COMPLEMENT COMPONENT C5 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Abstract

To provide eculizumab alternative therapies and combination therapies for treating subjects having a complement component C5-associated disease, e.g., paroxysmal nocturnal hemoglobinuria.SOLUTION: A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5 comprises a sense strand and an antisense strand, where the sense strand comprises at least 15 contiguous nucleotides differing by 3 or less nucleotides from a specific nucleotide sequence, and where the antisense strand comprises at least 15 contiguous nucleotides differing by 3 or less nucleotides from another specific nucleotide sequence.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 61 / 782,531, filed March 14, 2013, U.S. Provisional Patent Application No. 61 / 837,399, filed June 20, 2013, U.S. Provisional Patent Application No. 61 / 904,579, filed November 15, 2013, U.S. Provisional Patent Application No. 61 / 912,777, filed December 6, 2013, and U.S. Provisional Patent Application No. 61 / 942,367, filed February 20, 2014. The entire contents of each of the foregoing provisional patent applications are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy, created on March 10, 2014, is titled 121301-00520_SL.txt and is 734,486 bytes in size. [Background technology]

[0003] Complement was first discovered in the 1890s when it was found to assist, or "complement," bacterial killing by heat-stable antibodies present in normal serum (Non-Patent Document 1). The complement system consists of over 30 proteins present in the blood as soluble or membrane-bound proteins. Complement activation leads to a sequential cascade of enzymatic reactions known as the complement activation pathway, resulting in the formation of the potent anaphylatoxins C3a and C5a, which trigger numerous physiological responses ranging from chemoattraction to apoptosis. Initially, complement was thought to play a major role in innate immunity, where strong and rapid responses are mounted against invading pathogens. However, recently, it has become increasingly clear that complement also plays an important role in adaptive immunity, involving T and B cells that help eliminate pathogens while maintaining immunological memory to prevent reinvasion (Non-Patent Document 2; Non-Patent Document 3), and is involved in human pathological conditions (Non-Patent Document 4; Non-Patent Document 5).

[0004] Complement activation is known to occur via three distinct pathways: the alternative pathway, the classical pathway, and the lectin pathway (Figure 1), which involve proteins that exist primarily as inactive zymogens and are subsequently cleaved and activated. All pathways of complement activation result in the cleavage of the C5 molecule to generate the anaphylatoxin C5a and C5b, which subsequently form the terminal complement complex (C5b-9). C5a exerts significant pro-inflammatory activity through interactions with the classical G protein-coupled receptor C5aR (CD88) and the non-G protein-coupled receptor C5L2 (GPR77), both of which are expressed on a variety of immune and non-immune cells. C5b-9 triggers cell lysis via the formation of the membrane attack complex (MAC), and sublytic MAC and soluble C5b-9 also have many non-cytolytic immune functions. These two complement effectors, C5a and C5b-9, generated from the cleavage of C5, are key components of the complement system responsible for the propagation and / or initiation of lesions in a variety of diseases, including paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, ischemia-reperfusion injury, and neurodegenerative diseases. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Walport, M.J. (2001)N Engl J Med.344:1058 [Non-patent document 2] Dunkelberger JR and Song WC. (2010)Cell Res.20:34 [Non-patent document 3] Molina H, et al. (1996) Proc Natl Acad Sci US A.93:3357 [Non-patent document 4] Qu, H, et al. (2009) Mol Immunol. 47:185 [Non-patent document 5] Wagner, E. and Frank MM. (2010) Nat Rev Drug Discov.9:43 Summary of the Invention [Problem to be solved by the invention]

[0006] To date, the only therapy targeting the C5-C5a axis, the anti-C5 antibody eculizumab (Soliris®), is available for the treatment of complement component C5-related diseases. Eculizumab has been shown to be effective in treating paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS) and is currently being evaluated in clinical trials for additional complement component C5-related diseases. However, eculizumab therapy requires a weekly high-dose infusion followed by biweekly maintenance infusions at an annual cost of approximately $400,000. Therefore, there is a need in the art for alternative and combination therapies for subjects suffering from complement component C5-related diseases. [Means for solving the problem]

[0007] The present invention provides iRNA compositions that cause RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the C5 gene. The C5 gene can be present in a cell, e.g., a cell in a subject, such as a human. The present invention also provides methods and combination therapies for treating subjects suffering from disorders that may benefit from inhibiting or reducing expression of the C5 gene, such as diseases associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using iRNA compositions that cause RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the C5 gene to inhibit expression of the C5 gene.

[0008] Thus, in one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides.

[0009] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides that differs by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0010] In one embodiment, the sense strand and the antisense strand are selected from the group consisting of A-118320, A-118321, A-118316, A-118317, A-118332, A-118333, A-118396, A-118397, A-118386, A-118387, A-118312, A-118313, A-118324, A-118325, A-119324, A-119325, A-119332, A-1193 33, A-119328, A-119329, A-119322, A-119323, A-119324, A-119325, A-119334, A-119335, A-119330, A-119331, A-119326, A-119327, A-125167, A-125173, A-125647, A-125157, A-125173, and A-125127. In another embodiment, the sense strand and the antisense strand comprise a sequence selected from the group consisting of any of the sequences in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0011] In one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, the dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUAUAAUA (SEQ ID NO: 62) and the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUU (SEQ ID NO: 113). In one embodiment, the dsRNA agent comprises at least one modified nucleotide, as described below.

[0012] In one aspect, the invention provides a double-stranded RNAi agent for inhibiting expression of complement component C5, the double-stranded RNAi agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand are modified nucleotides, and the sense strand is conjugated to a ligand attached at its 3' end.

[0013] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand comprise a modification.

[0014] In one embodiment, substantially all of the nucleotides in the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal deoxythymine (dT) nucleotides. In another embodiment, substantially all of the nucleotides in the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal deoxythymine (dT) nucleotides. In another embodiment, the modified nucleotides are a short sequence of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus. In yet another embodiment, the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0015] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a nucleotide containing a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0016] In another embodiment, the modified nucleotides comprise a short sequence of 3' terminal deoxy-thymine (dT) nucleotides.

[0017] In one embodiment, the region of complementarity is at least 17 nucleotides in length, hi another embodiment, the region of complementarity is 19-21 nucleotides in length.

[0018] In one embodiment, the region of complementarity is 19 nucleotides in length.

[0019] In one embodiment, each strand is 30 nucleotides or less in length.

[0020] In one embodiment, at least one strand comprises a 3' overhang of at least one nucleotide, hi another embodiment, at least one strand comprises a 3' overhang of at least two nucleotides.

[0021] In one embodiment, the dsRNA agent further comprises a ligand.

[0022] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

[0023] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0024] In one embodiment, the ligand is [ka] is.

[0025] In one embodiment, the dsRNA agent is represented by the following schematic diagram: [ka] where X is O or S.

[0026] In one embodiment, X is O.

[0027] In one embodiment, the region of complementarity consists of one of the antisense sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0028] In one embodiment, the dsRNA agent is selected from the group consisting of AD-58123, AD-58111, AD-58121, AD-58116, AD-58133, AD-58099, AD-58088, AD-58642, AD-58644, AD-58641, AD-58647, AD-58645, AD-58643, AD-58646, AD-62510, AD-62643, AD-62645, AD-62646, AD-62650, and AD-62651.

[0029] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, the dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUAUAAUA (SEQ ID NO: 62) and the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUUdTdT (SEQ ID NO: 2899).

[0030] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, the dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence asasGfcAfaGfaUfAfUfuUfuuAfuAfauaL96 (SEQ ID NO: 2876) and the antisense strand comprises the nucleotide sequence usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT (SEQ ID NO: 2889).

[0031] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of complement component C5 in a cell, e.g., a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, and the antisense strand comprises a region that is complementary to a portion of an mRNA encoding C5, each strand being about 14 to about 30 nucleotides in length, and wherein the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-Nb -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0032] In one embodiment, i is 0; j is 0; i is 1; j is 1; both i and j are 0; or both i and j are 1.

[0033] In one embodiment, k is 0; l is 0; k is 1; l is 1; both k and l are 0; or both k and l are 1.

[0034] In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0035] In one embodiment, a YYY motif is present at or near the cleavage site on the sense strand.

[0036] In one embodiment, the Y'Y'Y' motif is present at positions 11, 12 and 13 of the 5'-end antisense strand.

[0037] In one embodiment, Y' is 2'-O-methyl.

[0038] In one embodiment, formula (III) is formula (IIIa): Sense:5'n p -N a -YYY-N a -n q 3' Antisense: 3'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 5'(IIIa) is expressed by

[0039] In another embodiment, formula (III) is formula (IIIb): Sense:5'n p -N a -YYY-N b -ZZZ-N a -n q 3' Antisense: 3'n p’ -N a’-Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5'(IIIb) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is expressed by

[0040] In yet another embodiment, formula (III) is formula (IIIc): Sense:5'n p -N a -XXX-N b -YYY-N a -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N a’ -n q’ 5'(IIIc) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is expressed by

[0041] In another embodiment, formula (III) is formula (IIId): Sense:5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5'(IIId) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides, and each Na and N a ' independently represent an oligonucleotide sequence containing 2 to 10 modified nucleotides) is expressed by

[0042] In one embodiment, the double-stranded region is 15 to 30 nucleotide pairs in length.

[0043] In one embodiment, the double-stranded region is 17 to 23 nucleotide pairs in length. In another embodiment, the double-stranded region is 17 to 25 nucleotide pairs in length. In another embodiment, the double-stranded region is 23 to 27 nucleotide pairs in length. In yet another embodiment, the double-stranded region is 19 to 21 nucleotide pairs in length. In another embodiment, the double-stranded region is 21 to 23 nucleotide pairs in length.

[0044] In one embodiment, each strand has between 15 and 30 nucleotides.

[0045] In one embodiment, the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.

[0046] In one embodiment, the modification on the nucleotide is a 2'-O-methyl or a 2'-fluoro modification.

[0047] In one embodiment, the ligand is one or more GalNAc derivatives attached via a bivalent or trivalent branched linker.

[0048] In one embodiment, the ligand is [ka] is.

[0049] In one embodiment, the ligand is attached to the 3' end of the sense strand.

[0050] In one embodiment, the RNAi agent is shown in the following schematic diagram: [ka] The ligand is conjugated to the ligand shown in

[0051] In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0052] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand.

[0053] In one embodiment, the strand is the antisense strand, hi another embodiment, the strand is the sense strand.

[0054] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand.

[0055] In one embodiment, the strand is the antisense strand, hi another embodiment, the strand is the sense strand.

[0056] In one embodiment, phosphorothioate or methylphosphonate internucleotide linkages are at both the 5' and 3' ends of one strand.

[0057] In one embodiment, the strand is the antisense strand.

[0058] In one embodiment, the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

[0059] In one embodiment, the Y nucleotide comprises a 2'-fluoro modification.

[0060] In one embodiment, the Y' nucleotide comprises a 2'-O-methyl modification.

[0061] In one embodiment, p'>0.

[0062] In one embodiment, p'=2.

[0063] In one embodiment, q'=0, p=0, q=0, and the p' overhanging nucleotides are complementary to the target mRNA.

[0064] In one embodiment, q'=0, p=0, q=0, and the p' overhanging nucleotides are non-complementary to the target mRNA.

[0065] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0066] In one embodiment, at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond.

[0067] In one embodiment, all n p ' is attached to the adjacent nucleotide via a phosphorothioate bond.

[0068] In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table 4, Table 18, Table 19, or Table 23. In another embodiment, the RNAi agent is selected from the group consisting of AD-58123, AD-58111, AD-58121, AD-58116, AD-58133, AD-58099, AD-58088, AD-58642, AD-58644, AD-58641, AD-58647, AD-58645, AD-58643, AD-58646, AD-62510, AD-62643, AD-62645, AD-62646, AD-62650, and AD-62651.

[0069] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of complement component C5 in a cell, the double-stranded RNAi agent comprising a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding complement component C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent being represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0070] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of proprotein convertase subtilisin kexin 9 (PCSK9) in a cell, the double-stranded RNAi agent comprising a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding complement component C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent having a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0071] In a further aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of complement component C5 in a cell, the double-stranded RNAi agent comprising a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding complement component C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent having a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0072] In yet another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of complement component C5 in a cell, the double-stranded RNAi agent comprising a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding complement component C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent having a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each Nb and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand comprises at least one phosphorothioate linkage; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0073] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting expression of complement component C5 in a cell, the double-stranded RNAi agent comprising a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding complement component C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent having a structure represented by formula (III): Sense:5'n p -N a -YYY-N a -n q 3' Antisense: 3'n p '-N a '-Y'Y'Y'-N a '-n q '5'(IIIa) (In the formula: Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; the sense strand comprises at least one phosphorothioate linkage; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0074] In one aspect, the invention provides a double-stranded RNAi agent for inhibiting expression of complement component C5, the double-stranded RNAi agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides, and wherein substantially all of the nucleotides in the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification. and a double-stranded RNAi agent is provided, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus, substantially all of the nucleotides of the antisense strand comprise modifications selected from the group consisting of 2'-O-methyl and 2'-fluoro modifications, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus, and the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0075] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides, hi another embodiment, each strand has between 19 and 30 nucleotides.

[0076] In one aspect, the invention provides a cell containing a dsRNA agent of the invention.

[0077] In one embodiment, the invention provides a vector encoding at least one strand of a dsRNA agent, wherein the dsRNA agent includes a region of complementarity to at least a portion of an mRNA encoding complement component C5, wherein the dsRNA is 30 base pairs or less in length, and wherein the dsRNA agent targets the mRNA for cleavage.

[0078] In one embodiment, the region of complementarity is at least 15 nucleotides in length. In another embodiment, the region of complementarity is 19-21 nucleotides in length. In another embodiment, each strand has 19-30 nucleotides.

[0079] In one aspect, the present invention provides a cell comprising a vector of the present invention.

[0080] In one aspect, the invention provides a pharmaceutical composition for inhibiting expression of the complement component C5 gene, comprising a dsRNA agent of the invention.

[0081] In one embodiment, the RNAi agent is administered in an unbuffered solution.

[0082] In one embodiment, the non-buffered solution is saline or water.

[0083] In one embodiment, the RNAi agent is administered with a buffer.

[0084] In one embodiment, the buffer comprises an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer, or any combination thereof.

[0085] In another embodiment, the buffer is phosphate buffered saline (PBS).

[0086] In another aspect, the invention provides a pharmaceutical composition comprising a double-stranded RNAi agent of the invention and a lipid formulation.

[0087] In one embodiment, the lipid formulation comprises LNP. In another embodiment, the lipid formulation comprises MC3.

[0088] In one aspect, the invention provides a composition comprising an antisense polynucleotide agent selected from the group consisting of a sequence listed in any one of Tables 3, 4, 5, 6, 19, 18, 20, 21, and 23.

[0089] In another aspect, the invention provides a composition comprising a sense polynucleotide agent selected from the group consisting of a sequence listed in any one of Tables 3, 4, 5, 6, 19, 18, 20, 21, and 23.

[0090] In yet another aspect, the present invention provides a modified antisense polynucleotide agent selected from the group consisting of the antisense sequences listed in any one of Tables 4, 6, 18, 19, 21, and 23.

[0091] In a further aspect, the present invention provides a modified sense polynucleotide agent selected from the group consisting of a sense sequence listed in any one of Tables 4, 6, 18, 19, 21, and 23.

[0092] In one aspect, the invention provides a method of treating a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the subject, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides.

[0093] In another aspect, the present invention provides a method for preventing at least one symptom of a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom of the subject suffering from the disorder that would benefit from reduced expression of C5, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides.

[0094] In another aspect, the invention provides a method of treating a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the subject, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, or 23.

[0095] In yet another aspect, the invention provides a method for preventing at least one symptom in a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a prophylactically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom in the subject suffering from the disorder that would benefit from reduced expression of C5, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides that differ by no more than three nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0096] In one aspect, the invention provides a method of treating a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5, comprising the step of administering to the subject a therapeutically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides, wherein substantially all of the nucleotides in the antisense strand and substantially all of the nucleotides in the sense strand are modified nucleotides, and wherein the sense strand is conjugated to one or more ligands at its 3' end.

[0097] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.

[0098] In one embodiment, the administration is subcutaneous.

[0099] In one embodiment, substantially all of the nucleotides in the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides in the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are a short sequence of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus. In yet another embodiment, the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0100] In another aspect, the invention provides a method for preventing at least one symptom of a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5, comprising the step of administering to the subject a prophylactically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides, wherein substantially all of the nucleotides in the antisense strand and substantially all of the nucleotides in the sense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand at its 3' end.

[0101] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.

[0102] In one embodiment, the administration is subcutaneous.

[0103] In one embodiment, substantially all of the nucleotides in the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides in the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are a short sequence of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus. In yet another embodiment, the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0104] In one aspect, the invention provides a method of treating a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby treating the subject, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, each strand being about 14 to about 30 nucleotides in length, and wherein the double-stranded RNAi agent has a sequence represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-Nb -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand is expressed by

[0105] In another aspect, the invention provides a method for preventing at least one symptom of a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5. The method includes administering to the subject a prophylactically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby preventing at least one symptom of the subject suffering from the disorder that would benefit from reduced expression of C5, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a sequence represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand is expressed by

[0106] In one embodiment, administration of the dsRNA to a subject results in a decrease in intravascular hemolysis, stabilization of hemoglobin levels, and / or a decrease in C5 protein accumulation.

[0107] In one embodiment, the disorder is a disease associated with complement component C5. In one embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis. disease) (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microimmune vasculitis; epidermolysis bullosa; habitual abortion; pre-eclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin-producing Escherichia coli (E. coli)-associated hemolytic uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allograft, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, Marger's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Dego's disease, antiphospholipid syndrome (APS), fulminant APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disease, peripheral vascular disease, renal vascular disease, mesenteric / intestinal vasculopathy, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-associated vasculitis, vasculitis associated with rheumatoid arthritis, immune complex-mediated vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). In yet another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0108] In one embodiment, the subject is a human.

