing anti-α-synuclein antibodies having 46.0% (w / w) G1 and 8.4 to 15.0% (w / w) G2; more preferably, 41.0 to 45.0% (w / w) G1 and 9.5 to 14.0% (w / w) G2 per total glycan, and most preferably, 42.1 to 43.9% (w / w) G1 and 10.6 to 13.3% (w / w) G2 per total glycan.

[0036] Preferably, culturing the mammalian cells results in an increase in titer of the antibody of at least 10%, preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, and most preferably at least 100%, compared to the titer in a corresponding culture of said mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium above at least 4.0 mM and below 10.0 mM.

[0037] Preferably, the culture of the mammalian cells does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium greater than 4.0 mM and less than 10.0 mM, compared to the non-monogalactosylated (G1) and non-digalactosylated (G2) forms of the anti-alpha-synuclein antibody in a corresponding culture of the mammalian cells. (i) an increase in protein target binding of at least 10%, preferably at least 20%, more preferably at least 35%, even more preferably at least 45%, and most preferably at least 50%; (ii) an increase in neonatal Fc receptor (FcRn) binding of at least 10%, preferably at least 20%, more preferably at least 33%, more preferably at least 40%, and most preferably at least 45%, and / or (iii) an increase in FcyRIIa binding of at least 10%, preferably at least 20%, more preferably at least 36%, even more preferably 45%, and most preferably 50%. The present invention provides an anti-α-synuclein antibody having monogalactosylated (G1) and digalactosylated (G2) glycans characterized by:

[0038] The method disclosed in connection with the present invention preferably comprises culturing mammalian cells with a starting concentration of sulfhydryl groups from one or more sulfhydryl compounds at least greater than 3.0 mM and less than 10.0 mM. Preferably, the method further comprises pre-culturing the mammalian cells in a cell culture medium prior to said culturing. Preferably, the concentration is maintained for at least 5 days, preferably at least 7 days, more preferably at least 10 days, even more preferably at least 12 days, and most preferably at least 14 days.

[0039] Preferably, the sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium disclosed in connection with the present invention are contained in reduced and / or oxidized form, more preferably the concentration of the reduced form of said sulfhydryls ranges between above 4.0 mM and below 10.0 mM, and / or the concentration of the oxidized form of said sulfhydryls ranges between above 2.0 mM and below 5.0 mM.

[0040] Preferably, the methods disclosed in the context of the present invention further comprise recovering the anti-CD20 / anti-CD3 bispecific antibody or the anti-α-synuclein antibody.

[0041] Preferably, the methods disclosed in the context of the present invention further comprise measuring the levels of monogalactosylated (G1) and digalactosylated (G2) glycans of the anti-CD20 / anti-CD3 bispecific antibody or anti-α-synuclein antibody. Preferably, the methods further comprise formulating the anti-CD20 / anti-CD3 bispecific antibody or anti-α-synuclein antibody into a formulation.

[0042] Preferably, the cell culture medium disclosed in the context of the present invention comprises at least more than 4.0 mM and not more than 9.0 mM, preferably at least more than 4.0 mM and not more than 8.0 mM, more preferably at least more than 4.0 mM and not more than 7.0 mM, and even more preferably at least more than 4.0 mM and not more than 6.0 mM of sulfhydryl groups from one or more sulfhydryl compounds.

[0043] Preferably, the cell culture medium disclosed in the context of the present invention comprises sulfhydryl groups from one or more sulfhydryl compounds at a concentration of at least 5.0 mM and less than 10.0 mM, preferably at least 5.0 mM and not more than 9.0 mM, more preferably at least 5.0 mM and not more than 8.0 mM, even more preferably at least 5.0 mM and not more than 7.0 mM, and most preferably at least 5.0 mM and not more than 6.0 mM.

[0044] Preferably, the cell culture medium disclosed in connection with the present invention comprises at least more than 2.0 g / L of glucose, preferably at least more than 3.0 g / L of glucose, more preferably at least more than 4.0 g / L of glucose.

[0045] Preferably, the cell culture medium comprises at most 13.0 g / L, preferably at most 8.0 g / L, more preferably at most 7.0 g / L, even more preferably at most 6.0 g / L, and most preferably at most 5.0 g / L of glucose.

[0046] Preferably, the cell culture medium comprises between more than 2.0 g / L and up to 13.0 g / L of glucose, preferably between more than 2.0 g / L and up to 8.0 g / L of glucose, more preferably between more than 2.0 g / L and up to 7.0 g / L of glucose, even more preferably between more than 2.0 g / L and up to 6.0 g / L of glucose, and most preferably between more than 2.0 g / L and up to 5.0 g / L of glucose.

[0047] Preferably, the one or more sulfhydryl compounds of the cell culture media disclosed in connection with the present invention are selected from the group consisting of cysteine, cystine, succinimer, methimazole, cysteamine, azathioprine, mercaptopurine, S-methylcysteine, selenocysteine, S-phosphocysteine, 4'-phosphopantetheine, butyrylthiocholine, carbocysteine, N-sulfocysteine, alethyl, acetylcysteine, dimercaprol, coenzyme M, sodium aurothiomalate, pantethine, bucillamine, methylselenocysteine, dimercaptosuccinic acid, acetylcysteinamide, thioglycolic acid, 2,3-dimercaptopropanol, O-methylmercaptoethanol, mercaptoacetic acid, flumercaptopropionic acid, methyl mercaptan, S-methylmercaptoethanol, glutathione, glutathione deivatives, and combinations thereof. More preferably, the one or more sulfhydryl compounds are selected from the group consisting of cysteine, cystine, and combinations thereof. Even more preferably, the one or more sulfhydryl compounds are cysteine, and the cysteine ​​concentration in the cell culture medium is greater than 4.0 mM and less than 10.0 mM, preferably, the cysteine ​​concentration is at least 5.0 mM and not more than 6.0 mM. Also preferably, the one or more sulfhydryl compounds are cystine, and the cystine concentration in the cell culture medium is greater than 2.0 mM and less than 5.0 mM, preferably, the cystine concentration is at least 3.0 mM and not more than 4.0 mM.

[0048] Preferably, the cultivation of mammalian cells in the methods disclosed in connection with the present invention is carried out in large-format bioreactors, preferably 10,000 L bioreactors.

[0049] Similarly, the present invention relates to an anti-CD20 / anti-CD3 bispecific antibody as disclosed in the context of the present invention, having monogalactosylated (G1) and digalactosylated (G2) glycans, obtainable by the methods or mammalian cells disclosed in the context of the present invention.

[0050] Similarly, the present invention relates to anti-alpha-synuclein antibodies disclosed in the context of the present invention having monogalactosylated (G1) and digalactosylated (G2) glycans that can be obtained by the methods or mammalian cells disclosed in the context of the present invention.

[0051] Preferably, the present invention relates to an anti-CD20 / anti-CD3 bispecific antibody disclosed in the context of the present invention having monogalactosylated (G1) and digalactosylated (G2) glycans for use as a medicament. More preferably, the anti-CD20 / anti-CD3 bispecific antibody disclosed in the context of the present invention is for use in the treatment of patients with B-cell-related cancers, preferably for use in the treatment of patients with chronic leukemia and lymphoma.

[0052] Also preferably, the present invention relates to anti-α-synuclein antibodies having monogalactosylated (G1) and digalactosylated (G2) glycans for use as a medicament. More preferably, the anti-α-synuclein antibodies disclosed in the context of the present invention are for use in treating patients with Parkinson's disease. [Brief explanation of the drawings]

[0053] [Figure 1]Glucose conversion pathway for the formation of UDP-glucose and UDP-galactose in CHO K1M. EC 2.7.7.9: UTP:α-D-glucose-1-phosphate uridylyltransferase. UDP-Glc-E: uridine-diphosphate glucose epimerase. [Figure 2] A combined interconversion pathway for UDP-glucose and UDP-galactose in CHO K1M. EC 2.7.7.9: UTP:α-D-glucose-1-phosphate uridylyltransferase. UDP-Glc-E: uridine-diphosphate glucose epimerase. UDP-Gal-T: UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase. [Figure 3] Regulation of UDP-glucose and UDP-galactose interconversion pathways in CHO K1M by sulfhydryl compounds. UDP-Glc-E: uridine-diphosphate glucose epimerase. UDP-Gal-T: UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase. [Figure 4] Regulation of UDP-glucose and UDP-galactose interconversion pathways in CHO K1M by L-cystine in the cell culture medium. UDP-Glc-E: uridine-diphosphate glucose epimerase. UDP-Gal-T: UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase. [Figure 5] UDP-galactose is produced from UDP-glucose and used in the Golgi for protein galactosylation. UDP-Glc-E: Uridine-diphosphate glucose epimerase. UDP-Gal-T: UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase. EC 2.4.1.38: β-N-acetyl-glucosaminylglycopeptide β-1,4-galactosyltransferase. [Figure 6A]Effect of different L-cysteine ​​concentrations on the G0 form of anti-α-synuclein antibody in CHO L965 cell cultures containing 6 mM or 10 mM L-cysteine ​​in the production medium. The percentage of the G0 form of anti-α-synuclein antibody is shown at the end of the 14-day production process. [Figure 6B] Figure 1 shows the effect of different L-cysteine ​​concentrations on the G1 form of an anti-α-synuclein antibody in CHO L965 cell cultures containing 6 mM or 10 mM L-cysteine ​​in the production medium. The percentage of the G1 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 6C] Figure 1 shows the effect of different L-cysteine ​​concentrations on the G2 form of an anti-α-synuclein antibody in CHO L965 cell cultures containing 6 mM or 10 mM L-cysteine ​​in the production medium. The percentage of the G2 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 6D] Figure 1 shows the effect of different L-cysteine ​​concentrations on anti-α-synuclein antibody product titer in CHO L965 cell cultures containing 6 mM or 10 mM L-cysteine ​​in the production medium. The percentage of anti-α-synuclein antibody product titer is shown at the end of the 14-day production process. [Figure 6E] Figure 1 shows the effect of different L-cysteine ​​concentrations on cell proliferation (IVCD) of anti-α-synuclein antibody-producing CHO L965 cell cultures containing 6 mM or 10 mM L-cysteine ​​in the production medium. The percentage of cell proliferation (IVCD) is shown at the end of the 14-day production process. [Figure 7A] Figure 1 shows the effect of different L-cysteine ​​concentrations on the G0 form of anti-CD20 / anti-CD3 bispecific antibody in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of G0 form of anti-CD20 / anti-CD3 bispecific antibody is shown at the end of the 14-day production process. [Figure 7B]Figure 1 shows the effect of different L-cysteine ​​concentrations on the G1 form of anti-CD20 / anti-CD3 bispecific antibody in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of G1 form of anti-CD20 / anti-CD3 bispecific antibody is shown at the end of the 14-day production process. [Figure 7C] Figure 1 shows the effect of different L-cysteine ​​concentrations on anti-CD20 / anti-CD3 bispecific antibody product titer in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of anti-CD20 / anti-CD3 bispecific antibody product titer is shown at the end of the 14-day production process. [Figure 7D] Figure 1 shows the effect of different L-cysteine ​​concentrations on cell proliferation (IVCD) of anti-CD20 / anti-CD3 bispecific antibody-producing CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of cell proliferation (IVCD) is shown at the end of the 14-day production process. [Figure 8A] Figure 1 shows the effect of different L-cysteine ​​concentrations on the G0 form of anti-CD20 / anti-CD3 bispecific antibody in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of G0 form of anti-CD20 / anti-CD3 bispecific antibody is shown at the end of the 14-day production process. [Figure 8B] Figure 1 shows the effect of different L-cysteine ​​concentrations on the G1 form of anti-CD20 / anti-CD3 bispecific antibody in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of G1 form of anti-CD20 / anti-CD3 bispecific antibody is shown at the end of the 14-day production process. [Figure 8C]Figure 1 shows the effect of different L-cysteine ​​concentrations on anti-CD20 / anti-CD3 bispecific antibody product titer in CHO T104 cell cultures containing 5 mM or 10 mM L-cysteine ​​in the production medium. The percentage of anti-CD20 / anti-CD3 bispecific antibody product titer is shown at the end of the 14-day production process. [Figure 8D] Figure 1 shows the effect of different L-cysteine ​​concentrations on cell proliferation (IVCD) of anti-CD20 / anti-CD3 bispecific antibody bsAB-producing CHO T104 cell cultures containing 5 mM L-cysteine ​​or 10 mM L-cysteine ​​in the production medium. The percentage of cell proliferation (IVCD) is shown at the end of the 14-day production process. [Figure 9A] Effect of different L-cystine concentrations on the G0 form of anti-α-synuclein antibody in CHO L967 cell cultures containing 2 mM or 4 mM L-cystine. The percentage of G0 form of anti-α-synuclein antibody is shown at the end of the 14-day production process. [Figure 9B] Figure 1 shows the effect of different L-cystine concentrations on the G1 form of an anti-α-synuclein antibody in CHO L967 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of the G1 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 9C] Figure 1 shows the effect of different L-cystine concentrations on the G2 form of an anti-α-synuclein antibody in CHO L967 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of the G2 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 9D] Figure 1 shows the effect of different L-cystine concentrations on anti-α-synuclein antibody product titer in CHO L967 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of anti-α-synuclein antibody product titer is shown at the end of the 14-day production process. [Figure 9E]1 shows the effect of different L-cystine concentrations on cell proliferation (IVCD) of anti-α-synuclein antibody-producing CHO L967 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of cell proliferation (IVCD) is shown at the end of the 14-day production process. [Figure 10A] Effect of different L-cystine concentrations on the G0 form of an anti-α-synuclein antibody in CHO L971 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of the G0 form of the anti-α-synuclein antibody is shown at the end of the 14-day production process. [Figure 10B] Figure 1 shows the effect of different L-cystine concentrations on the G1 form of an anti-α-synuclein antibody in CHO L971 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of the G1 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 10C] Figure 1 shows the effect of different L-cystine concentrations on the G2 form of an anti-α-synuclein antibody in CHO L971 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of the G2 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 10D] Figure 1 shows the effect of different L-cystine concentrations on anti-α-synuclein antibody product titer in CHO L971 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of anti-α-synuclein antibody product titer is shown at the end of the 14-day production process. [Figure 10E] Figure 1 shows the effect of different L-cystine concentrations on cell proliferation (IVCD) of anti-α-synuclein antibody-producing CHO L971 cell cultures containing 2 mM or 4 mM L-cystine in the production medium. The percentage of cell proliferation (IVCD) is shown at the end of the 14-day production process. [Figure 11A]Figure 1 shows the effect of different L-cystine / L-cysteine ​​concentrations on the G1 form of an anti-α-synuclein antibody in CHO L971 cell cultures containing 6 mM L-cysteine ​​or 3 mM L-cysteine ​​in the production medium. The percentage of the G1 form of the anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 11B] Effect of different L-cystine / L-cysteine ​​concentrations on the G2 form of anti-α-synuclein antibody in CHO L971 cell cultures containing 6 mM L-cysteine ​​or 3 mM L-cysteine ​​in the production medium. The percentage of G2 form of anti-α-synuclein antibody is shown at the end of a 14-day production process. [Figure 11C] Figure 1 shows the effect of different L-cystine / L-cysteine ​​concentrations on the relative FcRn binding levels of anti-α-synuclein antibodies in CHO L971 cell cultures containing 6 mM L-cysteine ​​or 3 mM L-cysteine ​​in the production medium. The percentage ratio of the relative FcRn binding levels of anti-α-synuclein antibodies is shown at the end of a 14-day production process. [Figure 11D] Effect of different L-cystine / L-cysteine ​​concentrations on the relative Fcγ-RIIa (H131) binding levels of anti-α-synuclein antibodies in CHO L971 cell cultures containing 6 mM L-cysteine ​​or 3 mM L-cysteine ​​in the production medium. The percentage ratio of the relative Fcγ-RIIa (H131) binding levels of anti-α-synuclein antibodies is shown at the end of a 14-day production process. [Figure 11E] Figure 1 shows the effect of different L-cysteine / L-cysteine ​​concentrations on the relative target binding of an anti-α-synuclein antibody in CHO L971 cell cultures containing 6 mM L-cysteine ​​or 3 mM L-cysteine ​​in the production medium. The percentage of relative target binding is shown at the end of a 14-day production process. [Figure 12] Schematic diagram of the glycosylation sites in the Fc region of an antibody (#1 Fc-glycosylation), the FcγIIa and FcRn effector binding sites in the Fab region (#2 FcγIIa binding and FcRn binding), the antigen binding site (#4 Fab binding), and the C-terminal modifications (#5 C-terminal alterations). DETAILED DESCRIPTION OF THE INVENTION

[0054] Detailed Description of the Invention Recombinant proteins with different glycosylation patterns, specifically galactosylation patterns, are typically produced by fermentation processes using mammalian expression systems. Post-translational glycosylation of proteins, particularly galactosylation, is essential for important physicochemical properties and functions, such as protein solubility, stability, clearance, immunogenicity, and immune effector function. In this regard, as potential prophylactic and therapeutic drugs approach clinical use, differences in the glycosylation patterns, particularly galactosylation patterns, of recombinantly produced proteins have recently attracted significant scientific attention. The oligosaccharide side chains of glycoproteins can affect protein function (Wittwer and Howard, Biochem. 29 (1990) 4175-4180) and intramolecular interactions between portions of the glycoprotein, resulting in the protein's conformation and presented three-dimensional surface (Hart, Curr. Op. Cell Biol., 4 (1992) 1017-1023; Goochee et al., Bio / Technology 9 (1991) 1347-1355; Parekh, Curr. Op. Struct. Biol. 1 (1991) 750-754). For example, the galactosylation state of recombinant proteins is regulated by different enzymes, and differences in the function of one or more of these enzymes can significantly affect the galactosylation state of recombinant proteins. In this regard, modulation of the UDP-sugar pathway has been shown to have multiple effects on recombinant mammalian cells, such as CHO cells, including, but not limited to, effects on cell growth, recombinant protein productivity and / or protein quality, particularly galactosylation levels. Further effects on the biological function of recombinant mAbs have also been demonstrated. Therefore, it is important to maintain the galactosylation pattern of recombinant proteins, especially those intended for therapeutic use.

[0055] The quality of recombinant proteins, particularly therapeutic proteins such as antibodies, is known to depend on various parameters, such as the concentrations of various nutrients present in the culture medium, because such nutrients, e.g., sugar molecules, act as precursors for the intracellular sugar nucleotide pool required for glycosylation. Variations in intracellular sugar nucleotide concentration levels can significantly affect antibody heterogeneity, which is particularly important in batch or fed-batch processes where consistent product quality is required to achieve a given clinical outcome.

[0056] Thus, one primary object of the present invention is the use of sulfhydryl compounds such as cysteine ​​or cystine to modulate intracellular UDP-glucose and UDP-galactose concentrations in mammalian cells, such as CHO K1 and its derivative cell lines, in vivo, thereby improving final product quality for certain clinical applications.

[0057] In this regard, the present invention relates to glycoproteins, particularly recombinant glycoproteins, having monogalactosylated (G1) and digalactosylated (G2) glycans, as well as means and methods for producing said glycoproteins. Accordingly, the glycoproteins described herein and in the context of the present invention can be, for example, therapeutic glycoproteins, such as recombinant glycoproteins. Accordingly, a glycoprotein, such as a recombinant protein, as disclosed herein and used in the context of the present invention is a protein that can be associated with one or more glycans. As disclosed herein and exemplified in the accompanying examples, a protein associated with one or more glycans refers to a protein having monogalactosylated (G1) or digalactosylated (G2) glycans. A protein having one or more glycans can have several sites at which glycans can be associated. Those skilled in the art will recognize potential sites at which glycans can associate with a protein, as disclosed herein and in the context of the present invention. For example, a protein can contain at least one, more preferably at least two, galactosylated glycans, and the galactosylated glycans can be associated with N-acetylglucosamine. Such glycans can be either monogalactosylated (G1) or digalactosylated (G2). As described herein, the level of monogalactosylated (G1) or digalactosylated (G2) proteins can be measured by means and methods known to those skilled in the art, as shown in the accompanying examples.

[0058] As disclosed herein and in connection with the present invention, the recombinant protein can be a therapeutic protein. Such a therapeutic protein can be, for example, but is not limited to, an antibody. Thus, the glycoprotein, e.g., an antibody, can be used as a pharmaceutical. Therapeutic proteins can include, but are not limited to, therapeutic proteins for use in treating B-cell proliferative disorders, such as non-Hodgkin's lymphoma and chronic lymphocytic leukemia, Parkinson's disease, and related disorders. In a specific embodiment, the recombinant protein can be an antibody. For example, the antibody produced by mammalian cells is an antibody used for therapy or an antibody used as a drug candidate for developing drugs for therapy. In one embodiment, the recombinant protein can be an anti-α-synuclein antibody or an anti-CD20 / anti-CD3 bispecific antibody.

[0059] The glycoprotein, e.g., an antibody, can be produced by a mammalian cell comprising a polynucleotide encoding the glycoprotein. For example, the mammalian cells described herein and in connection with the present invention can be cultured in large-scale format bioreactors, such as 10,000 L bioreactors. Chinese hamster ovary (CHO) cells are the most frequently used eukaryotic host for recombinant therapeutic protein production.

[0060] As described herein and in the context of the present invention, the glycoprotein can be an antibody, such as a bispecific antibody, e.g., an anti-CD20 / anti-CD3 antibody. The antibody can be expressed on a vector containing one or more polynucleotides encoding the antibody. As another example, the antibody can be an anti-α-synuclein antibody, which can be cloned into an appropriate vector, such as, but not limited to, the LoxP.SV40.Puro.CMVi.FseI nbe or Loxfas.puro.CMV.2L.v1 expression vector. CHO-K1M TI host cells were transfected with this polycistronic plasmid to generate stable eukaryotic cell lines. As used herein, the term "vector" refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, or virion, which, when associated with the appropriate control elements, can replicate and transfer genetic sequences between cells. Thus, the term includes cloning and expression vehicles as well as viral vectors. For example, one or more of the vectors described herein can be a polycistronic vector. As used herein, the term "polycistronic" refers to an mRNA encoding more than one polypeptide chain. As a specific example, more than one vector may be used, with a first vector expressing a first light chain and a second heavy chain, and a second vector expressing a second light chain and a first heavy chain. Those skilled in the art will know how to construct vectors suitable for expressing the antibodies described herein and in the context of the present invention. Furthermore, for the generation of recombinant cell lines, host cells can be co-transfected with one or more vectors, which may contain a selectable marker such as the dihydrofolate reductase (DHFR) gene. For example, expression of the mouse DHFR gene is driven by the simian virus 40 (SV40) early promoter and terminated by the SV40 polyadenylation signal (SV40 polyA).

[0061] Furthermore, the cell culture medium described herein and in connection with the present invention can be used to produce glycoproteins such as antibodies, and the cell culture medium contains sulfhydryl groups from one or more sulfhydryl compounds at a concentration greater than 4.0 mM and less than 10.0 mM and glucose at a concentration greater than 3.0 g / L. The cell culture medium can be a chemically defined medium, preferably a serum-free, protein-free, and / or oligopeptide-free cell culture medium. For example, a typical chemically defined cell culture medium can contain up to 100 components that can be classified into energy sources, amino acids, vitamins, trace elements and inorganic salts, nucleic acid derivatives, fatty acids and lipids, and several others.

[0062] As described herein, mammalian cells producing the glycoproteins described herein and exemplified by the accompanying examples are (a) culturing mammalian cells in a cell culture medium as described herein, wherein a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 4.0 mM and less than 10.0 mM and a concentration of glucose greater than at least 3.0 g / L in the cell culture medium is maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating the glycoprotein; The cells may be cultured by a method comprising:

[0063] The culturing of mammalian cells may result in an increased titer of the glycoprotein compared to the titer in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium greater than at least 4.0 mM and less than 10.0 mM. The culturing may further result in glycoproteins characterized by increased protein target binding, increased neonatal Fc receptor (FcRn) binding, and / or increased FcyRIIa binding compared to non-monogalactosylated (G1) and non-digalactosylated (G2) forms of glycoproteins in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium greater than at least 4.0 mM and less than 10.0 mM, as described herein. In particular, the culturing of mammalian cells may include culturing with a starting concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 3.0 mM and less than 10.0 mM. The method may further comprise the step of pre-culturing the mammalian cells in cell culture medium prior to said culturing.

[0064] The cell culture process disclosed herein and used in the context of the present invention refers to a cell culture process that can begin with seeding cells into a cell culture medium and end with harvesting the cells from the cell culture medium. The seeding refers to day 1 of the cell culture process, and harvesting the cells from the cell culture medium can be, for example, but not limited to, day 12, 13, or 14 of the cell culture. Accordingly, those skilled in the art will know how to select an appropriate period for the cell culture process using common sense. This is also demonstrated by the accompanying examples. The entire cell culture process disclosed herein and used in the context of the present invention can include a growth phase and a production phase. The concentration of sulfhydryl groups from one or more sulfhydryl compounds described herein and used in the context of the present invention is maintained for at least 5 days, preferably at least 7 days, more preferably at least 10 days, even more preferably at least 12 days, and most preferably at least 14 days of the cell culture process.

