Raldh2 expression enhancer

Abstract

To provide a novel RALDH2 expression enhancer.SOLUTION: The present invention provides a RALDH2 expression enhancer which contains as an active ingredient one or more components selected from the group consisting of quercetin, kaempferol, Coix, bee pollen, Polygonatum falcatum, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, Angelica keiskei, Syzygium aromaticum flower bud, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, Aloe arborescens, maca, and olive leaves.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present invention provides an agent for enhancing RALDH2 expression. [Background technology]

[0002] The number of patients suffering from allergic diseases is increasing year by year. Allergies are primarily caused by a disruption in the body's immune balance (Th1-Th2), and in the human body, approximately 60% of immune-related cells and antibodies are concentrated in the intestine. Regulatory T cells (hereinafter referred to as Tregs) that regulate the body's immune balance (Th1-Th2) have been discovered in recent years, and it has been discovered that excessive immune responses can be controlled by inducing Tregs. For example, it has been reported that inducing Tregs in mice alleviated the symptoms of allergic dermatitis and inflammatory bowel disease. It has been reported that certain lactic acid bacteria, lycopene, trehalose, and other substances are effective in inducing Treg differentiation (Patent Documents 1 to 4).

[0003] Tregs are known to differentiate in the thymus and intestine, and retinoic acid has been reported as a factor contributing to Treg differentiation. Retinoic acid is a metabolite of vitamin A, and it has been reported that certain lactic acid bacteria are effective as retinoic acid producers (Patent Document 5). Furthermore, it has been suggested that an enzyme called RALDH2 is involved in the metabolism of retinoic acid, and that increasing RALDH2 expression in dendritic cells via intestinal cells promotes their differentiation into Tregs (Non-Patent Document 1). However, although certain lactic acid bacteria have been reported (Non-Patent Document 2), little research has been done on substances that promote RALDH2 expression. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Publication No. 2019-80497 [Patent Document 2] Japanese Patent Application Laid-Open No. 2017-127846 [Patent Document 3] Japanese Patent Application Publication No. 2018-188436 [Patent Document 4] Japanese Patent Application Publication No. 2018-188408 [Patent Document 5] Patent No. 6543614 [Non-patent literature]

[0005] [Non-Patent Document 1] Makoto Iwata et al. Vitamins and hormones, 86 (2011) pp127-152 [Non-patent document 2] Gut microbiota 2012;61(3):354-366. doi:10.1136 / gutjnl-2011-300936 [Non-patent document 3] Alberto Caminero et al. Nat Rev Gastroenterol Hepatol. 2019; 16(1): 7-18. [Non-patent document 4] Min-Sung Kwon et al. Front Immunol. 2018; 9: 1905. [Non-Patent Document 5] IMMUNE NETWORK Vol. 15, No. 1: 1-8, February, 2015 [Non-patent document 6] PLoS ONE 14(5): e0217394. https: / / doi.org / 10.1371 / journal.pone.0217394, May 28, 2019 [Non-Patent Document 7] Wako Pure Chemical Journal Vol.87 No.2 (June 2019), pp.9-11 Yoshinori Katakura, "Exploring Anti-Brain-Aging Foods and Elucidating the Molecular Basis of Their Functionality," Asahi Beer Science Foundation, April 2010 [Non-patent document 8] IMMUNE NETWORK Vol. 15, No. 1: 1-8, February, 2015 Summary of the Invention [Problem to be solved by the invention]

[0006] An object of the present invention is to provide an agent for enhancing RALDH2 expression. [Means for solving the problem]

[0007] As a result of extensive research, the present inventors have found that one or more components selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, Aloe arborescens, maca, and olive leaves function as RALDH2 expression enhancers. Furthermore, the present inventors have found that these substances act on monocytes via intestinal cells. Based on these findings, the following inventions have been completed: (1) A RALDH2 expression enhancer containing, as an active ingredient, one or more ingredients selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried tangerine peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, Aloe arborescens, maca, and olive leaves. (2) The RALDH2 expression enhancer described in (1), which enhances RALDH2 expression in monocytic cells via intestinal cells. (3) A RALDH2 expression enhancer according to (1) or (2), which enhances RALDH2 expression in monocytic cells when administered orally. (4) A composition comprising the RALDH2 expression enhancer according to any one of (1) to (3). [Effects of the Invention]