[0109] In another embodiment, the method of the invention further comprises administering to the subject an anti-complement component C5 antibody, or antigen-binding fragment thereof.

[0110] In one embodiment, the antibody, or antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b. In another embodiment, the anti-complement component C5 antibody is eculizumab.

[0111] In another embodiment, the method of the invention further comprises administering a meningococcal vaccine to the subject.

[0112] In one embodiment, eculizumab is administered to a subject at a dose of less than about 600 mg once a week for four weeks, followed by a fifth dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0113] In another embodiment, eculizumab is administered to a subject at a dose of less than about 900 mg once a week for four weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0114] In one embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 900 mg once a week for 4 weeks, followed by a fifth dose of less than about 1200 mg about 1 week later, and then about every 2 weeks thereafter at a dose of less than about 1200 mg.

[0115] In another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0116] In another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 600 mg about one week later, and then about every two weeks thereafter at a dose of less than about 600 mg.

[0117] In yet another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0118] In one embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 300 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0119] In another embodiment, the method of the invention further comprises plasmapheresis or plasma exchange in the subject. In one such embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg or less than about 300 mg.

[0120] In a further embodiment, the method of the invention further comprises infusing the subject with plasma. In one such embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0121] In one embodiment, eculizumab is administered to a subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg, hi another embodiment, eculizumab is administered to a subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0122] In one embodiment, eculizumab is administered to a subject at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0123] In one embodiment, eculizumab is administered to the subject by intravenous infusion.

[0124] In another embodiment, eculizumab is administered to the subject subcutaneously.

[0125] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0126] In another embodiment, the dsRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg.

[0127] In one embodiment, the dsRNA agent is administered at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0128] In one embodiment, the dsRNA agent is administered to the subject once a week.In another embodiment, the dsRNA agent is administered to the subject twice a week.In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0129] In one embodiment, the dsRNA agent is administered to the subject subcutaneously.

[0130] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0131] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to decrease the level of complement component C5 in the subject, and eculizumab is thereafter administered at a dose of less than about 600 mg.

[0132] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0133] In one embodiment, eculizumab is administered at a dose of about 100 to 500 mg.

[0134] In one embodiment, the method of the present invention further comprises measuring hemoglobin and / or LDH levels in the subject.

[0135] In one embodiment, the dsRNA is conjugated to a ligand.

[0136] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0137] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0138] In one aspect, the present invention provides a method for inhibiting expression of complement component C5 in a cell, comprising the steps of contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides; and maintaining the cells produced in step (a) for a time sufficient to allow degradation of mRNA transcripts of the C5 gene, thereby inhibiting expression of the C5 gene in the cell.

[0139] In another aspect, the invention provides a method for inhibiting expression of complement component C5 in a cell. The method includes the steps of contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides that differ by no more than three nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23; and maintaining the cells produced in step (a) for a time sufficient to allow degradation of mRNA transcripts of the C5 gene, thereby inhibiting expression of the C5 gene in the cell.

[0140] In another aspect, the invention provides a method of inhibiting expression of complement component C5 in a cell, the method comprising the steps of contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand comprising a region of complementarity, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides, wherein substantially all of the nucleotides in the antisense strand and substantially all of the nucleotides in the sense strand are modified nucleotides, and the sense strand is conjugated at its 3' end to one or more ligands; and maintaining the cells produced in the first step for a time sufficient to obtain degradation of mRNA transcripts of the C5 gene, thereby inhibiting expression of the C5 gene in the cell.

[0141] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.

[0142] In one embodiment, substantially all of the nucleotides in the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides in the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are a short sequence of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus. In yet another embodiment, the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0143] In yet another aspect, the invention provides a method for inhibiting expression of complement component C5 in a cell, the method comprising contacting the cell with a dsRNA agent comprising a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand and maintaining the cells produced in step (a) for a time sufficient to obtain degradation of mRNA transcripts of the C5 gene, thereby inhibiting expression of the C5 gene in the cells.

[0144] In one embodiment, the cell is in a subject.

[0145] In one embodiment, the subject is a human.

[0146] In one embodiment, the human subject is suffering from a disease associated with complement component C5.

[0147] In one embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., Age-related macular degeneration (AMD); Hemolysis, Elevated Liver Enzymes, and Low Platelets (HELLP) syndrome; Thrombotic Thrombocytopenic Purpura (TTP); Spontaneous Abortion; Microimmune Vasculitis; Epidermolysis Bullosa; Habitual Abortion; Preeclampsia, Traumatic Brain Injury, Myasthenia Gravis, Cold Agglutinin Disease, Dermatomyositis, Bullous Pemphigoid, Shiga Toxin-Producing Escherichia coli (E. coli)-Associated Hemolytic Uremic Syndrome, C3 Nephropathy, Antineutrophil Cytoplasmic Antibody-Associated Vasculitis, Humoral and Vascular Transplant Rejection, Graft dysfunction, myocardial infarction, allograft, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response, sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Dego's disease, antiphospholipid syndrome (APS), fulminant APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disease, peripheral blood In another embodiment, the disease associated with complement component C5 is selected from the group consisting of vascular disease, renal vascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-associated vasculitis, vasculitis associated with rheumatoid arthritis, immune complex-mediated vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). In another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0148] In one embodiment, the method further comprises contacting the cell with an anti-complement component C5 antibody, or an antigen-binding fragment thereof.

[0149] In one embodiment, the antibody, or antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b.

[0150] In one embodiment, the anti-complement component C5 antibody, or antigen-binding fragment thereof, is eculizumab.

[0151] In one embodiment, the method further comprises contacting the cells with a meningococcal vaccine.

[0152] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg once a week for four weeks, followed by a fifth dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0153] In another embodiment, the cells are contacted with eculizumab at a dose of less than about 900 mg once a week for four weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0154] In another embodiment, the cells are contacted with eculizumab at a dose of less than about 900 mg once a week for four weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0155] In yet another embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0156] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 600 mg about one week later, and then about every two weeks thereafter at a dose of less than about 600 mg.

[0157] In another embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0158] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 300 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0159] In one embodiment, the cell is in a subject.

[0160] In one embodiment, the method further comprises plasmapheresis or plasma exchange in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0161] In one embodiment, the method of the invention further comprises plasma infusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0162] In one embodiment, the cells are contacted with eculizumab at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0163] In another embodiment, the cells are contacted with eculizumab at a dose of about 5 mg / kg to about 15 mg / kg.

[0164] In one embodiment, the cells are contacted with eculizumab at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0165] In one embodiment, eculizumab is administered to the subject by intravenous infusion. In another embodiment, eculizumab is administered to the subject subcutaneously.

[0166] In one embodiment, the cells are contacted with the dsRNA agent at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0167] In another embodiment, the cells are contacted with the dsRNA agent at a dose of about 10 mg / kg to about 30 mg / kg.

[0168] In one embodiment, the cells are contacted with the dsRNA agent at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0169] In one embodiment, cells are contacted with dsRNA agent once a week.In another embodiment, dsRNA agent is administered to subject twice a week.In another embodiment, cells are contacted with dsRNA agent twice a month.

[0170] In one embodiment, the dsRNA agent is administered to the subject subcutaneously.

[0171] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0172] In one embodiment, the cells are contacted with the dsRNA agent and eculizumab simultaneously.

[0173] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to decrease the level of complement component C5 in the subject, and eculizumab is thereafter administered at a dose of less than about 600 mg.

[0174] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0175] In one embodiment, eculizumab is administered at a dose of about 100 to 500 mg.

[0176] In one embodiment, the cells are first contacted with a dsRNA agent for a period of time sufficient to reduce the level of complement component C5 in the cells, and the cells are then contacted with eculizumab at a dose of less than about 600 mg.

[0177] In one embodiment, the level of complement component C5 in the cells is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0178] In one embodiment, the cells are contacted with eculizumab at a dose of about 100 to 500 mg.

[0179] In one aspect, the present invention provides a method for inhibiting expression of C5 in a subject, the method comprising administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting expression of C5 in the subject, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides.

[0180] In another aspect, the invention provides a method for inhibiting expression of C5 in a subject, the method comprising administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting expression of C5 in the subject, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides that differs by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0181] In another aspect, the invention provides a method of inhibiting expression of complement component C5 in a subject, the method comprising administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, thereby inhibiting expression of the C5 gene in the subject, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides, wherein substantially all of the nucleotides in the antisense strand and substantially all of the nucleotides in the sense strand are modified nucleotides, and wherein the sense strand is conjugated to one or more ligands at its 3' end.

[0182] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.

[0183] In one embodiment, the administration is subcutaneous.

[0184] In one embodiment, substantially all of the nucleotides in the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides in the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are a short sequence of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus. In yet another embodiment, the sense strand is conjugated at the 3'-terminus to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker.

[0185] In another aspect, the invention provides a method for inhibiting expression of C5 in a subject, the method comprising the step of administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby inhibiting expression of C5 in the subject, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand is expressed by

[0186] In one embodiment, the method further comprises administering to the subject an anti-complement component C5 antibody, or antigen-binding fragment thereof.

[0187] In one embodiment, the anti-complement component C5 antibody, or antigen-binding fragment thereof, is eculizumab.

[0188] In one embodiment, the antibody, or antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b.

[0189] In one embodiment, the method of the invention further comprises administering a meningococcal vaccine to the subject.

[0190] In one embodiment, eculizumab is administered to a subject at a dose of less than about 600 mg once a week for four weeks, followed by a fifth dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0191] In another embodiment, eculizumab is administered to a subject at a dose of less than about 900 mg once a week for four weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0192] In one embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 900 mg once a week for 4 weeks, followed by a fifth dose of less than about 1200 mg about 1 week later, and then about every 2 weeks thereafter at a dose of less than about 1200 mg.

[0193] In another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 900 mg about one week later, and then about every two weeks thereafter at a dose of less than about 900 mg.

[0194] In one embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for two weeks, followed by a third dose of less than about 600 mg about one week later, and then about every two weeks thereafter at a dose of less than about 600 mg.

[0195] In another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 600 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0196] In yet another embodiment, the subject is under 18 years of age and eculizumab is administered to the subject at a dose of less than about 300 mg once a week for one week, followed by a second dose of less than about 300 mg about one week later, and then about every two weeks thereafter at a dose of less than about 300 mg.

[0197] In one embodiment, the method further comprises plasmapheresis or plasma exchange in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0198] In one embodiment, the method further comprises plasma infusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0199] In one embodiment, eculizumab is administered to a subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg, hi another embodiment, eculizumab is administered to a subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0200] In another embodiment, eculizumab is administered to the subject at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 30 mg / kg.

[0201] In one embodiment, eculizumab is administered to the subject by intravenous infusion. In another embodiment, eculizumab is administered to the subject subcutaneously.

[0202] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0203] In one embodiment, the dsRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg. In another embodiment, the dsRNA agent is administered at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0204] In one embodiment, the dsRNA agent is administered to the subject once a week.In another embodiment, the dsRNA agent is administered to the subject twice a week.In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0205] In one embodiment, the dsRNA agent is administered to the subject subcutaneously.

[0206] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0207] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to decrease the level of complement component C5 in the subject, and eculizumab is thereafter administered at a dose of less than about 600 mg.

[0208] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0209] In one embodiment, eculizumab is administered at a dose of about 100 to 500 mg.

[0210] In one embodiment, the dsRNA agent is conjugated to a ligand.

[0211] In one embodiment, the ligand is conjugated to the 3' of the sense strand of the dsRNA agent.

[0212] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. [Brief explanation of the drawings]

[0213] [Figure 1] FIG. 1 is a schematic diagram of the three complement pathways: the alternative pathway, the classical pathway, and the lectin pathway. [Figure 2] 1 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice after a single 10 mg / kg dose of the indicated iRNA. [Figure 3] 1 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice after a single 10 mg / kg dose of the indicated iRNA. [Figure 4] 1 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice 48 hours after a single 10 mg / kg dose of the indicated iRNA. [Figure 5] Figure 5A is a graph showing the percentage of hemolysis remaining in rats on days 4 and 7 after a single subcutaneous dose of 2.5 mg / kg, 10 mg / kg, or 25 mg / kg of AD-58642. Figure 5B is a Western blot showing the amount of complement component C5 remaining in rats on day 7 after a single subcutaneous dose of 2.5 mg / kg, 10 mg / kg, or 25 mg / kg of AD-58642. [Figure 6] 1 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice 5 days after a single dose of 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg of AD-58642. [Figure 7] 1 is a graph showing the percentage of hemolysis remaining in C57BL / 6 mice on day 5 after a single dose of 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg of AD-58642. [Figure 8]1 is a Western blot showing the amount of complement component C5 remaining in C57BL / 6 mice on day 5 after a single dose of 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg of AD-58642. [Figure 9] 1 is a graph showing the amount of complement component C5 protein remaining in mouse serum on days 5 and 9 after a single dose of 0.625 mg / kg, 1.25 mg / kg, 2.5 mg / kg, 5.0 mg / kg, or 10 mg / kg of AD-58641. The lower limit of quantitation (LLOQ) of the assay is indicated by the dashed line. [Figure 10] 1 is a graph showing the amount of complement component C5 protein remaining in mouse serum on day 8 after administration of 0.625 mg / kg, 1.25 mg / kg, or 2.5 mg / kg of AD-58641 on days 0, 1, 2, and 3. The lower limit of quantitation (LLOQ) of the assay is indicated by the dashed line. [Figure 11] Figure 11A shows the efficacy and cumulative effect of repeated dosing of compound AD-58641 in rats. Figure 11A is a graph showing the hemolytic activity remaining in rat serum on days 0, 4, 7, 11, 14, 18, 25, and 32 after repeated dosing at 2.5 mg / kg / dose or 5.0 mg / kg / dose q2w x 3 (twice weekly for 3 weeks). Figure 11B is a Western blot showing the amount of complement component C5 protein remaining in the animal serum. [Figure 12] 1 is a graph showing the amount of complement component C5 protein in cynomolgus macaque serum at various time points before, during, and after two subcutaneous doses of AD-58641 at 2.5 mg / kg or 5 mg / kg every third day for eight doses. C5 protein levels were normalized to the mean of three pre-dose samples. [Figure 13]1 is a graph showing the percentage of hemolysis remaining in cynomolgus macaque serum at various time points before, during, and after two subcutaneous doses of AD-58641 at 2.5 mg / kg or 5 mg / kg every three days for eight doses. Percent hemolysis was calculated relative to maximum hemolysis and background hemolysis in control samples. [Figure 14] Graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on day 5 after a single 1 mg / kg dose of the indicated iRNA. [Figure 15] Graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on day 5 after a single 0.25 mg / kg, 0.5 mg / kg, 1.0 mg / kg, or 2.0 mg / kg dose of the indicated iRNA. [Figure 16] Graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on days 6, 13, 20, 27, and 34 after a single 1 mg / kg dose of the indicated iRNA. [Figure 17] 1 is a graph showing the percentage of hemolysis remaining in the serum of rats at various time points following administration of a 5 mg / kg dose of the indicated compound on days 0, 4, and 7. [Figure 18A] The nucleotide sequence of human (Homo sapiens) complement component 5 (C5) (SEQ ID NO: 1) is shown. [Figure 18B] 1 shows the nucleotide sequence of rhesus monkey (Macaca mulatta) complement component 5 (C5) (SEQ ID NO: 2). [Figure 18C] The nucleotide sequence of Mus musculus complement component 5 (C5) (SEQ ID NO: 3) is shown. [Figure 18D] 1 shows the nucleotide sequence of Rattus norvegicus complement component 5 (C5) (SEQ ID NO: 4). [Figure 18E] The reverse complement of SEQ ID NO: 1 (SEQ ID NO: 5) is shown. [Figure 18F] The reverse complement of SEQ ID NO:2 (SEQ ID NO:6) is shown. [Figure 18G] The reverse complement of SEQ ID NO: 3 (SEQ ID NO: 7) is shown. [Figure 18H] The reverse complement of SEQ ID NO:4 (SEQ ID NO:8) is shown. DETAILED DESCRIPTION OF THE INVENTION

[0214] The present invention provides iRNA agents that cause RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the complement component C5 gene.

[0215] The iRNA of the present invention may be about 30 nucleotides in length or less, for example, 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 26, 19 to 25, 19 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 26, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 26, 19 to 25, 19 to 26, 19 to 26, 19 to 26, 19 to 27, 19 to 28, 19 to 29 The iRNAs comprise an RNA strand (antisense strand) having a region of 9-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which is substantially complementary to at least a portion of the mRNA transcript of the C5 gene. The use of these iRNAs enables targeted degradation of the C5 gene mRNA in mammals. In particular, very low doses of C5 iRNA can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of C5 gene expression. The present inventors have demonstrated that iRNAs targeting C5 can mediate RNAi in vitro and in vivo, resulting in significant inhibition of C5 gene expression. Thus, methods and compositions comprising these iRNAs are useful for treating subjects who may benefit from reduced C5 protein levels and / or activity, such as those suffering from diseases associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH).

[0216] The present invention also provides methods and combination therapies for treating subjects suffering from disorders that may benefit from inhibiting or reducing expression of the complement component C5 gene, e.g., diseases associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using iRNA compositions that cause RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the C5 gene.

[0217] The present invention also provides a method for preventing at least one symptom, e.g., hemolysis, in a subject suffering from a disorder that may benefit from inhibiting or reducing expression of the C5 gene, e.g., a disease associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). The present invention further provides an iRNA composition that causes RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the complement component C5 gene. The C5 gene can be located in a cell, e.g., a cell within a subject, such as a human.

[0218] Combination therapies of the invention involve administering an RNAi agent of the invention and an additional therapeutic agent, such as an anti-complement component C5 antibody, or antigen-binding fragment thereof, e.g., eculizumab, to a subject suffering from a disease associated with complement component C5. Combination therapies of the invention use an iRNA agent of the invention to target C5 mRNA, thereby reducing C5 levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) and thus reducing the therapeutically (or prophylactically) effective amount of eculizumab required to treat the subject, thereby reducing the cost of treatment and allowing for easier and more convenient methods of administering eculizumab, such as subcutaneous administration.