[0065] The methods disclosed herein and in the context of the present invention may further include a step of pre-culturing mammalian cells in a cell culture medium. The pre-culturing step may involve culturing cells in a cell culture medium containing 4.0 mM to 10.0 mM of sulfhydryl groups derived from one or more sulfhydryl compounds as disclosed herein, or the cell culture medium may be free of sulfhydryl groups derived from one or more sulfhydryl compounds at the aforementioned concentrations. In particular, the cell culture medium in the pre-culturing step may include the medium used to seed the mammalian cells in a bioreactor as disclosed herein, or may include a medium free of the medium used to seed the mammalian cells in a bioreactor.

[0066] One or more sulfhydryl groups from one or more sulfhydryl compounds in a cell culture medium can be present in an oxidized and / or reduced form. The oxidized form means that one or more sulfhydryl groups from one or more sulfhydryl compounds are present in the cell culture medium in a "bound form," while the reduced form means that one or more sulfhydryl groups from one or more sulfhydryl compounds are present in a "free form," meaning that one or more sulfhydryl groups contain a free -SH group. The cell culture medium disclosed herein and used in connection with the present invention can contain 4 mM to 10 mM of sulfhydryl groups from one or more sulfhydryl compounds in their oxidized and / or reduced form. For example, the one or more sulfhydryl compounds can be cysteine, cystine, succinimer, methimazole, cysteamine, azathioprine, mercaptopurine, S-methylcysteine, selenocysteine, S-phosphocysteine, 4'-phosphopantheine, butyrylthiocholine, carbocysteine, N-sulfocysteine, arachidonic acid, acetylcysteine, dimercaprol, coenzyme M, sodium aurothiomalate, pantethine, bucillamine, methylselenocysteine, dimercaptosuccinic acid, acetylcysteineamide, thioglycolic acid, 2,3-dimercaptopropanol, O-methylmercaptoethanol, mercaptoacetic acid, fulmercaptopropionic acid, methylmercaptan, S-methylmercaptoethanol, glutathione, or a glutathione derivative. For example, the sulfhydryl group from the one or more sulfhydryl compounds in the cell culture medium disclosed herein and used in connection with the present invention can be cysteine. As another example, one or more sulfhydryl compounds in a cell culture medium disclosed herein and used in connection with the present invention can be cystine. As yet another example, one or more sulfhydryl compounds in a cell culture medium disclosed herein and used in connection with the present invention can be cystine and cysteine.

[0067] The method may further include measuring the levels of monogalactosylated (G1) and digalactosylated (G2) glycans of a glycoprotein, such as an antibody, as described herein.

[0068] Those skilled in the art know how to measure and determine the concentration of one or more sulfhydryl groups from one or more sulfhydryl compounds in cell culture medium.This concentration can be obtained by determining the amount of one or more sulfhydryl compounds by mass spectrometry and calculating the amount of sulfhydryl groups present in the sulfhydryl compounds.Further means and methods for measuring and determining the concentration of one or more sulfhydryl groups from one or more sulfhydryl compounds are within the general knowledge of those skilled in the art.

[0069] The methods or cell culture media described herein can contain, for example, sulfhydryl groups from one or more sulfhydryl compounds at a concentration of at least greater than 4.0 mM and not greater than 9.0 mM, preferably at least greater than 4.0 mM and not greater than 8.0 mM, more preferably at least greater than 4.0 mM and not greater than 7.0 mM, and even more preferably at least greater than 4.0 mM and not greater than 6.0 mM. As another example, the cell culture medium contains sulfhydryl groups from one or more sulfhydryl compounds at a concentration of at least 5.0 mM and less than 10.0 mM, preferably at least 5.0 mM and not greater than 9.0 mM, more preferably at least 5.0 mM and not greater than 8.0 mM, even more preferably at least 5.0 mM and not greater than 7.0 mM, and most preferably at least 5.0 mM and not greater than 6.0 mM.

[0070] As a particular example, the one or more sulfhydryl compounds are cysteine ​​and the cysteine ​​concentration in the cell culture medium is greater than 4.0 mM and less than 10.0 mM, preferably the cysteine ​​concentration is at least 5.0 mM and not more than 6.0 mM. As another particular example, the one or more sulfhydryl compounds are cystine and the cystine concentration in the cell culture medium is greater than 2.0 mM and less than 5.0 mM, preferably the cystine concentration is at least 3.0 mM and not more than 4.0 mM.

[0071] In most chemically defined cell culture media for the cultivation of mammalian cells, glucose is the most commonly used carbohydrate because it can be efficiently transported into the cell (Wright et al., J Exp Biol 196(1994)197-212). Glucose is a simple monosaccharide. In addition to being used as an energy source, glucose can also be used as a building block for many other molecules and structures. To serve these purposes, a given monosaccharide must first be "activated." This activation involves the addition of a nucleoside diphosphate group to the sugar, resulting in the formation of a nucleotide sugar. For example, in CHO cells, most nucleotide sugars are synthesized from glucose in well-characterized reactions. As shown in Figure 1, D-glucose is converted to D-glucose-1-phosphate. Activation of D-glucose-1-phosphate via UTP-glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) results in a cytoplasmic pool of UDP-glucose (Turnquist and Hansen, The Enzymes, 3rd. Ed. (Ed. Boyer, P.D.) 8 (1973) 51-71; Chang et al., Eur. J. Biochem. 236 (1996) 723-728).

[0072] Thus, the cell culture medium described herein and used in the context of the present invention may contain, for example, at least 3.0 g / L of glucose, more preferably at least 4.0 g / L of glucose. Additionally or alternatively, the cell culture medium may contain, for example, up to 13.0 g / L of glucose, preferably up to 8.0 g / L, more preferably up to 7.0 g / L, even more preferably up to 6.0 g / L, and most preferably up to 5.0 g / L of glucose. As a specific example, the cell culture medium may contain between 3.0 g / L and up to 13 g / L of glucose, preferably between 3.0 g / L and up to 8.0 g / L of glucose, more preferably between 3.0 g / L and up to 7.0 g / L of glucose, even more preferably between 3.0 g / L and up to 6.0 g / L of glucose, and most preferably between 3.0 g / L and up to 5.0 g / L of glucose.

[0073] In particular, cell culture media for seeding and culturing cells disclosed herein and in connection with the present invention may contain 3.0 mM to 10.0 mM sulfhydryl groups from one or more sulfhydryl compounds, which may be cysteine ​​and / or cystine. For example, recombinant protein-producing cells may be CHO cells producing an anti-α-synuclein antibody or an anti-CD20 / anti-CD3 bispecific antibody and may be cultured in a cell culture medium containing 6 mM cysteine. As another example, recombinant protein-producing cells may be CHO cells producing an anti-α-synuclein antibody or an anti-CD20 / anti-CD3 bispecific antibody and may be cultured in a cell culture medium containing 5 mM cysteine. As yet another example, recombinant protein-producing cells may be CHO cells producing an anti-α-synuclein antibody or an anti-CD20 / anti-CD3 bispecific antibody and may be cultured in a cell culture medium containing 4 mM cystine. As yet another example, the cells producing the recombinant protein may be CHO cells producing an anti-α-synuclein antibody or an anti-CD20 / anti-CD3 bispecific antibody, and may be cultured in a cell culture medium containing cystine and cysteine, the cell culture medium containing a combined cystine and cysteine ​​concentration of between 4.0 mM and 5.0 mM.

[0074] As disclosed herein and in connection with the present invention, cells can be cultured in a cell culture medium containing at least greater than 3 g / L of glucose. The glucose can be present at the time of seeding the cells into the cell culture medium disclosed herein and in connection with the present invention, or can be added during the cell culture process, for example, from day 4 to day 14 of the cell culture process. In one embodiment, glucose can be present during the production phase of the cell culture process.

[0075] As illustrated in the accompanying examples, cells may be cultured in the presence of 6 mM cysteine ​​and at least 3 g / L or more, such as 4 g / L or more, of glucose. As illustrated in the accompanying examples, cells may be cultured in the presence of 5 mM cysteine ​​and at least 3 g / L or more, such as 4 g / L or more, of glucose.

[0076] As illustrated in the Examples, glucose can be added to the cell culture medium on days 4 to 14 of the cell culture process. In other words, as shown in the Examples, the cell culture medium can contain at least 3 g / L of glucose from the time glucose is added to the cell culture medium, for example, on days 4 to 14. Glucose can be added to the cell culture medium by a fed-batch process or perfusion as disclosed herein and used in the context of the present invention, but the process by which glucose is added to the cell culture medium is not limited thereto. It should be understood that the glucose concentration present in the cell culture medium refers to a concentration that does not impair cell growth and / or recombinant protein production by the cells. In other words, a glucose concentration suitable for maintaining and / or increasing cell growth and / or recombinant protein production by the cells is selected.

[0077] As illustrated in the accompanying examples, the anti-α-synuclein antibody or anti-CD20-CD3 bispecific antibody can be produced in a CHO cell line, such as the CHO K1M cell line. It should be understood that the recombinant proteins disclosed herein and in the context of the present invention can be produced in any mammalian cell line suitable for producing the recombinant protein. In this regard, those skilled in the art will recognize suitable mammalian cells and know how to select such mammalian cells for producing the recombinant proteins disclosed herein and in the context of the present invention. Cells producing recombinant proteins, such as anti-α-synuclein antibodies or anti-CD20-CD3 bispecific antibodies, include, but are not limited to, CHO cells, Vero cells, BHK cells, COS cells, and HEK 293 / 293T cells. Mammalian cells can be cultured in a chemically defined cell culture medium. Cell culture media used in the context of the present invention are disclosed herein. In this regard, those skilled in the art will recognize suitable commercially available chemically defined cell culture media for use in the context of the present invention, such as, but not limited to, DMEM. As illustrated in the accompanying examples, serum-free, chemically defined media can be used to culture mammalian cells. In one embodiment, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free, and / or oligopeptide-free cell culture medium.

[0078] As disclosed herein and demonstrated by the accompanying examples, mammalian cells, such as CHO cells, can be cultured, for example, for up to 14 days, in a culture medium containing 4.0 mM to 10 mM sulfhydryl groups from one or more sulfhydryl compounds, such as cysteine ​​and / or cystine, and at least greater than 3 g / L glucose.

[0079] The method may further comprise recovering the glycoprotein, such as an antibody, as described herein. It should be understood that the cells may be recovered from the cell culture medium during or at the end of the production phase. This allows one skilled in the art to select an appropriate time point for recovering the cells from the cell culture medium, as also illustrated by the accompanying examples. The method may further comprise formulating the glycoprotein, such as an antibody, into a formulation, as described herein.

[0080] All aspects described below in relation to the cell culture medium used in the methods of the present invention also describe the cell culture medium used in connection with the present invention. Furthermore, the present invention provides recombinant proteins having a desired content of galactosylated glycans, which may contain at least monogalactosylated, and more preferably digalactosylated, glycans. Preferably, the galactosylated glycans are associated with N-acetylglucosamine. All aspects described below in relation to the recombinant proteins produced in the methods of the present invention also describe the recombinant proteins provided in connection with the present invention. The present invention also provides recombinant proteins obtainable by the methods of the present invention and disclosed below.

[0081] In this regard, the present invention has discovered that sulfhydryl compounds and their derivatives, such as L-cysteine ​​and / or cystine, can be used to activate UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase (EC 2.7.7.12). This effectively activates UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase. Furthermore, sulfhydryl compounds can be used to regulate the UDP-sugar pathway, particularly in vivo. For example, L-cystine, the oxidized dimeric form of L-cysteine, can be used to regulate the UDP-sugar pathway, particularly in vivo. In particular, the UDP-sugar pathway can be regulated by adding sulfhydryl compounds and their derivatives, such as cystine and / or cysteine, to increase cell growth, recombinant protein productivity, and / or protein quality, particularly in vivo, by increasing the galactosylation level of recombinant proteins in mammalian cell culture.

[0082] The term "degree of oxidation" refers to the extent to which oxidizable sulfhydryl groups from one or more sulfhydryl compounds undergo oxidation in a cell culture medium. For example, if a sulfhydryl compound contains a single sulfhydryl group that is oxidized by forming a disulfide bridge with a sulfhydryl group of another (same or different) sulfhydryl compound, an increase in the mass of the sulfhydryl compound indicates oxidation of the sulfhydryl group. The oxidation state can be measured by metrics known in the art of protein and peptide chemistry, including, but not limited to, assays such as the number of oxidized residues, mass spectral peak intensity, and mass spectral integrated area. In some embodiments of any aspect provided herein, the oxidation state is reported as a percentage, with 0% indicating no oxidation and 100% indicating complete oxidation of potentially oxidizable sulfhydryl groups from one or more sulfhydryl compounds in the medium. Terms such as "potentially oxidizable sulfhydryl groups" refer to the total amount of sulfhydryl groups from one or more sulfhydryl compounds in the medium that can undergo oxidation, for example, by forming a disulfide bridge.

[0083] Terms such as "unoxidized sulfhydryl groups" refer to the amount of one or more sulfhydryl groups from one or more sulfhydryl compounds in a medium that is not oxidized. The increase in the mass of a sulfhydryl compound over the mass of the same sulfhydryl compound that is not oxidized reflects the number of oxidized sulfhydryl groups in the sulfhydryl compound. The increase in the amount of a sulfhydryl compound with oxidized sulfhydryl groups over the amount of a sulfhydryl compound without oxidized sulfhydryl groups reflects the degree of oxidation. The oxidation state of one or more sulfhydryl groups from one or more sulfhydryl compounds is then determined from the total amount of sulfhydryl groups from one or more sulfhydryl compounds with one or more oxidized sulfhydryl groups and the total amount of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium.

[0084] For example, determining the oxidation state of sulfhydryl groups from one or more sulfhydryl compounds in a cell culture medium includes the steps of: a) determining the mass and amount of one or more sulfhydryl compounds in the cell culture medium; b) comparing the determined mass of the one or more sulfhydryl compounds with the mass of the one or more unoxidized sulfhydryl compounds, wherein an increase in the mass of the one or more sulfhydryl compounds over the mass of the one or more unoxidized sulfhydryl compounds reflects the number of oxidized sulfhydryl groups in the one or more sulfhydryl compounds; and c) determining the oxidation state of the one or more sulfhydryl compounds from the total amount of the one or more sulfhydryl compounds having at least one oxidized sulfhydryl group, and thus the total amount of one or more sulfhydryl groups of the one or more sulfhydryl compounds.

[0085] Determining the mass of target fragments uses mass spectrometry. Terms such as "mass spectrometry," "MS," and the like refer to methods of filtering, detecting, and measuring ions based on their mass-to-charge ratio (i.e., "m / z"). The terms "mass" and "m / z" are used interchangeably in reference to mass spectrometry results, and unless otherwise specified, all m / z values ​​assume a singly ionized species. The terms "major isotope mass" and "major isotope m / z" refer to the reported mass of a molecular ion, taking into account the mass of the most abundant (i.e., primary) isotope of each element. Typically, one or more molecules of interest are ionized, and the ions are then introduced into a mass spectrometry instrument, where a combination of magnetic and electric fields causes the ions to follow a path in space that depends on their mass ("m") and charge ("z"). See, for example, U.S. Patent No. 6,204,500, entitled "Mass Spectrometry From Surfaces"; U.S. Patent No. 6,107,623, entitled "Methods and Apparatus for Tandem Mass Spectrometry"; U.S. Patent No. 6,268,144, entitled "DNA Diagnostics Based on Mass Spectrometry"; U.S. Patent No. 6,124,137, entitled "Surface-Enhanced Photolabile Attachment and Release For Desorption and Detection Of Analytes"; Wright et al., Prostate Cancer and Prostatic Diseases 2:264-76 (1999); and Merchant and Weinberger, Electrophoresis 21:1164-67 (2000). Terms such as "integrated intensity," "mass spectrum integrated area," and "integrated mass spectrum intensity," as known in the art, refer to the area under the mass spectrometry curve corresponding to the amount of molecular ions having a particular major isotope m / z.

[0086] For example, in a "quadrupole" or "quadrupole ion trap" instrument, ions in an oscillating radio frequency field experience a force proportional to the DC potential applied between the electrodes, the amplitude of the RF signal, and m / z. The voltage and amplitude can be selected so that only ions with a particular m / z travel the length of the quadrupole, while all other ions are deflected. Thus, a quadrupole instrument can function as both a "mass filter" and a "mass detector" for ions injected into the instrument.

[0087] Uridine diphosphate (UDP)-sugar in mammalian cells Uridine diphosphate (UDP) α-D-glucose epimerase (EC 5.1.3.2) and UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) have been found to play important roles in the UDP-glucose and UDP-galactose conversion pathways in mammalian cells, such as CHO cells.

[0088] As used herein, the terms "uridine diphosphate (UDP) α-D-glucose epimerase" and "UDP-Glc-E" are used interchangeably and refer to an enzyme that is a homodimeric epimerase found in bacteria, fungi, plants, and mammalian cells that belongs to the EC 5.1.3.2 class. The cDNA for UDP-Glc-E in the cell line CHO K1M was amplified, sequenced, and further analyzed, as shown in Example 1.

[0089] As used herein, the terms "UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase," "UDP-Gal-T," and "EC 2.7.7.12" are used interchangeably and refer to an enzyme that catalyzes nucleotide exchange between uridine 5'-diphosphate glucose (UDP-glucose) and galactose-1-phosphate (Gal-1-P) to produce uridine 5'-diphosphate galactose (UDP-galactose) and glucose-1-phosphate (Glc-1-P) via a reversible mechanism. The cDNA for UDP-Gal-T in the cell line CHO K1M was amplified, sequenced, and further analyzed, as described in Example 2.

[0090] Uridine-diphosphate glucose epimerase. The UDP-glucose and UDP-galactose synthesis pathways are shown in Figure 1. It shows the UDP-sugar interconversion pathways for the formation of UDP-glucose from α-D-glucose, followed by the formation of UDP-galactose from UDP-glucose by UDP-glucose epimerase (UDP-Glc-E: uridine-diphosphate glucose epimerase EC 5.1.3.2).

[0091] UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase The UDP-galactose and UDP-glucose pathways are further expanded as shown in Figure 2, which shows the UDP-sugar interconversion pathways for the formation of UDP-galactose from α-D-glucose, followed by the conversion of UDP-galactose back to UDP-glucose by UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase (UDP-Gal-T:UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase EC 2.7.7.12).

[0092] Establishment of UDP-glucose / galactose conversion pathway As shown in Figure 2, UDP-Gal-T catalyzes the reversible conversion of UDP-glucose and UDP-galactose. However, Wagstaff et al. (2015) Carbohydrate Research 404:17-25 found that under certain circumstances (e.g., in the presence of excess glucose-1-P), UDP-Gal-T primarily performs the reverse conversion, converting most UDP-galactose to UDP-glucose. This mechanism can lead to intracellular changes in the UDP-sugar pool, composed of glucose and galactose, resulting in a decrease in the intracellular UDP-galactose concentration and an increase in the amount of intracellular UDP-glucose. Based on these experimental results, this new UDP-glucose / UDP-galactose pathway can be used to more precisely describe a given therapeutic protein production process using a chemically defined medium platform containing excess glucose, as shown in Figure 2.

[0093] A novel approach for regulating the UDP-glucose / UDP-galactose pathway in mammalian cells using sulfhydryl compounds As shown in Figure 3, sulfhydryl compounds and their derivatives, such as L-cysteine ​​and / or L-cystine, can be added to cell culture media to further activate UDP-Gal-T and regulate UDP-sugars composed of glucose and galactose in mammalian cells, such as CHO K1 and its derivative cell lines. The present inventors have therefore discovered that the addition of one or more sulfhydryl compounds can produce recombinant proteins with mono- or digalactosylated glycans. As used herein, the term "sulfhydryl compound" refers to inorganic or organic compounds containing sulfur as an integral part of the molecule, preferably compounds containing -SH groups; and / or compounds that initially contain -SH groups and covalently bond to each other under reducing conditions, thereby forming disulfide bridges. The present inventors have discovered that one or more sulfhydryl compounds that increase viable cell density and / or product titer during the production of recombinant proteins produced by mammalian cell culture have an effect that directly correlates with the galactose content of the produced recombinant proteins. In this regard, the present invention provides a process for controlling the degree of galactosylation of recombinant proteins produced by mammalian cell culture. Following the methods provided herein, one skilled in the art can determine the exact process parameters that provide control of the galactose content of recombinant proteins produced by mammalian cell culture.

[0094] In one related aspect of the present invention, the galactose content of recombinant proteins produced by mammalian cell culture can be increased during production of the recombinant proteins. In a further aspect of the present invention, the recombinant protein having monogalactosylated (G1) or digalactosylated (G2) glycans is an anti-CD20 / anti-CD3 bispecific antibody, which has 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan, preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan; more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan; and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

[0095] In particular, an anti-CD20 / anti-CD3 bispecific antibody having monogalactosylated (G1) and digalactosylated (G2) glycans comprises a first antigen-binding domain that binds to CD3 and a second antigen-binding domain that binds to CD20. The anti-CD20 / anti-CD3 bispecific antibody may comprise a first antigen-binding domain comprising a heavy chain variable region (VH) and a light chain variable region (VL), and a second antigen-binding domain comprising a heavy chain variable region (VH) and a light chain variable region (VL).

[0096] More specifically, the anti-CD20 / anti-CD3 bispecific antibody having monogalactosylated (G1) and digalactosylated (G2) glycans comprises a first antigen-binding domain and a second antigen-binding domain, wherein the first antigen-binding domain comprises: (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 25; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 26, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 27 a light chain variable domain (VL) comprising the second antigen-binding domain comprises: (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 34; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 35, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 36 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 37; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 38, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 39 a light chain variable domain (VL) comprising The anti-CD20 / anti-CD3 bispecific antibody has 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan; preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan; more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

[0097] Preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody (a) the first antigen-binding domain comprises the VH sequence of SEQ ID NO: 28 and the second antigen-binding domain comprises the VH sequence of SEQ ID NO: 40; (b) the first antigen-binding domain comprises the VL sequence of SEQ ID NO: 29 and the second antigen-binding domain comprises the VL sequence of SEQ ID NO: 41; (c) The first and second antigen-binding domains comprise the VH sequence described in (a) and the VL sequence described in (b).

[0098] Preferably, the anti-CD20 / anti-CD3 bispecific antibody is an antibody (a) the VH sequence of the first antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 28, and the VH sequence of the second antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 40; (b) the VL sequence of the first antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 29 and the VL sequence of the second antigen-binding domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 41; or (c) An anti-CD20 / anti-CD3 bispecific antibody comprises the VH sequences of the first and second antigen-binding domains described in (a) and the VL sequences of the first and second antigen-binding domains described in (b).

[0099] As disclosed herein and in the context of the present invention, an anti-CD20 / anti-CD3 bispecific antibody is an antibody, and the anti-CD20 / anti-CD3 bispecific antibody may comprise a third antigen-binding domain. For example, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, and the anti-CD20 / anti-CD3 bispecific antibody comprises a third antigen-binding domain that binds to CD20. Alternatively, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, and the anti-CD20 / anti-CD3 bispecific antibody comprises a third antigen-binding domain that binds to CD3. As used herein, terms such as "first," "second," and "third" with respect to antigen-binding domains are used for convenience of distinction when more than one of each type of domain is present. The use of these terms is not intended to confer a particular order or orientation unless explicitly indicated as such.

[0100] For example, an anti-CD20 / anti-CD3 bispecific antibody may comprise a second antigen-binding domain that binds to CD3 and first and third antigen-binding domains that bind to CD20. As a more specific example, the third antigen-binding domain may be identical to the first antigen-binding domain (i.e., the first and third antigen-binding domains may comprise the same heavy and light chain amino acid sequences). Even more specifically, the first and third Fab molecules comprising the first and third antigen-binding domains may be identical and may further have the same arrangement of domains (i.e., conventional or crossover).

[0101] As another example, an anti-CD20 / anti-CD3 bispecific antibody may comprise a first antigen-binding domain that binds to CD3 and second and third antigen-binding domains that bind to CD20. As a more specific example, the third antigen-binding domain may be identical to the second antigen-binding domain (i.e., the second and third antigen-binding domains may comprise the same heavy and light chain amino acid sequences). Even more specifically, the second and third Fab molecules comprising the second and third antigen-binding domains may be identical and may further have the same arrangement of domains (i.e., conventional or crossover).

[0102] As a more specific example described herein, the anti-CD20 / anti-CD3 bispecific antibody may comprise a third antigen-binding domain, wherein the third antigen-binding domain comprises: (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 34; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 35, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 36 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 37; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 38, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 39 a light chain variable domain (VL) comprising The anti-CD20 / anti-CD3 bispecific antibody has 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan; preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan; more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

[0103] As an even more specific example, the anti-CD20 / anti-CD3 bispecific antibody may be an antibody, and the third antigen-binding domain may comprise the VH sequence of SEQ ID NO: 40 and the VL sequence of SEQ ID NO: 41. Preferably, the anti-CD20 / anti-CD3 bispecific antibody may be an antibody, and the third antigen-binding domain may comprise a third antigen-binding domain VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 40, and a third antigen-binding domain VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 41.