[0008] Administration of the RALDH2 expression enhancer of the present invention can promote RALDH2 expression. According to the present invention, compositions and oral preparations containing the RALDH2 expression enhancer can be provided. [Brief explanation of the drawings]

[0009] [Figure 1] Figure 1 is a schematic diagram of Experiment 3. [Figure 2] FIG. 2 shows the amount of RALDH2 expression in THP-1 cells when each sample was added in Experiment 3, expressed as a relative value, with the value when the negative control (DMSO only) was added being set at 1. DETAILED DESCRIPTION OF THE INVENTION

[0010] Antigens that enter the intestinal tract induce the production of various cytokines from dendritic cells (DCs). Stimulation by these cytokines causes undifferentiated T cells present in the intestinal mesothelium to differentiate into activated T cells (T1, T2, and T17) or inhibitory T cells (Tregs). It has been reported that Tregs suppress immune responses, thereby preventing self-tolerance and excessive immune responses (Non-Patent Document 3). It has been suggested that increasing RALDH2 expression in dendritic cells via intestinal cells suppresses the production of inflammatory T cells, promotes their differentiation into Tregs, and maintains a favorable immune balance. It also promotes antibody IgA production in the mucosa and inhibits T cell migration to the skin (Non-Patent Documents 1, 4, and 5).

[0011] RALDH2 (retinaldehyde dehydrogenase 2) is an enzyme that converts retinal to retinoic acid. Retinoic acid (CAS number: 302-79-4) is a metabolic product of vitamin A. Vitamin A taken into the body is converted to retinal, which is then converted to retinoic acid, which is known to exert various effects in the body. Retinoic acid is known to be an important substance in controlling cell proliferation and differentiation during development, and also contributes to improving mucosal defenses. In recent years, it has also been shown to contribute to Treg differentiation (Non-Patent Documents 1 and 5).

[0012] The RALDH2 expression enhancer of the present invention is expected to promote Treg differentiation by promoting RALDH2 expression in monocytes via the intestinal tract, particularly when taken orally, thereby improving immune balance, suppressing allergies, inhibiting inflammatory T cell activity, and improving skin condition. In the present invention, improvement of skin condition refers to improvement of skin condition due to enhancement of RALDH2 expression in monocytes, such as suppression of inflammation and allergic reactions in the skin. Improvement of skin condition may be mediated by promotion of Treg differentiation, suppression of inflammatory T cell production, inhibition of T cell migration to the skin, etc., due to enhancement of RALDH2 expression in monocytes.

[0013] Enhancement of RALDH2 expression can mean, for example, that the expression level of RALDH2 is increased when a RALDH2 expression enhancer is administered compared to a state in which nothing is administered (control). For example, it can mean that the increase is statistically significant (e.g., Student's t-test) at a significance level of 5%. Alternatively, enhancement of RALDH2 expression in the present invention can mean that the expression level of RALDH2 is increased by, for example, 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 200% or more, 300% or more, 400% or more, or 500% or more when a RALDH2 expression enhancer is administered compared to a state in which nothing is administered (control). The expression level of RALDH2 can be determined by any known technique, including, but not limited to, a method in which a GFP gene is introduced downstream of the RALDH2 promoter in monocytic cells and changes in EGFP fluorescence derived from RALDH2p-EGFP are determined, as described in the Examples.