[0219] The following detailed description discloses methods for making and using compositions containing iRNA to inhibit expression of the C5 gene, as well as compositions, uses, and methods for treating subjects suffering from diseases and disorders that may benefit from the inhibition and / or reduction of expression of this gene.

[0220] I. Definition So that the present invention may be more readily understood, several terms are first defined. Furthermore, it should be noted that whenever a value or range of values ​​for a variable is recited, all values ​​and ranges intermediate to the recited values ​​are also intended to be part of the invention.

[0221] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0222] The term "including" is used herein to mean, and is used synonymously with, the phrase "including but not limited to."

[0223] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0224] As used herein, "complement component C5," which is used interchangeably with the term "C5," refers to a gene and polypeptide known in the art that is also known as CPAMD4, C3 and PZP-like α-2-macroglobulin domain-containing protein, anaphylatoxin C5a analog, hemolytic complement (Hc), and complement C5. The sequence of human C5 mRNA transcripts can be found, for example, in GenBank Accession No. GI:38016946 (NM_001735.2; SEQ ID NO:1). The sequence of rhesus monkey C5 mRNA can be found, for example, in GenBank Accession No. GI:297270262 (XM_001095750.2; SEQ ID NO:2). The sequence of mouse C5 mRNA can be found, for example, in GenBank Accession No. GI:291575171 (NM_010406.2; SEQ ID NO:3). The sequence of rat C5 mRNA can be found, for example, in GenBank Accession No. GI:392346248 (XM_345342.4; SEQ ID NO: 4). Further examples of C5 mRNA sequences are readily available using public databases, such as GenBank.

[0225] As used herein, the term "C5" also refers to variations in the natural DNA sequence of the C5 gene, such as single nucleotide polymorphisms in the C5 gene. Many SNPs in the C5 gene have been identified and can be found, for example, in NCBI dbSNP (see, for example, ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs in the C5 gene are found in NCBI dbSNP accession numbers rs121909588 and rs121909587.

[0226] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed upon transcription of the C5 gene, including mRNA that is the product of RNA processing of a primary transcript. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed upon transcription of the C5 gene.

[0227] The target sequence can be about 9 to 36 nucleotides in length, for example, about 15 to 30 nucleotides in length. For example, the target sequence can be about 15 to 30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 1 It can be 9-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also considered part of the invention.

[0228] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides represented by a sequence given using standard nucleotide nomenclature.

[0229] "G," "C," "A," and "U" generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides or surrogate replacement moieties, as described in more detail below (see, for example, Table 2). Those skilled in the art will appreciate that guanine, cytosine, adenine, and uracil may be substituted by other moieties without significantly changing the base pairing properties of oligonucleotides containing nucleotides with such replacement moieties. For example, but not limited to, a nucleotide containing inosine as its base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine may be substituted, for example, by a nucleotide containing inosine in the nucleotide sequence of a dsRNA characterized in the present invention. In another example, adenine and cytosine anywhere in an oligonucleotide can be substituted with guanine and uracil, respectively, to form a GU wobble base pair with the target mRNA. Sequences containing such substitutions are suitable for the compositions and methods featured in the present invention.

[0230] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," as used interchangeably herein, refer to an agent that contains RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway, as those terms are defined herein. iRNA directs sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates (e.g., inhibits) the expression of C5 in cells, e.g., cells in a subject, such as a mammalian subject.

[0231] In one embodiment, the RNAi agent of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, such as a C5 target mRNA sequence, and induces cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is degraded into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). Then, siRNA is incorporated into RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing complementary antisense strands to guide target recognition (Nykanen, et al., (2001) Cell 107:309). When bound to the appropriate target mRNA, one or more endonucleases in RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Here, in one aspect, the present invention relates to a single-stranded RNA (siRNA) that is produced in cells and promotes the formation of a RISC complex that leads to the silencing of target gene, i.e., C5 gene. Therefore, the term "siRNA" is also used herein to refer to the above-mentioned RNAi.

[0232] In another embodiment, the RNAi agent can be a single-stranded siRNA introduced into a cell or organism to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as single-stranded siRNAs chemically modified as described herein or by the methods described in Lima et al., (2012) Cell 150;:883-894.

[0233] In another embodiment, the "iRNA" for use in the compositions, uses, and methods of the present invention is double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, which are shown to have "sense" and "antisense" orientations relative to the target RNA, i.e., the C5 gene. In certain embodiments of the present invention, the double-stranded RNA (dsRNA) causes degradation of the target RNA, e.g., mRNA, by a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0234] Generally, the majority of the nucleotides in each strand of dsRNA molecule are ribonucleotides; however, as described in detail herein, each or both strands can also contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides.Furthermore, as used herein, " RNAi agent " can also contain ribonucleotides with chemical modifications; RNAi agent can contain substantial modifications in multiple nucleotides.Such modifications can include any type of modification disclosed herein or known in the art.Any such modification when used in siRNA type molecules is encompassed by " RNAi agent " for the purpose of this specification and claims.

[0235] The double-stranded region can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can range from about 9 to 36 base pairs in length, e.g., about 15 to 30 base pairs in length, e.g., about 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27 , 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26 The nucleic acid sequence may be about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of the invention.

[0236] The two strands forming the double-stranded structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. When the two strands are part of one larger molecule and are therefore connected by a continuous chain of nucleotides between the 3' end of one strand and the 5' end of the other strand that form the double-stranded structure, the connected RNA strands are called "hairpin loops." A hairpin loop may contain at least one unpaired nucleotide. In some embodiments, a hairpin loop may contain at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 23, or more unpaired nucleotides.

[0237] When the two substantially complementary strands of dsRNA are composed of separate RNA molecules, these molecules can be covalently linked, but they do not have to be.When the two strands are covalently linked by means other than a continuous chain of nucleotides between the 3'-end of one strand and the 5'-end of the other strand that form a double-stranded structure, the linked structure is called a "linker".The RNA strands can have the same or different number of nucleotides.The maximum number of base pairs is the number of nucleotides of the shortest strand of dsRNA minus the overhang that exists in the double strand.In addition to the double-stranded structure, the RNAi agent can include one or more nucleotide overhangs.

[0238] In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, such as a C5 target mRNA sequence, and induces cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is degraded into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNA is then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

[0239] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide protruding from the double-stranded structure of an iRNA, such as a dsRNA. For example, a nucleotide overhang exists when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa. A dsRNA may contain an overhang of at least one nucleotide; alternatively, the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. A nucleotide overhang may comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang may be in the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhanging nucleotide may be present at the 5'-end, the 3'-end, or both ends of either the antisense strand or the sense strand of a dsRNA.

[0240] In one embodiment, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3'-end and / or 5'-end. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3'-end and / or 5'-end. In another embodiment, one or more of the nucleotides in the overhang are substituted with a nucleoside thiophosphate.

[0241] "Blunt" or "blunt-ended" means that there are no unpaired nucleotides at the relevant end of a double-stranded RNAi agent, i.e., there are no nucleotide overhangs. A "blunt-ended" RNAi agent is a dsRNA that is double-stranded throughout its entire length, i.e., there are no nucleotide overhangs at either end of the molecule. The RNAi agents of the present invention include RNAi agents that have a nucleotide overhang at one end (i.e., an agent with one overhang and one blunt end) or RNAi agents that have nucleotide overhangs at both ends.

[0242] The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, that includes a region that is substantially complementary to a target sequence, e.g., C5 mRNA. As used herein, the term "region of complementarity," as defined herein, refers to a region of the antisense strand that is substantially complementary to a sequence, e.g., a target sequence, e.g., a C5 nucleotide sequence. When the region of complementarity is not perfectly complementary to the target sequence, mismatches can occur in internal or terminal regions of the molecule. Generally, most tolerated mismatches occur in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends of the iRNA.

[0243] The term "sense strand," or "passenger strand," as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand, as those terms are defined herein.

[0244] As used herein, the term "cleavage region" refers to a region located immediately adjacent to the cleavage site. The cleavage site is the site in the target where cleavage occurs. In some embodiments, the cleavage region comprises three bases immediately adjacent to the cleavage site on either side of the cleavage site. In some embodiments, the cleavage region comprises two bases immediately adjacent to the cleavage site on either side of the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12, and 13.

[0245] As used herein, unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize to an oligonucleotide or polynucleotide comprising the second nucleotide sequence and form a double-stranded structure under defined conditions, as understood by those of skill in the art. Such conditions may be, for example, stringent conditions, where stringent conditions may include 400 mM NaCl, 40 mM PIPES (pH 6.4), 1 mM EDTA, at 50°C or 70°C for 12-16 hours, followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual," Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions that may occur inside an organism, may be applied. Those skilled in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the ultimate use of the hybridized nucleotides.

[0246] A complementary sequence in an iRNA, e.g., a dsRNA, described herein includes base pairing across the entire length of one or both nucleotide sequences of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence. Such sequences may be referred to herein as "fully complementary" to each other. However, when a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences may be perfectly complementary, or they may form one or more, but generally no more than five, four, three, or two mismatched base pairs, upon hybridization to a duplex of up to 30 base pairs while retaining the ability to hybridize under conditions optimal for their ultimate application, e.g., inhibiting gene expression via the RISC pathway. However, if two oligonucleotides are designed to form one or more single-stranded overhangs after hybridization, such overhangs shall not be considered mismatches in determining complementarity. For example, for purposes described herein, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length may be referred to as "fully complementary" if the longer oligonucleotide comprises a 21 nucleotide sequence that is perfectly complementary to the shorter oligonucleotide.

[0247] As used herein, "complementary" sequences can also include, or be formed entirely of, non-Watson-Crick base pairs and / or base pairs formed from unnatural and modified nucleotides, so long as the above requirements related to their ability to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogsteen base pairs.

[0248] The terms "complementary," "fully complementary," and "substantially complementary" herein may be used in reference to matching bases between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as understood in the context of their use.

[0249] As used herein, a polynucleotide "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding PCSK9), including the 5' UTR, open reading frame (ORF), or 3' UTR. For example, a polynucleotide is complementary to at least a portion of a PCSK9 mRNA if its sequence is substantially complementary to a contiguous portion of an mRNA encoding PCSK9.

[0250] Generally, the majority of the nucleotides in each strand are ribonucleotides; however, as described in detail herein, each or both strands may also contain one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides. Furthermore, an "iRNA" may contain ribonucleotides having chemical modifications. Such modifications may include any type of modification disclosed herein or known in the art. Any such modifications when used in an iRNA molecule are encompassed by "iRNA" for purposes of this specification and claims.

[0251] In one embodiment of the present invention, the agent for use in the methods and compositions of the present invention is a single-stranded antisense RNA molecule that inhibits a target mRNA via an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to a sequence in the target mRNA. Single-stranded antisense oligonucleotides can inhibit translation stoichiometrically by base pairing to the mRNA and physically interfering with the translation machinery (see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355). The single-stranded antisense RNA molecule can be about 15 to about 30 nucleotides in length and have a sequence complementary to the target sequence. For example, the single-stranded antisense RNA molecule can comprise a sequence that is at least about 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from any one of the antisense sequences described herein.

[0252] The term "lipid nanoparticle" or "LNP" refers to a vesicle comprising a lipid layer that encapsulates a pharmaceutically effective molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid into which the iRNA is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0253] As used herein, a "subject" is an animal such as a mammal, including a primate (such as a human or a non-human primate, e.g., a monkey or chimpanzee), a non-primate (such as a cow, pig, camel, llama, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, mouse, horse, and whale), or a bird (e.g., a duck or goose). In one embodiment, the subject is a human, such as a human being treated or evaluated for a disease, disorder, or condition that would benefit from reduced expression of C5 as described herein; a human being at risk for a disease, disorder, or condition that would benefit from reduced expression of C5; a human suffering from a disease, disorder, or condition that would benefit from reduced expression of C5; and / or a human being being treated for a disease, disorder, or condition that would benefit from reduced expression of C5.

[0254] As used herein, the terms "treat" or "treatment" refer to beneficial or desired results, including, but not limited to, alleviating or ameliorating one or more symptoms associated with unwanted complement pathway activation (e.g., hemolysis and / or chronic inflammation); reducing the degree of unwanted complement pathway activation; stabilizing (i.e., not worsening) the state of chronic inflammation and / or hemolysis; and improving or alleviating unwanted complement pathway activation (e.g., chronic inflammation and / or hemolysis), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0255] The term "reducing" in the context of complement component C5 or a disease marker or symptom in a subject refers to a statistically significant decrease in such levels, which can be, for example, by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more, preferably to a level considered to be within the normal range for individuals without such disorder.

[0256] As used herein, "prevention" or "preventing," when used in connection with a disease, disorder, or condition that may benefit from reduced expression of the C5 gene, refers to a reduction in the likelihood that a subject will develop symptoms associated with such disease, disorder, or condition, e.g., symptoms of undesired complement activation, such as chronic inflammation, hemolysis, and / or thrombosis. The likelihood of developing thrombosis is reduced, for example, when an individual with one or more risk factors for thrombosis either does not develop thrombosis or develops less severe thrombosis than a population with the same risk factors who does not receive the treatment described herein. A failure to develop a disease, disorder, or condition, or a reduction in the occurrence of symptoms associated with such a disease, disorder, or condition (e.g., by at least about 10% on a clinically recognized measure of the disease or disorder), or a delayed onset of symptoms (e.g., by only days, weeks, months, or years) is considered effective prevention.

[0257] As used herein, the term "complement component C5-associated disease" refers to a disease or disorder caused by or associated with complement activation. Such diseases are typically associated with inflammation and / or immune system activation, such as membrane attack complex lysis, anaphylaxis, and / or hemolysis. Non-limiting examples of complement component C5-associated diseases include paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); and multifocal motor neuropathy. (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microimmune vasculitis; epidermolysis bullosa; habitual abortion; preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin-producing Escherichia coli (E.coli), C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatosis with polyangiitis (formerly known as Wegener's granulomatosis), Churg-Strauss syndrome, and microscopic polyangiitis), humoral and vascular transplant rejection, graft dysfunction, myocardial infarction (e.g., tissue damage and ischemia in myocardial infarction), allogeneic transplant, sepsis (e.g., poor outcomes in sepsis), coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response, sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), IT P, Goodpasture's syndrome, Dego's disease, antiphospholipid syndrome (APS), fulminant APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disease, peripheral (e.g., musculoskeletal) vasculopathy, renal vasculopathy, mesenteric / intestinal vasculopathy, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-associated vasculitis, vasculitis associated with rheumatoid arthritis, immune complex-mediated vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA) (see, e.g., Holers (2008) Immunological Reviews 223:300-316; Holers and Thurman (2004) Molecular Immunology 41:147-152; U.S. Patent Application Publication No. 20070172483).

[0258] In one embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). PNH can be classic PNH or another bone marrow failure syndrome and / or myelodysplastic syndrome (MDS), e.g., PNH in the setting of cytopenia. In another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0259] II. iRNAs of the Invention The present invention provides iRNAs that inhibit expression of the complement component C5 gene. In one embodiment, the iRNA agent comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of the C5 gene in a cell, such as a cell in a subject, e.g., a mammal, such as a human, suffering from a disease associated with complement component C5, e.g., PNH. The dsRNA comprises an antisense strand having a region of complementarity that is complementary to at least a portion of an mRNA formed during expression of the C5 gene. The region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with cells expressing the C5 gene, the iRNA inhibits expression of the C5 gene (e.g., human, primate, non-primate, or avian C5 gene) by at least about 10%, as assayed, for example, by PCR or branched DNA (bDNA) methods, or by protein-based methods, such as, for example, by immunofluorescence analysis using Western blot or flow cytometry techniques.

[0260] dsRNA comprises two RNA strands, which are complementary and hybridize to form a double-stranded structure under the conditions in which dsRNA is used.One strand (antisense strand) of dsRNA comprises a complementary region that is substantially complementary to the target sequence, generally completely complementary.The target sequence can be derived from the sequence of mRNA formed during the expression of C5 gene.The other strand (sense strand) comprises a region that is complementary to the antisense strand, and the two strands hybridize to form a double-stranded structure when combined under suitable conditions.As described elsewhere herein and known in the art, the complementary sequence of dsRNA can also be included as a self-complementary region of a single nucleic acid molecule, rather than being on separate oligonucleotides.

[0261] Generally, the double-stranded structure is 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 1 21-23, 21-22, or 21-22 base pairs in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of the present invention.

[0262] Similarly, the region of complementarity to the target sequence may be 15-30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-40, 19-50, 19-60, 19-70, 19-80, 19-90, 19-100, 19-110, 19-120, 19-130, 19-140, 19-150, 19-210, 19-220, 19-230, 19-240, 19-250, 19-260, 19-270, 19-280, 19-290, 19-300, 19-310, 19-320, 19-330, 19-340, 19-350, 19-360, 19-370, 19-380, 19-410, 19-420, 19-430, 19-440, 19-450, 19-460, 19-470, 19-480, 19-510, 21-23, 21-22, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of the present invention.

[0263] In certain embodiments, the dsRNA is about 15 to about 20 nucleotides in length, or about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21 to 23 nucleotides in length can serve as substrates for Dicer. As those skilled in the art will also recognize, the region of RNA targeted for cleavage is most often a portion of a larger RNA molecule (often an mRNA molecule). Where relevant, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0264] The double-stranded region may be a primary functional portion of the dsRNA, e.g., about 9-36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-3 3, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-2 4, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 1 Those skilled in the art will also recognize that a double-stranded region of 9-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs is also a dsRNA. In one embodiment, an RNA molecule or a complex of RNA molecules having a double-stranded region of more than 30 base pairs is a dsRNA, to the extent that it is processed into a functional double-strand of, for example, 15-30 base pairs that targets a desired RNA for cleavage. Thus, those skilled in the art will recognize that, in one embodiment, an miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting expression of C5 is not generated in the target cell by cleavage of a larger dsRNA.