[0104] The first antigen-binding domain of an anti-CD20 / anti-CD3 bispecific antibody is a cross-Fab molecule in which the variable or constant domains of the Fab heavy chain and the Fab light chain are exchanged, and the second and third antigen-binding domains, if present, can be conventional Fab molecules. For example, the antigen-binding domain that specifically binds to CD3 is a cross-Fab molecule in which the variable or constant domains of the Fab heavy chain and the Fab light chain are exchanged (i.e., replaced with each other). In another more specific example, the first antigen-binding portion is a cross-Fab molecule, and the second antigen-binding portion and the first antigen-binding portion are each conventional Fab molecules.

[0105] A "Fab molecule" refers to a protein consisting of the VH and CH1 domains of an immunoglobulin heavy chain (a "Fab heavy chain") and the VL and CL domains of an immunoglobulin light chain (a "Fab light chain"). "Fused" means that the components (e.g., the Fab molecule and Fc domain subunits) are joined by either a peptide bond directly or via one or more peptide linkers.

[0106] A "crossover" Fab molecule (also referred to as "Crossfab") refers to a Fab molecule in which the variable and constant domains of the Fab heavy and light chains have been exchanged (i.e., replaced with each other); i.e., the crossover Fab molecule comprises a peptide chain consisting of a light chain variable domain VL and a heavy chain constant domain 1 CH1 (VL-CH1, from N- to C-terminal), and a peptide chain consisting of a heavy chain variable domain VH and a light chain constant domain CL (VH-CL, from N- to C-terminal). For clarity, in a crossover Fab molecule in which the variable domains of the Fab light chain and the Fab heavy chain have been exchanged, the peptide chain comprising the heavy chain constant domain 1 CH1 is referred to herein as the "heavy chain" of the (crossover) Fab molecule. Conversely, in a crossover Fab molecule in which the constant domains of the Fab light chain and the Fab heavy chain have been exchanged, the peptide chain comprising the heavy chain variable domain VH is referred to herein as the "heavy chain" of the (crossover) Fab molecule.

[0107] In contrast, a "conventional" Fab molecule refers to a Fab molecule in its native format, i.e., comprising a heavy chain (VH-CH1, N-terminal to C-terminal) composed of a heavy chain variable domain and a constant domain, and a light chain (VL-CL, N-terminal to C-terminal) composed of a light chain variable domain and a constant domain.

[0108] The third Fab molecule can be fused at the C-terminus of the Fab heavy chain to the N-terminus of the first or second subunit of the Fc domain. As used herein, a "subunit" of an Fc domain refers to one of the two polypeptides that form a dimeric Fc domain, i.e., a polypeptide that contains the C-terminal constant region of an immunoglobulin heavy chain capable of stable self-association. For example, a subunit of an IgG Fc domain contains the IgG CH2 and IgG CH3 constant domains.

[0109] For example, the second and third Fab molecules each have the C-terminus of their Fab heavy chains fused to the N-terminus of one of the subunits of the Fc domain, and the first Fab molecule has the C-terminus of its Fab heavy chain fused to the N-terminus of the Fab heavy chain of the second Fab molecule. More specifically, the antibody consists essentially of first, second, and third Fab molecules, an Fc domain composed of first and second subunits, and optionally one or more peptide linkers, wherein the first Fab molecule is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the second Fab molecule, the second Fab molecule is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third Fab molecule is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain (see also EP 3252078, specifically Figures 1B, 1E, 1I, and 1M in combination with paragraph

[0338] , which are incorporated herein by reference).

[0110] In other words, the anti-CD20 / anti-CD3 bispecific antibody may comprise a third antigen-binding domain, wherein the first antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the second antigen-binding domain, the second antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.

[0111] The second and third Fab molecules may be fused to the Fc domain directly or via a peptide linker. For example, the second and third Fab molecules are each fused to the Fc domain via an immunoglobulin hinge region. Specifically, when the Fc domain is an IgG1 Fc domain, the immunoglobulin hinge region is a human IgG1 hinge region. Optionally, the Fab light chain of the first Fab molecule and the Fab light chain of the second Fab molecule may additionally be fused to each other.

[0112] Alternatively, the first and third Fab molecules are each fused at the C-terminus of the Fab heavy chain to the N-terminus of one of the Fc domain subunits, and the second Fab molecule is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first Fab molecule. More specifically, the antibody consists essentially of first, second, and third Fab molecules, an Fc domain composed of the first and second subunits, and optionally one or more peptide linkers, wherein the second Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the Fab heavy chain of the first Fab molecule, the first Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the second subunit of the Fc domain (see also EP 3252078, specifically Figures 1C, 1F, 1J, and 1N in combination with paragraph

[0339] , which are incorporated herein by reference).

[0113] In other words, the anti-CD20 / anti-CD3 bispecific antibody may comprise a third antigen-binding domain, wherein the second antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding domain, the first antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.

[0114] The first and third Fab molecules may be fused to the Fc domain directly or via a peptide linker. For example, the first and third Fab molecules are each fused to the Fc domain via an immunoglobulin hinge region. Specifically, when the Fc domain is an IgG1 Fc domain, the immunoglobulin hinge region is a human IgG1 hinge region. Optionally, the Fab light chain of the first Fab molecule and the Fab light chain of the second Fab molecule may additionally be fused to each other.

[0115] Alternatively, the first and second Fab molecules are each fused at the C-terminus of their Fab heavy chains to the N-terminus of one of the subunits of the Fc domain, and the third Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the Fab heavy chain of the first Fab molecule. More specifically, the antibody consists essentially of first, second, and third Fab molecules, an Fc domain composed of the first and second subunits, and optionally one or more peptide linkers, wherein the third Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the Fab heavy chain of the first Fab molecule, the first Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the second Fab molecule is fused at the C-terminus of its Fab heavy chain to the N-terminus of the second subunit of the Fc domain. In other words, the anti-CD20 / anti-CD3 bispecific antibody may comprise a third antigen-binding domain, wherein the third antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding domain, the first antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the second antigen-binding domain of the anti-CD20 / anti-CD3 bispecific antibody is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.

[0116] The first and second Fab molecules may be fused to the Fc domain directly or via a peptide linker. For example, the first and second Fab molecules are each fused to the Fc domain via an immunoglobulin hinge region. Specifically, when the Fc domain is an IgG1 Fc domain, the immunoglobulin hinge region is a human IgG1 hinge region. Optionally, the Fab light chain of the first Fab molecule and the Fab light chain of the third Fab molecule may additionally be fused to each other.

[0117] Further configurations of anti-CD20 / anti-CD3 bispecific antibodies used herein and in the context of the present invention can be found, for example, in EP 3252078, in particular Figure 1 and paragraphs

[0335] to

[0367] , which are incorporated herein by reference.

[0118] Even more specifically, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, the anti-CD20 / anti-CD3 bispecific antibody being (a) a first heavy chain having at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 47 and a second heavy chain having at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 45; (b) a first light chain having at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 33, and second and third light chains having at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 44; (c) the first heavy chain and second heavy chain described in (a) and the first light chain, second light chain, and third light chain described in (b); may include:

[0119] Even more specifically, the anti-CD20 / anti-CD3 bispecific antibody is an antibody, the anti-CD20 / anti-CD3 bispecific antibody being (a) a first heavy chain of SEQ ID NO: 47 and a second heavy chain of SEQ ID NO: 45; (b) a first light chain of SEQ ID NO: 33, a second light chain of SEQ ID NO: 44, and a third light chain; or (c) the first heavy chain and second heavy chain described in (a) and the first light chain, second light chain, and third light chain described in (b); Includes:

[0120] In another aspect of the present invention, the recombinant protein having monogalactosylated (G1) or digalactosylated (G2) glycans is an anti-α-synuclein antibody, and the anti-α-synuclein antibody has 17.2 to 48.0% (w / w) G1 and 3.1 to 15.0% (w / w) G2 per total glycan, preferably 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan, preferably 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan. Preferably, the total glycans are 40.0 to 46.0% (w / w) G1 and 8.4 to 15.0% (w / w) G2 per total glycan, more preferably, 41.0 to 45.0% (w / w) G1 and 9.5 to 14.0% (w / w) G2 per total glycan, and most preferably, 42.1 to 43.9% (w / w) G1 and 10.6 to 13.3% (w / w) G2 per total glycan.

[0121] In particular, anti-α-synuclein antibodies with monogalactosylated (G1) and digalactosylated (G2) glycans (a) CDR-H1 comprising the amino acid sequence of SEQ ID NO: 10; (b) CDR-H2 comprising the amino acid sequence of SEQ ID NO: 11, and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 12 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 13; (e) CDR-L2 comprising the amino acid sequence of SEQ ID NO: 14, and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 15 a light chain variable domain (VL) comprising The anti-α-synuclein antibody preferably comprises 17.2 to 48.0% (w / w) G1 and 3.1 to 15.0% (w / w) G2 per total glycan; preferably 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan; preferably 27.2 to 47.0% G1 and 4.4 to 15.0% G2 per total glycan; preferably , 40.0-46.0% (w / w) G1 and 8.4-15.0% (w / w) G2 per total glycan; more preferably, 41.0-45.0% (w / w) G1 and 9.5-14.0% (w / w) G2 per total glycan, and most preferably, 42.1-43.9% (w / w) G1 and 10.6-13.3% (w / w) G2 per total glycan.

[0122] More specifically, the anti-alpha-synuclein antibody: (a) the VH sequence of SEQ ID NO: 16; (b) the VL sequence of SEQ ID NO: 17, or (c) the VH sequence described in (a) and the VL sequence described in (b) Includes:

[0123] Even more specifically, the anti-alpha-synuclein antibody (a) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 16; (b) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 17; or (c) the VH sequence described in (a) and the VL sequence described in (b) Includes:

[0124] Even more particularly, the anti-alpha-synuclein antibody comprises a heavy chain having at least 99% sequence identity to the amino acid sequence of SEQ ID NO:20 and a light chain having at least 99% sequence identity to the amino acid sequence of SEQ ID NO:21.

[0125] Even more particularly, the anti-alpha-synuclein antibody comprises a heavy chain of SEQ ID NO:20 and a light chain of SEQ ID NO:21.

[0126] "Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical to those in the reference polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for sequence alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein, percent amino acid sequence identity values ​​are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc., and the source code, together with user documentation, has been filed with the U.S. Copyright Office, Washington, DC 20559, and is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc. (South San Francisco, California) or can be compiled from its source code. The ALIGN-2 program should be compiled for use on UNIX operating systems, including Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.In situations where ALIGN-2 is used for amino acid sequence comparison, the % amino acid sequence identity of a given amino acid sequence A to, with, or relative to a given amino acid sequence B (alternatively, it may be written as a given amino acid sequence A having or comprising a certain % amino acid sequence identity to, with, or relative to a given amino acid sequence B) is calculated as follows: 100 × fraction X / Y, where X is the number of amino acid residues scored by the sequence alignment program ALIGN-2 as identical matches in that program's alignment of A and B, and Y is the total number of amino acid residues in B. It will be understood that if the length of amino acid sequence A differs from the length of amino acid sequence B, the % amino acid sequence identity of A to B will differ from the % amino acid sequence identity of B to A. Unless otherwise specified, all % amino acid sequence identity values ​​used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph.

[0127] A nucleic acid or polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention is intended to be identical to the reference sequence, except that the nucleotide sequence of the polynucleotide may contain up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with other nucleotides, or up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These changes to the reference sequence may occur at the 5'-terminal position or 3'-terminal position of the reference nucleotide sequence, or anywhere between the 5'-terminal position and the 3'-terminal position, either individually between residues in the reference sequence or in one or more consecutive groups within the reference sequence. In practical terms, whether any particular polynucleotide sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the present invention can be conventionally determined using known computer programs, such as those described above for polypeptides (e.g., ALIGN-2).

[0128] Preferably, the monogalactosylated (G1) and digalactosylated (G2) glycans of the anti-CD20 / anti-CD3 bispecific antibody or anti-α-synuclein antibody as disclosed in the context of the present invention are associated with N-acetylglucosamine.

[0129] As used herein, the terms "cell culture medium" and "culture medium" are used interchangeably and refer to a nutrient solution used to grow mammalian cells, typically providing at least one component from one or more of the following categories: 1) an energy source, usually in the form of carbohydrates such as glucose; 2) all essential amino acids, usually a basic set of 20 amino acids plus cysteine; 3) vitamins and / or other organic compounds required at low concentrations; 4) free fatty acids; and 5) trace elements, where trace elements are defined as inorganic compounds or naturally occurring elements typically required at very low concentrations, usually in the micromolar range. The components, such as growth factors, required for a particular cell line can be readily determined empirically without undue experimentation, as described, for example, in Mammalian Cell Culture (Mather, JP ed., Plenum Press, NY 1984) and Barnes and Sato, (1980) Cell, 22:649.

[0130] As disclosed herein and in the context of the present invention, a cell culture medium for producing antibodies having monogalactosylated (G1) and digalactosylated (G2) glycans is a cell culture medium containing sulfhydryl groups from one or more sulfhydryl compounds at a concentration greater than 4.0 mM and less than 10.0 mM and glucose at a concentration greater than at least 3.0 g / L.

[0131] In a preferred aspect of the invention, the cell culture medium disclosed in connection with the present invention comprises at least more than 4.0 mM and not more than 9.0 mM, preferably at least more than 4.0 mM and not more than 8.0 mM, more preferably at least more than 4.0 mM and not more than 7.0 mM, and even more preferably at least more than 4.0 mM and not more than 6.0 mM of sulfhydryl groups from one or more sulfhydryl compounds.

[0132] In other preferred aspects, the cell culture medium disclosed in connection with the present invention comprises sulfhydryl groups from one or more sulfhydryl compounds at a concentration of at least 5.0 mM and less than 10.0 mM, preferably at least 5.0 mM and not more than 9.0 mM, more preferably at least 5.0 mM and not more than 8.0 mM, even more preferably at least 5.0 mM and not more than 7.0 mM, and most preferably at least 5.0 mM and not more than 6.0 mM.

[0133] Alternatively (e.g., in the case of cysteine ​​and / or cystine), the cell culture medium comprises one or more sulfhydryl compounds at between greater than 0.7 g / L and less than or equal to 1.2 g / L, preferably between greater than 0.7 g / L and less than or equal to 1.1 g / L, more preferably between greater than 0.7 g / L and less than or equal to 1.0 g / L, more preferably between greater than 0.7 g / L and less than or equal to 0.9 g / L, and even more preferably between greater than 0.7 g / L and less than or equal to 0.8 g / L.

[0134] The one or more sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium disclosed in connection with the present invention are present in reduced and / or oxidized form, for example, the reduced form of the sulfhydryls ranges between greater than 4.0 mM and less than 10.0 mM, and / or the concentration of the oxidized form of the sulfhydryls ranges between greater than 2.0 mM and less than 5.0 mM.

[0135] The one or more sulfhydryl compounds disclosed herein and in connection with the present invention are selected from the group consisting of cysteine, cystine, succinimer, methimazole, cysteamine, azathioprine, mercaptopurine, S-methylcysteine, selenocysteine, S-phosphocysteine, 4'-phosphopantetheine, butyrylthiocholine, carbocysteine, N-sulfocysteine, alethin, acetylcysteine, dimercaprol, coenzyme M, sodium aurothiomalate, pantethine, bucillamine, methylselenocysteine, dimercaptosuccinic acid, acetylcysteinamide, thioglycolic acid, 2,3-dimercaptopropanol, O-methylmercaptoethanol, mercaptoacetic acid, furmercaptopropionic acid, methyl mercaptan, S-methylmercaptoethanol, glutathione, glutathione deivatives, and combinations thereof. Preferably, the one or more sulfhydryl compounds are selected from the group consisting of cysteine, cystine, and combinations thereof.

[0136] In particular, the one or more sulfhydryl compounds can be selected from the group consisting of cysteine, cystine, and combinations thereof. For example, the one or more sulfhydryl compounds are cysteine, and the cysteine ​​concentration in the cell culture medium is greater than 4.0 mM and less than 10.0 mM, preferably the cysteine ​​concentration is at least 5.0 mM and not more than 6.0 mM.

[0137] Alternatively (e.g., in the case of cysteine ​​and / or cystine), cell culture media for producing recombinant proteins with mono- or di-galactosylated glycans in mammalian cells contain 0.5 g / L to 1.2 g / L, preferably 0.6 g / L to 1.2 g / L, of one or more sulfhydryl compounds.

[0138] The cell culture medium disclosed herein and in the context of the present invention may contain at least 3.0 g / L of glucose, more preferably at least 4.0 g / L of glucose. Alternatively, the cell culture medium may contain up to 13.0 g / L, preferably 8.0 g / L, more preferably up to 7.0 g / L, even more preferably up to 6.0 g / L, and most preferably up to 5.0 g / L of glucose. In particular, the cell culture medium described herein and in the context of the present invention may contain between 3.0 g / L and 13 g / L of glucose, preferably between 3.0 g / L and up to 8.0 g / L of glucose, more preferably between 3.0 g / L and up to 7.0 g / L of glucose, even more preferably between 3.0 g / L and up to 6.0 g / L of glucose, and most preferably between 3.0 g / L and up to 5.0 g / L of glucose.

[0139] As will be appreciated by those skilled in the art, the basal medium and feed medium used to culture cells for recombinant protein production, as well as other variables such as feeding schedule, growth rate, temperature, and oxygen level, can affect the yield and quality of the expressed protein. Methods for optimizing these conditions are within the knowledge of those skilled in the art, and exemplary conditions are described in the Examples herein. As described herein and in the context of the present invention, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free, and / or oligopeptide-free cell culture medium.

[0140] Chemically defined media have been widely developed and published in recent years, including those for mammalian cell culture. All components of defined media are well characterized, and such media do not contain complex additives such as serum and hydrolysates. Typically, these media contain defined amounts of purified growth factors, proteins, lipoproteins, and other substances that would otherwise be provided by serum or extract supplements. Such media have been manufactured for the sole purpose of supporting highly productive cell culture. Certain defined media may be referred to as low-protein media, or may be protein-free if they do not contain typical components of low-protein media, such as insulin and transferrin. Alternatively, serum-free media can be used in the methods of the present invention. Such media typically do not contain serum or protein fractions but may contain undefined components. Examples of commercially available culture media include Ham's F10 (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma), as well as chemically defined media and feed supplements sold by Life Technologies. Any of these media may be supplemented, as needed, with hormones and / or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as GENTAMYCIN™), and glucose or an equivalent energy source. The nutrients and growth factors required for a medium, including concentrations, for a particular cell line can be determined empirically and without undue experimentation, as described, for example, in "Mammalian Cell Culture," Mather (Plenum Press: NY 1984); Barnes and Sato, Cell 22 (1980) 649, or "Mammalian Cell Biotechnology: A Practical Approach," M. Butler (IRL Press, 1991).Suitable media include basal medium components, e.g., DMEM / HA F12-based formulations with modified concentrations of several components such as amino acids, salts, sugars, and vitamins, and optionally contain glycine, hypoxanthine, thymidine, recombinant human insulin, hydrolyzed peptones such as PRIMATONE HS™ or PRIMATONE RL™ (Sheffield, England) or equivalents, cytoprotectants such as PLURONIC F68™ or equivalent pluronic polyols, and GENTAMYCIN™.

[0141] In another aspect of the present invention, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free, and / or oligopeptide-free cell culture medium, which contains 4.0 mM to 10.0 mM of sulfhydryl groups from one or more sulfhydryl compounds. In another preferred aspect, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free, and / or oligopeptide-free cell culture medium, which contains at least 4.0 mM and no more than 9.0 mM, preferably at least more than 4.0 mM and no more than 8.0 mM, more preferably at least more than 4.0 mM and no more than 7.0 mM, and even more preferably at least more than 4.0 mM and no more than 6.0 mM of sulfhydryl groups from one or more sulfhydryl compounds. In yet another preferred aspect of the invention, the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free and / or oligopeptide-free cell culture medium, wherein the cell culture medium comprises at least 5.0 mM and less than 10.0 mM, preferably at least 5.0 mM and not more than 9.0 mM, more preferably at least 5.0 mM and not more than 8.0 mM, even more preferably at least 5.0 mM and not more than 7.0 mM, and most preferably at least 5.0 mM and not more than 6.0 mM of sulfhydryl groups from one or more sulfhydryl compounds.

[0142] The concentrations of one or more sulfhydryl compounds calculated to be present in commercially available media as described above will vary if those media are supplemented with complex components such as serum or peptone. Where the methods of the invention involve adjusting the concentration of one or more sulfhydryl compounds in a culture medium by adding one or more sulfhydryl compounds to the medium, any of the sulfhydryl compounds provided herein and suitable for inclusion in a medium for the production of recombinant proteins can be used.

[0143] Figure 3 shows the regulation of the UDP-glucose and UDP-galactose interconversion pathway in CHO K1 by sulfhydryl compounds. As shown in Figure 3, stimulating UDP-Gal-T by adding sulfhydryl compounds such as L-cysteine ​​can convert more UDP-galactose to UDP-glucose, resulting in less UDP-galactose remaining in the cytoplasm. As shown in Figure 4, adding L-cystine instead of L-cysteine ​​to the cell culture medium can attenuate the effect of L-cysteine ​​on stimulating UDP-Gal-T enzyme activity in the cytoplasm. Meanwhile, increased L-cystine uptake may provide a more effective redox system for regulating cell survival and improving the UDP-galactose metabolic process.

[0144] Another aspect of the present invention is the use of simple sulfhydryl molecules, such as L-cysteine ​​and / or cystine, to regulate intracellular UDP-glucose and UDP-galactose concentrations in mammalian cells, such as CHO K1 and its derivative cell lines, in vivo. For example, L-cystine can be added to the culture medium to regulate intracellular UDP-glucose and UDP-galactose concentrations in CHO K1 cells in vivo. In this way, the quantity and quality of the final product can be controlled and improved for predefined clinical applications.

[0145] Modulation of the UDP-glucose / UDP-galactose pathway to control product glycosylation and cell culture processes As shown in Figure 5, UDP-galactose acts as a galactosyl donor in different galactosylation reactions catalyzed by glycosyltransferases. For example, UDP-α-D-galactose:N-acetyl-β-D-glucosaminylglycopeptide 4-β-galactosyltransferase (EC 2.4.1.38) catalyzes the formation of a Galβ1-4 GlcNAc linkage by transferring a galactosyl group from UDP-galactose to GlcNAc (Qasba et al., Curr. Drug. Targets. 9 (2008) 292-309).

[0146] An increase in L-cysteine ​​in the cytoplasm may stimulate the enzyme UDP-Gal-T to convert more UDP-galactose to UDP-glucose, resulting in a decrease in the cytoplasmic pool of UDP-galactose for subsequent galactosylation reactions. On the other hand, in the presence of L-cystine instead of L-cysteine ​​in the cell culture medium, L-cystine is not involved in the conversion of galactose to UDP-glucose. c - Increased L-cystine uptake may attenuate stimulation of the enzyme UDP-Gal-T, resulting in a balanced cytoplasmic pool of UDP-galactose for subsequent galactosylation reactions.

[0147] According to the present invention, the concentration of one or more sulfhydryl compounds is controlled to affect the galactosylation pattern of recombinant proteins produced by mammalian cells. Concentrations of one or more sulfhydryl compounds having sulfhydryl groups ranging from about 4 mM to 10 mM may be used, and this can be modified according to the specific host cell being cultured and the desired galactosylation pattern of the recombinant protein being produced. To produce proteins with a desired galactosylation pattern, concentrations of one or more sulfhydryl compounds that provide a consistent, uniform galactosylation pattern of the recombinant protein are selected. To increase the galactosylation content of recombinant proteins, lower concentrations generally provide improved galactosylation content while maintaining the viability of the mammalian host cell culture. Generally, concentrations of one or more sulfhydryl compounds, such as cysteine ​​and / or cystine having sulfhydryl groups ranging from about 4 mM to 10 mM, preferably about 5 mM to 10 mM, are used. More preferably, a concentration of at least about 5.0 mM and not more than 9.0 mM, more preferably at least about 5.0 mM and not more than 8.0 mM, even more preferably at least about 5.0 mM and not more than 7.0 mM, and most preferably at least about 5.0 mM and not more than 6.0 mM is used. Alternatively (e.g., in the case of cysteine ​​and / or cystine), a concentration of at least about 0.6 g / L and not more than 1.1 g / L, more preferably at least about 0.6 g / L and not more than 1.0 g / L, more preferably at least about 0.6 g / L and not more than 0.9 g / L, even more preferably at least about 0.6 g / L and not more than 0.8 g / L, and most preferably at least about 0.6 g / L and not more than 0.7 g / L is used.