[0014] The RALDH2 expression enhancers of the present invention particularly enhance RALDH2 expression in monocytes via intestinal cells. "Enhancing RALDH2 expression in monocytes via intestinal cells" refers to ultimately enhancing RALDH2 expression in monocytes via direct or indirect pathways, such as administering an active ingredient of the present invention to intestinal cells and allowing it to be absorbed by the intestinal cells, resulting in the same component as the active ingredient directly reaching the monocytes, or the active ingredient being absorbed by the intestinal cells and reaching the monocytes in a degraded or modified state, or the intestinal cells taking in the active ingredient and releasing a different component, which then acts on the monocytes. An example of "enhancing RALDH2 expression in monocytes via intestinal cells" is enhancing RALDH2 expression in monocytes by oral administration. "Enhancing RALDH2 expression in monocytic cells by oral administration" means that by taking the RALDH2 expression enhancer of the present invention orally or enterally, the active ingredient of the present invention is absorbed through the intestinal tract, and the substance taken up from the intestine acts directly or indirectly to ultimately enhance RALDH2 expression in monocytic cells.

[0015] For example, even if a certain component is taken orally from the intestine, it does not directly reach the target cells, but rather another substance secreted by intestinal cells may reach the target cells and act indirectly. For example, as described in Non-Patent Documents 6-8, it has been reported that carnosine taken up from the intestine does not directly affect the brain, but rather activates CREB in intestinal cells, thereby enhancing BDNF production, which in turn activates neurons and improves brain function. Furthermore, it has been suggested that this activation of the brain-gut correlation is mediated by exosomes. In other words, even if a component is administered to the intestine, it is unclear what effect that component will have on the target cells. Therefore, it is necessary to administer the test substance to intestinal cells and then confirm what effect it has on the target cells.

[0016] Such effects mediated by intestinal cells can be measured by various methods, including in vivo, in vitro, and ex vivo. For example, as in the Examples herein, a test substance can be administered to a culture medium containing intestinal cells such as Caco-2, and the RALDH2 expression level in monocytic cells such as THP-1 cells when the culture medium is administered can be determined by an in vitro method. However, the measurement method is not limited to the above method, and any other method can be employed. For example, a Transwell method can be employed in which a test substance is added to one side of a layer of intestinal cells, passes through the layer, and the RALDH2 expression level in monocytic cells present on the opposite side of the layer can be measured. Alternatively, an in vivo method can be employed in which a test substance is orally administered to an animal such as a human and then RALDH2 activity in monocytes can be measured.

[0017] The present invention provides an agent for enhancing RALDH2 expression, containing as an active ingredient one or more components selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, Angelica keiskei, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, psyllium sieboldii, plantain, wolfberry, Aloe arborescens, maca, and olive leaf. The present invention also provides a composition containing as an active ingredient one or more components selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, Angelica keiskei, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, psyllium sieboldii, plantain, wolfberry, Aloe arborescens, maca, and olive leaf. The RALDH2 expression enhancer and composition of the present invention may be in the form of an oral or enteral agent, and may be for the purpose of beautifying the skin.

[0018] The quercetin (CAS number: 849061-97-8) used in the present invention is a type of flavonoid, a component found in vegetables such as onions. It is known to have antioxidant, anti-inflammatory, blood flow improving, and lipolytic effects. Quercetin may be in the form of its own or a glycoside such as rutin or quercitrin.

[0019] Kaempferol (CAS number: 520-18-3) used in the present invention is a flavonoid found in tea and vegetables. It is known to have antioxidant, anti-inflammatory, anti-cancer, and anti-diabetic effects. Kaempferol may be in the form of its own or a glycoside such as kaempferitrin or astragalin.

[0020] The Job's tears (Coix lacryma-jobi Linne var. mayuen Stapf (Gramineae)) used in the present invention is a grain of the genus Job's tears in the family Poaceae. It is preferable to use the seeds of Job's tears with the seed coat removed. The bark is said to be effective in treating skin warts and whitening the skin.

[0021] The bee pollen used in the present invention is pollen grains (pollen load) collected by honeybees. It has been reported to contain nutrients such as vitamins and minerals. Any pollen may be used, such as pollen from cistus, oak, rose, echium, or chrysanthemum. The location from which the bee pollen is collected is not limited to Europe, such as Spain, or Asia, such as China.

[0022] The narcissus (Polygonatum falcatum) used in the present invention is a perennial herb belonging to the genus Polygonatum in the family Liliaceae. It is preferable to use the dried rhizome as a herbal medicine. It is said to be effective as a nourishing tonic.