[0265] The dsRNA described herein may further comprise one or more single-stranded nucleotide overhangs, for example, 1, 2, 3, or 4 nucleotides. dsRNAs with at least one nucleotide overhang may have unexpectedly superior inhibitory properties compared to their blunt-ended counterparts. The nucleotide overhangs may comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhangs may be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhanging nucleotides may be present on the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand of the dsRNA.

[0266] dsRNA can be synthesized by standard methods known in the art, for example, by use of an automated DNA synthesizer (such as those commercially available from Biosearch, Applied Biosystems, Inc.), as further described below.

[0267] The iRNA compounds of the present invention can be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compounds can be prepared using solution phase or solid phase organic synthesis, or both. Organic synthesis offers the advantage that oligonucleotide strands containing unnatural or modified nucleotides can be easily prepared. The single-stranded oligonucleotides of the present invention can be prepared using solution phase or solid phase organic synthesis, or both.

[0268] In one embodiment, the dsRNA of the present invention comprises at least two nucleotide sequences, a sense sequence and an antisense sequence.The sense strand is selected from the group of sequences shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and the corresponding antisense strand of the sense strand is selected from the group of sequences shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.In this embodiment, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the sequence of mRNA produced during the expression of C5 gene. Therefore, in this embodiment, the dsRNA will comprise two oligonucleotides, wherein one oligonucleotide is represented as the sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and the second oligonucleotide is represented as the corresponding antisense strand of the sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In one embodiment, the substantially complementary sequences of the dsRNA are comprised in separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are comprised in one oligonucleotide.

[0269] Although some of the sequences in Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 are represented as modified and / or conjugated sequences, it will be understood that the RNA of the iRNA of the invention, e.g., the dsRNA of the invention, can comprise any one of the sequences set forth in Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 unmodified, unconjugated, and / or modified and / or conjugated, other than as set forth in the tables.

[0270] Those skilled in the art are well aware that dsRNAs with a double-stranded structure of about 20-23 base pairs, for example, 21 base pairs, have been found to be particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others skilled in the art have found that shorter or longer RNA double-stranded structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above embodiment, depending on the nature of the oligonucleotide sequence shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, the dsRNAs described herein may comprise at least one strand with a minimum length of 21 nucleotides. It can reasonably be expected that shorter duplexes having one of the sequences in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, minus only a few nucleotides at one or both ends, may be similarly effective compared to the above dsRNAs. Thus, dsRNAs having at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotide sequences from one of the sequences in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, whose ability to inhibit expression of the C5 gene differs from a dsRNA containing the entire sequence by no more than about 5, 10, 15, 20, 25, or 30% inhibition, are considered to be within the scope of the present invention.

[0271] Additionally, RNAs set forth in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 identify sites in the C5 transcript that are susceptible to RISC-mediated cleavage. Accordingly, the present invention also features iRNAs that target within one of these sites. As used herein, an iRNA is said to target within a specific site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that specific site. Such iRNAs will generally comprise at least about 15 contiguous nucleotides from one of the sequences set forth in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, linked to additional nucleotide sequences taken from regions adjacent to the selected sequence in the C5 gene.

[0272] Target sequences are generally approximately 15-30 nucleotides in length, although the suitability of specific sequences within this range for directing cleavage of any given target RNA varies. While the various software packages and guidelines described herein provide guidance for identifying optimal target sequences for any given gene target, an empirical approach can also be taken in which a "window" or "mask" of a given size (21 nucleotides, as a non-limiting example) is placed literally or figuratively (including, for example, in silico) over the target RNA sequence to identify sequences within a size range that could serve as target sequences. The next potential target sequence can be identified by gradually shifting the sequence "window" one nucleotide upstream or downstream of the initial target sequence position until a complete set of possible sequences has been identified for any given target size selected. This process, along with systematic synthesis and testing of identified sequences (using assays described herein or known in the art) to identify optimally functioning sequences, can identify RNA sequences that mediate the best inhibition of target gene expression when targeted with an iRNA agent. Thus, for example, while the sequences identified in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 represent effective target sequences, it is believed that further optimization of inhibitory efficiency may be achieved by gradually "moving the window" one nucleotide upstream or downstream of the given sequence to identify sequences with equivalent or better inhibitory properties.

[0273] Furthermore, for any sequence identified in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, further optimization could be achieved by systematically adding or removing nucleotides to generate longer or shorter sequences, and testing the resulting sequences by shifting the window of longer or shorter size from that point up or down the target RNA. Furthermore, coupling this approach to generating novel candidate targets with testing the efficacy of iRNAs based on those target sequences in inhibition assays known in the art and / or described herein could further improve the efficiency of inhibition. Furthermore, such optimized sequences could be adjusted, for example, by introducing modified nucleotides described herein or known in the art, adding or altering overhangs, or other modifications known in the art and / or described herein to further optimize the molecule as an expression inhibitor (e.g., increasing serum stability or circulating half-life, increasing thermostability, improving transmembrane delivery, targeting to specific locations or cell types, increasing interaction with silencing pathway enzymes, increasing release from endosomes).

[0274] The iRNAs described herein may contain one or more mismatches with the target sequence. In one embodiment, the iRNAs described herein contain three or fewer mismatches. If the antisense strand of an iRNA contains mismatches with the target sequence, it is preferable that the region of mismatch is not located in the center of the region of complementarity. If the antisense strand of an iRNA contains mismatches with the target sequence, it is preferable that the mismatches be limited to the last five nucleotides from either the 5' or 3' end of the region of complementarity. For example, for a 23-nucleotide iRNA agent, the strand complementary to a region of the C5 gene generally does not contain any mismatches within the central 13 nucleotides. Using methods described herein or known in the art, it can be determined whether an iRNA containing mismatches with the target sequence is effective in inhibiting expression of the C5 gene. Considering the effectiveness of an iRNA with mismatches in inhibiting expression of the C5 gene is important, especially when a particular region of complementarity in the C5 gene is known to have polymorphic sequence variation within the population.

[0275] III. Modified iRNAs of the Invention In one embodiment, the RNA, e.g., dsRNA, of an iRNA of the invention is unmodified, e.g., does not contain chemical modifications and / or conjugates known in the art and described herein. In another embodiment, the RNA, e.g., dsRNA, of an iRNA of the invention is chemically modified to improve stability or other beneficial properties. In certain embodiments of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. An iRNA of the invention in which "substantially all of the nucleotides are modified" is mostly, but not completely, modified and may contain no more than five, no more than four, no more than three, no more than two, or no more than one unmodified nucleotide.

[0276] Nucleic acids featured in the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. Lett. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugates, inverted linkages) or 3'-end modifications (conjugates, DNA nucleotides, inverted linkages, etc.); base modifications, such as substitution with stable bases, unstable bases, or bases that base pair with a wide range of partners, base removal (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and / or backbone modifications, including modification or substitution of phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or that do not contain natural internucleoside linkages. The RNA with modified backbone particularly includes those that do not have a phosphorus atom in the backbone.For the purpose of this specification and as sometimes referred to in the art, the modified RNA that does not have a phosphorus atom in the internucleoside backbone can also be considered as oligonucleoside.In some embodiments, the modified iRNA has a phosphorus atom in its internucleoside backbone.

[0277] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methylphosphonates, and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates; thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters; and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0278] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,32 Specification No. 1,131; Specification No. 5,399,676; Specification No. 5,405,939; Specification No. 5,453,496; Specification No. 5,455,233; Specification No. 5,466,677; Specification No. 5,476,925 Specification No. 5,519,126; Specification No. 5,536,821; Specification No. 5,541,316; Specification No. 5,550,111; Specification No. 5,563,253; Specification No. 5,571,799; Specification No. 5,587 ,361 Specification; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534, Nos. 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Reissue Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.

[0279] Modified RNA backbones that do not contain internal phosphorus atoms have backbones formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages. These include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH2 constituent moieties.

[0280] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; Nos. 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0281] In other embodiments, suitable RNA mimics are contemplated for use in iRNA, in which both the sugar and internucleoside linkages, i.e., the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic, that has been shown to have excellent hybridization properties is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0282] Certain embodiments featured in the present invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly those described in U.S. Pat. No. 5,489,677, such as --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2-- (also known as the methylene (methylimino) or MMI backbone), --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2-- (where the natural phosphodiester backbone is represented as --O--P--O--CH2--) and those described in U.S. Pat. No. 5,602,240, such as the amide backbones described in U.S. Pat. In certain embodiments, RNAs featured herein have the morpholino backbone structures described in U.S. Pat. No. 5,034,506, such as the morpholino backbone structures described in U.S. Pat.

[0283] Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein, can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It can be alkenyl and alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA comprises at the 2' position a C1 to C 10The modification may include one of the following: lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group that improves the pharmacodynamic properties of iRNA, or group that improves the pharmacokinetic properties of iRNA, and other substituents with similar properties. In certain embodiments, the modification includes 2'-methoxyethoxy (2'-O--CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, also known as 2'-DMAOE, i.e., O(CH2)2ON(CH3)2 group, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2, as described in the Examples herein below.

[0284] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the RNA of an iRNA, particularly the 3' position of the sugar on the 3'-terminal nucleotide or in a 2'-5'-linked dsRNA and the 5' position of the 5'-terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,81 Nos. 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, several of which are co-owned with the present application, the entire contents of each of which are incorporated herein by reference.

[0285] iRNAs can also include nucleobase (often simply referred to in the art as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), and 5-uracil (pseudouracil). Other synthetic and natural nucleobases include uracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine, and 3-deazaguanine and 3-deazaadenine.Further nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in Concise Encyclopedia of Polymer Science and Engineering, pp. 858-859, Kroschwitz, JL, ed. John Wiley & Sons, 1990; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T., and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), making them exemplary base substitutions, especially when combined with 2'-O-methoxyethyl sugar modifications.

[0286] Representative United States patents that teach the preparation of some of the above-mentioned modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patent Nos. 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; and 5,594,121. Nos. 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are incorporated herein by reference.

[0287] The RNA of an iRNA can also be modified to contain one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with a modified ribose moiety, which contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo structural configuration. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0288] Representative United States patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, the entire contents of each of which are incorporated herein by reference.

[0289] Potentially stable modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl 4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT (idT), and the like. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0290] A. Modified iRNAs Containing Motifs of the Invention In certain embodiments of the invention, double-stranded RNAi agents of the invention include, for example, agents having chemical modifications disclosed in U.S. Provisional Patent Application No. 61 / 561,710, filed November 18, 2011, or PCT / U.S. Patent Application Publication No. 2010 / 065691, filed November 16, 2012, the entire contents of each of which are incorporated herein by reference.

[0291] As shown herein and in U.S. Provisional Patent Application No. 61 / 561,710 or PCT Application No. PCT / US Patent Application Publication No. 2010 / 065691, better results can be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand of an RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of an RNAi agent can be completely modified. The introduction of these motifs, if present, disrupts the modification pattern of the sense strand and / or antisense strand. The RNAi agent can optionally be conjugated with a GalNAc derivative ligand, for example, on the sense strand. The resulting RNAi agent exhibits better gene silencing activity.

[0292] More specifically, it has been surprisingly discovered that when the sense and antisense strands of a double-stranded RNAi agent are fully modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the RNAi agent, the gene silencing activity of the RNAi agent is significantly improved.

[0293] Thus, the present invention provides double-stranded RNAi agents capable of inhibiting expression of a target gene (i.e., the complement component C5 (C5) gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent can be in the range of 12 to 30 nucleotides in length. For example, each strand can be 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotides in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

[0294] The sense strand and antisense strand typically form double-stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The double-stranded region of an RNAi agent can be 12 to 30 nucleotide pairs in length. For example, the double-stranded region can be 14 to 30 nucleotide pairs in length, 17 to 30 nucleotide pairs in length, 27 to 30 nucleotide pairs in length, 17 to 23 nucleotide pairs in length, 17 to 21 nucleotide pairs in length, 17 to 19 nucleotide pairs in length, 19 to 25 nucleotide pairs in length, 19 to 23 nucleotide pairs in length, 19 to 21 nucleotide pairs in length, 21 to 25 nucleotide pairs in length, or 21 to 23 nucleotide pairs in length. In another example, the double-stranded region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0295] In one embodiment, an RNAi agent can include one or more overhang regions and / or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs can be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides, 1 to 5 nucleotides, 2 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhangs can form mismatches with the target mRNA, or the overhangs can be complementary to the targeted gene sequence or can be another sequence. The first and second strands can also be joined by additional bases or other non-basic linkers, e.g., to form a hairpin.

[0296] In one embodiment, each nucleotide in the overhang region of an RNAi agent can independently be a modified or unmodified nucleotide, including a 2'-sugar modification, such as, but not limited to, 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA, or the overhang can be complementary to the targeted gene sequence, or it can be another sequence.

[0297] The 5'- or 3'-overhang on the sense strand, antisense strand, or both strands of an RNAi agent can be phosphorylated. In some embodiments, the overhang region comprises two nucleotides with a phosphorothioate between them, wherein the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 3'-overhang is present in the sense strand.

[0298] RNAi agent can have only one overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, the single-stranded overhang can be located at the 3'-end of the sense strand or the 3'-end of the antisense strand.RNAi can also have a blunt end located at the 5'-end of the antisense strand (or the 3'-end of the sense strand) or vice versa.Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end, and the 5'-end is blunt.Without wishing to be bound by theory, the asymmetric blunt end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand favors the introduction of the guide strand into the RISC process.

[0299] In one embodiment, the RNAi agent is a 19-nucleotide double-ended bluntmer, wherein the sense strand contains at least one motif of three 2'-F modifications at three consecutive nucleotides, positions 7, 8, and 9, from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end.

[0300] In another embodiment, the RNAi agent is a 20-nucleotide long blunt-ended duplex, wherein the sense strand comprises at least one motif of three 2'-F modifications at three consecutive nucleotides at positions 8, 9, and 10 from the 5' end, and the antisense strand comprises at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0301] In yet another embodiment, the RNAi agent is a blunt-ended duplex 21 nucleotides in length, wherein the sense strand comprises at least one motif of three 2'-F modifications at three consecutive nucleotides, positions 9, 10, and 11, from the 5' end, and the antisense strand comprises at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end.

[0302] In one embodiment, the RNAi agent comprises a 21-nucleotide sense strand and a 23-nucleotide antisense strand, wherein the sense strand comprises at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 9, 10, and 11 from the 5' end; and the antisense strand comprises at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, and one end of the RNAi agent is blunt, while the other end comprises two nucleotide overhangs. Preferably, the two nucleotide overhangs are at the 3' end of the antisense strand. When the two nucleotide overhangs are at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the three terminal nucleotides, two of the three nucleotides being overhanging nucleotides, and the third nucleotide being a paired nucleotide adjacent to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand. In one embodiment, all nucleotides in the sense and antisense strands of the RNAi agent, including nucleotides that are part of a motif, are modified nucleotides. In one embodiment, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example, in alternating motifs. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc3).

[0303] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25 to 30 nucleotide residues in length, and starting from the 5'-terminal nucleotide (position 1), positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36 to 66 nucleotide residues in length, and starting from the 3'-terminal nucleotide, comprises at least 8 ribonucleotides at positions paired with positions 1 to 23 of the sense strand to form a duplex; at least the 3'-terminal nucleotide of the antisense strand is not paired with the sense strand, and up to 6 consecutive 3'-terminal nucleotides are not paired with the sense strand, thereby forming a 3' single-stranded overhang of 1 to 6 nucleotides; and the 5' end of the antisense strand is 10 to 30 consecutive nucleotides that are not paired with the sense strand. The antisense strand comprises at least one ribonucleotide at the 5'-end of the sense strand, thereby forming a 10-30 nucleotide single-stranded 5' overhang; at least the 5'- and 3'-terminal nucleotides of the sense strand are base-paired with nucleotides in the antisense strand when the sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially double-stranded region between the sense and antisense strands; the antisense strand is sufficiently complementary to the target RNA along at least 19 ribonucleotides of the antisense strand length so as to reduce expression of the target gene when the double-stranded nucleic acid is introduced into a mammalian cell; the sense strand comprises at least one motif of three 2'-F modifications in three consecutive nucleotides, where at least one of the motifs is located at or near the cleavage site; and the antisense strand comprises at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at or near the cleavage site.

[0304] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a length of at least 25 and no more than 29 nucleotides, and a second strand having a length of no more than 30 nucleotides, the second strand comprising at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end; the 3' end of the first strand and the 5' end of the second strand form a blunt end, the second strand is 1 to 4 nucleotides longer than the first strand at its 3' end, the double-stranded region is at least 25 nucleotides long, the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotides of the second strand length such that the RNAi agent reduces expression of the target gene when introduced into a mammalian cell, and dicer cleavage of the RNAi agent preferentially yields siRNA comprising the 3' end of the second strand, thereby reducing expression of the target gene in a mammal. Optionally, the RNAi agent further comprises a ligand.

[0305] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications in three consecutive nucleotides, one of the motifs being at the cleavage site of the sense strand.

[0306] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications in three consecutive nucleotides, one of the motifs being at or near the cleavage site on the antisense strand.

[0307] In RNAi agents having a double-stranded region 17-23 nucleotides in length, the cleavage sites in the antisense strand are typically near positions 10, 11, and 12 from the 5' end. Thus, the three identical modification motifs can be located at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide from the 5' end of the antisense strand, or from the first paired nucleotide in the double-stranded region from the 5' end of the antisense strand. The cleavage site in the antisense strand can also vary depending on the length of the double-stranded region of the RNAi from the 5' end.

[0308] The sense strand of RNAi agent can comprise at least one motif of three identical modifications in three consecutive nucleotides at the break site of strand; antisense strand can have at least one motif of three identical modifications in three consecutive nucleotides at or near the break site of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand can be aligned so that one motif of three nucleotides in sense strand and one motif of three nucleotides in antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pairs.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.