[0148] As used herein, the term "concentration" of one or more sulfhydryl compounds refers to the total concentration of all sulfhydryl compounds contained in the culture medium. As used herein, the term "concentration" of sulfhydryl groups refers to the total concentration of all sulfhydryl compounds contained in the culture medium. In this context, sulfhydryl groups refer to -SH (also referred to herein as [-SH]), and may refer to sulfhydryl groups that have undergone a reaction, in which hydrogen dissociates from the sulfur atom of the sulfhydryl group and the sulfur atom forms an S-S bond with the sulfhydryl group that has undergone the reaction. In other words, the term "sulfhydryl group" also includes sulfhydryl groups linked by, for example, disulfide bridges. The concentration can be the measured or measurable, or calculated or calculable, actual concentration of sulfhydryl compounds in the medium surrounding the cells at a given time. Methods for measuring the concentration of these sulfhydryl compounds in the medium are known in the art. An example of such a method is PCI-MS (Agilent, Boblingen, Germany). Therefore, concentration also refers to the amount of sulfhydryl compound contained in the culture medium surrounding the cells during culture, and thus the actual concentration of each sulfhydryl compound at a given time point. This concentration can be determined analytically and results, for example, from the introduction of sulfhydryl compounds into the culture (by weighing, transferring cells and medium from a previous culture, introducing impurities, leaching, etc.), release by cells (e.g., by cell death or active secretion), uptake by cells, and other factors.

[0149] As used in the context of the present invention, a cell culture medium comprises elevated levels of one or more sulfhydryl compounds compared to a cell culture medium that does not contain elevated levels of one or more sulfhydryl compounds.

[0150] In particular, the present invention provides a method for producing a recombinant protein or antibody, in particular a glycoprotein such as an anti-CD20 / anti-CD3 bispecific antibody or an anti-α-synuclein antibody, comprising the steps of: (a) culturing the mammalian cells described herein in a cell culture medium described herein, wherein a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 4.0 mM and less than 10.0 mM and glucose greater than at least 3.0 g / L in the cell culture medium is maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating said antibody; The present invention relates to a method, comprising:

[0151] In the context of the methods of the present invention, the recombinant protein has elevated levels of mono- or di-galactosylated glycans compared to the corresponding levels of the recombinant protein produced using a medium that does not contain elevated levels of one or more sulfhydryl compounds. When used in the context of the methods of the present invention, the recombinant protein has an elevated level of mono- or di-galactosylated glycans by at least 3%, more preferably at least 5%, and even more preferably at least 10%. When used in the context of the methods of the present invention, the titer of the recombinant protein produced is increased compared to the titer of the corresponding recombinant protein produced using a medium that does not contain elevated levels of one or more sulfhydryl compounds. Preferably, the titer of the recombinant protein produced is at least 2000 mg / L.

[0152] When used in connection with the methods of the present invention, the viable cell density of cells in the cell culture medium is increased compared to the corresponding viable cell density of cells in a medium that does not contain elevated levels of one or more sulfhydryl compounds. Preferably, the maximum viable cell density of cells in the cell culture medium is at least about 120 x 10 5 cells / mL.

[0153] For example, the recombinant protein can be an anti-CD20 / anti-CD3 bispecific antibody having 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan, preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan, more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan. Said culturing of mammalian cells may result in an increase in titer of said antibody of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and most preferably at least 80%, compared to the titer in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium above at least 4.0 mM and below 10.0 mM.

[0154] In other examples, the recombinant protein may comprise 17.2 to 48.0% (w / w) G1 and 3.1 to 15.0% (w / w) G2 per total glycan, 25.4 to 48.0% (w / w) G1 and 3.5 to 15.0% (w / w) G2 per total glycan; preferably 27.2 to 47.0% G1 and 4.4 to 15.0% G2 per total glycan; preferably 4.4 to 47.0% G1 and 4.4 to 15.0% G2 per total glycan. The anti-α-synuclein antibody may have 0.0 to 46.0% (w / w) G1 and 8.4 to 15.0% (w / w) G2; more preferably, 41.0 to 45.0% (w / w) G1 and 9.5 to 14.0% (w / w) G2 per total glycan; and most preferably, 42.1 to 43.9% (w / w) G1 and 10.6 to 13.3% (w / w) G2 per total glycan. The culturing of mammalian cells may result in an increase in titer of the antibody of at least 10%, preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, and most preferably at least 100%, compared to the titer in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium greater than at least 4.0 mM and less than 10.0 mM. As another example, the culturing of mammalian cells may result in an increase in titer of the antibody of 9.0 to 75%, compared to the titer in a corresponding culture of mammalian cells that does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds in the cell culture medium greater than at least 4.0 mM and less than 10.0 mM.

[0155] Further, the culture of mammalian cells does not maintain a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than 4.0 mM and less than 10.0 mM in the cell culture medium, compared to the non-monogalactosylated (G1) and non-digalactosylated (G2) forms of the anti-α-synuclein antibody in corresponding cultures of mammalian cells. (i) an increase of at least 10%, preferably at least 20%, more preferably at least 35%, even more preferably at least 45%, and most preferably at least 50% in protein target binding (ii) an increase in neonatal Fc receptor (FcRn) binding of at least 10%, preferably at least 20%, more preferably at least 33%, more preferably at least 40%, and most preferably at least 45%, and / or (iii) an increase of at least 10%, preferably at least 20%, more preferably at least 36%, even more preferably at least 45%, and most preferably at least 50% in FcyRIIa binding The present invention provides an anti-α-synuclein antibody having monogalactosylated (G1) and digalactosylated (G2) glycans characterized by:

[0156] As used herein, "recombinant protein" or "recombinantly expressed protein" refers to a protein expressed from a host cell that has been engineered for the purpose of such expression. The engineering involves one or more genetic modifications, such as the introduction of one or more heterologous genes encoding the protein to be expressed. The heterologous genes may encode proteins that are normally expressed in the cell or that are foreign to the host cell. Alternatively, the engineering may be the upregulation or downregulation of one or more endogenous genes. As used in the context of the present invention, a recombinant protein has monogalactosylated or digalactosylated glycans. As used herein, the term "glycan" of a recombinant protein refers to a glycoprotein. As used herein, "glycoprotein" generally refers to peptides and proteins having more than about 10 amino acids and at least one oligosaccharide side chain. The glycoprotein may be homologous to the host cell or, preferably, is heterologous, i.e., foreign, to the host cell utilized, such as a human protein produced by Chinese hamster ovary (CHO) cells. Preferably, mammalian glycoproteins (glycoproteins originally derived from mammalian organisms) are used, more preferably those directly secreted into the culture medium. Examples of mammalian glycoproteins include molecules such as cytokines and their receptors, as well as chimeric proteins containing cytokines or their receptors, including tumor necrosis factor alpha and beta, their receptors and their derivatives, growth hormones including human growth hormone and bovine growth hormone, growth hormone-releasing factor, parathyroid hormone, thyroid-stimulating hormone, lipoproteins, alpha-1-antitrypsin, insulin A chain, insulin B chain, proinsulin, follicle-stimulating hormone, calcitonin, luteinizing hormone, glucagon, clotting factors, such as factor VIIIC, factor IX tissue factor, and von Willebrand factor, anticoagulants such as protein C, atrial natriuretic factor, pulmonary surfactant, urokinase, plasminogen activators such as human urinary or tissue-type plasminogen activator (t-PA), bombesin, thrombin, hematopoietic growth factors, enkephalinase,RANTES (regulated on activation normally expressed and secreted by T-cells), human macrophage inflammatory protein (MIP-1-α), serum albumins such as human serum albumin, murelan inhibitor, relaxin A chain, relaxin B chain, prorelaxin, mouse gonadotropin-related peptide, microbial proteins such as β-lactamase, DNase, inhibin, activin, vascular endothelial growth factor (VEGF), hormone or growth factor receptors, integrins, protein A or D, rheumatoid factor, and mitochondrial proteins. trophic factors, for example, bone-derived neurotrophic factor (BDNF), neurotrophin-3-4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6), or nerve growth factors such as NGF-β, platelet-derived growth factor (PDGF), fibroblast growth factors such as aFGF and bFGF, epidermal growth factor (EGF), transforming growth factors such as TGF-α and TGF-β, including TGF-β1, TGF-β2, TGF-β3, TGF-β4, and TGF-β5; Examples of polypeptides include transforming growth factors (TGFs), insulin-like growth factors-I and -II (IGF-I and IGF-II), des(1-3)-IGF-I (brain IGF-I), insulin-like growth factor binding proteins, CD proteins such as CD-3, CD-4, CD-8, CD-19, erythropoietin, osteoinductive factors, immunotoxins, bone morphogenetic proteins (BMPs), interferons such as interferon-alpha, -beta, and -gamma, colony-stimulating factors (CSFs) such as M-CSF, GM-CSF, and G-CSF, interleukins (ILs) such as IL-1 through IL-10, superoxide dismutase, T cell receptors, surface membrane proteins, decay-accelerating factors, viral antigens such as portions of the AIDS envelope, transport proteins, homing receptors, addressins, regulatory proteins, antibodies, chimeric proteins such as immunoadhesins, and fragments of any of the above-listed polypeptides. "Galactosylated" as used herein with respect to glycoproteins refers to glycoproteins that contain one or more galactose residues, resulting in G1 and G2 sugar structures. For example, GlcNAc3Man3GlcNAc2Gal, GlcNAc3Man3GlcNAc2Gal2,Galactosylated recombinant proteins having mono- or di-galactosylated glycans containing one or more sialic acid residues, such as GlcNAc3Man3GlcNAc2GalSiai, GlcNAc3Man3GlcNAc2Gal2Siai, and GlcNAc3Man3GlcNAc2Gal2Siai2.

[0157] In one aspect, the recombinant protein used in the context of the present invention is an antibody. As used herein, the term "antibody" (Ab) refers to an immunoglobulin molecule or an immunologically active portion of an immunoglobulin molecule, i.e., a molecule containing an antigen-binding site, such as a Fab or F(ab')2 fragment, whether natural or partially or wholly synthetically produced. The term "antibody" is used in its broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies (including full-length antibodies or intact monoclonal antibodies having an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, polyclonal antibodies, multivalent antibodies (typically engineered to have three or more antigen-binding sites), multispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies, single-chain molecules such as diabodies and scFv molecules, and antibody fragments (e.g., Fab, F(ab')2, and Fv), so long as they exhibit the desired antigen-binding activity. Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites, i.e., different epitopes on different antigens or different epitopes on the same antigen. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments.

[0158] Techniques for producing multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs with different specificities (see Milstein and Cuello, Nature 305:537 (1983)) and "knob-in-hole" engineering (see, e.g., U.S. Pat. No. 5,731,168 and Atwell et al., J. Mol. Biol. 270:26 (1997)). Multispecific antibodies have also been developed using techniques such as the manipulation of electrostatic steering effects to create antibody Fc heterodimeric molecules (see, e.g., WO 2009 / 089004); cross-linking of two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980 and Brennan et al., Science, 229:81 (1985)); the generation of bispecific antibodies using leucine zippers (see, e.g., Kostelny et al., J. Immunol., 148(5):1547-1553 (1992) and WO 2011 / 034605); and the use of leucine zippers to circumvent light chain mispairing problems. (see, e.g., WO 98 / 50431); using "diabody" technology to make bispecific antibody fragments (see, e.g., Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); and using single-chain Fv (sFv) dimers (see, e.g., Gruber et al., J. Immunol., 152:5368 (1994)); and by preparing trispecific antibodies as described, for example, in Tutt et al., J. Immunol. 147:60 (1991).

[0159] The definition of antibody includes antibody conjugates, such as antibody drug conjugates (ADCs), or antibodies conjugated to, for example, labeling elements. Further included within the definition of antibody are antibodies that bind to a specific target protein with sufficient affinity so that the antibody is useful as a diagnostic and / or therapeutic agent in targeting that specific protein. For example, the antibody can be an anti-α-synuclein antibody that can bind to α-synuclein with sufficient affinity so that the antibody is useful as a diagnostic and / or therapeutic agent in targeting α-synuclein.

[0160] As another example, the antibody can be an anti-CD20 / anti-CD3 antibody capable of binding to CD20-CD3 with sufficient affinity to be useful as a diagnostic and / or therapeutic agent in targeting CD20-CD3. In one aspect, the degree of binding of the antibody to unrelated, non-target proteins is less than about 10% of the binding of the antibody to the target, as measured, for example, by surface plasmon resonance (SPR). In certain aspects, the antibody that binds to the target has an affinity of 1 μM or less, 100 nM or less, 10 nM or less, 1 nM or less, 0.1 nM or less, 0.01 nM or less, or 0.001 nM or less (e.g., 10 -8 M or less, e.g. 10 -8 M~10 -13 M, e.g. 10 -9 M~10- -13 Dissociation constant (K D ) The antibody has a K value of 1 μM or less. DAn antibody is said to "specifically bind" to a target if it has a specific binding domain. In certain aspects, the antibody binds to an epitope of the target that is conserved among targets from different species. In other aspects used in the context of the present invention, the recombinant protein is a therapeutic protein. For example, when the recombinant protein is an antibody, the antibody may be a therapeutically effective antibody, such as an antibody that is bispecific for a member of the angiopoietin family, such as Ang1, Ang2, Ang3, and Ang4, and an antibody that is bispecific for a member of the angiopoietin family, such as Ang2 / VEGF, for example, a member of the HER receptor family, such as HER1 (EGFR), HER2, HER3, and HER4, CD3, CD4, CD8, CD18, CD19, CD20, CD21, CD22, CD25, CD It can bind to any protein, including CD proteins such as D33, CD34, CD38, CD40, CD44 and CD52, cell adhesion molecules such as LFA-1, VLA04, ICAM-1, VCAM and integrins (e.g., anti-CD11α, anti-CD18 or anti-CD11β antibodies), growth factors such as vascular endothelial growth factor (VEGF), cytokine receptors such as thymic stromal lymphopoietin receptor (TSLP-R), IgE, blood group antigens, flk2 / flt3 receptor, obesity (OB) receptor and protein C. Other exemplary proteins include growth hormones (GH), including human growth hormone (hGH) and bovine growth hormone (bGH), growth hormone-releasing factor, parathyroid hormone, thyroid-stimulating hormone, lipoproteins, insulin A chain, insulin B chain, proinsulin, follicle-stimulating hormone, calcitonin, luteinizing hormone, glucagon, clotting factors, e.g., factor VIIIC, tissue factor (TF), von Willebrand factor, atrial natriuretic factor, pulmonary surfactant, plasminogen activators, e.g., urokinase, tissue-type plasminogen activator (t-PA), bombadin, thrombin, tumor necrosis factor-α, -β, enkephalinase, RANTES (regulated on activation normally T-cell expressed andsecreted), human macrophage inflammatory protein (MIP-1-α), serum albumins such as human serum albumin (HSA), murellan inhibitor, relaxin A chain, relaxin B chain, prorelaxin, mouse gonadotropin-related peptide, DNase, inhibin, activin, hormone or growth factor receptor, protein A or D, fibroblast activation protein (FAP), carcinoma embryonic antigen (CEA), rheumatoid factor, neurotrophic factors such as bone-derived neurotrophic factor (BDNF), nerve growth factors such as neurotrophin-3, -4, -5 or -6 (NT-3, NT-4, NT-5 or NT-6) or NGF-β, fibroblast growth factors such as platelet-derived growth factor (PDGF), aFGF and bFGF, epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR), TGF-1, TGF-2, TGF-3, TG Transforming growth factors (TGFs) such as TGF-α and TGF-β, including F-4 or TGF-βδ, insulin-like growth factors-1 and -II (IGF-I and IGF-II), des(1-3)-IGF-1 (brain IGF-I), insulin-like growth factor binding proteins (IGFBPs), erythropoietin (EPO), thrombopoietin (TPO), osteoinductive factors, immunotoxins, bone morphogenetic proteins (BMPs), interferons (interferon-α, -β, or -γ), colony-stimulating factors (CSFs) such as M-CSF, GM-CSF, and G-CSF, interleukins (ILs) such as IL-1 to IL-10 and IL-17, superoxide dismutase, T cell receptors, BlyS (Br3) receptors, Br3-Fc immunoadhesins, Apo-2 receptors, Fc receptors, surface membrane proteins, FAPs (decay accelerating receptors), and the like.Antibodies include antibodies against breast epithelial cells or antibodies that bind to colon carcinoma cells, anti-EpCAM antibodies, anti-Gpllb / IIla antibodies, anti-RSV antibodies, anti-CMV antibodies, anti-HIV antibodies, anti-hepatitis antibodies, anti-CA125 antibodies, anti-human renal cell carcinoma antibodies, anti-human colorectal tumor antibodies, anti-human melanoma antibody R24 against GD3 ganglioside, anti-human squamous cell carcinoma antibodies, anti-human leukocyte antigen (HLA) antibodies, anti-HLA DR antibodies.

[0161] As used herein, the terms "antigen" and "epitope" are used interchangeably and refer to a site on either a proteinaceous or nonproteinaceous antigen (e.g., a contiguous stretch of amino acids or a conformation composed of distinct regions of noncontiguous amino acids) to which an antibody-binding moiety binds to form an antibody-binding moiety-antigen complex. Thus, an epitope is the region of an antigen that is bound by an antibody. Epitopes can be formed from a contiguous stretch of amino acids (linear epitopes) or can include noncontiguous amino acids (conformational epitopes), formed in spatial proximity due to, for example, antigen folding (i.e., tertiary folding of a proteinaceous antigen). Linear epitopes are typically still bound by antibodies after exposure of a proteinaceous antigen to denaturing agents, whereas conformational epitopes are typically disrupted by treatment with denaturing agents. Epitopes comprise at least 3, at least 4, at least 5, at least 6, at least 7, or 8-10 amino acids in a unique spatial structure.

[0162] In certain embodiments, epitopic determinants include chemically active surface groups of molecules, such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and may, in certain embodiments, have specific three-dimensional structural characteristics and / or specific charge characteristics. Useful antigenic determinants can be found, for example, on the surface of tumor cells, on the surface of virus-infected cells, on the surface of other diseased cells, on the surface of immune cells, free in serum, and / or in the extracellular matrix (ECM). Unless otherwise specified, proteins useful as antigens herein may be proteins in any native form from any vertebrate source, including mammals, e.g., primates (e.g., humans) and rodents (e.g., mice and rats). Screening for antibodies that bind to a specific epitope (i.e., antibodies that bind to the same epitope) can be performed using methods routine in the art, such as, but not limited to, alanine scanning, peptide blotting (Meth. Mol. Biol. 248 (2004) 443-463), peptide cleavage analysis, epitope excision, epitope extraction, chemical modification of antigens (see Prot. Sci. 9 (2000) 487-496), and cross-blocking (see "Antibodies," Harlow and Lane, Cold Spring Harbor Press, Cold Spring Harb., NY).

[0163] In certain embodiments, the antigen is a human protein.When referring to a specific protein of the present invention, this term includes "full-length" unprocessed protein and any form of protein obtained from cell processing.This term also includes naturally occurring variants of protein, such as splice variants or allelic variants.In other words, this term also includes antibodies that have a heavy chain that has a structure substantially similar to that of a native antibody or that contains the Fc region described herein.

[0164] "Antigen binding" means that an antigen-binding site of an antibody specifically binds to an antigen. In other words, the term "antigen-binding site" refers to a portion of an antibody that specifically binds to and contains a region complementary to a portion or all of an antigen. "Specific binding" means that the binding is antigen-selective and can be distinguished from unwanted or non-specific interactions. The ability of an antigen-binding molecule to bind to a specific antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques known to those skilled in the art, such as surface plasmon resonance (SPR) technology (analyzed with a BIAcore device) (Liljeblad et al., Glyco J 17, 323-329 (2000)) and conventional binding assays (Heeley, Endocr Res 28, 217-229 (2002)).

[0165] The variable regions of the heavy and light chains of immunoglobulin molecules contain binding domains that interact with antigens. The constant region of an antibody (Ab) can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (such as effector cells) and components of the complement system, such as Clq, the first component in the classical pathway of complement activation. As used herein, the term "variable domain" (variable domain of the light chain (VL), variable domain of the heavy chain (VH)) refers to each of a pair of light and heavy chains that are directly involved in binding of the antibody to the antigen. The domains of variable human light and heavy chains have the same general structure, and each domain contains four framework (FR) regions whose sequences are widely conserved and connected by three "hypervariable regions" (or complementarity-determining regions, CDRs). (See, e.g., Kindt et al., "Kuby Immunology," 6 thed., W.H. Freeman and Co., page 91 (2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind to a specific antigen may be isolated by using the VH or VL domain of an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991). As used herein, the term "hypervariable region" or "HVR" refers to each region of an antibody variable domain that is hypervariable in sequence and determines antigen-binding specificity, e.g., a "complementarity-determining region" ("CDR"). Unless otherwise specified, CDRs are determined according to Kabat et al., supra. Those skilled in the art will understand that the designation of CDRs can be determined according to Chothia, supra, McCallum, supra, or any other scientifically accepted nomenclature system.

[0166] The β-sheet conformation and the CDRs may form loops connecting the β-sheet structure. The CDRs in each chain are held in a three-dimensional structure by the framework regions and form an antigen-binding site together with the CDRs from the other chain. The heavy and light chain CDR3 regions of an antibody play a particularly important role in the binding specificity / affinity of the antibody according to the present invention, and therefore provide a further object of the present invention. Unless otherwise specified herein, the numbering of amino acid residues in the variable or constant regions follows the format set forth in Kabat et al., Sequences of Proteins of Immunological Interest, 5 thThe EU numbering system, also known as the EU index, is used as described in Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991. "Framework" or "FR" refers to variable domain residues other than hypervariable region (HVR) residues. The FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Thus, the HVR and FR sequences generally appear in the VH (or VL) in the following order: FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4. Except for CDR1 in VH, CDRs generally comprise amino acid residues that form hypervariable loops. CDRs also comprise "specificity-determining regions," or "SDRs," which are residues that contact the antigen. The SDRs are contained within the region of the CDR referred to as the abbreviation-CDR, or a-CDR. Exemplary a-CDRs (a-CDR-L1, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2, and a-CDR-H3) are located at amino acid residues 31-34 of L1, 50-55 of L2, 89-96 of L3, 31-35B of H1, 50-58 of H2, and 95-102 of H3 (See Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008)).

[0167] As noted above, the term antibody, as used herein, unless otherwise specified or clearly contradicted by the context, includes full-length antibodies and antigen-binding fragments, i.e., fragments of antibodies that retain the ability to specifically bind to an antigen. In other words, the term "fragment," as used herein, refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, (i) Fab' or Fab fragments, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv and scFab), multispecific antibodies formed from antibody fragments, V L , V H , C L and C H(ii) a monovalent fragment consisting of one domain, or a monovalent antibody as described in WO 2007059782 (Genmab); (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a V H Domain and C H (iv) an Fd fragment consisting essentially of one domain, V of a single arm of an antibody; L Domains and V H (v) an Fv fragment consisting essentially of the V domain; H These include (vi) dAb fragments (Ward et al., Nature 341, 544-546 (1989)), which essentially consist of domains and are also called domain antibodies (Holt et al., Trends Biotechnol. 2003 Nov; 21(11):484-90), (vi) camelids or nanobodies (Revets et al., Expert Opin Biol Ther. 2005 Jan; 5(1):111-24), and (vii) isolated complementarity-determining regions (CDRs). Pepsin treatment yields F(ab')2 fragments, which contain two antigen-binding sites (two Fab fragments) and a portion of the Fc region. For a discussion of Fab and F(ab')2 fragments containing salvage receptor-binding epitope residues and increased in vivo half-lives, see U.S. Patent No. 5,869,046. Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, e.g., European Patent No. 404,097, International Publication No. WO 1993 / 01161, Hudson et al., Nat. Med. 9:129-134 (2003), and Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993). Additionally, two domains of the Fv fragment, V L and V H are encoded by separate genes, they can be synthesized using recombinant methods L and V HThe regions can be linked by a synthetic linker that allows them to be generated as a single protein chain that pairs to form a monovalent molecule (known as a single-chain antibody or single-chain Fv (scFv)—see, for example, Bird et al., Science 242, 423-426 (1988) and Huston et al., PNAS USA 85, 5879-5883 (1988)). Thus, a "single-chain variable fragment" or "scFv" is a fusion protein of the variable domains of an antibody's heavy chain (VH) and light chain (VL) connected by a linker. In particular, the linker is a short polypeptide of 10 to 25 amino acids, typically rich in glycine for flexibility and serine or threonine for solubility, that can connect the N-terminus of the VH to the C-terminus of the VL, or vice versa. This protein can retain the specificity of the original antibody despite the removal of the constant regions and the introduction of the linker. For a review of scFv fragments, see, for example, Plueckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-Verlag, New York), pp. 269-315 (1994). See also WO 93 / 16185 and U.S. Patent Nos. 5,571,894 and 5,587,458. A "single-domain antibody" is an antibody fragment containing all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain aspects, the single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, MA; see, for example, U.S. Patent No. 6,248,516). Antibody fragments can be produced by various techniques, including, but not limited to, proteolytic digestion of intact antibodies and recombinant production in recombinant host cells (e.g., E. coli), as described herein.

[0168] Such single-chain antibodies are encompassed by the term antibody unless otherwise specified or clearly indicated by the context. Although such fragments are generally included within the meaning of antibody, they collectively and individually represent unique features of the present invention and exhibit different biological properties and usefulness. These and other useful antibody fragments in the context of the present invention, as well as bispecific formats of such fragments, are further discussed herein. For a review of specific antibody fragments, see Holliger and Hudson, Nature Biotechnology 23:1126-1136 (2005).