[0023] Hops (Humulus lupulus) used in the present invention is a climbing perennial plant of the Cannabaceae family. It is preferable to use the cones. Hops are said to have stomachic and sedative effects.

[0024] The dried tangerine peel used in the present invention is the peel of a mandarin orange. Mandarin oranges (genus Citrus) are evergreen shrubs of the family Rutaceae in the order Sapindales. They are said to be effective in improving blood flow, indigestion, loss of appetite, etc.

[0025] The cabbage (Brassica oleracea var. capitata) used in the present invention is a vegetable of the Brassicaceae family. Cabbage leaves are preferably used. Cabbage is rich in dietary fiber, vitamin U, and vitamin C, and is said to be effective in maintaining gastrointestinal health.

[0026] The celery used in the present invention is an annual plant of the Umbelliferae family (Apium graveolens var. dulce). Celery stalks and leaves are preferably used. Celery stalks and leaves are said to have the effects of preventing anorexia, stabilizing the mind, and suppressing hypertension.

[0027] The okra (Abelmoschus esculentus) used in the present invention is a plant belonging to the genus Abelmoschus in the family Malvaceae. It is preferable to use the fruit, which contains mucin and pectin and has been reported to have the effect of regulating gastrointestinal conditions.

[0028] The parsley (Petroselinum crispum) used in the present invention is a biennial plant of the Apiaceae family. It is preferable to use the stems and leaves. The stems and leaves are rich in nutrients such as vitamins and minerals, and are said to be effective in strengthening the stomach, relieving fatigue, and treating anemia.

[0029] Asparagus (Asparagus spp.) used in the present invention is a general term for various species belonging to the Asparagus genus. It is preferable to use the stems. The stems are rich in nutrients such as oligosaccharides, vitamins, and minerals, and are known to have diuretic, stomachic, and intestinal regulating effects.

[0030] The Angelica keiskei plant used in this invention is a plant of the Apiaceae family, Angelica genus. It is preferable to use the stems and leaves. It is rich in vitamins, minerals, and dietary fiber, and is known to have anti-constipation, diuretic, anti-hypertension, and tonic effects.

[0031] The clove (Syzygium aromaticum) used in the present invention is the flower bud of the clove tree of the Myrtaceae family. Clove is used as an edible spice and is said to have pain-relieving and stomach-strengthening effects.

[0032] The barley leaves used in the present invention are the young leaves of barley (Hordeum vulgare), a plant of the genus Hordeum in the family Poaceae, before ears emerge. They contain various vitamins, minerals, folic acid, SOD enzymes, and other nutrients, making them highly nutritious and used as an ingredient in green juice and other products.

[0033] The Houttuynia cordata Thunberg used in the present invention is a perennial plant of the genus Houttuynia in the family Houttuyniaceae. It is preferable to use the above-ground parts of Houttuynia cordata. It is used internally and as a tea, and is said to be effective for gastrointestinal disorders, detoxification, food poisoning, diarrhea, constipation, diuresis, and other conditions.

[0034] The baobab fruit (Adansonia spp.) used in the present invention is the fruit of a tree of the genus Adansonia in the family Malvaceae. Baobab fruit contains vitamins, minerals, dietary fiber, etc. and is known as a super fruit.

[0035] Broccoli (Brassica oleracea var. italica) used in the present invention is a green and yellow vegetable of the Brassicaceae family. It is preferable to use the above-ground parts of broccoli. Broccoli contains sulforaphane, which has been reported to have effects such as cancer prevention and suppression of Helicobacter pylori.

[0036] The moringa (Moringa oleifera LAM. (M. pterygosperma)) used in the present invention is a plant of the Moringa genus in the family Moringaceae, and it is preferable to use moringa leaves. Moringa leaves are used for food and medicine and are said to be effective in providing nutrition. They contain various vitamins and minerals and are known as a superfood.