[0309] In one embodiment, the sense strand of an RNAi agent may contain two or more motifs of three identical modifications in three consecutive nucleotides. The first motif may be located at or near the cleavage site of the strand, and the other motif may be a wing modification. The term "wing modification" herein refers to a motif located in another part of the strand, away from a motif located at or near the cleavage site of the same strand. The wing modification may be adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are directly adjacent to each other, the chemical structures of the motifs are different from each other; when the motifs are separated by one or more nucleotides, the chemical structures may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may be located at one end or on either side of the lead motif relative to the first motif at or near the cleavage site.

[0310] Like the sense strand, the antisense strand of an RNAi agent may contain two or more motifs of three identical modifications in three consecutive nucleotides, with at least one of the motifs occurring at or near the site of strand cleavage. The antisense strand may also contain one or more wing modifications in the same sequence as the wing modifications that may be present in the sense strand.

[0311] In one embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

[0312] In another embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two paired nucleotides within the double-stranded region at the 3' end, 5' end, or both ends of the strand.

[0313] When the sense and antisense strands of an RNAi agent each include at least one wing modification, the wing modifications may be located at the same end of the double-stranded region and may have an overlap of 1, 2, or 3 nucleotides.

[0314] When the sense and antisense strands of an RNAi agent each contain at least two wing modifications, the sense and antisense strands can be arranged such that two modifications from one strand are each located at one end of the double-stranded region and have an overlap of one, two, or three nucleotides; two modifications from one strand are each located at the other end of the double-stranded region and have an overlap of one, two, or three nucleotides; or two modifications from one strand are located on either side of the lead motif and have an overlap of one, two, or three nucleotides in the double-stranded region.

[0315] In one embodiment, all nucleotides in the sense and antisense strands of an RNAi agent, including nucleotides that are part of a motif, can be modified. Each nucleotide can be modified with the same or different modifications, and these modifications can include one or more changes to one or both of the non-linked phosphate oxygen and / or one or more linking phosphate oxygens; changes to components of the ribose sugar, such as the 2' hydroxyl of the ribose sugar; large-scale replacement of the phosphate moiety with a "dephosphorylation" linker; modifications or replacement of natural bases; and replacement or modification of the ribose-phosphate backbone.

[0316] Because nucleic acids are polymers of subunits, many modifications, such as modifications of bases, phosphate moieties, or non-linked Os in phosphate moieties, occur at repeated positions within the nucleic acid. In some cases, modifications can occur at all of the intended positions in the nucleic acid, but often this is not the case. For example, modifications can occur only at the 3' or 5' terminal positions, or only in terminal regions, such as at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of the chain. Modifications can occur in double-stranded regions, single-stranded regions, or both. Modifications can occur only in double-stranded regions of RNA, or only in single-stranded regions of RNA. For example, phosphorothioate modifications at non-linked O positions can occur only at one or both ends, or only in terminal regions, such as at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of the chain, or in double-stranded and single-stranded regions, especially at the ends. The 5' or both ends can be phosphorylated.

[0317] For example, it may be possible to enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide surrogates in the single-stranded overhang, e.g., the 5' or 3' overhang, or both. For example, it may be desirable to include purine nucleotides in the overhang. In certain embodiments, all or some of the bases in the 3' or 5' overhang may be modified, e.g., with the modifications described herein. Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar, e.g., deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl modifications in place of the ribosugar of the nucleobase, according to modifications known in the art, and modifications of the phosphate group, e.g., phosphorothioate modifications. The overhang need not be homologous to the target sequence.

[0318] In one embodiment, each residue in the sense strand and the antisense strand is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. A strand may contain two or more modifications. In one embodiment, each residue in the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0319] At least two different modifications are typically present in the sense and antisense strands, and the two modifications may be 2'-O-methyl or 2'-fluoro modifications, or others.

[0320] In one embodiment, N a and / or N b includes an alternating pattern of modifications. As used herein, the term "alternating motif" refers to a motif having one or more modifications, each modification occurring at alternating nucleotides in a strand. The alternating nucleotides can refer to one at every other nucleotide or one at every third nucleotide, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif could be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0321] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications at every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possibilities for modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0322] In one embodiment, the RNAi agent of the present invention comprises an alternating motif modification pattern in the sense strand that is shifted relative to the alternating motif modification pattern in the antisense strand. This shift can be such that the modification group of the nucleotide of the sense strand corresponds to a different modification group of the nucleotide of the antisense strand, or vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA duplex, the alternating motif in the sense strand can start with "ABABAB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can start with "BABABA" from 5' to 3' of the strand in the double-stranded region. As another example, the alternating motif in the sense strand can start with "AABBAABB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can start with "BBAABBAA" from 5' to 3' of the strand in the double-stranded region, thereby resulting in a complete or partial shift in the modification pattern between the sense strand and the antisense strand.

[0323] In one embodiment, the RNAi agent comprises a pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the sense strand, and this pattern has a first shift with respect to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the antisense strand, i.e., the 2'-O-methyl modified nucleotides in the sense strand form base pairs with the 2'-F modified nucleotides in the antisense strand, and vice versa. Position 1 of the sense strand may start with a 2'-F modification, and position 1 of the antisense strand may start with a 2'-O-methyl modification.

[0324] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand interrupts the original modification pattern present in the sense strand and / or antisense strand. This interruption of the modification pattern of the sense strand and / or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand unexpectedly enhances the gene silencing activity against the target gene.

[0325] In one embodiment, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modifications of the nucleotides adjacent to the motif are different from the modification of the motif. For example, a portion of a sequence containing a motif may be represented by "...N a YYYN b ...", where "Y" represents a modification of a motif of three identical modifications in three consecutive nucleotides, and "N a " and "N b " represents a modification of the nucleotide adjacent to the motif "YYY" that is different from the modification of Y, and N a and N b may be the same or different modifications. a and / or N b may or may not be present if wing modifications are present.

[0326] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may be present at any nucleotide in the sense strand, the antisense strand, or both strands, at any position in the strand. For example, the internucleotide linkage modification may be present at every nucleotide in the sense strand and / or the antisense strand; each internucleotide linkage modification may be present in an alternating pattern in the sense strand and / or the antisense strand; or the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide linkage modifications in the sense strand may be the same or different from that of the antisense strand, and the alternating pattern of internucleotide linkage modifications in the sense strand may have a shift relative to the alternating pattern of internucleotide linkage modifications in the antisense strand. In one embodiment, the double-stranded RNAi agent comprises 6 to 8 phosphorothioate internucleotide linkages. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at the 5' end or the 3' end.

[0327] In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate internucleotide bond modification in the overhang region. For example, the overhang region can comprise two nucleotides with a phosphorothioate or methylphosphonate internucleotide bond between the two nucleotides. The internucleotide bond modification can also be formed to link the overhang nucleotide with the terminal paired nucleotide in the double-stranded region. For example, at least 2, 3, 4, or all of the overhang nucleotides can be linked by phosphorothioate or methylphosphonate internucleotide bonds, and optionally, there can be additional phosphorothioate or methylphosphonate internucleotide bonds that link the overhang nucleotide with the paired nucleotide adjacent to the overhang nucleotide. For example, there can be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, two of the three nucleotides being overhang nucleotides, and the third nucleotide being the paired nucleotide adjacent to the overhang nucleotide. These terminal three nucleotides can be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and / or the 5' end of the antisense strand.

[0328] In one embodiment, the two nucleotide overhangs are at the 3'-end of the antisense strand, and there are two phosphorothioate internucleotide bonds between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is a paired nucleotide adjacent to the overhanging nucleotide. Optionally, the RNAi agent can further have two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.

[0329] In one embodiment, the RNAi agent contains mismatches with the target, mismatches within the duplex, or a combination thereof. Mismatches can occur in overhang regions or duplex regions. Base pairs can be evaluated based on their tendency to promote dissociation or melting (e.g., for the free energy of binding or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but similar or equivalent analyses can also be used). With regard to promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I = inosine). Mismatches, such as non-canonical or non-canonical pairings (described elsewhere herein), are preferred over canonical (A:T, A:U, G:C) pairings; and pairings involving universal bases are preferred over canonical pairings.

[0330] In one embodiment, the RNAi agent includes at least one of the first one, two, three, four, or five base pairs within the double-stranded region from the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and a mismatch pair, e.g., a non-canonical or non-canonical pairing or a pairing containing a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.

[0331] In one embodiment, the nucleotide at position 1 in the double-stranded region from the 5' end of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs in the double-stranded region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the double-stranded region from the 5' end of the antisense strand is an AU base pair.

[0332] In another embodiment, the nucleotide at the 3' end of the sense strand is deoxythymine (dT). In another embodiment, the nucleotide at the 3' end of the antisense strand is deoxythymine (dT). In one embodiment, there is a short sequence of deoxythymine nucleotides, e.g., two dT nucleotides, at the 3' end of the sense strand and / or antisense strand.

[0333] In one embodiment, the sense strand sequence has formula (I): 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3'(I) (In the formula: i and j are each independently 0 or 1; p and q are each independently 0 to 6; each N a independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p and n q independently represent overhanging nucleotides; wherein Nb and Y do not have the same modification; XXX, YYY and ZZZ each independently represent one motif of three identical modifications in three consecutive nucleotides. Preferably, all of YYY are 2'-F modified nucleotides.

[0334] In one embodiment, N a and / or N b contains alternating patterns of modifications.

[0335] In one embodiment, the YYY motif is located at or near the cleavage site of the sense strand. For example, if the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the YYY motif can be located at or near the cleavage site of the sense strand, counting from the first nucleotide from the 5' end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end (e.g., at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12, or 11, 12, 13).

[0336] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand may be represented by the following formula: 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib); 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id).

[0337] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0338] When the sense strand is represented by formula (Ic), N brepresents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0339] When the sense strand is represented as formula (Id), each N b independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6. Each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0340] Each of X, Y and Z can be the same or different from each other.

[0341] In other embodiments, i is 0, j is 0, and the sense strand may be represented by the formula: 5'n p -N a -YYY-N a -n q 3'(Ia).

[0342] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0343] In one embodiment, the antisense strand sequence of the RNAi has formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3'(II) (In the formula: k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each N a ' independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p ' and n q ' independently represents an overhanging nucleotide; where N b ' and Y' do not have the same modification; X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications in three consecutive nucleotides. It can be represented by:

[0344] In one embodiment, N a ' and / or N b ' includes alternating pattern modifications.

[0345] The Y'Y'Y' motif is present at or near the cleavage site of the antisense strand. For example, if the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the Y'Y'Y' motif can be present at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide from the 5' end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end. Preferably, the Y'Y'Y' motif is present at positions 11, 12, or 13.

[0346] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0347] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0348] Thus, the antisense strand can be represented by the following formula: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(IIb); 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(IIc); or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3'(IId).

[0349] When the antisense strand is represented by formula (IIb), N b ’ represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0350] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0351] When the antisense strand is represented by formula (IId), each N bEach N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6.

[0352] In other embodiments, k is 0, l is 0, and the antisense strand may be represented by the formula: 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia).

[0353] When the antisense strand is represented by formula (IIa), each N a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0354] Each of X', Y' and Z' can be the same or different from each other.

[0355] Each nucleotide in the sense strand and the antisense strand can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide in the sense strand and the antisense strand can be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' can specifically represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0356] In one embodiment, the sense strand of the RNAi agent may include a YYY motif at positions 9, 10, and 11 of the strand, counting from the first nucleotide from the 5' end if the double-stranded region is 21 nucleotides; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end; Y represents a 2'-F modification. The sense strand may further include a XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region; XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0357] In one embodiment, the antisense strand may include a Y'Y'Y' motif at positions 11, 12, and 13 of the strand, counting from the first nucleotide from the 5'-end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5'-end; Y' represents a 2'-O-methyl modification. The antisense strand may further include an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region; X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0358] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc), and (IId).

[0359] Thus, an RNAi agent for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi duplex has the formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p’ -N a ’ -(X'X'X') k -N b ’ -Y'Y'Y'-N b ’ -(Z'Z'Z') l -N a ’ -n q ’ 5' (III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ’ independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b and N b ’ independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; where: Each n may or may not be present p ',n p , n q ', and n q independently represent overhanging nucleotides; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides. is expressed by

[0360] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0361] Exemplary combinations of sense and antisense strands that form RNAi duplexes include the following formulas: 5'n p -N a -YYY-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N a ’ n q ’ 5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ n q ’ 5' (IIIb) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N a’ -n q ’ 5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a -n q ’ 5' (IIId)

[0362] When the RNAi agent is represented by formula (IIIa), each N a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0363] When the RNAi agent is represented by formula (IIIb), each N b represents an oligonucleotide sequence containing, independently, 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0364] When the RNAi agent is represented as formula (IIIc), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0365] When the RNAi agent is represented as formula (IIId), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a ’ represents an oligonucleotide sequence containing, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b and N b ’ Each of independently comprises an alternating pattern of modifications.

[0366] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) can be the same as or different from each other.

[0367] When an RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can be base-paired with one of the Y' nucleotides, alternatively, at least two of the Y nucleotides are base-paired with a corresponding Y' nucleotide; or all three of the Y nucleotides are base-paired with a corresponding Y' nucleotide.

[0368] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides, or at least two of the Z nucleotides can be base-paired with a corresponding Z' nucleotide; or all three of the Z nucleotides can be base-paired with a corresponding Z' nucleotide.

[0369] When an RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides can be base-paired with one of the X' nucleotides, alternatively, at least two of the X nucleotides are base-paired with the corresponding X' nucleotide; or all three of the X nucleotides are base-paired with the corresponding X' nucleotide.

[0370] In one embodiment, the modification on a Y nucleotide is different from the modification on a Y' nucleotide, the modification on a Z nucleotide is different from the modification on a Z' nucleotide, and / or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0371] In one embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to the adjacent nucleotide via a phosphorothioate bond. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the RNAi agent is represented by formula (IIId), N' is attached to the adjacent nucleotide via a phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker (described below). a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker.

[0372] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker.

[0373] In one embodiment, the RNAi agent is a multimer comprising at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are linked by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

[0374] In one embodiment, the RNAi agent is a multimer comprising three, four, five, six or more duplexes represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), the duplexes being linked by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

[0375] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at one or both of the 5' and 3' ends, and are optionally conjugated to a ligand. Each of the RNAi agents can target the same gene or two different genes; or each of the RNAi agents can target the same gene at two different target sites.

[0376] Various publications describe the multimeric RNAi agent that can be used in the method of the present invention.Such publications include WO2007 / 091269, US Patent No. 7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887 and WO2011 / 031520, each of which is incorporated herein by reference in its entirety.

[0377] As described in more detail below, RNAi agents that include one or more carbohydrate moieties conjugated to the RNAi agent can optimize one or more properties of the RNAi agent. Often, the carbohydrate moiety is attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.

[0378] The ligand can be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone attachment point," preferably two "backbone attachment points," and (ii) at least one "tether attachment point." As used herein, "backbone attachment point" refers to a bond available and suitable for incorporation of the carrier into the backbone of a ribonucleic acid, containing a functional group, e.g., a hydroxyl group, or generally a backbone, e.g., a phosphate, or a modified phosphate, e.g., sulfur. In certain embodiments, a "tether attachment point" (TAP) refers to a ring atom, e.g., a carbon atom or heteroatom (different from the atom providing the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety can be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier by an intervening tether. Thus, cyclic carriers often contain functional groups, such as amino groups, or generally provide bonds suitable for the incorporation or tethering of another chemical moiety, such as a ligand, to the constituent ring.

[0379] The RNAi agent may be conjugated to the ligand via a carrier, which may be a cyclic group or a cyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; preferably, the cyclic group is selected from a serinol backbone or a diethanolamine backbone.

[0380] In certain embodiments, an RNAi agent for use in the methods of the invention is an agent selected from the group of agents listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. These agents may further comprise a ligand.

[0381] IV. Ligand-Conjugated iRNA Another modification of the RNA of the iRNA of the invention involves chemically linking to the RNA one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA.Such moieties include, but are not limited to, cholesterol moieties (Letsinger et al., Proc. Natl. Acids Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Bior. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Bior. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or lipid moieties such as octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0382] In one embodiment, a ligand alters the distribution, targeting, or lifespan of an iRNA agent into which it is incorporated. In preferred embodiments, a ligand provides improved affinity for a selected target (e.g., a molecule, cell, or cell type), compartment (e.g., a cell or organ compartment), tissue, organ, or region of the body, e.g., compared to a species lacking such a ligand. Preferred ligands do not participate in pairing of the two strands in a double-stranded nucleic acid.

[0383] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids are polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.

[0384] The ligand can also include a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody that binds to a specific cell type such as a kidney cell. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide, or an RGD peptidomimetic or aptamer.

[0385] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid (cholenic acid), and the like. acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ tetraazamacrocycle conjugate), dinitrophenyl, HRP, or AP.

[0386] A ligand can be a molecule with specific affinity for a protein, e.g., a glycoprotein, or a peptide, e.g., a co-ligand, or an antibody, e.g., an antibody that binds to a particular cell type, such as a hepatocyte. Ligands can also include hormones and hormone receptors. Ligands can also include lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, or non-peptide species such as multivalent mannose, multivalent fucose, or aptamers. Ligands can be, for example, lipopolysaccharide, an activator of MAP kinase, or an activator of NF-κB.

[0387] The ligand can be a substance, e.g., a drug, that can enhance uptake of the iRNA agent into the cell, e.g., by disrupting the cellular microtubules, microfilaments, and / or intermediate filaments, e.g., by disrupting the cytoskeleton. The drug can be, e.g., taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0388] In certain embodiments, the ligands attached to the iRNAs described herein act as pharmacokinetic modulators (PK modulators). PK modulators include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing several phosphorothioate linkages are also known to bind to serum proteins. Therefore, short oligonucleotides, e.g., oligonucleotides of about 5, 10, 15, or 20 bases containing multiple phosphorothioate linkages in the backbone, are also suitable for use as ligands (e.g., PK-modulating ligands) in the present invention. Furthermore, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.