[0169] The term "full-length antibody" refers to an antibody consisting of two "full-length antibody heavy chains" and two "full-length antibody light chains." A "full-length antibody heavy chain" is a polypeptide consisting, from N- to C-terminus, of an antibody heavy chain variable domain (VH), antibody constant heavy chain domain 1 (CH1), antibody hinge region (HR), antibody heavy chain constant domain 2 (CH2), and antibody heavy chain constant domain 3 (CH3), abbreviated as VH-CH1-HR-CH2-CH3, and optionally, in the case of antibodies of the subclass IgE, antibody heavy chain constant domain 4 (CH4). Preferably, a "full-length antibody heavy chain" is a polypeptide consisting, from N- to C-terminus, of VH, CH1, HR, CH2, and CH3. A "full-length antibody light chain" is a polypeptide consisting, from N- to C-terminus, of an antibody light chain variable domain (VL) and antibody light chain constant domain (CL), abbreviated as VL-CL. The antibody light chain constant domain (CL) can be kappa (κ) or lambda (λ). Two full-length antibody chains are linked together via interpolypeptide disulfide bonds between the CL and CH1 domains and between the hinge regions of the full-length antibody heavy chains. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. In certain aspects, the antibody is an IgG1 isotype. The "class" of an antibody refers to the type of constant domain or constant region carried by its heavy chain. In certain aspects, the antibody is an IgG1 isotype with P329G, L234A, and L235A mutations to reduce Fc region effector function. In other aspects, the antibody is an IgG2 isotype. In certain aspects, the antibody is of the IgG4 isotype, with the S228P mutation in the hinge region to improve the stability of the IgG4 antibody. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.The light chain of an antibody may be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.

[0170] The term antibody, unless otherwise specified, should also be understood to include antibody-like polypeptides such as polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, and humanized antibodies, as well as antibody fragments (antigen-binding fragments) that retain the ability to specifically bind to an antigen, provided by any known technique, such as enzymatic cleavage, peptide synthesis, and recombinant techniques. The antibody produced can have any isotype. The term "chimeric" antibody refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remaining portions of the heavy and / or light chain are derived from a different source or species.

[0171] For example, the antibody may be a monoclonal antibody. As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and / or bind to the same epitope, with the exception of possible variant antibodies that contain, for example, naturally occurring mutations or arise during production of the monoclonal antibody preparation, and such variants are generally present in small amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and should not be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies can be made by a variety of techniques, including, but not limited to, hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such as those and other exemplary methods for making monoclonal antibodies described herein.

[0172] As another example, the antibody may be a humanized antibody. The term "humanized antibody" refers to an antibody in which the framework or "complementarity-determining regions" (CDRs) have been modified to contain CDRs from an immunoglobulin with different specificity compared to the parent immunoglobulin. In other words, the term encompasses chimeric antibodies containing amino acid residues from non-human CDRs and amino acid residues from human FRs. In certain aspects, a humanized antibody contains substantially all of at least one, typically two, variable domains in which all or substantially all of the CDRs correspond to the CDRs of a non-human antibody and all or substantially all of the FRs correspond to the FRs of a human antibody. A humanized antibody may optionally contain at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization. Methods for producing humanized antibodies include conventional recombinant DNA and gene transfection techniques well known in the art. See Riechmann, L. et al., Nature 332 (1988) 323-327 and Neuberger, MS et al., Nature 314 (1985) 268-270.

[0173] For example, the antibody may be a human antibody. As used herein, the term "human antibody" is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. In other words, the term encompasses antibodies produced by humans or human cells, or antibodies having amino acid sequences corresponding to antibodies of non-human origin that utilize the human antibody repertoire or other human antibody-encoding sequences. This definition of a human antibody specifically excludes humanized antibodies containing non-human antigen-binding residues. Human antibodies are well known in the art (van Dijk, MA, and van de Winkel, JG, Curr. Opin. Chem. Biol. 5 (2001) 368-374). Human antibodies can be produced using various techniques known in the art. Human antibodies are generally described in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5:368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450-459 (2008). Human antibodies may be prepared by administering immunogens to transgenic animals that have been engineered to produce intact human antibodies or intact antibodies with human variable regions in response to antigen challenge. Such animals typically contain all or part of human immunoglobulin loci that replace endogenous immunoglobulin loci or that are present extrachromosomally or randomly integrated into the animal's chromosomes. In such transgenic mice, endogenous immunoglobulin loci are generally inactivated. For a review of methods for obtaining human antibodies from transgenic animals, see Lonberg, Nat. Biotech. 23:1117-1125 (2005). See also, for example, XENOMOUSE. (商標)See also U.S. Patent Nos. 6,075,181 and 6,150,584, which describe HuMab® technology; U.S. Patent No. 5,770,429, which describes HuMab® technology; U.S. Patent No. 7,041,870, which describes KM MOUSE® technology; and U.S. Patent Application Publication No. 2007 / 0061900, which describes VelociMouse® technology. The human variable regions from intact antibodies produced by such animals may be further modified, for example, by combining with different human constant regions.

[0174] Human antibodies can also be produced by hybridoma-based methods. Human myeloma and mouse-human heteromyeloma cell lines for producing human monoclonal antibodies have been described. (See, for example, Kozbor J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al., J. Immunol., 147:86 (1991)). Human antibodies produced via human B cell hybridoma technology are also described in Li et al., Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006). Further methods include, for example, U.S. Patent No. 7,189,826 (which describes the production of monoclonal human IgM antibodies from hybridoma cell lines), and Ni, Xiandai Mianyixue, 26(4):265-268(2006) (which describes human-human hybridomas). Human hybridoma technology (trioma technology) is also described in Vollmers and Brandlein, Histology and Histopathology, 20(3):927-937(2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27(3):185-91(2005).

[0175] Human antibodies can also be generated by isolating variable domain sequences selected from human-derived phage display libraries. These variable domain sequences can then be combined with desired human constant domains. Techniques for selecting human antibodies from antibody libraries are described below.

[0176] In one aspect as used in the context of the present invention, the recombinant protein is an anti-α-synuclein antibody or a bispecific antibody against CD3 and CD20, also called an anti-CD20 / anti-CD3 bispecific antibody. The term "bispecific antibody" in the context of the present invention refers to an antibody having two different antigen-binding regions defined by different antibody sequences. Examples of bispecific antibody formats that may be useful for this purpose include so-called "BiTE" (bispecific T cell engager) molecules in which two scFv molecules are fused by a flexible linker (see, e.g., WO 2004 / 106381, WO 2005 / 061547, WO 2007 / 042261 and WO 2008 / 119567; Nagorsen and Baeuerle, Exp Cell Res 317, 1255-1260 (2011)), diabodies (Holliger et al., Prot Eng 9, 299-305 (1996)) and derivatives thereof, such as tandem diabodies ("TandAb," Kipriyanov et al., J Mol Biol 293, 41-56 (1999)), "DART" (dual affinity retargeting) molecules based on the diabody format but featuring a C-terminal disulfide bridge for stabilizing attachment (Johnson et al., J Mol Biol 399, 436-449 (2010)), and so-called triomabs, which are all-hybrid mouse / rat IgG molecules (reviewed in Seimetz et al., Cancer Treat Rev 36, 458-467 (2010)). Specific T cell bispecific antibody formats included herein are described in WO 2013 / 026833, WO 2013 / 026839, WO 2016 / 020309; Bacac et al., Oncoimmunology 5(8) (2016) e1203498.

[0177] The terms "anti-α-synuclein antibody," "anti-α-synuclein antibody," and "antibody that binds to α-synuclein" refer to antibodies that can bind to human α-synuclein with sufficient affinity to be useful as diagnostic and / or therapeutic agents for targeting α-synuclein. α-Synuclein is a protein that plays a central role in regulating dopaminergic neuron function in the brain and is thought to be critically involved in the pathophysiology of Parkinson's disease (PD). For example, synucleinopathies, also known as Lewy body disease (LBD), are characterized by degeneration of the dopaminergic system, motor changes, cognitive impairment, and the formation of Lewy bodies (LBs) and / or Lewy neurites (McKeith et al., Neurology (1996) 47:1113-24), and can be treated with anti-α-synuclein antibodies. Such synucleinopathies include Parkinson's disease (including idiopathic Parkinson's disease), diffuse Lewy body disease (DLBD), also known as dementia with Lewy bodies (DLB), Lewy body variant of Alzheimer's disease (LBV), combined Alzheimer's and Parkinson's disease, pure autonomic failure, and multiple system atrophy (MSA; e.g., olivopontocerebellar atrophy, striatonigral degeneration, and Shy-Drager syndrome).

[0178] Alpha-synuclein is part of a larger family of proteins that includes beta- and gamma-synuclein and synoretin. Native human wild-type alpha-synuclein is a 140 amino acid peptide with the following amino acid sequence: MDVFMKGLSK AKEGVVAAAE KTKQGVAEAA GKTKEGVLYV GSKTKEGVVH GVATVAEKTK EQVTNVGGAV VTGVTAVAQK TVEGAGSIAA ATGFVKKDQL GKNEEGAPQE GILEDMPVDP DNEAYEMPSE EGYQDYEPEA (SEQ ID NO: 9) (Ueda et al., Proc. Natl. Acad. Sci. USA (1993) 90:11282-6; GenBank accession number: P37840). The protein has three recognized domains: a KTKE repeat domain covering amino acids 1-61, a NAC (non-amyloid component) domain extending from approximately amino acids 60-95, and a C-terminal acidic domain extending from approximately amino acids 98-140. Reference to alpha-synuclein or a fragment thereof includes the naturally occurring human wild-type amino acid sequence set forth above, as well as human allelic variants thereof, particularly those associated with Lewy body disease (e.g., E46K, A30P and A53T, where the first letter indicates the amino acid in SEQ ID NO: 9, the number is the codon position in SEQ ID NO: 9, and the second letter is the amino acid of the allelic variant).

[0179] Alpha-synuclein is normally expressed in synapses and is thought to play a role in neuroplasticity, learning, and memory. Several studies have implicated alpha-synuclein in the pathogenesis of PD. The protein can aggregate to form insoluble fibrils in pathological conditions. For example, synuclein accumulates in LBs (Spillantini et al., Nature (1997) 388:839-40; Takeda et al., J. Pathol. (1998) 152:367-72; Wakabayashi et al., Neurosci. Lett. (1997) 239:45-8). Mutations in the alpha-synuclein gene cosegregate with rare familial forms of parkinsonism (Kruger et al., Nature Gen. (1998) 18:106-8; Polymeropoulos et al., Science (1997) 276:2045-7). Overexpression of α-synuclein in transgenic mice (Masliah et al., Science (2000) 287:1265-9) and Drosophila (Feany et al., Nature (2000) 404:394-8) mimics some pathological aspects of Lewy body disease. Furthermore, it has been suggested that soluble oligomers of synuclein may be neurotoxic (Conway KA et al., Proc Natl Acad Sci USA (2000) 97:571-576; Volles MJ, Lansbury PT, Biochemistry (2003) 42:7871-7878). The accumulation of α-synuclein accompanied by similar morphological and neurological changes in various species and animal models, including humans, mice, and flies, suggests that this molecule contributes to the pathogenesis of Lewy body disease.

[0180] For example, the anti-α-synuclein antibody may be an antibody designated as 9E4 (prasinezumab), BIIB054, 1H7, 5C1, 6H7, 8A5, and NI-202.21D11, as well as related antibodies. Prasinezumab or 9E4 is also known as PRX002 and RG7935. As shown in the accompanying examples, CHO L965 cells (Example 3), CHO L967 cells (Example 6), and CHO L971 cells (Examples 7 and 8) each produce prasinezumab. References to such antibodies may be found in the art, for example 9E4 (prasinezumab) and related antibodies can be found in U.S. Patent No. 8,609,820, U.S. Patent No. 9,556,259, U.S. Patent No. 9,884,906, U.S. Patent No. 8,697,082, U.S. Patent No. 8,506,959, U.S. Patent No. 9,034,337, U.S. Patent No. 7,919,088, U.S. Patent No. 8,092,801, U.S. Patent No. 8,147,833, U.S. Patent No. 8,673,593, U.S. Patent No. 7,910,333 and U.S. Patent No. 7,674,599. References to BIIB054, also known as NI-202.12F4, and related antibodies can be found, for example, in U.S. Patent Nos. 10,301,381, 9,975,947, 8,896,504, 9,580,493, and 8,940,276. References to 1H7 and related antibodies can be found, for example, in U.S. Patent Nos. 7,910,333, 8,790,644, 9,234,031, 9,217,030, 9,670,273, and 10,118,960. References to 5C1 and related antibodies can be found, for example, in U.S. Patent Nos. 9,605,056, 10,081,674, and 10,301,382. Reference to 6H7 and related antibodies can be found, for example, in U.S. Patent Nos. 8,673,593 and 7,910,333. Reference to 8A5 and related antibodies can be found, for example, in U.S. Patent Nos. 8,673,593 and 7,910,333.Reference to NI-202.21D11 and related antibodies can be found, for example, in US Pat. No. 9,580,493.

[0181] In particular, patients with Parkinson's disease and related disorders can be treated with anti-α-synuclein antibodies. In addition to the fact that α-synuclein is the main protein component of Lewy bodies (LBs), genetic studies have shown that specific point mutations and multiple mutations in the α-synuclein gene cause familial forms of PD. A growing body of evidence indicates that α-synuclein pathology at dopaminergic synapses may underlie the development of neuronal dysfunction and degeneration in the PD brain (Bellucci, A. et al., Brain Res. 1432 (2012) 95-113).

[0182] The term "CD20" refers to human CD20 (UniProtKB / Swiss-Prot No. P11836) and includes any variants, isoforms, and species homologs of CD20 naturally expressed by cells, including tumor cells, or expressed on cells transfected with the CD20 gene or cDNA. The CD20 molecule (also known as human B-lymphocyte-restricted differentiation antigen or Bp35) is a hydrophobic transmembrane protein with a molecular weight of approximately 35 kD that is localized on pre-B lymphocytes and mature B lymphocytes (Valentine et al. (1989) J. Biol. Chem. 264(19):11282-11287; and Einfield et al. (1988) EMBO J. 7(3):711-717). CD20 is found on the surface of more than 90% of B cells from peripheral blood or lymphoid organs, where it is expressed during early pre-B cell development and remains until plasma cell differentiation. CD20 is present on both normal and malignant B cells. In particular, CD20 is expressed on more than 90% of B-cell non-Hodgkin's lymphomas (NHL) (Anderson et al. (1984) Blood 63(6):1424-1433), but is not found on hematopoietic stem cells, pro-B cells, normal plasma cells, or other normal tissues (Tedder et al. (1985) J. Immunol. 135(2):973-979).

[0183] As used herein, the term "CD3" refers to the cluster of differentiation 3 protein, which is part of the T cell coreceptor protein complex and is composed of four distinct chains. CD3 is found in humans and other species, and therefore the term "CD3" may be used herein, and is not limited to human CD3, unless inconsistent with the context. In mammals, the complex consists of a CD3y (gamma) chain (human CD3y chain UniProtKB / Swiss-Prot number P09693, or cynomolgus monkey CD3y UniProtKB / Swiss-Prot number Q95LI7), a CD36 (delta) chain (human CD36 UniProtKB / Swiss-Prot number P04234, or cynomolgus monkey CD36 UniProtKB / Swiss-Prot number Q95LI8), two CD3s (epsilon) chains (human CD3s UniProtKB / Swiss-Prot number P07766; cynomolgus monkey CD3s UniProtKB / Swiss-Prot number Q95LI5; or rhesus monkey CD3s UniProtKB / Swiss-Prot number G7NCB9), and a zeta chain (human CD3ζ UniProtKB / Swiss-Prot number G7NCB9). The CD3 chains comprise the T cell receptor (TCR) and the cynomolgus monkey CD3ζ (UniProtKB / Swiss-Prot number P20963, and Q09TK0, respectively). These chains associate with a molecule known as the T cell receptor (TCR) to generate an activation signal in T lymphocytes. The TCR and CD3 molecules together comprise the TCR complex.

[0184] According to the present invention, mammalian cells are cultured to produce recombinant proteins with mono- or digalactosylated glycans. When selecting host cells for producing recombinant proteins in the context of the present invention, those skilled in the art will recognize that different host cells have different characteristics and / or specific mechanisms for translational and post-translational processing and modification of expressed proteins, including, but not limited to, glycosylation and cleavage. In this regard, those skilled in the art will know how to select appropriate cell lines in the context of the present invention. In other words, those skilled in the art will know which cell lines to select to ensure that post-translational modifications are possible. Alternatively, to express recombinant proteins with mono- or digalactosylated glycans, host cells may be modified by the means necessary for specific post-translational modifications. For example, recombinant methods for producing recombinant proteins such as antibodies can be produced, as described in U.S. Pat. No. 4,816,567. For these methods, one or more isolated nucleic acids encoding the antibody are provided. In the case of a native antibody or native antibody fragment, two nucleic acids are required: one for the light chain or fragment thereof and one for the heavy chain or fragment thereof. Such nucleic acids encode an amino acid sequence comprising the VL and / or an amino acid sequence comprising the VH of the antibody (e.g., the light chain and / or the heavy chain of the antibody). These nucleic acids may be on the same expression vector or on different expression vectors.

[0185] In the case of a bispecific antibody having a heterodimeric heavy chain, four nucleic acids are required: one for the first light chain, one for the first heavy chain comprising the first heteromonomeric Fc region polypeptide, one for the second light chain, and one for the second heavy chain comprising the second heteromonomeric Fc region polypeptide. The four nucleic acids may be contained in one or more nucleic acid molecules or expression vectors. Such nucleic acids encode an amino acid sequence comprising a first VL and / or an amino acid sequence comprising a first VH comprising the first heteromonomeric Fc region and / or an amino acid sequence comprising a second VL and / or an amino acid sequence comprising a second VH comprising the second heteromonomeric Fc region of the antibody (e.g., the first and / or second light chains and / or the first and / or second heavy chains of the antibody). These nucleic acids may be on the same or different expression vectors; typically, these nucleic acids are located on two or three expression vectors; i.e., one vector may contain more than one of these nucleic acids. An example of such a bispecific antibody is CrossMab (see, for example, Schaefer, W. et al., PNAS, 108 (2011) 11187-1191). For example, one of the heteromonomer heavy chains contains a so-called "knob mutation" (T366W and, optionally, one of S354C or Y349C) according to the EU index numbering, and the other contains a so-called "hole mutation" (T366S, L368A, and Y407V and, optionally, Y349C or S354C) (see, for example, Carter, P. et al., Immunotechnol. 2 (1996) 73).

[0186] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and its progeny, regardless of the number of passages. The progeny may not be completely identical in nucleic acid content to the parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included in the present invention. Suitable host cells for cloning or expressing antibody-encoding vectors include the prokaryotic or eukaryotic cells described herein. For expression of antibody fragments and polypeptides in bacteria, see, e.g., U.S. Patent Nos. 5,648,237, 5,789,199, and 5,840,523 (see also Charlton, KA, In: Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2003), pp. 245-254, describing the expression of antibody fragments in E. coli). After expression, the antibody may be isolated from the bacterial cell paste in a soluble fraction and may be further purified.

[0187] The terms "mammalian host cell," "mammalian host cell line," and "mammalian host cell culture" are used interchangeably and refer to cell lines derived from mammals that are capable of growth and survival in either monolayer or suspension culture in media containing appropriate nutrients and growth factors. The growth factors required for a particular cell line can be readily determined empirically without undue experimentation, as described, for example, in Mammalian Cell Culture (Mather, JP ed., Plenum Press, NY

[1984] ) and Barnes and Sato, (1980) Cell, 22:649). Typically, the cells are capable of expressing and secreting large amounts of a particular glycoprotein of interest into the culture medium. Examples of suitable mammalian host cells in the context of the present invention include Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasm. Proc. Natl. Acad. Sci. USA. 77:4216 (1980)), dp12.CHO cells (European Patent No. 307.247, published March 15, 1989), SV40-transformed monkey kidney CV1 line (COS-7, ATCC CRL 1651), human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)), baby hamster kidney cells (BHK, ATCC CCL 10), mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)), monkey kidney cells (CV1 ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRL-1587), human cervical carcinoma cells (HELA, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065), mouse mammary tumor (MMT 060562, ATCC CCL 51), TRI cells (Mather et al., Annals NY Acad. Sci., 383:44-68 (1982)), MRC5 cells, FS4 cells, and a human hepatoma line (Hep G2).In a preferred aspect of the present invention, the mammalian cells are selected from the group consisting of CHO cells, Vero cells, BHK cells, COS cells, and HEK 293 / 293T cells, and more preferably, the mammalian cells are CHO cells. More preferably, the mammalian host cells are CHO cells, even more preferably CHO cells lacking dihydrofolate reductase (DHFR) activity. The mammalian cells used in the present invention can be selected or engineered to produce recombinant proteins. The engineering includes one or more genetic modifications, such as the introduction of one or more heterologous genes encoding the proteins to be expressed. The heterologous genes may encode proteins that are normally expressed in the cell or that are exogenous to the host cell. The engineering can additionally or alternatively involve upregulating or downregulating one or more endogenous genes. Often, cells are engineered to produce recombinant proteins, for example, by introducing a gene encoding the protein and / or by introducing a regulatory element that regulates the expression of the gene encoding the protein of interest. The gene encoding the recombinant protein and / or regulatory element can be introduced into the host cell via a vector, such as a plasmid, phage, or viral vector. The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. This term includes vectors as self-replicating nucleic acid structures as well as vectors that are integrated into the genome of a host cell into which they are introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors."

[0188] Some vectors can replicate autonomously in the host cells into which they are introduced, while other vectors can be integrated into the genome of the host cell, thereby replicating together with the host genome.Various vectors are publicly available, and the exact nature of the vector is not essential to the present invention.Typically, expression vectors include one or more of a signal sequence, a replication origin, one or more marker genes, a promoter, and a transcription termination sequence.Such components are as described in International Publication No. 97 / 25428.

[0189] The "growth phase" of a cell culture generally refers to the exponential cell growth period (log phase) during which cells divide rapidly. During this phase, cells are cultured for a period of time (usually 1-4 days) under conditions that maximize cell growth. The determination of the host cell growth cycle is determined for a particular host cell without undue experimentation. "Duration and conditions that maximize cell growth" and the like refer to culture conditions determined to be optimal for cell growth and division for a particular cell line. During the growth phase, cells are cultured in a nutrient medium containing necessary additives. Further culture conditions, such as temperature, pH, dissolved oxygen (dO2), etc., will be used for a particular host and will be apparent to those skilled in the art. Generally, pH is adjusted using either an acid (e.g., CO2) or a base (e.g., Na2CO3 or NaOH). The appropriate temperature range for culturing mammalian cells, such as CHO cells, is approximately 30-38°C, with an appropriate dO2 of 5-90% air saturation in a humidified, controlled atmosphere to achieve optimal growth for a particular cell line. For example, fed-batch cell culture conditions can be used because they are designed to enhance the growth of mammalian cells during the growth phase of cell culture. As used herein, "fed-batch culture" refers to a method of culturing cells in which additional components are added to the culture at a time after the start of the culture process. Fed-batch culture is typically stopped at some point, and the cells and / or components in the medium are harvested and optionally purified. Furthermore, at certain stages, cells can be used to seed the production phase or step of a cell culture. Alternatively, the production phase or step may be continuous with the seeding or growth phase or step.

[0190] The "transition phase" of a cell culture refers to the period during which the culture conditions of the production phase are engaged. During the transition phase, environmental factors such as the temperature of the cell culture, medium osmolality, etc., are shifted from growth conditions to production conditions.

[0191] The "production phase" of a cell culture refers to a period during which cell growth stagnates. During the production phase, logarithmic cell growth ceases and protein production becomes dominant. During this period, the medium is typically replenished to support continued protein production and achieve a desired glycoprotein yield. For example, the cell culture environment during the production phase of a cell culture is controlled. According to the methods of the present invention, one or more factors affecting the viable cell density and / or product titer of a mammalian host cell culture are manipulated to achieve a specific galactosyl content of the expressed recombinant protein. As used herein, "titer" refers to the total amount of recombinantly expressed antibody produced by a cell culture in a given volume of medium. Titer is typically expressed in units of milligrams of glycoprotein per milliliter of medium. In particular, factors that increase the galactosyl content of the recombinant protein are controlled during the production phase of the cell culture process so that the resulting recombinant protein contains a specific galactosyl content. As used herein, the production phase of a cell culture process is preceded by a transition phase of the cell culture involving the production phase parameters of the cell culture.