[0037] The plantain (Plantago asiatica) used in the present invention is a perennial plant of the genus Plantago in the family Plantaginaceae, and it is preferable to use the whole plant. It is rich in dietary fiber and is said to have effects such as stomachic, reducing swelling, anti-inflammatory, diuretic, antidiarrheal, and cough suppressant.

[0038] The wolfberry used in the present invention is the fruit of wolfberry (Lycium chinense), a deciduous shrub of the Solanaceae family, and contains zeaxanthin, betaine, polyphenols, etc. Wolfberry has been reported to have nourishing and strengthening effects, blood flow improving effects, whitening effects, DNA damage repair effects, etc.

[0039] Aloe arborescens, which is used in the present invention, is a type of succulent plant of the genus Aloe. It is preferable to use Aloe arborescens leaves. It has been reported that external application of Aloe arborescens is effective for burns and cuts, and internal application is effective for improving gastrointestinal pain and constipation.

[0040] Maca (Lepidium meyenii) is a perennial plant in the Brassicaceae family. The root is the preferred source. It contains amino acids, minerals, dietary fiber, vitamins, and other nutrients, and is known for its nutritional benefits, endurance-boosting properties, and anti-fatigue properties.

[0041] Olive leaves are the leaves of the olive tree (Olea europaea), an evergreen tree in the Oleaceae family. Olive leaves contain polyphenols such as oleuropein, which are known to have antibacterial and antiviral properties.

[0042] Compounds such as quercetin and kaempferol may be synthesized, commercially available, or used in the form of herbal medicines. Herbal medicines such as Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, Aloe vera, maca, and olive leaves are known substances and can be easily dried, purified, extracted, etc., using known methods. They are also readily available as commercially available products. They can be used either fresh or dried, but from the perspective of usability, formulation, etc., they can also be used as extracts, dried products, dried powders, raw material powders, squeezed juices, etc. The form to be used can be appropriately selected depending on the raw material, and treatments such as sterilization may be performed as necessary.

[0043] When used as an extract, the extract can be extracted, for example, by solvent extraction. In solvent extraction, the whole plant or various parts (e.g., leaves, flowers, roots) of the plant are dried as needed, and further shredded or crushed as needed. The extract is then extracted using an aqueous extractant, water (e.g., cold water, warm water, or hot water at or below boiling point), or a hydrous organic solvent, or an organic solvent (e.g., ethanol, methanol, ether, 1,3-butylene glycol), selected appropriately depending on the properties of the raw materials and the intended use of the composition, at room temperature or with heating. However, the extraction method is not limited to solvent extraction and may be any conventional method known in the art. The extraction method and form of the extract used in the present invention are arbitrary as long as they do not impair the effects of the present invention. The extract may be in the form of a liquid extract itself, or may be diluted or concentrated as appropriate using conventional methods. It may also be in the form of a powder or lumpy solid obtained by drying the extract.

[0044] Examples of the aqueous organic solvent include aqueous lower alcohols such as aqueous ethanol, and in this case, the water content may be, for example, 0 to 10 v / v%, 10 to 40 v / v%, 20 to 30 v / v%, 30 to 50 v / v%, 50 to 80 v / v%, 80 to 99.5 v / v%, etc.

[0045] Methods for obtaining dry powder include shredding or crushing the whole plant or various parts (leaves, flowers, roots, etc.) and then drying, or drying the plant and then shredding or crushing it to obtain dry powder. Alternatively, methods such as shredding or crushing the plant, fermenting or enzymatically treating it, drying it, and then crushing it to a predetermined particle size as needed can also be used.

[0046] The RALDH2 expression enhancer of the present invention is preferably taken orally or enterally, but other administration routes such as transdermal administration are not excluded. When the RALDH2 expression enhancer of the present invention is administered by various administration routes, it is preferable to apply the active ingredient of the present invention in an amount that sufficiently exhibits the RALDH2 expression-enhancing effect. The amount of the ingredients of the present invention to be added can be determined appropriately depending on their type, purpose, form, method of use, etc.