[0389] Ligand-conjugated oligonucleotides of the invention can be synthesized by using oligonucleotides bearing reactive pendant functional groups, such as those derived from the attachment of a binding molecule to an oligonucleotide (described below). The reactive oligonucleotides can be reacted directly with commercially available ligands, synthesized ligands bearing any of a variety of protecting groups, or ligands having a binding moiety attached.

[0390] The oligonucleotides used in the conjugates of the present invention can be conveniently and routinely made by the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may be used in addition or instead. It is also known to use similar techniques to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.

[0391] In the ligand-conjugated oligonucleotides and ligand molecules having sequence-specifically bound nucleosides of the present invention, the oligonucleotides and oligonucleosides can be assembled in a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already have a linking moiety, ligand-nucleotide or nucleoside conjugate precursors that already have a ligand molecule, or non-nucleoside ligand-containing building blocks.

[0392] When using a nucleotide conjugate precursor that already has a linking moiety, synthesis of the sequence-specific linked nucleoside is typically completed before the ligand molecule is reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In certain embodiments, the oligonucleotides or linked nucleosides of the invention are synthesized by automated synthesizer using phosphoramidites derived from the ligand-nucleoside conjugates in addition to commercially available standard and non-standard phosphoramidites commonly used in oligonucleotide synthesis.

[0393] A. Lipid Conjugates In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to serum protein, for example, human serum albumin (HSA). HSA-binding ligand allows the conjugate to be distributed to target tissues in the body, for example, non-renal target tissues. For example, the target tissue can be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligand can be used to (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) adjust the binding to serum protein, for example, HSA.

[0394] Lipid-based ligands can be used to inhibit, for example, control, the binding of conjugates to target tissues. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and therefore less likely to be removed from the body. Lipids or lipid-based ligands that bind less strongly to HSA can be used to target conjugates to the kidney.

[0395] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity such that the conjugate preferably distributes to non-renal tissues. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed.

[0396] In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, such that the conjugate preferably distributes to the kidney. Other moieties that target kidney cells can also be used in place of or in addition to the lipid-based ligand.

[0397] In another embodiment, the ligand is a moiety, e.g., a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful, for example, for treating disorders characterized by unwanted cell proliferation, e.g., malignant or non-malignant, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamin B, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by target cells, such as hepatocytes. Also included are HAS and low-density lipoprotein (LDL).

[0398] B. Cell-penetrating agents In another embodiment, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, it can be modified, including peptidyl mimetics, invertomers, non-peptide or pseudo-peptide bonds, and the use of D-amino acids. The helical agent is preferably an α-helical agent, which preferably has a lipophilic and lipophobic phase.

[0399] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into defined three-dimensional structures similar to natural peptides. Attachment of peptides and peptidomimetics to iRNA agents can affect the pharmacokinetic distribution of iRNAs, for example, by enhancing cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5-50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0400] The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane transport sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, which has the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 9). RFGF analogs containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 10)) can also be targeting moieties. The peptide moiety can be a "delivery" peptide capable of transporting large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 12)) have been shown to be capable of functioning as delivery peptides. Peptides or peptidomimetics can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or one-bead-one-compound (OBOC) combinatorial libraries (Lam et al., 2004). al., Nature, 354:82-84, 1991). An example of a peptide or peptidomimetic attached to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is a peptide such as an arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can have structural modifications, such as to enhance stability or direct conformational properties. Any of the structural modifications described below can be used.

[0401] The RGD peptide moiety for use in the compositions and methods of the present invention can be linear or cyclic, and can be modified, for example, glycosylated or methylated, to facilitate targeting to specific tissues. RGD-containing peptides and peptidomimetics can use D-amino acids, as well as synthetic RGD mimics. In addition to RGD, other moieties that target integrin ligands can be used. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0402] A "cell-penetrating peptide" is capable of penetrating cells, e.g., microbial cells such as bacterial or fungal cells, or mammalian cells such as human cells. Peptides that penetrate microbial cells can be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins, or bactenecins), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidin). Cell-penetrating peptides can also contain a nuclear localization signal (NLS). For example, a cell-penetrating peptide can be a bisected amphipathic peptide such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0403] C. Carbohydrate conjugates In certain embodiments of the compositions and methods of the present invention, the iRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated iRNAs are advantageous for in vivo nucleic acid delivery, as described herein, and the compositions are suitable for in vivo therapeutic uses. As used herein, "carbohydrate" refers to either a compound that is a carbohydrate itself, composed of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched, or cyclic), each with an oxygen, nitrogen, or sulfur atom attached to it; or a compound that has as part thereof a carbohydrate moiety composed of one or more monosaccharide units, each of which has at least six carbon atoms (which may be linear, branched, or cyclic), each with an oxygen, nitrogen, or sulfur atom attached to it. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Particular monosaccharides include sugars of C5 or greater (e.g., C5, C6, C7, or C8); disaccharides and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0404] In one embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention is a monosaccharide. [ka] and other N-acetylgalactosamines.

[0405] In another embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention comprises: [ka] [ka] [ka] [ka] [ka] is selected from the group consisting of:

[0406] Other exemplary carbohydrate conjugates for use in the embodiments described herein include, but are not limited to: [ka] and when one of X or Y is an oligonucleotide, the other is hydrogen.

[0407] In certain embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, including, but not limited to, a PK modulator and / or a cell-penetrating peptide.

[0408] D. Linker In certain embodiments, the conjugates or ligands described herein can be attached to the iRNA oligonucleotide using a variety of linkers, which can be cleavable or non-cleavable.

[0409] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, for example, covalently bonds the two parts of a compound. Linkers are typically a direct bond or an atom such as oxygen or sulfur, a unit such as NR, C(O), C(O)NH, SO, SO, SONH, or a group including, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkynyl, alkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclyl and alkylaryl, alkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl (wherein one or more methylenes can be interrupted or terminated by O, S, S(O), SO, N(R), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic); where R is hydrogen, acyl, aliphatic, or substituted aliphatic.In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

[0410] A cleavable linking group is one that is sufficiently stable outside a cell, but is cleaved after entering a target cell to release the two moieties held together by the linker. In preferred embodiments, the cleavable linking group is cleaved at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold or more, or at least about 100-fold faster inside the target cell or under first reference conditions (which may, for example, be selected to mimic or represent intracellular conditions) than in the subject's blood or under second reference conditions (which may, for example, be selected to mimic or represent conditions found in blood or serum).

[0411] Cleavable linking groups are sensitive to cleaving agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleaving agents are more prevalent or found at higher levels or activity inside cells than in serum or blood. Examples of such degrading agents include oxidizing or reducing enzymes present in cells or reducing agents such as mercaptans that can degrade redox-cleavable linking groups by reduction, which are selective for specific substrates or have no substrate specificity; esterases; agents that can form endosomes or acidic environments, such as agents that cause a pH of 5 or less; enzymes that can hydrolyze or degrade acid-cleavable linking groups by acting as general acids, peptidases (which may be substrate-specific), and phosphatases.

[0412] Cleavable linking groups, such as disulfide bonds, can be pH-sensitive. While the pH of human serum is 7.4, the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH, approximately 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing the cationic lipid from the ligand inside the cell or into a desired compartment of the cell.

[0413] The linker may contain a cleavable linking group that can be cleaved by a specific enzyme. The type of cleavable linking group incorporated into the linker may depend on the target cell. For example, a liver-targeting ligand may be linked to a cationic lipid via a linker containing an ester group. Because hepatocytes are rich in esterases, this linker will be cleaved more efficiently in hepatocytes than in cell types that are not rich in esterases. Other cell types that are rich in esterases include lung, renal cortex, and testicular cells.

[0414] Linkers containing peptide bonds can be used to target peptidase-rich cell types, such as hepatocytes and synoviocytes.

[0415] In general, the suitability of a candidate cleavable binding group can be evaluated by testing the ability of a degradative agent (or degradative condition) to cleave the candidate binding group. It may also be desirable to test the ability of the candidate cleavable binding group to resist cleavage in blood or upon contact with other non-target tissues. Thus, the relative susceptibility to cleavage can be determined between first and second conditions, the first selected to be indicative of cleavage within target cells, and the second selected to be indicative of cleavage in other tissues or biological fluids, such as blood or serum. This evaluation can be performed in a cell-free system, in cells, in cell culture, in organ or tissue culture, or in a whole animal. It may be useful to perform initial evaluations in cell-free or culture conditions and confirm with further evaluations in a whole animal. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0416] i. Redox-cleavable linking group In one embodiment, the cleavable linking group is a redox-cleavable linking group that is cleaved after reduction or oxidation. An example of a reductively cleavable linking group is a disulfide bond (-SS-). To determine whether a candidate cleavable linking group is a suitable "reductively cleavable linking group," or suitable for use with, for example, a particular iRNA moiety and a particular targeting agent, one may turn to the methods described herein. For example, candidates can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art, which mimic the cleavage rate that can be observed in cells, e.g., target cells. Candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, the candidate compound is cleaved at about 10% or less in blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster inside cells (or under in vitro conditions selected to mimic intracellular conditions) compared to in blood (or under in vitro conditions selected to mimic extracellular conditions). The cleavage rate of the candidate compound can be determined using standard enzyme kinetic assays under conditions selected to mimic the intracellular medium and compared to conditions selected to mimic the extracellular medium.

[0417] ii. Phosphate-based cleavable linking groups In another embodiment, the cleavable linker comprises a phosphate-based cleavable linking group that is cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that cleaves phosphate groups within a cell is an enzyme such as an intracellular phosphatase. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, -OP(S)(Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.

[0418] iii. Acid-cleavable linking groups In another embodiment, the cleavable linker comprises an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or less) or by an agent, such as an enzyme, that can act as a general acid. Within a cell, certain low-pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for the acid-cleavable linking group. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups can be represented by the general formula -C=NN-, C(O)O, or -OC(O). In a preferred embodiment, the carbon bonded to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.

[0419] iv. Ester-based linking groups In another embodiment, the cleavable linker comprises an ester-based cleavable linking group. Ester-based cleavable linking groups are cleaved by enzymes such as intracellular esterases and amylases. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable linking groups are represented by the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.

[0420] v. Peptide-Based Cleavage Groups In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. Peptide-based cleavable linking groups are cleaved by enzymes, such as intracellular peptidases and proteases. Peptide-based cleavable groups are peptide bonds formed between amino acids to give oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include amide groups (—C(O)NH—). Amide groups can be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to give peptides and proteins. Peptide-based cleaving groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give peptides and proteins, but do not include all amide functional groups. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where R and R are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.

[0421] In one embodiment, the iRNA of the present invention is conjugated to a carbohydrate via a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the present invention include, but are not limited to: [ka] [ka] and when one of X or Y is an oligonucleotide, the other is hydrogen.

[0422] In certain embodiments of the compositions and methods of the present invention, the ligand is one or more "GalNAc" (N-acetylgalactosamine) derivatives attached via a bivalent or trivalent branched linker.

[0423] In one embodiment, the dsRNA of the present invention has the structure represented by any of the formulas (XXXI) to (XXXIV): [ka] and conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of the following: During the ceremony: each occurrence of q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C independently represents 0 to 20, and the repeating units may be the same or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C each, independently at each occurrence, is absent, CO, NH, O, S, OC(O), NHC(O), CH, CHNH, or CHO; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C is independently at each occurrence absent, alkylene, or substituted alkylene, wherein one or more methylenes are selected from O, S, S(O), SO, N(R N ), C(R')=C(R"), C≡C or C(O); R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5CEach occurrence is independently absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] or heterocyclyl; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represents a ligand; i.e., each occurrence is independently a monosaccharide (e.g., GalNAc), a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, or a polysaccharide; R a is H or an amino acid side chain. Trivalent conjugated GalNAc derivatives can be used with RNAi agents to form a compound of formula (XXXV): [ka] are particularly useful for inhibiting the expression of target genes such as those of In the formula, L 5A , L 5B and L 5C represents a monosaccharide such as a GalNAc derivative.

[0424] Examples of suitable divalent and trivalent branched linking groups for conjugation to GalNAc derivatives include, but are not limited to, the structures listed above as Formulas II, VII, XI, X, and XIII.

[0425] Representative patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5, No. 486,603; No. 5,512,439; No. 5,578,718; No. 5,608,046; No. 4,587,044; No. 4,605,735; No. 4,667,025; No. 4,762,779; No. 4,789,737; 4, No. 824,941; No. 4,835,263; No. 4,876,335; No. 4,904,582; No. 4,958,013; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,082,830; 5,1 No. 12,963; No. 5,214,136; No. 5,245,022; No. 5,254,469; No. 5,258,506; No. 5,262,536; No. 5,272,250; No. 5,292,873; No. 5,317,098; 5,3 No. 71,241, No. 5,391,723; No. 5,416,203, No. 5,451,463; No. 5,510,475; No. 5,512,667; No. 5,514,785; No. 5,565,552; No. 5,567,810; 5,57 Nos. 4,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022, the entire contents of each of which are incorporated herein by reference.

[0426] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the above modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0427] A "chimeric" iRNA compound or "chimera" in the context of the present invention is an iRNA compound, preferably a dsRNA, that contains two or more chemically distinct regions, each composed of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region in which the RNA is modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to the iRNA for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. For example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Thus, activation of RNase H results in cleavage of the RNA target, thereby greatly increasing the efficiency of iRNA inhibition of gene expression. Consequently, when chimeric dsRNAs are used, comparable results can often be obtained with shorter iRNAs compared to phosphorothioate deoxydsRNAs hybridizing to the same target region. Cleavage of the RNA target can typically be detected by gel electrophoresis and, if desired, by associated nucleic acid hybridization techniques known in the art.

[0428] In some cases, the RNA of an iRNA can be modified with a non-ligand group. Several non-ligand molecules have been conjugated to iRNAs to improve their activity, cellular distribution, or cellular uptake, and procedures for such conjugation are available in the scientific literature.Such non-ligand moieties include cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923).Representative US patents that teach the preparation of such RNA conjugates are listed above. A typical conjugation protocol involves the synthesis of RNA with an amino linker at one or more positions in the sequence. The amino group is then reacted with the conjugated molecule using an appropriate coupling or activating agent. The conjugation reaction can be carried out with the RNA still attached to a solid support or after cleavage of the RNA in solution phase. Purification of the RNA conjugate by HPLC typically yields a pure conjugate.

[0429] IV. Delivery of iRNA of the Invention Delivery of an iRNA of the invention to a cell, e.g., a cell in a subject, such as a human subject (e.g., a subject in need of an iRNA agent, such as a subject suffering from a disease associated with complement component C), can be achieved in several different ways. For example, delivery can be achieved by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery can also be achieved directly by administering a composition containing an iRNA, e.g., a dsRNA, to the subject. Alternatively, in vivo delivery can be achieved indirectly by administering one or more vectors that encode and direct the expression of the iRNA. Examples of these alternatives are described further below.

[0430] Generally, any method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the iRNAs of the present invention (see, e.g., Akhtar S. and Julian R.L., (1992) Trends Cell. Biol. 2(5):139-144 and WO 94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider when delivering iRNA molecules include, for example, the biological stability of the delivered molecule, prevention of nonspecific effects, and accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, e.g., by direct injection or implantation into the tissue, or by administering the formulation locally. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may be adversely affected by or degrade the agent, and can reduce the total dose of the iRNA molecule administered. Several studies have demonstrated successful knockdown of gene products when iRNAs are administered locally. For example, intraocular delivery of VEGF dsRNA via intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injection in mice (Reich, SJ. et al., (2003) Mol. Vis. 9:210-216) have both been shown to prevent neovascularization in experimental models of age-related macular degeneration. Furthermore, direct intratumoral administration of dsRNA in mice can reduce tumor volume (Pille, J. et al., (2005) Mol. Ther. 11:267-274) and prolong the survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523).RNA interference can be delivered locally to the central nervous system by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P.H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G.T. et al. (2004) Neuroscience 129:521-528; Thakker, E.R. et al. (2004) Proc. Natl. Acad. Sci. USA 101:17270-17275; Akaneya, Y. et al. (2005) J. Neurophysiol. 93:594-602) and locally to the lung by intranasal administration (Howard, K.A. et al. (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55) have also demonstrated success. To administer iRNA systemically for disease treatment, the RNA can be modified or delivered using a drug delivery system; both methods serve to prevent rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier can also enable targeting of iRNA compositions to target tissues and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups, such as cholesterol, to improve cellular uptake and prevent degradation. For example, iRNAs against ApoB conjugated to lipophilic cholesterol moieties were administered systemically to mice, resulting in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of iRNAs to aptamers has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, J. et al., (2006) Nat. Biotechnol. 24:1005-1015).In alternative embodiments, iRNAs can be delivered using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate binding of iRNA molecules (which are negatively charged) and also improve interaction with the negatively charged cell membrane, allowing for efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can be bound to iRNAs or induced to form vesicles or micelles that encapsulate iRNAs (see, e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116). The formation of vesicles or micelles further prevents degradation of iRNAs when administered systemically. Methods for making and administering cationic iRNA complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen, D.R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U.N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A.S. et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entireties).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, D.R., et al. (2003), supra; Verma, U.N. et al. (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T.S. et al. (2006) Nature 441:111-114), cardiolipin (Chien, P.Y. et al. (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al. (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M.E. et al. (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamine (Tomalia, D. A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, iRNAs are complexed with cyclodextrins for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

[0431] A. Vector-encoded iRNA of the invention iRNAs targeting the C5 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A., et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00 / 22113; Conrad, International PCT Publication No. WO 00 / 22114; and Conrad, U.S. Patent No. 6,054,299). Expression can be transient (from a few hours to a few weeks) or sustained (from weeks to months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrating or non-integrating. Transgenes can also be constructed to allow them to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0432] The individual strands of the iRNA can be transcribed from a promoter in an expression vector. Two separate expression vectors can be co-introduced into a target cell (e.g., by transfection or infection) where two separate strands are expressed to produce, for example, dsRNA. Alternatively, each individual strand of the dsRNA can be transcribed by a promoter located on the same expression plasmid. In one embodiment, the dsRNA is expressed as an inverted repeat polynucleotide joined by a linker polynucleotide sequence to form a stem-loop structure.