[0192] In the methods of the present invention, the concentration of one or more sulfhydryl compounds and / or the concentration of glucose are adjusted during either or all of the growth or production phases of the fermentation process. For example, the concentration of one or more sulfhydryl compounds and / or glucose can be adjusted at the beginning of the growth phase or during the growth phase, and / or at the beginning of the production phase or during the production phase. In particular, the concentration of one or more sulfhydryl compounds and / or glucose can be adjusted at the beginning of the growth phase and the beginning of the production phase, or at the beginning of the growth phase, during the growth phase, or at the beginning of the production phase and during the production phase, or all of these. In a preferred aspect of the present invention, one or more sulfhydryl compounds and / or glucose are added to the medium at the beginning of the production phase or during the production phase to create a concentration of about 4 mM to 10 mM of one or more sulfhydryl compounds having sulfhydryl groups and / or at least 3.0 g / L of glucose in the medium. In another preferred aspect of the invention, the method further comprises an initial step of culturing mammalian cells in the same medium that does not contain about 4 mM to 10 mM of said one or more sulfhydryl compounds containing sulfhydryl groups and / or at least more than 3.0 g / L of glucose. In yet another aspect of the invention, the method further comprises an initial step of culturing mammalian cells in the same medium that does not contain about 4 mM to 10 mM of said one or more sulfhydryl compounds containing sulfhydryl groups and / or at least more than 3.0 g / L of glucose, wherein one or more sulfhydryl compounds and / or glucose are added to the medium at the start of or during the production phase to create a concentration of about 4 mM to 10 mM of one or more sulfhydryl compounds having sulfhydryl groups and / or at least more than 3.0 g / L of glucose in the medium.

[0193] The concentration of one or more sulfhydryl compounds can be adjusted by increasing or decreasing the concentration of the sulfhydryl compounds in the culture medium. In the present invention, when the concentration of the sulfhydryl compounds is increased or decreased, this increase or decrease is relative to the concentration of the sulfhydryl compounds in the culture medium in the culture phase immediately preceding the increase. Thus, if the concentration of, for example, cystine and / or cysteine ​​in the culture medium increases at the beginning of the production phase, this is an increase in the concentration of the sulfhydryl compounds over the concentration of the sulfhydryl compounds in the culture medium in the immediately preceding growth phase. Similarly, if the concentration of, for example, cystine and / or cysteine ​​in the culture medium increases during the production phase, this is an increase in the concentration of the sulfhydryl compounds relative to the concentration of the sulfhydryl compounds in the culture medium in the portion immediately preceding the production phase. Similarly, if the concentration of, for example, cystine and / or cysteine ​​in the culture medium decreases at the beginning or during either the growth phase or the production phase, this is a decrease in the concentration of the sulfhydryl compounds in the culture medium in the immediately preceding culture phase.

[0194] When adjusting the concentration of any one or more sulfhydryl compounds in a cell culture medium, it is generally preferred to adjust the concentrations of all of these one or more sulfhydryl compounds simultaneously.However, the method of the present invention also includes adjusting one or more sulfhydryl compounds by adjusting a first sulfhydryl compound at a time and then adjusting a second sulfhydryl compound, or vice versa.In particular, when the concentration of one or more sulfhydryl compounds is increased and the concentration of one or more sulfhydryl compounds is decreased, the increase and decrease adjustments can be made simultaneously or at different times.In this case, it is preferred that the increase and decrease of the concentration of one or more sulfhydryl compounds are made at the same time or in the same medium.

[0195] In the method of the present invention, adjusting the concentration of one or more sulfhydryl compounds can be achieved by any technique suitable for the fermentation conditions used. The method for adjusting the concentration of one or more sulfhydryl compounds is not essential to the present invention, and suitable methods are known in the art. Thus, adjusting the concentration of one or more sulfhydryl compounds can be achieved by supplementing the medium in which the cells are cultured (if the concentration of one or more sulfhydryl compounds increases), or by transferring all or part of the cells (e.g., by splitting) to fresh medium containing the desired concentration of one or more sulfhydryl compounds. If necessary, a combination of these methods can be used.

[0196] Thus, adjustment of the concentration of one or more sulfhydryl compounds may be continuous throughout all or part of the culture period, or may be intermittent, for example, as a response to an assumed, calculated, or measured concentration of one or more sulfhydryl compounds in the culture medium. The present invention defines adjustment of the concentration of one or more sulfhydryl compounds within a range. If actual measurement or calculation of the concentration of each or all of one or more sulfhydryl compounds during a defined culture period, e.g., during the growth or production phase, indicates that the concentration of each or all of the one or more sulfhydryl compounds is within a range recited herein, adjustment of the concentration can nevertheless be made as long as the resulting concentration of one or more sulfhydryl compounds remains within the recited range. If necessary, the actual concentration of one or more sulfhydryl compounds in the medium can be measured using known techniques before making the adjustment.

[0197] Thus, when batch fermentation conditions are used, achieving an increased concentration of one or more sulfhydryl compounds can be achieved, for example, by inoculating fresh medium containing or supplemented with an appropriate one or more sulfhydryl compounds at an increased concentration relative to the existing culture medium, or by splitting the cells into medium containing or supplemented with an appropriate one or more sulfhydryl compounds at an increased concentration relative to the existing culture medium. When fed-batch fermentation conditions are used, achieving an increased concentration of one or more sulfhydryl compounds can be achieved, for example, by inoculating fresh medium containing or supplemented with an increased concentration of the appropriate one or more sulfhydryl compounds, providing the medium with one or more boluses or continuous feeds of the appropriate one or more sulfhydryl compounds, determining the feed rate based on cell number or calculated according to known metabolic models, metabolic surrogate markers, etc., or by splitting the culture into medium containing or supplemented with an increased concentration of the appropriate one or more sulfhydryl compounds. When a bolus or continuous feed is added, it can contain other nutrients / components required for the culture in addition to one or more sulfhydryl compounds. When perfusion fermentation conditions are used, achieving elevated concentrations of one or more sulfhydryl compounds can be achieved, for example, by continuous or intermittent addition of one or more sulfhydryl compounds to the reactor simultaneously or individually to other nutrients / components added to the perfusion culture.

[0198] If a reduction in the concentration of one or more sulfhydryl compounds is required, this can be achieved by plating the cells in fresh medium containing a reduced concentration of one or more sulfhydryl compounds compared to the concentration of the one or more sulfhydryl compounds in the medium of the immediately preceding culture phase.

[0199] The specific value of the reduced or elevated concentration of one or more sulfhydryl compounds is based either on an actual measurement of one or more sulfhydryl compounds in the culture medium or on a theoretical concentration or calculation of the concentration of one or more sulfhydryl compounds in the culture medium surrounding the cells. A practitioner will understand that there may be certain concentrations of one or more sulfhydryl compounds introduced, for example, via impurities and leaching, and will take these into account when calculating the reduced or elevated concentration of one or more sulfhydryl compounds according to the present invention.

[0200] In one aspect of the present invention, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to increase the galactosylation of recombinant protein glycans. In another aspect of the present invention, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to increase viable cell density, increase recombinant protein product titer, and / or subsequently increase the galactosylation of recombinant protein glycans. For example, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to first reduce growth and then increase the galactosylation of recombinant protein glycans. As another example, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to increase viable cell density and then increase the galactosylation of recombinant protein glycans. As another example, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to increase recombinant protein product titer and then increase the galactosylation of recombinant protein glycans. In yet another aspect of the invention, the concentration of one or more sulfhydryl compounds can be adjusted in the culture medium to increase viable cell density, increase product titer of the recombinant protein, and then again increase galactosylation of the glycans of the recombinant protein.

[0201] As used herein, the term "bioreactor" refers to any vessel used for growing prokaryotic or eukaryotic cell cultures, such as animal cell cultures (such as mammalian cell cultures). Bioreactors can be of any size, as long as they are useful for culturing cells, e.g., mammalian cells. Typically, bioreactors are at least 30 ml and may be 1, 10, 100, 250, 500, 1,000, 2,500, 5,000, 8,000, 10,000, 12,000 liters or more, or any intermediate volume. The internal conditions of the bioreactor, including but not limited to pH and temperature, are typically controlled during the culture period. Bioreactors may be constructed of any material suitable for holding a mammalian cell culture suspended in a medium under the culture conditions of the present invention, including glass, plastic, or metal. As used herein, the term "production bioreactor" refers to the final bioreactor used for the production of a polypeptide or protein of interest. Large-scale cell culture production bioreactors generally have a volume greater than about 100 ml, typically at least about 10 liters, and may be 500, 1,000, 2,500, 5,000, 8,000, 10,000, 12,000 liters or more, or any intermediate volume. For example, mammalian cell cultures are carried out in large-scale format bioreactors, preferably 10,000 L bioreactors.

[0202] Those skilled in the art will be aware of and able to select suitable bioreactors for use in practicing the present invention.

[0203] When used in preferred aspects in the context of the present invention, the method further includes recovering the recombinant protein produced by the mammalian cells. Recovering the expressed protein either during or at the end of the culture phase, preferably the production phase, can be achieved using methods known in the art. The protein can be recovered from the culture medium as a secreted protein, or from host cell lysates if directly produced without a secretory signal. If the protein is membrane-bound, it can be released from the membrane using an appropriate detergent solution (e.g., Triton-X 100), or its extracellular region can be released by enzymatic cleavage. The expressed protein can be isolated and / or purified, as needed, using techniques known in the art. An "isolated" protein, such as an antibody, is an antibody that has been separated from components of its natural environment. In some aspects, the protein, e.g., an antibody, is purified to greater than 95% or 99% purity, as determined, for example, by electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse-phase HPLC) methods. For a review of methods for assessing antibody purity, see, e.g., Flatman et al. J. Chromatogr. B 848:79-87 (2007).

[0204] As used herein, the terms "expression" and "expressing" are used interchangeably and refer to transcription and translation in a host cell. The level of recombinant protein expression in a host cell can be determined based on either the amount of corresponding mRNA present in the cell or the amount of protein produced by the corresponding gene. For example, mRNA transcribed from a product gene is desirably quantified by Northern hybridization (Sambrook et al., Molecular Cloning A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989)). The protein encoded by a product gene can be quantified either by assaying the biological activity of the protein or by using an assay independent of such activity, such as Western blot or radioimmunoassay, using an antibody capable of reacting with the protein (Sambrook et al., Molecular Cloning A Laboratory Manual, pp. 18-18-88 (Cold Spring Harbor Laboratory Press, 1989)).

[0205] In particular, mammalian cells expressing recombinant proteins bearing mono- or digalactosylated glycans should express or be engineered to express specific enzymes so that the appropriate post-translational modifications occur in vivo under the appropriate conditions described herein. Enzymes include those required for the addition and completion of N-linked and O-linked carbohydrates, such as those described by Hubbard and Ivan, supra, for N-linked oligosaccharides. Enzymes optionally include oligosaccharyltransferase, α-glucosidase I, α-glucosidase II, ER α(1.2) mannosidase, Golgi α-mannodase I, N-acetylglucosaminyltransferase I, Golgi α-mannotase II, N-acetylglucosaminyltransferase II, α(1.6) fucosyltransferase, and β(1.4) galactosyltransferase. Additionally, the host cell expresses appropriate enzymes that can be predicted as part of the host cell genome to attach galactose at specific positions and linkages. Optionally, the host cell can be made to express a suitable enzyme, for example, by transfecting the host cell with DNA encoding the enzyme. Such enzymes are expected to add galactose to appropriate oligosaccharide structures, such as GlcNAc. Suitable enzymes in the context of the present invention include, but are not limited to, enzymes that catalyze the galactosylation and branching of N-linked and O-linked oligosaccharides.

[0206] For the culture of mammalian cells capable of expressing a desired protein and attaching a desired carbohydrate at a specific position and linkage, a number of culture conditions can be used, with particular attention paid to the host cell being cultured. Culture conditions suitable for mammalian cells are well known in the art (J. Immunol. Methods (1983) 56:221-234) or can be easily determined by those skilled in the art (see, for example, Animal Cell Culture: A Practical Approach 2nd Ed. Rickwood, D. and Hames, BD, eds. Oxford University Press, New York (1992)), and will vary depending on the particular host cell selected.

[0207] The mammalian cells of the present invention are prepared in a medium suitable for the particular cells being cultured. The terms "medium," "cell culture medium," and "media" are used interchangeably herein to refer to a solution containing nutrients that sustains the growth of mammalian cells. Typically, such solutions provide the essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by cells for minimal growth and / or survival. Such solutions may also contain supplemental components that enhance growth and / or survival beyond the minimum rate, including, but not limited to, hormones and / or other growth factors, specific ions such as sodium, chloride, calcium, magnesium, and phosphate, buffers, vitamins, nucleosides or nucleotides, trace elements, amino acids, lipids, and / or glucose or other energy sources. Media are conveniently formulated to favor optimal pH and salt concentrations for cell survival and growth.

[0208] Commercially available culture media such as Ham's F10 (Sigma), minimal essential medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's modified Eagle's medium (DMEM, Sigma) are exemplary nutrient solutions.In addition, any of the media disclosed in Ham and Wallace (1979) Meth.Enz., 58:44, Barnes and Sato (1980) Anal.Biochem., 102:255, U.S. Patent No. 4,767,704, U.S. Patent No. 4,657,866, U.S. Patent No. 4,927,762, U.S. Patent No. 5,122,469, or U.S. Patent No. 4,560,655, International Publication No. WO 90 / 03430, and International Publication No. WO 87 / 00195 can be used as culture media, the disclosures of all of which are incorporated herein by reference. Any of these media can be supplemented as needed with hormones and / or other growth factors (e.g., insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium, magnesium, and phosphate), buffers (e.g., HEPES), nucleosides (e.g., adenosine and thymidine), antibiotics (e.g., the drug Gentamycin™), trace elements (usually defined as inorganic compounds present in the micromolar range at final concentrations), lipids (e.g., linoleic acid or other fatty acids) and their suitable carriers, and glucose, or an equivalent energy source. Any other necessary supplements can also be included at appropriate concentrations known to those skilled in the art.

[0209] As used herein, the term "under conditions in which cells express a recombinant protein" refers to conditions used for culturing cells that express a polypeptide and that are known or can be determined by those skilled in the art. Those skilled in the art will recognize that these conditions may vary depending on the type of cells being cultured and the type of recombinant protein being expressed. Generally, cells are cultured in a volume of 0.01 to 10 liters at a temperature of, for example, 20°C to 40°C for a period of time sufficient to allow efficient production of the conjugate, for example, 4 to 28 days.

[0210] Preferably, the mammalian host cells are CHO cells, preferably CHO cells lacking dihydrofolate reductase (DHFR) activity, and suitable media comprise basal medium components, e.g., DMEM / HAMF-12-based formulations with modified concentrations of several components such as amino acids, salts, sugars and vitamins, optionally containing glycine, hypoxanthine, thymidine, recombinant human insulin, hydrolyzed peptone, cytoprotectants such as Pluronic F68 or equivalent pluronic polyols, gentamicin and trace elements (for the composition of DMEM and HAM F12 media, see culture medium formulations in American Type Culture Collection Catalogue of Cell Lines and Hybridomas. Sixth Edition. 1988. pp. 346-349).

[0211] According to the present invention, mammalian host cells are cultured to produce recoverable recombinant proteins bearing mono- or digalactosylated glycans. The overall galactose content of the recombinant protein is controlled by controlling cell culture parameters that affect the viable cell density, product titer, and / or galactose content in the mammalian cells. Factors that affect viable cell density and / or product titer are well known in the art and include, but are not limited to, factors that affect DNA / RNA copy number, factors that affect RNA, such as factors that stabilize RNA, media nutrients and other supplements, the concentration of transcription promoters, the osmolality of the culture environment, the temperature and pH of the cell culture, etc. According to the present invention, adjusting these factors, alone or in combination, to increase viable cell density and / or product titer produces recombinant proteins bearing mono- or digalactosylated glycans. Adjusting these factors, alone or in combination, to increase viable cell density and / or product titer produces recombinant proteins with increased galactose content.

[0212] As used herein, terms such as "cell density" or "cell concentration" refer to the number, weight, mass, etc. of cells present in a given volume of medium. "Peak cell density" and the like refer to the maximum number of cells that can be achieved in a given volume of medium, and "desired peak cell density" and the like refer to the maximum number of cells that a practitioner desires (e.g., targets) to obtain in a given cell volume. Variations in such target values ​​will be apparent to those skilled in the art; for example, a skilled artisan may express one or more target values ​​for desired cell mass, and such one or more target values ​​may be in one or more appropriate units of measurement (e.g., desired peak units of cell mass).

[0213] As used herein, the term "cell viability" refers to the ability of cells in culture to survive under a given set of culture conditions or experimental variations. The term also refers to the proportion of surviving cells at a particular time point relative to the total number of surviving and dead cells in the culture at that time point.

[0214] As used herein, the terms "culture" and "cell culture" refer to a population of cells suspended in a cell culture medium under conditions suitable for the survival and / or growth of the population of cells. As used herein, these terms can refer to a combination comprising a population of cells (e.g., an animal cell culture) and the medium in which the population is suspended.

[0215] In one aspect, the method further comprises pre-culturing mammalian cells in a cell culture medium. Provided herein, the cells can be pre-cultivated to the exponential growth phase in a suitable cell culture medium, regardless of whether or not they contain sulfhydryl groups from one or more sulfhydryl compounds. As used herein, the terms "pre-culturing" and "pre-culturing" are used interchangeably and refer to a culturing step that precedes the culturing of cells in a second culturing step. For example, cells can be grown in a first cell culture as a pre-culturing step, and then seeded into a second cell culture, such as a bioreactor, for example, a production bioreactor. Those skilled in the art are aware of the pre-culturing step and know how to perform such a pre-culturing step.

[0216] As used herein, the term "cumulative viable cell density" or "IVCD" refers to the average density of viable cells over the course of the culture multiplied by the amount of time the culture has been carried out. Assuming that the amount of polypeptide and / or protein produced is proportional to the number of viable cells present over the course of the culture, the cumulative viable cell density is a useful tool for estimating the amount of polypeptide and / or protein produced over the course of the culture.

[0217] The recombinant proteins of the present invention can be produced by culturing cells expressing the recombinant protein under various cell culture conditions. In other words, biomass production and protein expression from mammalian cells can be achieved by culturing cells under any fermentation cell culture method or system suitable for growing cells for biomass production and protein expression according to the methods of the present invention and can be used with the present invention. For example, cells can be grown in batch, fed-batch, perfusion, or split-batch culture, and the culture can be terminated after sufficient expression of the protein has occurred, after which the protein can be recovered and optionally purified.

[0218] For example, the cell culture of the present invention may use a fed-batch culture procedure. In fed-batch culture, mammalian cells are initially fed into a culture vessel, and additional cell nutrients are continuously or cumulatively supplied to the culture during the culture, with or without periodic cell and / or product harvesting before the end of the culture. Examples of fed-batch culture include semi-continuous fed-batch culture, in which the entire culture medium (including cells and medium) is periodically removed and replaced with fresh medium. Fed-batch culture is distinguished from simple batch culture in that all components for cell culture (including cells and all culture nutrients) are supplied to the culture vessel at the beginning of the culture process. Fed-batch culture can also be distinguished from perfusion culture, insofar as the supernatant is not removed from the culture vessel during the process (in perfusion culture, cells are maintained in the culture medium, for example, by filtration, encapsulation, or anchoring to microcarriers, and culture medium is continuously or intermittently introduced and removed from the culture vessel). Alternatively, cells can be grown in perfusion culture, where the culture is never terminated, but rather new nutrients and components are periodically or continuously added to the culture and the expressed glycoprotein is either periodically or continuously removed.

[0219] Furthermore, the cells of the culture can be grown according to any scheme or routine that may be suitable for the particular host cell and the particular production plan under consideration. For example, reactors, temperatures, and other conditions, such as oxygen concentration and pH, for fermentation culture of cells for biomass generation and protein production are known in the art. Any conditions suitable for culturing selected mammalian cells can be selected using information available in the art. Culture conditions, such as temperature, pH, etc., are typically those already used with the host cell selected for expression, and will be apparent to those skilled in the art. If desired, temperature and / or pH and / or CO2 can be altered during culture to increase yield and / or the relative amount of the desired protein quality.

[0220] Further in this regard, the present invention contemplates single-step or multi-step culture procedures. In a single-step culture, host cells are inoculated into a culture environment, and the process of the present invention is used during a single production phase of the cell culture. Alternatively, multi-step cultures are contemplated. In a multi-step culture, cells can be cultured in multiple steps or periods. For example, cells can be grown in a first-step or growth phase culture medium. In this stage, cells, optionally removed from storage, are inoculated into a medium suitable for promoting growth and high viability. As used herein, "cell viability" refers to the ability of cells in culture to survive under a given set of culture conditions or experimental variations. As used herein, the term also refers to the proportion of surviving cells at a particular time point relative to the total number of viable or dead cells in the culture at that time. Cells can be maintained in the growth phase for a suitable period of time by adding fresh medium to the host cell culture.

[0221] Cell culture procedures, for example, for large-scale or small-scale production of proteins, are potentially useful in the context of the present invention. Procedures including, but not limited to, fluidized-bed bioreactors, hollow-fiber bioreactors, roller bottle cultures, or stirred-tank bioreactors can be used and alternatively operated in batch, fed-batch, and / or perfusion modes. As used herein, "perfusion culture" refers to a method of culturing cells that involves growing cells on a seed basal medium and replacing the spent medium with fresh medium once the cells achieve a desired cell density. Perfusion may involve either continuous or intermittent perfusion and may include delivery of at least one bolus feed to the cell culture. Perfusion culture may be followed by fed-batch culture. As used herein, the term "bioreactor" refers to any vessel used for growing mammalian cell cultures. Typically, bioreactors are at least 1 liter and may be 10, 100, 250, 500, 1000, 2500, 5000, 8000, 10,000, 12,000 liters or more, or any volume in between. Internal conditions of the bioreactor, including but not limited to pH, dissolved oxygen, and temperature, are typically controlled during the culture period. Bioreactors may be constructed of any material suitable for holding a mammalian cell culture suspended in a medium under the culture conditions of the present invention, including glass, plastic, or metal. In preferred aspects of the present invention, mammalian cell culture is performed in a bioreactor, more preferably a large-scale format bioreactor. In more preferred aspects of the present invention, mammalian cell culture is performed in a bioreactor of at least 10,000 L.

[0222] The importance of antibody Fc-galactosylation As shown in Figure 5, the Asn297-linked carbohydrate chain consists of a common biantennary glycan structure of four N-acetylglucosamine (GlcNAc) and three mannose residues, with variably added fucose, galactose, and sialic acid residues. These glycans are often named according to the number of biantennary terminal galactose residues, i.e., G0 (no galactose), G1 (one galactose), or G2 (two galactose), and according to the presence of a core fucose residue, i.e., G0 (no galactose), G1 (one galactose), or G2 (two galactose).

[0223] In a preferred aspect used in connection with the present invention, the recombinant protein is intended for use as a pharmaceutical. Changes in IgG galactosylation were first reported in rheumatoid arthritis (Parekh et al., Nature. 316 (1985) 452-457), and subsequently in other autoimmune diseases such as psoriatic arthritis and ankylosing spondylitis (Martin et al., J Rheumatol 28 (2001) 1531-1536). Increased galactosylation has been observed during pregnancy and in rheumatoid arthritis patients who have experienced pregnancy-induced remission (Bondt et al., J. Proteome. Res. 12 (2013) 4522-4531). This suggests that increased antibody galactosylation may be functionally more anti-inflammatory (Zauner et al., Mol. Cell Proteomics. 12 (2013) 856-865). Karsten et al. (Nature Medicine 18.9 (2012) 1401-1406) confirmed this anti-inflammatory property by showing in mice that high galactosylation of IgG immune complexes promotes the association of FcγRIIB and Dectin-1, which blocks the pro-inflammatory effector functions of C5aR and CXCR226. In other preferred aspects used in connection with the present invention, the recombinant protein is for use in treating patients with B-cell proliferative disorders such as non-Hodgkin's lymphoma and chronic lymphocytic leukemia, or patients with Parkinson's disease and related disorders.

[0224] Another important aspect to consider when examining the functional impact of terminal galactose is that it provides a basis for the addition of sialic acid, the most distal sugar moiety on IgG-Fc glycans. Oligosaccharide analysis revealed that defective protein galactosylation is a potential cause of the reduced sialic acid content.

[0225] Galactose-terminated structures are known to have a substantial effect on affinity for the C1q complex, and their removal results in reduced complement lytic activity (Hodoniczky, J. et al., Biotechnol. Progr. 21 (2005) 1644-1652). More specifically, Wright and Morrison (1998) (J Immunol. 1998; 160: 3393-3402) and Hodoniczky et al. (2005) found that the absence of galactose on mAb Fc oligosaccharides reduces the affinity between Fc and the C1q component of complement, thereby reducing CDC activity.

[0226] Rituximab (Rituxan® anti-CD20), first approved in 1997, is a chimeric monoclonal antibody produced in CHO cells for the treatment of non-Hodgkin's lymphoma and other B-cell-related diseases. Rituximab is glycosylated in the Fc, and Fc glycans are highly heterogeneous, primarily due to the variable presence of terminal galactose residues. The effect of rituximab's terminal galactose residues on CDC activity stems from the involvement of such residues in rituximab's binding to complement C1q (Hodoniczky et al., 2005).