[0047] When the RALDH2 expression enhancer of the present invention is used as an oral or enteral preparation, it is preferably prepared so that the dry weight of the plant or its solvent extract is about 0.001 to 100% by weight, more preferably about 0.01 to 10% by weight, and even more preferably about 0.1 to 1.0% by weight, based on the total weight of the oral or enteral preparation. Alternatively, it may be prepared so that the concentration in the intestine is about 1 to 10,000 μg / ml, more preferably about 1 to 5,000 μg / ml, and even more preferably about 5 to 2,000 μg / ml.

[0048] Furthermore, when the RALDH2 expression enhancer of the present invention is used as an oral or enteral agent, the intake amount of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, Aloe arborescens, maca, or olive leaf, or a solvent extract thereof, per adult is preferably prepared to be, for example, about 1 mg to 50,000 mg (dry weight equivalent), more preferably about 10 mg to 5,000 mg, and even more preferably about 100 mg to 500 mg (dry weight equivalent) per day. The frequency of intake is not limited, but may be once, or, for example, once every two weeks, once a week, once every three days, once every two days, once a day, twice a day, three times a day, four times a day, etc. Furthermore, it may be taken as needed, continuously, or intermittently, for example, at intervals of several months.

[0049] The RALDH2 expression enhancer of the present invention can be incorporated into compositions for oral or enteral ingestion, such as food compositions. The RALDH2 expression enhancer and composition of the present invention can be in any form, such as powder, liquid, solid (e.g., tablet), granule, particle, paste, or gel.

[0050] The RALDH2 expression enhancer and composition of the present invention can be used in combination with any additive selected as needed. Additives such as excipients can be included. Any excipients commonly used in the desired dosage form can be used, including, for example, starches such as wheat starch, rice starch, corn starch, potato starch, dextrin, and cyclodextrin; crystalline celluloses; sugars such as lactose, glucose, sugar, reduced maltose, starch syrup, fructooligosaccharides, and emulsified oligosaccharides; and sugar alcohols such as sorbitol, erythritol, xylitol, lactitol, and mannitol. These excipients can be used alone or in combination of two or more.

[0051] Other known colorants, preservatives, thickeners, binders, disintegrants, dispersants, stabilizers, gelling agents, antioxidants, surfactants, preservatives, pH adjusters, etc. can be appropriately selected and used.

[0052] The present invention also provides a method for promoting RALDH2 expression in monocyte cells by administering, for example orally or enterally, one or more components selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaves. The present invention also provides a method for improving immune balance through enhancing RALDH2 expression in monocytes by administering, for example orally or enterally, one or more components selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaf. The method of the present invention is a cosmetic method and may not be treatment by a doctor or medical professional.

[0053] Furthermore, the present invention also provides use of one or more ingredients selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaf in the manufacture of a pharmaceutical such as an oral or enteral preparation for improving immune balance. The present invention also provides one or more ingredients selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaf, for use in a method for improving immune balance by promoting RALDH2 expression in monocyte cells, for example, by oral or enteral administration. [Example]

[0054] The present invention will now be described in more detail with reference to examples, although the present invention is not limited thereto.

[0055] Experiment 1: Sample preparation As candidate samples for RALDH2 expression enhancers, quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaves were prepared as shown in the table below.

[0056] [Table 1]

[0057] A total of 147 candidate samples were prepared, including natural and synthetic ingredients such as animal and plant extracts. Samples were adjusted to 100 μg / ml with DMSO. Plain DMSO was used as a negative control.

[0058] Experiment 2: Construction of a screening system for compounds that promote RALDH2 expression Experiment 2-1: Cultivation of human acute monocytic leukemia-derived cell line THP-1 cells THP-1 cells, a human acute monocytic leukemia cell line, were used. THP-1 cells were subcultured in RPMI 1640 medium (Nissui, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; Life Technologies, CA, USA) in Petri dishes (FALCON, Tokyo, Japan) at 37°C and 5% CO2. RPMI 1640 medium was prepared by dissolving 5.1 g of RPMI 1640 powder in 500 mL of Milli-Q water, adding 0.1 g of streptomycin sulfate (Meiji, Tokyo, Japan), 100,000 U of penicillin G potassium (Meiji), and 9 mL of 10% NaHCO3 (Wako, Osaka, Japan), and sterilizing the mixture through a 0.22 μm filter (Toyo Roshi Kaisha, Tokyo, Japan). The resulting RPMI 1640 medium was then stored at 4°C.