[0433] iRNA expression vectors are generally DNA plasmids or viral vectors. Recombinant constructs for expressing the iRNAs described herein can be produced using expression vectors compatible with eukaryotic cells, preferably vertebrate cells. Eukaryotic expression vectors are well known in the art and are available from numerous commercial sources. Such vectors are typically provided containing convenient restriction sites for inserting the desired nucleic acid segment. Delivery of the iRNA expression vector can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells transplanted from the patient and then reintroduced into the patient, or by any other means that allows for introduction into the desired target cells.

[0434] iRNA expression plasmids can be transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdown targeting different regions of the target RNA over a period of one week or more are also contemplated by the present invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be indicated using a reporter, such as a fluorescent marker like green fluorescent protein (GFP). Stable transfection of cells ex vivo can be ensured using a marker that confers resistance to certain environmental factors (e.g., antibiotics and drugs) on the transfected cells, such as hygromycin B resistance.

[0435] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, and the like; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) orthopox, e.g., vaccinia virus vectors, or avian pox, e.g., canarypox or fowlpox, poxvirus vectors; and (j) helper-dependent or attenuated adenoviruses. Replication-deficient viruses may also be advantageous. Different vectors may or may not integrate into the cellular genome. The constructs may optionally include viral sequences for transfection. Alternatively, the constructs may be incorporated into vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant expression of iRNA generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are discussed further below.

[0436] Vectors useful for delivery of iRNA will contain sufficient regulatory elements (promoters, enhancers, etc.) for expression of the iRNA in the desired target cells or tissues. Regulatory elements can be selected to provide for either constitutive or regulatable / inducible expression.

[0437] Expression of iRNA can be precisely regulated, for example, by using inducible regulatory sequences that are sensitive to specific physiological regulators, such as blood glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Suitable inducible expression systems for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art will be able to select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.

[0438] Viral vectors containing nucleic acid sequences encoding iRNAs can be used. For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into host cell DNA. The nucleic acid sequences encoding the iRNAs are cloned into one or more vectors, which facilitate delivery of the nucleic acid to a patient. Further details about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to make them more resistant to chemotherapy. Other references demonstrating the use of retroviral vectors in gene therapy are Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are incorporated herein by reference.

[0439] Adenoviruses are also contemplated for use in delivering iRNAs of the present invention. Adenoviruses are particularly attractive vehicles for delivering genes to, for example, respiratory epithelia. Adenoviruses naturally infect respiratory epithelia, causing a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993), provide a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994), demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other examples of the use of adenovirus in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155; Mastrangeli et al. (1992), J. Clin. Invest. 91:225-234 (1993); PCT Publication WO 94 / 12649; and Wang et al., Gene Therapy 2:775-783 (1995). AV vectors suitable for expressing iRNAs featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Xia H et al. (2002), Nat. Biotech. 20:1006-1010.

[0440] Adeno-associated virus (AAV) vectors can also be used to deliver the iRNAs of the invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNAs can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. AAV vectors suitable for expressing the dsRNA featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J.Virol. 61:3096-3101; Fisher KJ et al. (1996), J.Virol, 70:520-532; Samulski R et al. (1989), J.Virol. 63:3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; International Patent Application No. WO 94 / 13788; and International Patent Application No. WO 93 / 24641, the entire disclosures of which are incorporated herein by reference.

[0441] Another viral vector suitable for delivery of the iRNA of the invention is a poxvirus, such as a vaccinia virus, e.g., an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, or an avian pox, such as fowlpox or canarypox.

[0442] The tropism of viral vectors can be modified by pseudotyping the vector with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins as needed. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to target different cells by engineering the vector to express different capsid protein serotypes. See, for example, Rabinowitz JE et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

[0443] The pharmaceutical preparation of the vector can include the vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

[0444] V. Pharmaceutical Compositions of the Invention The present invention also includes pharmaceutical compositions and formulations comprising the iRNAs of the present invention. In one embodiment, provided herein is a pharmaceutical composition containing the iRNAs described herein and a pharmaceutically acceptable carrier.

[0445] The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit-risk ratio.

[0446] As used herein, the phrase "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc, magnesium, calcium or zinc stearate, or stearic acid), or solvent encapsulating material, that is involved in carrying or transporting a compound to a subject from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject being treated. Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants such as magnesium state, sodium lauryl sulfate, and talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) cellulose derivatives such as propylene glycol. (11) glycols; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free distilled water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffers; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents such as polypeptides and amino acids; (23) serum components such as serum albumin, HDL, and LDL; and (24) other non-toxic, compatible materials used in pharmaceutical formulations.

[0447] Pharmaceutical compositions containing iRNA are useful for treating diseases or disorders associated with C5 gene expression or activity, e.g., diseases associated with complement component C5. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration via parenteral administration, e.g., subcutaneous (SC) or intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, e.g., by injection into the brain via continuous pump infusion. Pharmaceutical compositions of the invention can be administered at a dosage sufficient to inhibit C5 gene expression. Generally, suitable doses of iRNA of the invention range from about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, generally from about 1 to 50 mg per kilogram of body weight per day. For example, the dsRNA can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg per single dose.

[0448] For example, the dsRNA may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1 , 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8.8, 9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0449] In another embodiment, the dsRNA is about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, or about 20 to about 50 mg / kg , about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about About 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30mg / kg, about 5 to about 30mg / kg, about 7.5 to about 30mg / kg, about 10 to about 30mg / kg, about 15 to about 30mg / kg, about 20 to about 30mg / kg, about 20 to about 30mg / kg, about 25 to about 30mg / kg, about 0.1 to about 20m g / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also intended to be part of the present invention.

[0450] For example, dsRNA has approximately 0..01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0451] In another embodiment, the dsRNA is about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, or about 25 to about 50 mg / kg. 0mg / kg, about 30 to about 50mg / kg, about 35 to about 50mg / kg, about 40 to about 50mg / kg, about 45 to about 50mg / kg, about 0.5 to about 45mg / kg, about 0.75 to about 45mg / kg, about 1 to about 45mg / mg, about 1.5 to about 45mg / kb, about 2 to about 45mg / k g, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / kg mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 ~40mg / kg, 15~40mg / kg, 20~40mg / kg, 20~40mg / kg, 25~40mg / kg, 25~40mg / kg, 30~40mg / kg, 35~40mg / kg, 0.5~30mg / kg, 0.75~30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.It is administered at a dose of 5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg / kg to about 30 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0452] For example, for the subject, approximately 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 75, 76, 78, 79, 80, 81, 8 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6. 4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18 , 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg of iRNA may be administered, for example, subcutaneously or intravenously. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0453] In some embodiments, the subject is administered a dose of, for example, about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0. .975,1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9,2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9,3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9,4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9,5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9,6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5 A therapeutic amount of iRNA, such as a dose of about 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg, is administered subcutaneously or intravenously in multiple doses. A multiple dose regimen can include administering a therapeutic amount of iRNA daily for 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or more days.

[0454] In other embodiments, the subject is administered a dose of, for example, about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0. .975,1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9,2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9,3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9,4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9,5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9,6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5 A therapeutic amount of iRNA, such as a dose of 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg, is administered subcutaneously or intravenously in multiple doses. Multiple dose regimens can include administering a therapeutic amount of iRNA periodically, such as every other day, every third day, every fourth day, twice a week, once a week, every other week, or once a month.

[0455] The pharmaceutical composition may be administered by intravenous infusion over a period of time such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24 minutes, or about 25 minutes. Administration may be repeated periodically, for example, weekly or biweekly (i.e., every two weeks) for one month, two months, three months, four months, or more. After the initial treatment regimen, the therapeutic agent may be administered less frequently. For example, after three months of weekly or biweekly administration, administration may be repeated once a month for six months, one year, or more.

[0456] The pharmaceutical composition can be administered once daily, or the iRNA can be administered as two, three, or more subdoses at appropriate intervals throughout the day, or even via continuous infusion or delivery via sustained-release formulations. In such cases, each subdose must contain a correspondingly smaller amount of iRNA to achieve the total daily dosage. The dosage unit can also be formulated for delivery over several days, for example, using a conventional sustained-release formulation that provides sustained release of the iRNA over a period of several days. Sustained-release formulations are well known in the art and can be used with the agents of the present invention, as they are particularly useful for delivering agents to specific sites. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0457] In other embodiments, a single dose of the pharmaceutical composition can be administered prolonged, with subsequent doses administered at intervals of no more than 3, 4, or 5 days, or no more than 1, 2, 3, or 4 weeks. In some embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered weekly. In other embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered bi-monthly.

[0458] Those skilled in the art will recognize that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the overall health and / or age of the subject, and other diseases present, can influence the dosage and duration required to effectively treat a subject. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Effective dosages and in vivo half-lives for individual iRNAs encompassed by the invention can be estimated using conventional methodology or based on in vivo testing using appropriate animal models, as described elsewhere herein.

[0459] Advances in mouse genetics have generated numerous mouse models for the study of various human diseases, including disorders that may benefit from reduced expression of C5. These models can be used for in vivo testing of iRNAs and to determine therapeutically effective doses. Suitable mouse models are known in the art, including, for example, the collagen-induced arthritis mouse model (Courtenay, JS, et al. (1980) Nature 283, 666-668), myocardial ischemia (Homeister JW and Lucchesi BR (1994) Annu Rev Pharmacol Toxicol 34:17-40), the ovalbumin-induced asthma mouse model (e.g., Tomkinson A., et al. (2001). J. Immunol. 166, 5792-5800), (NZB x NZW)F1, MRL / Fas lprExamples include the (MRL / lpr) and BXSB mouse models (Theofilopoulos, AN and Kono, DH 1999. Murine lupus models: gene-specific and genome-wide studies. In Lahita RG, ed., Systemic Lupus Erythematosus, 3rd edn, p. 145. Academic Press, San Diego, CA), and the mouse aHUS model (Goicoechea de Jorge et al. (2011) The development of atypical hemolytic uremic syndrome depeds on complement C5, J Am Soc Nephrol 22:137-145).

[0460] The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be topical (e.g., via a transdermal patch), pulmonary administration, e.g., by inhalation or insufflation of powders or aerosols, such as with a nebulizer; intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous administration, e.g., via an implanted device; or intracranial administration, e.g., via intraparenchymal, intrathecal, or intraventricular administration.

[0461] The iRNA can be delivered to target a specific tissue, such as the liver (e.g., hepatocytes of the liver).

[0462] Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful. Suitable topical formulations include those in which the iRNA featured in the present invention is mixed with a topical delivery agent, such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), anionic (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleyltetramethylaminopropyl DOTAP and dioleylphosphatidylethanolamine DOTMA). The iRNAs featured in the present invention can be encapsulated in liposomes or complexed to liposomes, particularly cationic liposomes. Alternatively, the iRNAs can be complexed to lipids, particularly cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C 1~20 alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

[0463] A. iRNA formulations containing membrane molecular assemblies iRNAs for use in the compositions and methods of the present invention can be formulated for delivery in membrane molecular assemblies, such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one or more bilayers. Liposomes include unilamellar and multilamellar vesicles, whose membrane is formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material separates the aqueous interior from the aqueous exterior and typically does not contain the iRNA composition, although in some cases it may. Liposomes are useful for transporting and delivering active ingredients to sites of action. Because the liposome membrane is structurally similar to biological membranes, when the liposome is attached to a tissue, the liposome bilayer fuses with the cell membrane bilayer. As the liposome and cell fuse, the aqueous contents, including the iRNA, are delivered to the cell, where the iRNA can specifically bind to the target RNA and mediate RNAi. In some cases, the liposomes are also specifically targeted, for example, to direct the iRNA to a particular cell type.

[0464] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid components of the liposome are dissolved in a detergent so that micelles are formed with the lipid components. For example, the lipid components can be amphipathic cationic lipids or lipid conjugates. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. Next, a preparation of the RNAi agent is added to the micelles containing the lipid components. The cationic groups in the lipids interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example, by dialysis, to obtain a liposome preparation of the RNAi agent.

[0465] If necessary, a carrier compound that aids in condensation can be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to aid in condensation.

[0466] Methods for producing stable polynucleotide delivery vehicles that incorporate polynucleotide / cationic lipid complexes as components of the delivery vehicle are further described, for example, in WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation is described by Felgner, PLet al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987; U.S. Patent No. 4,897,355; U.S. Patent No. 5,171,678; Bangham et al., M. Mol. al.,Biochim.Biophys.Acta 557:9,1979;Szoka et al.,Proc.Natl.Acad.Sci.75:4194,1978;Mayhew et al.,Biochim.Biophys.Acta 775:169,1984;Kim et al.,Biochim.Biophys.Acta 728:339,1983; and Fukunaga et al. The present invention may also include one or more embodiments of the exemplary method described in

[0010] et al., Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of an appropriate size for use as a delivery vehicle include sonication and freeze-thaw and extrusion (see, e.g., Mayer et al., Biochim. Biophys. Acta 858:161, 1986). When consistently small (50-200 nm) and relatively uniform aggregates are desired, microfluidization can be used (Mayhew et al., Biochim. Biophys. Acta 775:169, 1984). These methods are easily adapted to packaging preparations of RNAi agents into liposomes.

[0467] Liposomes are divided into two major classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid / liposome complexes bind to the negatively charged cell surface and are transported into endosomes. The acidic pH within the endosomes causes the liposomes to rupture, releasing their contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0468] pH-sensitive, negatively charged liposomes entrap nucleic acids rather than complexing them. Because both the nucleic acid and the lipid are similarly charged, repulsion occurs rather than complexation. Nevertheless, some nucleic acids are entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the foreign gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0469] One major type of liposome composition contains phospholipids other than naturally occurring phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, while anionic membrane-fusogenic liposomes are primarily formed from dioleylphosphatidylethanolamine (DOPE). Other types of liposome compositions are formed from phosphatidylcholine (PC), such as soybean PC and egg PC. Other types are formed from mixtures of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0470] Other exemplary methods for introducing liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss, EMBO J. 11:417, 1992.

[0471] Nonionic liposomal systems, particularly those containing nonionic surfactants and cholesterol, have also been tested to determine their usefulness in delivering drugs to the skin. Nonionic liposomal formulations containing Novasome™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine A to the dermis of mouse skin. The results showed that such nonionic liposomal systems were effective in promoting the deposition of cyclosporine A in different layers of the skin (Hu et al. STP Pharma. Sci., 1994, 4(6)466).

[0472] Liposomes also include "sterically stabilized" liposomes, a term used herein to refer to liposomes containing one or more specialized lipids that, when incorporated into the liposome, result in enhanced circulation life compared to liposomes lacking such specialized lipids. An example of a sterically stabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome is (A) monosialoganglioside G M1or (B) those that are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Without being bound by any particular theory, it is believed in the art that the enhanced circulation half-life of these sterically stabilized liposomes, at least for those containing gangliosides, sphingomyelin, or PEG-derivatized lipids, is due to reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0473] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) reported the use of monosialoganglioside G, which improves the blood half-life of liposomes. M1 reported the ability of (1) sphingomyelin and (2) ganglioside G to bind to sphingomyelin. These findings are detailed by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88 / 04924, both to Allen et al., report the ability of (1) sphingomyelin and (2) ganglioside G to bind to sphingomyelin. M1 or galactocerebroside sulfate esters. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. WO 97 / 13499 (Lim et al.) discloses liposomes containing 1,2-sn-dimyristoylphosphatidylcholine.

[0474] In one embodiment, cationic liposome is used.Cationic liposome has the advantage that it can fuse with cell membrane.Non-cationic liposome cannot fuse with cell membrane as efficiently, but it can be taken up by macrophage in vivo and can be used to deliver RNAi agent to macrophage.

[0475] Additional advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water-soluble and lipid-soluble drugs; and liposomes can protect the RNAi agent encapsulated in their internal compartment from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," ​​Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in preparing liposome formulations are the lipid surface charge, vesicle size and aqueous volume of the liposome.

[0476] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously interact with nucleic acids, forming lipid-nucleic acid complexes that can fuse with the negatively charged lipids of tissue culture cell membranes, resulting in delivery of RNAi agents (see, e.g., Felgner, PL et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0477] DOTMA analogue, 1,2-bis(oleyloxy)-3-(trimethylammonia)propane (DOTAP), can be used in combination with phospholipids to form DNA complex vesicles. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids into living tissue culture cells, containing positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the net charge of the resulting complex is also positive. The positively charged complexes thus prepared spontaneously adhere to negatively charged cell surfaces, fuse with the cell membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana), differs from DOTMA in that the oleoyl moiety is attached by an ester rather than an ether bond.

[0478] Other reported cationic lipid compounds include those conjugated to one of two types of lipids and conjugated to various moieties, including, for example, carboxyspermine, including compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).

[0479] Another cationic lipid conjugate involves derivatizing lipids with cholesterol ("DC-Chol") formulated into liposomes in combination with DOPE (see Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, prepared by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). In certain cell lines, these liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0480] Liposome preparations are particularly suitable for topical administration, and liposomes have several advantages over other preparations.These advantages include the reduction of side effects associated with the high systemic absorption rate of administered drug, the increase in the accumulation of administered drug in desired target, and the ability to administer RNAi agent to skin.In some implementations, liposomes are used to deliver RNAi agent to epidermal cells and promote the penetration of RNAi agent into dermal tissue, for example, skin.For example, liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been reported (e.g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992:259-265; Mannino, RJ and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al., Gene 56:267-276, 1987; Nicolau, C. et al. (1987) Meth. Enz. 149:157-176, 1987; Straubinger, R M and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C Y and See Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

[0481] Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, have also been investigated to determine their usefulness in delivering drugs to the skin. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver drugs to the dermis of mouse skin. Such formulations containing RNAi agents are useful for treating skin diseases.