[0227] The presence or absence of galactose on IgG glycans correlates with altered Fc effector function in some, but not all, monoclonal IgG antibodies (Boyd et al., Mol Immunol. 32 (1995) 1311-1318; Wright and Morrison, J Immunol. 160 (1998) 3393-3402), indicating that the observed effects may be partially antibody-specific. Tsuchiya et al. (1989) found that agalacto-IgG reduced C1q and Fc receptor binding, and Boyd et al. found that agalacto-Campath1 (monoclonal anti-CD52) reduced cell-mediated lysis (CML) but retained the intact ability to trigger ADCC. Thus, as used herein, "effector function" refers to the biological activity attributable to the Fc region of an antibody, which varies depending on the antibody isotype. Examples of antibody effector functions include: C1q binding and complement dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis, downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation; see, e.g., Thomann et al., PLoS One. 2015 Aug 12;10(8):e0134949.doi:10.1371 / journal.pone.0134949.eCollection 2015.

[0228] The term "Fc region" is used herein to define the C-terminal region of an immunoglobulin heavy chain containing at least a portion of the constant region. The term includes native-sequence Fc regions and variant Fc regions. Although the boundaries of the Fc region of an IgG heavy chain may vary slightly, the human IgG heavy chain Fc region is usually defined to extend from Cys226 or from Pro230 to the carboxy terminus of the heavy chain. However, antibodies produced by host cells may undergo post-translational cleavage of one or more, particularly one or two, amino acids from the C-terminus of the heavy chain. Thus, upon expression of a particular nucleic acid molecule encoding a full-length heavy chain, antibodies produced by host cells may contain a full-length heavy chain or a cleaved variant of the full-length heavy chain (also referred to herein as a "cleaved variant heavy chain"). This may be the case when the final two C-terminal amino acids of the heavy chain are glycine (G446) and lysine (K447, according to the Kabat EU index). Thus, the C-terminal lysine (Lys447) of the Fc region, or the C-terminal glycine (Gly446) and lysine (K447) may or may not be present. Unless otherwise specified herein, numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also known as the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

[0229] In certain aspects, when the recombinant protein is an antibody, the Fc domain of the antibody may contain one or more changes compared to the wild-type Fc domain. Nevertheless, these Fc domains retain substantially the same characteristics required for therapeutic utility compared to their wild-type counterparts. For example, certain modifications to the Fc region result in altered (i.e., either improved or reduced) C1q binding and / or complement-dependent cytotoxicity (CDC), as described, for example, in WO 99 / 51642. For other examples of Fc region variants, see also Duncan & Winter, Nature 322:738-40 (1988), U.S. Patent Nos. 5,648,260, 5,624,821, and WO 94 / 29351. WO 00 / 42072 (Presta) and WO 2004 / 056312 (Lowman) describe antibody variants with improved or reduced binding to FcRs. The contents of these patent publications are expressly incorporated herein by reference. See also, e.g., Shields et al., J. Biol. Chem. 9(2):6591-6604 (2001). Antibodies with increased half-life and improved binding to neonatal Fc receptors (FcRn), which are responsible for transferring maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)), are described in U.S. Patent Application Publication No. 2005 / 0014934 (Hinton et al.). The half-life of an antibody can depend on the structure of the Fc region of the antibody, which in turn affects the binding efficiency of the Fc region to the neonatal receptor, FcRn. Thus, maintaining the binding of the Fc region to FcRn extends the half-life. In particular, at a pH of about 6.0, this binding prevents endosomal transport of the FcRn-bound antibody away from the lysosomal degradation pathway and instead recycles it to the plasma membrane, where the IgG is re-released into the bloodstream at pH 7.4.This pathway thereby increases the half-life of IgG in the blood, which is necessary for prolonged exposure of the antibody to its target and increased potential for therapeutic efficacy; see Saxena, Abhishek; Bai, Bingxin; Hou, Shin-Chen; Jiang, Lianlian et al., Methods in molecular biology (Clifton, NJ) 1827:399-417. (2018); Spearman, Maureen; Dionne, Ben; Butler, Michael, Cell Engineering, Vol 7: Antibody Expression and Production 7:251-292. SPRINGER. (2011), which is specifically incorporated herein by reference. These antibodies comprise an Fc region with one or more substitutions therein that improve binding of the Fc region to FcRn. Polypeptide variants with altered Fc region amino acid sequences and increased or decreased CIq binding ability are described in U.S. Patent No. 6,194,551 and WO 99 / 51642. See also Idusogie et al., J. Immunol. 164:4178-4184 (2000), the contents of which are specifically incorporated herein by reference.

[0230] Other reported effects of galactosylation on IgG molecules include altering physicochemical properties such as conformation and surface accessibility (Krapp et al., J. Mol. Biol. 325 (2003) 979-89; Mimura et al., Mol. Immunol. 37 (2000) 697-706). Fortunato and Colina (J. Phys. Chem. 118 (2014) 9844-9851) used explicit water atom molecular dynamics simulations to study the effects of galactosylation in the Fc domain of immunoglobulin G1. They suggested that glycosylation could be used as a pathway to improve the aggregation resistance of monoclonal antibodies for therapeutic treatment. As used herein, "treatment" (and grammatical variants thereof, such as "treat" or "treating") refers to a clinical intervention in an attempt to alter the natural course of disease in the treated individual, and can be carried out for prophylaxis or during the course of clinical pathology. Desired effects of treatment include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, attenuating any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, remission or alleviation of disease symptoms, and improving recovery or prognosis. In some aspects, the antibodies of the present invention are used to delay the onset of disease or to slow the progression of disease.

[0231] From currently available data, it appears that galactose residues in antibodies may influence certain IgG functions and need to be effectively monitored and controlled during galactosylation of these molecules.

[0232] As mentioned previously, antibody galactosylation is known to depend on the concentration of UDP-galactose present in cells, as these sugar molecules act as substrates for galactosylation. Increased UDP-galactose content was found to be associated with higher galactosylation and sialylation of antibodies expressed in CHO cells. Changes in intracellular UDP-galactose levels may also have important implications for other types of glycosylation in other therapeutic proteins.

[0233] Regulation of UDP-galactose concentration for O-linked glycosylation Generally, in recombinant proteins used herein, sugars can be attached to either the amide nitrogen atom of the side chain of an N-linked asparagine or the oxygen atom of the side chain of an O-linked serine or threonine. O-linked glycosylation occurs through the addition of N-acetyl-D-galactosamine to a serine or threonine residue by the enzyme UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (EC 2.4.1.41), followed by the addition of other carbohydrates, such as UDP-galactose. Therefore, intracellular UDP-galactose concentration can affect O-linked glycosylation. Therefore, the new approach described in this invention can be useful for regulating intracellular UDP-galactose levels and further controlling the galactosylation level of the final protein product.

[0234] Adjusting UDP-galactose concentration for antibody Fab glycosylation The existence of IgG Fab glycans has been known for some time. Fab glycans are likely more accessible to glycosyltransferases, leading to greater processing compared with Fc glycans, which are spatially localized on the inner surface of the CH2 domain. Therefore, the intracellular UDP-galactose concentration may also affect the IgG Fab galactosylation process. Therefore, the new approach described in this invention can be used to regulate intracellular UDP-galactose levels and further control the galactosylation level of the final protein product.

[0235] When used in connection with the present invention, the level of N-linked galactosylated glycans of recombinant proteins is increased. Thus, the method of the present invention increases the production of N-linked galactosylated glycans of recombinant proteins. In a preferred aspect of the present invention, the recombinant protein contains at least mono-galactosylated glycans, more preferably di-galactosylated glycans, and the galactosylated glycans are associated with N-acetylglucosamine. The binding of galactose to its respective target within the recombinant protein and its effect on the function of the recombinant protein are further outlined in the following examples.

[0236] The present invention also relates to pharmaceutical compositions comprising recombinant proteins. The terms "composition" and "pharmaceutical composition" are used interchangeably and should be understood as defining a pharmaceutical composition in which the individual components or components themselves are pharmaceutically acceptable, e.g., acceptable for oral use if oral administration is anticipated, acceptable for topical administration if topical administration is anticipated, and acceptable for oral and topical use if a combination thereof, i.e., acceptable for oral and topical use if oral and topical administration is anticipated. The term refers to a preparation in a form that is capable of effecting the biological activity of the active ingredient contained therein and does not contain additional components that are unacceptably toxic to the subject to which the pharmaceutical composition is administered. A "pharmaceutically acceptable carrier" refers to a component in a pharmaceutical composition or formulation other than the active ingredient that is non-toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0237] Pharmaceutical compositions are formulated and administered in a manner consistent with good medical practice, taking into account the clinical condition of individual patients, the delivery site of pharmaceutical compositions, administration method, administration schedule and other factors known to practitioners.Therefore, the "effective amount" of pharmaceutical compositions for the purposes of this specification is determined by such considerations.Those skilled in the art know that the effective amount of pharmaceutical compositions administered to individuals depends, among other things, on the nature of the compound.In this context, the "effective amount" of an agent, for example, a pharmaceutical composition, refers to the amount that is effective at the dosage and for the required period of time required to achieve desired therapeutic or preventive results.

[0238] Therapeutic proteins, such as antibodies of the present invention (and any additional therapeutic agents) can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, as well as intralesional administration if desired for localized treatment. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, for example, injection, such as intravenous or subcutaneous injection, depending in part on whether administration is short-term or long-term. Various dosing schedules are contemplated herein, including, but not limited to, single or multiple doses over various time points, bolus administration, and pulse infusion.

[0239] The antibodies of the present invention will be formulated, administered, and administered in a manner consistent with good medical practice. Factors to consider in this regard include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of drug delivery, the method of administration, the administration schedule, and other factors known to medical professionals. The antibodies are optionally, but need not be, formulated with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents will depend on the amount of antibody present in the pharmaceutical composition, the type of disease or treatment, and other factors discussed above. These will generally be administered in the same dosages and by any route of administration as described herein, or at about 1-99% of the dosages described herein, or at any dosage and via any route empirically / clinically determined to be appropriate.

[0240] For the prevention or treatment of disease, the appropriate dosage of the antibodies of the invention (when used alone or in combination with one or more other additional therapeutic agents) will depend on the type of disease being treated, the type of antibody, the severity and course of the disease, whether the antibody is administered for prophylactic or therapeutic purposes, previous therapy, the patient's medical history and response to the antibody, and the discretion of the attending physician.

[0241] As used herein, the term "and / or" should be interpreted as a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be interpreted as a specific disclosure of (i) A, (ii) B, and (iii) each of A and B, as if each were set forth individually herein.

[0242] Various aspects and features of the invention described herein are further illustrated by the following examples. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the illustrations and examples should not be construed as limiting the scope of the invention.

[0243] All patent and non-patent literature cited herein is hereby incorporated by reference in its entirety. [Example]

[0244] The cDNAs for uridine diphosphate (UDP) α-D-glucose epimerase (UDP_Glc-E, EC 5.1.3.2) and UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase from the CHO K1M cell line were cloned and sequenced. These two enzymes have been found to play important roles in the UDP-glucose and UDP-galactose conversion pathways in CHO cells.

[0245] Example 1: Uridine diphosphate glucose epimerase (UDP-Glc-E) cDNA amplification and sequence analysis in CHO K1M cell line The enzyme uridine diphosphate (UDP)-glucose 4-epimerase (UDP_Glc-E, EC 5.1.3.2), also known as UDP-galactose 4-epimerase, is a homodimeric epimerase found in bacteria, fungi, plants, and mammalian cells. This enzyme catalyzes the reversible conversion of UDP-glucose to UDP-galactose.

[0246] Total cellular RNA extraction from the CHO K1M cell line (WO 2009047007) was performed using Roche's MagNA Pure LC RNA Isolation Kit-High Performance (product number 03542394001) run on a Roche MagNA Pure LC 2.0 Instrument (product number 05197686001, Roche Diagnostics GmbH). The concentration of purified RNA was measured using NanoVue (GE Healthcare Bio-Science AB) and stored at -70°C.

[0247] This purified cellular RNA was used for UDP_Glc-E cDNA synthesis and targeted amplification. cDNA synthesis and amplification were performed using the Roche Transcriptor One-Step RT-PCR Kit (product number 04655877001, Roche Diagnostics GmbH) with two UDP_Glc-E-specific primers designed homologously according to the NCBI GenBank database.

[0248] The two primers used here are: Forward primer UDP_GlcE-F2-21 (SEQ ID NO: 5): 5' ATGGCCGAGAAGGTGCTGGTC 3' and Reverse primer UDP_GlcE-R21 (SEQ ID NO: 6): 5' TTAGGCCTGTGCTCCAAAGCC 3'.

[0249] RT-PCR conditions: Reverse transcription: 50℃ 30 minutes Initial denaturation: 94℃ 7 minutes Amplification PCR: Denaturation: 94℃ 10 seconds Annealing: 56℃ 30 seconds Extension: 68℃ 60 seconds (60 seconds / kb) Cycles: 10 Denaturation: 94℃ 10 seconds Annealing: 56℃ 30 seconds Extension: 68℃ 1:30+5 seconds (+5 seconds / kb) Cycles: 25 Final extension: 68℃ 7 min

[0250] The amplified PCR product was purified using the Roche High Pure PCR Product Purification Kit (product number 11732668001, Roche Diagnostics GmbH) and then subjected to direct sequencing analysis. The sequence of UDP_Glc-E cDNA is shown in SEQUENCE-1 (SEQ ID NO: 1). This cDNA encodes a predicted 348-amino acid protein. The resulting amino acid sequence of UDP-glucose 4-epimerase in CHO K1M is shown in SEQUENCE-2 (SEQ ID NO: 2).

[0251] The protein sequence encoded by UDP-Glc-E CHO K1M is 94.5% identical and 96.6% similar to human UDP-glucose 4-epimerase and is closely related to other UDP-glucose 4-epimerases from bovine and mouse.

[0252] Example 2: UDP-α-D-glucose:α-D-galactose-1-phosphate uridyltransferase (UDP-Gal-T) cDNA amplification and sequence analysis in CHO K1M cell line UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase (UDP-Gal-T, EC 2.7.7.12) catalyzes the nucleotide exchange between uridine 5'-diphosphate glucose (UDP-glucose) and galactose-1-phosphate (Gal-1-P) to generate uridine 5'-diphosphate galactose (UDP-galactose) and glucose-1-phosphate (Glc-1-P) via a reversible mechanism.

[0253] Total cellular RNA extraction from the CHO K1M cell line was performed using Roche's MagNA Pure LC RNA Isolation Kit-High Performance (product number 03542394001) run on a Roche MagNA Pure LC 2.0 Instrument (product number 05197686001, Roche Diagnostics GmbH). The concentration of purified RNA was measured using NanoVue (GE Healthcare Bio-Science AB) and stored at -70°C.

[0254] This purified cellular RNA was used for UDP_Gal-T cDNA synthesis and targeted amplification. cDNA synthesis and amplification were performed using the Roche Transcriptor One-Step RT-PCR Kit (product number 04655877001, Roche Diagnostics GmbH) with two UDP_Gal-T-specific primers designed homologously according to the NCBI GenBank database.

[0255] The two primers used here are: Forward primer UDP-Gal-TF 2-21 (SEQ ID NO: 7): 5' ATGTCGCAAAACGGAGATGAT 3', and Reverse primer UDP-Gal-T-R18 (SEQ ID NO: 8): 5' TCAAGCAACAGCTGCTGT 3'.

[0256] RT-PCR conditions: Reverse transcription: 50℃ 30 minutes Initial denaturation: 94℃ 7 minutes Amplification PCR: Denaturation: 94℃ 10 seconds Annealing: 56℃ 30 seconds Extension: 68℃ 60 seconds (60 seconds / kb) Cycles: 10 Denaturation: 94℃ 10 seconds Annealing: 56℃ 30 seconds Extension: 68℃ 1:30+5 seconds (+5 seconds / kb) Cycles: 25 Final extension: 68℃ 7 min

[0257] The amplified PCR product was purified using the Roche High Pure PCR Product Purification Kit (product number 11732668001, Roche Diagnostics GmbH) and then subjected to direct sequencing analysis. The sequence of UDP_Gal-T cDNA is shown in SEQUENCE-3 (SEQ ID NO: 3). This cDNA encodes a predicted 379-amino acid protein. The resulting amino acid sequence of UDP-α-D-glucose:α-D-galactose-1-phosphate uridylyltransferase in CHO K1M is shown in SEQUENCE-4 (SEQ ID NO: 4).

[0258] The protein sequence encoded by UDP-Gal-T CHO K1M is 89.4% identical and 94.7% similar to human UDP-α-D-glucose:α-D-galactose-1-phosphate uridyltransferase and is closely related to other UDP-α-D-glucose:α-D-galactose-1-phosphate uridyltransferases from mouse and bovine.

[0259] Example 3: Regulation of enzymes and pathways by L-cysteine ​​in the CHO cell line L965 for recombinant anti-human α-synuclein antibody production In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007).

[0260] CHO K1M cells were engineered to express an anti-human α-synuclein monoclonal antibody (described in U.S. Patent Nos. 9,670,274 and 9,890,209) that binds to monomeric or oligomeric human α-synuclein, and are herein designated the CHO L965 cell line.

[0261] Human α-synuclein can form fibrillar aggregates, and these aggregates are the main components of Lewy bodies and Lewy neurites. Recent scientific studies suggest that pre-fibrillar oligomers of α-synuclein may be an important contributing factor in the progression of Parkinson's disease (Luk et al., 2012).

[0262] The specific antibody L965 can specifically bind to extracellular α-synuclein and can be used to prevent the transmission of intercellular aggregates and the progression of Parkinson's disease.

[0263] For the cell culture process, a custom-made serum-free, chemically defined medium was used as the basal medium for culturing L965 cells. After thawing, cells were passaged in this medium on a 3-4 day schedule in shake flasks in the presence of 3 μg / mL blasticidin (Blasticidin, InvivoGen SAS, France) and 10 μg / mL puromycin (Puromycin Solution, InvivoGen SAS, France, catalog number ANT-PR). Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kühner Shaker X platform (Adolf Kühner AG, Birsfelden, Basel, Switzerland).

[0264] For the seeding training and production process, another custom-made version of serum-free, chemically defined medium was used as the basal medium to grow L965 cells.

[0265] During this production medium preparation, additional glucose, glutamine, amino acids, trace elements (RTE1.2 Solution, Gibco, UK; ref. 043-90585H) and salts were also included, in which case the final concentrations of L-cysteine ​​(Merck Chemicals GmbH, catalog number: 1.02735.1000) in the medium were adjusted to 6 mM and 10 mM, respectively.

[0266] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5 The production bioreactors were seeded in parallel with prepared production media containing 6 mM or 10 mM L-cysteine, all without blasticidin or puromycin, at 10.0 x 10 cells / mL. The production bioreactors were seeded with approximately 10.0 x 10 cells / mL in media containing 6 mM or 10 mM L-cysteine, respectively. 5 Cells / mL were seeded. Cells were cultured in production bioreactors under fed-batch culture conditions with defined pH, dissolved oxygen, temperature, and nutrient feeding strategies. Unless otherwise stated, a 2 L bioreactor with an initial culture volume of 1.2 L was typically used.

[0267] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH set point of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0268] The feed medium contained a combination of in-house medium with glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0269] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 4 g / l.

[0270] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0271] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0272] Figures 6A-6E show the effect of different L-cysteine ​​concentrations on the G0 form of anti-α-synuclein antibody L965, the G1 form of anti-α-synuclein antibody L965, the G2 form of anti-α-synuclein antibody L965, product titer, and cell proliferation (IVCD).

[0273] FIG. 6A shows that at the end of the 14-day production process, the G0 form of anti-α-synuclein antibody L965 from the process containing 6 mM L-cysteine ​​in the production medium was approximately 10.4% lower than the process containing 10 mM L-cysteine ​​in the production medium.

[0274] Figure 6B shows that at the end of the 14-day production process, the G1 form of anti-α-synuclein antibody L965 from the process containing 6 mM L-cysteine ​​in the production medium was approximately 13% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0275] Figure 6C shows that at the end of the 14-day production process, the G2 form of anti-α-synuclein antibody L965 from the process containing 6 mM L-cysteine ​​in the production medium was approximately 5% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0276] FIG. 6D shows that at the end of the 14-day production process, the product titer from the process containing 6 mM L-cysteine ​​in the production medium was approximately 73% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0277] FIG. 6E shows that at the end of the 14-day production process, cell growth in the process containing 6 mM L-cysteine ​​in the production medium was higher than in the process containing 10 mM L-cysteine ​​in the production medium.

[0278] Example-4: Enzyme and pathway regulation by L-cysteine ​​in CHO cell line T104 for recombinant anti-CD20 / anti-CD3 bispecific antibody production In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007). CHO K1M cells were engineered to express a CD20-CD3-targeted T cell bispecific monoclonal antibody, anti-CD20 / anti-CD3 bsAB (described in EP 3252078), herein designated CHO T104 cell line.

[0279] Anti-CD20 / anti-CD3 bsABs are T cell bispecific (TCB) antibodies that target CD20 expressed on B cells and the CD3 epsilon chain (CD3ε) present on T cells. The mechanism of action of anti-CD20 / anti-CD3 bsABs involves simultaneous binding to CD20+ B cells and CD3+ T cells, resulting in T cell activation and T cell-mediated killing of B cells. In the presence of CD20+ B cells, whether circulating or present in tissues, pharmacologically active doses trigger T cell activation and associated cytokine release. Anti-CD20 / anti-CD3 bsABs can be used to treat diseases, particularly B cell proliferative disorders, and to alleviate adverse effects in response to the administration of T cell-activating therapeutic agents. For example, patients with chronic lymphocytic leukemia can be treated with anti-CD20 / anti-CD3 bispecific antibodies.

[0280] For the cell culture process, a custom-made version of serum-free, chemically defined medium was used as the basal medium for culturing T104 cells. After thawing, cells were passaged in this medium on a 3-4 day schedule in the presence of 250 nM methotrexate (MTX; Pfizer, catalog number 13999031) in shaker flasks. Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kuhner Shaker X platform (Adolf Kuhner AG, Birsfelden, Basel, Switzerland).

[0281] For the seeding training and production processes, another custom-made version of a serum-free, chemically defined medium was used as the basal medium for growing T104 cells. Additional glucose, glutamine, amino acids, trace elements (RTE1.0 Solution, SAFC, Reference Number CR40054-1000M SLBR5143V), and salts were also included during the production medium preparation. In this case, the final concentrations of L-cysteine ​​(Merck Chemicals GmbH, Catalog Number: 1.02735.1000) in the medium were adjusted to 5 mM and 10 mM, respectively.

[0282] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5 The production bioreactors were inoculated with approximately 10.0 x 10 cells / mL in medium containing 5 mM or 10 mM L-cysteine, respectively, all without MTX, and the production bioreactors were inoculated with approximately 10.0 x 10 cells / mL in medium containing 5 mM or 10 mM L-cysteine, respectively. 5 Cells / mL were seeded. Cells were cultivated in production bioreactors under fed-batch cultivation conditions with defined pH, dissolved oxygen, temperature, and nutrient supply strategies. Unless otherwise stated, 2 L bioreactors with an initial culture volume of 1.2 L were typically used. An Ambr-250 bioreactor with an initial culture volume of 200 mL was used.

[0283] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH setpoint of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0284] The feed medium contained a combination of in-house medium with glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0285] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 3 g / l.

[0286] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0287] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0288] Figures 7A-7D show the effect of different L-cysteine ​​concentrations on G0 morphology of anti-CD20 / anti-CD3 bsAB, G1 morphology of anti-CD20 / anti-CD3 bsAB, cell proliferation (IVCD), and product titer.

[0289] Figure 7A shows that at the end of the 14-day production process, the G0 form of the anti-CD20 / anti-CD3 bsAB from the process with 5 mM L-cysteine ​​in the production medium was approximately 5.5% lower than the process with 10 mM L-cysteine ​​in the production medium.

[0290] Figure 7B shows that at the end of the 14-day production process, the G1 morphology of the anti-CD20 / anti-CD3 bsAB from the process containing 5 mM L-cysteine ​​in the production medium was approximately 3.4% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0291] Figure 7C shows that at the end of the 14-day production process, the product titer from the process containing 5 mM L-cysteine ​​in the production medium was approximately 66% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0292] FIG. 7D shows that at the end of the 14-day production process, cell growth in the process containing 5 mM L-cysteine ​​in the production medium was higher than in the process containing 10 mM L-cysteine ​​in the production medium.

[0293] Example-5: Enzyme and pathway regulation by L-cysteine ​​in recombinant anti-CD20 / anti-CD3 bispecific antibody-producing CHO cell line T104 for improved production process In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007). CHO K1M cells were engineered to express an anti-CD20 / CD3-targeted T cell bispecific monoclonal antibody, anti-CD20 / anti-CD3 bsAB (described in EP 3252078), herein designated T104 cell line.

[0294] Anti-CD20 / anti-CD3 bsABs are T cell bispecific (TCB) antibodies that target CD20 expressed on B cells and the CD3 epsilon chain (CD3ε) present on T cells. The mechanism of action of anti-CD20 / anti-CD3 bsABs involves simultaneous binding to CD20+ B cells and CD3+ T cells, resulting in T cell activation and T cell-mediated killing of B cells. In the presence of CD20+ B cells, whether circulating or present in tissues, pharmacologically active doses trigger T cell activation and associated cytokine release. Anti-CD20 / anti-CD3 bsABs can be used to treat diseases, particularly B cell proliferative disorders, and to alleviate adverse effects in response to the administration of T cell-activating therapeutic agents.