[0059] Experiment 2-2: Cultivation of Caco-2 cells, a human colon cancer cell line Human colon cancer-derived Caco-2 cells were used as a model of human intestinal epithelium. Caco-2 cells were subcultured in Dulbecco's Modified Eagle Medium (DMEM) (Nissui, Tokyo, Japan) containing 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies, CA, USA) in cell culture dishes (Greiner Bio-One, Tokyo, Japan) at 37°C and 5% CO2. DMEM medium was prepared by dissolving 10.0 g of DMEM powder in 1 L of Milli-Q water, supplemented with 100 U / mL penicillin (Meiji), 0.1 mg / mL streptomycin (Meiji), 2.38 g of 1 M HEPES (DOJINDO, Kumamoto, Japan), and 2.0 g of 10% NaHCO3 (Wako, Osaka, Japan), and sterilized with a 0.22 μm filter (Tokyo Roshi Kaisha, Tokyo, Japan).

[0060] Experiment 2-3: Preparation of plasmid (RALDH2-EGFP) and transfection into THP-1 cells The RALDH2-EGFP plasmid was constructed and introduced into THP-1 cells prepared in Experiment 2-1. Specifically, the human RALDH2 promoter (Forward: ATTAATAACTGACTTACCAGCCTCGT (SEQ ID NO: 1), Reverse: GCTAGCGGCGATCTCGCTGGAAGTCA (SEQ ID NO: 2)) was amplified by PCR using mouse genomic DNA as a template. The amplified fragment was cloned into pEGFP-C3 (TaKaRa, Japan), and its CMV promoter was removed by digestion with restriction enzymes AseI and NheI. The resulting plasmid was designated RALDH2p-EGFP. This plasmid was stably transfected into THP-1 cells prepared in Experiment 2-1, designated THP-1(RALDH2p-EGFP), and used to evaluate human RALDH2 promoter activity. The resulting RALDH2p-EGFP was then induced to differentiate with PMA (100 ng / ml PMA for 48 h).

[0061] Experiment 3: Test substance screening Caco-2 cells cultured in Experiment 2-2 were placed in a 24-well plate at 2.0 × 10 5 After 24 hours, 1 μL of each sample prepared in Experiment 1 was added to the THP-1 (RALDH2p-EGFP) cells prepared in Experiments 2-3, as shown in Figure 1. 100 μL of Caco-2 cell supernatant was added. 24 hours after the addition of the supernatant, the EGFP fluorescence intensity of the THP-1 cells was evaluated using an IN Cell Analyzer 2200 (Cytiva) to assess RALDH2 promoter activity.

[0062] result: The results are shown in Figure 2. As shown in Figure 2, administration of the composition of the present invention significantly increased the expression level of RALDH2 in THP-1 cells compared to the negative control (DMSO). Therefore, it can be seen that the composition of the present invention has an excellent effect of enhancing RALDH2 expression in monocytes.

Claims

1. A RALDH2 expression enhancer containing, as an active ingredient, one or more ingredients selected from the group consisting of quercetin, kaempferol, Job's tears, bee pollen, narcissus, hops, dried orange peel, cabbage, celery, okra, parsley, asparagus, angelica tree, clove, young barley leaves, Houttuynia cordata, baobab fruit, broccoli, moringa, plantain, wolfberry, aloe arborescens, maca, and olive leaves.

2. The RALDH2 expression enhancer according to claim 1, which enhances RALDH2 expression in monocytic cells via intestinal cells.

3. The RALDH2 expression enhancer according to claim 1 or 2, which enhances RALDH2 expression in monocytes when administered orally.

4. A composition comprising the RALDH2 expression enhancer according to any one of claims 1 to 3.

Images