[0482] Liposomes containing iRNA can be made highly deformable. Such deformability can allow the liposomes to pass through pores smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposome. Transfersomes can be made by adding a surface edge activator, usually a surfactant, to a standard liposome composition. Transfersomes containing RNAi agents can be delivered, for example, by subcutaneous injection to deliver the RNAi agent to keratinocytes in the skin. To cross intact mammalian skin, lipid vesicles must pass through a series of micropores, each with a diameter of less than 50 nm, under the influence of a suitable transdermal gradient. Furthermore, due to their lipid properties, these transferosomes can be self-optimizing (e.g., adaptable to the shape of pores), self-repairing, often reaching their target without fracture, and often self-loading.

[0483] Other formulations suitable for the present invention are described in U.S. Provisional Patent Applications Nos. 61 / 018,616, filed January 2, 2008; 61 / 018,611, filed January 2, 2008; 61 / 039,748, filed March 26, 2008; 61 / 047,087, filed April 22, 2008; and 61 / 051,528, filed May 8, 2008. PCT Application No. PCT / US2007 / 080331, filed October 3, 2007, also describes formulations suitable for the present invention.

[0484] Transfersomes are yet another type of liposome, highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes can also be described as lipid droplets, which, because of their high deformability, can easily penetrate pores smaller than the droplets. Transfersomes can adapt to the environment in which they are used, for example, they are self-optimizing (adapting to the shape of pores in the skin), self-repairing, often reach their targets without fragmentation, and are often self-loading. To create transfersomes, surface edge activators, usually surfactants, can be added to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0485] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the many different types of surfactants, both natural and synthetic, is by using the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of categorizing the different surfactants used in formulations (Rieger, "Pharmaceutical Dosage Forms", Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0486] If the surfactant molecule is not ionized, the surfactant is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. Their HLB values ​​generally range from 2 to approximately 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0487] When surfactant molecule dissolves or disperses in water, if it carries negative charge, this surfactant is classified as anionic.Anionic surfactants include carboxylates such as soap, acyl lactylates, acyl amides of amino acids, sulfates such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.The most important members of anionic surfactant class are alkyl sulfates and soaps.

[0488] If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic.Cationic surfactants include quaternary ammonium salts and ethoxylated amines.Quaternary ammonium salts are the most commonly used members of this class.

[0489] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

[0490] The use of surfactants in drug products, formulations, and emulsions has been reviewed (Rieger, "Pharmaceutical Dosage Forms," ​​Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0491] The iRNA for use in the method of the present invention can also be provided as a micelle formulation. " Micelle " is defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure, with all hydrophobic parts of the molecule facing inward, and the hydrophilic parts remaining in contact with the surrounding aqueous phase. When the environment is hydrophobic, the opposite arrangement exists.

[0492] Mixed micelle formulations suitable for transdermal delivery contain an aqueous solution of the siRNA composition, alkali metal C8-C 22 They can be prepared by mixing alkyl sulfates and micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocholanylglycine and its pharmaceutically acceptable salts, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and their analogs, polidocanol alkyl ethers and their analogs, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle-forming compounds may be added simultaneously with or after the addition of alkali metal alkyl sulfates. Mixed micelles can be formed by virtually any type of mixing of components, but more vigorous mixing is preferred to provide smaller micelles.

[0493] In one method, a first micelle composition containing an siRNA composition and at least an alkali metal alkyl sulfate is prepared. The first micelle composition is then mixed with at least three micelle-forming compounds to form a mixed micelle composition. In another method, the micelle composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulfate, and at least one of the micelle-forming compounds, followed by adding the remaining micelle-forming compounds while vigorously mixing.

[0494] Phenol and / or m-cresol may be added to the mixed micelle composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and / or m-cresol may be added together with the micelle-forming components. An isotonicity agent, such as glycerin, may also be added after the mixed micelle composition is formed.

[0495] To deliver a micelle formulation as a spray, the formulation can be placed in an aerosol dispenser, which is then filled with a propellant. The propellant, under pressure, is in liquid form in the dispenser. The ratio of the components is adjusted so that there is one aqueous phase and one propellant phase, i.e., one phase. If two phases are present, the dispenser must be shaken before dispensing a portion of its contents, for example, via a metered valve. The medicinal dose is then expelled from the metered valve in the form of a fine spray.

[0496] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0497] The specific concentrations of the essential components can be determined by relatively simple experimentation. For absorption via the oral cavity, it is often desirable to increase the dosage, for example, by at least two or three times, that for injection or administration via the gastrointestinal tract.

[0498] B. Lipid particles The iRNA or dsRNA of the present invention may be fully encapsulated in a lipid formulation, such as an LNP, or may form other nucleic acid-lipid particles.

[0499] As used herein, the term "LNP" refers to stable nucleic acid-lipid particles. LNPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). LNPs have an extended circulatory life after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically separated from the administration site), making them extremely useful for systemic applications. LNPs include "pSPLPs," which contain encapsulated condensing agent-nucleic acid complexes, as described in PCT Publication No. WO 00 / 03683. The particles of the present invention typically have an average particle size of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially nontoxic. Additionally, when present in the nucleic acid-lipid particles of the present invention, the nucleic acid is resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Patent Application Publication No. 2010 / 0324120; and PCT Publication No. WO 96 / 40964.

[0500] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above ranges are also considered part of the invention.

[0501] Examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-di Methylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanedio (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof , (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol% to about 50 mol%, or about 40 mol% of the total lipid present in the particle.

[0502] In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed October 23, 2008, which is incorporated herein by reference.

[0503] In one embodiment, the lipid-siRNA particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane:10% DSPC:40% cholesterol:10% PEG-C-DOMG (mol percent), and have a particle size of 63.0±20 nm and a 0.027 siRNA / lipid ratio.

[0504] Ionic / non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N The lipid may be an anionic or neutral lipid, including 1-(2-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid, when cholesterol is included, may comprise about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid present in the particle.

[0505] The conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG)-lipid, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C]8). The conjugated lipid that inhibits particle aggregation can be 0 mol% to about 20 mol%, or 2 mol% of the total lipid present in the particle.

[0506] In some embodiments, the nucleic acid-lipid particles further comprise cholesterol, for example, from about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0507] In one embodiment, lipidoid ND98·4HCl (MW 1487) (see U.S. Patent Application No. 12 / 056,230, filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each can be prepared in ethanol as follows: ND98, 133 mg / ml; cholesterol, 25 mg / ml; PEG-Ceramide C16, 100 mg / ml. The ND98, cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a molar ratio of, for example, 42:48:10. The combined lipid solution can be mixed with an aqueous dsRNA solution (e.g., in sodium acetate (pH 5)) so that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles usually form spontaneously upon mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cutoff) using a thermobarrel extruder such as the Lipex Extruder (Northern Lipids, Inc.). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be achieved, for example, by dialysis or tangential flow filtration. The buffer can be exchanged with phosphate-buffered saline (PBS), for example, at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4. [ka]

[0508] LNP01 formulations are described, for example, in International Application Publication No. WO 2008 / 042973, which is incorporated herein by reference.

[0509] Further exemplary lipid-dsRNA formulations are described in Table 1.

[0510] [Table 1]

[0511] [Table 2]

[0512] DSPC: Distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with an average molecular weight of 2000) PEG-DSG: PEG-distyrylglycerol (C18-PEG, or PEG-C18) (PEG with an average molecular weight of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with an average molecular weight of 2000) Formulations containing SNALP (1,2-dilinolenyloxy-N,N-dimethylaminepropane (DLinDMA)) are described in WO 2009 / 127060, filed April 15, 2009, which is incorporated herein by reference.

[0513] Formulations containing XTC are described, for example, in U.S. Provisional Patent Application Nos. 61 / 148,366, filed January 29, 2009; 61 / 156,851, filed March 2, 2009; 61 / 156,851, filed June 10, 2009; 61 / 228,373, filed July 24, 2009; 61 / 239,686, filed September 3, 2009; and International Application No. PCT / US2010 / 022614, filed January 29, 2010, which are incorporated herein by reference.

[0514] Formulations containing MC3 are described, for example, in US Patent Application Publication No. 2010 / 0324120, filed June 10, 2010, the entire contents of which are incorporated herein by reference.

[0515] Formulations containing ALNY-100 are described, for example, in International Patent Application No. PCT / US09 / 63933, filed November 10, 2009, which is incorporat...

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent or a salt thereof for inhibiting expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region; the sense strand comprises at least 15 contiguous nucleotides that differ from nucleotides 769-821 of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the corresponding nucleotide sequence of SEQ ID NO:5 by no more than 3 nucleotides; all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise modified nucleotides; A dsRNA agent or a salt thereof.

2. 10. The dsRNA agent of claim 1, or a salt thereof, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from nucleotides 780-802 of SEQ ID NO:1 by no more than 3 nucleotides.

3. 2. The dsRNA agent of claim 1, or a salt thereof, wherein the modified nucleotide is selected from the group consisting of a 3' terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a nucleotide containing a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

4. 10. The dsRNA agent or salt thereof of claim 1, wherein at least one strand comprises a 3' overhang of at least one nucleotide, or at least one strand comprises a 3' overhang of at least two nucleotides.

5. 10. The dsRNA agent, or a salt thereof, of claim 1, further comprising a ligand.

6. 6. The dsRNA agent, or salt thereof, of claim 5, wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

7. 6. The dsRNA agent, or salt thereof, of claim 5, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

8. The ligand is 【Chemistry 1】 8. The dsRNA agent of claim 7, or a salt thereof, wherein:

9. 10. The dsRNA agent according to claim 1, wherein the dsRNA agent is 【Chemistry 2】 8. The dsRNA agent of claim 7, or a salt thereof, conjugated to a ligand as shown in

10. 10. The dsRNA agent of claim 9, or a salt thereof, wherein X is O.

11. 2. The dsRNA agent, or salt thereof, of claim 1, wherein the double-stranded region is 15-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-25 nucleotide pairs in length, 23-27 nucleotide pairs in length, 19-21 nucleotide pairs in length, or 21-23 nucleotide pairs in length.

12. 2. The dsRNA agent of claim 1, or a salt thereof, wherein each strand is independently 15-30 nucleotides in length, 19-30 nucleotides in length, 17-23 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, 21-23 nucleotides in length, or 30 nucleotides or less in length.

13. 10. The dsRNA agent, or a salt thereof, of claim 1, further comprising at least one phosphorothioate or methylphosphonate internucleotide linkage.

14. 14. The dsRNA agent or salt thereof of claim 13, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-end of one strand.

15. 15. The dsRNA agent of claim 14, or a salt thereof, wherein said strand is the antisense strand.

16. 15. The dsRNA agent of claim 14, or a salt thereof, wherein said strand is the sense strand.

17. 14. The dsRNA agent or salt thereof of claim 13, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-end of one strand.

18. 18. The dsRNA agent of claim 17, or a salt thereof, wherein said strand is the antisense strand.

19. 18. The dsRNA agent of claim 17, or a salt thereof, wherein said strand is the sense strand.

20. 14. The dsRNA agent or salt thereof of claim 13, wherein the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5' and 3' ends of a strand.

21. 21. The dsRNA agent of claim 20, or a salt thereof, wherein said strand is the antisense strand.

22. 14. The dsRNA agent, or salt thereof, of claim 13, wherein the dsRNA agent comprises 6 to 8 phosphorothioate internucleotide linkages.

23. 23. The dsRNA agent or salt thereof of claim 22, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at the 5'-end or the 3'-end.

24. 2. The dsRNA agent of claim 1, or a salt thereof, wherein the antisense strand comprises at least 17 contiguous nucleotides that differ from the nucleotide sequence 5'-UAUUAUAAAAUAUCUUGCUUUU-3' of SEQ ID NO:113 by no more than 3 nucleotides.

25. 2. The dsRNA agent of claim 1, or a salt thereof, wherein the sense strand comprises at least 17 contiguous nucleotides that differ by no more than three nucleotides from the nucleotide sequence 5'-AAGCAAGAUAUUUUUAUAAUAAUA-3' of SEQ ID NO:62, and the antisense strand comprises at least 17 contiguous nucleotides that differ by no more than three nucleotides from the nucleotide sequence 5'-UAUUAUAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

26. 2. The dsRNA agent of claim 1, or a salt thereof, wherein the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

27. 2. The dsRNA agent of claim 1, or a salt thereof, wherein the sense strand consists of the nucleotide sequence 5'-AAGCAAGAUAUUUUUAUAAUAAUA-3' of SEQ ID NO:62, and the antisense strand consists of the nucleotide sequence 5'-UAUUAUAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

28. the sense strand consists of 5'-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3' of SEQ ID NO:2876, and the antisense strand consists of 5'-usAfsUfuAfuaAfaAfauaUfcUfuGfcuusususudTdT-3' of SEQ ID NO:2889; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dT is a deoxy-thymine nucleotide; and s is a phosphorothioate linkage.

2. The dsRNA agent of claim 1, or a salt thereof.

29. The sense strand and the antisense strand are 5'-AfaGfcAfaGfaUfAfUfuUfuUfaUfaAfuAf-3' of SEQ ID NO: 122, and 5′-uAfuUfaUfaAfaAfaAfauaUfcUfuGfcUfusUfsu-3′ of SEQ ID NO: 173; 5'-AfsasGfcAfaGfaUfAfUfuUfuUfaUfaAfuAf-3' of SEQ ID NO: 164, and 5′-usAfsuUfaUfaAfaAfaAfauaUfcUfuGfcUfusususu-3′ of SEQ ID NO:215; 5'-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3' of SEQ ID NO: 2875, and SEQ ID NO:2888 5′-usAfsUfuAfuAfAfaAfauaUfcUfuGfcuusususudTdT-3′; 5'-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3' of SEQ ID NO: 2876, and SEQ ID NO:2889 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuusususudTdT-3′; 5'-asasGfcAfaGfaUfAfUfuUfuuAfuaAfua-3' of SEQ ID NO: 2878, and SEQ ID NO:2891 5′-usAfsUfuAfuAfAfaAfauaUfcUfuGfcuusususudTdT-3′; 5'-asasGfcAfaGfaUfAfUfuUfuuAfuaAfua-3' of SEQ ID NO: 2879, and SEQ ID NO:2892 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuusususudTdT-3′; 5'-asasgcaagaUfaUfuuuuuauaaua-3' of SEQ ID NO: 2884, and 5'-usAfsUfuAfuAfAfaAfauaUfcUfuGfcuusususudTdT-3' of SEQ ID NO:2897; and 5'-asasgcaagaUfaUfuuuuuauaaua-3' of SEQ ID NO: 2885, and 5'-usAfsUfuAfuaAfaAfauaUfcUfuGfcuusususudTdT-3' of SEQ ID NO: 2898 consisting of a nucleotide sequence selected from the group consisting of a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dT is a deoxy-thymine nucleotide; and s is a phosphorothioate linkage.

2. The dsRNA agent of claim 1, or a salt thereof.

30. 30. An isolated cell comprising the dsRNA agent, or salt thereof, of any one of claims 1-29.

31. 30. A pharmaceutical composition for inhibiting expression of the complement component C5 gene, comprising the dsRNA agent of any one of claims 1 to 29, or a salt thereof.

32. 32. The pharmaceutical composition of claim 31 , wherein the dsRNA agent or salt thereof is in a non-buffered solution.

33. 33. The pharmaceutical composition of claim 32, wherein the non-buffered solution is saline or water.

34. 32. The pharmaceutical composition of claim 31 , wherein the dsRNA agent or salt thereof is in a buffer.

35. 35. The pharmaceutical composition of claim 34, wherein the buffer comprises an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer, or any combination thereof.

36. 35. The pharmaceutical composition of claim 34, wherein the buffer is phosphate buffered saline (PBS).

37. 37. The pharmaceutical composition of any one of claims 31 to 36 for use in a method of treating a subject having a disease or disorder that would benefit from reduced expression of complement component C5.

38. 38. The pharmaceutical composition of claim 37, wherein the disorder is a disease associated with complement component C5.

39. The disease associated with the complement component C5 is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AM)); D)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microimmune vasculitis; epidermolysis bullosa; recurrent abortion; preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin-producing E. coli-associated hemolytic uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction Embolism, allogeneic transplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response (sepsis), septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Dego's disease, antiphospholipid syndrome (APS), fulminant APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disease, peripheral vascular disease, renal vascular disease, mesenteric 39. The pharmaceutical composition of claim 38, wherein the disease is selected from the group consisting of intestinal vasculopathy, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-associated vasculitis, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA).

40. 40. The pharmaceutical composition of claim 39, wherein the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH).

41. 40. The pharmaceutical composition of claim 39, wherein the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

42. 40. The pharmaceutical composition of claim 39, wherein the disease associated with complement component C5 is myasthenia gravis.

43. 40. The pharmaceutical composition of claim 39, wherein the disease associated with complement component C5 is macular degeneration.

44. 40. The pharmaceutical composition of claim 39, wherein the disease associated with complement component C5 is age-related macular degeneration (AMD).

45. The pharmaceutical composition of any one of claims 37 to 44, wherein the subject is a human.

46. 46. ​​The pharmaceutical composition of any one of claims 37 to 45, wherein the use further comprises the use of an anti-complement component C5 antibody or antigen-binding fragment thereof.

47. 47. The pharmaceutical composition of claim 46, wherein the anti-complement component C5 antibody is eculizumab.

48. 46. ​​The pharmaceutical composition of any one of claims 37-45, wherein the dsRNA agent or salt thereof reduces intravascular hemolysis, stabilizes hemoglobin levels, and / or reduces C5 protein levels in a subject.

49. The pharmaceutical composition according to any one of claims 37 to 48, wherein the pharmaceutical composition is for subcutaneous administration.

50. 50. The pharmaceutical composition of any one of claims 37-49, wherein the dsRNA agent or salt thereof inhibits expression of complement component C5 by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%.

Images