[0295] For the cell culture process, a custom-made version of a serum-free, chemically defined in-house medium was used as the basal medium for culturing T104 cells. After thawing, cells were passaged in this medium on a 3-4 day schedule in the presence of 250 nM methotrexate (MTX; Pfizer, catalog number 13999031) in shaker flasks. Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kühner Shaker X platform (Adolf Kühner AG, Birsfelden, Basel, Switzerland).

[0296] For the seeding training and production processes, another custom-made version of a serum-free, chemically defined medium was used as the basal medium for growing T104 cells. Additional glucose, glutamine, amino acids, trace elements (RTE1.2 Solution, Gibco, UK; reference number 043-90585H), and salts were also included during the production medium preparation. In this case, the final concentrations of L-cysteine ​​(Merck Chemicals GmbH, catalog number 1.02735.1000) in the medium were adjusted to 5 mM and 10 mM, respectively.

[0297] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5 The production bioreactors were inoculated with approximately 10.0 x 10 cells / mL in medium containing 5 mM or 10 mM L-cysteine, respectively, all without MTX, and the production bioreactors were inoculated with approximately 10.0 x 10 cells / mL in medium containing 5 mM or 10 mM L-cysteine, respectively. 5 Cells / mL were seeded. Cells were cultured in production bioreactors under fed-batch culture conditions with defined pH, dissolved oxygen, temperature, and nutrient feeding strategies. Unless otherwise stated, 2 L bioreactors with an initial culture volume of 1.2 L were used. Unless otherwise stated, Ambr-250 bioreactors with an initial culture volume of 200 mL were used.

[0298] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH set point of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0299] The feed medium contained a combination of RF1.0 powder (SAFC, catalog number CR60112), glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0300] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 3 g / l.

[0301] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0302] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0303] Figures 8A-8D show the effect of different L-cysteine ​​concentrations on G0 morphology of anti-CD20 / anti-CD3 bsAB, G1 morphology of anti-CD20 / anti-CD3 bsAB, cell proliferation (IVCD), and product titer.

[0304] Figure 8A shows that at the end of the 14-day production process, the G0 form of the anti-CD20 / anti-CD3 bsAB from the process containing 5 mM L-cysteine ​​in the production medium was approximately 3.8% lower than the process containing 10 mM L-cysteine ​​in the production medium.

[0305] Figure 8B shows that at the end of the 14-day production process, the G1 morphology of the anti-CD20 / anti-CD3 bsAB from the process containing 5 mM L-cysteine ​​in the production medium was approximately 2.5% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0306] FIG. 8C shows that at the end of the 14-day production process, the product titer from the process containing 5 mM L-cysteine ​​in the production medium was approximately 67% higher than the process containing 10 mM L-cysteine ​​in the production medium.

[0307] FIG. 8D shows that at the end of the 14-day production process, cell growth in the process containing 5 mM L-cysteine ​​in the production medium was higher than in the process containing 10 mM L-cysteine ​​in the production medium.

[0308] Example 6: Pathway modulation by L-cystine in the CHO cell line L967 for recombinant anti-human α-synuclein antibody production In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007). CHO K1M cells were engineered to express an anti-human α-synuclein monoclonal antibody (described in U.S. Pat. Nos. 9,670,274 and 9,890,209) that binds to monomeric or oligomeric human α-synuclein, and are herein designated the L967 cell line.

[0309] Human α-synuclein can form fibrillar aggregates, and these aggregates are the main components of Lewy bodies and Lewy neurites. Recent scientific research suggests that pre-fibrillar oligomers of α-synuclein may be an important contributing factor in the progression of Parkinson's disease (Luk et al., 2012). The specific antibody L967 can specifically bind to extracellular α-synuclein and can be used to prevent the transmission of intercellular aggregates and the progression of Parkinson's disease.

[0310] For the cell culture process, a custom-made version of serum-free, chemically defined medium was used as the basal medium for culturing L967 cells. After thawing, cells were passaged in this medium in the presence of 5 μg / mL puromycin (Puromycin Solution, InvivoGen SAS, France, catalog number ANT-PR) in shaker flasks on a 3-4 day schedule. Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kühner Shaker X platform (Adolf Kühner AG, Birsfelden, Basel, Switzerland).

[0311] For the seeding training and production processes, another custom-made version of a serum-free, chemically defined medium was used as the basal medium for growing L967 cells. Additional glucose, glutamine, amino acids, trace elements (diluted RTE1.2 Solution, Gibco, UK; reference number 043-90585H), and salts were also included during this production medium preparation. Prior to use, the final concentrations of L-cystine (L-cystine disodium salt monohydrate; SAFC, supplier item number RES1523C-A154X) in the medium were adjusted to 2 mM and 4 mM, respectively.

[0312] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5 The production bioreactors were inoculated in parallel with prepared production medium containing 2 mM or 4 mM L-cystine at 0.1 × 10 cells / mL. The production bioreactors were inoculated with approximately 10.0 × 10 cells / mL in medium containing 2 mM or 4 mM L-cystine, respectively. 5 Cells / mL were seeded. Cells were cultivated in production bioreactors under fed-batch cultivation conditions with defined pH, dissolved oxygen, temperature, and nutrient supply strategies. Unless otherwise stated, 2 L bioreactors with an initial culture volume of 1.2 L were typically used. An Ambr-250 bioreactor with an initial culture volume of 200 mL was used.

[0313] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH set point of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0314] The feed medium contained a combination of RF1.0 powder (SAFC, catalog number CR60112), glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0315] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 4 g / l.

[0316] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0317] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0318] Figures 9A-9E show the effect of different L-cystine concentrations on the G0 form of anti-α-synuclein antibody L967, the G1 form of anti-α-synuclein antibody L967, the G2 form of anti-α-synuclein antibody L967, product titer, and cell proliferation (IVCD).

[0319] FIG. 9A shows that at the end of the 14-day production process, the G0 form of anti-α-synuclein antibody L967 from the process containing 2 mM L-cystine in the production medium was approximately 6.6% higher than the process containing 4 mM L-cystine in the production medium.

[0320] Figure 9B shows that at the end of the 14-day production process, the G1 form of anti-α-synuclein antibody L967 from the process containing 2 mM L-cystine in the production medium was approximately 5.9% lower than the process containing 4 mM L-cystine in the production medium.

[0321] Figure 9C shows that at the end of the 14-day production process, the G2 form of anti-α-synuclein antibody L967 from the process containing 2 mM L-cystine in the production medium was approximately 1.6% lower than the process containing 4 mM L-cystine in the production medium.

[0322] FIG. 9D shows that at the end of the 14-day production process, the product titer from the process containing 2 mM L-cystine in the production medium was approximately 9% lower than the process containing 4 mM L-cystine in the production medium.

[0323] FIG. 9E shows that at the end of the 14-day production process, cell growth in the process containing 2 mM L-cystine in the production medium was approximately 3.7% lower than in the process containing 4 mM L-cystine in the production medium.

[0324] Example 7: Pathway modulation by L-cystine in the CHO cell line L971 for recombinant anti-human alpha-synuclein antibody production In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007). CHO K1M cells were engineered to express an anti-human α-synuclein monoclonal antibody (described in U.S. Pat. Nos. 9,670,274 and 9,890,209) that binds to monomeric or oligomeric human α-synuclein, and are herein designated CHO L971 cell line.

[0325] Human α-synuclein can form fibrillar aggregates, and these aggregates are the main components of Lewy bodies and Lewy neurites. Recent scientific studies suggest that pre-fibrillar oligomers of α-synuclein may be an important contributing factor in the progression of Parkinson's disease (Luk et al., 2012). The specific antibody L971 can specifically bind to extracellular α-synuclein and can be used to prevent the transmission of intercellular aggregates and the progression of Parkinson's disease.

[0326] For the cell culture process, a custom-made version of serum-free, chemically defined medium was used as the basal medium for culturing L971 cells. After thawing, cells were passaged in this medium in the presence of 5 μg / mL puromycin (Puromycin Solution, InvivoGen SAS, France, catalog number ANT-PR) in shaker flasks on a 3-4 day schedule. Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kühner Shaker X platform (Adolf Kühner AG, Birsfelden, Basel, Switzerland).

[0327] For the seeding training and production processes, another custom-made version of a serum-free, chemically defined medium was used as the basal medium for growing L971 cells. Additional glucose, glutamine, amino acids, trace elements (RTE1.2 Solution, Gibco, UK; reference number 043-90585H), and salts were also included during this production medium preparation. Prior to use, the final concentrations of L-cystine (L-cystine disodium salt monohydrate; SAFC, supplier item number RES1523C-A154X) in the medium were adjusted to 2 mM and 4 mM, respectively.

[0328] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5The production bioreactors were inoculated in parallel with prepared production medium containing 2 mM or 4 mM L-cystine at 0.1 × 10 cells / mL. The production bioreactors were inoculated with approximately 10.0 × 10 cells / mL in medium containing 2 mM or 4 mM L-cystine, respectively. 5 Cells / mL were seeded. Cells were cultivated in production bioreactors under fed-batch cultivation conditions with defined pH, dissolved oxygen, temperature, and nutrient supply strategies. Unless otherwise stated, 2 L bioreactors with an initial culture volume of 1.2 L were typically used. An Ambr-250 bioreactor with an initial culture volume of 200 mL was used.

[0329] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH set point of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0330] The feed medium contained a combination of RF1.0 powder (SAFC, catalog number CR60112), glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0331] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 4 g / l.

[0332] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0333] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0334] 10A-10E show the effect of different L-cystine concentrations on the G0 form of anti-α-synuclein antibody L971, the G1 form of anti-α-synuclein antibody L971, the G2 form of anti-α-synuclein antibody L971, product titer, and cell proliferation (IVCD).

[0335] FIG. 10A shows that at the end of the 14-day production process, the G0 form of anti-α-synuclein antibody L971 from the process containing 2 mM L-cystine in the production medium was approximately 3% higher than the process containing 4 mM L-cystine in the production medium.

[0336] FIG. 10B shows that at the end of the 14-day production process, the G1 form of anti-α-synuclein antibody L971 from the process containing 2 mM L-cystine in the production medium was approximately 2% lower than the process containing 4 mM L-cystine in the production medium.

[0337] FIG. 10C shows that at the end of the 14-day production process, the G2 morphology of anti-α-synuclein antibody L971 from a process containing 2 mM L-cystine in the production medium was comparable to a process containing 4 mM L-cystine in the production medium.

[0338] FIG. 10D shows that at the end of the 14-day production process, the product titer from the process containing 2 mM L-cystine in the production medium was approximately 30% lower than the process containing 4 mM L-cystine in the production medium.

[0339] FIG. 10E shows that at the end of the 14-day production process, cell growth in the process containing 2 mM L-cystine in the production medium was slightly equivalent to the process containing 4 mM L-cystine in the production medium.

[0340] Example 8: Functional comparison of recombinant anti-human alpha-synuclein antibody L971 produced from processes with L-cysteine ​​or L-cystine In this example, CHO K1M, a cell line derived from Chinese hamster ovary (CHO) cells, was used as the host cell line (WO 2009047007). CHO K1M cells were engineered to express an anti-human α-synuclein monoclonal antibody (described in U.S. Pat. Nos. 9,670,274 and 9,890,209) that binds to monomeric or oligomeric human α-synuclein, and are herein designated CHO L971 cell line.

[0341] Human α-synuclein can form fibrillar aggregates, and these aggregates are the main components of Lewy bodies and Lewy neurites. Recent scientific studies suggest that pre-fibrillar oligomers of α-synuclein may be an important contributing factor in the progression of Parkinson's disease (Luk et al., 2012). The specific antibody L971 can specifically bind to extracellular α-synuclein and can be used to prevent the transmission of intercellular aggregates and the progression of Parkinson's disease.

[0342] For the cell culture process, a custom-made version of serum-free, chemically defined medium was used as the basal medium for culturing L965 cells. After thawing, cells were passaged in this medium in the presence of 5 μg / mL puromycin (Puromycin Solution, InvivoGen SAS, France, catalog number ANT-PR) in shaker flasks on a 3-4 day schedule. Passaging conditions were 36.5°C, 7% CO2, and 160 rpm for 125 mL and 500 mL flasks using a Kühner Shaker X platform (Adolf Kühner AG, Birsfelden, Basel, Switzerland).

[0343] For the seeding training and production process, another custom-made version of a serum-free, chemically defined medium was used as the basal medium to grow L971 cells.

[0344] During this production medium preparation, additional glucose, glutamine, amino acids, trace elements (RTE1.2 Solution, Gibco, UK; reference number 043-90585H), and salts were also included. Prior to use, the final concentration of L-cystine (L-cystine disodium salt monohydrate; SAFC, supplier item number RES1523C-A154X) in the medium was adjusted to 3 mM in one portion of the medium. For direct comparison, the final concentration of L-cysteine ​​(Merck Chemicals GmbH, catalog number: 1.02735.1000) in the medium was adjusted to 6 mM in the other portion of the medium.

[0345] Using precultured cells, perform the N-2 step with approximately 3.0 x 10 5 Approximately 5.0 x 10 cells / mL for step N-1 5 The production bioreactors were inoculated with approximately 10.0 × 10 cells / mL in medium containing L-cystine (3 mM) or L-cysteine ​​(6 mM), respectively, in parallel with prepared production medium containing a defined amount of L-cystine or L-cysteine. 5Cells / mL were seeded. Cells were cultivated in production bioreactors under fed-batch cultivation conditions with defined pH, dissolved oxygen, temperature, and nutrient supply strategies. Unless otherwise stated, 2 L bioreactors with an initial culture volume of 1.2 L were typically used. An Ambr-250 bioreactor with an initial culture volume of 200 mL was used.

[0346] The temperature in the bioreactor was controlled at 36.5°C, and the agitator speed was set at approximately 223 rpm. A gas mixture containing air, CO2, and O2 was provided. The dissolved carbon dioxide concentration (dCO2) was measured offline once daily. The dissolved oxygen concentration (DO) was controlled online and adjusted to 35% by varying the oxygen partial pressure in the gas mixture. Unless otherwise noted, the pH was maintained at a pH set point of 7.00 by addition of CO2 or 1.0 M NaHCO3, with a dead band of ±0.03 pH units.

[0347] The feed medium contained a combination of in-house medium with glucose, glutamine, amino acids, and salts. This feed medium was prepared in solution and added to the cultures on days 3, 6, and 9 at approximately 10% by volume of the working culture volume.

[0348] Supplemental glucose feed solution was prepared and added to the cultures on days 4-14 to maintain glucose concentrations above approximately 4 g / l.

[0349] Samples of the production cell culture were taken daily with a syringe for offline analysis. The production period typically lasted approximately 14 days. Cell concentration and viability were measured by trypan blue exclusion using a CEDEX instrument (Roche Diagnostics GmbH, Germany). Offline measurements of glucose, glutamine, glutamate, lactate, ammonium, and product concentrations were performed using a COBAS INTEGRA® 400 plus (Roche Diagnostics GmbH, Germany). Dissolved carbon dioxide was analyzed using a Cobas b221 analyzer (Roche Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Osmolality was measured by freezing point depression using an Osmomat Auto Osmometer (Gonotec GmbH, Berlin, Germany).

[0350] At the end of the main culture production process, the cell culture fluid was collected by centrifugation. The supernatant was further subjected to small-scale mAb purification with Protein A. The glycosylation pattern of the purified mAb was analyzed by 2AB.

[0351] The neonatal Fe receptor (FcRn) influences the pharmacokinetic (PK) profile of IgG antibodies through its ability to salvage antibodies from early endosomes and return them to the circulation. Interaction with FcRn is thought to be the most important factor in determining the PK of therapeutic IgG antibodies and is considered a surrogate for clearance (see review in Nimmerjahn and Ravetch 2008).

[0352] Fcγ receptors are mediators of effector functions on immune effector cells. Among the different human Fcγ receptors, Fcγ-RIIa is considered to be the dominant factor in mediating antibody-dependent phagocytosis (ADCP). Of the two most common allotypes of Fcγ-RIIa, the form with a histidine at amino acid position 131 (H131) is often described as the high-affinity allotype (Nimmerjahn and Ravetch, 2008; Yamada et al., 2013).

[0353] Here, we determined the relative binding of small-scale purified aSin-L971-mAb samples to FcRn and FcγIIa (His131) by surface plasmon resonance (SPR).The relative binding of small-scale purified aSin-L971-mAb samples to their targets was determined by ELISA.

[0354] Figures 11A-11E show a direct comparison of the aSyn-L971 antibody produced in cell culture processes containing 3 mM L-cystine or 6 mM L-cysteine ​​in the cell culture medium, respectively.

[0355] FIG. 11A shows that at the end of the 14-day production process, the G1 form of anti-α-synuclein antibody L971 from the process containing 6 mM L-cysteine ​​in the production medium was only slightly higher than the process containing 3 mM L-cystine in the production medium.

[0356] FIG. 11B shows that at the end of a 14-day production process, the G2 morphology of anti-α-synuclein antibody L971 from a process containing 6 mM L-cysteine ​​in the production medium was comparable to a process containing 3 mM L-cystine in the production medium.

[0357] Figure 11C shows that at the end of the 14-day production process, an approximately 33% higher relative FcRn binding level (relative level of approximately 118%) was observed for anti-α-synuclein antibody L971 from a process that included 6 mM L-cysteine ​​in the production medium than for anti-α-synuclein antibody L971 from a process that included 3 mM L-cystine in the production medium (relative level of approximately 85%).

[0358] Figure 11D shows that at the end of the 14-day production process, an approximately 36% higher relative Fcγ-RIIa (H131) binding level (relative level of approximately 113%) was observed for anti-α-synuclein antibody L971 from a process that included 6 mM L-cysteine ​​in the production medium than for anti-α-synuclein antibody L971 from a process that included 3 mM L-cystine in the production medium (relative level of approximately 77%).

[0359] FIG. 11E shows that at the end of the 14-day production process, a target relative binding level that was approximately 35% higher (relative level of approximately 118%) was observed for anti-α-synuclein antibody L971 from a process that included 6 mM L-cysteine ​​in the production medium than for anti-α-synuclein antibody L971 from a process that included 3 mM L-cystine in the production medium (relative level of approximately 83%). [Table 1] TIFF2025157400000002.tif246161 [Table 2] TIFF2025157400000004.tif237161 TIFF2025157400000005.tif237161 TIFF2025157400000006.tif237161 TIFF2025157400000007.tif185161

Claims

1. 1. An anti-α-synuclein antibody having monogalactosylated (G1) and digalactosylated (G2) glycans, (a) a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 10; (b) a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 11; and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 12 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 13; (e) a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 14; and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 15 a light chain variable domain (VL) comprising: The anti-α-synuclein antibody is preferably 17.2-48.0% (w / w) G1 and 3.1-15.0% (w / w) G2 per total glycan; preferably 25.4-48.0% (w / w) G1 and 3.5-15.0% (w / w) G2 per total glycan; preferably 27.2-47.0% G1 and 4.4-15.0% G2 per total glycan; more preferably, 41.0-45.0% (w / w) G1 and 9.5-14.0% (w / w) G2 per total glycan, and most preferably, 42.1-43.9% (w / w) G1 and 10.6-13.3% (w / w) G2 per total glycan.

2. (a) a VH sequence of SEQ ID NO: 16; (b) the VL sequence of SEQ ID NO: 17, or (c) the VH sequence described in (a) and the VL sequence described in (b) The anti-α-synuclein antibody of claim 1, comprising:

3. The anti-α-synuclein antibody of claim 1 or 2, comprising a heavy chain of SEQ ID NO: 20 and a light chain of SEQ ID NO:

21.

4. 1. An anti-CD20 / anti-CD3 bispecific antibody having monogalactosylated (G1) and digalactosylated (G2) glycans, comprising a first antigen-binding domain and a second antigen-binding domain, wherein the first antigen-binding domain comprises: (a) a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; (b) a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 25; (e) a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 26; and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 27 a light chain variable domain (VL) comprising: the second antigen-binding domain comprises: (a) a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 34; (b) a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 35; and (c) CDR-H3 comprising the amino acid sequence of SEQ ID NO: 36 a heavy chain variable domain (VH) comprising: (d) CDR-L1 comprising the amino acid sequence of SEQ ID NO: 37; (e) a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 38; and (f) CDR-L3 comprising the amino acid sequence of SEQ ID NO: 39 a light chain variable domain (VL) comprising:

1. An anti-CD20 / anti-CD3 bispecific antibody having 19.0-29.0% (w / w) G1 and 1.3-2.8% (w / w) G2 per total glycan, preferably 20.0-28.0% (w / w) G1 and 1.4-2.7% (w / w) G2 per total glycan, more preferably 21.0-28.0% (w / w) G1 and 1.5-2.7% (w / w) G2 per total glycan, and most preferably 21.0-27.4% (w / w) G1 and 1.5-2.6% (w / w) G2 per total glycan.

5. (a) the first antigen-binding domain comprises the VH sequence of SEQ ID NO: 28 and the VL sequence of SEQ ID NO: 29; (b) the second antigen-binding domain comprises the VH sequence of SEQ ID NO: 40 and the VL sequence of SEQ ID NO: 41; (c) the first antigen-binding domain and the second antigen-binding domain comprise the VH sequence of (a) and the VL sequence of (b); The anti-CD20 / anti-CD3 bispecific antibody of claim 4.

6. (a) a first heavy chain of SEQ ID NO: 46 and a second heavy chain of SEQ ID NO: 45; (b) a first light chain of SEQ ID NO: 33 and a second light chain of SEQ ID NO: 44, or (c) a first heavy chain and a second heavy chain according to (a) and a first light chain and a second light chain according to (b).

6. The anti-CD20 / anti-CD3 bispecific antibody of claim 4 or 5, comprising:

7. (a) a first heavy chain of SEQ ID NO: 47 and a second heavy chain of SEQ ID NO: 45 (b) a first light chain of SEQ ID NO: 33, a second light chain of SEQ ID NO: 44, and a third light chain; or (c) a first heavy chain and a second heavy chain according to (a) and a first light chain, a second light chain and a third light chain according to (b). The anti-CD20 / anti-CD3 bispecific antibody of any one of claims 4 to 6, comprising:

8. A method for producing an α-synuclein antibody having monogalactosylated (G1) and digalactosylated (G2) glycans according to any one of claims 1 to 3, comprising: (a) culturing mammalian cells in a cell culture medium, wherein a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 4.0 mM and less than 10.0 mM and a concentration of glucose greater than at least 3.0 g / L in the cell culture medium are maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating the antibody; and A method comprising:

9. A method for producing an anti-CD20 / anti-CD3 bispecific antibody having monogalactosylated (G1) and digalactosylated (G2) glycans according to any one of claims 4 to 7, comprising: (a) culturing mammalian cells in a cell culture medium, wherein a concentration of sulfhydryl groups from one or more sulfhydryl compounds greater than at least 4.0 mM and less than 10.0 mM and a concentration of glucose greater than at least 3.0 g / L in the cell culture medium are maintained for at least 3 days, more preferably at least 4 days, and even more preferably at least 5 days; (b) isolating said antibody; and A method comprising:

10. 10. The method of claim 8 or 9, wherein said concentration is maintained for at least 5 days, preferably at least 7 days, more preferably at least 10 days, even more preferably at least 12 days, and most preferably at least 14 days.

11. 11. The method of any one of claims 8 to 10, wherein the cell culture medium comprises the sulfhydryl groups from the one or more sulfhydryl compounds at a concentration of at least 5.0 mM and less than 10.0 mM, preferably at least 5.0 mM and not more than 9.0 mM, more preferably at least 5.0 mM and not more than 8.0 mM, even more preferably at least 5.0 mM and not more than 7.0 mM, and most preferably at least 5.0 mM and not more than 6.0 mM.

12. 12. The method of any one of claims 8 to 11, wherein the cell culture medium comprises between more than 3.0 g / L and up to 13 g / L of glucose, preferably between more than 3.0 g / L and up to 8.0 g / L of glucose, more preferably between more than 3.0 g / L and up to 7.0 g / L of glucose, even more preferably between more than 3.0 g / L and up to 6.0 g / L of glucose, and most preferably between more than 3.0 g / L and up to 5.0 g / L of glucose.

13. 13. The method of any one of claims 8 to 12, wherein the one or more sulfhydryl compounds are selected from the group consisting of cysteine, cystine, and combinations thereof.

14. The method according to any one of claims 8 to 13, wherein the cell culture medium is a chemically defined medium, preferably a serum-free, protein-free and / or oligopeptide-free cell culture medium.

15. An anti-CD20 / anti-CD3 bispecific antibody according to any one of claims 1 to 4 for use in the treatment of patients with B-cell related cancers, preferably chronic leukemias and lymphomas.

16. The anti-α-synuclein antibody of any one of claims 5 to 7 for use in treating patients with Parkinson's disease.

Images